PHAGOCYTES, GRANULOCYTES, AND MYELOPOIESIS

GM-CSF and IL-4 induce dendritic cell differentiation and disrupt

osteoclastogenesis through M-CSF receptor shedding by up-regulation of TNF-␣
converting enzyme (TACE)
Masahiro Hiasa,1-3 Masahiro Abe,1 Ayako Nakano,1 Asuka Oda,1 Hiroe Amou,1 Shinsuke Kido,1 Kyoko Takeuchi,1
Kumiko Kagawa,1 Kenichiro Yata,1 Toshihiro Hashimoto,1 Shuji Ozaki,1 Kenzo Asaoka,2 Eiji Tanaka,3 Keiji Moriyama,4 and
Toshio Matsumoto1
1Department of Medicine and Bioregulatory Sciences, University of Tokushima Graduate School of Medical Sciences, Tokushima; 2Department of Biomaterials
and Bioengineerings, University of Tokushima Graduate School of Oral Sciences, Tokushima; 3Department of Orthodontics and Dentofacial Orthopedics,
University of Tokushima Graduate School of Oral Sciences, Tokushima; and 4Department of Maxillofacial Orthognathics, Tokyo Medical and Dental University,
Tokyo, Japan

Monocytes give rise to macrophages, os- deflection of OC and DC differentiation TACE inhibition robustly causes the re-
teoclasts (OCs), and dendritic cells (DCs). from monocytes. GM-CSF and IL-4 abol- sumption of the surface expression of
Macrophage colony-stimulating factor ished monocytic differentiation into OCs M-CSF receptor on monocytes, facilitat-
(M-CSF) and receptor activator of while inducing DC differentiation even in ing M-CSF–mediated phosphorylation of
nuclear factor-kappaB (RANK) ligand the presence of M-CSF and RANK ligand. M-CSF receptor and macrophage/OC dif-
induce OC differentiation from mono- GM-CSF and IL-4 in combination potently ferentiation while impairing GM-CSF– and
cytes, whereas granulocyte-macrophage up-regulate tumor necrosis factor-␣ IL-4–mediated DC differentiation from
colony-stimulating factor (GM-CSF) and (TNF-␣) converting enzyme (TACE) and monocytes. These results reveal a novel
interleukin-4 (IL-4) trigger monocytic dif- activity in monocytes, causing ectodo- proteolytic regulation of M-CSF receptor
ferentiation into DCs. However, regula- main shedding of M-CSF receptor, result- expression in monocytes to control M-
tory mechanisms for the polarization of ing in the disruption of its phosphoryla- CSF signaling and monocytic differentia-
monocytic differentiation are still unclear. tion by M-CSF as well as the induction of tion into macrophage/OC-lineage cells or
The present study was undertaken to osteoclastogenesis from monocytes by DCs. (Blood. 2009;114:4517-4526)
clarify the mechanism of triggering the M-CSF and RANK ligand. Interestingly,

Introduction
Monocytes can give rise to macrophages, osteoclasts (OCs), and important role in determination of monocytic differentiation into
dendritic cells (DCs).1-4 Macrophage colony-stimulating factor macrophages/OCs or DCs.
(M-CSF) triggers induction of the differentiation of monocytes into DCs are antigen-presenting cells, which contribute to the
macrophage/OC-lineage cells. The absence of M-CSF signaling elicitation of immune defense against various infectious patho-
reduces tissue macrophages and OCs, resulting in severe osteope- gens and tumors as well as the pathophysiology of autoimmune
trosis as demonstrated in mice lacking M-CSF (Csf1op/op)5 or its or allergic inflammatory diseases. Human monocytic differentia-
receptor (Csf1r⫺/⫺).6 Along with M-CSF, receptor activator of tion into DCs can be induced by granulocyte-macrophage
nuclear factor-kappaB ligand (RANKL) is required for formation, colony-stimulating factor (GM-CSF) in combination with other
activation, and survival of OCs.7,8 M-CSF in combination with cytokines including IL-4 in the context of physiologic or
RANKL, therefore, potently enhances osteoclastogenesis from pathologic conditions.12-14 Various cell populations such as
monocytes, whereas M-CSF alone induces macrophage differentia- T helper 2 lymphocytes,13 CD3⫺CD56bright natural killer cells,14
tion. Thus, M-CSF is a key factor for induction of the differentia- mast cells,15 and keratinocytes16 have been demonstrated to
tion of monocytes into macrophage/OC-lineage cells. Furthermore, synthesize the cytokines required for monocytic differentiation
macrophage/OC differentiation by M-CSF is enhanced by interleu- into DCs, including GM-CSF and IL-4. Cytokine cocktails that
kin-6 (IL-6) through up-regulation of M-CSF receptor (M-CSFR) can induce differentiation of human monocytes into DCs in vitro
expression in monocytes.9,10 On the other hand, tumor necrosis have been established.3,4,12 The most authentic and established
factor-␣ (TNF-␣) down-modulates M-CSFR expression to sup- cytokine combinations for induction of the differentiation of
press macrophage/OC differentiation by M-CSF and redirect the monocytes into DCs are GM-CSF and IL-4.
differentiation of monocytes into DCs.11 These observations sug- In contrast to the induction of macrophage/OC differentia-
gest that M-CSF signaling is controlled by the levels of M-CSFR tion from monocytes by M-CSF, GM-CSF and IL-4 in combina-
expressed on monocytes and that surface M-CSFR levels play an tion trigger DC differentiation from monocytes while potently

Submitted April 15, 2009; accepted August 26, 2009. Prepublished online as The publication costs of this article were defrayed in part by page charge
Blood First Edition paper, September 17, 2009; DOI 10.1182/blood-2009-04- payment. Therefore, and solely to indicate this fact, this article is hereby
215020. marked ‘‘advertisement’’ in accordance with 18 USC section 1734.

The online version of this article contains a data supplement. © 2009 by The American Society of Hematology

BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20 4517

4518 HIASA et al BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20

inhibiting their macrophage/OC differentiation.1,17-22 Thus, the according to the Declaration of Helsinki and using a protocol approved by
differentiation pathways toward macrophage/OCs or DCs from the Institutional Review Board of the University of Tokushima for human
monocytes appear to be mutually exclusive. There is consider- protection.
able evidence that M-CSF signaling suppresses the differentia-
In vitro osteoclastogenesis
tion of monocytes into DCs and skews the monocytic differentia-
tion toward OC/macrophage-lineage cells.9,10,23,24 However, the Human OCs were generated according to previously described proce-
regulatory mechanisms of the OC and DC differentiation from dures.25 Monocytes isolated from PBMCs were cultured at 5 ⫻ 105 cells/
monocytes as well as the role of GM-CSF and IL-4 in M-CSF mL in 24-well culture plates or on bone slices from a calf femur in 96-well
culture plates in complete alpha-MEM supplemented with 50 ng/mL rh
signaling in monocytes remain largely elusive. In the present
soluble RANK ligand and 500 U/mL rhM-CSF with replacement of half of
study, we therefore investigated mechanisms for the determina-
the medium and addition of cytokines every 3 days. Media were replen-
tion of differentiation of monocytes into OCs and DCs with ished twice a week. In vitro osteoclastogenesis was also investigated with
focus on M-CSF signaling. We demonstrate herein that GM-CSF rabbit bone cell assays, as previously described.25 In brief, long bones of
and IL-4 in combination, a potent DC-inducing cytokine 5-day-old white rabbits were minced, and bone particles were removed. The
cocktail, up-regulate TNF-␣ converting enzyme (TACE)/a disin- rabbit bone cells were seeded on bone slices in 96-well plates at
tegrin and metalloproteinase 17 (ADAM17) expression and 5 ⫻ 104 cells/well and cultured for 4 days in alpha-MEM containing 3%
activity in monocytes, causing cleavage of cell surface M-CSFR fetal bovine serum. To evaluate OC-like cell formation, cells were washed
that results in disruption of M-CSF signaling and inhibition of twice with phosphate-buffered saline (PBS) and stained for tartrate-
osteoclastogenesis from monocytes by M-CSF and soluble resistant acid phosphatase (TRAP) using a Leukocyte Acid Phosphatase kit
(Sigma). Pits formed on bone slices were then stained with acid hematoxy-
RANKL (sRANKL). Inhibition of TACE activity restores
lin (Sigma) for 5 minutes to visualize resorption pits. The cells and pits
macrophage/OC differentiation while impairing DC differentia-
were viewed under an Olympus BX50 microscope (Olympus) equipped
tion from monocytes by GM-CSF and IL-4. These observations with a UPlanFl 10⫻/0.30 objective lens (Olympus) to achieve an original
unveil the critical involvement of proteolytic regulation of magnification of ⫻100. The number of TRAP-positive multinucleated cells
surface M-CSFR for modulation of M-CSF signaling in were counted; the excavation areas were determined with a mesh glass
monocytes. installed in the ocular lens by counting the number of mesh squares
covering the pits to evaluate osteoclastic bone resorption, as previously
described.25

