General Biology 2

Quarter 3 – Module 1:
Genetics, Evolution
and Taxonomy
Lesson 1 to 10

1
DO_Q3_BIOLOGY2_MODULE1_LESSONS1-10
General Biology 2– Grade 12
Alternative Delivery Mode
Quarter 3– Module 1: Genetics, Evolution, and Taxonomy
Revised Edition, 2024

Republic Act 8293, section 176 states that: No copyright shall subsist in any work of
the Government of the Philippines. However, prior approval of the government agency or office
wherein the work is created shall be necessary for the exploitation of such work for profit. Such
agency or office may, among other things, impose as a condition the payment of royalties.

Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names,
trademarks, etc.) included in this book are owned by their respective copyright holders. Every
effort has been exerted to locate and seek permission to use these materials from their
respective copyright owners. The publisher and authors do not represent nor claim ownership
over them.

Published by the Department of Education

Secretary: Juan Edgardo “Sonny” Angara
Undersecretary: Dr. Gina O. Gonong

Development Team of the Module

Writers: Julie Ann M. Sarmiento Manolito B. Chua,
Merlyn M. Gamboa Amylene Y. Catayas
Gilbert O. Milarpes Marife C. Advincula
Mary Ann F. Cabas

Editors: Maria Lea Q. Prondo Ed.D, EPS-Science

Sally R. Juanillas
Jocelyn C. Villarta

Language Validator: Liza Vinda P. Unay, Lilia H. Jaime

Illustrator: Nathaniel D.C. Del Mundo
Layout Artists: Julie Ann M. Sarmiento, Merlyn M. Gamboa, Roselle G. Hutamariz
Raphael A. Lopez, Kimberly G. Andonga
Management Team:
NOEL D. BAGANO, OIC - Schools Division Superintendent
FILMORE A. CABALLERO, CID Chief
MYRON WILLIE III B. ROQUE, EPS - LRMS
MARIA LEA Q. PRONDO, Ed.D. - Education Program Supervisor-Science

Printed in the Philippines by ________________________

Department of Education – National Capital Region – SDO VALENZUELA

Office Address: Pio Valenzuela St., Marulas, Valenzuela City

Telefax: (02) 292 – 3247
E-mail Address: [email protected]

1 DO_Q3_GENBIO2_MODULE1_LESSON1
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 1: Sex Linkage
and Recombination

2 DO_Q3_GENBIO2_MODULE1_LESSON1
Introductory Message
This Self-Learning Module (SLM) is prepared so that you, our dear learners, can
continue your studies and learn while at home. Activities, questions, directions,
exercises, and discussions are carefully stated for you to understand each lesson.
Each SLM is composed of different parts. Each part shall guide you step-by-
step as you discover and understand the lesson prepared for you.

Pre-tests are provided to measure your prior knowledge of lessons in each

SLM. This will tell you if you need to proceed with completing this module or if you
need to ask your facilitator or your teacher’s assistance for a better understanding
of the lesson. At the end of each module, you need to answer the post-test to self-
check your learning. Answer keys are provided for each activity and test. We trust
that you will be honest in using these.

In addition to the material in the main text. Notes to the Teacher are also
provided to our facilitators and parents for strategies and reminders on how they can
best help you with your home-based learning.
Please use this module with care. Do not put unnecessary marks on any part
of this SLM. Use a separate sheet of paper in answering the exercises and tests. And
read the instructions carefully before performing each task.

If you have any questions about using this SLM or any difficulty in answering
the tasks in this module, do not hesitate to consult your teacher or facilitator.
Thank you.

3 DO_Q3_GENBIO2_MODULE1_LESSON1
 Because the X and Y chromosomes determine sex, the genes located on them
show a pattern of inheritance called sex-linkage. A sex-linked gene is a gene located
on a sex chromosome. As you might expect, genes on the Y chromosome are found
only in males and are passed directly from father to son. Genes located on the X
chromosome are found in both sexes, but the fact that men have just one X
chromosome leads to some interesting consequences.
At the end of the lesson the learners are expected to:
 Explain sex linkage and recombination (STEM_BIO11/12- IIIa-
b-2)

Directions: FRAYER MODEL. Choose one term from the box below and complete
the model.

Mendelian Traits

Dominant Traits

Heredity

Sex-Linked Traits

Recessive Traits

Pedigree

1 DO_Q3_GENBIO2_MODULE1_LESSON1
 Lesson
1 Sex Linkage and Recombination

To analyze the pattern of inheritance followed by a particular trait, you

can use a chart that shows the relationships within a family. Such a chart is
called a pedigree. A pedigree shows the presence or absence of a trait according
to the relationships between parents, siblings, and offspring. It can be used for
any species, not just humans. The diagram shows what the symbols in a
pedigree represent.

Activity: Pedigree Reveal

First, you need to become comfortable with making a pedigree chart. Complete
the following examples.

1. How can you tell if a couple is married on a pedigree? Write a one-sentence

description and draw an example.
________________________________________________________________________
2. How can you tell if the couple who is married had children? Write a one-sentence
description and draw an example.
___________________________________________________
3. Draw a pedigree that represents Mary married to Greg and with 2 sons (Scott and
Tyler) and 1 daughter (Karen). Please label the pedigree with the names of the
people.

2 DO_Q3_GENBIO2_MODULE1_LESSON1
 With pedigree analysis, it is possible to apply the principles of Mendelian genetics to
humans and determine the nature of genes and alleles associated with inherited human
traits. You can often determine if an allele for a trait is dominant or recessive, autosomal or
sex-linked.

Sex-linked traits are traits that are linked with sex chromosomes. It can be X-linked
or Y-linked traits. An X-linked trait can NEVER be passed from father to son. Any father-to-
son transmission means that the trait is NOT X-linked. Y-linked traits will NEVER affect
females Any example of a female with the trait means that the trait is NOT Y-linked.

X-Linked Recessive X-Linked Dominant Traits Y-Linked Traits

▰ Both males and females ▰ If the trait is ▰ No affected females
can be affected, but the dominant, it will be
trait is much more
▰ ALL sons of affected
expected to occur males are also
common in males
slightly more often in affected
▰ Affected males transmit
the allele to ALL of
females
their daughters & ▰ ALL daughters of an
NONE of their sons affected male will be
▰ Daughters of affected affected (NO carriers)
males are always ▰ Cannot be passed on
carriers (not affected)
from father to son
unless the mother also
has the allele
▰ All sons of an affected
female will also be
affected

3 DO_Q3_GENBIO2_MODULE1_LESSON1
 Activity: What’s the Mode?
Directions: Identify the mode of inheritance as X-linked recessive, X-linked
dominant, or Y-linked. Explain your answer.

Tell Me What You Know

Directions: Based on what you have learned from this lesson, write a concise
explanation of the following questions.

1. Differentiate genotype from phenotype.

2. How did the Law of Inheritance contribute to your understanding of
inherited traits?

4 DO_Q3_GENBIO2_MODULE1_LESSON1
 Hemophilia is an example of a sex-
linked disorder. Two genes carried on the X
chromosome help control blood clotting. A
recessive allele in either of these two genes
may produce hemophilia. The pedigree shows
the transmission of hemophilia through three
generations of a family.
1. Which mothers are definite carriers
of the gene?
2. Why did the sons of Person 3 not
inherit the trait?
3. How could Person 12 have
hemophilia if neither of his parents
had hemophilia?

Directions: Write the letter of the correct answer.

For items 1-5, please refer to the given pedigree.

1. Which of the following is the genotype of I1 in the pedigree above?

A. Heterozygous
B. Homozygous Recessive
C. Homozygous Dominant
D. Not enough information
2. Which of the following is the genotype of II1 in the pedigree above?
A. Heterozygous
B. Homozygous Recessive
C. Homozygous Dominant
D. Not enough information

5 DO_Q3_GENBIO2_MODULE1_LESSON1
3. What is the mode of inheritance shown in the pedigree?
A. x-linked recessive
B. x-linked dominant
C. autosomal recessive
D. autosomal dominant
4. How can you know for sure that individuals II-3 and II-4 are heterozygous?
A. Because their offspring have the disease
B. Because their siblings are also heterozygous
C. Because their offspring is also heterozygous
D. Because their parents are affected by the trait
5. What is the probability of having an affected child if I5 and I6 will be having
another child?
A. 0%
B. 25%
C. 50%
D. 100%
6. A form of vitamin D-resistant rickets, known as hypophosphatemia, is inherited
as an X-linked dominant trait. If a male with hypophosphatemia marries a normal
female, which of the following predictions concerning their potential progeny would
be true?
A. All of their sons would inherit the disease
B. All of their daughters would inherit the disease
C. About 50% of their sons would inherit the disease
D. About 50% of their daughters would inherit the disease
7. In the pedigree below, squares represent males and circles represent females.
Individuals who express a particular trait are represented by shaded figures. Which
of the following patterns of inheritance best explains the transmission of the trait?

A. Autosomal recessive
B. Sex-linked recessive
C. Sex-linked dominant
D. Autosomal dominant
8. Which of the following describes an individual who is a carrier of a sex-linked trait,
such as hemophilia?
A. Is always male
B. Is homozygous for the condition
C. Shows the dominant phenotype
D. Cannot pass the gene to his or her daughters
9. Which statement is NOT true about x-linked characteristics?
A. Females can be carriers of the gene without showing it
B. If a female has the characteristic, all her sons will show it

6 DO_Q3_GENBIO2_MODULE1_LESSON1
 C. The characteristic often skips a generation, from a woman’s father
to her son
D. Males can have two copies of the allele for the trait, but females only
have one
10. Hemophilia is a recessive x-linked disorder. Which genotype represents a female
who is a carrier of hemophilia?
A. XHXh
B. XhXh
C. XHXH
D. XhY
11. Colorblindness is a recessive x-linked disorder. Which genotype represents a
male with normal vision?
A. XNXN
B. XnXn
C. XNY
D. XnY
12. Why are men 16 times more likely to be color-blind than women?
A. color-blindness is caused by testosterone
B. to be color-blind, you must have a Y chromosome
C. color-blindness is caused by the same gene as baldness
D. to be color-blind, all of your X chromosomes must have the gene
13. Which of the following is NOT a sex-linked trait?
A. Hemophilia
B. Color-blindness
C. Huntington disease
D. Muscular Dystrophy
14. Why are males are more likely to suffer from a sex-linked disease or disorder?
A. Males have less DNA
B. Males have more testosterone
C. Females have 1 Y chromosome to mask the trait
D. Males have 1 X chromosome, so the disorder is more likely to be expressed
15. If a woman is a carrier of sex-linked recessive trait of hemophilia and her
husband has hemophilia, which of the following is true?
A. All sons will have hemophilia
B. All daughters will have hemophilia
C. 50% of daughters and 50% of sons have hemophilia
D. 0% of sons have hemophilia but 100% of daughters are carriers

A researcher studying fruit flies finds a mutant fly with brown-colored eyes.
Almost all fruit flies in nature have bright red eyes. When the researcher crosses the
mutant fly with a normal, red-eyed fly, all the F1 offspring have red eyes. The
researcher then crosses two of the F1 red-eyed flies and obtains the following results
in the F2 generation.

7 DO_Q3_GENBIO2_MODULE1_LESSON1
 Eye Color in the F2 Generation

Red Eyes 37

Brown Eyes 14

1. What is the ratio of red-eyed flies to brown-eyed flies?

a. 1:1 c. 3:1
b. 1:3 d. 4:1
2. The allele for red eyes in fruit flies is
a. dominant over brown eyes.
b. recessive to brown eyes.
c. hard to determine due to lack of information.

8 DO_Q3_GENBIO2_MODULE1_LESSON1
DO_Q3_GENBIO2_MODULE1_LESSON1 9
What I Can Do What I Know
- Answer may Vary
1. Person 6
2. Mother is not carrier of the
disease. What’s More
3. Mother is a carrier of the disease
Assessment
1. C
2. A
3. B
4. A X-Linked Recessive
5. C
6. B
7. D
8. C
9. D
10. A
11. D
12. D
13. C
14. D
15. C
Additional Activities X-Linked Dominant
1. c
2. a
Y-Linked
Levine, Joseph, and Miller, Kenneth R. Biology. Student Edition. Prentice Hall.
January 2004.
Non-Mendelian Inheritance. CK-12 Biology For High School. Accessed December 9,
2020. https://flexbooks.ck12.org/cbook/ck-12-biology-flexbook-
2.0/section/3.7/primary/lesson/non-mendelian-inheritance-bio
Non-mendelian-genetics. Untamed science, Accessed December 9, 2020.
https://untamedscience.com/biology/genetics/non-mendelian-genetics/
Non-Mendelian inheritance review. Khan academy. Accessed December 9, 2020.
https://www.khanacademy.org/
Incomplete-Dominance-and-Co-Dominance-Notes-and-Practice. Teachers Pay
Teacher. Accessed December 9, 2020.
Https://www.teacherspayteachers.com/FreeDownload/Incomplete-Dominance-
and-Co-Dominance-Notes-and-Practice-2992868
Sex(X)-linked Recessive Inheritance. MI Genetics Resource Center. Accessed
December 9, 2020. https://migrc.org/teaching-tools/genetic-inheritance-
patterns/sexx-linked-recessive/

10 DO_Q3_GENBIO2_MODULE1_LESSON1
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 2: Modifications
to Classic Mendel’s
Ratios

11 DO_Q3_GENBIO2_MODULE1_LESSON1
 A characteristic may be controlled by one gene with two alleles, but the two
alleles may have a different relationship than the simple dominant-recessive
relationship that you have learned about so far. For example, the two alleles may
have a codominant or incompletely dominant relationship, or sometimes there are
more than two alleles expressed in the population.

At the end of the lesson the learners are expected to:

 Describe modifications to Mendel’s classic ratios (gene
interaction) (STEM_BIO11/12- IIIa-b-3)

Frayer Model: Choose one term from the box below and complete the model below.

Codominance

Multiple Allele

Incomplete
Dominance

12 DO_Q3_GENBIO2_MODULE1_LESSON2
 Lesson Modifications to Classic Mendel’s
2 Ratios

The inheritance of characteristics is not always as simple as it is for the

characteristics that Mendel studied in pea plants. Each characteristic Mendel
investigated was controlled by one gene that had two possible alleles, one of which
was completely dominant over the other. This resulted in just two possible
phenotypes for each characteristic. Each characteristic Mendel studied was also
controlled by a gene on a different (non-homologous) chromosome. As a result, each
characteristic was inherited independently of the other characteristics. Geneticists
now know that inheritance is often more complex than this.

