RESEARCH ARTICLE

Mechanism of down regulation of Na-H

exchanger-2 in experimental colitis
Amal Ali Soleiman, Farook Thameem, Islam Khan*
Department of Biochemistry, Faculty of Medicine, Kuwait University, Jabriya, Kuwait

* [email protected]

Abstract

Background
a1111111111
a1111111111 The Na-H exchanger [NHE] performs an electroneutral uptake of NaCl and water from the
a1111111111 lumen of the gastrointestinal tract. There are several distinct NHE isoforms, some of which
a1111111111 show an altered expression in the inflammatory bowel diseases (IBD). In this study, we
a1111111111 examined a role of NHE-2 in experimental colitis.

Methods
OPEN ACCESS Colitis was induced in male Sprague-Dawley rats by intra-rectal administration of trinitroben-
zenesulphonic acid (TNBS). On day 6 post-TNBS, the animals were sacrificed, colonic and
Citation: Soleiman AA, Thameem F, Khan I (2017)
Mechanism of down regulation of Na-H exchanger- ileal segments were taken out, cleaned with phosphate buffered saline and used in this
2 in experimental colitis. PLoS ONE 12(5): study.
e0176767. https://doi.org/10.1371/journal.
pone.0176767
Results
Editor: Mohamed T. Khayyal, Cairo University
Faculty of Pharmacy, EGYPT There was a significant decrease in the level of NHE-2 protein as measured by ECL western
Received: November 23, 2016 blot analysis and confocal immunofluorescence microscopy. The levels of NHE-2 mRNA
and heteronuclear RNA measured by an end-point RT-PCR and a real time PCR were also
Accepted: April 17, 2017
decreased significantly in the inflamed colon. However, there was no change in the level of
Published: May 11, 2017
NHE-2 protein in response to in vitro TNF-α treatment of uninflamed rat colonic segment.
Copyright: © 2017 Soleiman et al. This is an open These changes were selective and localized to the colon as actin, an internal control,
access article distributed under the terms of the
remained unchanged. Confocal immunofluorescence microscopy revealed co-localization
Creative Commons Attribution License, which
permits unrestricted use, distribution, and of NHE-2 and NHE-3 in the brush borders of colonic epithelial cells. Inflamed colon showed
reproduction in any medium, provided the original a significant increase in myeloperoxidase activity and colon hypertrophy. In addition, there
author and source are credited. was a significant decrease in body weight and goblet cells’ mucin staining in the TNBS
Data Availability Statement: All relevant data is treated colon. These changes were not conspicuous in the non-inflamed ileum.
within the paper.

Funding: This work was supported by the Kuwait

Conclusions
University Research Administration through a grant
(YM 12/15). These findings demonstrate suppression of NHE-2 expression on the brush borders in the
Competing interests: The authors have declared colonic epithelial cells which is regulated transcriptionally. However a role of TNF-α in the
that no competing interests exist. regulation of NHE-2 is discounted in the present model of colitis. This decrease in the NHE-

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 1 / 19

 Transport defect in IBD

2 expression will lead to a loss of electrolyte and water uptake thus contributing to the symp-
toms associated with IBD.

Introduction
Na+/H+ exchanger [NHE] is a transmembrane protein that catalyzes an electro neutral
exchange of extracellular Na+ for intracellular H+ [1–4]. It plays an important role in the regu-
lation of intracellular pH, cell volume and cell size. It contributes to a neutral uptake of NaCl
and water in the intestine and renal system [1–7]. Among ten different NHE isoforms, the iso-
forms NHE-2, NHE-3, and NHE-8 are localized to the apical membrane of epithelial cells and
play a major role in the absorption of NaCl from the GI lumen [8–16]. The NHE-3 isoform is
predominantly expressed in the ileum while NHE-2 is prevalent in the colonic mucosa and
crypt cells [15,16]. Although NHE-2 and NHE-3 contribute *50% exchange activity to ileal
Na+/H+, apical uptake of Na+ in the colon has been attributed to NHE-2 activity which is
abundant in the colonocytes and in crypt cells [11,14,16].
Rat NHE-2 polypeptide consisting of 813 aa is broadly organized into two major domains;
the N-terminus region [1–500 aa] and a regulatory C-terminus region [501–813 aa] having
potential sites for O-linked glycosylation [15]. The NHE-2 isoform has been shown to yield
two protein bands; the 85 kD an O-glycosylated, and a 75 kD as an unglycosylated NHE-2 pro-
tein [13–16]. Unlike NHE-3, the isoform NHE-2 does not recycle between the plasma mem-
brane and endosomes under different physiological conditions [16].
Various cis-acting elements have been identified in the NHE-2 gene promoter which regu-
late its expression under different conditions [17]. For example, a nuclear factor kappa-B [NF-
kB] binding site makes it respond to proinflammatory cytokines, infectious agents, and oxida-
tive stress. Therefore, high levels of pro-inflammatory cytokines, such as interferon-γ [IFN-γ],
tumor necrosis factor-α [TNF-α] in IBD might regulate NHE-2 expression leading to alter-
ation in the secretion and absorption of electrolytes in the inflamed colon [17–19]. It is inter-
esting to note that TNF-α decreases the expression and activity of NHE-2 in the intestinal
epithelial cell line, C2BBe1 [17]. This is consistent with previous investigations which have
shown a strong reduction in Na+ absorption in IBD patients [20–21]. Therefore it is possible
to speculate that altered expression and activity of NHE-2 could cause IBD, and that this
abnormality is regulated by TNF-α. Since both secretion and absorption of electrolytes are
altered in IBD, our hypothesis is that NHE-2 expression should alter in response to inflamma-
tion in rat colon.
In this study, we used an animal model of IBD induced in male Sprague-Dawley rats by
intra rectal administration of TNBS. The method of colitis induction in rat is well established
in this laboratory, and the present model has shown characteristics that mimic features of the
human IBD. In this study tissues from day 6 post-TNBS colitis were used.

