Editor- in -Chief Emeritus

A. Prof. Dr. Sarhang S. Hama Gul

Editor -in -Chief

A. Prof. Dr. Faraedon M. Zardawi

Associate Editor
A. Prof. Dr. Hadi M. Ismail

Managing Editor
A. Prof. Dr. Arass J. Noori

Editorial Office
A. Prof. Dr. Muhammed A. Mahmood
Mr. Miran H. Mohammed
Mr. Pola A.Othman
Dr. Lazyan L. Raouf
Renaz Othman Mohammed Amin (Secretary)

Editorial Board

Prof. Sauza A. Faraj (University of Baghdad)

Prof. Dr. Ibrahim S. Gataa (University of Dijlah)
Prof. Dr. Fakhri Al-Fatlawi (University of Baghdad)
Prof. Dr. Hussain F Al-Huaizi (University of Baghdad)
Prof. Dr. Akram F Al-Huaizi (University of Baghdad)
Prof. Salam D. Al-Qaisi (University of Sulaimani)
Prof. Dr. Balkees T. Garib (University of Sulaimani)
Prof. Dr. Shanaz M. Gaffor (University of Sulaimani)
Prof. Dr. Fadil A. Kareem (University of Sulaimani)
Prof. Dr. Bestoon M. Faraj (University of Sulaimani)
A. Prof. Dr. Aras M. Rauf (University of Sulaimani)
A. Prof. Dr. Falah A. Husein (University of Sulaimani)

A. Prof. Dr. Dara H. Saeed (Hawler Medical University)

A. Prof. Dr. Bahar J. Selivany (University of Duhok)

A. Prof. Dr. Faaiz Al-Hamadani (President of IAOR)
A. Prof. Dr. Hikmet A. Al-Ghrrawi (University of AL-Mostansria)
A. Prof. Dr. Saeed A. Latteef (University of Sulaimani)
A. Prof. Dr. Abdulsalam R. Al-zahawi (University of Sulaimani)
A. Prof. Dr. Faiq M. Amen (University of Sulaimani)
A. Prof. Dr. Tara A. Rasheed (University of Sulaimani)
I
A. Prof. Dr. Trefa M. Ali (University of Sulaimani)
A. Prof. Dr. Khadija M. Ahmed (University of Sulaimani)
A. Prof. Dr. Jwan F. Abdulla (University of Sulaimani)

A. Prof. Dr. Neda J Al-Kaisy (University of Sulaimani)

A. Prof. Dr. Dena N. Mohammad (University of Sulaimani)
A. Prof. Dr. Ranjdar M. Othman (University of Sulaimani)
A. Prof. Dr. Dler A. Khurshid (University of Sulaimani)
A. Prof. Dr. Anwar A. Amin (University of Sulaimani)
A. Prof. Dr. Kawan S. Othman (University of Sulaimani)
A. Prof. Dr. Hawzheen M. Mustafa (University of Sulaimani)
Dr. Zanyar M. Amin (University of Sulaimani)
Dr. Bayad J. Mahmood (University of Sulaimani)
Dr. Adham A. Abdulrahman (University of Sulaimani)
Dr. Aram M. Hamad (University of Sulaimani)
Dr. Miwan S. Abdulrahman (University of Sulaimani)
Dr. Shokhan H. Aziz (Sulaimani Polytechnic University)

Advisory Editorial Board

Prof. Dr. Richard van Noort (UK)

Prof. Dr. Anwar Tappuni (UK)
Prof. Dr. Salem Al-Samaray (Iraq)
Prof. Dr. Ali Al-Zubaidi (Iraq)
Prof. Dr. Qais H. Musa ( Iraq)
Prof. Dr. Lamia H. Al-Nakib (Iraq)
A. Prof. Dr. Adil Al-kayat (Iraq)
A. Prof. Dr. Intesar J. Mohammed (Iraq)

II
Scope of the journal

Sulamani Dental Journal encourages submissions from all authors throughout the world.
Manuscripts are assessed by two experts solely and anonymously on the basis of their
contribution of original data, ideas and their presentation. All manuscripts must comply
with Instruction to Authors, which is available in more details in our website,
http://sdj.univsul.edu.iq.

The following types of manuscript will be considered for publication: original articles,
systematic reviews, case reports/case series, editorials, brief communications and letters
to the editor.

Manuscripts are accepted for consideration with the understanding that data, text, figures,

photographs, and tables have not appeared in any other publication, except as an abstract

submitted and published in conjunction with a presentation by the author(s) at scientific

meetings, and that material has been submitted only to this journal.

Investigation on human subjects should conform to the guidelines noted in the World

Health Organization Chronicle 1976; 30: 360-362. Researches submitted to the journal

should be approved by an ethical committee according to the World Medical Association

Declaration of Helsinki 1964 and its last revision. Experimental animal studies need to be

carried out according to the principles of laboratory animal researches.

All articles will be critically reviewed by the editor and invited referees within 2 months.

III
 Table of Contents
Volume 9, Issue 1: June 2022
Content Page
I Efficacy of Curcumin Mouth Wash on Gingival Inflammation in Patients with 1-12
Chronic Gingivitis
Chenar A. Mohammad

II Stress Interpretation by Using Blood Glucose levels, blood pressure and pulse rate 13-20
measurement in Patients attending Oral and Maxillofacial Clinic in College of
Dentistry at University of Sulaimani
Kardo M. Abdalkarim, Kanar A. Hamaamin, Bayad J. Mahmud

III Evaluation of Skeletal Jaw Relation by Different Cephalometric Angles for Sample of 21-30
Kurdish Young Adults in Sulaimani City-A Cephalometric Study
Shiler A. Mohammed, Trefa M. Ali, Zhwan J. Rashid

IV Crown Size Comparisons in Patients with Unilateral Palatally Impacted Canine by 31-38
Cone-Beam Computed Tomography
Tara A. Rasheed, Handren A. Ahmed

V Evaluating Diagnostic Validity of Various Sagittal Cephalometric Parameters (a 39-44

Comparative Retrospective Study)
Saya Mustafa Azeez, Ribwar F. Khalid

VI Identification and Genotyping of Candida Species Involved in Oral Candidiasis among 45-53
Diabetic Patients
Shene A. Mohammed, Khattab A. Shekhany, Paywast J. Jalal, Chiman H. Fattah

VII Assessment of Clinical Attachment Level in Anxious Patients 54-61

Azhin K. Khwakaram, Harem Jaafar Hama Rashed

VIII Effect of Adding Titanium Dioxide Nanoparticles on Some Mechanical Properties of 62-67
Dental Alginate
Hoshang k. Abdel-Rahman, Ranj A. Omer, Mahabad M. Saleh, Sazgar S. Al-Hawezi, Fahd S. Ikram

IX Preference for Using Posts to Restore Endodontically Treated Teeth among Dentists in 68-76
College of Dentistry/ Hawler Medical University
Sohela F. Mahdi, Niaz H. Hamasaeed, Hidayat A. khudhur, Hozan F. Tawfiq
Vol 9(1) Mohammad

Original Article

Efficacy of Curcumin Mouth Wash on Gingival

Inflammation in Patients with Chronic Gingivitis
Chenar A. Mohammad1*

Abstract
Objective: For gingival disease, various modalities of treatment are available. Turmeric is a novel product obtained from plants that
plays a vital role in treating gingival and periodontal diseases. This study aims to evaluate the anti-plaque and anti-inflammatory
property effects of curcumin mouthwash (0.1%) on participants with plaque-induced gingivitis.

Methods: From eighty subjects, sixty participants with generalized gingivitis received meticulous scaling and polishing (S&P) and
were divided randomly into 3 groups: Curcumin (CU), Chlorhexidine (CHX), and control (S&P) groups. Clinical parameters: PI, GI,
BOP, and salivary IL-1β were assessed at baseline and after 4 weeks of therapy. The rest of the twenty patients with clinically healthy
gingiva.

Results: The results showed a significant reduction in the mean values of PI, GI, BOP, and Il-1β levels after 4 weeks of therapy as
compared to baseline in all 3 groups (p≤0.05), with the highest mean reduction of GI, BOP, and IL-1 β scores detected in the CU when
compared to the CHX and S&P groups, and the highest mean reduction of PI scores detected in the CHX group in comparison to the
CU and S&P groups (p≤0.05), with significant differences, existed between the 3 groups (p≤0.05).

Conclusions: CU was more effective than CHX when anti-inflammatory property effects were considered, while CHX was more
effective than CU when anti-plaque property effects were considered. Therefore, CU mouthwash can be considered an effective
alternative antigingivitis agent to CHX due to its anti-plaque and anti-inflammatory property effects.

Keywords: Chlorhexidine, Curcumin, Gingivitis, IL-1 β, Mouthwash.

Submitted: September 8, 2021, Accepted: December 24, 2021, Published: June 1, 2022.

Cite this article as: Mohammad CA. Efficacy of Curcumin Mouth Wash on Gingival Inflammation in Patients with
Chronic Gingivitis. Sulaimani Dent J. 2022;9(1):1-12.

DOI: https://doi.org/10.17656/sdj.10143

1. Periodontics Department, College of Dentistry, Hawler Medical University, Erbil, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

1
Efficacy of curcumin on chronic gingivitis Sulaimani Dent. J. June 2022

Introduction good alternatives to such synthetic agents. The need to

overcome the undesirable consequences associated with
Periodontitis Gingivitis is a reversible chronic the wide-scale misuse of chemotherapeutic agents has
inflammatory disease limited to the gingiva without therefore led to increased interest in plants with
either attachment or alveolar bone loss, induced by the antibacterial and anti-inflammatory properties.
presence of microorganisms in the biofilm near the
gingiva(1). Dental plaque has been proved to be a Turmeric (Curcuma longa) is a member of the ginger
paramount factor in the initiation and progression of family, (Zingiberaceae family) and is widely cultivated
gingival and periodontal diseases, and a direct in India and Southeast Asia. Curcumin (1,7-bis(4-
relationship has been demonstrated between plaque hydroxy-3-methoxyphenyl)-1E,6E-heptadiene-3,5-
levels and the severity of gingivitis(2). The presence of dione or diferuloylmethane) is a polyphenol derived
bacterial lipopolysaccharides triggers the inflammatory from turmeric, is responsible for the yellow color of
response of the host, activating polymorphonuclear turmeric, and is obtained from turmeric by ethanol
leukocytes and the secretion of inflammatory mediators extraction. Various studies showed that CU has
such as cytokines and chemokines(3). Among the antimicrobial, antioxidant, and anti-inflammatory
inflammatory mediators, interleukin-1beta (IL-1β) properties, along with its hepatoprotective,
presents the greatest correlation with the stage of immunostimulant, antiseptic, and antimutagenic
periodontal disease, compared with other inflammatory properties(8,9). The anti-inflammatory effect of CU has
mediators(4), and is considered a biomarker of been explored in the treatment of gingivitis, both as a
periodontal disease. local application in the form of a gel and as a
mouthwash(10,11). Although improvement in clinical
Since bacterial plaque is the principal causative factor in parameters has been detected, the anti-inflammatory
gingival and periodontal diseases, the most rational effects of CU on immunological parameters have not
methodology for the prevention of periodontal diseases been studied yet in relation to gingivitis. Therefore, the
would be regular effective removal of plaque by aim of the study was to evaluate the anti-plaque and anti-
personal oral hygiene protocol, using procedures for inflammatory property effects of 0.1% CU mouthwash
plaque control that include mechanical and chemical on clinical parameters (PI, GI, and BOP), as well as on
means. Although mechanical plaque control methods pro-inflammatory IL-1β levels in saliva of patients with
are efficient in maintaining adequate levels of oral moderate to severe gingivitis, and to conduct
hygiene, studies have shown that patient compliance in comparisons with a group using a commonly used
following these methods is not adequate in a large chemical plaque control, namely 0.12% CHX
population, and in order to overcome the shortcomings mouthwash (Kin, Spain), and a group receiving S&P
of mechanical plaque control methods, various only, at baseline before and after 4 weeks of therapy.
chemotherapeutic agents have been employed and
developed to control bacterial plaque, aimed at
improving the efficacy of daily hygiene control
measures(5). Chemotherapeutic agents, including Patients and methods
systemic antibiotics, antiseptic mouthwashes, as well as
Design, setting and time of study
local drug delivery of antiseptics and antibiotics, and a
host of modulating agents, have been used as an adjunct Clinical comparative study was carried out in the
to the conventional periodontal therapy(5,6). Periodontic Department / College of Dentistry - Hawler
Medical University, and BIO Clinical Laboratory in
In the field of dentistry, Chlorhexidine (CHX) is
Erbil city. The study period extended from March 2019
regarded as the ‘gold standard’ anti-plaque treatment, is
to September 2020. The study protocol was reviewed
found to be particularly effective against gingivitis, and
and approved by the institutional ethical committee of
is widely used as an adjunct treatment for periodontitis;
the College of Dentistry/Hawler Medical University,
however, most practitioners do not recommend the long-
Erbil, Kurdistan Region, Iraq.
term and daily use of CHX as a mouthwash, mainly
because of its side effects, such as objectionable taste, Study samples
tooth discoloration, desquamation, and soreness of oral
mucosa(7). Furthermore, synthetic antimicrobial agents Eighty participants were recruited from outpatients in
and antibiotics are known to cause antimicrobial the Department of Periodontology, College of Dentistry,
resistance, the emergence of previously uncommon Hawler Medical University in Erbil city. The study
infections, probably due to the inappropriate or protocol, duration, purposes, and the possible risk
widespread overuse of antimicrobials. Meanwhile, factors associated with the study were explained to all
natural phytochemicals have been demonstrated to be

2
Vol 9(1) Mohammad

participants, and informed written consents were signed In the (CU) and (CHX) groups, the mouthwashes were
by all participants before the conduction of the study. used twice daily (once in the morning and once in the
evening before sleeping) for just one minute, after half-
Patient selection is based on the following inclusion hour of tooth brushing, and the patients were instructed
criteria: both genders; twenty to forty-six years of age; to refrain from eating or drinking for at least half-hour
individuals with ≥ 20 teeth; systemically healthy after rinsing. All mouthwashes provided to the chronic
subjects; and cooperative patients who could be gingivitis subjects were given free from cost during the
motivated to comply with further oral hygiene entire duration of the study. Furthermore, all patients
instructions. Meanwhile, the exclusion criteria for the were instructed to use the same type of toothbrush (soft-
study were: the active focus of infection other than bristled toothbrush the same type of toothpaste (Colgate
gingivitis; gingival recession; a pocket of more than toothpaste with fluoride), and were instructed to use the
3mm; history of clinical periodontal treatment for the same type of brushing technique (Bass method brushing
previous 3 months; antibiotic/anti-inflammatory drug technique) twice a day during the entire study. All
treatment within 6 months prior to the experiment; participants were also provided with a sheet on which to
history of known allergy to chlorhexidine or CU mouth record their compliance with instruction and their
rinse; smoking; alcoholism; pregnancy; lactating complaints (side effects) after using the mouthwashes.
mothers, post-menopausal females; mouth breathing Subjective side effects included: taste acceptability,
habit; and users of orthodontic or prosthetic appliance. dryness/soreness, and burning sensation assessments,
From total subjects, twenty volunteers with clinically while objective side effects included: ulcer formation,
healthy gingiva with no clinical sign of gingival staining of teeth, staining of the tongue, and allergy
inflammation or periodontitis were recruited for this assessments. This sheet had to be filled by the
study, to estimate the normal mean value of clinical and participants daily after using the mouth wash. Then all
immunological parameters only. sheets were checked by the investigator after 4 weeks of
therapy.

