gels

Article
Metal Organic Framework-Incorporated Three-Dimensional
(3D) Bio-Printable Hydrogels to Facilitate Bone Repair:
Preparation and In Vitro Bioactivity Analysis
Cho-E Choi 1 , Aishik Chakraborty 1,2 , Hailey Adzija 3 , Yasmeen Shamiya 3 , Khaled Hijazi 2,4 , Ali Coyle 4 ,
Amin Rizkalla 1,2,4,5,6 , David W. Holdsworth 5 and Arghya Paul 1,2,3,4, *

1 Department of Chemical and Biochemical Engineering, The University of Western Ontario,

London, ON N6A 5B9, Canada
2 Collaborative Specialization in Musculoskeletal Health Research and Bone and Joint Institute, The University
of Western Ontario, London, ON N6A 5B9, Canada
3 Department of Chemistry, The University of Western Ontario, London, ON N6A 5B9, Canada
4 School of Biomedical Engineering, The University of Western Ontario, London, ON N6A 5B9, Canada
5 Department of Medical Biophysics, The University of Western Ontario, London, ON N6A 5B9, Canada
6 Dentistry, The University of Western Ontario, London, ON N5A 5B9, Canada
* Correspondence: [Link]@[Link]

Abstract: Hydrogels are three-dimensional (3D) water-swellable polymeric matrices that are used
extensively in tissue engineering and drug delivery. Hydrogels can be conformed into any desirable
shape using 3D bio-printing, making them suitable for personalized treatment. Among the different
3D bio-printing techniques, digital light processing (DLP)-based printing offers the advantage of
quickly fabricating high resolution structures, reducing the chances of cell damage during the printing
process. Here, we have used DLP to 3D bio-print biocompatible gelatin methacrylate (GelMA)
scaffolds intended for bone repair. GelMA is biocompatible, biodegradable, has integrin binding
motifs that promote cell adhesion, and can be crosslinked easily to form hydrogels. However, GelMA
on its own is incapable of promoting bone repair and must be supplemented with pharmaceutical
Citation: Choi, C.-E.; Chakraborty,
molecules or growth factors, which can be toxic or expensive. To overcome this limitation, we
A.; Adzija, H.; Shamiya, Y.; Hijazi, K.;
introduced zinc-based metal-organic framework (MOF) nanoparticles into GelMA that can promote
Coyle, A.; Rizkalla, A.; Holdsworth,
D.W.; Paul, A. Metal Organic
osteogenic differentiation, providing safer and more affordable alternatives to traditional methods.
Framework-Incorporated Incorporation of this nanoparticle into GelMA hydrogel has demonstrated significant improvement
Three-Dimensional (3D) across multiple aspects, including bio-printability, and favorable mechanical properties (showing
Bio-Printable Hydrogels to Facilitate a significant increase in the compressive modulus from 52.14 ± 19.42 kPa to 128.13 ± 19.46 kPa
Bone Repair: Preparation and In Vitro with the addition of ZIF-8 nanoparticles). The designed nanocomposite hydrogels can also sustain
Bioactivity Analysis. Gels 2023, 9, 923. drug (vancomycin) release (maximum 87.52 ± 1.6% cumulative amount) and exhibit a remarkable
[Link] ability to differentiate human adipose-derived mesenchymal stem cells toward the osteogenic lineage.
Academic Editor: Gianluca Viscusi Furthermore, the formulated MOF-integrated nanocomposite hydrogel offers the unique capability
to coat metallic implants intended for bone healing. Overall, the remarkable printability and coating
Received: 13 October 2023
ability displayed by the nanocomposite hydrogel presents itself as a promising candidate for drug
Revised: 15 November 2023
delivery, cell delivery and bone tissue engineering applications.
Accepted: 18 November 2023
Published: 23 November 2023
Keywords: nanocomposite hydrogels; bone repair; regenerative medicine; 3D printing; stem cells

Copyright: © 2023 by the authors.

Licensee MDPI, Basel, Switzerland. 1. Introduction
This article is an open access article
Bones are composite materials with the extracellular matrix (ECM) consisting of min-
distributed under the terms and
erals, water, collagen, proteins and lipids, protecting various vital organs and systems
conditions of the Creative Commons
through their solid support and rigidness [1]. ECM contains a small number of type I
Attribution (CC BY) license (https://
collagen fibres, which is the organic part of ECM. The rest of the ECM contains inorganic
[Link]/licenses/by/
matter from the mineral phase, mostly comprising hydroxyapatites [1,2]. Primary cells
4.0/).

Gels 2023, 9, 923. [Link] [Link]

Gels 2023, 9, 923 2 of 23

in bone tissues (osteoblasts, osteocytes and osteoclasts) actively communicate with each
other to heal defects and facilitate bone growth, maintenance and resorption [3]. However,
once a defect reaches a size and severity beyond the ability of bone to self-heal, an extrane-
ous intervention must be applied to ensure healthy bone regeneration [4,5]. Bone defects
usually range in severity, size of deformation, and root of causation. Causes include bone
injuries, congenital and hereditary disorders, infections, and diseases [1,4,6]. Such defects
can influence the healthy functioning and structural integrity of bones and joints and
may consequently harm the wellbeing of individuals living with impairments. Clinically
existing strategies for treating bone defects include autografts, allografts, alloplastic bone
grafts, and metallic implants [1,3]. To date, bone defect treatments are one of the most
common regenerative procedures, with more than 2 million bone grafts (83% autografts,
17% allografts and synthetic grafts) and 42 million metallic implant surgeries [7,8]. This sub-
stantial volume of procedures significantly impacts the healthcare system worldwide [7,8].
As such, developing effective treatment strategies is essential to reduce the enormous
burden imposed on the healthcare system.
Human-derived allogenic bone grafts mimic biological properties, expediting recov-
ery [9]. However, autografts and allografts pose risks, like donor-site pain, blood loss,
disease transmission, and infections [9]. Alloplastic bone grafts, which blend synthetic
and natural materials, offer advantages such as reduced disease transmission and easy
sterilization. but often underperform due to implant engineering and fixation issues [10,11].
To overcome these limitations, innovative platforms like polymeric hydrogel scaffolds are
being explored in regenerative medicine.
Polymeric hydrogels are 3D structures composed of hydrophilic polymer chains that
can maintain their structures upon swelling due to crosslinking within the structure [12–14].
These 3D networks possess high water contents and a structure resembling that of ECM,
which provides an ideal environment for cellular growth and tissue regeneration [12,15].
Polymeric hydrogels can be tailored to obtain the desired geometry, porosity, flexibility, and
degradation rate, which helps them to integrate with host tissues due to their adjustable
physiochemical properties [1,16]. The advantage of hydrogels, in contrast to traditional
therapeutic techniques (such as allografts), include minimizing the risk of adverse im-
mune responses [1,12,17]. This can be attributed to their biocompatible and biodegradable
properties, with physiochemical characteristics resembling that of living tissues [1,18–20].
Gelatin methacryloyl (GelMA), as a polymerical hydrogel, is a gelatin derivative from
denatured collagen, with methacrylic anhydride functional groups [12], and has attracted
great attention in biomedical fields because of its bio-compatibility, biodegradability, bio-
functionality, and ability to be photo-crosslinked [21,22]. GelMA-based scaffolds closely
resemble the essential properties of the ECM, with interconnected macropores that facilitate
cell adhesion, migration, growth, and proliferation [5,12,23,24]. However, traditional poly-
meric hydrogels (such as chitosan, alginate) are currently limited by their low mechanical
strength that leads to premature failure and lack of biological functionalities needed for
effective bone healing. To overcome these challenges, nanoparticles can be integrated
in such polymeric systems, offering a promising solution [1,18,20,25]. The low strength,
stiffness and toughness of GelMA hydrogel limit their applicability as implants because of
their poor cell support [26]. Nanoparticles have the potential to enhance the mechanical
strength and toughness of hydrogels, forming the development of either an intragranular
or an intergranular structure framework [27,28].
Mineral-based nanoparticles, such as hydroxyapatite, bio-glass, calcium phosphate,
and nanosilicates, have been widely used in bone regeneration application because of
their inherent osteogenic properties [29]. Mineral-based nanomaterials have been shown
to release favorable ions (such as Na+ , K+ , Mg2+ , Sr2+ , and Zn2+ ) that can regulate the
activation of osteogenic cells to facilitate bone regeneration [29,30]. Among the different
ions, zinc plays a crucial role in various biological processes, including bone metabolism
and regeneration. Zinc is also involved in bone mineralization, collagen synthesis, and
bone cell proliferation and differentiation [31]. Moreover, it is involved in the synthesis of
Gels 2023, 9, 923 3 of 23

bone matrix proteins, such as osteocalcin and collagen, which are essential for bone for-
mation and mineralization [31,32]. However, mineral-based nanomaterials contain traces
of elements, such as fluoride ions (F− ) and hydroxyl ions (OH− ), which cause an increase
in polycrystalline structures, thereby reducing the diffusion of nutrients and inhibiting
cell growth [30,33]. Additionally, the presence of excessive ions may lead to chronic in-
flammatory responses, and inhibit cell growth [30]. These drawbacks can be effectively
addressed by sustaining the release of ions using MOFs. MOFs possess the capability to
integrate osteogenic ions within their core structures, facilitating a controlled and gradual
release of these ions [34]. MOFs are organic–inorganic hybrid porous nanomaterials com-
posed of a regular arrangement of positively charged ions surrounded by organic ‘linker’
molecules, forming cage-like structures with large surface areas [34]. MOFs have several
advantages, including low toxicity, bio-compatibility, and tunable shape, and have emerged
as a promising carrier for delivering therapeutic molecules [34,35].
Considering these advantages, herein, we have integrated zinc-based zeolitic imidazo-
late framework-8 (ZIF-8) nanoparticles, which belong to the class of MOFs, into GelMA
polymer to form osteogenic hydrogel scaffolds, which can be used to treat non-load-bearing
bone defects. The designed GelMA/ZIF-8 formulations were photo-crosslinked with
the photo-initiator lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) using visible
light at 405 nm. Furthermore, since the architecture of every bone defect is unique and
patient-driven, we used Digital Light Processing (DLP)-based 3D bio-printing technology
to synthesize the scaffolds. DLP was used because of its ability to quickly print high
resolution structures. Our robust GelMA/ZIF-8 hydrogels were able to promote differ-
entiation of human adipose-derived mesenchymal stem cells in vitro. Furthermore, we
were also able to sustain the release of a model antimicrobial drug, vancomycin, using the
GelMA/ZIF-8 hydrogels. Finally, the developed nanocomposite formulation was used as
coating agent for the purpose of bio-functionalizing titanium-based metallic orthopedic
implants intended for bone repair. Figure 1 highlights the various applications of our
Gels 2023, 9, x FOR PEER REVIEW 4 of 26
designed nanocomposite hydrogel.

Figure 1. Illustration displays a ZIF-8-integrated nanocomposite hydrogel with versatile applica-

Figure 1. Illustration displays
tions in a ZIF-8-integrated
bone repair, serving as both 3D bio-printablenanocomposite
implants and coatings for hydrogel
inert metallic im-with versatile applications
plants. It significantly promotes osteogenic differentiation in human stem cells and can sustain an-
in bone repair, serving as both 3D bio-printable implants and coatings for inert metallic implants.
tibiotic drugs, exhibiting improved biological, and physicochemical properties.