Materials and methods

Induction of colitis
Male Sprague-Dawley rats weighing 200–250 gm obtained from the Faculty of Medicine Ani-
mal Facility were used in this study. The animals were housed in a 12-hourly day and night
cycle and provided with free access to normal food and water. The animals were treated in
accordance with the animal care guidelines of the Faculty of Medicine, Kuwait University. The
animals were divided into two groups; the colitis group in which each animal received

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 2 / 19

 Transport defect in IBD

trinitrobenzenesulphonic acid, TNBS [Fluka, Co] solution containing 30 mg TNBS dissolved

in 250 μl of 50% ethanol intra-rectally about 8 cm from the anal margin, and the control group
in which each animal received phosphate buffered saline [PBS] in a similar fashion [22–25].
The body weights of the animals were recorded prior to sacrifice on the day 6 post-TNBS
administration. The animals were sacrificed by cervical dislocation. Colonic and ileal segments
were taken out, and cleaned with PBS prior to use. In this study we used distal segments of the
colon and ileum. The protocol was approved by the Committee on the Ethics of Animal Exper-
iments of Kuwait University Faculty of Medicine.

Characterization of colitis
Colitis was characterized by measuring myeloperoxidase activity [MPO] following standard
methods [22–25]. Tissue segments were minced using a polytron [Brinkman Instruments Co.,
Westbury, NY], the MPO activity was measured in clarified tissue lysates, and expressed as
units per mg tissue [22–25]. MPO activity unit was defined as nmoles of H2O2 converted to
water per min per mg tissue.

Body weight and colon hypertrophy

Body weight [BW] of each animal was recorded before induction of colitis on day 0 and on
day 6 post-TNBS just before sacrifice. Changes in the BW on day 6 were calculated with
respect to their initial BW at day 0. Colon length and weights without feces were also measured
on day 0 and day 6 post-TNBS, and colon hypertrophy was expressed as weight [mg] per cm
length.

Histochemistry and goblet cell staining

Standard methods were used to fix tissues in paraformaldehyde and for embedding in paraffin
blocks [24]. Colon sections of 7 μm thickness were cut and stained with hematoxylin and eosin
dye solutions following standard deparaffinization, dehydration and rehydration steps [24].
For goblet cell staining, an alcian blue dye solution, pH 2.5 was used following standard
method [26]. After adding mounting solution, tissue sections were photographed using a
microscope attached camera.

Expression of NHE-2 protein

Tissue segments were chopped finely with scissors using 10 ml [per gm tissue] of ice cold
MOPS-sucrose (3 [N-Morpholino]propanesulfonic acid) buffer, pH 7.4 [22–25]. The tissues
were homogenized using a polytron and then centrifuged at 1620xg for 10 min in a bench top
centrifuge [Beckman]. The supernatants were collected and centrifuged at 10,000xg for 10 min
in a high speed centrifuge machine [Beckman, JA-20]. All steps were performed at 4˚C in this
procedure. Supernatants were collected and protein concentrations were estimated using a dye
binding kit following the instructions provided by the supplier [BioRad, Hercules, CA]. A
standard curve was prepared simultaneously using bovine serum albumin [Sigma] to calculate
protein concentrations in the tissue lysates.
The samples containing 2–3 mg/ml protein were prepared using a 4 x sample buffer, heated
in a boiling water bath for 5 min and then transferred directly onto an ice bath before loading
onto an 8% polyacrylamide gel. The buffer and gel solutions were prepared following methods
as used earlier in this laboratory [22–25]. Lysate proteins were separated along with a pre-
stained protein size marker [BioRad] electrophoretically, and then electroblotted onto a PVDF
membrane [Amersham] overnight using 20 mV [22, 24–27]. PVDF membranes were washed

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 3 / 19

 Transport defect in IBD

for 5 min twice with PBS, and blocked with a 5% fat free milk solution prepared in PBS for 30
min. The membranes were incubated with anti NHE-2 rabbit polyclonal antibodies [Origene]
using a dilution of 1:200 overnight at 4˚C. According to the data sheet provided by the supplier
the anti-NHE-2 primary antibodies are highly selective as their reaction was abolished upon
pre-incubation of these antibodies with the immunogenic peptide used to induce these anti-
bodies [Origene]. The membranes were washed again with PBS for 15 min before incubating
with a 2˚ antibody-HRP conjugate [Jackson ImmunoResearch, USA] for 2 hr. After washing
thoroughly with PBS, the membranes were incubated with enhanced chemiluminescence
reagents 1 and 2 [Amersham Biosciences] and exposed to X-ray film [X-OMAT film, Kodak]
to develop specific bands. The band density was estimated using a densitometer [SynGene,
Chemi Genius Bio Imaging System]. All steps were performed at room temperature with gen-
tle shaking unless stated otherwise.

NHE-2 localization and measurement by confocal microscopy

Levels of NHE-2 protein were estimated by measuring the fluorescence units obtained by con-
focal immunofluorescence microscopy. Paraformaldehyde fixed colonic tissues were embed-
ded in paraffin to prepare paraffin blocks. Tissue sections [7 μm thickness] were placed onto
glass slides, deparaffinized, dehydrated and rehydrated using graded ethanol solutions [24].
Sections were subjected to microwave treatment to expose antigenic epitopes, blocked using a
1% BSA solution, and then incubated with the anti-NHE-2 and anti-NHE-3 polyclonal anti-
bodies [1:25 dilution] overnight. Then the sections were washed and incubated with suitable
2˚Ab-rhodamine [NHE-2] and 2˚ Ab-FITC [NHE-3] conjugates together and separately. After
staining with DAPI, the sections were mounted with a mounting solution, and visualized
under a confocal microscope [Zeiss] using light of appropriate wave lengths. For the measure-
ment of expression levels, 3–4 areas were selected from each field and fluorescence units were
obtained for the NHE-2 labeling. These experiments were performed with negative controls in
which tissue sections were incubated with 2˚Ab conjugates only without the 1˚ Abs.

Expression of NHE-2 mRNA

To understand the underlying mechanism of NHE-2 protein expression we quantitated the
levels of NHE-2 transcript. Two approaches, an end-point cycle RT-PCR and a SYBR-green
real time RT-PCR were used to estimate the level of NHE-2 mRNA. For this purpose upstream
[PR1] and downstream [PR2] primers were designed using a published NHE-2 cDNA
sequence [Table 1]. The mRNA levels were estimated relative to a competitive control [CC]
which was constructed using the primers PR1 and PR3. The bridge-primer [PR3] was selected
from 2481–2493 bp positions of the published cDNA sequence [Table 1]. The bridge primer
consisted of PR2 sequence placed at 5’ end [underlined], and the remaining sequence which
was complementary to the NHE-2 cDNA sequence [Table 1]. The sizes of the NHE-2 target
and the CC were expected respectively to be 300 bp and 175 bp [Table 1].