Methods Wright-Giemsa staining

Reagents To evaluate cellular morphology, cells were fixed and stained with Wright
solution for 5 minutes, followed by Giemsa solution diluted 1:10 in PBS for
The following reagents were purchased from the indicated manufacturers: 20 minutes.
recombinant human (rh) M-CSF, rhGM-CSF, rhIL-4, rh macrophage
inflammatory protein 1␣, rhM-CSFR/Fc chimera, mouse monoclonal anti– Flow cytometry
human dendritic cell–specific intercellular adhesion molecule-3-grabbing
nonintegrin (DC-SIGN) antibody, neutralizing mouse monoclonal anti– Cell preparation and staining for flow cytometry were performed as
human TNF-␣ antibody, biotinylated goat anti–human M-CSFR antibody, described previously.25 Approximately 106 cells were incubated in 100 ␮L
and phycoerythrin (PE)–conjugated mouse monoclonal anti–human M- of PBS with 2% human gamma-globulin with saturating concentrations of
CSFR antibody from R&D Systems; mouse monoclonal anti–human different FITC-conjugated monoclonal antibodies along with PE-
RANK antibody from IMGENEX; a TACE inhibitor, TAPI-0, from conjugated anti-CD14 antibody on ice for 40 minutes and then washed. Samples
Calbiochem; rh soluble RANK ligand from PeproTech; rabbit polyclonal were analyzed by flow cytometry using EPICS-Profile (Coulter
anti–human TACE antibody and rabbit monoclonal anti–human phosphory- Electronics).
lated M-CSFR antibody from Santa Cruz Biotechnology; PE-conjugated
Immunofluorescence staining
mouse monoclonal anti–human CD14 antibody, fluorescein isothiocyanate
(FITC)–conjugated mouse anti–human CD1a, FITC-conjugated mouse For immunofluorescence staining, cells were cultured on glass coverslips
anti–human CD80, FITC-conjugated mouse anti–human CD86, and FITC- placed in 24-well plates. The cells were first fixed for 10 minutes with 4%
conjugated mouse anti–human leukocyte antigen DR from BD Pharmingen; formaldehyde in PBS and permeabilized with 0.1% Triton X-100 in PBS.
rabbit anti–␤-actin from Sigma; horseradish peroxidase (HRP)–conjugated After incubation for 20 minutes with 10% heat-inactivated normal human
anti–mouse immunoglobulin G (IgG), HRP-conjugated anti–goat IgG, and serum obtained from the same donors of monocytes, the cells were stained
HRP-conjugated anti–rabbit IgG from Cell Signaling Technology; rhoda- with rhodamine-labeled phalloidin at 10 ␮g/mL PBS, followed by staining
mine-labeled phalloidin from Molecular Probes; and 4⬘,6-diamidino-2- of DNA in nuclei by adding DAPI at 10 ␮g/mL PBS. Between each step,
phenylindole (DAPI) from Dojindo. coverslips were washed 3 times for 5 minutes in PBS. Observations were
performed by epifluorescence using a confocal fluorescence microscope
Cells and cultures (Axiovert 200M; Carl Zeiss).

Peripheral blood mononuclear cells (PBMCs) were isolated from healthy Measurement of soluble M-CSFR levels and TACE activity
volunteers as previously described.25 Monocytes were further purified from
After monocytes (106 cells/mL) have been cultured for 2 days alone or with
PBMCs with negative selection using Monocyte Negative Isolation Kit II
various combinations of cytokines, the cells and their conditioned media
(Miltenyi Biotec; ⬎ 95% of cells being positive for CD14). The cells were
were harvested, and soluble M-CSFR levels in the conditioned media and
cultured in minimum essential medium eagle-alpha modification (alpha-
TACE activity by the cell lysates were measured using Human M-CSFR
MEM; Sigma) with 10% heat-inactivated fetal bovine serum (Whittaker
Duoset (R&D Systems) and the InnoZyme TACE Activity Kit (Calbio-
Bioproducts), 100 U/mL of penicillin (Sigma), and 100 ␮g/mL of strepto-
chem), respectively.
mycin (Sigma; complete alpha-MEM). CD14⫹ monocytes were cultured in
complete alpha-MEM containing 50 ng/mL GM-CSF and 50 ng/mL IL-4 in
Western blot analysis
combination to obtain a population of immature DCs. Human MM cell
lines, U266 and RPMI8226, were obtained from ATCC. All procedures Cells were collected and lysed in lysis buffer (Cell Signaling) supplemented
involving human specimens were performed with written informed consent with 1mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail
BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20 M-CSFR SHEDDING AND DC DIFFERENTIATION BY TACE 4519

Table 1. Sequences of RT-PCR primers

Primers, 5ⴕ-3ⴕ
Sense Antisense PCR cycles

MMP1 TTCAGCTAGCTCAGGATGAC GCAGCATCGATATGCTTCAC 30

MMP2 CCGCCTTTAACTGGAGCAAA TTTGGTTCTCCAGCTTCAGG 30
MMP3 CAGGTGTGGAGTTCCTGATG GAGGTCCATAGAGGGACTGA 30
MMP7 TTTGATGGGCCAGGAAACAC ACTTGGTCCACCTGGTTCAA 30
MMP9 GAAGATGCTGCTGTTCAGCG ACTTGGTCCACCTGGTTCAA 30
MMP10 TTCTCCAGGCTGTATGAAGG GAAGGACAAAGCAGGATCAC 30
MMP11 CAGAGGCCCTAAAGGTATGG GACTCAGTGGGTAGCGAAAG 30
MMP24 GGCAGAACTGGTTAAAGTCC CTTCTGCCACACATCGAAAG 30
MMP25 CAGTGGCCACCATGCGTAAG AGTGAGTGTCCCCGGAGATG 30
MMP28 CGGATACCTCAATGAACAGG CGGTGTCTAGCAAACAAGTC 30
ADAM9 GGAGCTGTTCATTGTCGTAG GTCTCCACAGTGATTTGTCC 30
ADAM10 ACCAGATGACTGGTGTAGAG TCGGTCTGTGAAGACATAGG 30
ADAM12 CAAGACGGTACTGATGTCTC CTACCAACACGATCCGAATG 30
ADAM15 GGACGATCTCCCAATTAGCC CTGCTCCAGGGTATAGCTTC 30
ADAM17 ATTATTGGTGGTAGCAGATC GAGCCAACATAAGCTAATCC 30
ADAM19 ACCTCAGCTACGTCATCGAG ACTCCTCCAGACTGGTACAC 30
ADAM28 ACAGAACTTGCTGGAACGAC TCTCCCATTTCCACCAACTG 30
ADAM33 ACTACCAAGGGCGAGTAAGG TGAGAAGCTGGTCCACGTAG 30
TIMP1 AATTCCGACCTCGTCATCAG AAGCAATGAGTGCCACTCTG 30
TIMP2 ATGCAGATGTAGTGATCAGG CGTTGATGTTCTTCTCTGTG 30
TIMP3 GCAGATGAAGATGTACCGAG GTCTGTGGCATTGATGATGC 30
GAPDH TGTCTTCACCACCATGGAGAAGG GTGGATGCAGGGATGATGTTCTG 24