In Smileys, eye shape can be starred (SS), circular (CC), or a circle with a star
(CS). Write the genotypes for the pictured phenotypes.

1. Show the cross between a star-eyed and a circle-eyed.

What are the phenotypes of the offspring? ____________
What are the genotypes? _________

2. Show the cross between a circle-star-eyed, and a circle-eyed.

How many of the offspring are circle-eyed? ____________
How many of the offspring are circle-star-eyed?
_________

3. Show the cross between two circle-star eyed.

How many of the offspring are circle-eyed? ____________
How many of the offspring are circle-star-eyed?
_________
How many are star eyed? ____________

13 DO_Q3_GENBIO2_MODULE1_LESSON2
 Non-Mendelian genetics are any inheritance patterns that do not follow one
or more laws of Mendelian genetics. As we have discussed the basic rules of
Mendelian genetics are very helpful in understanding the patterns of inheritance, but
as scientists began exploring more and more test crosses, they found tons of traits
that did not match up nicely with what these laws predicted.

CODOMINANCE INCOMPLETE MULTIPLE ALLELE

DOMINANCE
Occurs when both Occurs when the Involves more than just the
alleles are expressed phenotype of a typical two alleles that usually
equally in the phenotype heterozygote offspring is code for a certain
of the heterozygote. somewhere in between characteristic in a species.
the phenotypes of both
Example: The red and homozygous parents; a Examples: The human ABO
white flower in the figure completely dominant blood type is a good example
has codominant alleles allele does not occur. of multiple alleles. Humans
for red petals and white can have red blood cells that
petals. Example: The red are of type A, type B, or type
snapdragons are crossed O. These three different alleles
with white snapdragons can be combined in different
the F1 hybrids are all ways following Mendel's Laws
pink heterozygotes for of Inheritance. The resulting
flower color. genotypes make either type A,
type B, type AB, or type O
blood.

If a Red (RR) and White flower (rr) were crossbred, resulting in 100%
Rr, what phenotype would be seen in the following mode of inheritance?
1. Complete Dominance
2. Incomplete Dominance
3. Codominance

14 DO_Q3_GENBIO2_MODULE1_LESSON2
 Tell Me What You Know

Directions: Based on what you have learned from this lesson, write a concise
explanation of the following questions. Write your answer on a separate
sheet of paper.
1. Describe the phenotype of the offspring in incomplete dominance.
2. Describe the phenotype of the offspring in codominance.
3. Describe the phenotype of the offspring with multiple alleles.

A. Snapdragons are incompletely dominant in color; they have phenotypes red, pink,
or white. The red flowers are homozygous dominant, the white flowers are
homozygous recessive, and the pink flowers are heterozygous. Give the genotypes for
each of the phenotypes, using the letters “R” and “r” for alleles:
Show genetic crosses between the following snapdragon parents, using the
Punnett squares provided, and record the genotypic and phenotypic %s below:
a. pink x pink b. red x white c. pink x white

Genotypic % ______ Genotypic% ______ Genotypic % ______

Phenotypic% ______ Phenotypic % ______ Phenotypic % ______

B. In cattle, brown fur (B) is co-dominant with white fur

(W). A heterozygote (BW) has “roan” fur. Draw a cross
between two roan cattle.
a. What are the genotypes of the offspring?
___________________
b. What are the phenotypes of the offspring?
__________________

C. Human blood types are determined by genes that

follow the CODOMINANCE pattern of inheritance.
There are two dominant alleles (A & B) and one
recessive allele (O).

Mrs. Essy is type “A” and Mr. Essy is type “O.” They
have three children named Matthew, Mark, and
Luke. Mark is type “O,” Matthew is type “A,” and
Luke is type “AB.” Based on this information:

15 DO_Q3_GENBIO2_MODULE1_LESSON2
a. Mr. Essy must have the genotype ______
b. Mrs. Essy must have the genotype ______ because ________ has blood type ______
c. Luke cannot be the child of these parents because neither parent has the allele _

Directions: Write the letter of the correct answer.

1. What type of inheritance is shown when a red-flowering plant is crossed with a

white-flowering plant and only pink-flowering plants are produced?
A. sex-linked
B. codominance
C. multiple alleles
D. incomplete dominance
2. When roan cattle are mated, 25% of the offspring are red, 50% are roan, and
25% are white. Upon examination, the coat of a roan cow consists of both red
and white hairs. This trait is one controlled by ___.
A. sex-linked
B. codominance
C. multiple alleles
D. incomplete dominance
3. What types of inheritance are blood types A, B, AB, and O?
A. sex-linked
B. codominance
C. multiple alleles
D. incomplete dominance
4. A farmer crosses a yellow feathered hen with a red feathered cock and observes
that all their offspring have orange feathers. If feather color is determined by a
single gene, then what is the most likely explanation for these results?
A. sex linkage
B. Co-dominance of red and yellow traits
C. Incomplete dominance of red and yellow traits
D. Overdominance of red trait
5. The coat characteristics of Siamese cats and Himalayan rabbits, where proteins
in the extremities function differently than in other parts of the body, is an
example of ___________________.
A. codominance
B. complete dominance
C. incomplete dominance
D. multiple allele systems
6. What are the blood types of the possible children that a woman (type O) and
man (type AB) can have?
A. A and B
B. O and A
C. O and B
D. O and AB
7. Radish color is completely dominant, and red, and white is pure breeding colors.
While heterozygous are purple. What would the phenotypes of the offspring be
if you crossed a red radish with a white radish?
A. 4 purples

16 DO_Q3_GENBIO2_MODULE1_LESSON2
 B. 2 reds, 2 white
C. 1 red, 2 purple, 1 white
D. 1 red, 1 purple, 2 white
8. Which of the following shows incomplete dominance?
A. Pod color in garden peas
B. Blood grouping in humans
C. Flower color in snapdragon
D. Flower color in garden peas
9. What is the mode of inheritance if a cross between true-breeding red-flowered
and true-breeding white-flowered plants gives rise to pink-flowered progeny?
A. Codominance
B. Multiple allelism
C. Complete dominance
D. Incomplete dominance
10. What is the ability of both IA and IB alleles to express together?
A. Codominance
B. Multiple allelism
C. Complete dominance
D. Incomplete dominance
11. What mode of inheritance involves more than two forms of gene giving rise to a
repertoire of phenotypes?
A. Codominance
B. Multiple allelism
C. Complete dominance
D. Incomplete dominance
12. What is the blood group of the offspring if one parent donates the IA allele while
the other donates I?
A. A
B. B
C. O
D. AB
13. What is the percentage of the offspring when two roan cows are crossed?
A. 10%
B. 25%
C. 50%
D. 75%
14. What is the interaction between two alleles that are expressed equally, and the
heterozygote is different from their homozygote?
A. Codominance
B. Multiple allelism
C. Complete dominance
D. Incomplete dominance
15. A new flower species is discovered in the rainforest. Back in the lab, a scientist
crosses a red variety with a blue variety. The result includes some red flowers,
some blue flowers, and some purple flowers. What type of dominance pattern
do these plants display?
A. Epistasis
B. Codominance
C. Complete dominance
D. Incomplete dominance

17 DO_Q3_GENBIO2_MODULE1_LESSON2
 Science Mystery: THE CROOKED CELL
When Ava inquired about her family’s medical history, she found out that
Uncle Eli’s mother (Ava’s grandmother) also had sickle cell disease, but Uncle Eli’s
father did not. One of her uncle’s four children also had the disease. However, Ava’s
father, who is Eli’s only sibling, did not have sickle cell disease, nor did Ava’s mother.
Ava’s two siblings showed no signs of the disease, either.
1. In general, what pattern of heredity does the sickle cell trait follow? Cite
evidence from the chapter and its clues to support your conclusion.
2. Based on your answer to question 1, what can you conclude about the
inheritance of sickle cell disease in Ava’s family? What might be Ava’s chances
of being a carrier of the sickle cell trait?

18 DO_Q3_GENBIO2_MODULE1_LESSON2
DO_Q3_GENBIO2_MODULE1_LESSON2 19
What’s More
1) The phenotype of Rr is Pink according to incomplete
dominance.
Incomplete dominance occurs when none of the alleles
is completely dominant over the other, resulting in
blending of the phenotype from the parents. When a
red (RR) and a white flower (rr) are crossbred, they
result in Rr that is a pink phenotype.
2) According to Codominance, the phenotype of Rr is
Red and White flower.
Assessment Codominance occurs when both the alleles are equally
expressed. In this case allele for Red (R) and white (r)
1. C phenotype are expressed equally giving Red and White
flower.
2.D
3) In Codominance, both the alleles are visible in the
3.C hybrid and in Incomplete dominance, intermediate
4. B (blend of parental) phenotype is visible in the hybrid.
5. D
What I Have Learned
6. A
1. Phenotype of incomplete dominance produced a
7. A heterozygous offspring.
8. C 2. Codominance occurs when the phenotypes of both
9. D parents are simultaneously expressed in the same
10. A offspring organism.
3. There are more than two phenotypes available
11. B depending on the dominant or recessive alleles that
12. A are available in the trait and the dominance pattern
13. C the individual alleles follow when combined.
14. D What I Can Do
15. D A. Snapdragons
Additional Activities
1. In general, it is present when
the sickle cell gene is passed
down from each parent. Since
both males and females have an B.
equal chance of receiving it, the
gene is located on both the X
and Y chromosomes.
2. I can conclude that people in
her family may be carriers for
the disease. It doesn't show
because both genes need to be
present. Ava may have a 50% C.
chance, if both of her parents
a. ii
carry one of the genes. b. IAi because Mark has type O
c. IB
“Concept Map Rubric.” Accessed July 13, 2022.
https://www.nps.gov/grsm/learn/education/classrooms/upload/Concept-
Map-Scoring-Rubric.pdf.

“Quizizz - the World's Most Engaging Learning Platform.” Quizizz — The world’s
most engaging learning platform. Accessed July 13, 2022.
https://quizizz.com/admin/quiz/5c6178dbf09fbc001ab3460b/pigments.

20 DO_Q3_GENBIO2_MODULE1_LESSON2
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 3: Molecular
Structure of DNA, RNA,
and Proteins

21 DO_Q3_GENBIO2_MODULE1_LESSON2
 DNA, RNA, and proteins all have a lot in common. Although DNA does not
make proteins directly, it includes the information necessary for encoding proteins.
RNA transports DNA information and converts it into proteins, which conduct most
biological functions.

At the end of the lesson the learners are expected to:

 Illustrate the molecular structure of DNA, RNA, and
proteins (STEM-BIO 12-IIIa-b-4)

Directions: Write the letter of the correct answer.

1. What makes up the backbone of the DNA molecule?
A. amino acid and sugar
B. sucrose and phosphate
C. five-carbon sugar and phosphate
D. nitrogenous bases and phosphate
2. What parts of nucleotides make up the rungs (middle) of the DNA strand?
A. Nucleotide
B. Amino Acid
C. Phosphate Group
D. Nitrogenous Bases
3. Which of the following best describes a DNA molecule?
A. double helix
B. contains ribose
C. contains uracil
D. made of amino acids
4. Which shows the correct complementary base pairing of RNA?
A. C-A, T-G
B. G-C, A-U
C. A-G, U-T
D. T-A, G-C
5. What is the term for a three-nucleotide sequence that codes for an amino
acid?
A. Codon
B. Anticodon
C. Nitrogen Bases
D. Phosphate group
6. What molecular bond held DNA molecules together?
A. Glue
B. Glucose
C. Magnetism
D. Hydrogen bonds
7. Which of the following takes the genetic code to the cytoplasm?
A. DNA

22 DO_Q3_GENBIO2_MODULE1_LESSON3
 B. tRNA
C. mRNA
D. Deoxyribose
8. Which of the following would be classified as purines?
A. Adenine and thymine
B. Adenine and guanine
C. Adenine and cytosine
D. Thymine and cytosine
9. Which of the following bonds are broken during DNA replication?
A. phosphodiester bonds
B. covalent bonds between bases
C. hydrogen bonds between bases
D. ionic bonds between bases and phosphate groups
10. Which nucleic acid, A-D, could contain the triplet of bases ACT?
A. DNA
B. mRNA
C. rRNA
D. tRNA
11. Which of the following units are repeatedly joined together to form a strand of
DNA?
A. fatty acids
B. nucleotides
C. amino acids
D. polysaccharides
12. What determines the code, or information, of a DNA molecule?
A. the color of the nitrogen bases
B. the order (sequence) of the nitrogen bases
C. the frequency (number) of nitrogen bases
D. the shape (structure) of the nitrogen bases
13. Which of the following bases is NOT found in RNA?
A. Adenine
B. Cytosine
C. Guanine
D. Thymine
14. Which statement describes RNA?
A. RNA is usually single-stranded and contains the base uracil
B. RNA is usually double-stranded and contains the base thymine
C. RNA is longer than DNA and uses five bases to encode information
D. RNA is made in the nucleus of eukaryotic cells and stays there to carry out
its functions
15. What is the primary function of DNA?
A. To determine the sequence of traits in an individual
B. To determine the sequence of fatty acids in a glycerol molecule
C. To determine the sequence of amino acids in a protein molecule
D. To determine the sequence of saccharide monomers in a polysaccharide
molecule

23 DO_Q3_GENBIO2_MODULE1_LESSON3
 Lesson Molecular Structure of DNA, RNA,
3 and Proteins

You have learned from the previous lesson the non-Mendelian modes of
inheritance such as co-dominance, incomplete dominance, and multiple alleles.
Therefore, co-dominance is when the heterozygote genotype is expressed as a distinct
phenotype, meaning both extreme phenotypes are expressed at the same time while
incomplete dominance is when the heterozygote genotype is expressed as a distinct
phenotype or a blend of the extreme phenotypes. Both in codominance and incomplete
dominance the phenotypic ratio is the same as the genotypic ratio. Lastly, multiple
alleles mean there are two types of alleles and the relationship of each allele concerning
others will determine the number of phenotypes that may be expressed.

Directions: Fill in the Blanks. Write the letter of the correct answer in the space
provided.

