Malak Elsawy ID:190600627
FINAL
1. Which of the following helical sequences can be the sequence of the
underlined helix in five paralel helices. O O O
OO
A) AVDQAVDQ B) ADLNAEVN C) VVVDVVVE D) DDDADDDA E) none of
the others
2. Which of the following helical sequences can be the sequence of the last
helix in three paralel helices. O O O
O
A) ADDVLDSV B) ADLNAEVN C) VVVDVVVE D) DDDADDDA E) none of
the others
If you cut the 5,000 long genome using 5 4mer , 2 6mer recognizing
restriction enzymes ( use this info for Questions 3 and 4)
3. What will be the average lengths of the fragments( round it to the closest
integer) ?
A) 98 B) 101 C) 283 D) 50 E) 112
4. How many fragments will you get?
A) 133 B) 1980 C) 101 D) 702 E) none of the others
5. In the given sequence, aacgcgaattctagtccccaaacccactcgaattcctttaaaaagggc
has two sites for restriction enzyme X which recognizes palindromic
sequences and cuts after the first nucleotide of the motif. What are the
lengths of the fragments one would get when they cut the given sequence
with enzyme X?
A) 8,12,27 B) 14,15,18 C) 6,19,22 D) 6,18,24 E) none of the others
For the alignment questions use match= 5 mismatch=-3 and gap= -4
6. How many best local alignments one would get when you align the given
two sequences cacacacaca and cccaaa. (uff )
A) 4 B) 8 C) 1 D) 2 E) none of the others
7. What would be the local alignment score of the alignment in Question 6?
A) 14 B) 7 C) 11 D) 10 E) none of the others
8. How many best global alignments are there between the given
sequences in question 6 ( Q6). (uff)
A) None of the others B) 1 C) 2 D) 3 E) 6
9. If there are two best semi global alignments between the given
sequences which of the given values could be the match, mismatch and
gap scores in the given order? ACAGGCT and CGGTAA (ufffffffffffff)
A) 4,-2,-3 B) 4,-1,-5 C) 4,-3,-4 D) 4,-2,-4 E) none of the others
For questions 10 through 13, use the given multiple alignment and the
Blossum ? matrix obtained from protein sequences obtained in Planet GS
Z X B J
XBZJB Z 25 -15 -24 -27
XZBJB X 10 1 3
XBXXB B 16 5
XZZJB J 19
XBBJB
10. What is X in Blossum X ?
A) 20 B) 60 C) 40 D) 80 E) None of the others
There are 2 charged, 1 polar and 1 hydrophobic amino acids in GS
11. Which amino acid in Planet GS is hydrophobic?
A) X B) B C) Z D) cannot be determined by the given information E) J
12. Which amino acids in Planet GS is polar?
A)X B) B C) Z D) cannot be determined by the given information E) J
13. Which amino acid is the most mutable amino acid of Planet GS?
A)J B) B C) Z D) cannot be determined by the given information E) X
C1 C2 C3 C4 C5 Use the given character trait matrix for Q14-15
A 0 1 0 1 0
B 1 0 1 0 0
C 0 0 0 1 1
D 0 1 0 0 0
E 1 0 0 0 0
14.Which 0 to 1 conversion is needed to have perfect pyhlogeny and perfect
speciation
A) C-C2 B) C-C3 C) D-C4 D) D-C3 E) Both A and C
15. If A-C4 is changed to 0 in the given matrix which of the following is true?
A) There is no perfect phylogeny B) There is perfect phylogeny C) There is
no perfect speciation D) There is perfect speciation E) Both A and C
16. For the given distances AB=8, AC=2, AD=3,BC=4, BD=5, CD=5 what kind
of topology max min and average method for hiererchical clustering
results in
A) All the same B) max min same C) max average same D) min
average same E) none of the others (ufff)
17.In a character state matrics of species A to E and character traits C1-C5
given A-C1=1, B-C3=1, B-C4=1,B-C5=1, ,C-C3=1, C-C5=1, D-C5=1,E-C1=1,E-
C2=1 all the other values on the matrix are 0. In the phylogenetic tree
most distinct species belonging to two seperate branches are?
A) C and E B) A and E C) B and C D) B and E E) B and D
21. If a gene synthesizing the given protein Met Ala Ser Leu Val Cys starts
producing a truncated protein after a single point mutation which of the
following can be the sequence of the truncated protein?
A) Met Ala Ser B) Met C) Met Ala D) both A and C E) none of the others
22. If a gene synthesing protein Met Val Arg Val Val starts producing
protein Met Val after a single point mutation which of the given codon
maybe the most likely codon for Arginine?
A) CGA B) CGG C) AGA D) AGG E) Both A and C
23. What is the probability that GLY can turn into a stop codon after a single
point mutation?
A) 1/9 B) 8/54 C ) 1/27 D) 1/18 E) 1/36
24. What is the probability of a deadly single point mutation for Leu?
Deadly mutation is Polar or charge to Hydrophobic or vice versa.
A) 3/9 B) none of the others C) 2/9 D) 13/54 E ) 15/54
25. tataataccctcacctgcccatgtttaaaccctcgatctaac given gene sequence
producing a protein of length 6 starts producing a shorter protein after a
single point deletion. What is the most likely position that the deletion
occured?uff
A) C at 9th B) C at 10th C) C at 34th D) C at 14th E) none of the others
26. Given the seed list KS=KS,KA , SA=SA ,AA=…which one is the most
conserved amino acid? ufff
A)K B) S C) A D ) cannot be determined E) There is conflicting info
27. For the same question in Q26 which one is the least conserved aminoacid
A) K B) S C) A D ) cannot be determined E) There is conflicting info
Use the given Query word (TSKAA) and the similarity scores for BLAST
Questions from 28-30. Similarity scores: TT=13, TS= y, SS=9 ,SA=1 ,AA=7,
AK=2, KK= x ,SK=-6. All the other similarity scores are negative.