Clinical parameters assessment

The rest 60 subjects with generalized plaque-induced
gingivitis met the following inclusion criteria: had All participants underwent a full-mouth periodontal
moderate to severe gingivitis (mean GI = 1.1-2 in examination at baseline before therapy and after 4 weeks
moderate to 2.1-3 in severe gingivitis), probing depth of therapy by a single specialist examiner. At baseline
PD≤ 3 mm, and had no clinical attachment loss before therapy, the subjects were assessed clinically for
(CAL=0) or furcation involvements, were divided into PI, GI, and BOP. The thickness of plaque was measured
three main studied groups, 20 in each. according to the PI by Silness and Löe(12). The extent
and severity of gingival inflammation were measured
Initially, the selected participants who satisfied the
according to the gingival index GI by Löe and Silness
inclusion criteria received mechanical treatment for (13)
. Finally, the presence or absence of bleeding on
plaque-induced gingivitis that consisted of scaling
probing BOP was assessed according to Ainamo and
(supra and subgingival scaling) and polishing, and then
Bay(14), by passing a Williaḿ́ś́ periodontal probe gently
were divided randomly into three equal main groups:
along the inner surface wall of the gingival sulcus and
1. (CU) group, which included 20 participants, was noting bleeding after 30 seconds as either present (1) or
instructed to rinse with 10 ml of prepared curcumin absent (0). The surface sites of the measurements were
mouthwash (0.1%) twice daily for 4 weeks. the mesiobuccal/labial, distobuccal/labial, mid-
2. (CHX) group, including 20 participants, were buccal/labial, and midpalatal/lingual sites for all teeth.
instructed to rinse with 10 ml of CHX mouthwash Following the measurement of the clinical parameters,
(0.12%) (Kin Gingival, Spain) twice daily for 4 scaling (supra and subgingival scaling) and polishing
weeks. were performed for each patient with gingivitis in a
3. Control (S&P) group, which included 20 single visit, and the patients were instructed to follow
participants, was instructed to follow up without the mouthwash usage as per the instructions. The
using any mouthwash. clinical parameters measurements were then assessed
again at the end of the 4-week therapy period.

3
Efficacy of curcumin on chronic gingivitis Sulaimani Dent. J. June 2022

Saliva sample collection and analysis test (Wilcoxon Signed Ranks Test) was used to compare
the mean values of PI, GI, BOP, and IL-1 beta of sixty
Saliva samples were collected in the morning (between participants between baseline and after 4 weeks of
9:00 and 11:00) according to the following procedure therapy. For each group, for the data with normal
described by Navazesh(15). The spitting method was distribution, paired t-test was applied to compare the
used for the collection of un-stimulated saliva at the mean values of PI in the CU group, GI in the CHX
baseline before clinical parameters assessments and group, BOP in CHX and S&P groups, between baseline
after 4 weeks of therapy, and in patients with clinically and after 4 weeks of therapy, while for the data with
healthy gingiva. The samples were collected in non-normal distribution, Wilcoxon test was used to
disposable, sterilized plastic test tubes, then centrifuged compare the mean values of IL-1β in three studied
immediately at 4000 rpm for 20 minutes to obtain clear groups, PI in CHX and S&P groups, and GI in CU and
supernatant, and finally stored at-20ºc for later S&P groups between baseline and after 4 weeks of
estimation of IL-1β by ELISA technique. Salivary IL-1β therapy. ANOVA test was applied for the comparison
levels were assessed using an enzyme-linked between the mean differences of three studied groups in
immunosorbent assay (Elisa technique) supplied by a regard to PI & IL-1β parameters, accompanied by a post
specialized kit company (KOMA BIOTECH INC, hoc test (LSD) for multiple pair groups comparison,
USA). while the Kruskal-Wallis H test was used for the
comparison between the mean differences of three
Preparation of Curcumin mouthwash
studied groups in regard to GI&BOP parameters,
Curcumin was prepared as a mouthwash according to accompanied with Man –Whitney U test for the
Waghmare et al.’s method(16), by an expert comparison between variable two groups. P ≤ 0.05 was
pharmacologist, at the Department of considered statistically significant.
Pharmacology/College of Pharmacy / Hawler Medical
University/Erbil city/Iraq.

Curcumin extraction and mouth wash preparation Results

At first, the raw material, turmeric rhizome, was Patients background

obtained from a bioorganic Indian grocery store.
A total of eighty individuals of both sexes were recruited
In curcumin extraction, the turmeric root was ground for the study with a mean age of 33.28 ± 5.715 years. 55
into powder using a mortar and was air-dried to remove subjects were male (61.1%) and 25 subjects were female
moisture in the ground powder. Then a known amount (38.9%). Of the total number, twenty subjects with
of turmeric powder (100 g) was weighed accurately and normal healthy gingiva with a mean age of 33.25±5.893
was soaked in 99% ethanol for 48 hrs. The filtrate that years. The rest of the sixty subjects with gingivitis
was procured was an even amber-colored ethanol (moderate to severe type) with a mean age of
solution. The ethanol was allowed to evaporate by air 33.28±5.705 years. Among these, 43 were male (71.7%)
drying and was placed in a microwave at 200 F until a and 17 were female (28.3%) as shown in Table 1.
dry extract enriched in CU was obtained.
Clinical and immunological parameters results
Preparation of the Curcumin mouthwash was in
Table 2 shows that the mean values of PI, GI, BOP, and
accordance with a previous study described by
pro-inflammatory cytokine IL-1 β level among the 60
Waghmare et al. 2011(16). This entailed dissolving 10
participants with plaque-induced gingivitis at baseline
mg of curcumin extract in 100 ml of distilled water, then
before therapy were: 2.100±0.230, 2.062±0.154,
adding a flavoring agent (0.005% peppermint oil) and
68.763±5.280, 17.646±0.543, respectively. Then these
adjusting the pH to 4. The participants in the CU group
values were significantly reduced to 0.553±0.187,
were asked to gargle with 10 ml of mouthwash in 1:1
0.745±0.166, 25.234±5.723, and 12.097±0.981,
dilution with water twice a day, after half-hour of
respectively, after 4 weeks of therapy (P≤0.05).
toothbrushing for 4 weeks.
Table 3 shows that the mean values of PI in the first CU,
Statistical analysis
second CHX, and the third S&P groups were
Data were presented as numbers, mean, standard significantly highly decreased after 4 weeks of therapy
deviation, and degree of freedom. The data were as compared to baseline (P≤0.05), and the mean
statistically analyzed using the SPSS software package difference of PI from baseline to 4 weeks (mean
(version 22; SPSS Inc., Chicago, IL, USA). Normality improvement of PI scores) was highest in the second
of the data was tested using Kolmogorov-Smirnov. Z CHX group (1.745±.232), followed by the first CU

4
Vol 9(1) Mohammad

group (1.530±0.270), and the least was in the S&P group Meanwhile, for the comparison between the mean
(1.365±0.187). Regarding GI and BOP, the mean values differences of three studied groups in regard to PI, and
were also highly significantly reduced after 4 weeks of IL-1β, using one way-Anova test, Table 4 revealed
therapy as compared to baseline in all three studied significant differences between the mean differences of
groups (P≤0.05), and the mean differences from the three studied groups (P≤0.05), accompanied by
baseline to 4 weeks for GI and BOP scores (mean significant differences in the mean improvements
improvement of GI and BOP scores) were highly between two groups(P≤0.05), with the exception of the
detected in the first CU group (1.472±0.134) comparison between CHX and S&P group in regard to
(48.921±4.148), followed by the second CHX group IL-1β (P >0.05). Also, significant differences between
(1.345±0.145) (44.369±4.865), and then the third S&P the 3 groups in regard to GI and BOP(P≤0.05), using the
group (1.134±0.183) (37.298±6.232), respectively. Kruskal-Wallis H test, accompanied by significant
Finally, for IL-1β, the mean values were also highly differences in the mean improvements between the 2
significantly reduced after 4 weeks of therapy as groups (P≤0.05).
compared to baseline in all three studied groups
(P≤0.05), with the highest mean difference in IL-1β Regarding participants’ complaints, no subjective side
levels (best mean improvement of IL-1 β scores), was effects were detected in CU group, while a tolerable
detected in the CU group (5.837±0.218 pg/ml), followed taste was detected in 2 participants using CHX
by S&P group (5.413±0.672 pg/ml), and CHX mouthwash after 7 days (Table 5). Additionally, staining
(5.398±0.627 pg/ml) group. of the teeth was seen in 3 participants from the CHX
group (in the lingual surface of lower incisors) after 21
days of mouth rinsing, while no complaints were
observed in the CU group.

Table 1: Age and gender distribution of participants.

Variables Levels CU+CHX+NC groups Healthy All groups

gingiva
N. % N. % N. %
Age 20 - 28 16 26.7 6 30.0 22 27.5
29 - 37 32 53.3 7 35.0 39 48.8
38 - 46 12 20.0 7 35.0 19 23.8
Total 60 100.0 20 100.0 80 100.0
Mean 33.28±5.705 33.25±5.893 33.28 ± 5.715
±S.D
Gender Male 43 71.7 12 60.0 55 61.1%
Female 17 28.3 8 40.0 25 38.9%
Total 60 100.0 20 100.0 80 100%
N: number of samples; %: percentage; S.D: standard deviation.

Table 2: Comparison of the mean overall PI, GI, BOP, and IL-1 β values
among participants with chronic gingivitis at baseline, and after 4 weeks of
therapy, using the Z test (Wilcoxon Signed Ranks Test).
Groups Index Time N Mean ± SD Z test P-Value
All 3 PI Base line 60 2.100±0.230 -6.746 P<0.001
groups 4weeks 60 0.553±0.187
GI Base line 60 2.062±0.154 -6.743 P<0.001
4weeks 60 0.745±0.166
BOP% Base line 60 68.763±5.280 -7.738 P<0.001
4weeks 60 25.234±5.723
IL-1β Base line 60 17.646±0.543 -6.739 P<0.001
pg/ml 4weeks 60 12.097±0.981

5
Efficacy of curcumin on chronic gingivitis Sulaimani Dent. J. June 2022

Table 3: Comparison of the mean value of PI, GI, BOP, and IL-1 beta between baseline and after 4 weeks of
therapy for each group with the mean differences from baseline to 4 weeks.

Mean differences
Index groups Time N Mean ± SD test P-Value
(base line-4weeks)
Baseline 20 2.125±0.273 1.530± 0.270 25.325′ P<0.001
CU
4 weeks 20 0.595±0.193
Baseline 20 2.150±0.259 1.745±0.232 -3.932″ P<0.001
PI CHX
4 weeks 20 0.405±0.119
Baseline 20 2.025±0.121 1.365±0.187 -3.938″ P<0.001
S&P 4 weeks 20 0.660±0.143
Baseline 20 2.073±0.133 1.472±0.134 -3.937″ P<0.001
CU
4 weeks 20 0.601±0.087
Baseline 20 2.070±0.153 1.345±0.145 41.482′ P<0.001
GI CHX 4 weeks 20 0.725±0.094

Baseline 20 2.045±0.181 1.134±0.183 -3.929″ P<0.001

S&P 4 weeks 20 0.911±0.134
Baseline 20 69.114±4.539 48.921±4.148 -3.923″ P<0.001
CU 4 weeks 20 20.193±2.889
Baseline 20 69.074±5.090 44.369±4.865 40.784′ P<0.001
BOP CHX
(%) 4 weeks 20 24.704±3.173
Baseline 20 68.104±6.285 37.298±6.232 26.764′ P<0.001
S&P
4 weeks 20 30.806±4.857
Baseline 20 17.502±0.539 5.837±0.218 -3.937″ P<0.001
CU
4 weeks 20 11.665±0.533
IL-1β Baseline 20 17.763±0.577 5.398±0.627 -3.921″ P<0.001
CHX 4 weeks 20 12.365±1.069
(Pg/ml)
Baseline 20 17.676±0.508 5.413± 0.672 -3.925″ P<0.001
S&P
4 weeks 20 12.263±1..124

6
Vol 9(1) Mohammad

Table 4: Comparison between the three studied groups using Anova test for PI and IL-1 β / or Kruskal-
Wallis H test for GI and BOP, accompanied with post hoc test (LSD)/or Mann-Whitney U test to compare
the mean differences between multiple 2 groups.

Mean P-Value
P-Value
Index Groups N. difference (3 Sig. Groups
(2 groups)
±SD groups)
A) CU 20 1.530±0.270 13.430‵ B×A 0.005‶ (HS)
B) 20 1.745±0.233 P<0.00 C×A 0.029‶ (S)
PI CHX 1
C) 20 1.365±0.187 C×B <0.001‶
S&P (HS)
Total 60 1.547±0.277
IL- A) CU 20 5.838±0.218 4.173‵ B×A 0.014‶ (S)
1β B) 20 5.398±0.628 0.02 C×A 0.017‶ (S)
(pg/ CHX
ml) C) 20 5.414±0.673 C×B 0.929 ‶ (NS)
S&P
Total 60 5.550±0.575
A) CU 20 1.472±0.134 23.970‣ B×A 0.013‣‣ (S)
B) 20 1.345±0.145 <0.001 C×A <0.001
GI
CHX ‣‣(HS)
C) 20 1.134±0.184 C×B <0.001‣‣
S&P (HS)
Total 60 1.317±0.208
A) CU 20 48.922±4.148 25.819‣ B×A 0.007‣‣ (HS)
B) 20 44.370±4.865 <0.001 C×A <0.001‣‣
BOP
CHX (HS)
%
C) 20 37.298±6.232 C×B <0.001‣‣
S&P (HS)
Total 60 43.530±6.995

PI: plaque index;IL-1β: Interlukine 1beta ; GI : gingival index; BOP:bleeding on probing

;CU:curcumin;CHX: chlorhexidine; S&P:scaling and polishing ; SD: standard deviation ; N: number;
Sig: significancy ; P: probability ; ‵= Anova test ; ‶= post hoc test (LSD) ; ‣ = Kruskal-Wallis H test ; ‣‣=
Mann-Whitney U test ; P≤ 0.05 was considered as significant and P>0.05was considered as non-
significant.

7
Efficacy of curcumin on chronic gingivitis Sulaimani Dent. J. June 2022

Table 5: Subjective and objective side effects records.