Preparation of competitive control

An aliquot of total RNA (1μg) was reverse transcribed using 1 pmol of PR3 primer using a sin-
gle step RT-PCR kit [Amersham], and subsequently amplified for 28 cycles using the primers
PR1 and PR2 [100 pmoles each]. The following cycle settings were used: denaturation [94˚C x
30 sec]; annealing [55˚C x 30 sec]; extension [74˚C x 30 sec]. The PCR product [CC, 175 bp]
was separated by the agarose gel electrophoresis, and purified. An optimal concentration of
the purified CC measured separately was used to spike each sample for its co-amplification
with the NHE-2 transcript. This process was called as competitive RT-PCR method because

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 4 / 19

 Transport defect in IBD

Table 1. Shown are primer structure (5’-3’), references and expected PCR fragment size in base pair (bp).
Primers PCR Band References
PR1 300 bp NM_001113335.1
TTCTCAAAGAAAGCCTCACCA
[2341–2361 bp; Tm 60˚C]
PR2
TTTGGCTTCATATCATGGCTTT
[2619–2640 bp; Tm 60˚C]
PR3 175 bp
TTTGGCTTCATATCATGGCTTTGGAGAGCAGGGGC
[2481–2493 bp; Tm 46˚C]
PR4 (Hnup) 325 bp NM_012653
TGCATATAGCAGTTAAAGTAAG
[47172974–47172995 bp; Tm 58˚C]
PR5 (Hndown)
TGGTGAGGCTTTCTTTGAGAA
[47173278–47173298 bp; Tm 58˚C]

PR1 = Upstream primer, PR2 = Downstream primer used for mRNA amplification, and PR3 = Bridge primer used to prepare a competitive control. The
underlined sequence in PR3 is PR2 sequence. Hnup/Down = Heteronuclear RNA upstream (PR4) /downstream (PR5) primers.

https://doi.org/10.1371/journal.pone.0176767.t001

the same set of primers were used to amplify both the target and the control. In this method
variations dependent on the structure and composition of the primers, the target and the con-
trol are minimized, and hence this quantitation is more accurate than the normal RT-PCR in
which a house-keeping gene is amplified using two different sets of primers.

Total cellular RNA extraction

Total RNA from rat colon was extracted using a Trizol RNA extraction kit following instruc-
tions from the supplier [GIBCO]. Concentration and purity of total RNA were estimated from
optical densities obtained at 260 and 280 nm using a spectrophotometer [Pharmacia].

Agarose gel analysis of total RNA

The quality of total RNA was assessed using a formaldehyde agarose gel electrophoresis and a
nano-drop method [RCF, HSC, Kuwait University, Kuwait]. An aliquot of total RNA [5–
10 μg] was mixed with an equal volume of 2 x RNA buffer [Ambion] and heated at 80˚C for 5
min. The samples were then separated electrophoretically on a 1.4% agarose gel containing 1%
formaldehyde, or on 8% polyacrylamide gel as described earlier [22, 24–25]. The gels were
stained with ethidium bromide, visualized under UV light and photographed.

End-Point RT-PCR quantitation of NHE-2 mRNA

Different concentrations of CC were used to obtain an optimal concentration for quantitation.
A known optimized concentration of CC was then used to spike both the control and colitis
samples, and co-amplified by 28 cycles. Individual densities of both the target and the CC
bands was obtained from each lane, and a ratio of NHE-2:CC was calculated. This ratio was
therefore used to express the level of NHE-2 mRNA in this study. This data was further con-
firmed using a SYBR green real time PCR method.

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 5 / 19

 Transport defect in IBD

Real Time RT-PCR quantitation of NHE-2 mRNA

An aliquot of total RNA [1μg] was mixed with the primers PR1 and PR2 [100 pmoles of each],
buffer and 1 unit of Platinum Taq DNA polymerase supplied with the kit [Promega]. Reactions
were performed as follows: Reverse transcription: 42˚C x 45 min ! 30 [Denaturation: 94˚C x
30 sec, Annealing: 45˚C x 30 sec, Extension: 74˚C x 60 sec]. A standard curve between the
cycle threshold [CT] and concentrations of purified CC was prepared separately. The Corre-
sponding CT values were obtained for both the non colitis control and the colitis RNA sam-
ples. The level of NHE-2 mRNA was calculated using the CT curve. A change in the mRNA
was calculated with respect to the control CT values.

Characterization of PCR fragment

The gel-purified PCR fragment was sequenced using a non-radioactive DNA sequencing
method [Perkin-Elmer], with the downstream primer using a standard capillary gel electro-
phoresis method [3100 Avant Genetic Analyzer, ABI] in the RCF, Health Sciences Center,
Kuwait University, Kuwait. Nucleotide sequence was identified using the Blast program
(www.ncbi.nlm.nih.gov) with the published sequence.

Heteronuclear RNA level

The mechanism underlying the regulation of NHE-2 mRNA expression was investigated by
measuring the level of heteronuclear RNA [HnRNA] using RT-PCR. An aliquot [1μg] of total
RNA was reverse transcribed using a single step RT-PCR kit. Specific primers PR4 and PR5
[Table 1] were used to amplify the level of HnRNA. These primers were selected from the adja-
cent exon and intron sequences corresponding respectively to 47172974–47172995 bp and
47173278–47173298 bp positions in the published gene sequence (NM_012653). The melting
temperature for both primers was 58˚C, and the expected size of PCR fragment was 325 bp
[Table 1].

Data analysis
Data is presented as mean±SEM. A nonparametric statistical analysis using analysis of variance
and Student’s t-test for unpaired observations was used to calculate the significance, p. A value
p<0.05 was considered statistically significant. The number [n] refers to the number of ani-
mals used in each experiment.