MMP1 indicates matrix metalloproteinase-1; ADAM, a disintegrin and metalloproteinase; TIMP, tissue inhibitor of metalloproteinase; and GAPDH, glyceraldehyde-3-
phosphate dehydrogenase.

solution (Sigma). Cell lysates and conditioned media were electrophoresed Phagocytic activity
in 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis gel and
blotted onto polyvinylidene difluoride membranes (Millipore). After block- Phagocytic activity was evaluated as described elsewhere.26 Briefly,
polystyrene microspheres of 1.75 ␮m in diameter (Fluoresbrite Carboxy
ing with 5% nonfat dry milk, the membranes were incubated with primary
YG Microspheres; Polysciences) were diluted 1:500 and incubated with
antibodies overnight at 4°C, followed by washing and addition of a
cells for 60 minutes at 37°C. Then the cells were washed 4 times with
horseradish-conjugated secondary antibody for 1 hour. The protein bands
ice-cold PBS, and ingestion of microspheres was analyzed under a confocal
were visualized with an Enhanced Chemiluminescence Plus Western
microscope (Axiovert 200M).
Blotting Detection System (Amersham Biosciences).

RT-PCR and quantitative real-time PCR Statistical analysis

Total RNA was extracted from cells using TRIzol reagent (Gibco BRL). For Statistical significance was determined by 1-way analysis of variance with
reverse transcription–polymerase chain reaction (RT-PCR), 2 ␮g of total Scheffe posthoc tests. The minimal level of significance was P equals .05.
RNA was reverse-transcribed with Superscript II (Gibco BRL) in a 20-␮L
reaction solution. One-tenth of the RT-PCR products was used for subse-
quent PCR analysis with 24 to 30 cycles of 95°C for 30 seconds, 58°C for Results
30 seconds, and 72°C for 30 seconds. The primers used are shown in
Table 1. Real-time PCR was performed using Platinum SYBR Green qPCR GM-CSF and IL-4 in combination abolish osteoclastogenesis
SuperMix UDG with Rox (Invitrogen Life Technologies) with the follow- induced by M-CSF and sRANKL
ing amplification program: 1 cycle of 50°C for 2 minutes and 95°C for
2 minutes and 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. When monocytes isolated from peripheral blood mononuclear cells
The reaction was followed by a melting curve protocol according to the were cultured in the presence of M-CSF and sRANKL, multinucle-
specifications of the ABI 7300 instrument (Applied Biosystems). The ated cells were formed as described before.25 These cells met the
primers used were as follows: human M-CSFR sense 5⬘-CTACACGGTTCA- criteria for mature OCs, including positive staining for TRAP,
GAGCGACG-3⬘ and antisense 5⬘-AGGATGCCAGGGTAGGGATT-3⬘;
calcitonin receptor expression, ability to form resorption pits on
human RANK sense 5⬘-TTGCAGCTCAACAAGGACAC-3⬘ and antisense
5⬘-AGCTGGCAGAGAAGAACTGC-3⬘; human osteoprotegerin sense 5⬘-
dentine slices, and dose-dependent suppression of pit formation by
GTGAGGAGGCATTCTTCAGG-3⬘ and antisense 5⬘-TTCTTGTGAGCT- calcitonin (supplemental Figure 1A-D, available on the Blood
GTGTTGCC-3⬘. Human GAPDH was used as a housekeeping gene for website; see the Supplemental Materials link at the top of the online
quantity normalization (sense 5⬘-AATCCCATCACCATCTTCCA-3⬘, anti- article). M-CSF and sRANKL in combination skewed monocytic
sense 5⬘-TGGACTCCACGACGTACTCA-3⬘). differentiation almost completely toward TRAP-positive multinucle-
ated OCs, whereas differentiation into CD1a⫹, CD14⫺ DCs was
Transfection not induced (Figure 1 top panel). Interestingly, when GM-CSF and
TACE siRNA (5⬘-augaguuguaaccaggucagcuucc-3⬘ and 5⬘-ggaagcugaccug-
IL-4 were added together to monocytic cultures along with M-CSF
guuacaacucau-3⬘) and scrambled siRNA were purchased from Invitrogen. and sRANKL, monocytes were differentiated into immature DCs
siRNA (3 ␮g each) was transfected into human monocytes seeded in but not into OCs (Figure 1 bottom panel). These cells had no
24-well plates by electroporation using a Human Monocyte Nucleofector expression of CD14 and had high expression levels of DC markers,
Kit (Amaxa Biosystems). such as CD1a and DC-SIGN, and up-regulation of costimulatory
4520 HIASA et al BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20

Figure 1. GM-CSF and IL-4 in combination abolish oste-

oclastogenesis while inducing formation of immature
DCs. Monocytes were cultured in the presence of M-CSF and
sRANKL (top panels). GM-CSF and IL-4 in combination were
added to the monocytic cultures together with M-CSF and
sRANKL (bottom panels) with replacement of half of the
medium and addition of the cytokines every 3 days. The cells
were stained for TRAP at day 14 (left panels), and cell surface
CD1a and CD14 expression was analyzed at day 5 by flow
cytometry.

molecules, CD80 and CD86, and human leukocyte antigen DR lysates, whereas a smaller sized (⬃ 100 kDa) fragment of
(supplemental Figure 2). To determine whether these effects of M-CSFR accumulated in culture supernatants (Figure 2A),
GM-CSF and IL-4 are due to a transdifferentiation, we examined suggesting that GM-CSF and IL-4 enhanced cleavage of M-
the effects of the cytokine replacement on monocytic differentia- CSFR to release its extracellular domain into the medium. To
tion. Immature DCs were generated from monocytes after culturing further confirm ectodomain shedding of M-CSFR, M-CSFR
for 5 days in media containing 4-cytokine cocktail. Thus induced immunoreactivity was examined by enzyme-linked immunosor-
immature DCs were washed and cultured in the absence or bent assay (ELISA) in culture supernatants of monocytes.
presence of M-CSF and sRANKL. TRAP-positive multinucleated Treatment with GM-CSF and IL-4 up-regulated soluble M-
osteoclasts were formed at day 21 in the presence of M-CSF and CSFR levels approximately 3-fold in culture supernatants of
sRANKL (supplemental Figure 3). However, after monocytes had monocytes isolated from healthy donors (n ⫽ 12; Figure 2B).
been cultured for 5 days in media containing M-CSF and sRANKL, Treatment with GM-CSF and IL-4 did not result in an appre-
washed, and subsequently cultured in the presence of GM-CSF and ciable change in M-CSFR mRNA expression in monocytes as
IL-4, the cells still adhered to plastic dishes, formed multinucleated determined by real-time polymerase chain reaction (PCR;
cells, and no longer differentiated into CD1a⫹ DCs (data not
shown). Therefore, monocytes appear to lose the ability to differen-
tiate DCs after committing OC differentiation by M-CSF and
sRANKL, and the effects of GM-CSF and IL-4 are not due to a
transdifferentiation, whereas immature DCs retain a potential of
plasticity to differentiate into OCs. These results demonstrate that
monocytic differentiation into OCs or DCs by these combinations
of cytokines occurs in a mutually exclusive manner and that
GM-CSF and IL-4 in combination somehow block OC differentia-
tion signals by M-CSF and sRANKL and direct monocytic
differentiation into DCs.