N. Taste acceptability Burning Dryness/Soreness

Group Accep- Toler- Unaccep- Absent Present Absent Present
table able table
CU 20 20 0 0 20 0 20 0
20 18 2 0 20 0 20 0
CHX
Ulcer Teeth staining Tongue staining Allergy

Presen Absent Present Absen Present Absent Present Absent

t t
CU 20 0 20 0 20 0 20 0 20

CHX 20 0 20 3 20 0 20 0 20
N: number of participants.

Discussion to be particularly effective against gingivitis. Similar

results were obtained by Leyes et al.(22), who compared
Clinical findings the effect of chlorhexidine with and without alcohol
along with placebo, by Waghmare et al.(16), who used
Regarding the anti-plaque property effect, the mean 0.2% chlorhexidine gluconate with base alcohol,
values of PI were measured at baseline and after 4 weeks Grundemann et al.(23), who used chlorhexidine
in all three studied groups. In the CU group, the mean alone(0.12%) and chlorhexidine in combination with an
value of PI was significantly reduced after 4 weeks of oxidizing agent (sodium perborate monohydrate),
therapy as compared to baseline (P ≤0.05). This may Chatterjee et al.(17), Arunachalam et al.(18), who used
have been due to the anti-plaque property effect of CHX gluconate in a concentration of 0.2%, and
curcumin mouthwash. Our results related to curcumin Francetti et al.(24), all the previous studies reported anti-
are similar to those studies carried out by Waghmare et plaque activities of CHX.
al.(16), Chatergee et al.(17), and Arunachalam et al.(18),
where turmeric was used as a mouthwash. Curcumin has Our study also revealed that the best improvement in the
demonstrated a wide range of activities, including mean values of PI scores (The highest mean difference
antimicrobial, anti-inflammatory, and antioxidant from baseline to 4 weeks) was detected in the CHX
agents. The lipophilic nature of the molecule allows group followed by the CU group. This superior
rapid permeability of the cell membrane, and the antiplaque property effect of chlorhexidine gluconate
reduction in the plaque level at the end of the 4 weeks could be due to chlorhexidine having the property of
follow-up period could also be attributed to the substantivity (The high surface substantivity of CHX
bactericidal property of the curcumin herbal product. enables it to remove high concentrations of
The curcumin mimics various events that happen during microorganisms). It could also be due to the action of
the apoptosis process by causing changes in the function chlorhexidine at different levels of plaque formation, the
and structure of the cell membrane(19). The antibacterial property of slow-release, and the concentration used was
effect of CU is well documented and involves the 0. 2%. Although curcumin showed an antiplaque
activity of many microorganisms(20). Mohammed et property effect, it was observed to be slightly less
al.(21) have shown that the antimicrobial activity of CU effective in comparison with chlorhexidine, and this
may be useful for controlling dental biofilms, and might be due to the dilution of curcumin which was
Waghmare et al.(16) have reported a significant reduction followed in the present study. These results are similar
in the total microbial count with the use of turmeric to the results obtained by other studies.(16,20,25), which
mouthwash, making it a suitable candidate as an anti- found a larger mean reduction of PI in the CHX group
plaque agent. than in the curcumin group when curcumin and
chlorhexidine were used as a mouthwash(16,20) or in gel
For the second CHX group, the mean value of PI was form(25). However, in contrast to our study,
also significantly reduced after 4 weeks of therapy as Arunachalam et al.(18) reported that there was no
compared to baseline (P≤0.05), indicating that significant difference between the CHX and CU groups
chlorhexidine has anti-plaque activity effects. This after 4 weeks of therapy, and denoted that both were
result was to be expected since CHX is regarded as the comparable in terms of the anti-plaque property. The
‘gold standard of chemical plaque control and is found

8
Vol 9(1) Mohammad

difference between our and those results could be due to mediators and causes shrinkage by reducing
the limited number of participants (10 in each group) in inflammatory edema and vascular engorgement of
that study, which may have influenced the results. connective tissue(32). It has also been shown
that curcumin incorporated in collagen, which acts as a
Regarding the anti-inflammatory property effect, supportive matrix for the slow release of curcumin,
clinically, the mean values of GI and BOP were increases wound reduction, and enhances cellular
measured at baseline and after 4 weeks in all three proliferation(33).
studied groups. In the CHX group, statistically
significant reductions in the mean values of GI and BOP However, the best improvement in the mean values of
were detected after 4 weeks of therapy as compared to GI and BOP scores (the highest mean difference from
baseline before therapy, which may have been due to the base line to 4 weeks) was detected in the CU group,
anti-inflammatory property effects of CHX. Similar to followed by the CHX group, indicating that both types
the findings of the present study, studies carried out of mouthwash were effective in reducing the gingival
by(16-18,22,23,26) reported a significant reduction of inflammation but with non-equal results, since better
gingival inflammation (GI) using chlorhexidine anti-inflammatory properties were detected clinically in
gluconate. the CU than the CHX group. Our results are in
concordance with the finding by Arunachalam et al.(18)
Regarding the CU group, significant reductions in the reported that CU mouthwash had better anti-
mean values of GI and BOP were also reported after 4 inflammatory effects than CHX mouthwash, based on a
weeks of therapy as compared to baseline (p ≤ 0.05). more significant reduction of GI and reactive oxidative
This may have been due to the anti-inflammatory metabolites ROMs in the CU group after 4 weeks of
property effect of CU, which inhibits inflammatory therapy. Mali et al.(10) reported improvement in results in
mediator, tumor necrosis factor TNF-dependent NFκB clinical indices for both CU and CHX types of
activation, reducing the production of reactive oxygen mouthwash, while Suhag et al.(32) reported that 1% CU
species ROS(27). solution could resolve signs and symptoms of
inflammation better than CHX and saline groups when
Arora et al.(28) evaluated the anti-inflammatory property
used as a subgingival irrigant. In contrast to our study,
of turmeric and, similar to our study, found a significant
another study(16) reported that both curcumin and CHX
reduction in gingival inflammation (p<0.01). Similar
types of mouthwash were equally effective in reducing
results were also obtained in studies carried out by
the gingival inflammation (GI) from baseline to 14 days
Srimal and Deodhar(29) and Ghatak and Basu(30). In the
and their results were explained as due to their anti-
above studies, the anti-inflammatory effect was
inflammatory properties. Meanwhile, another study (25),
observed in relation to turmeric but not in relation to the
reported that the means of GI and sulcus bleeding index
gingiva. In our study, the anti-inflammatory property
SBI were reduced after 2 and 3 weeks in both curcumin
effects of curcumin mouthwash on the gingiva were
and CHX groups, but higher reductions were detected in
evaluated clinically using GI and BOP, and
the CHX group as compared to the curcumin group. The
immunologically using salivary IL-1 beta level. These
difference in results between that study and our study
results are nearly similar to studies(16,17,25), that reported
could be due to the use of different formulations – gel in
the anti-inflammatory action of turmeric on clinical
that study versus mouthwash in our study.
parameters using GI and the sulcus bleeding index SBI
in the cases of Chatterjee et al.(17) and Singh et al.(25), and Immunological findings
GI in the cases of Waghmare et al.(16) and Arunachalam
et al.(18). Regarding the anti-inflammatory property effect of CU,
the mean value of inflammatory marker IL-1β was
The possible mechanism of action of curcumin as an measured at baseline and after 4 weeks in all three
anti-inflammatory agent could be due to the inhibitory studied groups, In our study, the results showed high
action on prostaglandin synthesis E2 (PGE2) and a mean levels of inflammatory cytokine Il-1β in the saliva
strong stabilizing action on the lysosomal of plaque-induced gingivitis participants at baseline
membranes(31), and could also be due to the inhibitory before therapy in all three studied groups, which then
action of inflammatory mediators of arachidonic acid significantly reduced after 4 weeks of therapy (P≤0.05),
metabolism. CU selectively inhibits the synthesis of with the best mean reduction of IL-1β level from
PGE2 and thromboxane, while not affecting the baseline to 4 weeks detected in the CU group in
synthesis of prostacyclin(27). Curcumin, by virtue of its comparison to the CHX and control groups (P>0.05).
anti-inflammatory property, reduces inflammatory

9
Efficacy of curcumin on chronic gingivitis Sulaimani Dent. J. June 2022

Since inflammatory cytokines are secreted in response depth PD after 4 weeks of rinsing with placebo in one
to inflammatory and infectious stimuli, increased levels group, and CHX in the other group, while gingival
of inflammatory cytokines have been detected in the crevicular fluid GCF IL-1alpha and IL-1Ra levels
saliva of patients with plaque-induced gingivitis, and the remained unchanged after 4 weeks.
presence of this inflammatory marker in the saliva is
important to determine the presence, risk, and transition Regarding patients’ compliance and complaints, in the
phase between healthy gingiva and gingivitis(34). CU group, there was good compliance with no adverse
Therefore, the presence of elevated levels of IL-1β is effects, while in the CHX group, a bitter taste was
related to the pathogenesis and progression of noticed by two participants, and tooth staining was
periodontal disease, because the secretion of this experienced by three participants. However, a limitation
cytokine requires the exposure of cellular alterations or of the study was the short duration of the clinical trial
stress signals triggering the activation of inflammatory and the limited sample size. Additional studies are
cells, which mediate the action of caspase-1, essential required to evaluate the anti-plaque and anti-
for IL-1β activation(35). In general, IL-1β plays an inflammatory property effects of CU for a longer
important role in the neutrophil migration capacity by duration of time, using large sample size, and different
stimulating the spread of these inflammatory cells concentrations.
through the blood vessels, and reducing the
concentration of this cytokine may decrease the need for
migration. The inflammatory process can be reduced,
Conclusions
either by mechanically removing the biofilm(34), which
results in reducing gingival inflammation, as in the S&P Curcumin CU mouthwash, as an anti-inflammatory
group, or by using 0.2% CHX mouth rinse or curcumin agent, was found to be more effective in the reduction
mouth rinse as an adjunct to mechanical therapy for of gingival inflammation than CHX mouthwash, as was
better plaque control. demonstrated clinically throughout more significant
reduction of GI, and BOP, and immunologically
Another reason for the superior salivary IL-1β reduction
throughout more significant reduction of inflammatory
in the curcumin group after 4 weeks of therapy could be
mediator IL-1β. Meanwhile, chlorhexidine mouthwash
that curcumin is known to possess potent immune-
was more effective than CU mouthwash in terms of anti-
modulating agents which down-regulate the expression
plaque effect, as was demonstrated clinically throughout
of the cyclooxygenase-2 enzyme (an enzyme that
a larger reduction of PI scores after 4 weeks of therapy.
catalyzes the synthesis of PGs and is linked to most
Therefore, like chlorhexidine mouthwash, curcumin
forms of inflammation, including periodontitis) and
mouthwash can be used for effective prevention of
inhibit the expression of pro-inflammatory cytokines.
plaque, gingival inflammation, and treatment of
The downregulation of various inflammatory cytokines
gingivitis, but without the unfavorable side effects of
such as TNF, IL-1, IL-6, IL-8, interferon, and some
bitter taste and teeth staining found with CHX.
other chemokines is also carried out by curcumin(36).
Moreover, another study reported that the anti-
inflammatory mechanism of action of CU could be due
to the blockage of arachidonic acid metabolism, namely, Conflicts of Interest
(1) inhibition of arachidonic acid metabolism through
lipoxygenase and scavenging of free-radicals generated No conflicts of interest are reported.
in this pathway; and (2) decreased expression of
inflammatory cytokines: interleukin (IL)-1b, IL-6, and
tumor necrosis factor-alpha(37).
Acknowledgments
Additionally, in our study, reduction of PI, GI, BOP,
and IL-1 beta levels were also detected in the S&P group I would like to express my deep thanks and appreciation
after 4 weeks of mechanical therapy (scaling and to the staff members of the pharmacology and
polishing alone) as compared to baseline before therapy. periodontic departments for their support in performing
This could have been due to patients’ motivation to the study.
maintain good oral hygiene. Furthermore, proper
mechanical plaque control could have resulted in the
resolution of gingival inflammation, This result is very
similar to that in a study performed by Türkoğlu(38), who
reported improvement in the clinical parameters PI, GI,
sulcus bleeding index SBI, calculus index, and pocket

10
Vol 9(1) Mohammad

References 13. Löe H, Silness J. Periodontal disease in pregnancy.

I. Prevalence and severity. Acta Odontol Scand.
1. Madianos PN, Bobetsis WA, Kinane DF. 1963;21(1):533-51.
Generation of inflammatory stimuli: how bacteria 14. Ainamo J, Bay I. Problems and proposals for
set up inflammatory responses in the gingiva. J recording gingivitis and plaque. Int Dent J.
Clin Periodontol. 2005;32(6):57-71. 1975;25(4):229-35.
2. Fine HD. Chemical agents to prevent and regulate 15. Navazesh M. Methods for collecting saliva. Ann of
plaque development. Periodontol 2000. the New York Aca of Scie. 1993;649(1):72-7.
1995;8(1):87-107. 16. Waghmare PF, Chaudhari AU, Karhadkar VM,
3. Bakdash B. Current patterns of oral hygiene Jamkhande AS. Comparative evaluation of
product use and practices. Periodontol 2000. turmeric and chlorhexidine gluconate mouthwash
1995;8(1):11-14. in prevention of plaque formation and gingivitis: A
4. Gomes FIF, Aragão MGB, Barbosa FCB, Bezerra clinical and microbiological study. J Contemp
MM, Pinto VPT, Chaves HV. Inflammatory Dent Pract. 2011;12(4):221-4.
cytokines Interleukin-1β and tumour necrosis 17. Chatterjee A, Debnath K, Rao NK. A comparative
factor-α - novel biomarkers for the detection of evaluation of the effi cacy of curcumin and
periodontal diseases: a literature review. J Oral chlorhexidine mouthrinses on clinical infl
Maxillofac Res. 2016;7(2):e2. ammatory parameters of gingivitis: A double-
5. Somu CA, Ravindra S, Ajith S, Ahamed MG. blinded randomized controlled clinical study. J
Efficacy of a herbal extract gel in the treatment of Indian Soc Periodontol. 2017;21(3):132-7.
gingivitis: A clinical study. J Ayurveda Integr 18. Arunachalam LT, Sudhakar U, Vasanth J,
Med. 2012;3(2):85-90. Khumukchum S, SelvamVV. Comparison of anti
6. Jolkovsky DL, Ciancio SG. Chemotherapeutic plaque and anti gingivitis effect of curcumin and
Agents. In: Takei HH, editor. Carranza's clinical chlorhexidine mouth rinse in the treatment of
periodontology, 10th ed. Missouri: Saunders gingivitis: A clinical and biochemical study. J
Company. pp.798-812,2006. Indian Soc Periodontol. 2017;21(6):478-83.
7. Bonesvoll P , Lökken P , Rölla G, Paus PN . 19. Jaruga E, Salvioli S, Dobrucki J, Chrul S,
Retention of Chlorhexidine in the human oral Bandorowicz-Pikuła J, Sikora S, et al. Apoptosis-
cavity after mouth rinses. Arch Oral Biol. like, reversible changes in plasma membrane
1974;19(3):209-12. asymmetry and permeability, and transient
8. Menon VP, Sudheer AR. Antioxidant and modifications in mitochondrial membrane
antiinflammatory properties of curcumin. Adv Exp potential induced by curcumin in rat thymocytes .
Med Biol. 2007;595:105–25. FEBS Letters. 1998;433(3):287-93.
9. Noorfshan A, Ashkani-Esfahani SA. Review of 20. Moghadamtousi SZ, Kadir HA, Hassandarvish P,
therapeutic effects of curcumin. Currr Pharm Dis. Tajik H, Abubakar S, Zandi K, et al. A review on
2013;19(11):2032-46. antibacterial, antiviral, and antifungal activity of
10. Mali AM, Behal R, Gilda SS. Comparative curcumin. Biomed Res Int. 2014;2014:186864.
evaluation of 0.1% turmeric mouthwash with 0.2% 21. Mohammed NA, Habil NY. Evaluation of
chlorhexidine gluconate in prevention of plaque antimicrobial activity of curcumin against two oral
and gingivitis: A clinical and microbiological bacteria. Automation, Control Intell Syst.
study. J Indian Soc Periodontol. 2012;16(3):386- 2015;3(2):18-21.
91. 22. Leyes Borrajo JL, Garcia VL, Lopez CG,
11. Kandwal A, Mamgain RK, Mamgain P. Rodriguez-Nuñez I, Garcia FM, Gallas TM, et al.
Comparative evaluation of turmeric gel with 2% Effi cacy of chlorhexidine mouthrinses with and
chlorhexidine gluconate gel for treatment of without alcohol: A clinical study. J Periodontol.
plaque induced gingivitis: A randomized 2002;73(3):317-21.
controlled clinical trial. Ayu. 2015;36 (2):145-50. 23. Gründemann LJ, Timmerman MF, van der Velden
12. Silness J, Loe H. Periodontal disease in pregnancy. U, van der Weijden GA. Reduction of stain, plaque
II. Correlation between oral hygiene and and gingivitis by mouth rinsing with chlorhexidine
periodontal condition. Acta Odontol Scand. and peroxyborate. Ned Tijdschr Tandheelkd.
1964;22(1):121-35. 2002;109(7):255-9.
24. Francetti LD, Fabbro M, Testroi T., Weinstein RL.
Chlorhexidine spray versus chlorhexidine