A. Nucleotides B. Ribose C. Deoxyribose D. Adenine E. Uracil

F. Double G. Single H. Cytosine I. Proteins J. Amino Acid

1. A _____________ is composed of a phosphate group, five-carbon sugar, and

nitrogenous bases.
The sugar in DNA is 2. _________________ while the sugar in RNA is 3.
__________________. Specific base pairings occur in DNA. 4. _____________ pair with
thymine; guanine pair with 5. ______________. DNA is 6. _______________ strand while
RNA is 7. _____________ strand with 8. _____________ instead of thymine.
9. _______________ it is the functional products of genes and 10. __________________ is
the building blocks of this which executes cellular functions

Deoxyribonucleic Acid (DNA) is the repository of genetic information and

considers the sequence of bases that encodes the blueprint for life processes. The
sugar in DNA is deoxyribose and the base pairings occur in it is adenine (A) pair
with the thymine (T) and guanine (G) pair with the cytosine (C). In Ribonucleic Acid
(RNA) the information in the form of the base sequence is transformed (transcribed)
into mRNA, tRNA, and rRNA. The base pairings that occur in RNA are guanine (G)
pair with cytosine (C) and adenine (A) pair with uracil (U). While proteins are the
functional products of genes, and it executes cellular functions. There are four
structural levels of proteins such as primary, secondary, tertiary, and quaternary.

24 DO_Q3_GENBIO2_MODULE1_LESSON3
 Deoxyribonucleic Acid (DNA) is composed of nucleotides. A nucleotide has
three parts such as phosphate group, nitrogenous bases, and five-carbon sugar.
The sugar in DNA is deoxyribose. A DNA molecule is composed of two DNA strands
held together by hydrogen bonds between the paired bases. The sides of the ladder
are made up of alternating phosphate group and five-carbon sugar that twist around
each other to form a DNA double helix, and the bases pointing inwards with adenine
base pairing to thymine and guanine base pairing to cytosine. The specifics of base
pairing occurs adenine and thymine are aligned to form two hydrogen bonds,
whereas cytosine and guanine form three hydrogen bonds. Ribonucleic acid (RNA) is
a single-stranded one that contains ribose sugar with carbons numbered 1’ through
5’. A base is attached to the 1’ position, in general, adenine (A), cytosine (C), guanine
(G), and uracil (U).
Adenines and guanine are purines, and cytosine and uracil are pyrimidines.
A phosphate group is attached to the 3’ position of the ribose and the 5’ position of
the next. The phosphate groups have a negative charge each, making RNA a charged
molecule (polyanion). An important structural component of RNA that distinguishes
it from DNA is the presence of a hydroxyl group at the 2’ position of the ribose
sugar. Proteins are biomolecules, or macromolecules, consisting of one or more long
chains of amino acid residues. Most proteins fold into the unique 3D structure. The
four structural levels of proteins are primary is a sequence of amino acids in the
polypeptide chains, secondary is when the polypeptide chains from or β pleated sheet
structure; tertiary is coiling of the polypeptide, combining helices and sheet forms
and quaternary is the association of two or more polypeptides in space.

Directions: Answer the following questions so you can label the parts of each
diagram below. Write your answer in the space provided.
1. Name of sugar in DNA
2. Functional group that is
attached in the five-carbon
sugar of DNA.
3. Initials of the nitrogenous bases
of DNA.
4. Functional group that is
attached in the five-carbon
sugar of RNA.
5. Name of sugar in RNA
6. Initial of the nitrogenous bases
of RNA.
7-10. Enumerate the structure of
proteins.

In your own words, describe the structure of DNA, RNA, and Proteins.
Write your answer on a separate paper.

25 DO_Q3_GENBIO2_MODULE1_LESSON3
Directions: You will be asked to build a unique, free-standing model. Choose one
from DNA, RNA, and Proteins by using recyclable materials. Criteria
below will be used to rate your output

 Must be 3-Dimensional
 Must be free standing
 Must show the complete parts
 Must include labels for each part
 Must be creative

Directions: Write the letter of the correct answer.

1. What binds with adenine in RNA molecules?
A. Uracil
B. Thymine
C. Cytosine
D. Guanine
2. Which of the following is correct between RNA and DNA?
A. All the statements mentioned.
B. DNA uses Uracil and RNA uses thymine
C. RNA has deoxyribose and DNA has sucrose.
D. RNA is a single strand and DNA is a double strand.
3. What would the complementary RNA sequence be for the given DNA
sequence? A-G-G-C-T-A
A. T-G-C-A-A-G
B. U-C-G-C-A-U
C. U-C-C-G-A-U
D. T-C-C-G-A-T
4. What is the term for a three-nucleotide sequence that codes for an amino acid?
A. Codon
B. Sugar
C. Phosphate group
D. Nitrogenous base
5. What parts of nucleotides make up the rungs (middle) of the DNA strand?
A. Nucleotide
B. Amino Acid
C. Phosphate Group
D. Nitrogenous Bases
6. What determines the code, or information, of a DNA molecule?
A. the color of the nitrogen bases
B. the order (sequence) of the nitrogen bases
C. the frequency (number) of nitrogen bases
D. the shape (structure) of the nitrogen bases

26 DO_Q3_GENBIO2_MODULE1_LESSON3
7. What is the primary function of DNA?
A. To determine the sequence of traits in an individual
B. To determine the sequence of fatty acids in a glycerol molecule
C. To determine the sequence of amino acids in a protein molecule
D. To determine the sequence of saccharide monomers in a polysaccharide
molecule
8. Which statement describes RNA?
A. RNA is usually single-stranded and contains the base uracil
B. RNA is usually double-stranded and contains the base thymine
C. RNA is longer than DNA and uses five bases to encode information
D. RNA is made in the nucleus of eukaryotic cells and stays there to carry out
its functions
9. Which of the following bases is NOT found in RNA?
A. Adenine
B. Cytosine
C. Guanine
D. Thymine
10. What molecular bond held DNA molecules together?
A. Glue
B. Glucose
C. Magnetism
D. Hydrogen bonds
11. Which of the following takes the genetic code to the cytoplasm?
A. DNA
B. tRNA
C. mRNA
D. Deoxyribose
12. Which of the following would be classified as purines?
A. Adenine and thymine
B. Adenine and guanine
C. Adenine and cytosine
D. Thymine and cytosine
13. Which nucleic acid, A-D, could contain the triplet of bases ACT?
A. DNA - ANSWER
B. mRNA
C. rRNA
D. tRNA
14. Which of the following units are repeatedly joined together to form a strand of
DNA?
A. fatty acids
B. nucleotides
C. amino acids
D. polysaccharides
15. What determines the code, or information, of a DNA molecule?
A. the color of the nitrogen bases
B. the order (sequence) of the nitrogen bases
C. the frequency (number) of nitrogen bases
D. the shape (structure) of the nitrogen bases

27 DO_Q3_GENBIO2_MODULE1_LESSON3
Directions. Conduct a short interview with one or two of your family members. Ask
them about how they think of the positive and negative effects of genetic
engineering. List all their responses. Below is the rubric that will guide
you on what to do in the activity. Write your answer on a separate sheet
of paper.

28 DO_Q3_GENBIO2_MODULE1_LESSON3
DO_Q3_GENBIO2_MODULE1_LESSON3 29
What I Know What’s New What I Have Learned
Answers may Vary
1. C 11. C 1. A
2. D 12. B 2. C
3. A 13. D 3. B
4. B 14. A 4. D
5. A 15. C 5. H
6. D 6. F What I Can Do
7. A 7. G Answers may Vary
8. B 8. E
9. C 9. I
10. A 10. J
What’s More Assessment
1. Deoxyribose 1. A
2. Phosphate group 2. D
3. C-G, A-T 3. D
4. Hydroxyl group 4. A
5. Ribose 5. D
6. C-G, A-U 6. B
7. Primary 7. C
8. Secondary 8. A
9. Tertiary 9. D
10. Quaternary 10. D
11. A
12. B
13. A
14. C
15. B
Additional Activities
Answers may Vary
“Earth and Life Science - Deped Tambayan.” Accessed September 17, 2022.
https://depedtambayan.net/wp-content/uploads/2021/11/ELS_Q2_Module-
4_GeneticEngineering_v2.pdf.

What Is Genetic Engineering? n.d. https://www.yourgenome.org/facts/what-is-

genetic-engineering/.

30 DO_Q3_GENBIO2_MODULE1_LESSON3
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 4: DNA
Replication and Protein
Synthesis

31 DO_Q3_GENBIO2_MODULE1_LESSON3
 The central dogma or the directional command of creating proteins from
genetic information (DNA) was dubbed by Francis Crick in 1956. It is summarized in
a simple illustration below.

At the end of the lesson the learners are expected to:

 Diagram the steps in DNA replication and protein
synthesis (STEM-BIO 12-IIIa-b-5)

Directions. Write the letter of the correct answer.

1. Which describes DNA after replication has taken place?
A. two molecules, each with two old strands
B. two molecules, each with two new strands
C. two molecules, each with one original and one new strand
D. one molecule with two original strands and one molecule with two new
strands.
2. Which of the following carries amino acids to the site of protein synthesis?
A. mRNA
B. nRNA
C. rRNA
D. tRNA
3. What process resulted in the duplication of DNA?
A. Translation
B. Replication
C. Respiration
D. Transcription
4. What is produced during transcription?
A. rRNA
B. tRNA
C. mRNA
D. protein
5. What happens during the process of translation?
A. messenger RNA is made from DNA.
B. copies of DNA molecules are made
C. transfer RNA is made from messenger RNA.
D. the cell uses information from messenger RNA to produce proteins.
6. What is the role of the ribosome in protein synthesis?
A. it is where DNA synthesis occurs
B. it is where gene synthesis occurs

32 DO_Q3_GENBIO2_MODULE1_LESSON4
 C. it is where mRNA synthesis occurs
D. it is where protein synthesis occurs
7. What is an exception to the central dogma of molecular biology?
A. Viruses can translate without RNA.
B. Viruses sometimes transfer information from RNA to DNA.
C. Viruses sometimes transfer information from DNA to RNA.
D. Viruses sometimes transfer information from proteins to DNA.
8. What is produced during transcription?
A. proteins
B. RNA molecules
C. DNA molecules
D. RNA polymerase
9. Which of the following enzymes are used to join bits of DNA?
A. Primase
B. DNA ligase
C. Endonuclease
D. DNA Polymerase
10. Which of the following bonds are broken during DNA replication?
A. phosphodiester bonds
B. covalent bonds between bases
C. hydrogen bonds between bases
D. ionic bonds between bases and phosphate groups
11. Which of the following enzymes separates the two strands of DNA during
replication?
A. Gyrase
B. Helicase
C. Topoisomerase
D. DNA polymerase
12. Where does DNA replication takes place in humans?
A. Nucleus –
B. Cytoplasm
C. Ribosomes
D. Cell membrane
13. Which one is the correct pair?
A. Transcription- synthesis of protein
B. Ribosomal RNA – carries amino acid to the site of protein synthesis
C. Anticodon- site of tRNA having complementary bases to a codon of mRNA
D. Translation- the process of mRNA carrying information from nucleus to
ribosome
14. What is the job of tRNA during translation?
A. It carries amino acids to the mRNA.
B. It binds to the small ribosomal subunit.
C. It triggers the termination of the protein.
D. It carries information from DNA to the ribosome.
15. What is the complementary strand of DNA sequence ATTGTCC?
A. TAACAGG
B. CGGAGTT
C. ACCTCGG
D. CCTGTTA

33 DO_Q3_GENBIO2_MODULE1_LESSON4
 Lesson DNA Replication and Protein
4 Synthesis

When a cell receives a signal to begin preparing for division, DNA replication
starts to take place in the S-phase of the interphase. Here. DNA will split in a semi-
conservative manner. Protein synthesis includes DNA transcription and DNA
translation. How is DNA replication related to protein synthesis? The primary
distinction between protein synthesis and DNA replication is that the former involves
creating a functional protein molecule based on information contained in the genes,
whereas the latter involves creating an identical replica of an existing DNA molecule.

Activity
Directions: Fill in the matching bases in each table from DNA to DNA,
DNA to mRNA, and mRNA to proteins.

34 DO_Q3_GENBIO2_MODULE1_LESSON4
 DNA replication is when DNA
strands separate and serve as templates
to produce new DNA molecules, and it is
called a complementary strand. The
following are the features of replication:
i. semiconservative is the
resulting DNA consisting of one old and
new strand.
ii. Base pairing is maintained
where adenine pairs with thymine and
guanine pairs with cytosine.
iii. New DNA molecules are
produced in the 5’ to 3’ direction.
iv. the Last one is the semi-
discontinuous where the leading strand
is synthesized in a continuous manner
(5’ to 3’) while the lagging strand is
produced discontinuously in short stretches called Okazaki fragments.

In lagging strand synthesis, there is a need for a primer terminus which is

provided by an RNA molecule. RNA is synthesized by a primase or RNA polymerase.
The 3’OH of the RNA is where new DNA nucleotides are added thus new DNA is
built in the 5’ to 3’ direction.

Transcription is when DNA is unwound, and one strand is used as a template

to produce an RNA molecule. An RNA polymerase makes RNA in the 3’ to 5’ direction.
Specific regions in the DNA called promoters allow the binding of transcription
factors which make the possible binding of the RNA polymerase. Three major types
of RNA: messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA).

Translation is occurring in the ribosome. Basic ingredients are the various

types of RNAs produced in transcription and some proteins or enzymes. The mRNA
contains a triplet of bases called codons that specify an amino acid, e.g., UUU – phe.
Various tRNA carriers’ amino acids from the cytoplasm to the actual site of
translation in the ribosome.

Directions: Write the answer in the space provided.

1. Break the DNA sequence into triplets of letters. Draw a vertical line to
separate the three-letter code or codon.
TACGATCGACGGACAGGCCTTAAGCGAC

35 DO_Q3_GENBIO2_MODULE1_LESSON4
 2. If the above code showed the strand of DNA, what would be the
complementary strand? Write your answer in the space provided.
_____________________________________________

3. Transcribe the code in question no. 2 into mRNA (messenger RNA). RNA is
the same as DNA except for the nitrogenous base Uracil. That means Adenine
combines with Uracil instead of Thymine. Write your answer in the space
provided. __________________________

4. How many “three letter words” or codons are there in the translated
messenger RNA? ________________________________________
5. Using the transcribed mRNA code in question 3, translate it into amino
acids. Write your answer in the space provided.
______________________________________________________

Directions: Write your answer in the space provided.