It significantly promotes
2. Results and osteogenic
Discussion differentiation in human stem cells and can sustain antibiotic
2.1. Physicochemical Characterization Confirms the Successful Synthesis of ZIF-8 Nanoparticles
drugs, exhibiting improved biological, and physicochemical properties.
The ZIF-8 nanoparticles were prepared according to the proposed reaction scheme
by Ozterk et al. [36] (Figure 2A). The linker coordination of Zn2+ occurs at first, which is
followed by the deprotonation of the 2-methylimidazole linker. Then, the monomers are
oligomerized by linking together finite Zn2+ centres via the deprotonated 2-methyl imid-
azole ligands [36,37]. The TEM images of the synthesized ZIF-8 nanoparticles showed the
morphology, size, and uniform distribution of the nanoparticles (Figure 2B). From the
TEM, ZIF-8 showed a resemblance to a dodecahedron shape, which corresponds to the
literature [36,37]. Through the use of DLS, the size of the ZIF-8 nanoparticles was deter-
mined to be 92.1 10.1 nm (Figure 2C). Additionally, the ζ potential of the ZIF-8 nano-
particles was determined to be 29.5 7.2 mV, which may help with charge interaction
Gels 2023, 9, 923 4 of 23

2. Results and Discussion

2.1. Physicochemical Characterization Confirms the Successful Synthesis of ZIF-8 Nanoparticles
The ZIF-8 nanoparticles were prepared according to the proposed reaction scheme
by Ozterk et al. [36] (Figure 2A). The linker coordination of Zn2+ occurs at first, which
is followed by the deprotonation of the 2-methylimidazole linker. Then, the monomers
are oligomerized by linking together finite Zn2+ centres via the deprotonated 2-methyl
imidazole ligands [36,37]. The TEM images of the synthesized ZIF-8 nanoparticles showed
the morphology, size, and uniform distribution of the nanoparticles (Figure 2B). From the
TEM, ZIF-8 showed a resemblance to a dodecahedron shape, which corresponds to the liter-
ature [36,37]. Through the use of DLS, the size of the ZIF-8 nanoparticles was determined
Gels 2023, 9, x FOR PEER REVIEW to
5 of 26
be 92.1 ± 10.1 nm (Figure 2C). Additionally, the ζ potential of the ZIF-8 nanoparticles was
determined to be 29.5 ± 7.2 mV, which may help with charge interaction with GelMA. Next,
the nanoparticles were chemically characterized to further validate the formation of ZIF-8
formation of ZIF-8 nanoparticles. From the ultraviolet-visible (UV-Vis) spectra graphs
nanoparticles.
(Figure S1A),From the ultraviolet-visible
it was seen that there was(UV-Vis) spectra
an increase graphs (Figure
in absorbance of UVS1A),
withitincreasing
was seen
that there was an increase
nanoparticle in absorbance
concentration, with the of UV withabsorbance
prominent increasing peak
nanoparticle concentration,
of the nanoparticles at
with 215
the nm.
prominent absorbance peak of the nanoparticles at 215 nm. The XRD
The XRD pattern of ZIF-8 nanoparticles (Figure 2D) revealed peaks correspond- pattern of
ZIF-8ing
nanoparticles
to (011), (002), (Figure 2D) revealed
(112), (022), peaks
(013), (222), corresponding
(114), (233) and (231),to which
(011), (002),
match (112), (022),
with previ-
(013),ous
(222), (114), (233) and (231), which match with previous findings and
findings and confirms the successful synthesis of the nanoparticles [38]. The FTIR confirms the
successful synthesis of the nanoparticles [38]. The FTIR spectra of ZIF-8
spectra of ZIF-8 nanoparticles and their base components (Zinc and 2-methylimidazole)nanoparticles and
their are
base components
shown in Figure(Zinc andband
2E. The 2-methylimidazole)
1590 cm−1 arises from are shown in Figurewhile
C=N stretching, 2E. The
1457band
and
cm−1cm
1590 1382 arises from C=N
−1 correspond stretching, while 1457 and 1382 cm −1 correspond to the ring
to the ring stretching of the ZIF-8. The Zn-N stretching vibration
stretching
band at of 421
the cm
ZIF-8. The
−1 was alsoZn-N stretching
observed, which vibration at 421 cm−synthesis
band successful
demonstrates 1 was also observed,
of ZIF-8 na-
whichnoparticles.
demonstrates successful synthesis of ZIF-8 nanoparticles.

Figure 2. Characterization
Figure and and
2. Characterization fabrication of ZIF-8
fabrication nanoparticles
of ZIF-8 nanoparticles and GelMA/ZIF-8
and GelMA/ZIF-8 nanocomposite
nanocomposite
hydrogels.
hydrogels. (A) Reaction
(A) Reaction schemescheme
of theofsynthesis
the synthesis of ZIF-8.
of ZIF-8. (B) TEM
(B) TEM images
images showing
showing size,
size, morphol-
morphology,
ogy, anddistribution
and uniform uniform distribution of ZIF-8 nanoparticles.
of ZIF-8 nanoparticles. (C) DLS
(C) DLS data data showing
showing the size distribution
the size distribution of
of the ZIF-
the ZIF-8 nanoparticles in ethanol solution. (D) XRD pattern of Zn, 2-Melm, and ZIF-8. The XRD
8 nanoparticles in ethanol solution. (D) XRD pattern of Zn, 2-Melm, and ZIF-8. The XRD analysis of
analysis of ZIF-8 indicates high crystallinity of the prepared ZIF-8. (E) FT-IR spectra of ZIF-8, 2-
ZIF-8 indicates high crystallinity of the prepared ZIF-8. (E) FT-IR spectra of ZIF-8, 2-methylimidazole
methylimidazole (2-Melm), and zinc nitrate hexahydrate confirmed that zinc ions combined chem-
(2-Melm),
icallyand
withzinc nitrateatoms
nitrogen hexahydrate confirmed thatgroups
of the methylimidazole zinc ions combined
to form chemically
the imidazolate inwith nitrogen
a ZIF-8 prod-
atomsuct.
of the methylimidazole
(F) Cumulative releasegroups
profile to
of form the imidazolate
zinc amount in a ZIF-8
from the ZIF-8 product. Results
nanoparticles. (F) Cumulative
are indi-
cated
release as mean
profile ± S.D.,
of zinc (n = 5)from
amount * = pthe
< 0.05.
ZIF-8 nanoparticles. Results are indicated as mean ± S.D.,
(n = 5) * = p < 0.05.
2.2. ZIF-8 Nanoparticles Release Zn2+ Ions in Physiological Solutions
2.2. ZIF-8ZIF-8
Nanoparticles Release
nanoparticles Zn2+ Ions
degrade intoin2-methlyimidazoles
Physiological Solutions
and Zn2+ in cell culture media
ZIF-8 nanoparticles
and most degrade
common buffers dueinto 2-methlyimidazoles
to the presence of variousand Zn2+ in cell[39–41],
components culturesuch
mediaas
and most common
albumin, buffers
inorganic dueand
anions, to ascorbic
the presence of various
acid that components
have a significant [39–41],
effect such as
on the stability
of ZIF-8
albumin, (Figureanions,
inorganic S1B). Due
andtoascorbic
the sustained release
acid that haveofa Zn 2+, which plays a key role in oste-
significant effect on the stability of
properties, ZIF-8 can be used in bone 2+
ZIF-8 (Figure S1B). Due to the sustained release of Zn , which plays a[42].
ogenic healing applications keyThus,
role inunderstand-
osteogenic
ing the degradation behavior of ZIF-8 under physiological conditions is essential to con-
trol the release of Zn2+ amount for their potential use in tissue regeneration. The residues
of proteins and inorganic molecules can bind to Zn2+ ions and transport them into the cells
to promote bone tissue regeneration [40]. DMEM and PBS were used to investigate the
degradation behaviour of ZIF-8 nanoparticles as they are the most commonly used cell
Gels 2023, 9, 923 5 of 23

properties, ZIF-8 can be used in bone healing applications [42]. Thus, understanding the
degradation behavior of ZIF-8 under physiological conditions is essential to control the
release of Zn2+ amount for their potential use in tissue regeneration. The residues of
proteins and inorganic molecules can bind to Zn2+ ions and transport them into the cells
to promote bone tissue regeneration [40]. DMEM and PBS were used to investigate the
degradation behaviour of ZIF-8 nanoparticles as they are the most commonly used cell
culture medium and buffer [43]. To determine the release kinetics of Zn2+ degradation, a
linear curve was plotted between the Au and the concentration of Zn2+ ions, which was
found using the zincon colorimetric assay, as shown in Figure S1C. Figure 2F displays the
release profiles of Zn2+ ions from ZIF-8 nanoparticles. Equilibrium release was achieved
after 11 days, corresponding to 12.48 ± 2.24% (in PBS) and 18 ± 1.16% (in DMEM). These
results indicated that the presence of serum and various enzymatic activities in DMEM,
which is similar to the physiological conditions, could induce degradation of ZIF-8, leading
to effective bone repair. ZIF-8 nanoparticles were then integrated into GelMA to prepare
nanocomposite hydrogels for bone repair.

2.3. Composition of GelMA Plays a Key Role on the Printability of GelMA/ZIF-8 Hydrogels
The composition of the ZIF-8-based nanocomposite hydrogel is critical to ensure the
shape fidelity of the printed structure. Not all formulations are capable of bio-printing,
which makes it important to optimize the formulation by 3D-bio-printing. Here, by 3D-
bio-printing various GelMA hydrogel compositions using the Lumen XTM DLP Bio-printer
at fixed parameters (8 s exposure time, 80% power intensity), an optimal composition of
components was determined. As illustrated in Figure S2A, only hydrogels printed with
15% w/v GelMA were printable, while hydrogels with 5% w/v and 10% w/v GelMA were
not. The overall printability of hydrogels was determined by comparing the dimensions of
the printed hydrogels to that of the original computer-aided design (4 mm diameter, 2 mm
height) created with OnShape (PTC, Boston, MA, USA). All hydrogels at 15% w/v GelMA
were printed to the desired dimensions (4 mm diameter, 2 mm height), with good shape
retention and structural integrity (Figure S2B,D,E), whereas unprintable hydrogels did not
meet the dimensions of the desired structure and lacked shape retention upon removal
from the build platform (Figure S2C). Printability of hydrogels was not influenced by the
concentration of ZIF-8 (Figure or results?). The observed trend with printability can be
directly correlated to the concentration of GelMA instead. Upon exposure to visible light,
the hydrogel compositions with smaller concentrations of GelMA did not print because
they did not undergo substantial crosslinking [44,45]. Increased crosslinking occurs with
higher concentrations of GelMA, creating a more rigid structure that is likely to maintain
its configuration [44]. Increased crosslinking density limits the possibility of hydrogel
deformation [44]. Next, we optimized different bio-printing parameters to effectively
fabricate the GelMA/ZIF-8 nanoparticles.

2.4. Exposure Time and Power Have a Profound Effect on Shape Retention of 3D Printed
GelMA/ZIF-8 Hydrogels
After determining the optimal GelMA/ZIF-8 composition for printing, we examined
the effect of various printing parameters on the printability of the material. Three distinct
power intensities, falling within the 10–30 mW/cm2 range, were examined at three specific
levels: 70%, 80%, and 90%. These power settings were tested across various exposure
durations, encompassing 5, 8, 10, and 15 s. It is noteworthy that after a 5-s exposure, the
hydrogel printing process proved ineffective, irrespective of the chosen power intensity.
(Figure S3A). At all remaining power intensities and exposure times, the hydrogels printed
effectively. As illustrated in Figure S3B, there was variability in height observed for each
printed hydrogel when considering the designated exposure times and intensities. At a
higher power intensity (90%), there was less variation of height measurements at 8, 10,
and 15 s, suggesting that hydrogels are sufficiently crosslinked at these parameters, so as
to achieve the shape and dimensions specified by the intended stereolithography (STL)
Gels 2023, 9, 923 6 of 23

file. In contrast, Figure S3C showed no variation in diameter at different power intensities
or exposure times. This may be due to sufficient crosslinking having a more profound
impact on achieving a set height as compared to its ability to achieve a set diameter. To
conclude, 15% GelMA is needed for bio-printing, along with 1% LAP and 0.1% Tartrazine.
Gels 2023, 9, x FOR PEER REVIEW 7 of 26
Moreover, 80% power and 8 s of light exposure are sufficient to achieve shape retention of
the fabricated GelMA/ZIF-8 hydrogels. In the subsequent sections, we use these optimized
parameters to characterize the designed hydrogels.
2.5. Integration of ZIF-8 Nanoparticles in GelMA Alters the Physicochemical Behavior of the
[Link] Hydrogel
Integration of ZIF-8 Nanoparticles in GelMA Alters the Physicochemical Behavior of the
Pristine Hydrogel
2.5.1. GelMA/ZIF-8 Hydrogels Display Lower Swelling Ratio When Compared to
2.5.1. GelMA/ZIF-8
GelMA Hydrogels Hydrogels Display Lower Swelling Ratio When Compared to
GelMA Hydrogels
Swelling ratio is a critical physical property of hydrogels intended for use in bone
Swelling
repair. A highratio
rateis
ofaswelling
critical in
physical property
implanted of hydrogels
hydrogels intended
can be detrimental for well-being
to the use in bone
repair. Aneighboring
of the high rate of tissue
swelling
[46].inFigure
implanted hydrogels can
3A demonstrates the be detrimental
effect to the well-being
of ZIF-8 nanoparticles on
of the
the neighboring tissueof[46].
swelling behavior GelMAFigure 3A demonstrates
hydrogels. the effect
At equilibrium, GelMAof ZIF-8 nanoparticles
hydrogels displayedon
theaswelling
swelling behavior of±GelMA
ratio of 586 71.51%,hydrogels. At equilibrium,
whereas GelMA/ZIF-8 GelMA hydrogels
nanocomposite hydrogelsdisplayed
swelled a
swelling
to 534 ±ratio
16.71%. As ±
of 586 71.51%,
such, whereas
integration GelMA/ZIF-8
of ZIF-8 nanocomposite
nanoparticles can reduce thehydrogels swelled
rate of swelling
and±
to 534 16.71%.the
improve Asapplicability
such, integration of ZIF-8 nanoparticles
of the hydrogels can reduce the rate
for treating non-load-bearing boneofdefects.
swelling
and improve the applicability of the hydrogels for treating non-load-bearing bone defects.

