What is Bioinformatics?

Mathematics Computer
and Statistics Science

Biology
 What is bioinformatics?

A working definition is that of House of Representatives Standing

Committee on Primary Industries and Regional Services Inquiry :-
"All aspects of gathering, storing, handling, analyzing, interpreting and
spreading vast amounts of biological information in databases. The
information involved includes gene sequences, biological activity/function,
pharmacological activity, biological structure, molecular structure, protein-
protein interactions, and gene expression. Bioinformatics uses powerful
computers and statistical techniques to accomplish research objectives, for
example, to discover a new pharmaceutical or herbicide."
Areas of current and future development of bioinformatics
• Molecular biology and genetics
• Phylogenetic and evolutionary sciences
• Different aspects of biotechnology including pharmaceutical and
microbiological industries
• Medicine
• Agriculture
•Eco-management
Why bioinformatics?
• Exponential growth of investments
• Constant deficit of trained professionals
• Diversification of bioinformatics applications
• Need in different types of bioinformaticians
 Central Dogma of Molecular Biology

replication

GENOTYPE (i.e. Aa) GENE (DNA) ATGCAAGTCCACTGTATTCCA

transcription reverse tr
MESSENGER (RNA) UACGUUCAGGUGACAUAAGGG

translation
PROTEIN

PHENOTYPE (pink) TRAIT

 DNA
5’ A C G T C A T G 3’
3’ 5’ template
T G C A G T A C

Symbol Meaning Explanation

G G Guanine
A A Adenine
T T Thymine
C C Cytosine
R A or G puRine
Y C or T pYrimidine
N A, C, G or T Any base

RNA
Double helix 5’ A C G U C A U G 3’

U U Uracil
 Genetic Code

1. Amino acids are coded by codons – triplets of

nucleotides, e.g. |ACG|TAT|….
2. There are 43 = 64 codons for ~20 amino acids, the
code is degenerate
3. Codons do not overlap
4. Deletions or insertions of one or few nucleotides (not
equal to 3 x N) usually destroy a message by shifting
a reading frame
5. Three specific codons (stop codons) do not code any
amino acid and are always located at the very end of
the protein coding part of a gene
The 20 amino acids common in living
organisms
 PROTEINS

Green Fluorecent Protein (GFP)

1 mcgkkfelki dnvrfvghpt llqpphtiqa sktdpspkre lptmilfsvv falranadas

61 viscmhnlsr riaialqhee rrcqyltrea klmlamqdev ttiidsdgsp qspfrqilpk
121 cklardlkea ydslcttgvv rlhinnwlev sfclphkihr vggkhiplea lerslkairp
 Genomic Hierarchy in Eukaryotes

Genome nuclear (1)

Chromosomes (23x2)

DNA molecules (23x2)

Genes (~30,000); only a small fraction of genome

Nucleotides (~3x109)
 Brief history of bioinformatics: Databases

• The first biological database - Protein Identification Resource

was established in 1972 by Margaret Dayhoff
• Dayhoff and co-workers organized the proteins into families and
superfamilies based on degree of sequence similarity
• Idea of sequence alignment was introduced as well as special
tables that reflected the frequency of changes observed in the
sequences of a group of closely related proteins
• Currently there are several huge Protein Banks : SwissProt, PIR
International, etc.
• The first DNA database was established in 1979. Currently there
are several powerful databases: GenBank, EMBL, DDBJ, etc.
 Brief history of bioinformatics: other
important steps

• Development of sequence retrieval methods (1970-80s)

• Development of principles of sequence alignment (1980s)
• Prediction of RNA secondary structure (1980s)
• Prediction of protein secondary structure and 3D (1980-90s)
• The FASTA and BLAST methods for DB search (1980-90s)
• Prediction of genes (1990s)
• Studies of complete genome sequences (late 1990s –2000s)
 Collection and retrieval of data.
Alignment methods.

• Sequencing (DNA, proteins)

• Submission of sequences to the databases
• Computer storage of sequences
• Development of sequence formats
• Conversion of one sequence format to another
• Development of retrieval and alignment methods
 Prediction, reconstruction and
classification

• Prediction of secondary and 3D structure of RNA and proteins

• Gene prediction in prokaryotes and eukaryotes
• Prediction of promoters and other functional sites
• Reconstruction of phylogeny
• Genome analysis
• Classification of proteins and genes
 Prediction of RNA secondary structure:
an example

A. Single stranded RNA 5’ 3’

5’
B. Stem and loop or hairpin loop
3’
 Biomaterials
◼ A biomaterial is a nonviable material used
in a medical device, intended to interact
with biological systems.
◼ Defined by their application NOT chemical
make-up.
 Characteristics of Biomaterials

◼ Physical Requirements
◼ Hard Materials.
◼ Flexible Material.

