Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining , 2nd Edition

by
Tan, Steinbach, Karpatne, Kumar

01/22/2018 Introduction to Data Mining, 2nd Edition 1

Outline

 Attributes and Objects

 Types of Data

 Data Quality

 Similarity and Distance

 Data Preprocessing

01/22/2018 Introduction to Data Mining, 2nd Edition 2

What is Data?

 Collection of data objects Attributes

and their attributes
 An attribute is a property or Tid Refund Marital Taxable
Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
person, temperature, etc. 2 No Married 100K No

– Attribute is also known as 3 No Single 70K No

Objects
variable, field, characteristic, 4 Yes Married 120K No
dimension, or feature 5 No Divorced 95K Yes
 A collection of attributes 6 No Married 60K No
describe an object 7 Yes Divorced 220K No
– Object is also known as 8 No Single 85K Yes
record, point, case, sample, 9 No Married 75K No
entity, or instance
10 No Single 90K Yes
10
A More Complete View of Data

 Data may have parts

 The different parts of the data may have

relationships

 More generally, data may have structure

 Data can be incomplete

 We will discuss this in more detail later

01/22/2018 Introduction to Data Mining, 2nd Edition 4
Attribute Values

 Attribute values are numbers or symbols

assigned to an attribute for a particular object

 Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute
values
 Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of

values
 Example: Attribute values for ID and age are integers
 But properties of attribute values can be different

01/22/2018 Introduction to Data Mining, 2nd Edition 5

 Measurement of Length
 The way you measure an attribute may not match the
attributes properties.
5 A 1

B
7 2

C
This scale This scale
8 3
preserves preserves
only the the ordering
ordering D and additvity
property of properties of
length. 10 4 length.

15 5
 Types of Attributes

 There are different types of attributes

– Nominal
 Examples: ID numbers, eye color, zip codes
– Ordinal
 Examples: rankings (e.g., taste of potato chips on a
scale from 1-10), grades, height {tall, medium, short}
– Interval
 Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
 Examples: temperature in Kelvin, length, time, counts
01/22/2018 Introduction to Data Mining, 2nd Edition 7
Properties of Attribute Values

 The type of an attribute depends on which of the

following properties/operations it possesses:
– Distinctness: = 
– Order: < >
– Differences are + -
meaningful :
– Ratios are * /
meaningful

– Nominal attribute: distinctness

– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & meaningful differences
– Ratio attribute: all 4 properties/operations
01/22/2018 Introduction to Data Mining, 2nd Edition 8
 Attribute Description Examples Operations
Type
Nominal Nominal attribute zip codes, employee mode, entropy,
values only ID numbers, eye contingency
distinguish. (=, ) color, sex: {male, correlation, 2
Categorical
Qualitative

female} test

Ordinal Ordinal attribute hardness of minerals, median,

values also order {good, better, best}, percentiles, rank
objects. grades, street correlation, run
(<, >) numbers tests, sign tests
Interval For interval calendar dates, mean, standard
attributes, temperature in deviation,
differences between Celsius or Fahrenheit Pearson's
Quantitative
Numeric

values are correlation, t and

meaningful. (+, - ) F tests
Ratio For ratio variables, temperature in Kelvin, geometric mean,
both differences and monetary quantities, harmonic mean,
ratios are counts, age, mass, percent variation
meaningful. (*, /) length, current

This categorization of attributes is due to S. S. Stevens

 Attribute Transformation Comments
Type
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Categorical
Qualitative

Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better best
new_value = f(old_value) can be represented equally
where f is a monotonic function well by the values {1, 2, 3} or
by { 0.5, 1, 10}.

Interval new_value = a * old_value + b Thus, the Fahrenheit and

where a and b are constants Celsius temperature scales
Quantitative
Numeric

differ in terms of where their

zero value is and the size of a
unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.

This categorization of attributes is due to S. S. Stevens

Discrete and Continuous
Attributes

 Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a
collection of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete
attributes
 Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and
represented using a finite number of digits.
– Continuous attributes are typically represented as floating-
point variables.
01/22/2018 Introduction to Data Mining, 2nd Edition 11
More Complicated Examples
 ID numbers
– Nominal, ordinal, or interval?

 Number of cylinders in an automobile engine

– Nominal, ordinal, or ratio?