GM-CSF and IL-4 in combination cleave membrane-bound

M-CSFR to shed its extracellular domain in monocytes

Because M-CSF is essential for OC/macrophage lineage commit-

ment and differentiation from monocytes and because RANKL
has been demonstrated to stimulate differentiation into DCs as
well as OCs, we investigated the mechanism of disruption of
M-CSF and sRANKL-mediated osteoclastogenesis from mono-
cytes by GM-CSF and IL-4 focusing on M-CSF signaling. Figure 2. GM-CSF and IL-4 in combination cleave membrane-bound M-CSFR in
Because GM-CSF and IL-4 abolished osteoclastogenesis in the monocytes. (A) Cell lysates and culture supernatants were harvested after culturing
monocytes for 48 hours in the presence or absence of GM-CSF and IL-4 in
presence of excessive M-CSF, we examined the possibility that combination. M-CSFR immunoreactivity was analyzed by immunoblotting with an
M-CSF signaling is attenuated by the combination of these antibody against an M-CSFR extracellular domain. (B) Monocytes isolated from
cytokines. We first examined M-CSFR expression in monocytes. healthy donors (n ⫽ 12) were cultured for 48 hours in the presence or absence of
GM-CSF and IL-4 in combination. Soluble M-CSFR levels in the culture supernatants
Immunoblotting with an antibody against the extracellular
were measured by ELISA. Data are expressed as means ⫾ SD; *P ⬍ .05. (C) M-
domain of M-CSFR revealed that GM-CSF and IL-4 in combina- CSFR mRNA expression in monocytes cultured for 6 hours in the absence or
tion potently down-regulated M-CSFR protein levels in cell presence of GM-CSF and IL-4 in combination was quantified by real-time PCR.
BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20 M-CSFR SHEDDING AND DC DIFFERENTIATION BY TACE 4521

TACE is responsible for ectodomain shedding of M-CSFR and

disruption of M-CSF signaling in monocytes

To clarify the role of TACE in ectodomain shedding of M-CSFR in

monocytes, we next examined the effects of a TACE inhibitor,
TAPI-0. Treatment with TAPI-0 dose-dependently reduced the
elevated levels of soluble M-CSFR in culture supernatants of
monocytes in the presence of GM-CSF and IL-4 in combination
(Figure 4A). At the same time, the TACE inhibition by TAPI-0
treatment restored the surface levels of M-CSFR suppressed by
GM-CSF and IL-4 in a dose-dependent manner (Figure 4B). To
further investigate the role of TACE in M-CSF signaling, we next
examined the effects of TACE inhibition on M-CSF–induced
phosphorylation of M-CSFR in monocytes in the presence or
absence of GM-CSF and IL-4. Addition of M-CSF induced
phosphorylation of M-CSFR in monocytes; GM-CSF and IL-4 in
combination abolished the M-CSFR phosphorylation in monocytes
by M-CSF (Figure 4C). However, addition of TAPI-0 resulted in
resumption of M-CSF–induced M-CSFR phosphorylation in the
presence of GM-CSF and IL-4 in combination. TNF-␣ is known to
down-modulate M-CSFR expression in monocytes11 and be shed
and activated by TACE. Therefore, we next examined the effects of
neutralizing anti–TNF-␣ antibody on M-CSFR expression on
Figure 3. GM-CSF and IL-4 in combination enhance TACE expression and
monocytes. The surface expression of M-CSFR on monocytes
activity in monocytes. (A) Monocytes were cultured for 6 hours in the presence or
absence of GM-CSF and IL-4 in combination. mRNA expression of a battery of known
sheddases and expression of their endogenous inhibitors in monocytes were
analyzed by RT-PCR. (B) Cell lysates were harvested after culturing monocytes for
48 hours in the presence or absence of GM-CSF and IL-4 in combination. TACE
immunoreactivity was analyzed by immunoblotting with an antibody against human
TACE. (C) Monocytes from 4 different donors were cultured for 48 hours in the
presence or absence of GM-CSF and IL-4 in combination or TPA. Total cell lysates
were prepared, and TACE activity in the cell lysates was measured using an internally
quenched fluorescent substrate for TACE in the InnoZyme TACE Activity Kit.
Fluorescence intensity was measured at an excitation wavelength of 320 nm and
emission wavelength of 405 nm by a fluorometer (Fluoroscan Ascent FL; Lab-
systems). Results were displayed in relative fluorescence units (RFU) per milligram
of protein (means ⫾ SD) according to the manufacturer’s instruction.

Figure 2C). These results demonstrate that down-modulation of

M-CSFR protein expression in monocytes by GM-CSF and IL-4
in combination is largely due to posttranslational ectodomain
shedding of M-CSFR.

GM-CSF and IL-4 in combination enhance TACE expression

and activity in monocytes

To identify sheddases responsible for M-CSFR ectodomain shed-

ding, we screened a battery of known sheddases and their
endogenous inhibitors in monocytes by reverse transcription (RT)–
PCR. Monocytes were treated for 6 hours with GM-CSF and IL-4
in combination or with TPA (12-O-Tetradecanoylphorbol 13-
acetate), which is known to induce various sheddases,27,28 as a
positive control. TACE (ADAM17) has been reported to be
required for TPA-induced shedding of M-CSFR ectodomain.27 The
expression of ADAM9, ADAM15, and ADAM19 and TACE Figure 4. TACE is responsible for ectodomain shedding of M-CSFR. (A) Mono-
mRNA was apparently up-regulated after treatment with GM-CSF cytes were cultured for 48 hours in the absence or presence of GM-CSF and IL-4 in
combination. TACE inhibitor, TAPI-0, was added at the indicated concentrations.
and IL-4 (Figure 3A). Among these sheddases, TACE mRNA Soluble M-CSFR levels in culture supernatants were measured by ELISA. Data are
expression was most prominently up-regulated, whereas expres- expressed as means ⫾ SD; *P ⬍ .05. (B) Surface expression of M-CSFR was
sion of its endogenous inhibitor, tissue inhibitor of metalloprotein- analyzed by flow cytometry. The levels of M-CSFR in the absence of GM-CSF and
IL-4 in combination are shown in gray. (C) Effects of TACE inhibition on phosphoryla-
ases-3 (TIMP-3),29 showed no appreciable change. TACE expres- tion of M-CSFR in monocytes in the absence or presence of GM-CSF and IL-4 in
sion was also up-regulated at protein levels by GM-CSF and IL-4 combination. Monocytes were cultured for 1 day in the absence or presence of
(Figure 3B). Consistently, TACE sheddase activity in monocytes GM-CSF and IL-4 in combination. TAPI-0 was added at 10␮M as indicated. After
stimulation with M-CSF for 5 minutes, the cells were fixed and stained with
was enhanced nearly 2-fold to a level similar to that observed by
antiphosphorylated M-CSFR antibody. Phosphorylated M-CSFR levels were ana-
TPA treatment (Figure 3C). Thus, GM-CSF and IL-4 in combina- lyzed by flow cytometry, and provided as a red line. Background staining with normal
tion enhance TACE expression and activity in monocytes. IgG is shown in gray.
4522 HIASA et al BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20