Threshold=15, per letter threshold=6 for k=2
28. What is the minimum integer score for TS similarity score y such that TT
makes it to the seed list but SS does not make it to the seed list ?uff
A) 5 B) 8 C) 4 D) 10 E) none of the others
29. What is the maximum integer score for KK similarity score x such that SK
makes it to the seed list but KA does not make it to the seed list ?uff
B) 5 B) 7 C) 4 D) 10 E) none of the others
30. If KK score is 6 and TS similarity score=3 What would the BLAST search
give from the given database sequence TSSSSSTTKKKK?ufff
A) TS B) TSSS C) TKKK D) TKK E) none of the others
31. What is the maximum score of the matching sequence?
A) 30 B) 22 C) 24 D) 19 E) None of the others
32. For the given seed list KK=KK, KA=KA, AZ= AZ ,AK Similarity scores are
given as KK=5 , AA=7 , ZZ=10 What should be the lowest value for Ks
similarity to A to get the given seed list? Ufff
A) 1 B) 2 C) -1 D) There is conflicting info E) 3
33. For the given query sequence aaccgggcgttgtta and the database
sequence tttaccgggagttgagtgaac for FASTA search of k=3 at what
differential index the maximum match is?
A) 2 B) 1 C) -2 D) 0 E) None of the others
34. In Question 33 How many letters are matching between the query and
the database?
A) 8 B) 10 C) 7 D) 6 E) None of the others
35. For the given partial digest problem 2,3,4,5,6,7,8,9,11,13,15,17,18,20,24
the gene you are interested in has enzyme A motif occurs twice and the
distance between them is 3. Then potential location of this gene ?
A) 6-9 B) 5-8 C) 7-10 D) 15-18 E) Both A and D
36. For the given partial digest problems which one has a unique
solution?UFFFFFFFF
A) A:2,3,5,6 B:3,6,7 A+B:1,2,3,3,3,4 B) A:3,5,8 B:1,2,3,3,7 A+B:1,2,3,3,7
C) A:2,4,5,6 B:1,3,4,9 A+B: 1,1,2,3,4,6 D) A:5,6,8 B:3,4,5,7 A+B:
1,3,4,5,6 E) None of the others
37. How many contig solution do you get from the given fragments for t=4
and e=0.2?atcccg,ctcgg,ccggt,tagct,agatt ( ufff)
A)1 B) 2 C) 3 D) 4 E) 5
38. For the given fragments acagctt,cgtctta and the missing fragment yields
the consensus sequence acggcttag for t=5 and e=0.2 what can be the
sequence of the missing fragment?ufffffff
A) atacttag B) ggcatag C) aaaaaacg D) gggttag E) both B and D
Ugurase Cimbomase
1 2 3 4 1 2 3 4
B -4 15 -13 -1 B 18 -3 0 -13
Z 17 -14 22 3 Z -20 2 -3 16
X -15 6 -18 -5 X 7 0 4 -15
Mean= 20 s.d=16 Mean= 5 s.d=14
Use the given profile matrices for Q39-45.
In normal distribution 68% of the values lie within 1 s.d of the mean
And 95% of the values lie within 2 s.d of the mean
39. If there is one hydrophobic, one polar and one charged aminoacid which
one is the polar amino acid
A) Z B) X C) B D) cannot be determined E) there is conflicting info
40. Which one the given motif(s) ensures at least 97.5% cimbomase activity
A)BBXZ B) BXZB C) BZZZ D) XBXZ E) Both A and C
41. Which sequence of length 6 would most likely to show 97.5% ugurase
activity and cimbomase activity ( Uffff)
A)ZBZBXX B)XXZBZZ C) XZBZZZ D) ZBZBZX E) Both C and D
42. Which one of the given sequences show either enzymatic activity at 50%
confidence?( ufffff)
A) XXXXXX B) XBXBXB C) XBZZZZ D) ZZZZZZ E) none of the others
43. Lack of ugurase activity ( No activity) causes bioinfobetes disease. Given
their ugurase sequences which one of the given individuals is
bioinfobetes patient.
A) BBBBBB B) XBBZBX C) ZXXXXX D) XZZZZX E) Both A and C uffffff
44. What are the most likely aligned aminocids at the 2nd position of the
multiple alignment of cimbomase ?
A) BBBXX B) ZZZXX c) ZXXXX D) ZZZZX E) none of the others
For questions 45-48 use the given multiple alignment of lyase and
scores.UFFFFFF
1 2 3 score for Z at position 2 of the profile is -1
X B Z BB similarity score=10 XX similarity score=8
X B X Score for B at position 2 of the profile is 2
X X Z score for Z at position 1 of the profile is 2
X Z X Score for X at position 2 of the profile is 0
45. What is the similarity score of X to B.
A) -4 B) 0 C) -3 D) -5 E) None of the others
46. What is the similarity score of Z to Z?
A) 6 B) 8 C) 5 D) 10 E) None of the others
47. What is the score for B at position 3?
A) -6 B) -8 C)-3 D) 0 E) none of the others
48. What is the score for X at position 3?
A) -6 B) 5 C)2 D) 0 E) none of the others
49. If the 1st position of the multiple alignment of a profile is zzxx if score for
x at position 1 is 3 and score for Z at position 1 is 2.Then which of the
following can be true? XX similarity score of X to X , ZZ is the similarity
score of Z to Z
A) XX-ZZ=3 B) XX-ZZ= 5 C) ZZ-XX= 4 D) XX-ZZ=2 E) none of the
others