 Biased Scale
– Interval or Ratio

01/22/2018 Introduction to Data Mining, 2nd Edition 12

Types of data sets
 Record
– Data Matrix
– Document Data
– Transaction Data
 Graph
– World Wide Web
– Molecular Structures
 Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

01/22/2018 Introduction to Data Mining, 2nd Edition 13

Important Characteristics of Data

– Dimensionality (number of attributes)

 High dimensional data brings a number of challenges

– Sparsity
 Only presence counts

– Resolution
 Patterns depend on the scale

– Size
 Type of analysis may depend on size of data

01/22/2018 Introduction to Data Mining, 2nd Edition 14

Record Data

 Data that consists of a collection of records, each

of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

01/22/2018 Introduction to Data Mining, 2nd Edition 15

Data Matrix

 If data objects have the same fixed set of numeric

attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

 Such data set can be represented by an m by n matrix,

where there are m rows, one for each object, and n
columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1

01/22/2018 Introduction to Data Mining, 2nd Edition 16

Document Data

 Each document becomes a ‘term’ vector

– Each term is a component (attribute) of the vector
– The value of each component is the number of times
the corresponding term occurs in the document.

timeout

season
coach

game
score
play
team

win
ball

lost
Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

01/22/2018 Introduction to Data Mining, 2nd Edition 17

Transaction Data

 A special type of record data, where

– Each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
01/22/2018 Introduction to Data Mining, 2nd Edition 18
 Graph Data
 Examples: Generic graph, a molecule, and webpages

2
5 1
2
5

Benzene Molecule: C6H6

01/22/2018 Introduction to Data Mining, 2nd Edition 19
Ordered Data

 Sequences of transactions
Items/Events

An element of
the sequence
01/22/2018 Introduction to Data Mining, 2nd Edition 20
Ordered Data

 Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

01/22/2018 Introduction to Data Mining, 2nd Edition 21

Ordered Data

 Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

01/22/2018 Introduction to Data Mining, 2nd Edition 22

Data Quality

 Poor data quality negatively affects many data processing

efforts
“The most important point is that poor data quality is an unfolding
disaster.
– Poor data quality costs the typical company at least ten
percent (10%) of revenue; twenty percent (20%) is
probably a better estimate.”
Thomas C. Redman, DM Review, August 2004
 Data mining example: a classification model for detecting
people who are loan risks is built using poor data
– Some credit-worthy candidates are denied loans
– More loans are given to individuals that default
01/22/2018 Introduction to Data Mining, 2nd Edition 23
Data Quality …

 What kinds of data quality problems?

 How can we detect problems with the data?
 What can we do about these problems?

 Examples of data quality problems:

– Noise and outliers
– Missing values
– Duplicate data
– Wrong data

01/22/2018 Introduction to Data Mining, 2nd Edition 24

Noise

 For objects, noise is an extraneous object

 For attributes, noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor
phone and “snow” on television screen

Two Sine Waves Two Sine Waves + Noise

01/22/2018 Introduction to Data Mining, 2nd Edition 25
Outliers

 Outliers are data objects with characteristics that

are considerably different than most of the other
data objects in the data set
– Case 1: Outliers are
noise that interferes
with data analysis

– Case 2: Outliers are

the goal of our analysis
 Credit card fraud
 Intrusion detection

 Causes?
01/22/2018 Introduction to Data Mining, 2nd Edition 26
Missing Values

 Reasons for missing values

– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

 Handling missing values

– Eliminate data objects or variables
– Estimate missing values
 Example: time series of temperature
 Example: census results

– Ignore the missing value during analysis

01/22/2018 Introduction to Data Mining, 2nd Edition 27

Duplicate Data

 Data set may include data objects that are

duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeneous
sources

 Examples:
– Same person with multiple email addresses

 Data cleaning
– Process of dealing with duplicate data issues

 When should duplicate data not be removed?

01/22/2018 Introduction to Data Mining, 2nd Edition 28
Similarity and Dissimilarity
Measures

 Similarity measure
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
 Dissimilarity measure
– Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
 Proximity refers to a similarity or dissimilarity
01/22/2018 Introduction to Data Mining, 2nd Edition 29
 Similarity/Dissimilarity for Simple
Attributes

The following table shows the similarity and dissimilarity

between two objects, x and y, with respect to a single, simple
attribute.

01/22/2018 Introduction to Data Mining, 2nd Edition 30

Euclidean Distance

 Euclidean Distance

and yk are, respectively, the kth attributes

where n is the number of dimensions (attributes) and xk

(components) or data objects x and y.

 Standardization is necessary, if scales differ.

01/22/2018 Introduction to Data Mining, 2nd Edition 31

Euclidean Distance

3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
01/22/2018 Introduction to Data Mining, 2nd Edition 32
Minkowski Distance

 Minkowski Distance is a generalization of Euclidean

Distance

Minkowski Distance is a generalization of

Euclidean Distance
Where r is a parameter, n is the number of dimensions
(attributes) and xk and yk are, respectively, the kth
attributes (components) or data objects x and y.