A. 3 things/concepts/key ideas they have learned in the lesson(s).
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

B. 2 things/concepts/key ideas they have questions about the lesson(s); and

___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

C. 1 thing/concept/key idea they want the teacher to know about in

connection to the lesson(s) discussed.

___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

36 DO_Q3_GENBIO2_MODULE1_LESSON4
Directions: Supply the missing word to complete the diagram below. Write the
answer in the space provided.

A. Directions: Write the letter of the correct answer.

1. Which molecule carries a copy of the genetic information out of the nucleus?
A. tRNA
B. rRNA
C. mRNA
D. amino acid
2. What do you call the sequence of three bases in mRNA that corresponds to an
amino acid?
A. code
B. codon
C. anticodon
D. amino acid
3. What do you call the sequence of three bases in tRNA that corresponds to an
amino acid?
A. code
B. codon
C. anticodon
D. amino acid

37 DO_Q3_GENBIO2_MODULE1_LESSON4
 4. Where does transcription take place?
A. nucleus
B. ribosome
C. Golgi bodies
D. mitochondria
5. Which of the following is directly involved in the translation phase of protein
synthesis?
A. nucleus
B. ribosome
C. cytoplasm
D. mitochondria
6. Which of the following is carried by the transfer RNA (tRNA)?
A. DNA
B. ribosome
C. amino acid
D. nucleic acid
7. Which of the following is NOT a part of protein synthesis?
A. elongation
B. replication
C. translation
D. transcription
8. Which nitrogen base is found in the RNA molecule in place of thymine?
A. cytosine
B. thymine
C. guanine
D. uracil
9. What is produced in the translation process?
A. ATP
B. H2O
C. DNA
D. mRNA
10. If the DNA template reads “ATA”, which of the following would be the
corresponding mRNA codon?
A. ATA
B. TUT
C. UAU
D. UCU
B. Directions: Your task is to arrange the following events in the central dogma in
proper sequence. Assign numbers 1-5 on the space provided to
indicate the correct sequence of events.
_______1. Specific regions in the DNA called promoters allow the binding of
transcription factors which make possible the binding of RNA polymerase.
_______2. The mRNA contains triplets of bases called codons that specify an amino
acid.
_______3. DNA strands separate and serve as templates to produce new DNA
molecules.
_______4. Different rRNAs combine with ribosomal proteins to make up the subunits
of a ribosome.
_______5. New DNA molecules are produced in the 5’ to 3’ direction.

38 DO_Q3_GENBIO2_MODULE1_LESSON4
 Protein is essential to the building block of muscles. Muscle protein synthesis
is a naturally occurring process in which protein is produced to repair muscle
damage caused by intense exercise. It is an opposing force to muscle protein
breakdown (MPB) in which protein is lost because of exercise. (Source:
https://www.encyclopedia.com/sports/sports-fitness-recreation-and leisure
magazines/muscle-protein-synthesis). For example, you are an athlete, and you
want to maintain the strength and mass of your muscles.

1. How important is protein synthesis in your body?

2. How are you going to boost the protein synthesis in your body? How are you going
to boost the number of essential amino acids and proteins in your body?

39 DO_Q3_GENBIO2_MODULE1_LESSON4
DO_Q3_GENBIO2_MODULE1_LESSON4 40
What’s More What I Know
1.TAC-GAT-CGA-CGG-ACA-GGC- 1. C 6. D 11. B
CTT-AAG-CGA 2. D 7. B 12. A
2.ATG-CTA-GCT-GCC-TGT-CCG- 3. B 8. D 13. C
GAA-TTC-GCT 4. C 9. B 14. A
3.UAC-GAU-CGA-CGG-ACA-GGC- 5. D 10. C 15. A
CUU-AAG-CGA
4. 9 What’s New
5. Tyr, Asp, Arg, Arg, Thr, Gly, Leu, DNA DNA
Lys, Arg Process: DNA Replication
Thymine- Adenine
What’s I Have Learned Adenine- Thymine
Answers may Vary Cytosine- Guanine
Guanine-Cytosine
What I Can Do Thymine-Adenine
1. DNA Replication Adenine- Thymine
2. Transcription Cytosine- Guanine
3. Translation Guanine-Cytosine
4. Ribosome Adenine- Thymine
5. Proteins
DNA mRNA
Assessment Process: Transcription
A. B. Thymine- Adenine
1. C 6. C 1. 3 Adenine- Uracil
2. B 7. A 2. 4 Cytosine- Guanine
3. B 8. D 3. 1 Guanine-Cytosine
4. A 9. D 4. 5 Thymine-Adenine
5. B 10. C 5. 2 Adenine- Uracil
Cytosine- Guanine
Additional Activities Guanine-Cytosine
Answers may Vary Adenine- Uracil
mRNA Proteins
Process: Translation
Adenine- Uracil
Uracil – Adenine
Guanine – Cytosine Tyr
Cytosine- Guanine
Adenine-Uracil
Uracil- Adenine Val
Guanine-Cytosine
Cytosine-Guanine
Uracil-Adenine Arg
“Molecular Mechanism of DNA Replication (Article).” Khan Academy. Khan Academy.
Accessed September 17, 2022. https://www.khanacademy.org/science/ap-
biology/gene-expression-and-regulation/replication/a/molecular-mechanism-
of-dna-replication.

“Science - Depedtambayan.net.” Accessed September 17, 2022.

https://depedtambayan.net/wp-content/uploads/2022/01/SCI10-Q3-
MODULE4.pdf.

41 DO_Q3_GENBIO2_MODULE1_LESSON4
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 5: Recombinant
DNA

42 DO_Q3_GENBIO2_MODULE1_LESSON4
 The basic knowledge about a cell, protein synthesis, and DNA's role in the
body helps you to understand how changes in DNA result in major changes in the
characteristics of organisms.
At the end of the lesson, learners are expected to:
 Outline the processes involved in genetic engineering
STEM_BIO11/12-IIIa-b-6
 Discuss the applications of recombinant DNA
STEM_BIO11/12-IIIa-b-7

Directions. Encircle the letter of the best answer.

1. Which of the sentences below best describes recombinant DNA?
A. Recombinant DNA is a mix of human and animal DNA.
B. Recombinant DNA is a technique for repairing damaged DNA.
C. Recombinant DNA is created for stem cells and human cloning.
D. Recombinant DNA involves the process of creating a DNA molecule obtained
from two different species.
2. What special carrier do scientists use to transfer DNA into a cell?
A. genes
B. vector
C. plasmid
D. hormone
3. What branch of science uses recombinant DNA techniques for practical purposes?
A. Embryology
B. Microbiology
C. Biotechnology
D. Agrotechnology
4. What organism is used to produce some human proteins in preparing insulin?
A. insects
B. viruses
C. bacteria
D. parasites
5. What is the process that allows very specific isolation and movement of genes for
desirable traits without the inclusion of less desirable traits?
A. Cloning
B. Stem Cells
C. Gene splicing
D. Genetic engineering
6. What enzymes are used to join two different types of DNA molecules?
A. ligase
B. protease
C. exonuclease
D. endonuclease
7. What is a cloning vector?
A. The laboratory apparatus used to clone genes.

43 DO_Q3_GENBIO2_MODULE1_LESSON5
 B. An enzyme that cuts DNA into restriction fragments.
C. The DNA probe is used to locate a particular gene in the genome.
D. An agent such as a plasmid, is used to transfer DNA from an in vitro solution
into a living cell.
8. Which of the following is a protein that acts as DNA scissors?
A. ligase
B. plasmid
C. protein expression
D. restriction enzyme
9. Which of the following is NOT an example of genetic engineering?
A. Gene isolation
B. Gene modification
C. Develop transgenes
D. Basic molecular biology
10. Which of the following is a laboratory technique used by scientists to change
the DNA of living organisms?
A. Cloning
B. Immunology
C. Molecular biology
D. Genetic engineering
11. What is a genetically modified organism?
A. Epigenetics
B. An organism missing genes
C. An organism with foreign DNA
D. A genetically identical organisms
12. Which of the following is a circular DNA from bacteria that can hold a foreign
gene?
A. ligase
B. plasmid
C. restriction enzyme
D. protein expression
13. What is true about plasmids?
A. All the statements are true about plasmids.
B. Plasmids can contain an antibiotic resistance gene.
C. Plasmids can be cut at specific sequences called restriction sites.
D. Plasmids contain a promoter sequence that defines where transcription
begins.
14. Which of the following is NOT a tool used in genetic engineering?
A. plasmid
B. DNA ligase
C. DNA helicase
D. restriction enzyme
15. What is the name of the process that inserts a recombinant plasmid into a
bacterium?
A. meiosis
B. gene cloning
C. binary fission
D. transformation

44 DO_Q3_GENBIO2_MODULE1_LESSON5
 Lesson
Recombinant DNA
5

Using enzymes and numerous laboratory procedures, recombinant DNA

technology allows for the manipulation and isolation of desired DNA segments. This
technique can be used to merge (or splice) DNA from various species or to make genes
with new functions. Recombinant DNA is the term used to describe the resultant
copies.

Genetically Modified Organisms (GMOs) are produced through recombinant

DNA technology. It involves the process of creating a DNA molecule obtained from
two different species. Throughout this time, DNA technology has helped humankind
in various ways. From the verification of one’s identity to the treatment of genetic
disorders, and the improvement of crop varieties and animal breeds.

Genetic engineering or Biotechnology is the branch of science that uses

recombinant DNA techniques to identify, study, or modify genes. With recombinant
DNA technology, scientists can take genes from one organism and transfer those
genes into the cells of another organism. Genetic engineers have transferred specific
human genes into bacteria, making this bacterium to produce proteins useful to
humans. The illustration below shows the preparation of insulin from genetically
altered bacteria. Bacteria are used to produce some human proteins. Genes encoding
human insulin were cloned and expressed in Escherichia coli in 1978. At present,
insulin is being produced in E.coli and the yeast Saccharomyces cerevisiae for
diabetic patients (Baeshen et al. 2014).

45 DO_Q3_GENBIO2_MODULE1_LESSON5
 https://ib.bioninja.com.au/standard-level/topic-2-molecular-biology/27-dna-replicationtranscri/universality.html
DNA transfer in the cell uses a vector, as the carrier of genetic material.
Bacteria contain vectors called plasmids which move circular pieces of DNA within
bacteria.
Gene Cloning Technique:
•Isolate a gene of interest, for example, the gene for human insulin.
•Insert the gene into a plasmid.
•Insert the plasmid into a vector, a cell that will carry the plasmid, such
as a bacterium.
•Clone the gene. As the bacteria reproduce themselves by fission, the
plasmid and the selected gene are also cloned. Millions of copies of the gene are
produced.
•Identify the bacteria that contain the selected gene and harvest it from
the culture.
Many other products are now available, including veterinary vaccines and
human growth hormone
Gene splicing allows very specific isolation and movement of genes for
desirable traits without the inclusion of less desirable traits. Through the addition,
deletion, and modification of genes for useful traits, the creation of genetically
modified organisms (GMO) or transgenic organisms is possible that are more
beneficial to humans. The genes of interest that are moved into an organism using
recombinant DNA technology are also known as transgenes.

Genetically modified crops are produced by

inserting or moving DNA.

46 DO_Q3_GENBIO2_MODULE1_LESSON5
Significance:
1. to resist insects and certain types of herbicides
2. increase yields
3. make production easier
4. biotech crops have been modified to resist viral infections (pathogen
resistance)
5. produce useful proteins (plant-made products)
6. remove heavy metals from soil and water (phytoremediation)
7. increase nutritional content (quality traits)

How to produce genetically modified crops (Rani and Usha, 2014)

1. Identifying and locating genes for plant traits (transgenic process)

2. Designing genes for insertion
3. Transforming plants
4. Selection of successfully transformed tissues
5. Regeneration of whole plants

Activity Picto-Gen

Directions. Study the diagram then explain how it was genetically modified.
Write the answer on your answer sheet.

Human Insulin

47 DO_Q3_GENBIO2_MODULE1_LESSON5
Directions: Answer the questions.
1. What is genetic engineering?
________________________________________________________________
2. What are the steps involved in recombinant DNA technology?
________________________________________________________________

Directions. Complete the table about the application of genetic

engineering in the different fields. Do it on a separate paper.

GENETIC ENGINEERING

AGRICULTURE INDUSTRY MEDICINE

Directions. Write the letter of the correct answer.

1. What special carrier do scientists use to transfer DNA into a cell?

A. genes
B. vector
C. plasmid
D. hormone
2. What branch of science uses recombinant DNA techniques for practical purposes?

48 DO_Q3_GENBIO2_MODULE1_LESSON5
 A. Embryology
B. Microbiology
C. Biotechnology
D. Agrotechnology

3. What organism is used to produce some human proteins in preparing insulin

A. insects
B. viruses
C. bacteria
D. parasites
4. What is the process that allows very specific isolation and movement of genes for
desirable traits without the inclusion of less desirable traits?
A. Cloning
B. Stem Cells
C. Gene splicing
D. Genetic engineering
5. What enzymes are used to join two different types of DNA molecules?
A. ligase
B. protease
C. exonuclease
D. endonuclease
6. Which of the following is a protein that acts as DNA scissors?
A. ligase
B. plasmid
C. protein expression
D. restriction enzyme
7. Which of the sentences below best describes recombinant DNA?
A. Recombinant DNA is a mix of human and animal DNA.
B. Recombinant DNA is a technique for repairing damaged DNA.
C. Recombinant DNA is created for stem cells and human cloning.
D. Recombinant DNA involves the process of creating a DNA molecule obtained
from two different species.
8. Which of the following is NOT an example of genetic engineering?
A. Gene isolation
B. Gene modification
C. Develop transgenes
D. Basic molecular biology
9. What is a genetically modified organism?
A. Epigenetics
B. An organism missing genes
C. An organism with foreign DNA
D. A genetically identical organisms
10. What is true about plasmids?
A. All the statements are true about plasmids.
B. Plasmids can contain an antibiotic resistance gene.
C. Plasmids can be cut at specific sequences called restriction sites.
D. Plasmids contain a promoter sequence that defines where transcription begins.
11. Which of the following is NOT a tool used in genetic engineering?
A. plasmid
B. DNA ligase
C. DNA helicase
D. restriction enzyme
12. What is the name of the process that inserts a recombinant plasmid into a
bacterium?