11
Efficacy of curcumin on chronic gingivitis Sulaimani Dent. J. June 2022

mouthwash in the control of dental plaque after 33. Gopinath D, Ahmed MR, Gomathi K , Chitra K,
periodontal surgery. J Clin Periodontol. Sehgal PK, Jayakumar R. Dermal wound healing
2000;27(6):425-30. processes with curcumin incorporated collagen
25. Singh V, Pathak AK, Pal M, Sareen S, Goel K. films. Biomat. 2004;25(10):1911-7.
Comparative evaluation of topical application of 34. Syndergaard B, Al-Sabbagh M, Kryscio RJ, Xi J,
turmeric gel and 0.2% chlorhexidine gluconate gel Ding X, Ebersole JL, et al. Salivary biomarkers
in prevention of gingivitis. Natl J Maxillofac Surg. associated with gingivitis and response to therapy.
2015;6(1):67-71. J Periodontol. 2014;85(8):e295-303.
26. Van der Weijden GA, Timmer CJ, Timmerman 35. Finoti LS, Nepomuceno R, Pigossi SC, Corbi SC,
MF, Reijerse E, Mantel MS, van der Velden U, et Secolin R, Scarel-Caminaga RM. Association
al. The effect of herbal extracts in an experimental between interleukin-8 levels and chronic
mouthrinse on established plaque and gingivitis. J periodontal disease: A PRISMA-compliant
Clin Periodontol. 1998;25(5):399-403. systematic review and meta-analysis. Medi
27. Amit SH, Ben-Neriah Y. NF-Kappa B activation (Baltimore). 2017:96(22):e6932.
in cancer: Achalenge for uniquitination-and 36. Gao X, Kuo J, Jiang H, Deeb D, Liu Y, Divine G,
proteasome-based therapeutic approach,” Semin et al. Immunomodulatory activity of curcumin:
Cancer.Biol. 2003;13(1):15-28. Suppression of lymphocyte proliferation,
28. Arora RB, Kapoor V, Basu N, Jain AP. Anti- development of cell-mediated cytotoxicity, and
inflammatory studies on Curcuma Long (turmeric) cytokine production in vitro. Biochem Pharmacol
. Indian J Med Res. 1971;59(8):1289-95. 2004;68(1):51-61.
29. Srimal, Deodhar RC. Pharmacology of 37. Huang MT, Lysz T, Ferraro T, Abidi TF, Laskin
diferuloylmethane (curcumin), a nonsteroidal anti- JD, Conney AH, et al. Inhibitory effects of
inflammatory agent. Pharmacology of curcumin . J curcumin on in vitro lipoxygenase and
Pharm Phrmacol. 1979;25(6):447-52. cyclooxygenase activities in mouse epidermis.
30. Ghatak N, Basu N. Sodium curcuminate as an Cancer Res. 1991;51(3):813-9.
effective antiinflammatory agent. Ind J Exp Biol. 38. Türkoğlu O, Becerik B, Emingil G, Kütükçüler N,
1972;10(3):235-236. BaylasH, Atilla G. The effect of adjunctive
31. Ivan A. Ross. Medical Plant of the World chlorhexidine mouth rinse on clinical parameters
Textbook, Human press Inc, Tatowa, New Jersey, and gingival crevicular fluid cytokine levels in
1999. untreated plaque-associated gingivitis. Inflamm
32. Suhag A, Dixit J, Dhan P. Role of curcumin as a Res. 2009;58(5):277-83.
subgingival irrigant: A pilot study. PERIO.
2007;4(2):115-21.

12
Vol 9(1) Abdalkarim et al.

Original Article

Stress Interpretation by Using Blood Glucose levels,

blood pressure and pulse rate measurement in
Patients attending Oral and Maxillofacial Clinic in
College of Dentistry at University of Sulaimani
Kardo M. Abdalkarim1, Kanar A. Hamaamin1, Bayad J. Mahmud1

Abstract
Objective: Based on specific parameters such as blood glucose levels, blood pressure, and pulse rate, a prospective randomized case-
control study was conducted to determine the stress during minor oral surgical procedures.

Methods: A total of 200 patients who underwent minor oral surgical procedures were randomly assigned into two groups: group (1)
received 2% lignocaine with adrenaline, while group (2) received the same plus an oral intake of 10 mg glucose in 200 mL water after
administration of local anesthesia. Before starting the operation and after the procedure was completed, the blood glucose level, blood
pressure, and pulse rate were taken at the chairside, with the time difference for each phase noted.

Results: In group (1), blood glucose levels were found to decrease before operations and then increase to a value higher than the
preoperative value, while in group (2), blood sugar levels remained constant before eventually rising to a higher postoperative value.
Blood pressure increased gradually in all classes, and a rise in pulse rate was observed.

Conclusions: We found a temporary decrease in blood glucose levels preceding an increase in blood glucose levels, lasting no more
than four or five minutes in minor intraoral operations under local anesthesia. Mild hypoglycemia may trigger episodes of psychogenic
syncope, so this brief hypoglycemia is of great clinical importance. At the same time, pulse rate and blood pressure gradually increase
with the procedures' progress, which is due to sympathetic nervous system excitation that promotes norepinephrine-induced changes
in many systems.

Keywords: Blood glucose, Blood pressure, Pulse rate, Adrenaline, Hypoglycemia.

Submitted: March 30, 2022, Accepted: May 12, 2022, Published: June 1, 2022.

Cite this article as: Abdalkarim KM, Hamaamin KA, Mahmud BJ. Stress Interpretation by Using Blood Glucose
levels, blood pressure and pulse rate measurement in Patients attending Oral and Maxillofacial Clinic in College of
Dentistry at University of Sulaimani. Sulaimani Dent J. 2022;9(1):13-20.

DOI: https://doi.org/10.17656/sdj.10144

1. Oral and Maxillofacial Surgery Department, College of Dentistry, University of Sulaimani, Sulaimani, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

13
Stress interpretation and oral surgery Sulaimani Dent. J. June 2022

Introduction glucose levels due to the release of endogenous

adrenaline and injected exogenous adrenaline.(13)
Minor oral surgical procedures are one of the basic and Hyperglycemia may result from both the direct and
most frequent dental procedures, which is considered a indirect action of adrenaline. Insulin secretion is
stressful and painful intervention(1,2). If a patient's suppressed as an indirect effect. Direct activities
discomfort can be eased, surgical treatments can be done resulted from increased hepatic glucose release and
in a more relaxed setting, and the patient's pain level decreased glucose consumption. A physiological
may rise(3). Lidocaine is the most widely used local increase in adrenaline will promote glycogenolysis and
anesthetic solution in dentistry. Nils Lofgren first glyconeogenesis. Although its impact on
introduced lidocaine in 1943, and it was first used as a glycogeno-lysis varies rapidly, hyperglycemia
local anesthetic material in 1948. However, the systemic continues because of gluconeogenesis(14-19).
complications of local anesthetic injection are one of the
most serious concerns(4). Although hyperglycemia is a feature of acute stress, this
effect in the initial phase of stress shows that subjects
Vasovagal shock, hyperventilation syndrome, who have undergone more stress have a lower
tachycardia, shivering, and loss of consciousness are the hyperglycemic response to adrenaline injection. A
most common complications after lidocaine injection(2- psychogenic stimulation may be the direct cause of the
4)
. In addition, injection procedures trigger pain and drop in blood sugar. The parasympathetic nervous
cause the release of endogenous catecholamine, which system induces insulin release through the vagus nerve,
can have a synergistic effect with the anesthetic which regulates glucose homeostasis by affecting the
vasoconstrictors, resulting in certain complications(5,6). pancreatic islet of Langerhans cells(20-24).
Using epinephrine and local anesthesia can also induce
metabolic changes(7).

Some people have adverse reactions to local anesthetic Patients and methods
injections, such as paleness and loss of consciousness,
and one of the helpful substances in these cases is Over six months, from December 2019 to June 2020, a
glucose(8). Stress before and during an injection can randomized, prospective, case-control study was
stimulate the sympathetic nervous system, boosting performed in the Department of Oral and Maxillofacial
blood glucose levels in patients undergoing minor oral Surgery, College of Dentistry, University of Sulaimani.
procedures. In addition, catecholamine release, blood In this study, patients who underwent minor dental
glucose, and insulin levels can all be increased by dental procedures such as therapeutic extractions and
surgery with a local anesthetic injection(9). impactions, patients with no underlying systemic
problems that would make the procedure unsafe are
The stress response is responsible for the hormonal and included in the research. In addition, patients with
metabolic changes that occur as a result of injury or systemic diseases such as diabetes and hypertension,
trauma, and it includes a wide range of endocrinological, steroid therapy three months before the study, pregnant
immunological, and hematological events as a state of and lactating mothers, and subjects with intolerance to
discord or disruptions in homeostasis brought about by local anesthetics or nonspecific drugs were excluded.
psychological, environmental, or physiological
stressors(10). In addition, these conditions trigger After obtaining written informed consent, 200 patients
immune-inflammatory and metabolic responses that are who needed regular minor oral surgical procedures and
intricately intertwined since the cells involved in these met this study's inclusion requirements were chosen.
main events ontogenetically derive from a special Patients were divided randomly into two groups. Before
primordial organ combining both immune and and after local anesthesia administration and after the
metabolic roles(11). procedure was completed, the patient's blood pressure,
blood glucose levels, and pulse rate were monitored at
The net effect of the endocrine response to stress due to the chairside, with the time difference for each phase
surgery is an increase in catabolic hormone secretion as noted. In group (2), after administering local anesthesia
blood glucose levels rise after surgery starts. As a result to all patients, 10 milligrams of glucose in 200 milliliters
of increased hepatic glycogenolysis and of water were provided, and the same parameters were
gluconeogenesis, cortisol and catecholamines aid reported. Before local anesthesia administration, after
glucose production. Furthermore, the intake of local anesthesia administration, and after procedure
peripheral glucose is limited and decreased(12). completion, both patients' blood pressure and blood
glucose levels were registered on a chair, with the time
Adrenaline has systemic and hemodynamic effects like gap for each phase noted. Three surgeons took those
an increase in blood pressure, heart rate, and blood patients randomly with the same inclusion criteria and

14
Vol 9(1) Abdalkarim et al.

used the same protocol or method for both groups of blood glucose levels immediately after the procedure
patients. One of the fingers was prepared and pricked showed a range of values from a maximum of 162 mg/dl
with a disposable lancet to extract blood after being to a minimum of 100 mg/dl, Table 2.
disinfected with an alcohol swab. A drop of blood was
placed on the test strip, and the glucometer's readings Both patients’ pulse rates and blood pressure gradually
were registered. Blood pressure and pulse rate were rose during the operations. The pulse rate was observed
monitored using an automated sphygmomanometer. All to increase until stage three of the procedures, after
the collected data were analyzed for statistically which it started to decrease to a value higher than the
significant correlations using the Shapiro-Wilk start time. However, according to the Shapiro-Wilk
normality test, Mann-Whitney U test, and the Friedman normality test, the data is not normally distributed. As a
test to assess the statistical difference between blood result, non-parametric tests were used in the present
glucose and blood pressure pulse rate before and after study.
local anesthesia application after the procedure is
According to the Mann-Whitney u test, there is a
completed.
statistically significant difference (p=0.00) between the
blood glucose levels before and after local anesthesia
application between groups (1) and (2), but no
Results statistically significant difference (p=0.084) between
groups (1) and (2) for the blood glucose levels after the
A total of 200 patients who sought minor oral surgical treatment. According to the Friedman Test, there is a
procedures were randomly assigned to one of two substantial statistical difference between blood glucose
groups: test group (1) and control group (2). group (1) levels before and after local anesthesia application and
had 52% female patients and 48% male patients, while after the procedure is completed, with the maximum
group (2) had 32% male patients and 68% female level of blood glucose level occurring before local
patients, Table 1. anesthesia application, followed by after local
anesthesia application, and finally, after the procedure is
Table 1: Number of males and females per group. completed, Figure 1.
Groups Groupe (1) Groupe (2) Total
Pulse rate
Male 48% 32% 80
Female 52% 68% 120 According to the Friedman Test, there is a statistically
Total 100% 100% 200 significant difference (p=0.00) in pulse rate (PR) before,
during, and after the operation, with the highest level of
In test group (1), blood glucose levels declined before pulse rate after local anesthesia (LA) application,
the procedure and then gradually increased to a value followed by before local anesthesia application, and
higher than the preoperative value. At the same time, in finally after procedure completion, Table 3, Figure 2.
the group (2), blood sugar levels remained stable
Blood pressure
without decline and gradually increased to a higher
postoperative value; the range of blood glucose levels According to the Friedman Test, there is a statistically
on the chair varied from the highest value of 178 mg/dl significant difference (p=0.034) in systolic blood
to the lowest of 80 mg/dl. In contrast, the blood glucose pressure before, during, and after the operation, with the
level after administration of local anesthesia ranged highest level of systolic blood pressure before local
from a peak value of 163 mg/dl to a lowest of 78 mg/dl, anesthesia application, followed by after local
the final evaluation of blood glucose level was anesthesia application, and finally after procedure
immediately posted extraction revealed a range of completion, Table 4.
values from the highest of 183 mg/dl to a lowest of 74
mg/dl, Table 2. According to the Friedman Test, there is a highly
statistically significant difference (p=0.00) in diastolic
The blood glucose level in the control group (2) ranged blood pressure before, during, and during the operation,
from a maximum of 147 mg/dl to a minimum of 91 with the highest diastolic blood pressure level after local
mg/dl, while the blood glucose level after administration anesthesia treatment.
of local anesthesia ranged from a maximum of 162
mg/dl to a minimum of 100 mg/dl, and about the blood
glucose level in the group (2) the final measurement of