Results
Characterization of colitis
Colitis was characterized by measuring MPO activity, body weight, and colon hypertrophy,
and microscopically by H&E and alcian blue staining.

MPO activity
In inflamed colon the level of MPO activity [units/mg tissue] was significantly [p<0.05] higher
as compared to the non colitis control colon [Fig 1, closed bars]. On the contrary, the level of
MPO activity in the ileum from the colitis rats was not different (p>0.05) as compared to that
of the ileum from the non colitis controls [Fig 1, open bars].

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 6 / 19

 Transport defect in IBD

Fig 1. Bar diagram showing myeloperoxidase (MPO) activity as units per mg tissue in the colon
(closed bars), and ileum (open bars) taken from the uninflamed (control) and inflamed rat colon on
day 6 post-TNBS. Data are mean±SEM (n = 20). *Indicates significance p<0.05 between the control and
TNBS.
https://doi.org/10.1371/journal.pone.0176767.g001

Body weight and colon hypertrophy

The colitis animals appeared to be sick, and lost weight significantly [p<0.05] as compared to
their initial weights at day 0 [Fig 2, upper panel]. On the contrary, the non colitis control ani-
mals gained weight significantly [p<0.05] as compared to their initial weight at day 0 [Fig 2,
upper panel].
The weights of colon in colitis were increased, and there was shortening of the colon length
significantly [not shown]. Colon hypertrophy was expressed as weight [mg] per cm length of
colon which was also significantly [p<0.05] higher in the inflamed colon as compared to the
non colitis control colon [Fig 2, lower panel].

Histochemistry and goblet cell staining

The H&E stained tissue sections revealed a significant infiltration of inflammatory cells and
thickening of the muscle layers in inflamed colon. In contrary to the uninflamed control colon
[Fig 3A], there were erosions in the epithelial cell lining and ulceration as well and an overall
tissue histology deformation in the inflamed colon [Fig 3B]. Alcian blue staining was more
prominent in the non colitis controls [Fig 3C] as compared to the inflamed colon [Fig 3D].

Localization of NHE-2 and NHE-3 proteins

Both NHE-2 and NHE-3 proteins were colocalized on the brush borders in the epithelial cells
lining the colonic lumen [Fig 4]. These NHE protein isoforms were not present in the cyto-
plasm, nucleus or on the basolateral domains [Fig 4]. A similar expression profile of both

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 7 / 19

 Transport defect in IBD

Fig 2. Upper panel: Shown are the percent changes in the body weight (BW) on day 6 post-TNBS as
compared with their initial body weights at day 0. Data are mean±SEM (n = 20). *Indicates significance
p<0.05 with respect to their initial weights at day 0. Lower panel: Bar diagram showing colon weight (mg) per
cm length (hypertrophy) of the uninflamed (control) and inflamed rat colon on day 6 post-TNBS. Data are
mean±SEM (n = 20). *Indicates significance p<0.05 versus non colitis control.
https://doi.org/10.1371/journal.pone.0176767.g002

NHE-2 and NHE-3 isoforms was also evident in the inflamed colon [Fig 4]. The levels of both
isoforms were also reduced in inflamed colon [Fig 4].

NHE-2 protein expression

The size of the reactive band confirmed separately corresponded to a molecular mass of
85–90 kD as expected [not shown]. ECL western blot analysis showed a significant reduction
(p<0.05) in the steady state level of NHE-2 protein in the crude lysates from inflamed colon as

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 8 / 19

 Transport defect in IBD

Fig 3. Representative picture (n = 9) showing H&E stained colon sections (A = Control, B = Colitis).
Muscle hypertrophy and infiltration of inflammatory cells are evident. Goblet cells staining with Alcian blue dye
of uninflamed colon [C] and inflamed colon [D]. A reduction of mucin expression is evident in the inflamed
colon.
https://doi.org/10.1371/journal.pone.0176767.g003

Fig 4. A representative confocal fluorescence microscopy picture showing expression of NHE-2 and
NHE-3 and their colocalization in the epithelial brush borders of the control non inflamed and
inflamed colon. Nuclei have been stained with DAPI. Magnification was 40x.
https://doi.org/10.1371/journal.pone.0176767.g004

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 9 / 19

 Transport defect in IBD

Fig 5. A representative ECL western blot picture showing expression of NHE-2 and actin proteins
(n = 9) in three (1–3) controls and three (1–3) TNBS colitisin colonic (upper panel), and ileal (lower
panel) segments.
https://doi.org/10.1371/journal.pone.0176767.g005

compared to non-colitis controls [Figs 5 and 6, closed bars]. These changes were not reflected
in the level of actin protein [Fig 5]. On the contrary, there was no significant alteration in the
level of NHE-2 protein, or actin, in the ileum from colitis animals as compared with non colitic
controls [Figs 5 and 6, open bars].
Since the western blot analysis has multiple variables, it was necessary to support this data
with confocal microscopy. The confocal data as shown in Fig 7, upper and lower panels were
consistent with the ECL western blot analysis, indicating a significant [p<0.05] decrease in the
NHE-2 protein levels in inflamed colon [Fig 7, upper and lower panels).

NHE-2 mRNA expression

The quality and yield [μg/mg tissue] of total RNA were consistent in both the control (C) and
colitis (T) samples [Table 2, Fig 8, upper panel]. The density of 28S and 18S on agarose gel
and the LIN values indicated a similar quality of RNA in the control and TNBS-treated colon

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 10 / 19

 Transport defect in IBD

Fig 6. Bar diagrams showing the level of NHE-2 protein expression as a ratio NHE-2:actin in the
control and TNBS–treated rat colon (closed bars) and Ileum (open bars). Data are mean±SEM (n = 9),
*Indicates significance p<0.05) with respect to the controls.
https://doi.org/10.1371/journal.pone.0176767.g006

[Fig 8, upper panel, Table 2]. The NHE-2 mRNA [300 bp] and the CC [175 bp] PCR products
were easily separated on the agarose gel or PAGE electrophoresis [Fig 8, lower panel]. Nucleo-
tide sequence of the NHE-2 PCR fragment showed 100% identity with the published sequence
[not shown]. In this study the level of mRNA expression was indicated as the ratios of NHE-2:
CC.
The level of NHE-2 mRNA measured using the end-point RT-PCR [Fig 9, open bars] was
significantly [p<0.05] reduced in the inflamed colon as compared to the uninflamed control
colon [Figs 8B and 9, open bars]. This data was further supported with the SYBR green real
time PCR method [Fig 9, closed bars]. Similar to the end-point PCR amplification [Fig 9, open
bars], results from the real time PCR [Fig 9, closed bars] also showed a comparable and a sig-
nificant (p<0.05) reduction in the NHE-2 mRNA level [Fig 9] in inflamed colon [p<0.05].