Figure 5. A TACE inhibitor restores OC formation and activation in

the presence of GM-CSF and IL-4. (A-D) Monocytes were cultured in
24-well culture plates (A,D) as well as on dentine slices in 96-well culture
plates (B-C) in quadruplicate for 21 days in the presence of M-CSF and
sRANKL. GM-CSF and IL-4 in combination were added to the monocytic
cultures together with M-CSF and sRANKL in the indicated wells. TAPI-0
and a soluble M-CSF receptor-Fc fusion protein were further added to
the indicated wells at 10␮M and 10 ␮g/mL, respectively. After culturing
for 21 days, the cells were stained for TRAP. Representative results in
24-well culture plates are shown panel A. The numbers of TRAP-
positive adherent cells with more than 5 nuclei (B) and pits (C) formed
on dentine slices in 96-well culture plates were counted. Data are
expressed as means ⫾ SD; *P ⬍ .05. (D) Actin and nuclei in the cells in
24-well culture plates were stained with rhodamine-labeled phalloidin
and DAPI, respectively. Samples were visualized with a confocal
microscope (Axiovert 200M) using Plan Apochromat 10⫻ objective.

almost completely disappeared upon treatment with GM-CSF and ery of OC formation and activity by TACE inhibition is dependent
IL-4 in combination, whereas the levels of sM-CSFR in their on M-CSF signaling. These results demonstrate that up-regulation
culture supernatants were elevated (supplemental Figure 4). The of TACE activity is responsible for inhibition of osteoclastogenesis
levels of surface M-CSFR expression on monocytes as well as by GM-CSF and IL-4 in combination through disruption of M-CSF
sM-CSFR in their culture supernatants remained unchanged by signaling by M-CSFR ectodomain shedding.
addition of anti–TNF-␣ antibody in the presence of GM-CSF and
IL-4, suggesting marginal contribution of TACE-mediated TNF-␣ TACE silencing suppresses M-CSFR shedding in monocytes
release from monocytes in our experimental conditions. These and restores OC formation and activation in the presence of
results suggest that up-regulation of TACE expression and activity GM-CSF and IL-4
is the mechanism by which GM-CSF and IL-4 enhance ectodomain
To further delineate the role of TACE in the regulation of M-CSF
shedding of M-CSFR and disrupt M-CSF signaling in monocytes.
signaling and osteoclastogenesis, we examined the effects of TACE
A TACE inhibitor restores M-CSF and RANKL-induced OC RNA silencing. Transfection with TACE siRNA reduced TACE in
formation and activation suppressed by GM-CSF and IL-4 monocytes by approximately 60% at protein levels. Immunoreactiv-
ity of M-CSFR by an antibody against an ectodomain of M-CSFR
If the enhanced ectodomain shedding of M-CSFR via up-regulation was markedly reduced by GM-CSF and IL-4 in cell lysates of
of TACE is the mechanism by which osteoclastogenesis is sup- monocytes transfected with control siRNA (Figure 6A). Transfec-
pressed by GM-CSF and IL-4, TACE inhibition should result in tion with TACE siRNA was able to partly restore the cellular
resumption of osteoclastogenesis in the presence of GM-CSF and M-CSFR levels down-regulated by GM-CSF and IL-4. Conversely,
IL-4. Addition of GM-CSF and IL-4 together with M-CSF and the TACE silencing significantly suppressed soluble M-CSFR
sRANKL almost completely inhibited the formation of TRAP- levels up-regulated by GM-CSF and IL-4 (Figure 6B). Suppression
positive multinucleated OCs and resorption pits on dentine slices of OC formation from monocytes by GM-CSF and IL-4 was also
(Figure 5A-C). However, addition of a TACE inhibitor, TAPI-0, restored, and large multinucleated OCs were formed by treatment
restored both OC and pit formation in the presence of GM-CSF and with TACE siRNA (Figure 6C), similar to those observed by
IL-4 in combination. Notably, OCs formed under the condition of TAPI-0 treatment (Figure 5A). Because GM-CSF and IL-4 up-
TACE inhibition were larger in size with an increased number of regulated the expression of sheddases other than TACE, although to
nuclei (Figure 5D) and showed a higher level of bone-resorbing a lesser extent (Figure 3A), we also examined the effects of RNA
activity per cell (Figure 5B-C). Importantly, such effects of TAPI-0 silencing of ADAM9, ADAM15, and ADAM19. However, RNA
were fully antagonized by M-CSF inhibition with a soluble M-CSF silencing of these sheddases did not result in any appreciable
receptor-Fc fusion protein (Figure 5A-C), indicating that the recov- changes in soluble M-CSFR levels in culture supernatants of
BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20 M-CSFR SHEDDING AND DC DIFFERENTIATION BY TACE 4523

experimental condition induced the formation of huge giant

multinucleated cells (Figure 7B bottom right) with actin ring
formation (Figure 7C bottom right), namely OCs. These results are
consistent with the notion that monocytes cannot be differentiated
into DCs by GM-CSF and IL-4 without TACE activity and that
TACE inhibition can convert DC differentiation from monocytes in
the presence of GM-CSF and IL-4 into macrophage/OC differentia-
tion. The results suggested that TACE plays a pivotal role in the
fate of differentiating monocytes, controlling their differentiation
into DCs (TACE dependent) or OCs (TACE inhibited). Thus, not
only GM-CSF and IL-4 signaling but also M-CSF signaling
suppression is required for monocytic differentiation into DCs.

Discussion
Cytokine and growth factor signaling is controlled by the amount
Figure 6. TACE silencing restores M-CSFR expression in monocytes and OC of relevant ligands as well as the expression levels of their cognate
formation and activation in the presence of GM-CSF and IL-4 in combination. receptors. TACE cleaves and releases various cell surface proteins
(A) Monocytes seeded at 106/mL in 24-well plates were transfected with TACE or from the plasma membrane, including cytokines and cytokine
scrambled siRNA and cultured in the presence or absence of GM-CSF and IL-4 in
combination. After culturing for 48 hours, cell lysates were harvested. M-CSFR receptors,32-35 which dramatically regulates the activity of cyto-
immunoreactivity was analyzed by immunoblotting with antibodies against M-CSFR kines as well as signal transduction through cytokine receptors.
extracellular domain. ␤-Actin was used as a loading control. (B) The monocytes M-CSF signaling is critical for induction of macrophage/OC
transfected with TACE or scrambled siRNA were cultured in quadruplicate in 96-well
plates for 2 days. Soluble M-CSFR levels in the culture supernatants were measured
differentiation and suppression of DC differentiation from mono-
by ELISA. Data are expressed as means ⫾ SD; *P ⬍ .05. (C) The monocytes cytes, and the signaling is finely controlled by the levels of
transfected with TACE or scrambled siRNA were cultured in the presence of M-CSF
and sRANKL. GM-CSF and IL-4 in combination and a soluble M-CSF receptor-Fc
fusion protein (10 ␮g/mL) were added to the indicated wells. After culturing for
21 days, the cells were stained for TRAP.

monocytes in the presence of GM-CSF and IL-4 in combination

(data not shown), suggesting minor contribution of these sheddases
to ectodomain shedding of M-CSFR in monocytes. Taken
together, the results indicate that TACE up-regulation in mono-
cytes plays a critical role in the disruption of osteoclastogenesis
by GM-CSF and IL-4.