Figure 3. Physiochemical Characterization of GelMA/ZIF-8 nanocomposite hydrogels. (A) Swelling

Figure 3. Physiochemical Characterization of GelMA/ZIF-8 nanocomposite hydrogels. (A) Swelling
ratio of GelMA
ratio of GelMAand
andGelMA/ZIF-8
GelMA/ZIF-8 (3 (3mg/mL)
mg/mL) nanocomposite
nanocomposite hydrogels
hydrogels (nIncorporation
(n = 5). = 5). Incorporation
of ZIF- of
ZIF-8 resultedininaareduced
8 resulted reducedswelling
swellingraterateofofthe
thehydrogels.
hydrogels.(B) (B)Percent
Percent degradation
degradation of of GelMA
GelMA andand
GelMA/ZIF-8(3(3mg/mL)
GelMA/ZIF-8 mg/mL) nanocomposite
nanocomposite hydrogels
hydrogels (n(n
= 5). ZIF-8
= 5). reduces
ZIF-8 the the
reduces rate rate
of degradation of
of degradation
the hydrogels
of the hydrogels after
after1414days.
days.(C)(C)
FTIR analysis
FTIR of GelMA,
analysis ZIF-8,ZIF-8,
of GelMA, and GelMA/ZIF-8.
and GelMA/ZIF-8.(D) SEM (D)
image
SEM
and elemental mapping images of GelMA and (E) GelMA/ZIF-8 hydrogel. Both hydrogels showed
image and elemental mapping images of GelMA and (E) GelMA/ZIF-8 hydrogel. Both hydrogels
similar porosity. As revealed by elemental mapping, two major components (C, O elements) of
showed similar porosity. As revealed by elemental mapping, two major components (C, O elements)
GelMA hydrogels were present in both the groups whereas, Zn was only found in GelMA/ZIF-8
of GelMA
[Link] were indicate
These results present that
in both
ZIF-8the
wasgroups whereas,
successfully Zn was only
incorporated found hydrogels.
in GelMA in GelMA/ZIF-
(F)
8 hydrogels.
EDX analysisThese results indicate
of GelMA/ZIF-8 thatverifying
further ZIF-8 was thesuccessfully
presence of Zn incorporated in GelMAhydrogel.
in the nanocomposite hydrogels.
* = p <analysis
(F) EDX 0.05. of GelMA/ZIF-8 further verifying the presence of Zn in the nanocomposite hydrogel.
* = p < 0.05.
2.5.2. GelMA/ZIF-8 Hydrogels Degraded Slower than GelMA Hydrogels
The rate of degradation of hydrogels is crucial for the release of zinc ions or encap-
sulated therapeutics intended for bone repair or fighting infection. However, a rapid rate
of degradation leads to implant failure because of its inability to support cells of adhesion
[47,48]. Therefore, it is of paramount interest to the researchers to evaluate the rate of deg-
radation of such bio-based implants. To study the influence of ZIF-8 on hydrogel
Gels 2023, 9, 923 7 of 23

2.5.2. GelMA/ZIF-8 Hydrogels Degraded Slower than GelMA Hydrogels

The rate of degradation of hydrogels is crucial for the release of zinc ions or encap-
sulated therapeutics intended for bone repair or fighting infection. However, a rapid rate
of degradation leads to implant failure because of its inability to support cells of adhe-
sion [47,48]. Therefore, it is of paramount interest to the researchers to evaluate the rate
of degradation of such bio-based implants. To study the influence of ZIF-8 on hydrogel
degradation, the percent degradation was studied over 2 weeks in PBS with 1% p/s at
37.5 ◦ C. Findings suggest that the presence of ZIF-8 slowed the rate of degradation. On
day 14, there was significant reduction in degradation between GelMA/ZIF-8 and GelMA
hydrogels, where the weight remaining was 68.9 ± 9.40% and 55.8 ± 7.79%, respectively
(Figure 3B). As suggested by Liu et al. [49], ZIF-8 nanoparticles used in hydrogel structures
may strengthen the mechanical properties of hydrogels, which in turn can reduce their rate
of degradation. A reduced rate of degradation is beneficial for using these hydrogels as
implants for bone repair.

2.5.3. Presence of ZIF-8 in GelMA/ZIF-8 Hydrogel Was Confirmed Using FTIR Analysis
FTIR spectra were used to validate the presence of ZIF-8 in GelMA/ZIF-8 hydrogels.
Figure 3C displays the band characteristic of ZIF-8 wat 2979 and 1381 cm−1 , which repre-
sents the N-H stretching of the imidazole ring and the bending of the ring, respectively [50].
The band characteristic of GelMA is also present at 3296 and 1631 cm−1 , which can be
attributed to O-H stretching and amide bonds (with C=O stretching vibrations), respec-
tively [50]. GelMA/ZIF-8 hydrogels exhibited comparable peak patterns, including N-H
stretch and ring stretching, reinforcing the existence of ZIF-8 within the nanocomposite
group. Further chemical proof is obtained by using EDX spectra, discussed in Section 2.5.5.

2.5.4. SEM Images and Elemental Mapping Demonstrated the Successful Integration of
ZIF-8 in GelMA/ZIF-8 Hydrogel
The cross-sectional morphology of GelMA and GelMA/ZIF-8 hydrogels were investi-
gated using SEM (Figure 3D,E). The pore size was observed to be similar for both GelMA
and GelMA/ZIF-8 hydrogels. Elemental mapping revealed that major components for both
samples included carbon and oxygen. Zinc was only found in GelMA/ZIF-8 hydrogels,
which indicated that ZIF-8 was successfully incorporated in GelMA/ZIF-8 hydrogels.

2.5.5. Presence of ZIF-8 in GelMA/ZIF-8 Hydrogels Was Further Confirmed with

EDX Analysis
EDX analysis was performed to further understand the elemental composition of
GelMA/ZIF-8 hydrogel. The major components in the sample included carbon, nitrogen,
and oxygen. The minor component consisted of zinc, which highlighted the presence of
ZIF-8 nanoparticles in the sample. The component with the highest weight percent was
carbon at 57.8% and following was oxygen and nitrogen at 22.2% and 17.6%, respectively
(Figure 3F). Zinc had a weight percent of 0.3%. Notably, zinc was not present in the
GelMA group. Next, we use the designed nanocomposite formulation as a coating agent
and characterize GelMA/ZIF-8-coated metallic implants using SEM, elemental mapping,
and EDX.

2.6. Orthopedic Metallic Implants Can Be Coated with GelMA/ZIF-8 Hydrogels

The gyroid structure was fabricated utilizing laser-powder bed fusion (LPBF) within an
additive manufacturing facility (Figure 4A). The morphology of GelMA and GelMA/ZIF-8
hydrogel-coated gyroid-shaped metallic implants were investigated with SEM. Figure 4B,C
show SEM images of GelMA-coated and nanocomposite hydrogel coated gyroid-shaped
metallic implants, respectively. The uncoated gyroid structure showed irregular spheres on
its surface, as confirmed by SEM imaging. In contrast, the gyroid coated with nanocompos-
ite hydrogel had a porous hydrogel surface. Elemental mapping revealed that the uncoated
gyroid-shaped metallic implants consisted mainly of Ti. Conversely, the hydrogel-coated
Gels 2023, 9, 923 8 of 23

Gels 2023, 9, x FOR PEER REVIEW

gyroid showed the presence of carbon, oxygen, nitrogen, and zinc, which are the9 primary
of 26

components of the hydrogel.

Figure
Figure 4. 4. Application
Application and and physicochemical
physicochemical characterizationofof
characterization GelMA/ZIF-8hydrogels.
GelMA/ZIF-8 hydrogels.(A) (A)Fab-
rication of the gyroid structure was carried out using laser-powder bed fusion (LPBF) at anan
Fabrication of the gyroid structure was carried out using laser-powder bed fusion (LPBF) at addi-
additive manufacturing facility (Additive Design in Surgical Solutions, London, ON, Canada) using
tive manufacturing facility (Additive Design in Surgical Solutions, London, ON, Canada) using
a commercial 3D metal printer (AM400, Renishaw plc, Wotton-under-Edge, Gloucestershire, UK).
a commercial 3D metal printer (AM400, Renishaw plc, Wotton-under-Edge, Gloucestershire, UK).
Printing parameters were: laser power 200–400 W, scanning speed 10,000–20,000 points/second,
Printing parameters
particle diameter 15–45 were: laser spot
microns, power size200–400
70 microns. W, After
scanning speed 10,000–20,000
consolidation, points/second,
the test components were
particle diameter
heat treated 15–45
(24-h cyclemicrons,
of stressspot size
relief, 85070°C
microns.
for 1 h After consolidation,
then passive the test
cool down) components
to reduce residual were
stress.
heat (B) Photograph,
treated (24-h cycle of SEM images,
stress relief,and ◦ C for
850EDX spectre of gyroid
1 h then passivestructure (C) Photograph,
cool down) SEM
to reduce residual
images,
stress. (B)and EDX spectre
Photograph, SEMof gyroid
images,structure
and EDX coated withofGelMA/ZIF-8
spectre hydrogel.
gyroid structure (D) Schematic
(C) Photograph, SEM
design of mechanical testing on 3D printed hydrogel with a cylindrical dimension (3 mm × 6 mm).
images, and EDX spectre of gyroid structure coated with GelMA/ZIF-8 hydrogel. (D) Schematic
(E) Photographs revealing the notable compression resistance of nanocomposite hydrogel. (F)
design of mechanical
Compressive testing
stress−strain on 3D(G)
curves. printed hydrogel with
The compression a cylindrical
modulus of samplesdimension (3 mm ×
was determined in 6the
mm).
(E)range
Photographs
between 1revealing
and 15 %the notable
of the compression
stress-strain (n = 5).resistance
(H) Toughnessof nanocomposite
of the sampleshydrogel. (F) Com-
(n = 5). p values
pressive stress−strain
were determined by a curves.
student t-test;
(G) The * p ≤compression
0.05. (I) Cumulative
modulus release profile ofwas
of samples vancomycin
determined drugin in the
gels. between
range (J) Evaluating
1 and in vitro
15 %antimicrobial activity at(n
of the stress-strain different
= 5). concentrations
(H) Toughnessof of gels.
the(nsamples
= 3) V32, V64,
(n = 5).
and V96 indicate drug concentrations, vancomycin 32, 64, and 96 ug/mL, respectively. (K) Images
p values were determined by a student t-test; * p ≤ 0.05. (I) Cumulative release profile of vancomycin
of bacterial cultured plates shows decreased bacterial populations in drug-loaded GelMA/ZIF-8
drug in gels. (J) Evaluating in vitro antimicrobial activity at different concentrations of gels. (n = 3)
hydrogel.
V32, V64, and V96 indicate drug concentrations, vancomycin 32, 64, and 96 ug/mL, respectively.
(K)2.7.
Images of bacterial
GelMA/ZIF-8 cultured Displayed
Hydrogels plates shows decreased
Superior bacterial
Mechanical populations
Strength in drug-loaded
and Toughness WhenGelMA/
ZIF-8 hydrogel.
Compared to GelMA Hydrogels
Several nanoparticles,
2.7. GelMA/ZIF-8 such as carbon
Hydrogels Displayed nanotube
Superior [51] and
Mechanical graphene
Strength oxide [52],
and Toughness have
When
been shown to enhance the
Compared to GelMA Hydrogels mechanical properties of GelMA hydrogels [53]. As such, ZIF-
8 nanoparticles may also serve as a potential aid to improve the mechanical properties of
Several nanoparticles, such as carbon nanotube [51] and graphene oxide [52], have
GelMA hydrogels. To determine the effect of ZIF-8 nanoparticles on the mechanical
been shown to enhance the mechanical properties of GelMA hydrogels [53]. As such,
Gels 2023, 9, 923 9 of 23

ZIF-8 nanoparticles may also serve as a potential aid to improve the mechanical properties
of GelMA hydrogels. To determine the effect of ZIF-8 nanoparticles on the mechanical
strength and toughness of the GelMA hydrogel, compressive modulus, strength, and
toughness were measured using static compression loading. Figure 4D illustrates the
set-up of the compression tests. Photographs in Figure 4E illustrate the compressibility
of GelMA/ZIF-8 hydrogels. The stress–strain curves shown in Figure 4F are obtained
using the compression test. Figure 4G shows that a significant increase in the compres-
sive modulus from 52.14 ± 19.42 kPa to 128.13 ± 19.46 kPa was obtained when ZIF-8
nanoparticles were added to GelMA hydrogels (n = 5). Next, the toughness of hydrogels
was also determined from the area below the stress–strain curve until fracture (Figure 4H).
An increased toughness was observed in GelMA/ZIF-8 hydrogels from 13.02 ± 2.39 kPa
to 21.14 ± 5.06, with a significant difference between the samples (n = 5). These findings
demonstrate that the incorporation of ZIF-8 can effectively enhance the mechanical strength
and toughness of the hydrogel. Improved mechanical properties may also be a reason
for the slower rate of degradation (as observed in Section 2.5.2). It is speculated that the
molecular interactions between the positively charged ZIF-8 nanoparticles and the polymer
chains may help support and enhance the mechanical properties of the nanocomposite
hydrogels. This improvement of material stiffness may, in turn, support sufficient cellular
growth and integration [54,55].