Expression of heteronuclear RNA

The level of HnRNA was also significantly decreased in inflamed colon [Fig 10]. This decrease
in HnRNA level was not due to a genomic DNA contamination as there was no amplification
in the negative control in which RNA was amplified without transcription reaction [Fig 10].

In vitro Effect of TNF-α on the expression of NHE-2

TNF-α has been shown to suppress NHE-2 expression in the epithelial cell line through inter-
action with NFkB region present in the NHE-2 promoter region [17]. In our experimental
condition, however treatment of colon with TNF-α in vitro did not show any difference in the
expression of NHE-2 protein levels as compared to untreated controls [data not shown].

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 11 / 19

 Transport defect in IBD

Fig 7. A representative (n = 9) confocal microscopy picture showing the levels of NHE-2 protein in the
non colitic control and TNBS inflamed colon. Arrow indicates the location of NHE-2 expression (red) and
blue dye indicates staining of the nuclei (DAPI). Magnification 40x (upper panel). Lower panel: Quantitative
data shown as mean±SEM (n = 9). From each section 3–4 fields were selected for quantitation. *Indicates
significance P<0.05 with respect to controls (lower panel).
https://doi.org/10.1371/journal.pone.0176767.g007

Discussion
Diarrhea and altered GI-muscle contractility are common manifestations of inflammatory
bowel diseases such as Crohn’s disease and ulcerative colitis. Cations such as Na+ and Ca+2

Table 2. Protein and total RNA yields from the indicated tissues.
Conditions Protein Yield (μg/mg tissue) Total RNA Yield (μg/mg tissue) RNA Quality LIN
Colon Ileum Colon Colon
Controls 28.4±1.1 63.5±4.9 2.52±0.5 7.0±0.5
Colitis 30.9±1.8 51.2±5.9 2.17±0.2 7.4±0.3
p 0.26 0.13 0.11 0.5

RNA quality in the control (uninflamed) and inflamed colon (colitis) measured in the arbitrary units (LIN) are shown as mean±SEM (n = 14). P values shown
are non-significant with respective to the control in each case.

https://doi.org/10.1371/journal.pone.0176767.t002

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 12 / 19

 Transport defect in IBD

Fig 8. Agarose gel picture showing quality of total RNA extracted from the control (C) and colitis (T)
colonic tissues used in this study. The 28S and 18S bands are ribosomal RNA (upper panel). Expression
of NHE-2 mRNA (300 bp) and the competitive control (CC, 175 bp) in the control (C) and TNBS inflamed (T)
colon using the end-point RT-PCR method (lower panel).
https://doi.org/10.1371/journal.pone.0176767.g008

play an important role in maintaining these functions. Sodium is transported through multiple
mechanisms including Na-H exchanger which is located in the plasma membrane and in the
inner compartment of eukaryotic cells [1–4]. The isoforms NHE-2, -3 and -8 are present on
the apical domain in the epithelial cells lining the GI-lumen. A strategic location of these iso-
forms suggests their role in the absorption of Na+ and water from dietary sources. Therefore a

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 13 / 19

 Transport defect in IBD

Fig 9. Bar diagram showing expression levels of mRNA as measured by the end-point RT-PCR
(closed bars) and a SYBR green real time PCR (open bars). Quantitative expression level measured as
ratios (NHE-2:CC) are shown. Data are mean±SEM (n = 9). *Indicates P<0.05 versus controls.
https://doi.org/10.1371/journal.pone.0176767.g009

compromise in their expression should be expected to affect these processes and hence altered
physiology. It is interesting to note that NHE-3 and -8 isoforms have been shown to be altered
in both human IBD conditions and experimental colitis [22, 24–25]. From animal studies it is
well known that NHE3 -/- knockout showed residual Na transport which is attributed to
NHE-2 simply because the NHE-1 is highly resistant, and NHE-4 is highly sensitive to amilor-
ide [16, 28]. Furthermore since NHE-2 is expressed abundantly in the intestinal brush border
membrane and is regulated by immune stimuli [16, 28–30], it is expected to play a role in the
pathogenesis of IBD. To address this issue we examined the expression of NHE-2 mRNA and
protein in rat colon inflamed by TNBS, a well characterized animal model of colitis. The tissues
used in this study are from animals which received TNBS 6 days earlier. This condition has
been shown earlier to develop maximum inflammation in the current model. In the following
paragraphs, the focus of the discussion will be on the characterization of colitis, expression of
NHE-2 mRNA and protein and localization of NHE-2 in the rat colon, and finally an interpre-
tation of data will be presented in relation to its role in the normal and pathophysiology of GI
tract.

Characterization of colitis
The colitis animals lost body weight significantly. The colon from TNBS treated animals was
shortened and thickened significantly on the day 6 post-induction of colitis. Furthermore,
there was a significant increase in the MPO activity in inflamed colon but not in the unin-
flamed ileum, suggesting that TNBS used in this study caused a localized inflammation in the
colon. Thus this is considered as a model of Crohn’s disease and not of ulcerative colitis. There

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 14 / 19

 Transport defect in IBD

Fig 10. Bar diagram showing expression level of hnRNA as obtained from RT-PCR. Data are mean
±SEM (n = 9). *Indicates P<0.05versus controls.
https://doi.org/10.1371/journal.pone.0176767.g010

was an increased infiltration of inflammatory cells in the mucosa and muscle layers in the
inflamed colon as well. Goblet cells’ staining with alcian blue dye demonstrated damage in the
epithelium and a decrease in mucin production. Under normal conditions mucin makes a pro-
tective barrier which prevents sensitization of the GI tract by normal microflora or food anti-
gens. These findings are consistent with previous reports, which taken together confirmed
presence of inflammation in the tissues used in this study [22, 24–25].