15
Stress interpretation and oral surgery Sulaimani Dent. J. June 2022

Table 2: Descriptive statistical analysis for the blood glucose level of both groups.
Blood Glucose Blood Glucose Blood Glucose
Group
Before anesthesia After anesthesia Final evaluation
No. 100 100 100
Minimum 80 78 74
Without Maximum 178 163 183
Range 98 85 109
Median 111.00 110.00 109.50
No. 100 100 100
Minimum 91 100 82
With
Maximum 147 162 208
sugar
Range 56 62 126
Median 125.00 123.00 115.00
No. 200 200 200
Minimum 80 78 74
Total Maximum 178 163 208
Range 98 85 134
Median 121.00 116.00 111.00
Blood Glucose Blood Glucose Blood Glucose
Group
Before anesthesia After anesthesia Final evaluation
No. 100 100 100
Minimum 80 78 74
Without Maximum 178 163 183
Range 98 85 109
Median 111.00 110.00 109.50
No. 100 100 100
Minimum 91 100 82
With
Maximum 147 162 208
sugar
Range 56 62 126
Median 125.00 123.00 115.00
No. 200 200 200
Minimum 80 78 74
Total Maximum 178 163 208
Range 98 85 134
Median 121.00 116.00 111.00

Figure 1: Blood glucose levels before, after local anesthesia, and at the
completion of procedure (BG=Blood glucose, LA=local anasthesia).
16
Vol 9(1) Abdalkarim et al.

Table 3: Descriptive statistical analysis for pulse rate.

Pulse rate Pulse rate Pulse rate

Before anesthesia After anesthesia Final evaluation
No. 200 200 200
Minimum 53 55 61
Maximum 120 119 151
Range 67 64 90
Median 84.50 89.00 81.00

Table 4: Descriptive analysis for both systolic and diastolic blood pressure levels.
Systolic Final
Systolic Blood Diastolic Diastolic Final .
Blood diastolic
Pressure before Blood Pressure Blood Pressure systolic
Pressure after Blood
LA. before LA. after LA. Blood Pressure
LA. Pressure
No. 200 200 200 200 200 200
Minimum 90 11 86 12 86 44
Maximum 178 114 184 791 185 109
Range 88 103 98 779 99 65
Median 124 76 123 74 120 75

Figure 2: The difference in Blood Pressure during local anesthesia and at the completion of the
procedure.

17
Stress interpretation and oral surgery Sulaimani Dent. J. June 2022

Discussion Murugan et al.(24) found that the blood glucose levels

declined before extraction and then increased to a value
This clinical trial analyzed glucose levels in 200 patients higher than the preoperative value in the test group (1).
before, after local anesthesia, and after tooth extraction. At the same time, in the control group (2), the blood
There was no evidence of hypoglycemia, which may be sugar values maintained a steady state without decline
attributed to the release of catecholamine and cortisol in until they progressively increased to a higher
reaction to anxiety, fear, and pain throughout the postoperative value. In their research, the blood pressure
injection(1,2,3). was found to elevate gradually. An increase in pulse rate
was observed in all stages until the administration of
The stress response to surgery is characterized by local anesthesia, after which there was a marked decline.
increased pituitary hormone production and sympathetic
nervous system activation, which have secondary Jason Radley et al.(25) found that physiological stress
effects on the adrenal glands, resulting in a hormone responses are initiated rapidly. Sympathetic nervous
cascade(4-9). system excitation promotes norepinephrine-induced
changes in numerous bodily systems, including
During the stress response, hypothalamic sympathetic increases in heart rate and blood pressure and
nervous system activation results in increased epinephrine release(29-32), promoting hepatic
catecholamine secretion from the adrenal medulla and glycogenolysis which will introduce glucocorticoid
release of norepinephrine and cardiovascular effects hormones into the circulation to provide further
such as tachycardia and hypertension(10-16). redistribution of energy resources (like hepatic
gluconeogenesis), while also serving to limit the
Surgery is one of the most effective activators of cortisol
duration and impact of the initial stress response (24,33-36).
secretion, resulting in protein catabolism,
these findings are agreed with the results of our study.
gluconeogenesis, and inhibition of glucose uptake by
peripheral cells, both of which contribute to higher
blood glucose levels(17-20).
Conclusions
The most effective method of inhibiting stress responses
is neuronal blockade with local anesthetics, A transient drop in blood glucose levels occurs, lasting
emphasizing active anesthetic and analgesic regimens(21- no more than four or five minutes, before a dramatic
24)
; catabolism of stored body fuels is the ultimate increase in blood glucose levels. Mild hypoglycemia can
metabolic reaction. The severity and length of the also cause psychogenic syncope; therefore, this transient
response are usually proportional to the surgical injury hypoglycemia is significant in therapeutic practice,
and the incidence of complications such as sepsis(25-27). which is true to some extent, but it is especially relevant
in malnourished or fasting patients. And both blood
Our research focused on quantifying and assessing
pressure and pulse rate were found to increase gradually
stress in patients undergoing minor oral surgical
with the progression of the procedure because the stress
procedures using blood glucose as a primary parameter
leads to increase epinephrine release by adrenal glands
and blood pressure and pulse rate as adjuvant
due to sympathetic system stimulation.
parameters. Then, in the group (1), it gradually
increased to a value higher than the preoperative value,
while in the group (2), blood sugar levels remained
stable without declining and gradually increased. Acknowledgment
A prospective study by Paul C Salins et al.(13) measured The authors would like to acknowledge the University
the glucose level in capillary blood of 16 patients who of Sulaimani/Oral and maxillofacial department and
experienced vasovagal syncope during exodontia with those who participated in the progress of this study.
local anesthesia. Syncope can be caused by hypotension
(especially in patients with poor nutrition or those who
are fasting). Loser et al.(18) conducted a retrospective
analysis in which glucose metabolism is significantly References
altered in acute conditions. Stress-induced
hyperglycemia is an adaptive response to stress with 1. Yusa, H., Onizawa, K., Hori, M., Takeda, S.,
altered glucose metabolism resulting in the Takeda, H., Fukushima, S., et al. Anxiety
redistribution of glucose intake into other metabolic measurements in university students undergoing
pathways such as lactate development. third molar extraction. Oral Surg Oral Med Oral
Pathol Oral Radiol Endod. 2004;98(1):23-7.

18
Vol 9(1) Abdalkarim et al.

2. López-Jornet P, Camacho-Alonso F, Sanchez- 12. Desborough JP. The stress response to trauma and
Siles M. Assessment of general pre and surgery. British Journal of Anesthesia.
postoperative anxiety in patients undergoing tooth 2000;85(1):109-17.
extraction: A prospective study. Br J Oral 13. Salins PC, Kuriakose M, Sharma SM, Tauro DP.
Maxillofac Surg. 2014;52(1):18-23. Hypoglycemia as a possible factor in the induction
3. Abdeshahi SK, Hashemipour MA, Mesgarzadeh of vasovagal syncope. Oral Surg Oral Pathol.
V, Payam AS, Monfared AH. Effect of hypnosis 1992;74(5):544-549.
on induction of local anaesthesia, pain perception, 14. Gounaris A, Zagouri F, Sergentanis TN, et al.
control of haemorrhage and anxiety during Vacuum-assisted breast biopsy: insight into stress-
extraction of third molars: a case-control study. J induced endocrine events. In vivo.
Craniomaxillofac Surg. 2013;41(4):310-5. 2007;21(6):1081-4.
4. Gordh T, Gordh TE, Lindqvist K. Lidocaine: the 15. Zografu GC, Zagouri F, Sergentanis TN, et al.
origin of a modern local anesthetic. Excisional breast biopsy under local anesthesia:
Anesthesiology. 2010;113(6):1433-7. stress-related neuroendocrine. metabolic and
5. Kämmerer PW, Palarie V, Daubländer M, Bicer C, immune reactions during the procedure. In vivo.
Shabazfar N, Brüllmann D, et al. Comparison of 2009;23(4):649-52.
4% Articaine with epinephrine (1: 100,000) and 16. Black PH- Central nervous system-immune system
without epinephrine in inferior alveolar block for interactions Psychoneuroendocrinology of stress
tooth extraction: double-blind randomized clinical and its immune consequences Antimicrob agents
trial of anesthetic efficacy. Oral Surg Oral Med and Chemother. 1994;38(1):1-6.
Oral Pathol Oral Radiol. 2012;113(4):495-9. 17. Jern S- Effects of acute carbohydrate
6. Bronzo AL1, Cardoso CG Jr, Ortega KC, Mion D administration on central and peripheral
JR. Felypressin increases blood pressure during hemodynamic responses to mental stress.
dental procedures in hypertensive patients. Arq Hypertention. 1991;18(16):790-7.
Bras Cardiol. 2012;99(2):724-31. 18. Loser MR, Damoisel C, Payen D. Bench-to-
7. Kalra P, Rana AS, Peravali RK, Gupta D, Jain G. bedside review: glucose and stress conditions in
Comparative evaluation of local anaesthesia with the intensive care unit. Crit Care. 2010;1(2):231
adrenaline and without adrenaline on blood 19. Knoop K, Stack LB, Storrow AB, Thurman RJ.
glucose concentration in patients undergoing tooth The atlas of emergency medicine. 4th ed, USA:
extractions. J Maxillofac Oral Surg. Mcgraw Hill Professional; 2009.1-1008.
2011;10(3):230-5. 20. Seelig E, Bilz S, Keller U, Meienberg F, Christ-
8. Cholewa M, Sobaniec S, Sobaniec P, Sendrowski Crain M. Concentrations of the stress hormone
K, Żochowska M. Sudden episodes of loss of copeptin increase upon hypoglycaemia in patients
consciousness in dental practice. Neurologia with type I diabetes dependent of hypoglycaemia
Dziecięca. 2012;21(43):71-8. awareness. PLOS ONE. 2013;8(8):e72876.
9. Hansen O, Johansson BW, Nilsson-Ehle P. 21. Kambalimath HV, Dixit UB, Thyagi PS. Salivary
Metabolic, electrocardiographic, and cortisol response to psychological stress in
hemodynamic responses to increased circulating children with early childhood caries. Indian J Dent
adrenaline: effects of selective and nonselective Res. 2010;21(2):231-7.
beta adrenoceptor blockade. Angiology. 22. Kalman BA, Grahn RE. Measuring salivary
1990;41(3):175-88. cortisol in the behavioral neuroscience laboratory.
10. Bortoluzzi MC, Manfro R, Nardi A. Glucose levels J Undergrad Neurosci Educ. 2004;2(2):41-9.
and hemodynamic changes in patients submitted to 23. Hempenstall PD, Campbell JP, Bajumow AT.
routine dental treatment with and without local Cardiovascular. biochemical, and hormonal
anesthesia. Clinics. 2010;65(10):975-8. responses to intravenous sedation with local
11. Siddiq M, Rao S, Rai G, Hiregoudar JS, Pitale U. analgesia versus general anesthesia in patients
Study on blood glucose concentration in patients undergoing oral sugary. J Oral ,Maxillofac Surg.
with diabetes undergoing dental extraction under 1986;44(6):441-6.
local anesthesia with and without adrenaline. 24. Aparna Murugan, Farah kulsum, Neelakandan RS,
Journal of basic and clinical physiology and phar- Titus K Thomas. Using blood glucose estimation
macology. 2012;23(4):169-71. to interpret stress in patients undergoing minor oral
surgery procedures. J Dent Health Oral Disord
Ther. 2017;8(2):461-4.

19
Stress interpretation and oral surgery Sulaimani Dent. J. June 2022

25. Radley JJ, Williams B, Sawchenko PE.

Noradrenergic innervation of the dorsal medial
prefrontal cortex modulates hypothalamo-
pituitary-adrenal responses to acute emotional
stress. J Neurosci 2008;28 (22):5806-6.
26. Bellucci CC, Kapp-Simon. Psychological 32. Finger BC, Dinan TG, Ciyan JF. The temporal
considerations in orthognathic surgery. Clin Plast impact of chronic intermittent psychosocial stress
Surg. 2007;34(3):1l-6. on high-fat diet-induced alterations in body
27. McEwen BS, Stellar E. Stress and the individual. weight. Pchychoneuroendocrinology.
Mechanisms leading to disease. Arch Intern Med. 2012;37(6):729-41.
1993;153(18): 2093-101. 33. Germain A, Nofzinger EA, Meltzer CC, Wood A,
28. Munck A, Guyre PM. holbrook NJ- Physiological Kupfer DJ, Moore RY, et al. Diurnal variation in
functions of glucocorticoids in stress and their regional brain glucose metabolism in depression.
relation to pharmacological actions. Endocr Rev. Biol Psychiatry. 2007;62(5):438-45.
1984;5(1):25-44. 34. Vázquez LR, López ER, Centelles AV, Otero AB,
29. McE"en BS. Plasticity of the hippocampus: Otero FV, Centelles PV. Stress amongst primary
adaptation to chronic stress and allostatic load. dental care patients. Med Oral Patol Oral Bucal.
Ann N Y Acad Sci. 2001:933; 265-77. 2008;13(4):253-6.
30. Depke M, Fusch G, Domanska G, Geffers R, 35. Waldstein SR, Siegel EL, Lefkowitz D, Maier KJ,
Völker U, Schuett C, et al. Hypermetabolic Pelletier Brown JR. Stress-induced blood pressure
syndrome as a consequence of repeated reactivity and silent cerebrovascular disease.
psychological stress in mice. Endocrinology. Salute. 2004;35(6):1294-8.
2008;149(6):2714-23. 36. Jabbar JK, Hani Radhi. Ahmad F Hassan.
31. Eaton WW, Armenian H, Gallo J, Pratt L, Ford Influence of dental extraction on patient's stress
DE. Depression and risk for onset of type II and anxiety level by assessing the salivary cortisol
diabetes. A prospective population-based study. concentration at different time points during the
Diabetes Care. 1996;19(10):1097-102. extraction procedure. Assessment. 2012;9(2):208-
17.