2.8. GelMA/ZIF-8 Hydrogels Sustain the Release of Model Antibiotic Vancomycin at

Physiological Conditions
Effective post-transplant treatment requires minimizing the risk of infection. However,
administering high doses of systemic antibiotics can cause potential systemic toxicity, lead-
ing to treatment failure and unwanted side effects [56]. To address this issue, a promising
approach is to use polymeric delivery vehicles, which can offer appreciable concentrations
at the target site while causing fewer side effects than systemic administration [57,58].
For drug delivery applications, polymeric hydrogels are frequently used due to their (a)
high porosity and water retention, which is suitable for hydrophilic drug encapsulation,
(b) reproducible drug loading, and (c) sustained drug release profiles [59]. In this study, the
hydrophilic vancomycin was used as a model antimicrobial drug to investigate its cumula-
tive release from GelMA/ZIF-8 hydrogels. Vancomycin has a half-life of 4 to 6 h, and as
such, a sustained release is desirable for improved therapeutic efficacy. Here, 96 ug/mL of
vancomycin was loaded into dried hydrogels and the release was studied using UV-Vis
spectroscopy. Both GelMA (92.97 ± 3.1%) and GelMA/ZIF-8 (87.52 ± 1.6%) were able to
sustain the release of vancomycin over 48 h (Figure 4I). Next, we assessed the antimicrobial
efficacy of three different drug concentrations by exposing the drug-loaded nanocomposite
hydrogels to E. coli for a period of 24 h. All three concentrations showed significant pro-
gressive bacterial reduction compared to the control (Figure 4J). Figure 4K shows images of
bacterial plates, which confirmed that drug-loaded GelMA/ZIF-8 hydrogel has effective
antibacterial properties.

2.9. Antioxidant Agent-Loaded Nanocomposite Hydrogels Can Scavenge Free Radicals

Antioxidant agents play a vital role in maintaining cellular health by neutralizing
harmful free radicals. Nanocomposite hydrogels can be used to deliver and release these
molecules [60]. To demonstrate the scavenging activity of the designed ZIF-8 integrated
nanocomposite hydrogel, the antioxidant agent ascorbic was loaded in the lyophilized
scaffold. The activity of the loaded antioxidant agents can be evaluated using the 2,2-
diphenyl-1-picrylhydrazyl (DPPH) assay, a method where the released antioxidant species
can react with the stable free radical. Figure S4 shows an increase in the scavenging activity
of the ascorbic acid-loaded nanocomposite hydrogel with an increase in the concentra-
tion of DPPH. Such robust scavenging activity demonstrates the ability of the designed
GelMA/ZIF-8 hydrogel to serve as a carrier of antioxidant-based therapeutics.
Gels 2023, 9, 923 10 of 23

2.10. GelMA/ZIF-8 Hydrogels Show Excellent Cyto-Compatibility and Osteogenic

Differentiation Abilities
2.10.1. In Vitro Cyto-Compatibility of Mineral-Based Nanocomposite Hydrogels
When considering bio-medical applications of GelMA/ZIF-8 hydrogels, it is crucial
that the components are cyto-compatible. GelMA is often sought after for tissue engi-
neering and drug delivery applications because of its high bio-compatibility and low
cytotoxicity [23,24,61]. Additionally, although ZIF-8 nanoparticles have bio-compatible
properties, a threshold concentration must be examined using a stem cell proliferation
assay to determine its compatibility with biological tissue [62]. Here, cyto-compatibility
was confirmed by seeding hASCs on GelMA/ZIF-8 nanocomposite hydrogels at varying
concentrations of ZIF-8 (Figure 5A). Figure 5B indicates that there was no difference in
cell proliferation between the control (hASCs), GelMA, and GelMA/ZIF-8 hydrogels up to
3 mg/mL. The morphology of cells was imaged by bright field microscopy with different
concentrations of nanocomposite hydrogels. Furthermore, fluorescence microscopy with
Calcein AM staining was performed to assess the effect of GelMA/ZIF-8 hydrogels on the
shape and morphology of the hASCs (Figure 5C). Both phase contrast and fluorescence
microscopy showed that GelMA/ZIF-8 hydrogels did not have any detrimental effects on
hASCs up to 3 mg/mL of ZIF-8 concentration. However, with GelMA/ZIF-8 at 6 mg/mL,
there was a significant difference, with a distinct reduction in cell proliferation. Similar
assays from Hoop et al. suggest that the cytotoxicity of ZIF-8 at higher concentrations
results from increased release of Zn2+ , which impacts the mitochondrial reactive oxygen
species
Gels 2023, 9, x production [62]. Combining the results of cell proliferation studies, 3 mg/mL ZIF-8
FOR PEER REVIEW 12 of 26
nanoparticles is the advisable concentration to fabricate GelMA/ZIF-8 hydrogels.

Figure 5. In vitro
Figure 5. In vitro cyto-compatibility andcyto-compatibility and osteogenicpotential
osteogenic differentiation differentiation potential of GelMA/ZIF-8
of GelMA/ZIF-8 hydro-
hydrogels with 2D human stem cell culture. (A) Schematic visualization of the method by which the
gels with 2D human stem cell culture. (A) Schematic visualization of the method by which the cellson
cells were exposed to the hydrogels. (B) MTS cell proliferation assay showing no adverse effect
stem cells when ZIF-8 is equal to or less than 3 mg/mL in the nanocomposite hydrogels (n = 3). (B)
These were determined using a two-tailed t-test. A p-value 0.05 indicates statistical significance,
which was displayed as * p < 0.05. (C) DIC and fluorescence images of stem cells with various
nanocomposite hydrogel concentrations. Scale bar indicates 100 µm. (D) Images of alizarin red stain
show significantly higher production of mineralized deposition in hASCs treated with GelMA/ZIF-
8 hydrogel compared to Negative control (no dexamethasone in media) or Positive control (with
dexamethasone in media). Incorporation of ZIF-8 nanoparticles resulted in a substantial
improvement in the production of the mineralized matrix in presence of osteogenic media, as
Gels 2023, 9, 923 11 of 23

were exposed to the hydrogels. (B) MTS cell proliferation assay showing no adverse effect on stem
cells when ZIF-8 is equal to or less than 3 mg/mL in the nanocomposite hydrogels (n = 3). (B) These
were determined using a two-tailed t-test. A p-value 0.05 indicates statistical significance, which was
displayed as * p < 0.05. (C) DIC and fluorescence images of stem cells with various nanocomposite
hydrogel concentrations. Scale bar indicates 100 µm. (D) Images of alizarin red stain show signifi-
cantly higher production of mineralized deposition in hASCs treated with GelMA/ZIF-8 hydrogel
compared to Negative control (no dexamethasone in media) or Positive control (with dexametha-
sone in media). Incorporation of ZIF-8 nanoparticles resulted in a substantial improvement in the
production of the mineralized matrix in presence of osteogenic media, as determined by quantifying
the amount of ARS stained in the mineralized matrix. (E) Introduction of ZIF-8 nanoparticles also
led to an upregulation of osteogenic markers, specifically OPN and RUNX2, corresponding to the
gene expressions related to osteogenic differentiation of hASCs. Differentiation of the cells cultured
in three groups (n = 3) for 21 days. * = p-value < 0.05, ** = p-value < 0.01, and **** = p-value < 0.0001.

2.10.2. GelMA/ZIF-8 Hydrogels Can Differentiate hASCs toward Osteogenic Lineage

Mineral-based ions are essential dietary requirement and are involved with several
biological functions [63]. In particular, zinc performs multiple functions related to the
immune system, cell division, fertility, and cell growth and maintenance [64]. In bone
biology, zinc is proven to be an important element for the formation of bone, mineralization,
development, and maintenance of healthy tissue [64]. In this regard, zinc has widely
been used along with other bio-materials, such as bioactive glasses for bone regeneration
applications [64,65]. Given the role for zinc in osteogenic differentiation [31], we assessed
the osteogenic activities of zinc in the form of ZIF-8 nanoparticles contained in GelMA/ZIF-
8 hydrogels. To analyze the formation of mineral depositions, a crucial indicator of late-
stage osteogenesis, an Alizarin Red S (ARS) assay, was performed on day 14. Encouragingly,
the introduction of GelMA/ZIF-8 nanocomposite hydrogel significantly enhanced matrix
mineralization in hASCs when compared to the group without nanoparticles (Figure 5D).
To determine the osteogenic activities at the genetic level, RT-qPCR was performed. First,
hASCs were seeded in 24 well plates at a cell density of 0.05 × 106 per well. Then, 3D-
printed GelMA and GelMA/ZIF-8 hydrogels were co-cultured (n = 3). After 21 days,
osteogenic gene levels of OPN and RUNX2, which are common osteogenic bone markers,
were determined as shown in Figure 5E. Significantly higher levels of OPN and RUNX2
expression can be seen in GelMA/ZIF-8 hydrogels compared to the GelMA and the blank
groups. These results demonstrated that the delivery of zinc using GelMA/ZIF-8 hydrogels
can promote effective osteogenic differentiation, which is vital for bone repair applications.

2.10.3. Complex Shapes of GelMA/ZIF-8 Hydrogels Can Be Fabricated Using DLP-Based

3D Bio-Printing
3D bio-printing enables the fabrication of complex structures with high precision
and reproducibility. To achieve this, bio-material inks with suitable printability and bio-
compatibility are necessary. In this study, we investigated formulations containing GelMA,
ZIF-8, and hASCs as bio-inks for 3D bio-printing (Figure 6A). Figure 6B shows the principle
of the DLP-based bio-printer. Briefly, the first step requires the creation of a 3D model of the
object that needs to be printed. This can be carried out using computer-aided design (CAD)
software, such as OnShape. The 3D model is sliced into multiple 2D layers that are limited
only by the resolution of the printer being used. A vat of liquid bioink is placed above
a DLP projector, which projects a pattern of light onto the bio-ink. The pattern of light
corresponds to the 2D image sliced from the 3D model, and the areas of the bio-ink that are
exposed to this patterned light crosslink to form the final object. The process is repeated for
each 2D layer, building the object up finally in a layer-by-layer format. Figure 6C shows
images of the nanocomposite GelMA/ZIF-8 hydrogels printed with various 3D models
along with their compressibility. Figure 6D shows bio-printed GelMA/ZIF-8 hydrogels
encapsulated with hASCs with the Calcein AM stained cells, showing the presence of
healthy cells along the thickness of the GelMA/ZIF-8 hydrogel. Furthermore, the bio-
 bioink is placed above a DLP projector, which projects a pattern of light onto the bio-ink.
The pattern of light corresponds to the 2D image sliced from the 3D model, and the areas
of the bio-ink that are exposed to this patterned light crosslink to form the final object. The
process is repeated for each 2D layer, building the object up finally in a layer-by-layer
Gels 2023, 9, 923
format. Figure 6C shows images of the nanocomposite GelMA/ZIF-8 hydrogels printed 12 of 23
with various 3D models along with their compressibility. Figure 6D shows bio-printed
GelMA/ZIF-8 hydrogels encapsulated with hASCs with the Calcein AM stained cells,
showing the presence of healthy cells along the thickness of the GelMA/ZIF-8 hydrogel.
printed cells exhibited
Furthermore, a noticeable
the bio-printed increase in
cells exhibited proliferation
a noticeable over in
increase time (Figure 6E)
proliferation overwith
very
timefew dead cells
(Figure (Figure
6E) with veryS5),
fewdemonstrating the ability
dead cells (Figure of the designed
S5), demonstrating nanocomposite
the ability of the
hydrogels
designedto support and maintain
nanocomposite hydrogelscells for effective
to support bone repair.
and maintain cells for effective bone repair.

Figure 6. Feasibility and applicability of DLP-based 3D bio-printing of GelMA/ZIF-8 hydrogels

Figure 6. Feasibility and applicability of DLP-based 3D bio-printing of GelMA/ZIF-8 hydrogels
using various CAD-designed models. (A) Illustration of the strategy implemented in the fabrication
using
of 3Dvarious CAD-designed
structures models.3D
using a DLP-based (A)bio-printer.
Illustration(B)
ofGraphic
the strategy implemented
displaying in theoffabrication
the principle digital
of light
3D structures
processing using a DLP-based
(DLP)-based 3D bio-printer.
3D bio-printing (B) Graphic
technology. Thedisplaying the principle
light-sensitive of digital
liquid polymer
solution
light is placed
processing in a vat. A visible
(DLP)-based blue-light (405
3D bio-printing nm) projector
technology. The exposes a series liquid
light-sensitive of images onto the
polymer solu-
polymer
tion solution.
is placed TheA
in a vat. areas of polymer
visible solution
blue-light (405 that
nm)are exposedexposes
projector to the light crosslink
a series and solidify
of images onto the
into a single layer. The build platform moves up to allow each layer to stack and build the model.
polymer solution. The areas of polymer solution that are exposed to the light crosslink and solidify
into a single layer. The build platform moves up to allow each layer to stack and build the model.
(C) Photographs displaying various 3D printed nanocomposite hydrogels scaffolds. Scale bar in-
dicates 5 mm. Optical images showing elasticity of the 3D printed nanocomposite hydrogels after
deformation. (D) Images of designed model and 3D bio-printed structure showing a bright-field
microscopic image and fluorescent image of live cells. (E) Fluorescent images of live cells were
determined at different time points. (F) The proliferation of cells over time is influenced by variations
in cell seeding density. (Initial cell seeding number per well indicated as L: 0.5 × 104 , M: 1 × 104 , and
H: 2 × 104 ).