49 DO_Q3_GENBIO2_MODULE1_LESSON5
 A. meiosis
B. gene cloning
C. binary fission
D. transformation
13. Which of the following is a laboratory technique used by scientists to change the
DNA of living organisms?
A. Cloning
B. Immunology
C. Molecular biology
D. Genetic engineering
14. Which of the following is a circular DNA from bacteria that can hold a foreign
gene?
A. ligase
B. plasmid
C. restriction enzyme
D. protein expression
15. What is a cloning vector?
A. The laboratory apparatus used to clone genes.
B. An enzyme that cuts DNA into restriction fragments.
C. The DNA probe is used to locate a particular gene in the genome.
D. An agent such as a plasmid, is used to transfer DNA from an in vitro solution
into a living cell.

Make 5 sentences of insights about the lessons discussed.

________________________________________________________________________________
________________________________________________________________________________

50 DO_Q3_GENBIO2_MODULE1_LESSON5
DO_Q3_GENBIO2_MODULE1_LESSON5 51
Assessment What I Know
1. B 6. D 11. C 1. D 6. A 11. D
2. C 7. D 12. D 2. B 7. D 12. B
3. C 8. D 13. A 3. C 8. D 13. A
4. D 9. D 14. B 4. C 9. D 14. C
5. A 10.A 15. D 5. D 10.D 15. D
Additional Activities What’s More
Answer may Vary Answer may Vary
What I Have Learned
1. Genetic engineering or
Biotechnology is the branch of science
that uses recombinant DNA
techniques to identify, study, or
modify genes.
2. •Isolation of genetic material (DNA)
DNA is enclosed within the membrane
•Cutting of DNA at specific locations
•Joining of DNA fragment
•Insertion of DNA into the host cell
•Selection and screening of
transformed cells
What I Can Do
Agriculture: faster and more precise
breeding, higher crop yields,
development of more nutritious food,
and decreased need for herbicides and
pesticides
Industry: development of new strains
for additional processes, manufacture
of proteins products
Medicine: production of vaccines,
creation of hormone insulin,
production of blood clotting factors
“Genetic Engineering.” Genetic Engineering - an overview | ScienceDirect Topics. Accessed
September 21, 2022. https://www.sciencedirect.com/topics/chemical-
engineering/genetic-engineering.

“Genetically Modified (GM) Crops: Techniques and Applications - 0.710.” Accessed

September 21, 2021. https://extension.colostate.edu/topic-areas/agriculture/genetically-
modified-gm-crops-techniques-and-applications-0-710/.

“." Science of Everyday Things. . Encyclopedia.com. 25 Aug. 2022.” Encyclopedia.com.

Encyclopedia.com, September 21, 2022. https://www.encyclopedia.com/science-and-
technology/biology-and-genetics/genetics-and-genetic-engineering/genetic-engineering.

Suza, Walter, Donald Lee, Marjorie Hanneman, and Patricia Hain. “Genetic Engineering.”
Genetics Agriculture and Biotechnology. Iowa State University Digital Press, October
15, 2021. https://iastate.pressbooks.pub/genagbiotech/chapter/genetic-engineering/.

52 DO_Q3_GENBIO2_MODULE1_LESSON5
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 6: Geologic
Timeline and
Mechanism of Evolution

53 DO_Q3_GENBIO2_MODULE1_LESSON5
 The tale of life on Earth unfolded about 4.5 billion years ago. The planet that
contains different forms of life has undergone several changes in biological and
geological levels that have resulted not only in physical features but also in its
inhabitants. Through studying the Earth’s geological timeline, we will be able to try
to understand and imagine what life looks like billion years ago and how it evolved
until this very date of time. We will trace the burst of evolutionary diversity of
organisms how they are different and similar, and the disaster extinction events.

At the end of the lesson learners are expected to:

 Describe general features of the history of life on Earth, including
generally accepted dates and sequence of the geologic time scale
and characteristics of major groups of organisms present during
these periods STEM_BIO11/12-IIIc-g-8
 Explain the mechanisms that produce a change in populations
from generation to generation (e.g., artificial selection, natural
selection, genetic drift, mutation, recombination)
STEM_BIO11/12-IIIc-g-9

Directions: Write the letter of the correct answer.

1. Which of these segments of time is the longest?

A. eon
B. epoch
C. era
D. period
2. What method was used to observe rock records by placing geological events in a
chronological sequence?
A. double dating
B. relative dating
C. principle dating
D. radioactive dating
3. Around how long ago did humans start to appear on Earth?
A. 40,000 years
B. 400,000 years
C. 4 million years
D. 40 million years
4. What does Archean mean?
A. before life
B. visible life
C. young
D. ancient

54 DO_Q3_GENBIO2_MODULE1_LESSON6
 5. What geological unit of time is typically named for the place where the rocks or
fossils were discovered or first described before life?
A. era
B. period
C. epoch
D. Precambrian
6. Which of the following periods of plant life appeared on land?
A. Silurian period
B. Devonian period
C. Cambrian period
D. Ordovician period
7. Which of the following periods is the earliest in which animals have appeared?
A. Cambrian period
B. Ediacaran period
C. Ordovician period
D. Cryogenian period
8. What type of data is primarily used to determine the existence and appearance of
early animal species?
A. fossil data
B. molecular data
C. morphological data
D. embryological development data
9. What period was the time 512-488 million years ago?
A. Silurian period
B. Devonian period
C. Cambrian period
D. Ediacaran period
10. What is the mechanism whereby individuals with certain heritable traits have an
increased chance of surviving and producing offspring?
A. Evolution
B. Natural Selection
C. The Circle of Life
D. Descent with modification
11. Which of the following is not an observable fact of nature on which natural
selection is based?
A. Variation
B. Sustenance
C. Inheritance
D. Differential Survival and Reproduction
12. What is the process of random changes in the frequency of an allele called?
A. Evolution
B. Genetic drift
C. Founder’s effect
D. Natural selection
13. What is the first major cause of genetic change in populations?
A. Eugenics
B. Natural selection
C. Random mutation
D. Environmental change
14. Which of the following statements regarding evolution is true?
A. There is a distinct origin and end goal.
B. It is typically observable in a single generation.
C. There is no overall direction, simply a response to local conditions.

55 DO_Q3_GENBIO2_MODULE1_LESSON6
 D. Evolution anticipates future changes in the environment and allows organisms
to adapt accordingly.
15. What is the phenomenon of one species branching off from an existing species?
A. Speciation
B. Sustenance
C. Genetic drift
D. Founder's effect

Geologic Timeline and Mechanism

Lesson 6
of Evolution

Rock stratigraphy (layers) and time intervals are related by the geological time
scale. Geologists, paleontologists, and many other Earth scientists utilize the time
scale to date specific Earthly historical events.

The age of the Earth is roughly 4.6 billion years, as we have already shown on
other pages on this subject. Radiometric dating was used to estimate this age.
According to the events that took place at this time, Earth's past has been divided
into many periods. As an illustration, consider the extinction event that split the
Cretaceous and Paleogene periods (formerly the Tertiary periods), which are
separated by the extinction of the dinosaurs and numerous other species.

Geologic Timeline
In the history of geologic time, rock was hard to figure out in reading, the
history of life on earth. From much human history, of course, we had no idea how
old the earth was, what happened in deep time, or what happened in what order. In
1669, Danish scientist Nicolas Steno published the first laws of stratigraphy.
Stratigraphy deals with all the characteristics of layered rocks; it includes the study
of how these rocks relate to time. Steno argued that the layers closer to the surface
must be younger than the layers below. So, the farther the rocks from the surface
the older the fossil it has.
Next, an Italian geologist Giovanni Arduino entered and named the layers
of rocks. In the 1960s, Arduino studied the Italian Alps, organizing the layers based
on their depth and composition. The lowest layers of metamorphic and volcanic
rocks, he called the primary layer. Above these were hard sedimentary rocks which
he called the secondary layer. And at the top layers of softer alluvial deposits, he
named tertiary and quaternary. And in 1819, English geologist William Smith stated
that by comparing the remains of organisms from different rock formations, Smith
could match their ages, regardless of how far apart they were. And because of these

56 DO_Q3_GENBIO2_MODULE1_LESSON6
scientists, the modern scientist has used these and other clues to create what we
now call the Geological Timescale.
Geologists have divided Earth's history into a series of time intervals. These
time intervals are not equal in length to the hours in a day. Instead, the time intervals
are variable in length. This is because geologic time is divided using significant events
in the history of the Earth. For example, the boundary between the
Permian and Triassic are marked by a global extinction in which a large percentage
of Earth's plant and animal species were eliminated. Another example is the
boundary between the Precambrian and the Paleozoic which is marked by the first
appearance of animals with hard parts.
Eons are the largest intervals of geologic time and are hundreds of millions of
years in duration. In the time scale above you can see the Phanerozoic Eon is the
most recent one and began more than 500 million years ago. Eons are divided into
smaller time intervals known as eras. In the time scale above you can see that the
Phanerozoic is divided into three eras: Cenozoic, Mesozoic, and Paleozoic. Very
significant events in Earth's history are used to determine the boundaries of the eras.
Eras are subdivided into periods. The events that bound the periods are widespread
in their extent but are not as significant as those which bound the eras. In the time
scale above you can see that the Paleozoic is subdivided into the Permian,
Pennsylvanian, Mississippian, Devonian, Silurian, Ordovician, and Cambrian
periods.

Mechanisms of Evolution

1. Natural selection is the process through which populations of living organisms

adapt and change. Individuals in a population are naturally variable, meaning
that they are all different in some ways
2. Mutation is a source of new alleles in a population. The mutation is a change in
the DNA sequence of the gene. A mutation can change one allele into another, but
the net effect is a change in frequency. The change in frequency resulting from
mutation is small, so its effect on evolution is small unless it interacts with one of
the other factors, such as selection.
3. Genetic drift is when chance events cause changes in allele frequency. They are
predictable or sometimes harmful if there ends up being a lot of unsafe alleles in
the population.
4. Gene flow occurs when individuals move into or out of a population. If the rate of
migration is high, this can have a significant effect on allele frequencies. The allele
frequencies of both the population they leave and the population they enter may
change.

Activity 1: Make it POP!

Directions: Using the Geological Timescale, make a pop-up book on how life form
begins on earth. Do it on a separate paper.

57 DO_Q3_GENBIO2_MODULE1_LESSON6
 ONE MINUTE PAUSE
Directions: In one minute, write 5 significant learnings from lessons discussed using
the given format.

3 Top Rank Learnings

2 Second in Rank Learnings

Direction: Draw the beak of the following birds. Write the possible food
they eat in the third column.

Bird Specie Illustration of Beak Possible Food Diet

58 DO_Q3_GENBIO2_MODULE1_LESSON6
 Cedar Waxwing

Brown Pelican

Mallard Duck

Directions: On your answer sheet, write the letter of the best answer.

1. Which of these segments of time is the longest?

A. Eon
B. Era
C. Epoch
D. Period
2. What does Archean mean?
A. young
B. ancient
C. before life
D. visible life
3. On the geological time scale, what unit of time is commonly named after the
geographic region in which the rocks or fossils were first observed or described?
A. era
B. epoch
C. period
D. Precambrian
4. Which of the following statements about genetic drift is TRUE?
A. Genetic drift can rapidly homogenize allele frequencies in different populations.
B. If unchecked by other processes, genetic drift will result in a genetically
uniform population.
C. Genetic drift changes only genotype frequencies, not allele
frequencies.
D. The effective population size is usually larger than the actual population size.

59 DO_Q3_GENBIO2_MODULE1_LESSON6
5. What is an alternation in the arrangement of nucleotides in a chromosome?
A. Mutation
B. Gene flow
C. Genetic drift
D. Natural selection
6. What is the mechanism whereby individuals with certain heritable traits have an
increased chance of surviving and producing offspring?
A. Evolution
B. Natural Selection
C. The Circle of Life
D. Descent with modification
7. Which of the following is not an observable fact of nature on which natural
selection is based?
A. Variation
B. Sustenance
C. Inheritance
D. Differential Survival and Reproduction
8. What is the process of random changes in the frequency of an allele called?
A. Evolution
B. Genetic drift
C. Founder’s effect
D. Natural selection
9. What is the first major cause of genetic change in populations?
A. Eugenics
B. Natural selection
C. Random mutation
D. Environmental change
10. Which of the following statements regarding evolution is true?
A. There is a distinct origin and end goal.
B. It is typically observable in a single generation.
C. There is no overall direction, simply a response to local conditions.
D. Evolution anticipates future changes in the environment and allows
organisms to adapt accordingly.
11. What is the phenomenon of one species branching off from an existing species?
A. Speciation
B. Speciation
C. Genetic drift
D. Founder's effect
12. Which of the following periods' of plant life appeared on land?
A. Silurian period
B. Devonian period
C. Cambrian period
D. Ordovician period

13. Which of the following periods is the earliest in which animals have appeared?
A. Cambrian period
B. Ediacaran period
C. Ordovician period
D. Cryogenian period
14. What type of data is primarily used to determine the existence and appearance
of early animal species?
A. fossil data
B. molecular data

60 DO_Q3_GENBIO2_MODULE1_LESSON6
 C. morphological data
D. embryological development data
15. What period was the time 512-488 million years ago?
A. Silurian period
B. Devonian period
C. Cambrian period
D. Ediacaran period

How does natural selection predict a gradualist mode of evolution? Does the
presence of fossils that are consistent with punctuated equilibrium mean that
natural selection does not occur?

61 DO_Q3_GENBIO2_MODULE1_LESSON6
DO_Q3_GENBIO2_MODULE1_LESSON6 62
Assessment What I Know What’s More
1. A
2. C 1. A 11. B Answers may Vary
3. D 2. B 12. B
4. A 3. C 13. C
5. A 4. A 14. D What I Have
6. B Learned
7. B 5. D 15. A Answers may Vary
8. B 6. D
9. C 7. D
10. C 8. A
11. A 9. C
12. D 10. B
13. D
14. A What I Can Do
15. C Cedar Waxwing
Beak:
Additional Activities
Answers may Vary
Possible Diet: Mostly berries and insects
Brown Pelican
Beak:
Possible Diet: Fish, crustaceans
Mallard Duck
Beak:
Possible Diet: Plant material from roots and
leaves, seeds, and even small fish
Geological time. Accessed September 27, 2022. https://www.gsi.ie/en-
ie/education/our-planet-earth/Pages/Geological-Time.aspx.
Review quiz. Accessed September 27, 2022.
https://global.oup.com/us/companion.websites/9780195381986/stud/ch9/
quiz/.