20
Vol 9(1) Mohammad et al.

Original Article

Evaluation of Skeletal Jaw Relation by Different

Cephalometric Angles for Sample of Kurdish Young
Adults in Sulaimani City-A Cephalometric Study

Shiler A. Mohammed1, Trefa M. Ali2, Zhwan J. Rashid2

Abstract
Objective: An accurate evaluation of the skeletal sagittal jaw relationship is important in orthodontic diagnosis and treatment planning.
This study was done to establish cephalometric norms of all types of malocclusions using ANB angle, Wit’s appraisal, and Beta angle
and evaluate the significance of W angle compared to these parameters.

Methods: Ninety pre-treatment lateral cephalograms of male and female patients aged 18-28 years from Sulaimani city that met the
sample criteria were traced digitally by the Easy Dent 4 software program. The sample was divided into three groups of skeletal
malocclusions, class I, II, and III, by the two-finger method of Foster initially. It was later confirmed cephalometrically by ANB angle,
Beta angle, and Wit’s appraisal; each group consisted of 30 patients. Also, for each subject, the W angle was measured.

Results: Significant differences were found in the ANB angle, Beta angle, Wit’s appraisal, and W-angle in all 90 patients. The
coefficient of variability showed that Wit’s appraisal was the most variable parameter and W angle was the least variable parameter.

Conclusions: ANB angle, Beta angle, Wit’s appraisal, and W-angle are significant parameters to assess the sagittal jaw relationship.
The use of W angle and other parameters can provide a more accurate assessment of the sagittal skeletal jaw relationship as it has the
least coefficient of variance; it should therefore enable better diagnosis and treatment planning for patients.

Keywords: Skeletal sagittal jaw relationship, W Angle, ANB angle, Beta angle, Wit’s appraisal.

Submitted: September 23, 2021, Accepted: December 26, 2021, Published: June 1, 2022.

Cite this article as: Mohammed SA, Ali TM, Rashid ZJ. Evaluation of Skeletal Jaw Relation by Different
Cephalometric Angles for Sample of Kurdish Young Adults in Sulaimani City-A Cephalometric Study. Sulaimani
Dent J. 2022;9(1):21-30.

DOI: https://doi.org/10.17656/sdj.10145

1. Sulaimani Directorate of Health, Sulaimani, Iraq.

2. Pedodontic, Orthodontic, and Preventive Dentistry Department, College of Dentistry, University of Sulaimani, Sulaimani, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

21
Skeletal Jaw Relation and Cephalometric Angles Sulaimani Dent. J. June 2022

Introduction

In orthodontics, discrepancies in the jaws can be Patients and methods

described in three planes, namely transverse, sagittal
and vertical(1). Of these, the sagittal discrepancies are of The present study was conducted on patients seeking
most concern to the patient. Hence, in orthodontic orthodontic treatment in the Orthodontic department of
diagnosis and treatment planning, an accurate Shorsh teaching dental center from the beginning of July
measurement of sagittal discrepancy is critical(2). 2016 to the end of January 2017 in Sulaimani city. The
However, evaluating the sagittal relationship between study was approved by the college research committee,
the maxilla and mandible has posed a major problem. Dentistry college, Sulaimani University (Appendix I).
The causes of this problem are the change in the sagittal The sample consisted of 124 cephalograms of 311
relationship due to rotations of the jaws during growth patients examined clinically (male and female) with
and a lack of validity of the various methods proposed class I, class II, or class III malocclusion. The sample
for their evaluation(3). size has been determined based on the Sharma et al.
(2011) study. However, in this study, the sample size
The importance of the sagittal jaw relationship for was increased to increase the statistical power and
patients and orthodontists has led to the invention of reduce type II error (the non-rejection of a false null
many linear and angular cephalometric parameters for hypothesis)(9).
its measurement, including ANB angle, Wit’s appraisal,
and Beta angle(4). But they are affected by at least one of Ninety patients fit the study's criteria, while 34 cases
the following factors: jaw rotations, poor reproducibility were excluded due to the poor quality of cephalometric
of landmarks, patient’s age changes during orthodontic radiograph or failure to communicate with the patients.
treatment, and growth changes in reference planes(5). Among the selected cases, 40% were male (36 cases),
and 60 % were female (54 cases). These 90 cases were
In 2013, Bhad et al. introduced the W-angle to overcome randomly divided into three groups, based on class I, II,
these problems. This is the angle between the and III classifications, with 30 cases in each group.
perpendicular line from point M to the S–G line and the
M–G line. The use of this has many advantages. Firstly, Criteria for selecting the cases
it is not dependent on unstable landmarks or dental
1. Patients must possess Kurdish nationality (all
occlusion. Therefore, it is a valuable tool for assessing
three grandparents of both parents for patients
true sagittal changes because of growth and orthodontic
were Kurdish) and live in Sulaimani.
treatment(6). Secondly, in skeletal patterns with
2. Patients aged between 18 and 28 years old.
clockwise or counterclockwise rotation of the jaws and
3. Patients with complete permanent dentition
during transitional periods when vertical facial growth
except for third molars.
is taking place, the W angle is a useful sagittal
4. No history of orthodontic treatment or
parameter(7). Finally, it can be used for treatment
orthognathic surgery.
planning during orthopedic or orthognathic procedures.
5. No history of craniofacial trauma.
This angle is independent of the cranial base length
6. No cranial or facial malformation.
(position of point N) that sometimes camouflages the
7. No TMJ disorder or pain.
true skeletal class I, II, and III patterns(8).
The researcher filled the data recording sheet for each
Moreover, cephalometric analysis is practiced by
case (Appendix II). After that, the patients were referred
comparing the patient’s radiographic measurements
for a lateral cephalometric radiograph (ceph). All the
with norms or standard values, most obtained from
cephs were taken by one radiologist. These cephs were
samples of European or American populations.
obtained using the cephalogram [pax-i3D system (Pano-
Therefore, applying these norms to other populations
Cephalo-CT), 2014]. The machine was set at 84
may cause errors because of possible ethnic and racial
kilovoltage peak, 10.0 milliampere, and exposure time
variations(7).
of 1.2 seconds. Cephs were taken with teeth in centric
This study aims to establish cephalometric norms of all occlusion, lips relaxed posture, and the head in the
types of sagittal skeletal malocclusion using ANB, Wit’s natural position with the Frankfort plane parallel to the
appraisal, W angle, and Beta angle for a sample of floor(10).
Kurdish young adults in Sulaimani city and to evaluate
the significance of W angle in comparison to these
parameters.

22
Vol 9(1) Mohammad et al.

Cephalometric landmarks and planes used in this shown in Figures 1 A, B, C. Next, the patients were
study for analyses(3,6) (Figures 1 and 2) classified into class I, II, or III skeletal pattern groups if
two of the three parameters meet the same criteria and
S: The midpoint of the pituitary fossa (sella turcica). be within the same class(6). Table 1 shows the
distribution of the patients who fulfilled the criteria
Point A: The deepest midline point on the premaxilla
across the class I, II, and III study groups.
between the anterior nasal spine and prosthion, near the
apex of the central incisor root. All landmark identification and measurements were
made using the software program (Easy Dent 4,
Point B: The deepest midline point of the bony
software version: 4,14,1 (2012)). This software program
curvature of the mandible.
had options for adjusting the radiograph by adjusting the
Nasion (N): In the frontonasal suture at the most contrast and brightness to facilitate the identification of
anterior point. the landmarks and zoom option and magnification for
better viewing and differentiation of the landmarks.
ANB angle: Is an angle formed between A, N, and B
points (Figure 1 A). After sample classification, the W angle was constructed
and measured, as shown in Figure 2. According to Bhad
Functional occlusal plane: A line drawn through the et al., a W angle between 51 - 56 ° is considered a class
region of the overlapping cusps of the first premolars I skeletal pattern. An angle less than 51 ° is considered
and first molars. a skeletal class II relationship, and an angle greater than
56 ° is considered a skeletal class III(6).
Wit’s appraisal: horizontal distance between two lines,
AO and BO, is formed by drawing two lines To assess the intra-examiner and inter-examiner
perpendicularly from points A and B to the functional reliability of the cephalometric analysis, five
occlusal plane (Figure 1 B). parameters/variables from 10 randomly selected
cephalograms were traced twice at a two-week interval
C: Condylion, the midpoint of the condyle. by the same observer and by 2nd observer. Later, the
intra-examiner was tested by the paired t-test, and for the
Beta angle: The center of the condyle and point B is
inter-examiner reliability, a one-way analysis of
joined by the C-B line. A perpendicular line is drawn
variance (ANOVA) was used. The analysis showed no
from point A to the C-B line angle. Also, a connecting
significant difference.
line between point A and point B is drawn. The Beta
angle is between the perpendicular line and the A-B line Statistical analysis
(Figure 1 C).
The Statistical Package for Social Sciences (SPSS,
M: The midpoint of the premaxilla, identified as the version 22) was used for analyzing data. The Shapiro
mid-point of the largest circle that could be drawn in the Wilk test was done to test the normality of the data.
premaxilla tangent to the anterior and superior walls. According to the p - values, the data were normally
distributed. Hence, ANOVA was used to compare the
G: Center of the largest circle tangent to the anterior,
means of the three study groups. The post-doc test was
posterior, and internal inferior surfaces of the
used to compare every two groups, Pearson correlation
mandibular symphysis.
coefficient (r) was used to assess the strength of
S-G Line: This is a line connecting S and G points. correlation between two numerical variables, and the
coefficient of variability was used to measure the extent
W angle: Sella is connected to the M point, and G and of variability of the variable in relation to the population.
M-G points are connected. Then a perpendicular line is The significance alpha level was set at a p-value of ≤
drawn from point M to the S-G line. Finally, the W angle 0.05.
is formed between the perpendicular and the M-G lines
(Figure 2).

Foster's two-finger method (9) was used for the initial Results
skeletal classification of the malocclusion, and later the
following variables: ANB, Beta angle, and Wit’s Determination of Kurdish norms for sagittal analyses in
appraisal, separately for each patient was measured as class I, II, and III groups for the variables of Beta angle,
ANB angle, Wit’s appraisal, and W angle for all three

23
Skeletal Jaw Relation and Cephalometric Angles Sulaimani Dent. J. June 2022

classes of malocclusion included in the study along with The differences in the means of Beta angle, ANB, Wit’s
the coefficient of variability were summarized in Table appraisal, and W angle readings between and within the
2. three classes are shown in Table 3.

Table 1: The criteria included in the classes I, II, or III skeletal patterns for grouping of study.

Skeletal class ANB angle (11) Wit’s appraisal (12) Beta angle (13)

Coincidence of AO and BO in females Between 27o to 35o and clinically a

Class I 2° to 4°
or BO 1 mm ahead of AO in males pleasant (almost straight) profile
AO ahead of BO in females or AO
Class II > 4° < 27
coinciding with or ahead of BO in males
BO ahead of AO in females or BO
Class III < 2° ahead of AO by more than 1 mm in > 35°
males

Table 2: Determination of Kurdish norms for sagittal analysis in

class I, II and III group along with coefficient of variability.
Class No. Mean SD CV

Class I 30 32.387 2.96 0.09

Beta angle Class II 30 25.233 3.10 0.12

Class III 30 42.957 6.39 0.15

Class I 30 2.740 0.73 0.27

ANB angle Class II 30 5.850 1.27 0.22

Class III 30 -3.290 1.36 -0.41

Class I 30 -.010 0.75 -74.90

Wit’s appraisal Class II 30 4.320 2.37 0.55

Class III 30 -6.060 3.88 -0.64

Class I 30 54.1 3.31 0.06

W angle Class II 30 48.34 2.16 0.04

Class III 30 60.07 3.74 0.06

24
Vol 9(1) Mohammad et al.

Table 3: ANOVA and post-hoc (LSD) test results of Table 2.

p (ANOVA) LSD groups p (LSD)

Class I X
Class I < 0.001
Class II
Class I X
Beta angle Class II < 0.001 < 0.001
Class III
Class Class II X
< 0.001
III Class III
Class I X
Class I < 0.001
Class II
Class I X
ANB angle Class II < 0.001 < 0.001
Class III
Class Class II X
< 0.001
III Class III
Class I X
Class I < 0.001
Class II
Wit’s Class I X
Class II < 0.001 < 0.001
appraisal Class III
Class Class II X
< 0.001
III Class III
Class I X
Class I < 0.001 < 0.001
Class II
Class I X
W angle Class II < 0.001
Class III
Class Class II X
< 0.001
III Class III

Figure 1: Cephalometric tracing: A) ANB angle, B) Wit’s appraisal, and C) Beta angle identification.

25
Skeletal Jaw Relation and Cephalometric Angles Sulaimani Dent. J. June 2022

Figure 2: Cephalometric tracing showing W angle.

Correlation between the study parameters relationship. A literature search indicated that various
parameters are available to assess the sagittal
In class, I patients, all of the correlations between the relationship, but none can be applied with maximum
studied parameters were weak and not significant (r < reliability(11).
0.4, and P > 0.05), except for the correlation between W
angle and Wit’s appraisal, which was a significant Riedel developed the ANB angle in 1952(12). It is
positive correlation (r = 0.382, p = 0.037). It means in considered the most popular and widely used angle for
class I, patients, when the value of W angle increases, assessing the sagittal jaw relationship. However, it is
the value of Wit’s appraisal also increases and vice affected by jaw rotation due to orthodontic treatment or
versa. In class II patients, all the correlations were weak growth. In addition, any displacement in point N
and not significant, except for a negative, moderate influences ANB values(12). Therefore, when using the
strength significant correlation between W angle and ANB angle, many factors, including the length of the
ANB angle (r = -0.563, p = 0.001). It means in class II anterior cranial base, growth rotation of the jaws,
patients, when the value of W angle increases, the value vertical growth, and patient age, should be considered,
of ANB angle decreases and vice versa (Table 3). which assesses this angle much more complicated(13). In
the present study, the mean values of this angle were
The picture was different regarding class III patients. near to those of Riedel's standards, and the results of our
First, a strong inverse significant correlation was study showed that the ANB angle values are not affected
detected between the Beta and ANB angles (r = -0.725, by ethnic group differences. However, it is affected by
p < 0.001). The same was found for the correlation various factors, which can often lead to errors such as
between Beta angle and Wit’s appraisal (r = -0.820, p < positions of point A or B and position of Nasion.
0.001). Second, a nearly strong positive significant
correlation was detected between the Beta and W angle To overcome the controversies surrounding the ANB
readings (r = 0.686, p < 0.001). Third, a strong angle, Wit’s appraisal was introduced by Jacobson in
significant positive correlation was detected between the 1975(14). Although landmarks identification or jaw
ANB angle and Wit’s appraisal (r = 0.719, p < 0.001). rotations do not affect it, its accuracy is affected by the
Fourth, there was a strong negative correlation between need to correctly identify the functional occlusal plane,
ANB angle readings and W angle readings (r = -0.723, which can sometimes be impossible, especially in
p < 0.001). Finally, an inverse, nearly strong, significant patients with open bites, mixed dentition, multiple
correlation was observed between Wit’s appraisal and impactions, missing teeth, severe cant of the occlusal
W angle (r = -0.678, p < 0.001) (Table 3). plane, and skeletal asymmetries, or steep curve of
Spee(15). Additionally, the functional occlusal plane may
be changed by orthodontic treatment, which can
influence Wit’s measurement. Therefore, in these cases,
Discussion Wit’s appraisal will not reflect pure sagittal changes of
the jaws(3). The mean values of the present study were
Angular and linear variables are utilized
near Jacobson's finding. Again, the result indicated that
cephalometrically to analyze the skeletal sagittal jaw

26
Vol 9(1) Mohammad et al.

we could use Wit’s appraisal for our population and not significant, except for the correlation between
confidently as an ethnic group has not affected the W angle and Wit’s appraisal, where there was a
finding. However, the functional occlusal plane's significant positive correlation. This may be related to
location was difficult, as confirmed by Ishikawa et al. the that the ANB angle is affected by the growth of
and Moore et al.(5,17). Nasion while the W angle is most stable and reliable(19).