◼ Chemical Requirements
◼ Must not react with any tissue in the
body.
◼ Must be non-toxic to the body.
◼ Long-term replacement must not be
biodegradable.
 Biomaterials Science

◼ Grow cells in culture.

◼ Apparatus for handling proteins in the
laboratory.
◼ Devices to regulate fertility in cattle.
◼ Aquaculture of oysters.
◼ Cell-silicon “Biochip”.
 Skin/cartilage
Drug Delivery
Devices
Ocular
Polymers implants

Orthopedic Bone
screws/fixation replacements

Heart
valves
Metals Synthetic Ceramics
BIOMATERIALS

Dental Implants Dental Implants

Semiconductor
Materials Biosensors
Implantable
Microelectrodes
 First Generation Biomaterials

◼ Specified by physicians using common

and borrowed materials.
◼ Most successes were accidental rather
than by design.
 Second Generation of Biomaterials

◼ Developed through collaborations of

physicians and engineers.
◼ Engineered implants using common and
borrowed materials.
◼ Built on first generation experiences.
◼ Used advances in materials science
(from other fields).
 Third generation implants

◼ Bioengineered implants using bioengineered

materials.
◼ Few examples on the market.
◼ Some modified and new polymeric devices.
◼ Many under development.
 Examples of Biomaterial
Applications

◼ Heart Valve
◼ Artificial Tissue
◼ Dental Implants
◼ Intraocular Lenses
◼ Vascular Grafts
◼ Hip Replacements
 Biocompatibility

◼ The ability of a material to elicit an

appropriate biological response in a
specific application by NOT producing
a toxic, injurious, or immunological
response in living tissue.
◼ Strongly determined by primary chemical
structure.
 Host Reactions to Biomaterials

◼ Thrombosis
◼ Hemolysis
◼ Inflammation
◼ Infection and Sterilization
◼ Carcinogenesis
◼ Hypersensitivity
◼ Systemic Effects
 What are some of the
Challenges?
◼ To more closely replicate complex tissue
architecture and arrangement in vitro.
◼ To better understand extracellular and
intracellular modulators of cell function.
◼ To develop novel materials and processing
techniques that are compatible with biological
interfaces.
◼ To find better strategies for immune
acceptance.
 Biomaterials - An Emerging
Industry

◼ Next generation of medical implants and

therapeutic modalities.
◼ Interface of biotechnology and traditional
engineering.
◼ Significant industrial growth in the next
15 years -- potential of a multi-billion
dollar industry.
 Biomaterials Companies

•Baxter International develops technologies related to the blood and circulatory system.

• Biocompatibles Ltd. develops commercial applications for technology in the field of biocompatibility.

• Carmeda makes a biologically active surface that interacts with and supports the bodys own control mechanisms

• Collagen Aesthetics Inc. bovine and human placental sourced collagens, recombinant collagens, and PEG-polymers

• Endura-Tec Systems Corp. bio-mechanical endurance testing ofstents, grafts, and cardiovascular materials

• Howmedica develops and manufactures products in orthopaedics.

• MATECH Biomedical Technologies, development of biomaterials by chemical polymerization methods.

• Medtronic, Inc. is a medical technology company specializing in implantable and invasive therapies.

• Molecular Geodesics Inc., biomimetic materials for biomedical, industrial, and military applications

• Polymer Technology Group is involved in the synthesis, characterization, and manufacture of new polymer products.

• SurModics, offers PhotoLink(R) surface modification technology that can be used to immobilize biomolecules

• W.L. Gore Medical Products Division, PTFE microstructures configured to exclude or accept tissue ingrowth.

• Zimmer, design, manufacture and distribution of orthopaedic implants and related equipment and supplies
Structure of the Eye
• Structure of the eye is an
important topic to understand
as it one of the important
sensory organs in the human
body.
• It is mainly responsible for
vision, differentiation of
colour (the human eye can
differentiate approximately
10 – 12 million colours) and
maintaining the biological
clock of the human body.
• The human eye can be
compared to a camera as both
works by gathering,
focusing, and transmitting
the light through the lens for
creating an image of an
object.
Structure and Functions of the Human Eye
• The human eyes are the most complicated sense organs in the human body.
• From the muscles and tissues to nerves and blood vessels, every part of the human eye is responsible for a
certain action.
• Furthermore, contrary to popular belief, the eye is not perfectly spherical; instead, it is two separate
segments fused together.
• It is made up of several muscles and tissues that come together to form a roughly spherical structure.
• From an anatomical perspective, the human eye can be broadly classified into the external structure and
internal structure.
The External Structure of an Eye
The parts of the eye that are visible externally include the following:-