Expression and role of NHE-2

IBD is associated with loss of electrolyte and water that has been attributed in part to the sup-
pression of NHE-3 and NHE-8 isoforms [22, 25]. However, the role of NHE-2 is not certain
and was the focus of this study. To address this we examined the levels of NHE-2 protein,
however before its quantitation we confirmed its co-localization with the NHE-3, an apical
isoform which is known to express in the colonic epithelial cells. Localization data from con-
focal immunofluorescence demonstrated that NHE-2 is a prominent isoform located on the
brush borders in the colon epithelial cells which suggests a prominent role in the NaCl
absorption from the lumen. It is worth mentioning that the NHE-3 is known to shift its loca-
tion to internal stores under certain conditions. However, the level of both the isoforms
NHE-2 and -3 was decreased but retained the same localization on the brush borders (Fig 4),
further support that this is due to decrease in the protein concentration, and not due to its
translocation to internal stores. We and others have shown a decreased expression of NHE-3
in human IBD and in animal model of colitis and therefore in this study we did not present
quantitative data specifically on the NHE-3 isoform [31–32]. With regard to NHE-2 protein
estimation, since western blot analysis involves a large number of variables, therefore confo-
cal immunofluorescence microscopy was also used to support our western blot results.

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 15 / 19

 Transport defect in IBD

Interestingly, confocal microscopy also showed a similar decrease in the NHE-2 protein lev-
els in the inflamed colon. The decrease in the level of NHE-2 protein was selective as the level
of actin, an internal control, remained unchanged. In addition, this decrease is also not a
reflection of changes in the total protein contents as the protein yield remained similar in
both the inflamed and uninflamed colon [Table 2]. Furthermore, these changes were not con-
spicuous in the non inflamed ileum of the colitis animals, which are suggestive of the fact that
changes in colon are inflammation induced and localized to the inflamed colon only. There-
fore further investigations on the non-inflamed ileum were not extended in this study. Physi-
ologically these findings may be interpreted to compromise the absorption of NaCl and
water hence contribute to the development of diarrhea in the present model of colitis. Fur-
thermore, we have not measured the uptake of Na+ or water in this condition as this is a well-
known fact that the electrolyte uptake is impaired in inflamed enterocytes which is a contrib-
utory factor to the development of diarrhea in these animals [20–21, 33– 34]. This has been
reported that in DSS model, suppression of NHE-3 activity is accompanied by an induction
of the NHE-2 activity as a counter act mechanism [34]. However, our findings do not support
such changes as both the NHE-2 and NHE-3 isoforms were suppressed in the present model
(Fig 4). In addition, expression of the apical isoforms NHE-3 and NHE-8 is also decreased in
IBD [25, 32]. Thus our results are at variance with those reported earlier [34] which could be
due to differences in the models used, degree and location of inflammation, and also the type
of etiological agents used to induce inflammation.

Mechanism of NHE-2 suppression

Next we investigated the mechanism of the decrease in NHE-2 protein expression which
might involve pre- and post-transcriptional processes. Since the level of protein is usually
directly correlated with the mRNA level, in this study we measured the level of NHE-2 mRNA
using RT-PCR method. We used an end-point RT-PCR amplification (28 cycles) using a com-
petitive control which was prepared in this study. These findings demonstrated a reduction in
the level of NHE-2 mRNA in inflamed colon. To support these findings we further measured
the mRNA levels by a SYBR green real time RT-PCR method. For this purpose, a standard
curve between the cycle threshold [CT] and known concentrations of the competitive control
was constructed to calculate the level of NHE-2 mRNA expression. Interestingly, the real time
PCR findings also showed a similar reduction in the level of NHE-2 mRNA, suggesting that
the decrease in NHE-2 protein levels is due to a decrease in the NHE-2 mRNA abundance in
inflamed tissue. Furthermore, the yield and the integrity of total RNA used in this study were
not different in the inflamed colon than the controls [Table 2]. Therefore this reduction in the
NHE-2 mRNA level is not attributable to these factors. Thus the three apical isoforms NHE-2
(present study), NHE-3 [32] and NHE-8 [25] are suppressed in colitis which together contrib-
ute to the pathogenesis of IBD. However, the isoform selective inhibitors are currently not
known, therefore quantitative contribution of the NHE-2 isoform remains to be investigated.

Transcription of NHE-2
To investigate if transcription has a role in regulating the level of mRNA in inflamed tissue, we
measured the level of heteronuclear RNA using the real time RT-PCR with SYBR green. For
this purpose we used an upstream primer (PR4) selected from an intron, and a downstream
primer (PR5) selected from an adjoining exon of NHE-2 gene sequence [Table 1]. We used the
same competitive control in this case to measure HnRNA levels as well. Our findings demon-
strate a significant reduction in the level of HnRNA in inflamed colon suggesting a role of
transcription in the suppression of NHE-2 mRNA expression in inflamed colon. Analysis of

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 16 / 19

 Transport defect in IBD

the ratio of NHE-2 protein:NHE-2 mRNA levels demonstrated that this ratio was not statisti-
cally different in the inflamed colon as compared to the uninflamed control colon (data not
shown). Therefore, these findings could suggest that the translation step is not compromised
in this model, and support our contention that the transcription of the NHE-2 gene is a main
regulatory process in inflamed colon in this model.
Studies using recombinant cells have shown that NHE-2 gene is immune responsive as it
responds to TNF-α and INFγ in vitro. Since the level of these inflammatory mediators are
induced in IBD [19, 20], we examined effects of TNF-α on the expression of NHE-2 using
uninflamed colonic strips [14, 28–30]. The uninflamed colonic strips were treated with differ-
ent concentrations of TNF-α, and the level of NHE-2 protein was measured. Our ex vivo find-
ings discount a role of TNF-α in the suppression of NHE-2 in the experimental colitis (data
not shown). Our findings are different than those reported earlier [17] which could be
explained due to many factors. In our study we used the whole colonic segment while others
have used cultured cell line or the animals injected with TNF-α. It is likely that other factors
are required in vivo for the action of TNF-α as compared to the present ex vivo study. In addi-
tion, recombinant cells are different in many respects including that they carried a recombi-
nant NHE-2 gene promoter [17] which was more likely to respond to TNF-α as against the ex
vivo condition used in the present study. It is worth noting that TNF-α is commonly used to
treat Crohn’s disease, and in this present model TNF-α and other cytokines have been shown
to be upregulated [17–19].
In conclusion, taken together these findings suggest that NHE-2 is colocalized with NHE-3
on the apical domain of the colonic epithelial cells, and that NHE-2 is more abundant than the
NHE-3 in the colonic epithelial cells. The decrease in NHE-2 expression together with NHE-3
and NHE-8 [25, 31–35] may contribute significantly to diarrhea through a compromised
action on the absorption of NaCl from the colonic lumen. Additionally, the suppression of
NHE-2 is regulated transcriptionally. However, due to unavailability of isoform selective
inhibitors it remains to be known as to what extent the NHE-2 isoform contributes to electro-
lyte and water absorption and secretion in this model. These findings are new and add new
insights into the pathogenesis of IBD with reference to a role of NHE-2, and hence may be
taken into consideration while designing a new therapeutic approach for the treatment of IBD.

