0% found this document useful (0 votes)
18 views5 pages

Daily Questions 01-B 1742699563

Uploaded by

Nikhil V
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
18 views5 pages

Daily Questions 01-B 1742699563

Uploaded by

Nikhil V
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Date : 23/03/2025 Nikhil Sir's Biology Chapter : 5

Time : 1 hours Std 12 : Biology Total Marks : 24

Daily Questions 01-B

Section A
Write the answer of the following questions : (Each carries 1 Mark) [4]

1. If the length of E.coli DNA is 1.36 mm, can you calculate the number of base pairs in E.coil?
2. What is cistron ?
3. Name any three viruses which have RNA as the genetic material.
4. Give the function of DNA Polymerase I, II & III during replication.

Section B

ir
lS
Write the answer of the following questions : (Each carries 2 Marks) [12]

5. If the sequence of one strand of DNA is written as follows :


5’–ATGCATGCATGCATGCATGCATGCATG C–3’ hi
Write down the sequence of complementary strand in 5’ → 3’ direction
ik
6. If the sequence of the coding strand in a transcription unit is written as follows:
5’-ATGCATGCATGCATGCATGCATGCATGC-3’
-N

Write down the sequence of mRNA.


7. What is Central Dogma
y

Why both the strands are not copied during transcription.


og

8.

9. Dfferentiale between. Template strand and Coding strand


ol

10. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Bi

Section C
Write the answer of the following questions : (Each carries 4 Marks) [8]

11. Write a short note on transcription unit.


12. Explain different types of RNA along with process of transcription.

Page No.: 1
Date : 23/03/2025 Nikhil Sir's Biology Chapter : 5
Time : 1 hours Std 12 : Biology Total Marks : 24

Answer Key

Section A
Write the answer of the following questions : (Each carries 1 Mark) [4]

1. If the length of E.coli DNA is 1.36 mm, can you calculate the number of base pairs in E.coil?
 1.36 × 10–3 / 0.34 × 10–9 = 4 × 106 bp
2. What is cistron ?
 Cistron is the alternative term for gene. It is the DNA segment that codes for a polypeptide during protein synthesis.
 A DNA segment with one cistron is called monocistronic, whereas, a DNA segment with more than one cistron is called
polycistronic.
3. Name any three viruses which have RNA as the genetic material.
 (i) TMV (Tobacco Mosaic virus)
(ii) HIV (Human Immuno Deficiency virus)
(iii) QB bacteriophage
4. Give the function of DNA Polymerase I, II & III during replication.

→ It has a role in recombination and repair.
DNA → It removes the RNA primer from lagging strand by 5' → 3' exonuclease
Polymerase I activity and also fills the gap.
→ Also called as korenberg enzyme.

DNA → Its main role is in repair and also a backup of DNA polymerase III.
Polymerase II → It has 3’ → 5’ exonuclease activity.

→ Main enzyme of DNA replication.


DNA → The main function of the third polymerase. Pol III, is duplication of the
Polymerase III chromosomal DNA, while other DNA polymerases are invoived mostly in
DNA repair and translesion DNA synthesis.

Section B
Write the answer of the following questions : (Each carries 2 Marks) [12]

5. If the sequence of one strand of DNA is written as follows :


5’–ATGCATGCATGCATGCATGCATGCATG C–3’
Write down the sequence of complementary strand in 5’ → 3’ direction
 Ans: If the sequence of one strand of DNA is written as follows:
 5’ - ATGCATGCATGCATGCATGCATGCATGC - 3’
 The sequence of the complementary strand in 5’ -> 3’ direction will be :
 5’ - GCATGCATGCATGCATGCATGCATGCAT - 3’
Page No.: 1
6. If the sequence of the coding strand in a transcription unit is written as follows:
5’-ATGCATGCATGCATGCATGCATGCATGC-3’
Write down the sequence of mRNA.
 In the transcription unit the coding strand does not code for anything therefore the sequence remains the same, only the thymine
get replaced by uracil.
 If the given sequence is :
5’-ATGCATGCATGCATGCATGCATGCATGC-3’
 Then the sequence of mRNA form will be :
5’-AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
7. What is Central Dogma
 The proposition of a double helix structure for DNA and its simplicity in explaining the genetic implication became
revolutionary.
 Very soon, Francis Crick proposed the Central dogma in molecular biology, which states that the genetic information flows from
DNA → RNA → Protein