• Sclera: It is a white visible portion. It is made up of dense connective tissue and

protects the inner parts.
• Conjunctiva: It lines the sclera and made up of stratified squamous epithelium. It
keeps our eyes moist and clear and provides lubrication by secreting mucus and tears.
• Cornea: It is the transparent, anterior or front part of our eye, which covers the pupil
and the iris. The main function is to refract the light along with the lens.
• Iris: It is the pigmented, coloured portion of the eye, visible externally. The main
function of the iris is to control the diameter of the pupil according to the light source.
• Pupil: It is the small aperture located in the centre of the Iris. It allows light to enter
and focus on the retina.
The Internal Structure of an Eye
The internal components of an eye are:
• Lens: It is a transparent, biconvex, lens of an eye. The lens is attached to the ciliary body
by ligaments. The lens along with cornea refracts light so that it focuses on the retina.
• Retina: It is the innermost layer of the eye. It is light sensitive and acts as a film of a
camera. Three layers of neural cells are present in them, they are ganglion, bipolar and
photoreceptor cells. It converts the image into electrical nerve impulses for the visual
perception by the brain.
• Optic nerve: It is located at the posterior portion of the eyes. The optic nerves carry all
the nerve impulses from the retina to the human brain for perception.
• Aqueous Humour: It is a watery fluid present between the cornea and the lens. It
nourishes the eye and keeps it inflated.
• Vitreous Humour: it is a transparent, jelly-like substance present between the lens and the
retina. It contains water (99%), collage, proteins, etc. The main function of vitreous
humour is to protect eyes and maintain its spherical shape.
Function of the
Human Eye
• As we mentioned earlier that
the eye of a human being is
like a camera.
• Much like the electronic
device, the human eye also
focuses and lets in light to
produce images.
• So basically, light rays that are
deflected from or by distant
objects land on the retina after
they pass through various
mediums like the cornea,
crystalline lens, aqueous
humor, the lens, and vitreous
humor.
• The concept here though is that as the light rays move through the various mediums, they experience
refraction of light.

• Refraction is nothing but the change in direction of the rays of light as they pass between different mediums.

• The table below shows the refractive indices of the various parts of the eye.

• Having different refractive indexes is what bends the rays to form an image.
• The light rays finally are received and focused on the retina.
• The retina contains photoreceptor cells called rods and cones and these basically detect the intensity and the
frequency of the light.
• Further, the image that is formed is processed by millions of these cells, and they also relay the signal or
nerve impulses to the brain via the optic nerve.
• The image formed is usually inverted but the brain corrects this phenomenon. This process is also similar to
that of a convex lens.

Important: Human eye is very important, and they play a distinct part in helps humans to see.
Structure of Ear
• Ears are one of the five
sensory organs of our
body.
• Other than hearing, the
main function is to
maintain the balance of
the body.
• The hair cells present in
the inner ear of
mammals help in
sensing the position of
the body, in accordance
with gravity and
maintain the
equilibrium.
 The ear has three main sections: the outer ear, middle ear and inner ear

Outer Ear
• Pinna is the outermost part, it has very fine hairs and glands. The glands secrete wax.
It protects foreign organisms and dust from entering.
• External auditory canal or meatus is connected to pinna at the outer side and
extends till tympanic membrane or eardrum. They also have wax glands.
• Tympanic membrane or eardrum is made up of connective tissue. Skin covers the
outer portion and from inside, it is covered by mucous membrane.

Pinna receives the sound in the form of vibration. The sound waves reach and vibrate the
eardrum through the external auditory canal.
 Middle Ear
• It contains a chain of three tiny bones malleus, incus and stapes, present in the same
order.
• Malleus: is a hammer-shaped bone, attached to the tympanic membrane.
• Incus: is an anvil-shaped bone, present between the malleus and stapes.
• Stapes: is the smallest bone of the body. It is stirrup-shaped and attached to the oval
window of the cochlea.
• The eustachian tube: is the connection between the middle ear and the pharynx. It
equalises pressure between the middle ear and the outer atmosphere.