3. Conclusions
In conclusion, this study proves the printability of GelMA/ZIF-8 hydrogels developed
for bone regeneration. It was determined that, to effectively 3D print a structure, a concen-
tration of 15% GelMA is required along with a minimum of an 8 s exposure time at 80%
power intensity. Moreover, the designed nanocomposite formulation can also be used as a
coating agent for orthopedic metallic implants.
Gels 2023, 9, 923 13 of 23

Chemical characterization using FTIR and EDX analysis proved the presence of ZIF-8
in the hydrogel. Furthermore, the ZIF-8 nanoparticles reduced the hydrogel’s swelling
ratio, which is beneficial when used as an implant for treating non-load-bearing defects
(e.g., the calvarial defect). The presence of ZIF-8 nanoparticles in hydrogels also reduced
the rate of the degradation significantly, which may prolong cell support and infiltration
in vivo. This relatively low degradation rate should be exploited in vivo to evaluate the
effect of the nanocomposite hydrogel on therapeutic potential.
Additionally, ZIF-8 nanoparticles enhanced the mechanical strength and toughness
of the hydrogels, which could help prevent the premature degradation of the scaffolds.
In vitro cyto-compatibility of nanocomposite hydrogels revealed that there was a thresh-
old concentration of 3 mg/mL up to which ZIF-8 exhibits cyto-compatible characteristics.
Lastly, the incorporation of ZIF-8 nanoparticles significantly improved the osteogenic prop-
erties of the nanocomposite hydrogels in vitro. This enhancement was observed through
the up-regulation of key osteogenic markers, namely RUNX2 and OPN, which plays a
crucial role in promoting the osteogenic differentiation of stem cells. Furthermore, the
presence of ZIF-8 nanoparticles resulted in increased mineral depositions, further indicating
the enhanced osteogenic potential of the nanocomposite hydrogels. Through extensive
analysis, we demonstrate the remarkable potential of GelMA/ZIF-8 hydrogels in vari-
ous bio-medical applications, such as drug delivery (examples of therapeutics include
antimicrobial and antioxidant agents), 3D bio-printing, and coating metallic implants. We
would also like to acknowledge that in vivo experiments must be conducted in future to
further assess the bioactivity of our designed nanocomposite hydrogel. Taken together,
this newly developed ZIF-8 nanoparticle reinforced hydrogel with its multifaceted biomed-
ical properties including (i) controllable zinc ion release ability to facilitate bone repair,
(ii) ability to deliver antibiotic drugs, (iii) superior bio-compatibility with respect to stem
cell adhesion, proliferation, and differentiation, as well as (iv) 3D bio-printability of stem
cells, using visible light-induced crosslinking, make them an attractive candidate for use in
orthopedic implants and critical size bone defect therapy.

4. Materials and Methods

4.1. Preparation of GelMA Pregel Solution
GelMA was fabricated using established protocol [24]. In an Erlenmeyer flask, gelatin
at 10% w/v in PBS was stirred with a magnetic stir bar for 1 h at 60 ◦ C, until solubilized.
After dissolution of gelatin, methacrylic anhydride (0.8 mL/g of gelatin) was slowly added
dropwise to the polymer solution and was left to rotate for an additional 2 h at 60 ◦ C.
Next, the GelMA was diluted with heated PBS (100 mL) and the mixture was dialyzed for
about 1 week by using a dialysis membrane (12–14 kDa molecular weight cut-off) with
distilled water (50 ◦ C). The water was changed twice daily, to remove the toxic unreacted
methacrylic anhydride from the GelMA. The GelMA was stored in 50 mL-Falcons for
4 days at −80 ◦ C and subsequently freeze-dried.

4.2. Preparation of ZIF-8 Nanoparticles

ZIF-8 was synthesized following the literature with some modifications [31]. First,
150 mg of zinc nitrate hexahydrate was solubilized in 5 mL of DI water. Next, 330 mg of
2-methylimidazole was solubilized in 100 mL of methanol. Then, the two solutions were
combined and stirred overnight (12 h) at room temperature. The resultant solution was
centrifuged at 14,000 rpm for 30 min. Upon separation of the components, the precipitated
ZIF-8 nanoparticles were washed, re-suspended in methanol and centrifuged: this process
was repeated once more to remove unreacted species. The final pellet was resuspended in
ethanol and was dried for further use.
Gels 2023, 9, 923 14 of 23

4.3. Electron Microscopy to Determine Morphology of ZIF-8 Nanoparticles and GelMA/

ZIF-8 Hydrogels
To assess the topography of synthesized ZIF-8 nanoparticles, transmission electron
microscopy (TEM) was performed using a Philips 420 transmission microscope. To charac-
terize the morphology of synthesized GelMA and GelMA/ZIF-8 nanocomposite hydrogels,
scanning electron microscopy (SEM) was performed using Hitachi SU8230 and images
of the lyophilized (Labconco, Kansas, MO, USA) hydrogels were taken at an acceleration
voltage of 20 kV. Energy-dispersive X-ray (EDX) spectroscopy and elemental mapping were
also carried out using an X-Flash 6160 EDX detector (Bruker, ESPRIT analytical software,
Santa Barbara, CA, USA) to investigate the major components of the samples.

4.4. Zeta Potential and Dynamic Light Scattering (DLS) Analysis of ZIF-8 Nanoparticles
To determine the zeta potential and size distribution of ZIF-8 nanoparticles, dynamic
light scattering (DLS) was performed using Zetasizer Nano ZS instrumentation (Malvern
Instruments, Malvern, UK) at 25 ◦ C.

4.5. DLP-Based 3D Bio-Printing of GelMA/ZIF-8 Hydrogels

4.5.1. Preparation of Bio-ink
The pre-gel solution called bio-ink was prepared as follows. First, lyophilized GelMA
was solubilized in PBS (pH 7.4) to a 20% GelMA concentration in an oven at 70 ◦ C. Next, ZIF-
8 nanoparticles were weighed and suspended in a solution of ethanol to a concentration of
10 mg/mL. The solution was sonicated (505 Sonic Dismembrator, Fisher Scientific, Waltham,
MA, USA) at 15% amplitude for 1 min to ensure homogenization. Table 1 highlights the
amount of stock ZIF-8 that was dried in a 15 mL falcon tube per 300 µL of the GelMA
hydrogel solution, to achieve the desired concentration of the ZIF-8 in the final scaffold.
The ZIF-8 solution was dried in 15 mL falcon tubes overnight, while covered with parafilm
with fine holes to allow for airflow, while minimizing contamination. Once dried, 300 µL
of GelMA hydrogel solution was added to the falcon tube with dried ZIF-8 and sonicated
(15% power, 30 s) to obtain the final GelMA/ZIF-8 nanocomposite hydrogel mixture.

Table 1. Amount of 10 mg/mL ZIF-8 solution required to be dried to achieve desired ZIF-8 concen-
tration in a final 300 µL GelMA hydrogel formulation.

Desired ZIF-8 Conc. in GelMA Hydrogel Amount of 10 mg/mL ZIF-8 Solution

Formulation (mg/mL) Required (µL)
0.5 15
1 30
2 60
3 90

GelMA/ZIF-8 nanocomposite hydrogel formulations were prepared with varying

concentrations of ZIF-8 nanoparticles (0, 0.5, 1, 2, 3 mg/mL). Concentrations of the photo-
initiator, LAP (1% w/v) and photo-absorber, tartrazine (0.1% w/v) were kept constant for
every formulation. Table 2 illustrates the general scheme for preparation of the polymeric
hydrogel depending on the concentration of GelMA. Upon successfully preparing individ-
ual components, GelMA, LAP, tartrazine, and DI water were added to 15 mL falcon tubes
and vortexed to ensure all components were adequately mixed to create a homogenous
mixture of the bio-ink. The finalized GelMA hydrogel formulation was kept in the oven
at 50 ◦ C until ready to be used for 3D bio-printing. For formulations containing cells,
human derived adipose stem cells (hDASCs) were digested by 0.125% trypsin-EDTA and
centrifuged for 2 min. The GelMA/ZIF-8 nanocomposite hydrogels mixture was added to
hDASCs at a final density of approximately 2 × 106 cells mL−1 .
Gels 2023, 9, 923 15 of 23

Table 2. Preparation of polymeric hydrogel for 3D bio-printing.

Components Stock Conc. (% w/v) Component Conc. in Hydrogel (% v/v)

GelMA 20 5 10 15
LAP 8 1 1 1
Tartrazine 1 0.1 0.1 0.1

4.5.2. 3D Bio-Printing of GelMA/ZIF-8 Hydrogels Using LumenXTM

The Lumen XTM DLP Bio-printer (CELLINK) was used for fabricating the hydrogels.
Lumen XTM uses a visible light source at 405 nm and 10–30 mW/cm2 to crosslink polymers.
Polydimethylsiloxane (PDMS) dishes (CELLINK) were used to 3D bio-print the hydrogels.
The models for bio-printing were designed using an online computer-aided design (CAD)
software called Onshape (Format: accessed on 1 May 2023, [Link]
en/) and subsequently downloaded to LumenXTM . The printing process was initiated by
calibrating the build plate of the printer first. Upon completion of calibration, bio-printing
parameters were set to a fixed power of 80% (intensity range between 10–30 mW/cm2 ),
exposure time of 8 s, and first layer time scale factor of 4X to allow extra time for the cured
layer to gain contact with bio-printing dish and hydrogel. To print the 25 µL cylinder,
100 µL of the composed GelMA hydrogel was dispensed onto the Lumen X+TM –PDMS
Dish. Bio-printing occurred in a dark room as to avoid visible light interreference. After
the bio-printing was completed, the 3D hydrogel was removed from the build platform
with a plastic razor. For shape fidelity confirmation and comparison, visual analysis of
hydrogels was performed. The hydrogels were transferred to a blank background where
both height and diameter were measured to ensure that the printed hydrogel aligned
with set measurements of the fabricated structure created through OnShape. Through
visual analysis, recorded dimensions, and observed structural integrity of the 3D printed
hydrogel, an optimal GelMA hydrogel formulation was thus determined.

4.5.3. Lyophilization of Hydrogels

GelMA/ZIF-8 nanocomposite hydrogel solution was pipetted in 96 well plates and
crosslinked using visible light (405 nm) for 25 min to ensure sufficient crosslinking. The
hydrogels were carefully removed from the well plate by using curved forceps, placed in a
petri dish and covered with PBS and placed on a shaker for 12 h to remove unreacted com-
ponents. The hydrogels were transferred to a container and frozen at −80 ◦ C. Subsequently,
the frozen hydrogels underwent lyophilization using a Labconco system, USA.

4.5.4. Physical Characterization: Swelling

To compare swelling behaviour in the presence of ZIF−8 nanoparticles, dried 150 µL
GelMA and GelMA/ZIF-8 hydrogels (n = 5) were prepared and weighed. Swelling be-
haviour was assessed by placing dried hydrogels in a 24-well plate and soaking in PBS
(1 mL) at 37.5 ◦ C. Equilibrium swelling was determined by weighing the swollen hydro-
gels at 30-min intervals for a total of 5 h. For each time point, the swelling ratio (%) was
calculated using the following equation:
• Equation (1): Swelling Ratio (%)

( W s − Wo )
Swelling Ratio(%) = ∗ 100 (1)
Wo
where WS is the weight of the swollen hydrogel at specific time intervals and Wo is the
initial weight of the dried hydrogel.

4.5.5. Physical Characterization: Degradation

To compare degradation behaviour in the presence of ZIF-8 nanoparticles, dried 150 µL
GelMA and GelMA/ZIF-8 hydrogels (n = 5) were prepared and weighed as the initial
weight. The hydrogels were incubated in 24-well plates and were soaked in PBS (1 mL)
Gels 2023, 9, 923 16 of 23

with 1% p/s at 37.5 ◦ C for 2 weeks. On different days, the hydrogels were dehydrated and
weighed. The degradation rate (%) was calculated using the following equation:
• Equation (2): Degradation rate (%)

Wo − WD
Degradation rate(%) = ∗ 100 (2)
WD
where Wo is the initial weight of the dried hydrogel and WD is the weight of the dried
hydrogel at specific time intervals.

4.5.6. Chemical Characterization: Fourier Transformed Infrared (FTIR)

Fourier Transformed Infrared (FTIR) spectra were collected on a Nicolet Summit FTIR
Spectrometer (Thermo Fisher, Norristown, PA, USA). All FTIR experiments were performed
at room temperature and the spectra were recorded between 400 and 4000 cm−1 .

4.5.7. Mechanical Characterization of GelMA/ZIF-8 Hydrogels

Mechanical testing was performed using the Instron 3345 universal mechanical testing
machine (Instron, Norwood, MA, USA) to determine the compressive modulus of the
nanocomposite hydrogels and assessed under unconfined uniaxial compression with a
10 N load cell (n = 5). The analyzed samples were fabricated in a cylinder shape (diameter
of 6 mm and height of 3 mm: total volume of ~50 uL per sample). All mechanical tests were
performed on the swollen hydrogels and the diameter of samples was measured using
a calliper prior to the test to ensure exact dimensions of the samples. The compression
probes were covered with sandpaper to prevent the gel from sliding during the test. A
compression rate of 0.30 mm/min was used. The compressive modulus was measured
by fitting the linear region of the stress-strain slope, ranging between 1 and 15% strain.
Samples were compressed until fracture was measured directly with the Instron 3345. The
toughness was calculated from the area below the stress–strain curve until fracture. The
calculation used in the following equation:
• Equation (3): Toughness (kPa)
Z x
f
Toughness (kPa) = σ(x)dx (3)
x0

where x0 corresponds to the starting point of the strain, xf corresponds to the fracture point
of the strain, and σ corresponds to the starting point of the stress during compression.