63 DO_Q3_GENBIO2_MODULE1_LESSON6
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 7: Evolutionary
Modifications of
Organisms

64 DO_Q3_GENBIO2_MODULE1_LESSON6
 Evolution is a change in the heritable characteristics of biological
populations over successive generations. Different characteristics tend to exist
within any given population, because of mutation, genetic recombination, and
other sources of genetic variation.

At the end of the lesson, the learners are expected to:

 Show patterns of descent with modification from common
ancestors to produce the organismal diversity observed today
(STEM_BIO11/12- IIIc-g-10)

A. Direction: Rearrange the jumbled letters to reveal the hidden word. Write the
words on your answer sheet.
1. Evolutionary process by which populations evolve to become distinct species.
(NTCPSEIAIO)
2. It is the dramatic change of organisms because of adaptation. (NUVLTIOOE)
3. The first diploid cell of an organism. (EOTGZY)
4. The evolutionary process that increases the survivability of the organism in a
particular place. (DPNTIOAAA)
5. The sole purpose of every organism. (VVLSRIAU)

B. Direction. Identify the concept referred by the statements.

1. It is the process that raises the frequency of beneficial alleles in a population.

2. It is the type of pre-zygotic isolation that shows different patterns of courtship.
3. This mechanism shows fertilized egg fails to develop at an early embryonic
stage.
4. It occurs occurs when members of a population that initially occupy the same
habitat within the same range diverge into two or more different species.
5. It occurs when some members of a population become geographically
separated from the other members thereby preventing gene flow.
6. It resulted when the groups of species are geographic neighbors where gene
flows with reduced distances.
7. It shows incompatibilities between egg and sperm that prevents fertilization.
8. It resulted in the differences of reproductive organs that prevent successful
interbreeding.
9. It is a pre-zygotic isolation mechanism that shows different groups may not
reproductively mature at the same season, month, or year.
10. This mechanism shows potential mates occupy different habitats which
mates never come in contact.

65 DO_Q3_GENBIO2_MODULE1_LESSON7
 Lesson Evolutionary Modifications of
7 Organisms

Natural selection, a process that raises the frequency of beneficial alleles in a

population, is one mechanism that propels evolution. Organisms that are more likely
to live and reproduce are the product of natural selection. Genetic drift, which
represents arbitrary variations in allele frequencies in a population, is another
mechanism that propels evolution. A subpopulation may eventually become
genetically distinct from its parent population due to genetic drift. In fact, over a long
time, genetic drift and the accumulation of other genetic alterations can lead to
speciation, which is the evolution of a new species.

Reproductive isolation is a collection of evolutionary mechanisms,

behaviors, and physiological processes critical for speciation. They prevent members
of different species from producing sterile offspring. Zoologist Ernst Mayr classified
it into two categories: pre-zygotic for those that act before fertilization (or before
mating in the case of animals) and post-zygotic for those that act after it.

Reproductive Isolation Mechanisms

Pre-zygotic isolation mechanisms prevent fertilization and zygote formation.
Types of prezygotic isolation mechanisms:
1. Geographic or ecological or habitat isolation – potential mates occupy different
habitats thus, they never come in contact.
2. Temporal or seasonal isolation – different groups may not be reproductively
mature at the same season, month, or year.
3. Behavioral isolation – different patterns of courtship.
4. Mechanical isolation – differences in reproductive organs prevent successful
interbreeding.
5. Gametic isolation – incompatibilities between egg and sperm prevent fertilization.
Post-zygotic isolation mechanisms allow fertilization but nonviable or weak
or sterile hybrids are formed.

66 DO_Q3_GENBIO2_MODULE1_LESSON7
Types:
1. Hybrid viability – fertilized egg fails to develop at an early embryonic
stage.
2. Hybrid sterility – gonads develop abnormal segregation of chromosomes
during meiosis.
3. Hybrid breakdown - F1 hybrids are normal, strong, and viable, while F2
contains weak or sterile offspring.
Speciation
The evolutionary process by which populations evolve to become
distinct species.
Types:
A. Allopatric or geographic speciation (allo – other, patric – place) -occurs
when some members of a population become geographically separated
from the other members thereby preventing gene flow.
Examples: bodies of water and mountain ranges.
B. Sympatric speciation (sym – same, patric – place) - occurs when
members of a population that initially occupy the same habitat within the
same range diverge into two or more different species. It involves abrupt
genetic changes that quickly lead to the reproductive isolation of a group of
individuals.
Example: change in chromosome number (polyploidization).
C. Parapatric speciation (para – beside, patric – place) – occurs when the
groups of species are geographic neighbors where gene flows with reduced
distances. There is an abrupt change in the environment over and strong
disruptive selection.

Activity: Reproductive Isolation Mechanisms

Direction: Briefly answer the questions. Write your answer on your answer sheet.

Guide Questions:
1. What is evolution?
2. Differentiate pre-zygotic and post zygotic isolation mechanisms.
3. What is the significance of reproductive isolation in the evolution of any
organisms?
4. How barriers greatly affect speciation of organisms?
5. How does habitat contribute to the evolution of organisms?

67 DO_Q3_GENBIO2_MODULE1_LESSON7
 Write 5 significant learnings from the lesson discussed.

How will you adapt to an environment surrounded by competitive individuals?

Directions: Write TRUE if the statement is correct, and FALSE if it is not. Write your
answer on your answer sheet.
1. Sympatric speciation occurs when members become geographically separated,
which prevents gene flow.
2. Mechanical isolation refers to varying patterns of courtship among organisms.
3. Hybrid viability happens when a fertilized egg fails to develop at an early embryonic
stage.
4. Evolution is a change in the heritable characteristics of a biological population.
5. Evolutionary mechanisms are collections of reproductive isolation behaviors and
physiological processes critical for speciation.
6. In extreme situations, evolution can be reversed.
7. Adaptive radiation is not found in very old species but is found when new species
become older species.
8. Sympatric speciation is seen in closely related species that share a common gene
pool.
9. Allopatric speciation is only seen in different species.
10. Speciation is a branching mechanism through time.
11. Reproductive isolation occurs when there are only two males left in a population
of females.
12. Extrinsic isolation occurs when two groups of organisms are separated by
external, physical barriers.
13. When the population is small, the presence of absence of a single individual
cannot affect the gene pool.
14. In small captive populations, doubling the effective size of the population
maintains twice the amount of additive genetic variation.
15. Ecological situations that require rapid evolution are likely to favor asexual
reproduction.

68 DO_Q3_GENBIO2_MODULE1_LESSON7
How do evolutionary modifications among organisms cause genetic diversity?

69 DO_Q3_GENBIO2_MODULE1_LESSON7
DO_Q3_GENBIO2_MODULE1_LESSON7 70
What I Can Do What I Know
Answer may Vary A.
1. Speciation
Assessment 2. Evolution
1. FALSE 3. Zygote
2. FALSE 4. Adaptation
3. TRUE 5. Survival
4. TRUE B.
5. TRUE 1. Genetic drift
6. FALSE 2. Behavioral isolation
7. FALSE 3. Hybrid viability
8. FALSE 4. Sympatric speciation
9. FALSE 5. Geographic speciation
10. TRUE 6. Parapatric Speciation
11. FALSE 7. Gametic isolation
12 TRUE 8. Mechanical isolation
13. FALSE 9. Temporal/seasonal isolation
14. TRUE 10.Geographical/ecological/habitat
15. FALSE isolation
Additional Activities What’s More
Answer may Vary Answer may Vary
What I Have Learned
Answer may Vary
Mallet, Jim. Isolating mechanisms. Accessed September 27, 2021.
http://abacus.gene.ucl.ac.uk/jim/Sp/isolmech.html.

Libretexts. “18.2b: Reproductive Isolation.” Biology LibreTexts. Libretexts, June 9, 2022.

https://bio.libretexts.org/Bookshelves/Introductory_and_General_Biology/Book%3A_
General_Biology_(Boundless)/18%3A_Evolution_and_the_Origin_of_Species/18.02%
3A_Formation_of_New_Species/18.2B%3A_Reproductive_Isolation.

71 DO_Q3_GENBIO2_MODULE1_LESSON7
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 8: Development
of Evolutionary
Thoughts

72 DO_Q3_GENBIO2_MODULE1_LESSON7
 Evolution is the gradual development of organisms because of adaptation for
survival.

At the end of the lesson, the learners are expected to:

 Trace the development of evolutionary thought
(STEM_BIO11/12- IIIc-g-11)

Direction. Locate the names of scientists who contributed to the

development of evolutionary thought.

DARWIN
RAY
MALTHUS
LUCRETIUS
ARISTOTLE
LINNAEUS
CUVIER
LAMARCK
LYELL

73 DO_Q3_GENBIO2_MODULE1_LESSON8
 Lesson Development of Evolutionary
8 Thoughts

Genetic diversity is crucial for adapting to new environments, as more

variation in genes leads to more individuals having favorable traits to withstand
harsh conditions. Low genetic diversity, on the other hand, can be very problematic
during changing environments. Many researchers are investigating whether this is
true and how it might be prevented.

“Evolution” in contemporary discussions denotes the theory of the change of

organic species over time. Evolutionary thought, the recognition that species change
over time and the perceived understanding of how such processes work, has roots in
antiquity—in the ideas of the ancient Greeks, Romans, and Chinese as well as in
medieval Islamic science.

Pre-Scientific View

• Ancient Greek philosophers Anaximander (611-547 B.C.) and Roman

philosopher Lucretius (99-55 B.C.) conceived the idea that all living things
were related and changed over time.
• Aristotle’s “Great Chain of Being,” held that life was arranged from the
simplest to the most complex. He believed that Earth was “full” and nothing
new could be added.
• Archbishop James Ussher of Ireland (1581 – 1656) – sees the world as the
result of a grand design – God’s design.

Scientific View

• John Ray - provided the first definition of the concept of species and genus.
• Carolus Linnaeus - developed a system of taxonomic classification and
binomial nomenclature.
• Comte de Buffon - recognized the environment as an agent of change.
• John Baptiste Lamarck - the first scientist to explain the evolutionary
process, (theory of use and disuse)

74 DO_Q3_GENBIO2_MODULE1_LESSON8
 • Georges Cuvier - introduced the concept of extinction and the theory of
catastrophism.
• Charles Lyell - developed the theory of uniformitarianism.
• Thomas Malthus – explained the relationship between food supply and
population increase.
• Charles Darwin – He emphasized Natural Selection.
• Alfred Russel Wallace - He proposed the Theory of Geological Change

Activity: ANSWER ME QUICK!

Direction. Answer the questions briefly. Write your answer on a separate paper.

Guide Questions:

1. According to Thomas Malthus, “the growth of population will outrun its capacity to
feed itself.” Relate this to the current situation of the Philippines in terms of
population growth.

2. The idea of Comte the Buffon “that environment is an agent of change for any
organism,” how will you relate this to Charles Darwin’s “Natural Selection?”

3. How is Alfred Wallace’s “Theory of Geological Change” connected to the works of

Charles Darwin’s Origin of Species through Natural Selection?

Make a timeline that shows the ideas of the scientists about evolution.

75 DO_Q3_GENBIO2_MODULE1_LESSON8
 Natural selection was the process whereby organisms better adapted to their
environment tend to survive and produce more offspring. The theory of its action was
first fully expounded by Charles Darwin and is now believed to be the main process
that brings about evolution.

Connecting that idea of Charles Darwin, in the current situation of the

Philippines experiencing COVID – 19, would you agree that this pandemic serves as
the way how nature selects the next generation that will take the opportunity to take
over the niche of the old one?

A. Directions: Choose the correct answers from the box. Write your answer on
your answer sheet.

Great Chain of Being Extinction Natural Selection

4004 BC Theory of Use and Disuse Environment
Origin of Species Theory of Uniformitarianism Taxonomy

1. The book is written by Charles Darwin.

2. This theory emphasizes that the used characteristic will be passed on to the
offspring while the unused traits will disappear.
3. The book of Aristotle states, “life was arranged from the simplest to the most
complex” and believed that the “Earth was full and nothing new could be added.”
4. This catastrophic event leads to great transitions in life when new groups of
species got the opportunity to take over the niches of old ones.
5. This theory states that Earth’s features are the result of long-term processes that
continue to operate in the present as they did in the past.

B. Directions. Write the name of the scientist referred to by the statements.

1. He proposed the Theory of Geological Change.
2. The first scientist to explain the evolutionary process, (theory of use and disuse).
3. He developed a system of taxonomic classification and binomial nomenclature.
4. He introduced the concept of extinction and the theory of catastrophism.
5. The scientist who provided the first definition of the concept of species and genus.
6. Environment was recognized by this scientist as an agent of change.
7. He explained the relationship between food supply and population increase.
8. He sees the world as the result of God’s design.
9-10. They conceived the idea that all living things were related and changed over
time.

Make 5 sentences of insights about the lessons discussed.

76 DO_Q3_GENBIO2_MODULE1_LESSON8
DO_Q3_GENBIO2_MODULE1_LESSON8 77
What’s More
Answer May Vary
Assessment
A.
1. Natural Selection
2. Theory of Use and Disuse
3. Great Chain of Being
4. Extinction
5. Theory of Uniformitarianism
B.
1. Alfred Russel Wallace
2. John Baptiste Lamarck
3. Carolus Linnaeus
4. George Cuvier
5. John Ray
6. Comte de Buffon
7. Thomas Malthus
8. Archbishop James Ussher of
Ireland
9. Anaximander
10. Lucretius
Additional Activities
Answer May Vary
 https://extendedevolutionarysynthesis.com/resources/timeline-of-
evolutionary-theory/
 https://ucmp.berkeley.edu/history/evothought.html
 https://www.pewresearch.org/religion/2009/02/04/evolution-a-
timeline/
 https://www.oxfordbibliographies.com/view/document/obo-
9780199941728/obo-9780199941728-0021.xml

78 DO_Q3_GENBIO2_MODULE1_LESSON8
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 9: Evidence of
Evolution

79 DO_Q3_GENBIO2_MODULE1_LESSON8
 Evolution consists of changes in the heritable traits from generation to
generation of a population of organisms by processes of mutation, natural selection,
and genetic drift.

At the end of the lesson, learners are expected to:

 Explain evidence of evolution (e.g., biogeography, the fossil record,
DNA/protein sequences, homology, and embryology)
STEM_BIO11/12-IIIc-g-12
 Infer evolutionary relationships among organisms using the evidence
of evolution STEM_BIO11/12-IIIc-g-13

Directions: On your answer sheet, write the letter of the correct answer.