The middle ear amplifies the sound waves and transmits to the inner ear.
Inner Ear
•The inner ear is called the labyrinth. It is composed of a group of interconnected canals and sacs.
•The membranous labyrinth is present inside the bony labyrinth and surrounded by a fluid known as perilymph.
•The endolymph is filled within the membranous labyrinth.
•Auditory receptors are located in the cochlea and vestibular apparatus maintains the body balance

Physiology of Ear
Ears perform two main functions, hearing and equilibrium maintenance.

• The organ of Corti (Cochlea) is responsible for hearing function.

• Maculae (Saccule and Utricle) are responsible for static equilibrium.
• Cristae (semicircular canals) are responsible for dynamic equilibrium.
Mechanism of Hearing
1. The pinna receives the sound waves and it reaches the tympanic membrane through the meatus.
2. The eardrum vibrates and these vibrations get transmitted to the three ossicles present in the middle ear.
3. Malleus, incus and stapes amplify the sound waves.
4. These vibrations then reach the perilymph (scala vestibuli) through the oval window.
5. Then the pressure waves get transferred to the endolymph of scala media and reach basilar membrane and
then to perilymph of scala tympani. This movement of fluid is facilitated by the round window present at the
end of scala tympani.
6. The basilar membrane movement causes rubbing of stereocilia against the tectorial membrane.
7. Stereocilia are bent resulting in the opening of ion channels in the plasma membrane of hair cells. Glutamate,
a neurotransmitter, is released due to Ca++ ion movement inside the cell.
8. These neurotransmitters bind to the receptors of afferent neurons, which synapse with hair cells causing
depolarisation of neurons. A nerve impulse is generated and transmitted to the auditory cortex of the brain
through the auditory nerve (cranial nerve VIII).
9. The brain analyses the impulses and we hear the sound. The brain not only recognises the sound but also
judges the direction, loudness and pitch of the sound.
Synthetic biology
Synthetic biology is a field of science that involves redesigning organisms for useful purposes by engineering
them to have new abilities. Synthetic biology researchers and companies around the world are harnessing the
power of nature to solve problems in medicine, manufacturing and agriculture.

What can synthetic biology do?

Redesigning organisms so that they produce a substance, such as a medicine or fuel, or gain a new ability, such
as sensing something in the environment, are common goals of synthetic biology projects. Some examples of
what scientists are producing with synthetic biology are:
▪ Microorganisms harnessed for bioremediation to clean pollutants from our water, soil and air.
▪ Rice modified to produce beta-carotene, a nutrient usually associated with carrots, that prevents vitamin
A deficiency. Vitamin A deficiency causes blindness in 250,000 - 500,000 children every year and greatly
increases a child's risk of death from infectious diseases.
▪ Yeast engineered to produce rose oil as an eco-friendly and sustainable substitute for real roses that
perfumers use to make luxury scents.

https://www.genome.gov/about-genomics/policy-issues/Synthetic-Biology#:~:text=Synthetic%20biology%20is%20a%20field,them%20to%20have%20new%20abilities.
Synthetic biology
• Synthetic biology can change the
genetic material in viruses, bacteria,
yeasts, plants, or animals to give them
useful new characteristics. For example,
integrating spider DNA makes a
silkworm produce super strong, ultra-
lightweight silk.
• The technology could help address
challenges in areas such as medicine,
agriculture, manufacturing, and the
environment.
• Some of the benefits of synthetic
biology and the challenges ahead. For
example, while it could be used to
engineer living cells that treat disease
from within the body, it could also be
used to make bioweapons.

https://www.gao.gov/products/gao-23-106648
• Synthetic biology can modify or create organisms to help address challenges in medicine, agriculture, manufacturing, and
the environment. This technology is already being used for commercial products, and recent advances in biotech and
computation have broadened its potential benefits. But it also may raise safety, national security, and ethical concerns.

• Synthetic biology is a multidisciplinary field of biotechnology that involves engineering the genetic material of
organisms—such as viruses, bacteria, yeast, plants, or animals—to have new characteristics. It has the potential to create
useful changes in crops, improved drugs, stronger materials, and more efficient industrial processes. Scientists are also
exploring the use of synthetic biology to address environmental challenges by engineering organisms to use carbon
dioxide, produce biofuels for vehicles, and transform methane into biodegradable plastics.

• Synthetic biology combines engineering principles with existing biotechnology techniques, such as DNA sequencing
and genome editing, to modify organisms or create new ones. Scientists use DNA sequencing to read the biological
information stored in DNA. As this technology becomes more accurate, faster, and cheaper, scientists are building
databases of DNA sequences to help them identify the biological functions of specific pieces of DNA. Complementing
this work, advances in computational tools such as artificial intelligence (AI) support rapid and iterative design and testing
cycles to replace time-consuming lab experiments. For example, synthetic biologists could use machine learning to better
predict the effect of changes they make to an organism.