4.6. Zinc Ion Release from ZIF-8 Nanoparticles

The Zn2+ release behaviour was performed by the zincon spectrophotometric (Sigma,
Cat. No. 96440, St. Louis, MI, USA) method following the manufacturer’s protocol [66,67].
To monitor the released Zn2+ from 3 mg/mL of ZIF-8, nanoparticles (n = 5) were soaked in
both PBS and DMEM with pH 7.4 at 37 ◦ C. During the process, the leaching liquor was
collected by centrifugation at 4000 rpm for 10 min and quantified by zincon spectropho-
tometry at 620 nm. The obtained standard curve was utilized to calculate the cumulative
release quantity of Zn2+ .

4.7. Antioxidant Release from GelMA/ZIF-8 Hydrogels

Antioxidant agents, such as ascorbic acid, can be incorporated into nanocomposite
hydrogels. To evaluate the antioxidant activity of the ascorbic acid-loaded nanocompos-
ite hydrogel, a 2,2-Diphenyl-1-picrylhydrazyl (DPPH) assay was performed with some
modifications [68]. First, ascorbic acid (10 µg/mL) was added to the lyophilized hydrogels
(volume = 150 µL) and allowed to incubate for 5 h. Subsequently, 200 µL of PBS was
placed onto the ascorbic acid-loaded nanocomposite hydrogels and left for another 5 h.
Different concentrations (10, 15 20, and 25 µg/mL) of the 180 µL DPPH solution were then
mixed with the 20 µL of supernatant obtained from the ascorbic acid-loaded nanocom-
Gels 2023, 9, 923 17 of 23

posite hydrogels (n = 5). The resulting mixture was allowed to stand for 30 min at 37 ◦ C
before measuring the OD517 . The percentage scavenging activity was calculated using the
following equation:
• Equation (4): % scavenging activity of DPPH

(A0 − A1)
 
% scavenging activity of DPPH = ∗ 100 (4)
A0
where A0 represents the absorbance of the control, and A1 represents the absorbance in the
presence of the samples.

4.8. Model Antibiotic Release from GelMA/ZIF-8 Hydrogel

To analyze the release of model antibiotic, vancomycin (EDM Millipore, USA) from
hydrogels, three concentrations of vancomycin (32, 64, and 96 µg/mL) were prepared in
PBS and added to each dried 150 µL of GelMA/ZIF-8 hydrogel (n = 3). Each hydrogel was
allotted 24 h to allow absorbance of vancomycin. The vancomycin-loaded hydrogels were
then placed in dialysis tubing (6–8 kDa molecular weight cut-off) and immersed in 1 mL
of PBS at 37.5 ◦ C and placed on a shaker. At desired time intervals, 2 µL of the PBS was
collected from the bulk solution surrounding the dialysis tubing for spectroscopic analysis
(Spark 20M Plate Reader, Tecan, USA) and analyzed at a wavelength of 281 nm to detect
the amount of released vancomycin in the surrounding solution. The collected solution
was then returned to the bulk to obtain a cumulative drug release profile. The released
vancomycin concentration was determined using a pre-established standard curve. The
GelMA/ZIF-8 without vancomycin served as blanks for drug-loaded hydrogels.
• Equation (5): Cumulative drug release (%)

weight of drug released

Culmuative drug release(%) = ∗ 100 (5)
weight of total drug

4.9. Antibacterial Efficacy of GelMA/ZIF-8 Hydrogel

Overnight cultures of E. coli DH5α were grown in LB medium (37 ◦ C, 210 RPM).
Cultures were pelleted at 13,000 g for 3 min and washed two times with phosphate-buffered
saline (PBS), pH 7.0, and resuspended in PBS. The optical density at 600 nm (OD600 ) of
this bacterial suspension was determined, and the bacteria were normalized to an OD600
equal to 0.1 in PBS. A 1 mL suspension of LB and the experimental groups (GelMA/ZIF-8
hydrogels at different concentration of vancomycin) were inoculated with 10 µL E. coli
(equal to OD600 of 0.01) in 13 mL tubes at 37 ◦ C with 210 RPM shaking for 24 h. The OD600
of bacterial cultures were measured for microbial growth. After culturing bacteria exposed
to GelMA/ZIF-8 and drug-loaded GelMA/ZIF-8, cultures were diluted to 1 × 10−6 in PBS.
100 µL of culture were plated onto LB-agar plates incubated at 37 ◦ C. Following 24 h of
incubation, the agar plates were imaged.

4.10. Coating Titanium Implants with GelMA/ZIF-8 Hydrogels

4.10.1. Preparation of Gyroid-Shaped Titanium Implants
A cylindrical primitive with the desired outer dimensions (diameter = 12 mm,
height = 6 mm) was produced using CAD and rasterized using VTK (Visualization Toolkit,
Kitware Inc., Clifton Park, NY, USA) into a binary image volume (voxel size = 0.025 mm
isotropic, dimensions = 501 × 501 × 261 voxels). Custom written Python code was used to
generate a binary image volume of a sheet-based gyroid lattice of unit-cells (lattice dimen-
sions = 2 × 2 × 1 unit-cells, unit-cell dimension = 6 × 6 × 6 mm) following the procedure
outlined in and with a desired porosity of 85% [69]. Wall thickness of the resultant gyroid
structure was nominally 0.300 mm and ranged from 0.250–0.350 mm. Image masking of
the gyroid lattice binary volume with the cylinder binary volume removed any gyroid
lattice structure falling outside the cylinder, thus producing a binary image of a gyroid
Gels 2023, 9, 923 18 of 23

lattice whose extents had been restricted to fall within confines of the cylinder dimensions.
Iso-surfacing the result of the Boolean operation produced a triangulated surface model of
the porous cylinder. Surface model triangle count and quality were reduced and improved,
respectively, using decimation and remeshing (Geomagic, 3D Systems, Rock Hill, SC, USA).
Output of the geometric improvements was an STL file that subsequently was sent for 3D
printing in titanium alloy.
Fabrication of the gyroid structure was carried out using laser-powder bed fusion
(LPBF) at an additive manufacturing facility (Additive Design in Surgical Solutions, London,
ON, Canada) using a commercial 3D metal printer (AM400, Renishaw plc, Wotton-under-
Edge, Gloucestershire, UK). Printing parameters were: laser power 200–400 W, scanning
speed 10,000–20,000 points/second, particle diameter 15–45 microns, spot size 70 microns.
After consolidation, the test components were heat treated (24-h cycle of stress relief, 850 ◦ C
for 1 h then passive cool down) to reduce residual stress.

4.10.2. Coating of Gyroids with GelMA/ZIF-8 Hydrogels

Gyroid-shaped implants were dip-coated with GelMA/ZIF-8 pre-gel formulations.
Subsequently, the dip-coated implants were exposed to blue-light at 405 nm for 10 min to
crosslink the pre-gel. The GelMA/ZIF-8 coated gyroids were then lyophilized and imaged
using SEM. Presence of zinc was also confirmed with EDX.

4.11. Cyto-Compatibility and Bio-Functionality of GelMA/ZIF-8 Hydrogels

4.11.1. In Vitro Cell Culture
Human adipose-derived stem cells (hASCs; Lot no. 1001002, Gibco, Grand Island, NY,
USA) were cultured following the manufacturer’s protocol. Briefly, the cells were incubated
at 37 ◦ C in a 5% CO2 incubator using MesenPRO RS™ (Gibco, Grand Island, NY, USA)
medium supplemented with 2% serum, 1% of p/s, and 200 mM L-glutamine (Thermo
Fisher Scientific, Norristown, PA, USA, ca 25030081). The medium was replaced every
3 days, and the cells were harvested using TrypLE™ Express without phenol red (Gibco,
Grand Island, NY, USA) and resuspended in fresh culture medium. Osteogenic medium
was prepared in MesenPRO RS™ supplemented with 1% p/s and 50 µM ascorbic acid
(Sigma, Ronkonkoma, NY, USA), 100 nM Dexamethasone, and 10 mM ß-glycerophosphate
(Sigma, Ronkonkoma, NY, USA).

4.11.2. Cell Proliferation and Cyto-Compatibility

To determine cell proliferation, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-
2-(4-sulfophenyl)-2H-tetrazolium (MTS; Promega, USA) assay was performed following
the manufacturer’s instructions. Briefly, the hydrogels were placed in a 96-well plate and
hASCs were seeded onto the hydrogels at a seeding density of 1 × 104 cells per well. The
cells were incubated for 24 h after which the culture media was replaced with 20 µL of MTS
reagent containing 100 µL of fresh culture media. The plate was then incubated at 37 ◦ C for
2 h and the absorbance was measured at 490 nm using a 96-well plate reader (Asys UVM
340 Scanning Microplate Reader, Biochrom Ltd., Cambridge, UK). Lastly, the morphology
of the cells was visualized by differential interference contrast (DIC) microscopy (IX81,
Olympus, Westborough, MA, USA).

4.11.3. Determining Cell Viability by Calcein Acetoxymethyl (Calcein-AM) Staining

To determine cell viability in the presence of GelMA/ZIF-8 hydrogels, calcein-AM
(Thermo Fisher, Ronkonkoma, NY, USA) was performed following the manufacturer’s
instructions. 20 µL of GelMA hydrogel with various concentrations of ZIF-8 nanoparticles
were placed into a 96-well plate. The pre-gel was then crosslinked using visible light
(405 nm) at 10-min exposure. The crosslinked hydrogels were then washed three times
with fresh PBS for 18 h to remove unreacted components and tartrazine. hASCs were
seeded onto the crosslinked hydrogel at a density of 1 × 104 cells per well. On day 1, 2 µM
Gels 2023, 9, 923 19 of 23

calcein AM was added to hASCs and incubated for 20 min at 37 °C. The live cells were
imaged using fluorescence microscopy (IX81, Olympus, Westborough, MA, USA).

4.11.4. Determining Osteogenic Differentiation of Stem Cells Using Alizarin Red S

(ARS) Staining
Cells were fixed with 4% formalin for 10 min and then washed three times with PBS.
Alizarin red S solution (ARS, ScienCell, ARS Staining Quantification Assay, Catalog No.
8678, USA) was added for 30 min at room temperature and then the fixed cells were washed
with distilled water to remove excess of ARS solution. The ARS staining was imaged using
Nikon Eclipse Microscope (Nikon, Tokyo, Japan) and processed using the NIS elements
software from Nikon. To quantify the ARS, 10% acetic acid was added to the cells. After
10 min of incubation at 85 ◦ C, the cells with the acetic acid were centrifuged for 15 min
at 20,000× g. The supernatant was collected to other tubes and neutralized with 10%
ammonium hydroxide. 150 µL of each sample was added to a 96-well plate and the OD405
was read using Spark® multimode microplate reader from Tecan, San Jose, CA, USA.

4.11.5. Quantifying the Ability of GelMA/ZIF-8 Hydrogels to Promote Osteogenic

Differentiation of Stem Cells Using Real-Time Quantitative Polymerase Chain Reaction
(RT-qPCR) Analysis
Stem cells were cultured with experimental groups (control, 3D printed GelMA and
GelMA/ZIF-8 hydrogls) in 24-well plates in osteogenic medium for 21 days. Total RNA was
isolated using RNeasy Micro Kit (Qiagen, Hilden, Germany) and 150 µg RNA was reversed
transcribed to cDNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher
Scientific, Norristown, PA, USA) according to the manufacturer’s instructions. Gene ex-
pression was quantified by using TB Green Advantage qPCR premix (Takara, San Jose, CA,
USA). The expression of genes, including osteopontin (OPN) and runt-related transcription
factor-2 (RUNX2) which are known as the expression of a regulator of osteoblast differentia-
tion. Real-time PCR analysis was repeated three trials for each group. The gene expression
level of each target gene was calculated by the ∆∆CT method and was normalized to that
of the reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primers
sequences for the selected genes are shown in Table 3.

Table 3. Primer sequences used for RT-qPCR.

Gene Species Forward Primer Sequence (50 -30 ) Reverse Primer Sequence (50 -30 ) Ref.
OPN Human GTGCAGAGGAAACCGAAGAG TGTTTGCAGTGGTGGTTCTG [70]
RUNX2 Human CCCGTGGCCTTCAAGGT CGTTACCCGCCATGACAGTA [70]
GAPDH Human AACAGCACCCACTCCTC CATACCAGGAAATGAGCTTGACAA [71]

4.12. Evaluating Cell Viability in 3D Bio-printing through Live/Dead Cell Staining

To evaluate the cytotoxicity of nanocomposite hydrogels, a Live/Dead cell imaging
assay (Invitrogen by Thermo Fisher Scientific, Cat. No. R37601, Norristown, PA, USA)
was carried out. Briefly, hASCs were harvested using trypsin, and then they were gently
mixed with the pre-GelMA solution. Cells were seeded at a density of 1 × 104 cells per well
in a 96-well plate. After completing the crosslinking, we wash the hydrogels for 10 min
with culture media at 37 ◦ C and 5% CO2 . This step is essential for removing any unreacted
component and improving cell viability. Following this, hydrogels are cultured in fresh
culture media. The cells were then stained with the Live/Dead cell imaging kit for 1 day,
3 days, and 7 days.