TACE inhibition impairs GM-CSF– and IL-4–mediated DC

differentiation and induces macrophage/OC differentiation

Because the combination of GM-CSF and IL-4 is a well-known

inducer of DCs from monocytes while blocking osteoclastogenesis,
endogenous TACE up-regulation may have certain roles in differen-
tiation of monocytes into DCs. Therefore, we next examined the
effects of a TACE inhibitor on induction of DC differentiation from
monocytes. GM-CSF and IL-4 in combination induced immature
DCs with high expression levels of CD1a, DC-SIGN, and CD80 on
their surface and with no expression of CD14 (Figure 7A), which
were observed as villous mononuclear cells (Figure 7B top middle).
TAPI-0 treatment substantially reduced the number of CD1a⫹ DCs
in the presence of GM-CSF and IL-4 in combination (Figure 7A).
The levels of DC-SIGN and CD80 also decreased. These TAPI-0–
treated cells were multinucleated with vacuoles in their cytoplasm
(Figure 7B bottom middle) and showed an increase in phagocytic
activity with latex bead uptake in their cytoplasms without actin Figure 7. TACE inhibition impairs GM-CSF– and IL-4–mediated DC differentia-
ring formation, a hallmark of OCs30,31 (Figure 7C bottom middle), tion and induces macrophage/OC differentiation. (A) Monocytes were cultured in
suggesting differentiation into morphologically and functionally 24-well culture plates in the absence (top panels) or presence (middle panels) of
GM-CSF and IL-4 in combination. TAPI-0 was added at 10␮M together with GM-CSF
macrophage-like cells. We further examined the effects of TACE and IL-4 in combination (bottom panels). After culturing for 5 days, cells were
inhibition on monocytic differentiation by GM-CSF and IL-4 in analyzed by flow cytometry. (B-C) Monocytes were cultured for 14 days in 24-well
combination in the presence of M-CSF and sRANKL. Without culture plates alone or in the presence of GM-CSF and IL-4 in combination without or
with M-CSF and sRANKL. TAPI-0 was added at 10␮M (bottom panels). Cells were
TACE inhibition, GM-CSF and IL-4 in combination with M-CSF
fixed and visualized with Wright-Giemsa staining (B) or further incubated with FITC
and RANKL induced the formation of villous mononuclear imma- microspheres, followed by actin and nuclear staining (C). Green and red staining
ture DCs (Figure 7B top right). Addition of TAPI-0 in this represent a microsphere and an actin, respectively.
4524 HIASA et al BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20

exogenous M-CSF and its receptor expressed in monocytes. Cell of GM-CSF or IL-4 alone on osteoclastogenesis have been
surface M-CSFR levels have been demonstrated to be transcription- reported,1,21,22 but the results are inconsistent. Nevertheless, the
ally modulated by external stimuli such as interferon-␥,36 IL-6,9 levels of soluble M-CSFR in monocytes and the induction of DC
TNF-␣,11 and IL-4.37 In addition, the effect of GM-CSF on M-CSF differentiation from monocytes tended to be up-regulated in
responsiveness has been reported.38 In the present study, we response to GM-CSF or IL-4 alone in monocytes isolated from
demonstrated a critical role of posttranslational enzymatic regula- approximately half of donors. Representative results are shown in
tion in cell surface M-CSFR expression in monocytes, which supplemental Figure 6. When soluble M-CSFR levels were up-
controls the differentiational switch between DCs and macrophages/ regulated in monocytic cultures after treatment with GM-CSF or
OCs. The combination of GM-CSF and IL-4, a well-established IL-4, osteoclastogenesis from monocytes was disrupted in the
authentic DC inducer, was found to up-regulate TACE expression presence of M-CSF and sRANKL. In such cases, a TACE inhibitor
and activity in monocytes, causing cleavage of membrane-bound was able to resume osteoclastogenesis by M-CSF and sRANKL in
M-CSFR, which results in loss of its ligand-binding capacity and at the presence of GM-CSF or IL-4. Thus, the inconsistent up-
the same time shedding of its soluble form as a decoy receptor to regulation of TACE activity by GM-CSF or IL-4 alone among
interrupt binding of M-CSF to its cell surface receptor, thereby monocytes from different donors may at least in part explain the
drastically disrupting M-CSF signaling and osteoclastogenesis inconsistent effects of GM-CSF or IL-4 alone on osteoclastogenesis.
from monocytes. Elucidation of regulatory mechanisms for TACE expression in
The RANKL/RANK/osteoprotegerin axis has been shown to be monocytes by external stimuli is important for a better understand-
involved in the regulation of the bifurcated differentiation of ing of OC and DC induction in the context of physiologic and
monocytes into either DCs or OCs.1 However, the effects of pathologic settings. Malignant tumors residing in the bone includ-
GM-CSF and IL-4 in combination on RANK and osteoprotegerin ing multiple myeloma and bone metastatic cancers develop and
expression in monocytes has not been fully understood. We expand in the bone marrow and generate devastating bone destruc-
therefore examined RANK and osteoprotegerin expression with tion by enhanced OC formation and activity.46-50 In contrast to the
GM-CSF and IL-4 treatment. The surface RANK level on mono- enhanced osteoclastogenesis, the number and function of DCs are
cytes was partially reduced in the presence of GM-CSF and IL-4 in reciprocally reduced in these pathologic conditions, leading to
combination, although RANK mRNA expression in monocytes suppression of tumor immunity and susceptibility to infection.51,52
was up-regulated (supplemental Figure 5). On the other hand, These clinical features also significantly contribute to poor progno-
osteoprotegerin mRNA expression showed no appreciable change sis of patients with myeloma or bone metastatic cancers. Therefore,
by GM-CSF and IL-4 treatment. Interestingly, TACE inhibition amelioration of the deregulated differentiation of OCs and DCs is a
restored the surface levels of RANK under GM-CSF and IL-4 major clinical issue in such pathologic conditions. Up-regulation of
treatment, suggesting that RANK also undergoes TACE-mediated TACE by GM-CSF and IL-4 in combination is able to disrupt
cleavage. Such down-modulation of RANK may also be involved osteoclastogenesis enhanced by MM cells as well as macrophage
in induction of monocyte differentiation into DCs by GM-CSF and inflammatory protein 1␣, a major osteoclastogenic factor in
IL-4. However, even though inhibition of TACE restores surface multiple myeloma47,48 (supplemental Figure 7A-C). Therefore,
RANK levels, disruption of M-CSF signaling by GM-CSF and up-regulation of endogenous TACE activity in monocytes by
IL-4 can no longer induce monocyte differentiation into OCs in the GM-CSF and IL-4 or other stimulation factors may become a novel
presence of surplus RANKL (Figure 5A-C). These results are therapeutic approach to drive monocytic differentiation deflected to
consistent with the notion that M-CSF signaling is indispensable OC lineage into DC lineage in myeloma or metastatic bone
for commitment of monocyte differentiation into OCs, allowing diseases. Thus, the present observations demonstrate a pivotal role
subsequent induction of osteoclastogenesis by RANKL, and that of TACE in controlling the fate of differentiating monocytes into
the modulation of M-CSFR by TACE plays a critical role in the DCs or OCs and provide a molecular basis for the development of
regulation of bifurcated differentiation of monocytes into DCs or novel therapies against myeloma and other cancers in bone.
OCs. However, because cell surface RANKL in osteoblasts is
known to be cleaved by TACE, systemic TACE inhibition may also
affect the regulation of osteoclast formation and activity by bone Acknowledgments
marrow stromal cells through inhibition of TACE-mediated RANKL
shedding. This work was supported in part by Grants-in-Aid for Scientific
Because TACE inhibition significantly impaired DC differentia- Research (A) to T.M. and (C) to M.A. and for the 21st Century
tion from monocytes by GM-CSF and IL-4 in combination in both Center of Excellence Program from the Ministry of Education,
the presence and absence of M-CSF and sRANKL (Figure 7), Culture, Science and Sports of Japan, and a Grant-in-Aid for
up-regulation of TACE by GM-CSF and IL-4 appears to be Cancer Research (17-16) to M.A. from the Ministry of Health,
essential for facilitation of DC differentiation from monocytes. Labor and Welfare of Japan.
However, it is unclear from the present study how the up-regulation
of TACE by GM-CSF and IL-4 enhances DC differentiation from
monocytes. Because TACE cleaves a variety of cytokines and their Authorship
receptors, including TNF ligand/receptor family members,32,39-41
IL-1␤ receptor,42 IL-6 receptor,43 and Notch,44,45 there may be Contribution: M.H., M.A., and T.M. designed most of the experi-
TACE-dependent factors in monocytes responsible for DC differen- ments; M.H., A.N., K.T., K.K., K.Y., and T.H. contributed to
tiation. Further studies are needed to clarify this issue. collection of peripheral blood, isolation and culture of monocytes,
We found that GM-CSF and IL-4 in combination consistently and ELISA measurements; M.H., M.A., A.N., A.O., and H.A.
up-regulated TACE expression and soluble M-CSFR levels in contributed to immunoblotting and cell staining; M.H., M.A., A.O.,
parallel with abrogation of osteoclastogenesis in cultures with and H.A. contributed to flow cytometry; M.H., A.N., A.O., and
monocytes isolated from all donors (n ⫽ 12). Suppressive effects S.K. contributed to transfection; M.H., M.A., A.O., S.K., K.A.,
BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20 M-CSFR SHEDDING AND DC DIFFERENTIATION BY TACE 4525