1. Which term describes the similar structures of an organism but perform

differently?
A. DNA
B. Fossils
C. Vestigial
D. Homologous
2. Which features are present in modern organisms that are no longer in
use?
A. DNA
B. Fossils
C. Vestigial
D. Homologous
3. What common proteins and amino acids do scientists use to determine
how species are closely related?
A. DNA
B. Fossils
C. Vestigial
D. Homologous
4. Which evidence shows changes in an environment over some time?
A. DNA
B. Fossils
C. Vestigial
D. Homologous
5. Which of the following is an example of vestigial structure?
A. fins of the shark
B. tailbone of a human
C. hind limbs of a house cat
D. wings of a red-tailed hawk

80 DO_Q3_GENBIO2_MODULE1_LESSON9
6. Some lizards have an adaptation that allows their tails to break off with minimal
damage to bones, nerves, blood vessels, and muscles. This type of lizard can then
regrow the missing portion of the tail. Which of the following statements best explains
why this adaptation is selected for lizard populations?
A. Lizards with this adaptation are better at climbing trees.
B. Lizards with this adaptation is more likely to escape from predators.
C. Lizards with this adaptation can use their tails as lures to attract more food.
D. Lizards with this adaptation can camouflage themselves more easily in
vegetation.
7. Penguins are powerful swimmers. Scientists have concluded that penguins evolved
adaptations for powerful swimming early in their evolutionary history. Which of the
following pieces of evidence did scientists most likely use to make this conclusion?
A. DNA sequences of different penguin species
B. Maps of the global distribution of penguin species
C. X-rays of the bone structure in modern penguins’ wings
D. Fossils showing the shape of ancient penguins’ wings and feathers
8. Sperm whales have vestigial hip bones, and a small percentage of sperm whales
also have vestigial hind limbs. Which of the following statements best explains the
presence of these vestigial structures in sperm whales?
A. Sperm whales evolved from ancestors that walked on land.
B. Sperm whales are in the process of evolving into land mammals.
C. These structures are acquired by each sperm whale during its lifetime.
D. These structures resulted from sperm whales having a long period of
embryonic development.
9. Which of the following is the best scientific evidence that mammals evolved from
reptiles?
A. Similarities in the diets of extinct reptiles and modern mammals
B. Similarities in the average lifespans of modern reptiles and modern mammals
C. Fossils of ancient reptiles and mammals that appear together in the same
layers of rock
D. Fossils that show gradual changes in skull shape from reptile-like organisms
to mammal-like organisms
10. The smooth-skinned, leaf-tailed gecko lives on Madagascar, an island off the
coast of Africa. The gecko hunts at night and sleeps on trees by day. The color and
pattern of the gecko’s body resemble leaves. Which of the following statements best
explains how the gecko’s unique body color and pattern evolved?
A. All the geckos needed to look like leaves to live in trees and therefore acquired
the necessary trait.
B. Individuals with bodies that looked the most like leaves interbred only with
other green or brown lizard species.
C. Gene sequences of all the geckos mutated to produce the leaf appearance when
ancestral geckos moved from mud to trees.
D. Individuals with bodies that looked the most like leaves were better able than
other individuals to avoid predators and passed on the trait.

81 DO_Q3_GENBIO2_MODULE1_LESSON9
11. Which of the following statements are true?
I. Analogous structures are structures found in different species that have
similar functions resulting from a common ancestor
II. Analogous structures are structures found in different species that have
similar functions resulting from natural selection
III. Homologous structures are structures found in different species that have
similar anatomical forms, resulting from a common ancestor
IV. Homologous structures are structures found in different species that have
similar anatomical forms, resulting from natural selection

A. I and IV B. II and III C. III only D. II only

12. Both octopuses and cuttlefish are mollusks that have a single-lens eye. Their
common ancestor also had a single-lens eye. What word describes the relationship
between the octopus’ eye and the cuttlefish eye?
A. Vestigial structures
B. Analogous structures
C. Convergent structures
D. Homologous structures
13. Which of the following statements most detracts from the claim that the human
appendix is a completely vestigial organ?
A. The appendix might have been larger in fossil hominids.
B. The appendix can be surgically removed with no immediate ill effects.
C. The appendix has a substantial amount of defensive lymphatic tissue.
D. Individuals with a larger-than-average appendix leave fewer offspring than
those with a below-average-sized appendix.
14. Which of the following pairs of structures is least likely to represent homology?
A. The wings of a bird and those of an insect
B. The wings of a bat and the arms of a human
C. The hemoglobin of a baboon and that of a gorilla
D. The mitochondria of a plant and those of an animal
15. How do fossils support evolution?
A. Organisms in the fossil record are identical to living organisms.
B. Individual species disappear and reappear in the fossil record over time.
C. The fossil record provides evidence that organisms have changed over time.
D. The fossil record provides evidence that all organisms developed at the same
time.

Lesson
Evidence of Evolution
9

The fundamental unifying idea of biology is evolution. Theodore Dobzhansky

once remarked, "Everything in biology makes sense only in the context of evolution
"But specifically what aspects of biology make more sense when viewed through the
perspective of evolution? What evidence or traces, to put it another way, demonstrate
that evolution has occurred in the past and is still occurring today?

82 DO_Q3_GENBIO2_MODULE1_LESSON9
Directions: Pick the word from the box to complete the diagram. Write the answer
on your answer sheet

Evolution is a key unifying principle in biology. Theodosius Dobzhansky

states that “Nothing in biology makes sense except in the light of evolution.”
Five Lines of Evidence in Evolution:

1. Biogeography. The global distribution of organisms and the unique features of

island species reflect the evolution and geological change. Wallace, one of the
founders of biogeography noticed that species in one region were often very different
from species in another, even though their climate and geography were the same.
The species of eastern Indonesia (and Papua New Guinea) are very different from
their counterparts in western Indonesia. The eastern species resemble those of the
Australian continent, while the western species are more Asian.

83 DO_Q3_GENBIO2_MODULE1_LESSON9
2. Fossil Record. Fossils document the existence of now-extinct past species that
are related at present. It allows dating for a timestamp that gives us the species
distribution looked like at certain periods in our planet’s history. This provides us
with some inkling of a mass extinction event. Example: The only line of dinosaurs
that survived was a small branch of the archosaurs, the ancestors that led to modern
birds.
3. Anatomy. Species may share similar physical features because the feature was
present in a common ancestor (homologous structures). In embryology, closely
related organisms may also have physical similarities before they are even born.
a. Homologous structures are similar in related organisms because
they were inherited from a common ancestor.
b. Analogous structures are similar in unrelated organisms. The
similarities evolved to do the same job, not because they were inherited from a
common ancestor.
c. Vestigial structures' evolution has reduced their size because the
structures are no longer used.
4. Molecular Biology. Deoxyribonucleic acid (DNA) comparisons of features such as
transcription and translation can show the relationship among related species.
5. Direct Observation. A small-scale evolution of organisms with short life cycles.

Directions: Complete the table with the data from the box. Do it on a separate paper.

Global distribution of organisms DNA comparison

Remnants of prehistoric species Small-scale evolution
Similarities in structures and functions

Evidence of What Does it Mean?

Evolution
Biogeography
Fossil Record
Comparative Anatomy
(Embryology, Analogous,
Homologous, Vestigial)
Molecular Biology
Direct Observation

84 DO_Q3_GENBIO2_MODULE1_LESSON9
Directions: Underline the word to complete the statement.
1. Fossils are most found in (metamorphic, sedimentary) rocks.
2. Fossils are formed by the (man-made, natural) process.
3. The oldest fossils are found in the (topmost, deepest) layers of rocks.
4. (Homologous, Analogous) structures serve the same function but are structurally
different.
5. The (greater, lesser) the similarity of the genetic makeup among organisms, the
more closely related they are.

Create a mnemonic device to express five pieces of evidence of evolution.

Directions. Write the letter of the correct answer.

1. Why do fossils provide evidence for evolution?
A. They are millions of years old.
B. They exist in all types of rocks.
C. They supply good samples of RNA.
D. They show patterns of biological change.
2. Some lizards have an adaptation that allows their tails to break off with minimal
damage to bones, nerves, blood vessels, and muscles. This type of lizard can then
regrow the missing portion of the tail. Which of the following statements best explains
why this adaptation is selected for lizard populations?
A. Lizards with this adaptation are better at climbing trees.
B. Lizards with this adaptation is more likely to escape from predators.
C. Lizards with this adaptation can use their tails as lures to attract more food.
D. Lizards with this adaptation can camouflage themselves more easily in
vegetation.
3. Penguins are powerful swimmers. Scientists have concluded that penguins evolved
adaptations for powerful swimming early in their evolutionary history. Which of the
following pieces of evidence did scientists most likely use to make this conclusion?
A. DNA sequences of different penguin species
B. Maps of the global distribution of penguin species
C. X-rays of the bone structure in modern penguins’ wings
D. Fossils showing the shape of ancient penguins’ wings and feathers

85 DO_Q3_GENBIO2_MODULE1_LESSON9
4. Sperm whales have vestigial hip bones, and a small percentage of sperm whales
also have vestigial hind limbs. Which of the following statements best explains the
presence of these vestigial structures in sperm whales?
A. Sperm whales evolved from ancestors that walked on land.
B. Sperm whales are in the process of evolving into land mammals.
C. These structures are acquired by each sperm whale during its lifetime.
D. These structures resulted from sperm whales having a long period of
embryonic development.
5. Which of the following is the best scientific evidence that mammals evolved from
reptiles?
A. Similarities in the diets of extinct reptiles and modern mammals
B. Similarities in the average lifespans of modern reptiles and modern mammals
C. Fossils of ancient reptiles and mammals that appear together in the same
layers of rock
D. Fossils that show gradual changes in skull shape from reptile-like organisms
to mammal-like organisms
6. The smooth-skinned, leaf-tailed gecko lives on Madagascar, an island off the coast
of Africa. The gecko hunts at night and sleeps on trees by day. The color and pattern
of the gecko’s body resemble leaves. Which of the following statements best explains
how the gecko’s unique body color and pattern evolved?
A. All the geckos needed to look like leaves to live in trees and therefore acquired
the necessary trait.
B. Individuals with bodies that looked the most like leaves interbred only with
other green or brown lizard species.
C. Gene sequences of all the geckos mutated to produce the leaf appearance when
ancestral geckos moved from mud to trees.
D. Individuals with bodies that looked the most like leaves were better able than
other individuals to avoid predators and passed on the trait.
7. Which of the following statements are true?
I. Analogous structures are structures found in different species that have
similar functions resulting from a common ancestor
II. Analogous structures are structures found in different species that have
similar functions resulting from natural selection
III. Homologous structures are structures found in different species that have
similar anatomical forms, resulting from a common ancestor
IV. Homologous structures are structures found in different species that have
similar anatomical forms, resulting from natural selection
A. I and IV
B. II and III
C. III only
D. II only
8. Both octopuses and cuttlefish are mollusks that have a single-lens eye. Their
common ancestor also had a single-lens eye. What word describes the relationship
between the octopus eye and the cuttlefish eye?
A. Vestigial structures
B. Analogous structures
C. Convergent structures
D. Homologous structures
9. Which of the following statements most detracts from the claim that the human
appendix is a completely vestigial organ?
A. The appendix might have been larger in fossil hominids.
B. The appendix can be surgically removed with no immediate ill effects.
C. The appendix has a substantial amount of defensive lymphatic tissue.

86 DO_Q3_GENBIO2_MODULE1_LESSON9
 D. Individuals with a larger-than-average appendix leave fewer offspring than
those with a below-average-sized appendix.
10. Which of the following pairs of structures is least likely to represent homology?
A. The wings of a bird and those of an insect
B. The wings of a bat and the arms of a human
C. The hemoglobin of a baboon and that of a gorilla
D. The mitochondria of a plant and those of an animal
11. How do fossils support evolution?
A. Organisms in the fossil record are identical to living organisms.
B. Individual species disappear and reappear in the fossil record over time.
C. The fossil record provides evidence that organisms have changed over time.
D. The fossil record provides evidence that all organisms developed at the same
time.
12. Which of the following would best determine whether two plant species share a
recent common ancestor?
A. Stem lengths
B. DNA sequences
C. Flowering times
D. Habitat distribution
13. Where can most fossils be found?
A. Black soil
B. Lava flows
C. Granite rock
D. Sedimentary rock
14. Which of the following is the strongest evidence of evolution from a common
ancestor?
A. similar fossils.
B. similar DNA sequences.
C. similar body structures.
D. similar embryological structures.
15. Which of the following is an example of vestigial structure?
A. fins of the shark
B. tailbone of a human
C. hind limbs of a house cat
D. wings of a red-tailed hawk

Search the internet to learn about the evidence suggesting that birds and dinosaurs
are closely related. If scientists could extract DNA from dinosaurs' fossils, how could
they use the sequences to learn more about the origin of birds?

87 DO_Q3_GENBIO2_MODULE1_LESSON9
DO_Q3_GENBIO2_MODULE1_LESSON9 88
What I Know
1. D 4. B 7. D 10. D 13. B
2. C 5. B 8. A 11. B 14. B
3. A 6. B 9. C 12. D 15. C
Assessment
1. D 4. A 7. B 10. B 13. D
2. B 5. C 8. D 11. C 14. B
3. D 6. D 9. B 12. D 15. B
“Evidence for Evolution (Practice).” Khan Academy. Khan Academy. Accessed September
27, 2022. https://www.khanacademy.org/science/biology/her/evolution-and-natural-
selection/e/evidence-for-evolution.

“Evolution Quiz - Wordpress for Faculty & Staff.” Accessed September 27, 2022.
https://wordpress.clarku.edu/mat15-hasullivan/files/2015/01/Evolution-Quiz-IEP.pdf.

“Evidence of Evolution - Znnhs.zdnorte.net.” Accessed September 27, 2022.

https://znnhs.zdnorte.net/wp-content/uploads/2022/03/Science-10_Module-5_version-
3.pdf.

“Identify Evidence for Evolution - High School Biology.” Private Tutoring. Accessed
September 27, 2022. https://www.varsitytutors.com/high_school_biology-help/identify-
evidence-for-evolution.

“Science - DepEd Tambayan.” Accessed September 27, 2022. https://depedtambayan.net/wp-

content/uploads/2022/01/SCI10-Q3-MODULE6.pdf.