• Once equipped with information about the DNA's function, synthetic biologists can edit or create the desired
genetic material within an organism using genome-editing tools such as CRISPR. Scientists can make these genetic
changes far more rapidly using synthetic biology than with earlier methods, such as selective breeding over multiple
generations. Moreover, synthetic biologists are able to retool organisms to have uses they do not currently exhibit in
nature. For example, scientists are engineering silkworms to produce spider silk rather than traditional silk (see fig. 1).
https://www.gao.gov/products/gao-23-106648
Figure 1. Potential applications of synthetic biology in four sectors. Source: https://www.gao.gov/products/gao-23-106648
Scientists are exploring emerging uses of synthetic biology across multiple fields. In medicine, experts are
considering synthetic biology techniques to develop the next generation of vaccines. Through optimal design of a key
molecule, synthetic biology could enable vaccines that are effective against a range of viruses and their variants. One
possible example would be a universal influenza vaccine. This technology could also enable a vaccine that does not
require refrigeration, making transport and distribution easier for resource-poor countries. Synthetic biology could also
improve drug discovery and development through rapid screening of DNA sequences to zero in on drug candidates
using AI and machine learning.

Synthetic biology applications could help reduce pollution and conserve ecosystems. For example, modified
bacteria could create nutrients for crops, reducing the need for industrial fertilizer, which can pollute water. Synthetic
biology also could serve as a useful conservation tool for invasive species control or aid of species at risk of extinction.
For example, scientists are trying to engineer endangered plants to be more resilient to non-native pests and diseases.
Scientists are also studying DNA modifications to make coral more resilient to warmer ocean temperatures.

Opportunities
• Widely adaptable. Synthetic biology holds the potential to help diagnose and treat diseases, improve industrial
processes, and address some environmental challenges.
• More equitable access to biotechnology. Some of the tools needed for synthetic biology are low-cost and widely
available, which could make access to beneficial applications more equitable.
• Conservation efforts. Synthetic biology could support endangered species conservation, for example, by altering the
genes of endangered plants to make them resilient to diseases.
https://www.gao.gov/products/gao-23-106648
Nanobiotechnology
Nanobiotechnology is a discipline in which tools from nanotechnology are developed and applied to study
biological phenomena. For example, nanoparticles can serve as probes, sensors or vehicles for biomolecule
delivery in cellular systems. (Source: https://www.nature.com/subjects/nanobiotechnology)

Nano-biotechnology, an applicable approach for sustainable future

• Nanotechnology is one of the most emerging fields of research within recent decades and is based upon the
exploitation of nano-sized materials (e.g., nanoparticles, nanotubes, nanomembranes, nanowires, nanofibers and so
on) in various operational fields.

• Nanomaterials have multiple advantages, including high stability, target selectivity, and plasticity. Diverse biotic (e.g.,
Capsid of viruses and algae) and abiotic (e.g., Carbon, silver, gold and etc.) materials can be utilized in the synthesis
process of nanomaterials.

• “Nanobiotechnology” is the combination of nanotechnology and biotechnology disciplines.

• Nano-based approaches are developed to improve the traditional biotechnological methods and overcome their
limitations, such as the side effects caused by conventional therapies.

• Several studies have reported that nanobiotechnology has remarkably enhanced the efficiency of various techniques,
including drug delivery, water and soil remediation, and enzymatic processes.
https://pmc.ncbi.nlm.nih.gov/articles/PMC8828840/
Figure: Nanobiotechnology in agriculture for combating nutrient deficiencies with nanotoxicity challenges.
https://www.mdpi.com/2071-1050/13/4/1781
Figure 3. Opportunities (in green) and challenges (in red) for nanobiotechnology in agriculture. Source: https://www.mdpi.com/2071-1050/13/4/1781
Fig: Diverse
Applications of
Nanobiotechnology:
multiple techniques,
including Drug
delivery-based
therapies,
remediating
processes, and
industrial nano-bio
catalysts benefit
from nano-scaled
particles

Source: https://pmc.ncbi.nlm.nih.gov/articles/PMC8828840/
Fig: Nano-based
drug delivery in the
therapies of
neurodegenerative
disorders: blood–
brain barrier (BBB)
is a noticeable
obstacle for
conventional
medicines; however,
drugs encapsulated
within nanoparticles
efficiently penetrate
through the BBB
and reach the central
nervous system
(CNS)