The present study showed that the Beta angle values The findings agree with Mittal et al. study(4) but disagree
were statistically significant among all groups, as with Sharma et al.(7) study, which found that in class I
supported by Biak and Ververidou. They stated that the subjects, ANB angle correlated positively with Wit’s
Beta angle remains relatively stable even when the jaws appraisal. Additionally, our study disagrees with Pervez
are rotated, and it does not depend on the functional and Ahmed's (8) and Al-Mashhadany's (18) studies, which
occlusal plane or cranial landmarks(13). When there is a reported a strong negative correlation between W angle
clockwise or counterclockwise rotation of the jaws, the and ANB angle in CL I malocclusion.
Beta angle can more accurately assess the sagittal jaw
relationship. Nonetheless, it still uses points A and B, Correlation of the study parameters in class II
which are affected by alveolar bone remodeling patients
associated with growth or orthodontic movement of the
The present study showed that in the class II group, all
incisor teeth(18).
the correlations between the studied parameters were
- above limitations of other parameters, a measurement weak and not significant except for a negative, moderate
was developed named the W angle. In the present study, strength significant correlation between W angle and
the mean values of W angle were near those found in the ANB angle, which agrees with Sharma et al.(7) and
Bhad et al. and Al Mashhadany studies(6,18), while it Pervez and Ahmed(8) studies but disagrees with the
disagrees with Mittal et al. study(4). This difference study by Mittal et al.(4) which found a moderate negative
might be due to sample size or ethnic group. However, correlation between W angle and Wit’s appraisal.
the present study shows that the groups' W angle values Therefore, assuming that Beta angle may not be a
were statistically significant. This agrees with Bhad et reliable tool for assessing sagittal jaw discrepancy in
al.’s study, which proposed that this angle indicates patients exhibiting vertical growth patterns with skeletal
sagittal skeletal dysplasia(6). The W angle uses three Class I and Class II malocclusions. However, the Beta
stable landmarks: point S, point M, and point G; the W angle is a reliable indicator of sagittal dysplasia in
angle remains relatively stable even when the jaws are normal and horizontal growth patterns(20). Furthermore,
rotated or growing vertically. This is because of the S-G the geometry of the W angle gives it the advantage of
line's rotation and jaw rotation, which carries the remaining relatively stable even when the jaws are
perpendicular from point M with it(6). rotated or growing vertically as it uses three stable
landmarks: point S, point M, and point G, and the angle
Another advantage of the W angle is that it can be a is measured between a perpendicular line from point M
valuable tool for planning orthopedic or orthognathic to the SG line and M-G line. Thus the W angle remains
procedures as this angle is independent of cranial base relatively stable even when the jaws rotate or grow
length, which will be affected by the position of point N vertically. This is because of the S-G line's rotation and
and can sometimes camouflage true skeletal class I, II, jaw rotation, which carries the perpendicular line from
and III patterns(3). The present study results showed that point M with it(6).
the coefficient of variability was highest for Wit’s
appraisal and lowest for W angle in all three classes, Correlation of the study parameters in class III
agreeing with Mittal et al. and Sharma et al. studies (4, 7). patients
This indicates that Wit’s appraisal is a highly variable
The findings of this study showed a strong negative
parameter and W angle is the least variable and most
significant correlation between ANB angle and Beta
homogeneously distributed parameter in intra-group
angle, also a strong significant positive correlation
comparisons.
between ANB angle and Wit’s appraisal. Interestingly,
Correlation of the study parameters in class I skeletal class III malocclusions showed 100% adherence
patients to Beta angle values irrespective of the growth pattern.
To overcome some of the limitations of the previously
The present study showed that in the class I group, all discussed parameters, the W angle was developed(20).
correlations between the studied parameters were weak These results agree with Mittal et al.’s(4) study. In the CL

27
Skeletal Jaw Relation and Cephalometric Angles Sulaimani Dent. J. June 2022

III group, the W angle showed a strong positive 5. Ishikawa H, Nakamura S, Iwasaki H, Kitazawa S.
significant correlation with the Beta angle and a Seven parameters describing anteroposterior jaw
significant correlation with Wit’s appraisal. relationships: postpubertal prediction accuracy and
interchangeability. Am J Orthod Dentofacial
Moreover, there was a strong negative correlation Orthop. 2000;117(6):714-20.
between the ANB angle readings and the W angle 6. Bhad W, Nayak S, Doshi U. A new approach of
readings. These results agree with Pervez, Ahmed, and assessing sagittal dysplasia: the W angle. Eur
AL Mashhadany(8,18). However, they disagree with the J Orthod. 2013;35(1):66-70.
Mittal et al.(4) results which showed only a negative 7. Sharma R, Sharma K, Mathur A, Preethi N,
correlation between W and ANB angles and no Agarwal V, Singh S and Satija N. Comparison of
significant correlation between other parameters. W angle with different angular and linear
measurements in assessment of sagittal skeletal
The Beta angle is similar to the W angle in being unable
relationship in Class I and Class II patients in
to determine which jaw is prognathic or retrognathic in
Jaipur population-A cephalometric study. OHDM.
class II and class III skeletal cases. To clarify this,
2015;14(3):155-60.
clinicians should be aware of the importance of other
8. Pervez H and Ahmed I. A new cephalometric tool
cephalometric measurements(8). The relatively new W
W angle in the evaluation of anteroposterior
angle is the most stable and reliable angle for measuring
skeletal discrepancy in orthodontic patient. Int.
sagittal skeletal discrepancies(21).
JDH S. 2014;1(3):299-304.
9. Foster TD. A textbook of orthodontics 2nd ed. St
Louis: Blackwell Scientific Publications, Mosby
Conclusions Book Distributors. 1982. P25-41.
10. Major P, Johnson D, Hesse K, Glover K. Effect of
The ANB angle, Beta angle, Wit’s appraisal, and W- head orientation on posterior anterior
angle are significant parameters for assessing the cephalometric landmark identification.
sagittal jaw relationship between maxilla and mandible; Angle Orthod. 1996;66(1):51-60.
however, to overcome the limitations of each, at least 2- 11. Doshi J, Trivedi K, Shyagali T. Predictability of
to to three parameters should be used. The use of W YEN angle & appraisal of various cephalometric
angle and other parameters can provide a more accurate parameters in the assessment of sagittal
assessment of the sagittal skeletal jaw relationship as it relationship between maxilla and mandible in
has the least coefficient of variance; it should therefore Angle's class II malocclusion. Peoples J Sci Res.
enable better diagnosis and treatment planning for 2012;5(1):1-8.
patients. 12. Riedel R. The relation of maxillary structures to
cranium in malocclusion in normal occlusion.
Angle Orthod. 1952;22(3):140-45.
13. Baik C, Ververidou M. A new approach of
References assessing sagittal discrepancies: the Beta angle.
Am J Orthod Dentofacial Orthop.
1. Singh A, Jain A, Hamsa P, Ansari A, Misra V,
2004;126(1):100-5.
Savana K, Yadav A. Assessment of sagittal
14. Jacobson A. The Wit’s appraisal of jaw
discrepancies of jaws: A review. Int J Adv Health
disharmony. Am J Orthod1975; 67 (2):125-38.
Sci. 2015;1(9):29-4.
15. Jacobson A. Application of the" Wit’s" appraisal.
2. Jain S, Raghunath N, Muralidhar N. A comparison
Am J Orthod.1976;70(2):179-89.
of W angle, Pi Angle and YEN angle as an
16. Sherman S, Woods M and Nanda R. The
indicator for assessing anteroposterior skeletal
longitudinal effects of growth on the Wit’s
dysplasia in various malocclusion among the
appraisal. Am J Orthod. 1988;93(5):429-36.
regional population: a cephalometric study.
17. Moore R, DuBois L, Boice P, Igel K. The accuracy
IJDRD. 2018;8(3):29-40.
of measuring condylion location.
3. Gor J, Kubavat A, Desai M, Mahida K, Modh A,
Am J Orthod Dentofacial Orthop. 1989;95(4):344-
Vaghela A. W angle: sagittal jaw dysplasia
7.
indicator for orthodontic diagnosis outcome.
18. Al-Mashhadany S. The relation between W angle
JMSCR. 2019;8(5):61-5.
and other methods used to assess the sagittal jaw
4. Mittal D, Venkatesh S, Shivamurthy P, Mathew S.
relationship. J Bagh Coll Dentistry.
A" new vista" in the assessment of antero-posterior
2012;24(2):144-9.
jaw relationship. APOS Trends Orthod.
19. Anjora D. Comparative Evaluation of Yen Angle
2015;5(4):151-55.
and W Angle with ANB Angle and Wits Appraisal

28
Vol 9(1) Mohammad et al.

for Predicting Sagittal Jaw Dysplasia. EJMCM. 21. Gupta A, Kumar A, Ashraf K, Hussain K, Kumar
2021;8(2):2021. A, Kulshrestha R. Establishment of cephalometric
20. Asudaria B, Chandulal Jadav D, Srinivasulu D, norms of Yen, W and Beta angle with assessment
Swamy S, Mothe G. Reliability of W-angle to of sagittal jaw relationship in Eastern Indian
assess sagittal skeletal dysplacia in class I, class II, population. Indian J Orthod Dentofacial Res.
class III, patients: A Cephalometric study. 2019;5(2):63-6.
Int J Appl Dent Sci. 2021;7(1):414-17.

29
Skeletal Jaw Relation and Cephalometric Angles Sulaimani Dent. J. June 2022

30
Vol 9(1) Rasheed and Ahmed

Original Article

Crown Size Comparisons in Patients with

Unilateral Palatally Impacted Canine by Cone-
Beam Computed Tomography
Tara A. Rasheed 1*, Handren A. Ahmed 2

Abstract
Objective: Impacted canine is a frequently encountered clinical problem. The goal of this study is to compare canines’ dimensions
and the adjacent lateral incisors to investigate the impact of tooth size on canine impaction as it could help the orthodontists to
prepare a scientific treatment plan which proportionally aligns the teeth on both sides.

Methods: In this retrospective study, the cone-beam computed tomography of 40 patients with unilateral palatally impacted canines
from the Kurdish population was assessed. Individual linear measurements were obtained from multiple axial slices of cone-beam
computed tomography to assess mesiodistal width, gingivoincisal height, and labio-palatal thickness of the upper maxillary canines
and lateral incisors crowns. The achieved data were compared between the impacted and non-impacted sides and a ratio of lateral
incisor/canine for each dimension was calculated.

Results: The crowns of maxillary impacted canines were significantly larger labio-palatally and mesiodistally than the canine on the
normally erupted side. While lateral incisor crowns adjacent to the impacted canines were shorter gingivoincisally than those
adjacent to non-impacted canines. There was a significant association between the erupted lateral incisor and higher gingivoincisal
meanwhile no significant difference was observed in labio-palatal and mesiodistal dimensions.

Conclusions: Palatally impacted canines were significantly larger in labio-palatal and mesiodistal dimensions than the normally
erupted canines. The maxillary lateral incisors in the impacted canine side were slightly shorter than those on the non-impacted side
and this difference has an effect on the orthodontic treatment planning.

Keywords: Crown size, Palatally impacted canine, Cone-beam computed tomography.

Submitted: December 3, 2021, Accepted: February 25, 2022, Published: June 1, 2022.

Cite this article as: Rasheed TA, Ahmed HA. Crown Size Comparisons in Patients with Unilateral Palatally
Impacted Canine by Cone Beam Computed Tomography. Sulaimani Dent J. 2022;9(1):31-38.

DOI: https://doi.org/10.17656/sdj.10146

1. Pedodontics, Orthodontics, and Preventive Dentistry Department, College of Dentistry, University of Sulaimani,
Sulaimani, Iraq.
2. Ministry of Health, Sulaimani Director of Health, Sulaimani, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

31
Crown size and unilateral palatally impacted canine Sulaimani Dent. J. June 2022

Introduction Patients and methods

According to the position of the canine intraorally, it is The present study was done in the Kurdistan region
regarded as an important tooth in functional occlusion, specifically Erbil city. The ethical committee, College
occlusion protection, and aesthetics. So, the proper of Dentistry/University of Sulaimani agreed to give the
knowledge about the permanent canine impaction and approval to perform the study with an ethical number
its position is essential before ortho-surgical (21/32). It’s a retrospective study based on the
procedures(1). Maxillary canine is the second-most diagnostic records of 2400 cases who attended the
frequently impacted tooth in the dental arch after the radiology department of Denta Center in Erbil city
third molars with prevalence from 1 to 3%. Most of the from early 2014 till the end of 2016. After sample size
canine impactions are palatal 85%, whereas 15% are calculation from the collected cases, only 40 patients
labial(2). A tooth is considered as impacted if it’s (27 Females, 13 Male) were selected as they were all
unable to erupt after root completion, or its from the Kurdish population and met the selective
contralateral side erupted with complete root criteria of the study. The mean age of the sample was
formation(3). The impacted permanent canine should be 26.8±7.7 years according to the presented data as it’s a
assessed both clinically and radiographically. It was retrospective study and to ensure the erupted
suggested that canine impaction is more in females 3.6 contralateral canine for the comparison. All the CBCT
times more than in males, and mostly diagnosed as were from the same device (New Tom GiANO, CBCT
unilateral impaction(1). unit, NNT version 6.1, software for reconstruction)
with the settings exposure as 90 KV, 3.00 mA, and 9.0
Surgical exposure and a guided orthodontic eruption is second exposure time with the patient in maximum
the preferred approach that can be followed for the intercuspation and the Frankfort horizontal plane
treatment of impacted canines among the other parallel to the floor as common CBCT imaging
approaches(4). The exact position of palatally impacted protocols.(14)
canines (PIC) can be determined by cone-beam
computerized tomography (CBCT) because its linear Selective Criteria:
and angular measurements are very accurate and
precise(5). In a general sense, the risks of CBCT in 1. No limitation of dental or skeletal
orthodontics are outweighed by the benefits that CBCT classification.
scans provide in special cases in which conventional
2. No deformation of erupted canine and lateral
radiographs cannot provide the information necessary
incisor crowns due to attrition or trauma and
for diagnosis and treatment planning(6,7). The CBCT
no prosthetic crown.
offers a three-dimensional image that aid in the
orthodontic diagnosis, and treatment planning and as 3. No dental restoration or root canal treatment
soon will change the method in taking the needed for both erupted canine and lateral incisor
orthodontic records (8). Also with advancements in the
technology and the CBCT devices, the in vivo 4. Two-thirds of canine root appear with cusp tip
evaluations of teeth and surrounding tissue become located behind the root of the lateral incisor
more dependable and can be applied in orthodontic (as the palatally impacted canine was
diagnosis and treatment planning(9). selected) in the horizontal plane of CBCT
scan.
Three-dimensional models construction from the
CBCT allowed a novel and accurate approach to the 5. No previous root restoration.
quantification of canine displacement(10,11). There were
no clinical differences between the measurements 6. No previous orthodontic treatment
obtained by CBCT and digitalized plaster models(12), so
7. No cleft palate.
the CBCT was applied in numerous branches of
dentistry in the orthodontic field(13). 8. All the radiographic images for the patients
are of good quality from the Kurdish
The dimension of the maxillary dentition in PIC cases
population in origin (all the three grandparents
among the Kurdish population has not been studied in
of both parents were Kurdish from Iraq).
detail by experts in the field. Besides, there are
insufficient articles on this subject in our community. 9. No congenital anomaly of hard tissue like
Therefore, by conducting this study, we may add a amylogenesis imperfecta.
valuable resource.
10. Patient without missing of lateral incisors.