01/22/2018 Introduction to Data Mining, 2nd Edition 33

Minkowski Distance: Examples

 r = 1. City block (Manhattan, taxicab, L1 norm) distance.

– A common example of this is the Hamming distance, which
is just the number of bits that are different between two
binary vectors

 r = 2. Euclidean distance

 r  . “supremum” (Lmax norm, L norm) distance.

– This is the maximum difference between any component of
the vectors

 Do not confuse r with n, i.e., all these distances are

defined for all numbers of dimensions.

01/22/2018 Introduction to Data Mining, 2nd Edition 34

Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
01/22/2018 Introduction to Data Mining, 2nd Edition 35
Common Properties of a Distance
 Distances, such as the Euclidean distance,
have some well known properties.
1. d(x, y)  0 for all x and y and d(x, y) = 0 only if
x = y. (Positive definiteness)
2. d(x, y) = d(y, x) for all x and y. (Symmetry)
3. d(x, z)  d(x, y) + d(y, z) for all points x, y, and z.
(Triangle Inequality)

where d(x, y) is the distance (dissimilarity) between

points (data objects), x and y.

 A distance that satisfies these properties is a

metric

01/22/2018 Introduction to Data Mining, 2nd Edition 36

Common Properties of a Similarity

 Similarities, also have some well known

properties.

1. s(x, y) = 1 (or maximum similarity) only if x = y.

2. s(x, y) = s(y, x) for all x and y. (Symmetry)

where s(x, y) is the similarity between points (data

objects), x and y.

01/22/2018 Introduction to Data Mining, 2nd Edition 37

Information and Probability

 Information relates to possible outcomes of an event

– transmission of a message, flip of a coin, or
measurement of a piece of data

 The more certain an outcome, the less information

that it contains and vice-versa
– For example, if a coin has two heads, then an outcome
of heads provides no information
– More quantitatively, the information is related the
probability of an outcome
 The smaller the probability of an outcome, the more information
it provides and vice-versa
– Entropy is the commonly used measure
01/22/2018 Introduction to Data Mining, 2nd Edition 38
Entropy

 For
– a variable (event), X,
– with npossible values (outcomes), x1, x2 …, xn
– each outcome having probability, p1, p2…, pn
– the entropy of X , H(X), is given by

 Entropy is between 0 and log2n and is measured

in bits
– Thus, entropy is a measure of how many bits it takes
to represent an observation of X on average
01/22/2018 Introduction to Data Mining, 2nd Edition 39
Entropy Examples

 For a coin with probability p of heads and

probability q = 1 – p of tails

– For p= 0.5, q = 0.5 (fair coin) H= 1

– For p = 1 or q = 1, H= 0

 What is the entropy of a fair four-sided die?

01/22/2018 Introduction to Data Mining, 2nd Edition 40

Entropy for Sample Data: Example

Hair Color Count p -plog2p

Black 75 0.75 0.3113
Brown 15 0.15 0.4105
Blond 5 0.05 0.2161
Red 0 0.00 0
Other 5 0.05 0.2161
Total 100 1.0 1.1540

Maximum entropy is log25 = 2.3219

01/22/2018 Introduction to Data Mining, 2nd Edition 41

Entropy for Sample Data

 Suppose we have
– a number of observations (m) of some attribute, X,
e.g., the hair color of students in the class,
– where there are n different possible values
– And the number of observation in the ith category is mi
– Then, for this sample

 For continuous data, the calculation is harder

01/22/2018 Introduction to Data Mining, 2nd Edition 42

Mutual Information

 Information one variable provides about another

Formally, , where

H(X,Y)is the joint entropy of X and Y,

Wherepij is the probability that the ith value of X and the jth value of Y
occur together

 For discrete variables, this is easy to compute

 Maximum mutual information for discrete variables is

log2(min(nX,nY), where nX (nY) is the number of values of X (Y)
01/22/2018 Introduction to Data Mining, 2nd Edition 43
 Mutual Information Example

Student Count p -plog2p Student Grade Count p -plog2p

Status Status
Undergrad 45 0.45 0.5184
Undergrad A 5 0.05 0.2161
Grad 55 0.55 0.4744
Undergrad B 30 0.30 0.5211
Total 100 1.00 0.9928
Undergrad C 10 0.10 0.3322

Grade Count p -plog2p Grad A 30 0.30 0.5211

A 35 0.35 0.5301 Grad B 20 0.20 0.4644

B 50 0.50 0.5000 Grad C 5 0.05 0.2161
C 15 0.15 0.4105 Total 100 1.00 2.2710
Total 100 1.00 1.4406