4.13. Statistical Analysis

One-way ANOVA was used to determine statistical significance for studies with
more than two groups tested, such as cell proliferation study using MTS assay and RT-
qPCR analysis, and Tukey procedure for post hoc comparison. p < 0.05 was considered
statistically significant. A t-test was carried out when comparing the mean of two sets of
Gels 2023, 9, 923 20 of 23

data, for example, the quantification of the compressive module of GelMA and GelMA/
ZIF-8 hydrogels.

Supplementary Materials: The following supporting information can be downloaded at: https://
[Link]/article/10.3390/gels9120923/s1, Figure S1: Physicochemical characteristic of ZIF-8
nanoparticles. (A) The UV-Vis spectra analysis of ZIF-8 nanoparticles in water revealed that the
maximum absorption consistently occurred at 215 nm in different concentrations. (B) Visual represen-
tation the zinc ions release from ZIF-8 nanoparticles. ZIF-8 undergoes degradation, resulting in the
release of Zn ions and 2-Melm, in response to surrounding anions and acidic conditions. (C) Zn2+
release standard curve measured by a spectrophotometric method (n = 3); Figure S2: Optimizing
biomaterial formulation via 3D printing. (A) Printability of GelMA and GelMA/ZIF-8 nanocomposite
hydrogels at varying compositions. (B) Corresponding images of printable hydrogels. (C) Images of
unprintable hydrogels. Unprintable hydrogels were classified by their inability to retain their shape
and meet the dimensions of the desired structure (4 mm diameter, 2 mm height). (D) Corresponding
images of printable hydrogels. Corresponding height of printable hydrogels (n = 3). (E) Corre-
sponding diameter of printable hydrogels (n = 3); Figure S3: Optimizing the printing parameters
(power and intensity) of the LumenX+ DLP bioprinter. (A) Corresponding images of hydrogels
printed using various power (%) and time exposure (seconds). (B) Corresponding height of hydrogels
(n = 3). (C) Corresponding diameter of hydrogels (n = 3); Figure S4: The incorporation of antioxidant
agents into nanocomposite hydrogels significantly enhanced their antioxidant activity. A nanocom-
posite hydrogel was loaded with 10 µg/mL of ascorbic acid as an antioxidant agent (n = 3). The
antioxidant-loaded nanocomposite hydrogel demonstrated diverse scavenging activities in relation
to different concentrations of DPPH. The results indicated that as the concentrations of the DPPH
agents increased, the efficacy of %scavenging further improved, providing confirmation of antioxi-
dant activity in the nanocomposite hydrogel. * p-value < 0.05, ** p-value < 0.01, *** p-value < 0.001,
and **** p-value < 0.0001; Figure S5: Live/dead cell viability assay of hADS cells cultured with the
crosslinked GelMA/ZIF-8. The cells were cultured for 1 day, 3 day, and 7 days and then stained with
the Live/Dead cell imaging staining kit. The live and dead cells exhibited green and red fluorescence,
respectively. The scale bar represents 100 µm.
Author Contributions: Conceptualization, A.P., A.C. (Aishik Chakraborty) and C.-E.C.; Methodology,
investigation and analysis C.-E.C., A.C. (Ali Coyle), Y.S., K.H., H.A. and A.R.; Writing—original
draft, C.-E.C. with input from all authors; Writing—review & editing, A.C. (Aishik Chakraborty),
D.W.H. and A.P.; Supervision, A.P.; Funding acquisition, A.P. All authors have read and agreed to the
published version of the manuscript.
Funding: This research was funded by Canada Research Chairs Program of the Natural Sciences and
Engineering Research Council (NSERC) of Canada (CRC-2018-00028), NSERC Discovery Accelerator
Supplements (DAS), NSERC Discovery Grant, Early Research Award (ERA) from Province of Ontario,
and Wolfe-Western Fellowship.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are openly available in article.
Acknowledgments: Paul is thankful to the above-mentioned funding agencies for providing support.
Yasmeen Shamiya would like to acknowledge the funding and support from the Ontario Graduate
Scholarship (OGS), and Ali Coyle would like to acknowledge the funding and support from NSERC
Canada Graduate Scholarships—Masters program (CGS-M). Chakraborty is supported in part by
a Transdisciplinary Award from the Bone and Joint Institute, The University of Western Ontario,
Canada. The authors would also like to acknowledge Jacques Milner for designing the 3D titanium
gyroid structure, Reza Khazaee and the Biotron facility as at the University of Western Ontario for
transmission electron microscopy, and Surface Science Western for scanning electron microscopy. The
authors are also thankful to the company BioRender. Some images and illustrations were created
with [Link] (accessed on 1 September 2023).
Conflicts of Interest: The authors have no conflict of interest to declare.
Gels 2023, 9, 923 21 of 23

References
1. Bai, X.; Gao, M.; Syed, S.; Zhuang, J.; Xu, X.; Zhang, X.Q. Bioactive Hydrogels for Bone Regeneration. Bioact. Mater. 2018, 3,
401–417. [CrossRef] [PubMed]
2. Pedrosa, M.; Ferreira, M.T.; Luís, L.A.; Maria, M.P.; Curate, F. The Association of Osteochemometrics and Bone Mineral Density in
Humans. Am. J. Phys. Anthropol. 2021, 176, 434–444. [CrossRef]
3. Amini, A.R.; Laurencin, C.T.; Nukavarapu, S.P. Bone Tissue Engineering: Recent Advances and Challenges. Crit. Rev. Biomed.
Eng. 2012, 40, 363. [CrossRef]
4. McGovern, J.A.; Griffin, M.; Hutmacher, D.W. Animal Models for Bone Tissue Engineering and Modelling Disease. DMM Dis.
Model. Mech. 2018, 11, dmm033084. [CrossRef] [PubMed]
5. Xue, X.; Hu, Y.; Deng, Y.; Su, J. Recent Advances in Design of Functional Biocompatible Hydrogels for Bone Tissue Engineering.
Adv. Funct. Mater. 2021, 31, 2009432. [CrossRef]
6. Wang, W.; Yeung, K.W.K. Bone Grafts and Biomaterials Substitutes for Bone Defect Repair: A Review. Bioact. Mater. 2017, 2,
224–247. [CrossRef] [PubMed]
7. Kinaci, A.; Neuhaus, V.; Ring, D.C. Trends in Bone Graft Use in the United States. Orthopedics 2014, 37, e783–e788. [CrossRef]
[PubMed]
8. Lee, E.M.; Ibrahim, E.-S.H.; Dudek, N.; Lu, J.C.; Kalia, V.; Runge, M.; Srinivasan, A.; Stojanovska, J.; Agarwal, P.P. Improving MR
Image Quality in Patients with Metallic Implants. Radiographics 2021, 41, E126–E137. [CrossRef]
9. Roberts, T.T.; Rosenbaum, A.J. Bone Grafts, Bone Substitutes and Orthobiologics the Bridge between Basic Science and Clinical
Advancements in Fracture Healing. Organogenesis 2012, 8, 114–124. [CrossRef]
10. Cannio, M.; Bellucci, D.; Roether, J.A.; Boccaccini, D.N.; Cannillo, V. Bioactive Glass Applications: A Literature Review of Human
Clinical Trials. Materials 2021, 14, 5440. [CrossRef]
11. Dewi, A.H.; Ana, I.D. The Use of Hydroxyapatite Bone Substitute Grafting for Alveolar Ridge Preservation, Sinus Augmentation,
and Periodontal Bone Defect: A Systematic Review. Heliyon 2018, 4, e00884. [CrossRef] [PubMed]
12. Koshy, S.T.; Ferrante, T.C.; Lewin, S.A.; Mooney, D.J. Injectable, Porous, and Cell-Responsive Gelatin Cryogels. Biomaterials 2014,
35, 2477. [CrossRef] [PubMed]
13. Choi, C.E.; Chakraborty, A.; Coyle, A.; Shamiya, Y.; Paul, A. Contact-Free Remote Manipulation of Hydrogel Properties Using
Light-Triggerable Nanoparticles: A Materials Science Perspective for Biomedical Applications. Adv. Healthc. Mater. 2022,
11, 2102088. [CrossRef] [PubMed]
14. Chakraborty, A.; Alexander, S.; Luo, W.; Al-Salam, N.; Mia, O.V.; Sudhir, R.H.; Chakrabarti, S.; Paul, A. Engineering Multifunc-
tional Adhesive Hydrogel Patches for Biomedical Applications. Interdiscip. Med. 2023, 1, e20230008. [CrossRef]
15. Waters, R.; Pacelli, S.; Maloney, R.; Medhi, I.; Ahmed, R.P.H.; Paul, A. Stem Cell Secretome-Rich Nanoclay Hydrogel: A Dual
Action Therapy for Cardiovascular Regeneration. Nanoscale 2016, 8, 7371–7376. [CrossRef] [PubMed]
16. Chakraborty, A.; Roy, A.; Ravi, S.P.; Paul, A. Exploiting the Role of Nanoparticles for Use in Hydrogel-Based Bioprinting
Applications: Concept, Design, and Recent Advances. Biomater. Sci. 2021, 9, 6337–6354. [CrossRef] [PubMed]
17. Del Valle, L.J.; Díaz, A.; Puiggalí, J. Hydrogels for Biomedical Applications: Cellulose, Chitosan, and Protein/Peptide Derivatives.
Gels 2017, 3, 27. [CrossRef]
18. Xavier, J.R.; Thakur, T.; Desai, P.; Jaiswal, M.K.; Sears, N.; Cosgriff-Hernandez, E.; Kaunas, R.; Gaharwar, A.K. Bioactive
Nanoengineered Hydrogels for Bone Tissue Engineering: A Growth-Factor-Free Approach. ACS Nano 2015, 9, 3109–3118.
[CrossRef]
19. Merino, S.; Martín, C.; Kostarelos, K.; Prato, M.; Vázquez, E. Nanocomposite Hydrogels: 3D Polymer-Nanoparticle Synergies for
on-Demand Drug Delivery. ACS Nano 2015, 9, 4686–4697. [CrossRef]
20. Sharma, G.; Thakur, B.; Naushad, M.; Kumar, A.; Stadler, F.J.; Alfadul, S.M.; Mola, G.T. Applications of Nanocomposite Hydrogels
for Biomedical Engineering and Environmental Protection. Environ. Chem. Lett. 2017, 16, 113–146. [CrossRef]
21. Sun, M.; Sun, X.; Wang, Z.; Guo, S.; Yu, G.; Yang, H. Synthesis and Properties of Gelatin Methacryloyl (GelMA) Hydrogels and
Their Recent Applications in Load-Bearing Tissue. Polymers 2018, 10, 1290. [CrossRef] [PubMed]
22. Pablos, J.L.; Jiménez-Holguín, J.; Salcedo, S.S.; Salinas, A.J.; Corrales, T.; Vallet-Regí, M. New Photocrosslinked 3D Foamed
Scaffolds Based on GelMA Copolymers: Potential Application in Bone Tissue Engineering. Gels 2023, 9, 403. [CrossRef]
23. Yue, K.; Trujillo-de Santiago, G.; Alvarez, M.M.; Tamayol, A.; Annabi, N.; Khademhosseini, A. Synthesis, Properties, and
Biomedical Applications of Gelatin Methacryloyl (GelMA) Hydrogels. Biomaterials 2015, 73, 254. [CrossRef] [PubMed]
24. Klotz, B.J.; Gawlitta, D.; Rosenberg, A.J.W.P.; Malda, J.; Melchels, F.P.W. Gelatin-Methacryloyl Hydrogels: Towards Biofabrication-
Based Tissue Repair. Trends Biotechnol. 2016, 34, 394. [CrossRef] [PubMed]
25. Zhao, H.; Liu, M.; Zhang, Y.; Yin, J.; Pei, R. Nanocomposite Hydrogels for Tissue Engineering Applications. Nanoscale 2020, 12,
14976–14995. [CrossRef] [PubMed]
26. Piao, Y.; You, H.; Xu, T.; Bei, H.P.; Piwko, I.Z.; Kwan, Y.Y.; Zhao, X. Biomedical Applications of Gelatin Methacryloyl Hydrogels.
Eng. Regen. 2021, 2, 47–56. [CrossRef]
27. Chakraborty, A.; Pacelli, S.; Alexander, S.; Huayamares, S.; Rosenkrans, Z.; Vergel, F.E.; Wu, Y.; Chakravorty, A.; Paul, A.
Nanoparticle-Reinforced Tough Hydrogel as a Versatile Platform for Pharmaceutical Drug Delivery: Preparation and in Vitro
Characterization. Mol. Pharm. 2023, 20, 767–774. [CrossRef]
Gels 2023, 9, 923 22 of 23