Acknowledgments
This work was supported by Kuwait University Research Grant No. [YM 12/15]. Dr James
Craik for editing the manuscript. Prof Khan, Anatomy Department for allowing use of his
laboratory for tissue block preparation and Histochemistry. Research Core Facility, Health Sci-
ences Center, Kuwait University for providing technical support (Ms Gabriel J) and equipment
for confocal immunofluorescence microscopy.

Author Contributions
Conceptualization: IK.
Data curation: IK AAS FT.
Formal analysis: IK AAS.
Funding acquisition: IK.
Investigation: AAS.
Methodology: AAS IK.

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 17 / 19

 Transport defect in IBD

Project administration: IK.

Supervision: IK FT.
Writing – original draft: IK.
Writing – review & editing: AAS FT.

References
1. Fliegel L. Regulation of the Na+/H+ exchanger in the healthy and diseased myocardium. Expert Opin
Ther Targets. 2009; 13: 55–68. https://doi.org/10.1517/14728220802600707 PMID: 19063706
2. Wakabayashi S, Shigekawa M, Pouyssegur J. Molecular physiology of vertebrate Na+/H+ exchangers.
Physiol Rev. 1997; 77[1]: 51–74. PMID: 9016300
3. Orlowski J, Grinstein S. Na+/H+ exchangers of mammalian cells. J Biol Chem. 1997; 272: 22373–
22376. PMID: 9278382
4. Nakamura N, Tanaka S, Teko Y, Mitsui K, Kanazawa H. Four Na+/H+ exchanger isoforms are distrib-
uted to Golgi and post-Golgi compartments and are involved in organelle pH regulation. J Biol Chem.
2005; 280: 1561–1572. https://doi.org/10.1074/jbc.M410041200 PMID: 15522866
5. Donowitz M, Ming Tse C, Fuster D. SLC9/NHE gene family, a plasma membrane and organellar family
of Na⁺/H⁺ exchangers. Mol Aspects Med. 2013; 34(2–3): 236–251. https://doi.org/10.1016/j.mam.2012.
05.001 PMID: 23506868
6. Khan I. Genetic diversity and pathogenic relevance of sodium hydrogen exchanger. Chapter 9, In
Trends in RNA Research, McNamara Peter [eds], NovaScience. 2006; p191–224.
7. Dudeja PK, Rao D, Syed I, Joshi V, Dahdal RY, Gardner C et al. Intestinal distribution of human Na-/H
exchanger isoforms NHE-1, NHE-2, and NHE-3 mRNA. Am J Physiol Gastrointest Liver Physiol. 1996;
271: G483–G493.
8. Hoogerwerf WA, Tsao SC, Devuyst O, Levine SA, Yun CHC, Yip JW et al. NHE2 and NHE3 are human
and rabbit intestinal brush-border proteins. Am J Physiol Gastrointest Liver Physiol 270: G29—G41,
1996)
9. Goyal S, Mentone S, Aronson PS. Immunolocalization of NHE8 in rat kidney. Am J Physiol Renal Phy-
siol. 2005; 288: F530–F538. https://doi.org/10.1152/ajprenal.00229.2004 PMID: 15522984
10. Xu H, Chen R, Ghishan FK. Subcloning, localization, and expression of the rat intestinal sodium-hydro-
gen exchanger isoform 8. Am J Physiol Gastrointest Liver Physiol. 2005; 289: G36–41. https://doi.org/
10.1152/ajpgi.00552.2004 PMID: 15731506
11. Guan Y, Dong J, Tackett L, Meyer JW, Shull GE, Montrose MH. NHE2 is the main apical NHE in mouse
colonic crypts but an alternative Na+-dependent acid extrusion mechanism is upregulated in NHE2-null
mice. Am J Physiol- Gastrointest Liver Physiol. 2006; 291:G689–G699. https://doi.org/10.1152/ajpgi.
00342.2005 PMID: 16690903
12. Gawenis LR, Stien X, Shull GE, Schultheis PJ, Woo AL, Walker NM et al. Intestinal NaCl transport in
NHE2 and NHE3 knockout mice. Am J Physiol Gastrointest Liver Physiol. 2002; 282(5): G776–784.
https://doi.org/10.1152/ajpgi.00297.2001 PMID: 11960774
13. Collins JF, Honda T, Knobel S, Bulus NM, Conary J, DuBois R et al. Molecular cloning, sequencing, tis-
sue distribution, and functional expression of a Na+/H+ exchanger [NHE-2]. Proc Natl Acad Sci (U S A).
1993; 90: 3938–3942.
14. Tse CM, Levine SA, Yun CH, Montrose MH, Little PJ, Pouyssegur J et al. Cloning and expression of a
rabbit cDNA encoding a serum-activated ethylisopropylamilorideresistant epithelial Na+/H+ exchanger
isoform [NHE-2]. J Biol Chem. 1993; 268: 11917–11924. PMID: 7685025
15. Tse CM, Levine SA, Yun CH, Khurana S, Donowitz M. Na+/H+ exchanger-2 is an O-linked but not an
N-linked sialoglycoprotein. Biochemistry. 1994; 33: 12954–12961 PMID: 7524659
16. Bachmann O, Riederer B, Rossmann H, Groos S, Schultheis PJ, Shull GE et al. The Na+/H+ exchanger
isoform 2 is the predominant NHE isoform in murine colonic crypts and its lack causes NHE3 upregula-
tion. Am J Physiol—Gastrointest Liver Physiol. 2004; 287:G125–G133. https://doi.org/10.1152/ajpgi.
00332.2003 PMID: 14962844
17. Amin MR, Orenuga T, Tyagi S, Dudeja PK, Ramaswamy K, Malakooti J. Tumor necrosis factor-α
represses the expression of NHE2 through NF-κB activation in intestinal epithelial cell model, C2BBe1.
Inflamm Bowel Dis. 2011; 17(3): 720–31. https://doi.org/10.1002/ibd.21419 PMID: 20722069
18. Neurath MF. Cytokines in inflammatory bowel disease. Nature Reviews Immunology. 2014; 14: 329–
342. https://doi.org/10.1038/nri3661 PMID: 24751956