“Science Evolution and Natural Selection Evidence for Evolution.” Accessed September 27,
2022. https://www.uc.edu/content/dam/refresh/cont-ed-62/olli/s21/kahn-evidence-of-
evolution.pdf.

89 DO_Q3_GENBIO2_MODULE1_LESSON9
 SENIOR HIGH SCHOOL

General Biology 2
Quarter 3 – Module 1
Lesson 10: Principles of
Classification of Living
Things

90 DO_Q3_GENBIO2_MODULE1_LESSON9
 Hierarchical classification is a system of grouping things according to a
hierarchy or levels and orders. It includes different hierarchical levels and among
these are the domain and kingdom.
After this lesson, the learners are expected to:
 Discuss the domain and kingdom scheme of classification of living
organisms.
 Explain how the dichotomous key is important in classifying
organisms.
 Identify organisms using the dichotomous key.
(STEM_BIO11/12IIIhj-15)

Directions: Write the letter of the correct answer.

1. Which of the following is classified as a prokaryote?

A. algae
B. fungi
C. bacteria
D. animal cells
2. Which of the following is the correct abbreviated scientific name for Escherichia
coli?
A. E. coli
B. e. coli
C. es. coli
D. Es. coli
3. A student examines insects’ body structures. Which tool will help him identify
each insect?
A. taxonomy levels
B. dichotomous key
C. classification studies
D. binomial nomenclature
4. Which makes up a scientific name of an organism?
A. family and order
B. phylum and class
C. genus and species
D. domain and kingdom
5. Why do you use the dichotomous key?
A. to identify organisms
B. to conduct experiments
C. to predict the outcomes of the offspring
D. to determine how the organisms reproduce

91 DO_Q3_GENBIO2_MODULE1_LESSON10
6. Which of the following refers to the science of naming and grouping organisms?
A. genetics
B. taxonomy
C. speciation
D. linnaeanology
7. Which of the following is used to group organisms based on modern systematics?
A. size
B. ecological niche
C. physical appearance
D. evolutionary relationships
8. Which of the following is true about unrooted phylogenetic trees?
A. Has a single lineage at the base.
B. They show the ancestry relationship.
C. They show relationships among organisms.
D. They show relationships but not lineage between species.
9. Which of the following pairs is least related?
A. dogs and cats
B. insects and birds
C. monarch and butterfly
D. human and chimpanzee
10. Which of the following refers to the two-name classification system used to
organize living things?
A. phylogeny
B. systematic
C. Biodiversity
D. binomial nomenclature
11. Which of the following is NOT part of a taxonomist role?
A. Assigning a scientific name.
B. Classifying ornamental plants.
C. Identifying an unknown flowering plant.
D. Explaining the relatedness of plants in different locations.
12. Which level of classification within a lineage has the largest number of shared
derived characters?
A. Class
B. Family
C. Domain
D. Kingdom
13. What is defined as the study of the diversification of living forms, both past and
present, and the relationships among living things through time?
A. Phonetics
B. taxonomy
C. systemics
D. systematics
14. What are the main levels of taxa in order?
A. domain, kingdom, phylum, class, order, family, genus
B. kingdom, phylum, class, order, family, genus, species
C. domain, kingdom, phylum, class, order, genus, family, species
D. domain, kingdom, phylum, class, order, family, genus, species
15. Which of the following anatomical tree part is most analogous to two species with
a common ancestor?
A. the trunk
B. a node where two twigs diverge
C. a twig that branches with time
D. a single twig that gets longer with time

92 DO_Q3_GENBIO2_MODULE1_LESSON10
 Lesson Principles of Classification of Living
10 Things

Taxonomy is a multi-level system of organisms, in which each group is nested,

or contained, within a larger group. Groups at the highest level are the largest and
most general and contain a wide variety of living things. These groups are divided
into smaller groups of similar organisms with even more similar features.

A. Directions: Answer the questions based on the given table of information.

Write your answer on a separate paper.

DOMAIN Bacteri Archae Eukarya

a a
KINGDOM Eubacte Archaeb Protist Fungi Plantae Animalia
ria ac a
teria
CELL Prokaryot Prokaryo Eukary Eukaryot Eukaryote Eukaryote
TYPE e te ot e
e
Cell Cell walls Cell walls No cell
walls of chitin; of walls or
CELL Cell walls Cell of no cellulose; chloroplast
STRUCTUR with walls cellulo chloropla chloroplas s
ES peptidogl without se in st ts
ycan an peptidogl some;
ycan some
have
chloro
plasts
sts
Most Most
unicell multicell
NUMBER ul ar; ular
OF CELLS Unicellul Unicell some ; some Multicell Multicell
ar ular colonial unicellul ular ular
; some ar
multice
ll
ular

93 DO_Q3_GENBIO2_MODULE1_LESSON10
MODE OF Autotrop Autotro Autotr Heterotro
NUTRITION h or ph or oph h ph Autotrop Heterotr
heterotr heterotr or h oph
oph oph h heterot
roph
ph
Amoe Mushroo Mosses, Sponges,
Streptoco ba, ms, ferns, worms,
Param
EXAMPLES cc us, Methano ecium, yeasts flowering insects,
Escheric ge ns, slime plants fishes,
hia coli halophil molds mammals
es , giant
kelp

1. What is the main difference between the Bacteria and Archaea domains?
2. If an organism is a multicellular autotroph and has a cell wall, which kingdom
does it belong to?
3. You learned that a unicellular organism has chloroplasts and a nucleus, which
kingdom does it belong to?
B. Directions: Study the dichotomous key and answer the given questions. Write
your answer on your answer sheet.

Guide Questions:
1. What is the primary characteristic of all organisms from the dichotomous key?
2. Is the dichotomous key helpful to you?

94 DO_Q3_GENBIO2_MODULE1_LESSON10
A. Domain and Kingdom Scheme of Classification of Living Things

Classification is the systematic grouping of organisms based on structural,

functional similarities, or evolutionary history. The science of classifying living things
is called taxonomy. Scientists classify living things to organize and make sense of the
incredible diversity of life. Modern scientists base their classifications of organisms
on similar related molecular proteins and DNA.

Carl Linnaeus
Carl Linnaeus was, a Swedish botanist known as the “Father of Taxonomy”.
He was the first to frame principles for defining natural genera and species of
organisms and create a uniform system for naming, known as binomial
nomenclature. Species are given a unique two-word name written in Latin, which
includes the genus (capitalized and italics) and species name. For example, humans
(Homo sapiens) and dogs (Canis familiaris).

In the Linnaean classification system or Linnaean hierarchy, all organisms are

placed in rank. A taxon is a group, of one or more organisms of equal rank within
the hierarchical and phylogenetic organization. The current groupings from largest

95 DO_Q3_GENBIO2_MODULE1_LESSON10
to smallest are kingdom, phylum, class, order, family, genus, and species. The higher
you go, the less similar organisms in the group may appear. However, as you move
downward, the organisms become more and more similar.
The three-domain (Carl Woese) system biological classification of life
(colon)
•Archaea
•Bacteria
•Eukaryote

Robert Whittaker’s five kingdom classification and criteria

•Monera
•Protista
•Fungi
•Plantae
•Animalia
Main criteria: (1) cell structure (2) body organization (3) mode of nutrition
(4) reproduction (5) phylogenetic relationships.
Archaebacteria are in a separate division within the kingdom Monera,
recognized as a 6th kingdom. The DNA and RNA comparisons indicate that they
should not even be classified with bacteria. Systematists have devised a classification
level higher than a kingdom, called a domain to accommodate it. These remarkable
organisms are now placed in the domain Archaea. While prokaryotes, including
eubacteria and cyanobacteria, are placed in the domain of Bacteria. On the other
hand, all the kingdoms of Eukaryotes, such as Protista, Fungi, Plantae, and
Animalia, were placed in the domain of Eukarya.
B. Dichotomous Key

A tool that allows the user to determine the identity of items in the natural
world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Dichotomous
means ‘divided into two parts, as each question about an organism has two choices,
through a process of answering yes or no questions.
Importance of dichotomous key
1. Identifying and categorizing organisms
2. Helping students easily understand harder scientific concepts
3. Organizing large amounts of information to make the identification of an
organism much easier.

A major role of classification:

1. To have techniques in place to identify and classify the organism.

2. To create a dichotomous key, both qualitative (i.e. physical attributes such

as how the organism looks, what color it is, etc.) and quantitative (i.e. the
number of legs, weight, height, etc.) factors are considered.
3. Done in both a graphical (as a branching flowchart) or written format (series
of paired statements organized sequentially) based on a set of observable
characteristics.

96 DO_Q3_GENBIO2_MODULE1_LESSON10
Examples:

A.

B.

A. Direction: Give the characteristics of the following domains.

97 DO_Q3_GENBIO2_MODULE1_LESSON10
B. Direction: Identify the organisms from the given dichotomous key.
While I was watering the plants in my garden, I saw insects that
caught my attention. Try to decode the organisms that I saw.
1. Do they have wings?
a. wings covered by an exoskeleton ........... go to step 2
b. wings not covered by an exoskeleton ... go to step 3
2. What does their body look like?
a. the body has a round shape ................ ladybug
b. body has an elongated shape ...............grasshopper
3. Their wings differ from one another.
a. wings point out from the side of the body dragonfly
b. wings point to the posterior of the body …… housefly

Directions. Answer the question.

Why do we have to classify organisms?

A. Direction: Choose the terms from the box to complete that flowchart. Write your
answer on a separate paper.

Eubacteria Plantae Fungi

Archae Animalia Archaea

Protista Bacteria Eucarya

98 DO_Q3_GENBIO2_MODULE1_LESSON10
A. Directions. Using the dichotomous key, answer items 1-5.

99 DO_Q3_GENBIO2_MODULE1_LESSON10
1. A candy is chewy and wrapped in a transparent. What is the name of this
dichotomous candy?
A. Ursa gummius
B. Saltus taffinia
C. Chocolates cyssas
D. Caramellus stickies
2. According to dichotomous key, which is NOT a characteristic of Mandibulus
cracks?
A. Candy is hard
B. Candy is silver
C. Candy is spherical
D. Candy is unwrapped
3. Which kind of candy is unwrapped?
A. Ursa gummius
B. Saltus taffinia
C. Chocolatus cyssas
D. Caramellus stickimus
4. Which of the following is the characteristic of Steorra explodius?
A. It is hard and wrapped in silver.
B. Chewy and wrapped in all white.
C. It is cylindrical with a clear wrapper.
D. It is cylindrical with the varied color of the unclear wrapper.
5. What candy is hard, non-spherical, and wrapped in a yellow transparent wrapper
without a label?
A. Mintus stripus
C. Moronus moronus
B. Caramellus stickimus
D. Rannunculus schotchus

B. Direction. Write the letter of the correct answer.

1. Which of the following refers to the two-name classification system used to

organize living things?
A. phylogeny
B. systematic
C. Biodiversity
D. binomial nomenclature
2. Which of the following is NOT part of a taxonomist role?
A. Assigning a scientific name.
B. Classifying ornamental plants.
C. Identifying an unknown flowering plant.
D. Explaining the relatedness of plants in different locations.
3. Which level of classification within a lineage has the largest number of shared
derived characters?
A. Class
B. Family
C. Domain
D. Kingdom
4. What is defined as the study of the diversification of living forms, both past and
present, and the relationships among living things through time?
A. Phonetics
B. taxonomy
C. systemics
D. systematics

100 DO_Q3_GENBIO2_MODULE1_LESSON10
5. What are the main levels of taxa in order?
A. domain, kingdom, phylum, class, order, family, genus
B. kingdom, phylum, class, order, family, genus, species
C. domain, kingdom, phylum, class, order, genus, family, species
D. domain, kingdom, phylum, class, order, family, genus, species
6. Which of the following anatomical tree part is most analogous to two species with
a common ancestor?
A. the trunk
B. a node where two twigs diverge
C. a twig that branches with time
D. a single twig that gets longer with time
7. Which of the following refers to the science of naming and grouping organisms?
A. genetics
B. taxonomy
C. speciation
D. linnaeanology
8. Which of the following is used to group organisms based on modern systematics?
A. size
B. ecological niche
C. physical appearance
D. evolutionary relationships
9. Which of the following is true about unrooted phylogenetic trees?
A. Has a single lineage at the base.
B. They show the ancestry relationship.
C. They show relationships among organisms.
D. They show relationships but not lineage between species.
10. Which of the following pairs is least related?
A. dogs and cats
B. insects and birds
C. monarch and butterfly
D. human and chimpanzee

Direction. At this point, create a cladogram of five indoor plants. (It would be nice if
you can collect all of them, propagate, plant them in pots and place them
in your home you may sell for extra cash).

101 DO_Q3_GENBIO2_MODULE1_LESSON10
102 DO_Q3_GENBIO2_MODULE1_LESSON10
DO_Q3_GENBIO2_MODULE1_LESSON10 103
Assessment What’s New
A. Answer may Vary
1. B
2. D What’s More
3. A A. Answer may Vary
4. D B.
5. D 1. ladybug
B. 2. grasshopper
1. D 3. housefly
2. A 4. dragonfly
3. B What I Can Do
4. D 1. Eubacteria 6. Animalia
5. C 2.Archaebacteria 7. Bacteria
6. B 3. Protista 8. Archaea
7. B 4. Plantae 9. Eucarya
8. D 5. Fungi
9. D
10. A What I Have Learned
Answers may Vary
Additional Activities
Answers may Vary
“Biology - Classification of Organisms.” Tutorials Point. Accessed September 27,
2022.
https://www.tutorialspoint.com/biology_part2/biology_classification_of_organisms
.htm.

Bailey, Regina. “What Is the Three Domain System?” ThoughtCo. ThoughtCo,

November 28, 2019. https://www.thoughtco.com/three-domain-system-373413.

Vix. “Taxonomy - Definition, Examples, Classification - Biology Online Dictionary.”

Biology Articles, Tutorials & Dictionary Online, July 26, 2021.
https://www.biologyonline.com/dictionary/taxonomy.

104 DO_Q3_GENBIO2_MODULE1_LESSON10
For inquiries or feedback, please write or call:

Department of Education – SDO Valenzuela

Office Address: Pio Valenzuela Street, Marulas, Valenzuela City

Telefax: (02) 8292-4340

Email Address: [email protected]

105 DO_Q3_GENBIO2_MODULE1_LESSON10