28. Basu, S.; Chakraborty, A.; Alkiswani, A.R.I.; Shamiya, Y.; Paul, A. Investigation of a 2D WS 2 Nanosheet-Reinforced Tough DNA
Hydrogel as a Biomedical Scaffold: Preparation and in Vitro Characterization. Mater. Adv. 2022, 3, 946–952. [CrossRef]
29. Jeong, J.; Kim, J.H.; Shim, J.H.; Hwang, N.S.; Heo, C.Y. Bioactive Calcium Phosphate Materials and Applications in Bone
Regeneration. Biomater. Res. 2019, 23, 4. [CrossRef]
30. Habibah, T.U.; Amlani, D.V.; Brizuela, M. Hydroxyapatite Dental Material; StatPearls Publishing: Treasure Island, FL, USA, 2021.
31. Li, H.; Li, M.; Ran, X.; Cui, J.; Wei, F.; Yi, G.; Chen, W.; Luo, X.; Chen, Z. The Role of Zinc in Bone Mesenchymal Stem Cell
Differentiation. Cell. Reprogram. 2022, 24, 80–94. [CrossRef]
32. Ciosek, Ż.; Kot, K.; Rotter, I. Iron, Zinc, Copper, Cadmium, Mercury, and Bone Tissue. Int. J. Environ. Res. Public Health 2023,
20, 2197. [CrossRef]
33. Sun, T.W.; Yu, W.L.; Zhu, Y.J.; Chen, F.; Zhang, Y.G.; Jiang, Y.Y.; He, Y.H. Porous Nanocomposite Comprising Ultralong
Hydroxyapatite Nanowires Decorated with Zinc-Containing Nanoparticles and Chitosan: Synthesis and Application in Bone
Defect Repair. Chem.-A Eur. J. 2018, 24, 8809–8821. [CrossRef] [PubMed]
34. Liang, N.; Ren, N.; Feng, Z.; Sun, Z.; Dong, M.; Wang, W.; Liu, F.; Sun, C.; Zhou, W.; Xing, Z.; et al. Biomimetic Metal−Organic
Frameworks as Targeted Vehicles to Enhance Osteogenesis. Adv. Healthc. Mater. 2022, 11, 2102821. [CrossRef] [PubMed]
35. Tyagi, N.; Wijesundara, Y.H.; Gassensmith, J.J.; Popat, A. Clinical Translation of Metal–Organic Frameworks. Nat. Rev. Mater.
2023, 8, 701–703. [CrossRef]
36. Öztürk, Z.; Filez, M.; Weckhuysen, B.M. Decoding Nucleation and Growth of Zeolitic Imidazolate Framework Thin Films with
Atomic Force Microscopy and Vibrational Spectroscopy. Chem.–A Eur. J. 2017, 23, 10915–10924. [CrossRef] [PubMed]
37. Cravillon, J.; Schröder, C.A.; Bux, H.; Rothkirch, A.; Caro, J.; Wiebcke, M. Formate Modulated Solvothermal Synthesis of ZIF-8
Investigated Using Time-Resolved in Situ X-Ray Diffraction and Scanning Electron Microscopy. CrystEngComm 2011, 14, 492–498.
[CrossRef]
38. Kaur, H.; Mohanta, G.C.; Gupta, V.; Kukkar, D.; Tyagi, S. Synthesis and Characterization of ZIF-8 Nanoparticles for Controlled
Release of 6-Mercaptopurine Drug. J. Drug Deliv. Sci. Technol. 2017, 41, 106–112. [CrossRef]
39. Luzuriaga, M.A.; Benjamin, C.E.; Gaertner, M.W.; Lee, H.; Herbert, F.C.; Mallick, S.; Gassensmith, J.J. ZIF-8 Degrades in Cell
Media, Serum, and Some—But Not All—Common Laboratory Buffers. Supramol. Chem. 2019, 31, 485–490. [CrossRef]
40. Spitsyna, A.S.; Poryvaev, A.S.; Sannikova, N.E.; Yazikova, A.A.; Kirilyuk, I.A.; Dobrynin, S.A.; Chinak, O.A.; Fedin, M.V.;
Krumkacheva, O.A. Stability of ZIF-8 Nanoparticles in Most Common Cell Culture Media. Molecules 2022, 27, 3240. [CrossRef]
41. Velásquez-Hernández, M.D.J.; Ricco, R.; Carraro, F.; Limpoco, F.T.; Linares-Moreau, M.; Leitner, E.; Wiltsche, H.; Rattenberger, J.;
Schröttner, H.; Frühwirt, P.; et al. Degradation of ZIF-8 in Phosphate Buffered Saline Media. CrystEngComm 2019, 21, 4538–4544.
[CrossRef]
42. Liu, Y.; Li, T.; Sun, M.; Cheng, Z.; Jia, W.; Jiao, K.; Wang, S.; Jiang, K.; Yang, Y.; Dai, Z.; et al. ZIF-8 Modified Multifunctional
Injectable Photopolymerizable GelMA Hydrogel for the Treatment of Periodontitis. Acta Biomater. 2022, 146, 37–48. [CrossRef]
[PubMed]
43. Yao, T.; Asayama, Y. Animal-Cell Culture Media: History, Characteristics, and Current Issues. Reprod. Med. Biol. 2017, 16, 99–117.
[CrossRef] [PubMed]
44. Zhao, X.; Sun, X.; Yildirimer, L.; Lang, Q.; Lin, Z.Y.; Zheng, R.; Zhang, Y.; Cui, W.; Annabi, N.; Khademhosseini, A. Cell Infiltrative
Hydrogel Fibrous Scaffolds for Accelerated Wound Healing. Acta Biomater. 2017, 49, 66. [CrossRef] [PubMed]
45. Xiang, L.; Cui, W. Biomedical Application of Photo-Crosslinked Gelatin Hydrogels. J. Leather Sci. Eng. 2021, 3, 1–24. [CrossRef]
46. Gibbs, D.M.R.; Black, C.R.M.; Dawson, J.I.; Oreffo, R.O.C. A Review of Hydrogel Use in Fracture Healing and Bone Regeneration.
J. Tissue Eng. Regen. Med. 2016, 10, 187–198. [CrossRef] [PubMed]
47. Akbari, M.; Khademhosseini, A. Tissue Bioprinting for Biology and Medicine. Cell 2022, 185, 2644–2648. [CrossRef] [PubMed]
48. Mantha, S.; Pillai, S.; Khayambashi, P.; Upadhyay, A.; Zhang, Y.; Tao, O.; Pham, H.M.; Tran, S.D. Smart Hydrogels in Tissue
Engineering and Regenerative Medicine. Materials 2019, 12, 3323. [CrossRef]
49. Liu, Y.; Zhu, Z.; Pei, X.; Zhang, X.; Cheng, X.; Hu, S.; Gao, X.; Wang, J.; Chen, J.; Wan, Q. ZIF-8-Modified Multifunctional
Bone-Adhesive Hydrogels Promoting Angiogenesis and Osteogenesis for Bone Regeneration. ACS Appl. Mater. Interfaces 2020, 12,
36978–36995. [CrossRef]
50. Liu, C.; Zeng, H.; Chen, Z.; Ge, Z.; Wang, B.; Liu, B.; Fan, Z. Sprayable Methacrylic Anhydride-Modified Gelatin Hydrogel
Combined with Bionic Neutrophils Nanoparticles for Scar-Free Wound Healing of Diabetes Mellitus. Int. J. Biol. Macromol. 2022,
202, 418–430. [CrossRef]
51. Shin, S.R.; Bae, H.; Cha, J.M.; Mun, J.Y.; Chen, Y.C.; Tekin, H.; Shin, H.; Farshchi, S.; Dokmeci, M.R.; Tang, S.; et al. Carbon
Nanotube Reinforced Hybrid Microgels as Scaffold Materials for Cell Encapsulation. ACS Nano 2012, 6, 362–372. [CrossRef]
52. Xavier Mendes, A.; Moraes Silva, S.; O’Connell, C.D.; Duchi, S.; Quigley, A.F.; Kapsa, R.M.I.; Moulton, S.E. Enhanced Elec-
troactivity, Mechanical Properties, and Printability through the Addition of Graphene Oxide to Photo-Cross-Linkable Gelatin
Methacryloyl Hydrogel. ACS Biomater. Sci. Eng. 2021, 7, 2279–2295. [CrossRef]
53. Kurian, A.G.; Singh, R.K.; Patel, K.D.; Lee, J.H.; Kim, H.W. Multifunctional GelMA Platforms with Nanomaterials for Advanced
Tissue Therapeutics. Bioact. Mater. 2022, 8, 267–295. [CrossRef] [PubMed]
54. Liu, J.; Zheng, H.; Poh, P.S.P.; Machens, H.G.; Schilling, A.F. Hydrogels for Engineering of Perfusable Vascular Networks. Int. J.
Mol. Sci. 2015, 16, 15997–16016. [CrossRef] [PubMed]
55. Ahearne, M. Introduction to Cell–Hydrogel Mechanosensing. Interface Focus 2014, 4, 20130038. [CrossRef] [PubMed]
Gels 2023, 9, 923 23 of 23

56. Heta, S.; Robo, I. The Side Effects of the Most Commonly Used Group of Antibiotics in Periodontal Treatments. Med. Sci. 2018,
6, 6. [CrossRef] [PubMed]
57. Xin, W.; Gao, Y.; Yue, B. Recent Advances in Multifunctional Hydrogels for the Treatment of Osteomyelitis. Front. Bioeng.
Biotechnol. 2022, 10, 865250. [CrossRef] [PubMed]
58. Pacelli, S.; Chakravarti, A.R.; Modaresi, S.; Subham, S.; Burkey, K.; Kurlbaum, C.; Fang, M.; Neal, C.A.; Mellott, A.J.; Chakraborty,
A.; et al. Investigation of Human Adipose-Derived Stem-Cell Behavior Using a Cell-Instructive Polydopamine-Coated Gelatin–
Alginate Hydrogel. J. Biomed. Mater. Res. Part A 2021, 109, 2597–2610. [CrossRef] [PubMed]
59. Dreiss, C.A. Hydrogel Design Strategies for Drug Delivery. Curr. Opin. Colloid Interface Sci. 2020, 48, 1–17. [CrossRef]
60. Hu, Y.; Li, H.; Lv, X.; Xu, Y.; Xie, Y.; Yuwen, L.; Song, Y.; Li, S.; Shao, J.; Yang, D. Stimuli-Responsive Therapeutic Systems for the
Treatment of Diabetic Infected Wounds. Nanoscale 2022, 14, 12967–12983. [CrossRef]
61. Paul, A.; Manoharan, V.; Krafft, D.; Assmann, A.; Uquillas, J.A.; Shin, S.R.; Hasan, A.; Hussain, M.A.; Memic, A.; Gahar-
war, A.K.; et al. Nanoengineered Biomimetic Hydrogels for Guiding Human Stem Cell Osteogenesis in Three Dimensional
Microenvironments. J. Mater. Chem. B 2016, 4, 3544–3554. [CrossRef]
62. Hoop, M.; Walde, C.F.; Riccò, R.; Mushtaq, F.; Terzopoulou, A.; Chen, X.Z.; de Mello, A.J.; Doonan, C.J.; Falcaro, P.; Nelson, B.J.;
et al. Biocompatibility Characteristics of the Metal Organic Framework ZIF-8 for Therapeutical Applications. Appl. Mater. Today
2018, 11, 13–21. [CrossRef]
63. Brokesh, A.M.; Gaharwar, A.K. Inorganic Biomaterials for Regenerative Medicine. ACS Appl. Mater. Interfaces 2020, 12, 5319–5344.
[CrossRef] [PubMed]
64. Balasubramanian, P.; Strobel, L.A.; Kneser, U.; Boccaccini, A.R. Zinc-Containing Bioactive Glasses for Bone Regeneration, Dental
and Orthopedic Applications. Biomed. Glas. 2015, 1, 51–69. [CrossRef]
65. O’Connor, J.P.; Kanjilal, D.; Teitelbaum, M.; Lin, S.S.; Cottrell, J.A. Zinc as a Therapeutic Agent in Bone Regeneration. Materials
2020, 13, 2211. [CrossRef] [PubMed]
66. Zeng, H.; Ran, J.; Shi, B. Rational Design of a Stable, Effective, and Sustainable Dexamethasone Delivery Platform on Ti
Implant—An Innovative Application of Metal Organic Framework in Bone Implants. Clin. Oral Implant. Res. 2018, 29, 204.
[CrossRef]
67. Yao, S.; Chi, J.; Wang, Y.; Zhao, Y.; Luo, Y.; Wang, Y. Zn-MOF Encapsulated Antibacterial and Degradable Microneedles Array for
Promoting Wound Healing. Adv. Healthc. Mater. 2021, 10, 2100056. [CrossRef] [PubMed]
68. Kocyła, A.; Pomorski, A.; Kr˛eżel, A. Molar Absorption Coefficients and Stability Constants of Zincon Metal Complexes for
Determination of Metal Ions and Bioinorganic Applications. J. Inorg. Biochem. 2017, 176, 53–65. [CrossRef]
69. Mukherjee, S.; Pawar, N.; Kulkarni, O.; Nagarkar, B.; Thopte, S.; Bhujbal, A.; Pawar, P. Evaluation of Free-Radical Quenching
Properties of Standard Ayurvedic Formulation Vayasthapana Rasayana. BMC Complement. Altern. Med. 2011, 11, 38. [CrossRef]
70. Jin, Y.; Kong, H.; Zhou, X.; Li, G.; Du, J. Design and Characterization of Sheet-Based Gyroid Porous Structures with Bioinspired
Functional Gradients. Materials 2020, 13, 3844. [CrossRef]
71. Tsao, Y.T.; Huang, Y.J.; Wu, H.H.; Liu, Y.A.; Liu, Y.S.; Lee, O.K. Osteocalcin Mediates Biomineralization during Osteogenic
Maturation in Human Mesenchymal Stromal Cells. Int. J. Mol. Sci. 2017, 18, 159. [CrossRef]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.