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 18 / 19

 Transport defect in IBD

19. Strober W, Fuss IJ. Proinflammatory cytokines in the pathogenesis of inflammatory bowel diseases.
Gastroenterology. 2011; 140: 1756–1767. https://doi.org/10.1053/j.gastro.2011.02.016 PMID:
21530742
20. Martı́nez-Augustin O, Romero-Calvo I, Suárez MD, Zarzuelo A, de Medina FS. Molecular bases of
impaired water and ion movements in inflammatory bowel diseases. Inflamm Bowel Dis. 2009; 15:
114–27. https://doi.org/10.1002/ibd.20579 PMID: 18626965
21. Hawker PC, McKay JS, Turnberg LA. Electrolyte transport across colonic mucosa from patients with
inflammatory bowel disease. Gastroenterology. 1980; 79: 508–11. PMID: 7429111
22. Khan I, al-Awadi FM, Abul H. Colitis-induced changes in the expression of the Na+/H+ exchanger iso-
form NHE-1. J Pharmacol Exp Ther. 1998; 285: 869–875 PMID: 9580638
23. Wallace JL, Le T, Carter L, Appleyard CB, Beck PL. Hapten-induced chronic colitis in the rat: alterna-
tives to trinitrobenzenesulfonic acid. J Pharmacol Toxicol Methods. 1995; 33: 237–239. PMID:
8527832
24. Bou-Fersen AM, Jehoram T. Anim AT, Khan I. Experimental colitis is associated with ultrastructural
changes in inflamed and uninflamed regions of the gastrointestinal tract. Med Princ Pract. 2008; 17:
190–196. https://doi.org/10.1159/000117791 PMID: 18408386
25. Al-Shamali A, Khan I. Expression of Na–H exchanger-8 isoform is suppressed in experimental colitis in
adult rat: lack of reversibility by dexamethasone. Scand J Gastroenterol. 2011; 46: 20–29. https://doi.
org/10.3109/00365521.2010.521890 PMID: 20950207
26. Kong J, Sai H, Crissey MAS, Jhala N, Falk GW, Ginsberg GG et al. Lynch Immature myeloid progeni-
tors promote disease progression in a mouse model of Barrett’s-like metaplasia. Oncotarget. 2015; 6
(32): 32980–33005.
27. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature. 1970; 227(5259): 680–685. PMID: 5432063
28. Chow CW. Regulation and intracellular localization of the epithelial isoforms of the Na+/H+ exchangers
NHE2 and NHE3. Clin Invest Med. 1999; 22(5):195–206. PMID: 10579058
29. Schultheis PJ, Clarke LL, Meneton P, Harline M, Boivin GP, Stemmermann G et al. Targeted disruption
of the murine Na+/H+ exchanger isoform 2 gene causes reduced viability of gastric parietal cells and
loss of net acid secretion. J Clin Invest. 1998; 101: 1243–1253. https://doi.org/10.1172/JCI1249 PMID:
9502765
30. Rocha F, Musch MW, Lishanskiy L, Bookstein C, Sugi K, Xie Y et al. IFN-gamma down regulates
expression of Na+/ H+ exchangers NHE2 and NHE3 in rat intestine and human Caco-2/bbe cells. Am J
Physiol Cell Physiol. 2001; 280: C1224–1232. PMID: 11287336
31. Yeruva S, Farkas K, Hubricht J, Rode K, Riederer B, Bachmann O et al. Preserved Na(+)/H(+)
exchanger isoform 3 expression and localization, but decreased NHE3 function indicate regulatory
sodium transport defect in ulcerative colitis. Inflamm Bowel Dis. 2010; 16(7):1149–1161. https://doi.
org/10.1002/ibd.21183 PMID: 20027604
32. Siddique I, Khan I. Mechanism of regulation of Na-H exchanger in inflammatory bowel disease: role of
TLR-4 signaling mechanism. Dig Dis Sci. 2011; 56(6):1656–1662. https://doi.org/10.1007/s10620-010-
1524-7 PMID: 21221801
33. Sullivan S, Alex P, Dassopoulos T, Zachos NC, Iacobuzio-Donahue C, Donowitz M et al. Downregula-
tion of sodium transporters and NHERF proteins in IBD patients and mouse colitis models: potential
contributors to IBD-associated diarrhea. Inflamm Bowel Dis. 2009; 15(2): 261–274. https://doi.org/10.
1002/ibd.20743 PMID: 18942765
34. Rajendran VM, Nanda Kumar NS, Tse CM, Binder HJ. Na-H Exchanger Isoform-2 (NHE2) Mediates
Butyrate-dependent Na+ Absorption in Dextran Sulfate Sodium (DSS)-induced Colitis. J Biol Chem.
2015; 290(42): 25487–25496. https://doi.org/10.1074/jbc.M115.654277 PMID: 26350456
35. Sandle GI, Higgs N, Crowe P, Marsh MN, Venkatesan S, Peters TJ. Cellular basis for defective electro-
lyte transport in inflamed human colon. Gastroenterology. 1990; 99(1):97–105. PMID: 2344946

PLOS ONE | https://doi.org/10.1371/journal.pone.0176767 May 11, 2017 19 / 19