Mutual information of Student Status and Grade = 0.9928 + 1.4406 - 2.2710 = 0.1624

01/22/2018 Introduction to Data Mining, 2nd Edition 44

Data Preprocessing

 Aggregation
 Sampling
 Dimensionality Reduction
 Feature subset selection
 Feature creation
 Discretization and Binarization
 Attribute Transformation

01/22/2018 Introduction to Data Mining, 2nd Edition 45

Aggregation

 Combining two or more attributes (or objects) into

a single attribute (or object)

 Purpose
– Data reduction
 Reduce the number of attributes or objects
– Change of scale
 Cities aggregated into regions, states, countries, etc.
 Days aggregated into weeks, months, or years
– More “stable” data
 Aggregated data tends to have less variability

01/22/2018 Introduction to Data Mining, 2nd Edition 46

Example: Precipitation in Australia

 This example is based on precipitation in

Australia from the period 1982 to 1993.
The next slide shows
– A histogram for the standard deviation of average
monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in
Australia, and
– A histogram for the standard deviation of the average
yearly precipitation for the same locations.
 The average yearly precipitation has less
variability than the average monthly precipitation.
 All precipitation measurements (and their
standard deviations) are in centimeters.
01/22/2018 Introduction to Data Mining, 2nd Edition 47
Sampling
 Sampling is the main technique employed for data
reduction.
– It is often used for both the preliminary investigation of
the data and the final data analysis.

 Statisticians often sample because obtaining the

entire set of data of interest is too expensive or
time consuming.

 Sampling is typically used in data mining because

processing the entire set of data of interest is too
expensive or time consuming.
01/22/2018 Introduction to Data Mining, 2nd Edition 48
Sampling …

 The key principle for effective sampling is the

following:

– Using a sample will work almost as well as using the

entire data set, if the sample is representative

– A sample is representative if it has approximately the

same properties (of interest) as the original set of data

01/22/2018 Introduction to Data Mining, 2nd Edition 49

Sample Size

8000 points 2000 Points 500 Points

01/22/2018 Introduction to Data Mining, 2nd Edition 50

Dimensionality Reduction

 Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

 Techniques
– Principal Components Analysis (PCA)
– Singular Value Decomposition
– Others: supervised and non-linear techniques

01/22/2018 Introduction to Data Mining, 2nd Edition 51

Dimensionality Reduction: PCA

 Goal is to find a projection that captures the

largest amount of variation in data
x2

x1
01/22/2018 Introduction to Data Mining, 2nd Edition 52
Feature Subset Selection

 Another way to reduce dimensionality of data

 Redundant features
– Duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid
 Irrelevant features
– Contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
 Many techniques developed, especially for
classification
01/22/2018 Introduction to Data Mining, 2nd Edition 53
Feature Creation

 Create new attributes that can capture the

important information in a data set much more
efficiently than the original attributes

 Three general methodologies:

– Feature extraction
 Example: extracting edges from images
– Feature construction
 Example: dividing mass by volume to get density
– Mapping data to new space
 Example: Fourier and wavelet analysis

01/22/2018 Introduction to Data Mining, 2nd Edition 54

Discretization

 Discretization is the process of converting a

continuous attribute into an ordinal attribute
– A potentially infinite number of values are mapped into
a small number of categories
– Discretization is commonly used in classification
– Many classification algorithms work best if both
the independent and dependent variables have
only a few values
– We give an illustration of the usefulness of
discretization using the Iris data set

01/22/2018 Introduction to Data Mining, 2nd Edition 55

Binarization

 Binarization maps a continuous or categorical

attribute into one or more binary variables

 Typically used for association analysis

 Often convert a continuous attribute to a

categorical attribute and then convert a
categorical attribute to a set of binary attributes
– Association analysis needs asymmetric binary
attributes
– Examples: eye color and height measured as
{low, medium, high}
01/22/2018 Introduction to Data Mining, 2nd Edition 56
Attribute Transformation

 An attribute transform is a function that maps the

entire set of values of a given attribute to a new set
of replacement values such that each old value can
be identified with one of the new values
– Simple functions: xk, log(x), ex, |x|
– Normalization
 Refers to various techniques to adjust to differences
among attributes in terms of frequency of
occurrence, mean, variance, range
 Take out unwanted, common signal, e.g., seasonality

– In statistics, standardization refers to subtracting off the

means and dividing by the standard deviation
01/22/2018 Introduction to Data Mining, 2nd Edition 57