 In some viruses, the flow of information is in reverse direction, that is, from RNA to DNA. It is called reverse transcription.
8. Why both the strands are not copied during transcription.
 (i) First, if both strands act as a template, they would code for RNA molecule with different sequences, (Remember
complementarity does not mean identical.) and in turn, if they code for proteins, the sequence of amino acids in the proteins
would be different.
 Hence, one segment of the DNA would be coding for two different proteins, and this would complicate the genetic
information transfer machinery.
(ii) Second, the two RNA molecules if produced simultaneously would be complementary to each other, hence would form
a double stranded RNA.
 This would prevent RNA from being translated into protein and the exercise of transcription would become a futile one.
9. Dfferentiale between. Template strand and Coding strand

Template strand Coding strand
1. During the transcription 1. During the transcription process, the coding
process, template strands work as a strand does not code for anything and act as a
template for the synthesis of mRNA. complementary strand of the template strand.
2. It has a sequence complementary to 2. It has a sequence identical to mRNA except that
the mRNA thymine in DNA is replaced by uracil in mRNA
3. Its direction is from 3' to 5' 3. Its direction is from5' to 3 '.

10. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
 In the double helix model or in double-stranded DNA, the ratio between the adenine and thymine molecule is the same, whereas
the ratio between the guanine and cytosine is the same.
 In 100% of DNA, if the percent of cytosine is 20% then the percent of guanine is also equal to 20%.
 By adding the percentage of cytosine and guanine, total of 40% are present and the remaining 60% of DNA is formed by adenine
and thymine.

Page No.: 2
 Thus in DNA, there is 30% of adenine and 30% of thymine.So, the percent of adenine in DNA is 30%.
Section C
Write the answer of the following questions : (Each carries 4 Marks) [8]

11. Write a short note on transcription unit.


 A transcription unit in DNA is defined primarily by the three regions in the DNA :
(i) The Structural gene
(ii) A Promoter
(iii) A Terminator
(i) A structural gene :
 There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit.
 Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only
one direction, that is, 5’ → 3’,
 Template strand :
 The strand that has the polarity 3’ → 5’ acts as a template, and is also referred to as template strand.
 Coding strand :
 The other strand which has the polarity (5’ → 3’) and the sequence same as RNA (except thymine at the place of uracil), is
displaced during transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand.
 All the reference point while defining a transcription unit is made with coding strand.

Schematic structure of a transcription unit


(ii) A promoter :
 The promoter and terminator flank the structural gene in a transcription unit.
 The promoter is said to be located towards 5’-end (upstream) of the structural gene (the reference is made with respect to the
polarity of coding strand).
 It is a DNA sequence that provides binding site for RNA polymerase and it is the presence of a promoter in a transcription unit
that also defines the template and coding strands.
(iii) A Terminator :
 By switching its position with terminator, the definition of coding and template strands could be reversed.
 The terminator is located towards 3’-end (downstream) of the coding strand and it usually defines the end of the process of
transcription.
 There are additional regulatory sequences that may be present further upstream or downstream to the promoter.
12. Explain different types of RNA along with process of transcription.
 Type of RNA
 In bacteria, there are three major types of RNAs:
(i) mRNA (messenger RNA),
(ii) tRNA (transfer RNA), and
(iii) rRNA (ribosomal RNA).
 All three RNAs are needed to synthesise a protein in a cell.
 The mRNA provides the template, tRNA brings aminoacids and reads the genetic code, and rRNAs play structural and catalytic
role during translation.
 There is a single DNA-dependent RNA polymerase that catalyses transcription of all types of RNA in bacteria.
Process of Transciption
 RNA polymerase binds to promoter and initiates transcription (Initiation).
Page No.: 3
 It uses nucleoside triphosphates as substrate and polymerises in a template depended fashion following the rule of
complementarity.
 It somehow also facilitates opening of the helix and continues elongation.
 Only a short stretch of RNA remains bound to the enzyme.
 Once the polymerases reaches the terminator region, the nascent RNA falls off, so also the RNA polymerase. This results in
termination of transcription.
 An intriguing question is that how is the RNA polymerases able to catalyse all the three steps, which are initiation, elongation
and termination.
 The RNA polymerase is only capable of catalysing the process of elongation. It associates transiently with initiation-factor (σ)
and termination-factor (ρ) to initiate and terminate the transcription, respectively.
 Association with these factors alter the specificity of the RNA polymerase to either initiate or terminate.

 In bacteria, since the mRNA does not require any processing to become active, and also since transcription and translation take
place in the same compartment (there is no separation of cytosol and nucleus in bacteria), many times the translation can begin
much before the mRNA is fully transcribed.
 Consequently, the transcription and translation can be coupled in bacteria.

Page No.: 4

You might also like