E.T., K.M., and T.M. contributed to assays for osteoclastogenesis; Conflict-of-interest disclosure: The authors declare no compet-
M.H., M.A., A.O., K.Y., T.H., S.O., K.A., and E.T. contributed to ing financial interests.
DC differentiation and assays for phagocytosis; all authors ana- Correspondence: Masahiro Abe, Department of Medicine and
lyzed data, discussed the results, and helped to write the manu- Bioregulatory Sciences, University of Tokushima Graduate School
script; and M.H., M.A., K.M., and T.M. have mainly written the of Medicine, 3-18-15 Kuramoto-cho, Tokushima 770-8503, Japan;
manuscript. e-mail: [email protected].

References
1. Miyamoto T, Ohneda O, Arai F, et al. Bifurcation 16. Yu Y, Tang L, Wang J, et al. Psoriatic lesional ker- 29. Black RA. TIMP3 checks inflammation. Nat
of osteoclasts and dendritic cells from common atinocytes promote the maturation of human Genet. 2004;36(9):934-935.
progenitors. Blood. 2001;98(8):2544-2554. monocyte-derived Langerhans cells. Dermatol- 30. Teitelbaum SL. Osteoclasts: what do they do and
ogy. 2002;204(2):94-99. how do they do it? Am J Pathol. 2007;170(2):427-
2. Akagawa KS, Takasuka N, Nozaki Y, et al. Gen-
eration of CD1⫹RelB⫹ dendritic cells and tar- 17. Romani N, Gruner S, Brang D, et al. Proliferating 435.
trate-resistant acid phosphatase-positive oste- dendritic cell progenitors in human blood. J Exp 31. Faccio R, Novack DV, Zallone A, Ross FP,
oclast-like multinucleated giant cells from human Med. 1994;180(1):83-93. Teitelbaum SL. Dynamic changes in the oste-
monocytes. Blood. 1996;88(10):4029-4039. 18. Sallusto F, Lanzavecchia A. Efficient presentation oclast cytoskeleton in response to growth factors
3. Shortman K, Naik SH. Steady-state and inflam- of soluble antigen by cultured human dendritic and cell attachment are controlled by ␤3 integrin.
matory dendritic-cell development. Nat Rev Im- cells is maintained by granulocyte/macrophage J Cell Biol. 2003;162(3):499-509.
munol. 2007;7(1):19-30. colony-stimulating factor plus interleukin 4 and 32. Black RA, Rauch CT, Kozlosky CJ, et al. A metal-
downregulated by tumor necrosis factor ␣. J Exp loproteinase disintegrin that releases tumour-
4. Ardavin C. Origin, precursors and differentiation
Med. 1994;179(4):1109-1118. necrosis factor-␣ from cells. Nature. 1997;
of mouse dendritic cells. Nat Rev Immunol. 2003;
3(7):582-590. 19. Zhou LJ, Tedder TF. CD14⫹ blood monocytes can 385(6618):729-733.
differentiate into functionally mature CD83⫹ den- 33. Rocks N, Paulissen G, El Hour M, et al. Emerging
5. Yoshida H, Hayashi S, Kunisada T, et al. The mu- dritic cells. Proc Natl Acad Sci U S A. 1996;93(6):
rine mutation osteopetrosis is in the coding region roles of ADAM and ADAMTS metalloproteinases
2588-2592. in cancer. Biochimie. 2008;90(2):369-379.
of the macrophage colony stimulating factor
gene. Nature. 1990;345(6274):442-444. 20. Alnaeeli M, Park J, Mahamed D, Penninger JM, 34. Seals DF, Courtneidge SA. The ADAMs family of
Teng YT. Dendritic cells at the osteo-immune in- metalloproteases: multidomain proteins with mul-
6. Dai XM, Ryan GR, Hapel AJ, et al. Targeted dis- terface: implications for inflammation-induced tiple functions. Genes Dev. 2003;17(1):7-30.
ruption of the mouse colony-stimulating factor 1 bone loss. J Bone Miner Res. 2007;22(6):775-
receptor gene results in osteopetrosis, mono- 780. 35. Huovila AP, Turner AJ, Pelto-Huikko M,
nuclear phagocyte deficiency, increased primitive Karkkainen I, Ortiz RM. Shedding light on ADAM
21. Mangashetti LS, Khapli SM, Wani MR. IL-4 inhib- metalloproteinases. Trends Biochem Sci. 2005;
progenitor cell frequencies, and reproductive de-
its bone-resorbing activity of mature osteoclasts 30(7):413-422.
fects. Blood. 2002;99(1):111-120.
by affecting NF-␬B and Ca2⫹ signaling. J Immu-
7. Kong YY, Yoshida H, Sarosi I, et al. OPGL is a nol. 2005;175(2):917-925. 36. Delneste Y, Charbonnier P, Herbault N, et al.
key regulator of osteoclastogenesis, lymphocyte Interferon-␥ switches monocyte differentiation
22. Kitaura H, Nagata N, Fujimura Y, et al. from dendritic cells to macrophages. Blood. 2003;
development and lymph-node organogenesis.
Interleukin-4 directly inhibits tumor necrosis 101(1):143-150.
Nature. 1999;397(6717):315-323.
factor-␣-mediated osteoclast formation in mouse
8. Yasuda H, Shima N, Nakagawa N, et al. Oste- bone marrow macrophages. Immunol Lett. 2003; 37. Dello Sbarba P, Rovida E, Caciagli B, et al. Inter-
oclast differentiation factor is a ligand for osteo- 88(3):193-198. leukin-4 rapidly down-modulates the macrophage
protegerin/osteoclastogenesis-inhibitory factor colony-stimulating factor receptor in murine mac-
23. Lo AS, Gorak-Stolinska P, Bachy V, Ibrahim MA, rophages. J Leukoc Biol. 1996;60(5):644-650.
and is identical to TRANCE/RANKL. Proc Natl Kemeny DM, Maher J. Modulation of dendritic
Acad Sci U S A. 1998;95(7):3597-3602. cell differentiation by colony-stimulating factor-1: 38. Chen BD, Clark CR, Chou TH. Granulocyte/mac-
9. Chomarat P, Banchereau J, Davoust J, Palucka role of phosphatidylinositol 3⬘-kinase and delayed rophage colony-stimulating factor stimulates
AK. IL-6 switches the differentiation of monocytes caspase activation. J Leukoc Biol. 2007;82(6): monocyte and tissue macrophage proliferation
from dendritic cells to macrophages. Nat Immu- 1446-1454. and enhances their responsiveness to macro-
phage colony-stimulating factor. Blood. 1988;
nol. 2000;1(6):510-514. 24. De AK, Laudanski K, Miller-Graziano CL. Failure 71(4):997-1002.
10. Menetrier-Caux C, Montmain G, Dieu MC, et al. of monocytes of trauma patients to convert to im-
mature dendritic cells is related to preferential 39. Lum L, Wong BR, Josien R, et al. Evidence for a
Inhibition of the differentiation of dendritic cells
macrophage-colony-stimulating factor-driven role of a tumor necrosis factor-␣ (TNF-␣)-convert-
from CD34(⫹) progenitors by tumor cells: role of
macrophage differentiation. J Immunol. 2003; ing enzyme-like protease in shedding of
interleukin-6 and macrophage colony-stimulating
170(12):6355-6362. TRANCE, a TNF family member involved in oste-
factor. Blood. 1998;92(12):4778-4791.
oclastogenesis and dendritic cell survival. J Biol
11. Chomarat P, Dantin C, Bennett L, Banchereau J, 25. Abe M, Hiura K, Wilde J, et al. Osteoclasts en- Chem. 1999;274(19):13613-13618.
Palucka AK. TNF skews monocyte differentiation hance myeloma cell growth and survival via cell-
cell contact: a vicious cycle between bone de- 40. Peschon JJ, Slack JL, Reddy P, et al. An essen-
from macrophages to dendritic cells. J Immunol.
struction and myeloma expansion. Blood. 2004; tial role for ectodomain shedding in mammalian
2003;171(5):2262-2269.
104(8):2484-2491. development. Science. 1998;282(5392):1281-
12. Conti L, Cardone M, Varano B, Puddu P, 1284.
Belardelli F, Gessani S. Role of the cytokine envi- 26. Li X, Udagawa N, Takami M, Sato N, Kobayashi
Y, Takahashi N. p38 mitogen-activated protein 41. Solomon KA, Pesti N, Wu G, Newton RC. Cutting
ronment and cytokine receptor expression on the edge: a dominant negative form of TNF-␣ con-
generation of functionally distinct dendritic cells kinase is crucially involved in osteoclast differen-
tiation but not in cytokine production, phagocyto- verting enzyme inhibits proTNF and TNFRII se-
from human monocytes. Eur J Immunol. 2008; cretion. J Immunol. 1999;163(8):4105-4108.
38(3):750-762. sis, or dendritic cell differentiation of bone marrow
macrophages. Endocrinology. 2003;144(11): 42. Reddy P, Slack JL, Davis R, et al. Functional
13. Mariotti S, Sargentini V, Marcantonio C, et al. T- 4999-5005. analysis of the domain structure of tumor necro-
cell-mediated and antigen-dependent differentia- sis factor-␣ converting enzyme. J Biol Chem.
27. Rovida E, Paccagnini A, Del Rosso M, Peschon
tion of human monocyte into different dendritic 2000;275(19):14608-14614.
J, Dello Sbarba P. TNF-␣-converting enzyme
cell subsets: a feedback control of Th1/Th2 re-
cleaves the macrophage colony-stimulating factor 43. Althoff K, Reddy P, Voltz N, Rose-John S,
sponses. FASEB J. 2008;22(9):3370-3379.
receptor in macrophages undergoing activation. Mullberg J. Shedding of interleukin-6 receptor
14. Zhang AL, Colmenero P, Purath U, et al. Natural J Immunol. 2001;166(3):1583-1589. and tumor necrosis factor alpha: contribution of
killer cells trigger differentiation of monocytes into the stalk sequence to the cleavage pattern of
28. Wheeler DL, Ness KJ, Oberley TD, Verma AK.
dendritic cells. Blood. 2007;110(7):2484-2493. transmembrane proteins. Eur J Biochem. 2000;
Protein kinase Cepsilon is linked to 12-O-tetra-
15. Kitawaki T, Kadowaki N, Sugimoto N, et al. decanoylphorbol-13-acetate-induced tumor ne- 267(9):2624-2631.
IgE-activated mast cells in combination with crosis factor-alpha ectodomain shedding and the 44. Brou C, Logeat F, Gupta N, et al. A novel proteo-
pro-inflammatory factors induce Th2-promoting development of metastatic squamous cell carci- lytic cleavage involved in Notch signaling: the role
dendritic cells. Int Immunol. 2006;18(12):1789- noma in protein kinase Cepsilon transgenic mice. of the disintegrin-metalloprotease TACE. Mol
1799. Cancer Res. 2003;63(19):6547-6555. Cell. 2000;5(2):207-216.
4526 HIASA et al BLOOD, 12 NOVEMBER 2009 䡠 VOLUME 114, NUMBER 20

45. Merlos-Suarez A, Fernandez-Larrea J, Reddy P, tiple myeloma. Cancer Treat Rev. 2008;34(1):92- 51. Brown RD, Pope B, Murray A, et al. Dendritic
Baselga J, Arribas J. Pro-tumor necrosis factor-␣ 101. cells from patients with myeloma are numeri-
processing activity is tightly controlled by a com- 48. Matsumoto T, Abe M. Bone destruction in mul- cally normal but functionally defective as
ponent that does not affect notch processing. tiple myeloma. Ann N Y Acad Sci. 2006; they fail to up-regulate CD80 (B7-1) expression
J Biol Chem. 1998;273(38):24955-24962. 1068:319-326. after huCD40LT stimulation because of
46. Hideshima T, Mitsiades C, Tonon G, Richardson 49. Abe M, Hiura K, Wilde J, et al. Role for macro- inhibition by transforming growth factor-␤1
PG, Anderson KC. Understanding multiple my- phage inflammatory protein (MIP)-1␣ and MIP-1␤ and interleukin-10. Blood. 2001;98(10):2992-
eloma pathogenesis in the bone marrow to iden- in the development of osteolytic lesions in mul- 2998.
tify new therapeutic targets. Nat Rev Cancer. tiple myeloma. Blood. 2002;100(6):2195-2202. 52. Ratta M, Fagnoni F, Curti A, et al. Dendritic cells
2007;7(8):585-598. 50. Mundy GR. Metastasis to bone: causes, conse- are functionally defective in multiple myeloma:
47. Roodman GD, Dougall WC. RANK ligand as a quences and therapeutic opportunities. Nat Rev the role of interleukin-6. Blood. 2002;100(1):230-
therapeutic target for bone metastases and mul- Cancer. 2002;2(8):584-593. 237.