32
Vol 9(1) Rasheed and Ahmed

Measurements Statistical analysis

Individual linear measurements can be obtained from The patients’ data were calculated by Statistical
the CBCT by using multiple axial slices with 0.150 Package for Social Sciences (SPSS) version 21 was
mm voxel size including coronal and sagittal used. Descriptive statistics are presented as (mean ±
reformatted images and then selecting maximum standard deviation) and frequencies as percentages.
dimensions in each slice to assess mesiodistal (MD) Kolmogorov Smirnov analysis verified the normality
width, gingiva-incisal (GI) height, and labio-palatal of the data set. Multiple contingency tables were
(LP) thickness of each crown for maxillary canines and conducted and appropriate statistical tests were
lateral incisors.(15) performed, independent sample t-test was used to
compare between two means. The level of significance
Axial images were used to determine grayscale (p-value) was set at ≤ 0.05 and the result was presented
threshold values in HU that could be used to separate as tables.
the various tissues of the teeth and periodontium. For
the maxillary canine, the (MD can be measured from
the greatest mesial to distal anatomic contact points,
(GI) from the cusp tip of the canines on the incisal Results
edge to the deepest curvatures on the cementoenamel
junction while (LP) from buccal or labial surface of the The descriptive statistics for the variable included in
maxillary canines(15), which indicate anatomically the the study were summarized in Table 2. The mean MD
labial ridge to a point on the palatal side which of impacted canine was significantly higher than the
indicates lingual ridge of maxillary canine on cingulum mean MD of erupted canine and the mean GI of lateral
as in figure 1. A. The same measurements should also incisor at the impaction side was significantly lower
be done for the maxillary lateral incisors except instead than the mean GI of lateral incisor at the eruption side.
of the cusp tip of the canine the incisal edge was used All the compared canine means according to impaction
for the lateral as in Figure 1. B. The points were chosen and eruption sides were determined in Table 3. The
regarding clinical and radiographic dental mean MD and GI ratio at the impaction side was
anatomy(16,17). significantly lower than the eruption side with a highly
significant difference. No significant differences in LP
Each of the measurements that were taken for the ratio between impaction and eruption sides as in Table
canine and lateral incisors on the impacted side was 4.
compared to the same measurements on the non-
impacted side. Canine measurements and The mean MD of canines in the impacted side was
measurements from the ipsilateral incisor were significantly higher than erupted side for both males
combined to create a lateral incisor/canine ratio for and females. Also. the mean MD of canines in the
each dimension. This ratio should be compared impacted side was significantly higher than the erupted
between the impacted and non-impacted sides to side as shown in Table 5. For both male and female
further illustrate whether canine crown size alone patients, erupted lateral incisors and higher GI mean
affects the rate of impaction, or if also there may have showed a significant result. For right and left impaction
been a combined effect from the size of lateral incisors. sides, there was a significant difference between
This was done by orienting each tooth parallel to the erupted lateral incisor and higher GI mean. No
long axis for gingiva-incisal height and perpendicular significant difference was observed in the other
to the long axis for the mesiodistal width and measurements of lateral incisors between impacted and
labiolingual thickness(15). erupted sides as in Table 6.

The reliability of the observer was tested by repeating

the linear measurements for 20 randomly selected
subjects after a 10- week washout period and
calculating the intra-class correlation coefficients. The
result was excellent, with r=0.81 for the GI, r=0.72 for
the LP and r=0.8 for the MD as shown in Table 1.

33
Crown size and unilateral palatally impacted canine Sulaimani Dent. J. June 2022

Table 1: Intra-examiner reliability in measuring canines and lateral incisors.

Variable Intraclass correlation 95% PIC p-value

GI 1st measurement 0.81 0.74-0.85 ≤ 0.05**
& 2nd measurement
LP 1st measurement 0.72 0.63-0.91 ≤ 0.05**
& 2nd measurement
MD 1st measurement 0.8 0.57-0.93 ≤ 0.05**
& 2nd measurement

Table 2: Demographic characteristics of

palatally impacted canine patients.
Variable No. %
(Age mean± SD 2.6±7.7)
<20 years 8 20.0
20-29 years 20 50.0
30-39 years 9 22.5
40 years 3 7.5
Total 40 100.0
Gender
Male 13 32.5
Female 27 67.5
Total 40 100.0
Impaction side
Right 20 50.0
Left 20 50.0

Total 40 100.0

Table 3: Comparison of measurements mean of the variables in mm between impacted

and non-impacted sides.
Variable Impaction Eruption t-test p-value
Mean±SD (mm) Mean±SD (mm)
GI of canine 9.76±0.9 9.45±1.02 1.4 0.1
LP of canine 7.93±0.61 6.53±0.58 10.4 ≤ 0.05**
MD of canine 7.87±0.84 6.06±0.54 11.4 ≤ 0.05**
GI of lateral incisor 9.76±0.9 9.45±1.02 1.4 0.1
LP of lateral incisor 7.93±0.61 6.53±0.58 10.4 ≤ 0.05**
MD of lateral incisor 7.87±0.84 6.06±0.54 11.4 ≤ 0.05**
*Independent sample t-test

34
Vol 9(1) Rasheed and Ahmed

Table 4: Distribution of lateral incisor/canine ratio means according to impaction

and eruption sides.

Variable Impaction Eruption t-test p-value

Mean±SD Mean±SD
GI of lateral incisor/ GI 0.9±0.07 1.17±0.23 7.1 ≤ 0.05**
of canine ratio
LP of lateral incisor/ 0.78±0.09 0.8±0.05 1.2 0.2
LP of canine ratio
MD of lateral incisor / 0.77±0.1 0.86±0.06 4.1 ≤ 0.05**
MD of canine ratio

*Independent sample t-test

Table 5: Distribution of canines' characteristic means according to impaction and

eruption sides for male and female patients.
Variable Impaction Eruption t-test p-value
Mean±SD (mm) Mean±SD (mm)
Male
GI of canine 10.2±0.7 9.85±0.78 1.2 0.2
LP of canine 8.3±0.68 6.46±0.53 7.6 ≤ 0.05**
MD of canine 7.7±0.89 5.96±0.56 5.8 ≤ 0.05**
Female
GI of canine 9.54±0.91 9.25±1.08 1.05 0.2
LP of canine 7.75±0.49 6.55±0.61 7.8 ≤ 0.05**
MD of canine 7.96±0.82 6.11±0.53 9.7 ≤ 0.05**
Right
GI of canine 9.64±1.03 9.35±1.19 0.8 0.4
LP of canine 7.63±0.46 6.45±0.52 7.5 ≤ 0.05**
MD of canine 8.04±0.81 6.07±0.54 9.04 ≤ 0.05**
Left
GI of canine 9.88±0.75 9.55±0.84 1.2 0.2
LP of canine 8.23±0.61 6.61±0.64 8.2 ≤ 0.05**
MD of canine 7.71±0.86 6.06±0.55 7.1 ≤ 0.05**
*Independent sample t-test

A B

Figure 1: A: A. Measurement of mesiodistal width of impacted canine on axial section. B. Measurement of

inciso-gingival and bucco palatal dimensions of impacted canine on coronal section. C. Impacted canine on
sagittal view. B: A. Orienting the axes on the maxillary lateral incisors on axial section. B Measuring the
maximum mesiodistal dimension on coronal section. C. Measuring the bucco palatal and gingivoincisal
dimensions on sagittal section.

35
Crown size and unilateral palatally impacted canine Sulaimani Dent. J. June 2022

Table 6: Distribution of lateral incisor characteristic means according to impaction

and eruption sides for male and female patients.

Variable Impaction Eruption t-test p-value

Mean±SD (mm) Mean±SD (mm)
Male
GI of lateral incisor 8.41±1.07 9.43±0.58 2.6 0.006**
LP of lateral incisor 6.6±0.47 6.47±0.32 0.7 0.4
MD of lateral incisor 6.29±0.47 6.16±0.53 0.6 0.5
Female
GI of lateral incisor 8.2±1.04 9.52±1.12 4.4 ≤ 0.05**
LP of lateral incisor 6.2±0.5 6.25±0.49 0.3 0.7
MD of lateral incisor 6.25±0.58 6.15±0.61 0.6 0.5
Right
GI of lateral incisor 8.25±0.93 9.7±1.03 4.6 ≤ 0.05**
LP of lateral incisor 6.23±0.51 6.36±0.45 0.8 0.3
MD of lateral incisor 6.29±0.52 6.16±0.6 0.7 0.4
Left
GI of lateral incisor 8.3±1.16 9.28±0.88 1.2 ≤ 0.05**
LP of lateral incisor 6.43±0.53 6.29±0.46 8.2 0.3
MD of lateral incisor 6.24±0.58 6.15±0.57 7.1 0.6

B
Discussion canine and adjacent teeth with the aid of CBCT,
suggested that the impacted canine has a greater size
The use of CBCT improved the diagnostic capabilities compared to the canine on the normally erupted side,
and increased the chances of success in the more which may be an influential factor for maxillary canine
difficult cases(18). CBCT produced a three-dimensional impaction(24).
evaluation of impacted maxillary canines which helps
in selecting specific treatment procedures(19). Currence The difference in maxillary lateral incisors
of impacted canines, due to the chance of combined dimensions
dental anomalies(20). The current study mainly
In this study, the GI of the lateral incisor adjacent to
depended on the records that were taken from CBCTs
the impacted canine was smaller than that of the
which were considered one of the most reliable and
contralateral side with no statistically significant
accurate tools, to assess teeth dimension(20,21).
difference in the MD and LP mean values. Many
Differences in palatally impacted canine dimensions studies have concluded that smaller lateral incisors are
less likely to work as a navigator for the developing
The PIC in the present study was larger by 1.40±0.03 maxillary canine during their eruption, and this
mm and wider by 1.81±0.30 mm when compared to supports the guidance theory of canine eruption
normally erupted canine. It was observed a statistically described by Becker et al.(25) The results of this study
significant difference in the LP and MD mean values are supported by Liuk et al.(26), who found that the
(P≤ 0.05) of the canines between the impacted and lateral incisors in the impacted side were shorter than
normally erupted sides which agreed with Eliason and the that in the control group.
Lindauer(15). This study disagreed with Yan et al.(22)
who found non-significant differences in the MD width The current study results also agreed with Dubovska et
and LP dimensions. However, when conducting the al.(27) who evaluated the morphology of the lateral
study among the unilateral PIC subjects alone, the incisor adjacent to the PIC using CBCT. They stated
mesiodistal widths on the impaction side were that the size of the lateral incisor on the side of
significantly greater than those on the normal side, impaction is shorter. Also, a study performed by Kim
whereas the LP width was similar between the et al.(24), concluded that the root of the lateral incisor
impaction and normally erupted side. Contrary to our had a significantly shorter length and smaller size on
findings, a study was done in Germany which showed the impaction side compared with the normal eruption
that the maxillary canine on the affected side is smaller side. Also, another study done by Yan et al.(22)
in size than the contralateral side(23). comparing CBCT of patients with PICs and a control
group, found that there was statistically significant
Three-dimensional evaluation done by Kim et al in difference in the MD dimensions of the lateral incisors
2017 on the morphology of the impacted maxillary between the two groups. Also, two other studies that

36
Vol 9(1) Rasheed and Ahmed

used dental casts have found that the lateral incisor was Conclusions
narrower (MD dimension was smaller) than the lateral
incisor of the unaffected side(28). The LP and MD dimensions of the palatally impacted
canines were significantly larger than the normally
The lateral incisor adjacent to the PIC may act as an erupted canines. The maxillary lateral incisors adjacent
investigator to the impaction of the canine, either to PICs were slightly shorter than those adjacent to the
because its eruption and size are related to the same non-impacted canines. There is no gender difference
genes that control the eruption of the canine (genetic regarding the dimensions of the impacted canine and
theory) or due to its position in the arch which adjacent lateral incisors in comparison to the
influences the eruption path of the canine(29). contralateral side. The side of the impaction has no
influence on the crown size when the comparison is
Maxillary canine/lateral incisor dimensions ratio
made between the impacted and non-impacted sides.
Eliason and Lindauer(15) created a ratio for the Each difference in the size between the examined teeth
dimensions of the lateral incisor adjacent to the canine has an effect on orthodontic treatment planning.
on both impacted and non-impacted sides, and then
compared both ratios. Their purpose was to determine
whether a larger canine with a normal size lateral References
incisor produces the same size difference when
compared to a normal size canine with an adjacent 1. Hamozi S, Alghanim K, Abdali Y. Prevalence
small lateral incisor. In both conditions, the size of the and classification of maxillary canine impaction
lateral incisor may not be adequate relative to the among Iraqi patients at An-Najaf City. Indian J
adjacent canine to work as a guide during the eruption Forensic Med Toxicol. 2012;14(1):540-3.
process of the maxillary canine. In this manner, we 2. Al-Zoubi H, Alharbi AA, Ferguson DJ, Zafar MS.
tried to develop the same ratio and make a comparison Frequency of impacted teeth and categorization of
between the impacted and normally erupted sides. In impacted canines: A retrospective radiographic
our findings, we observed statistical differences in the study using orthopantomograms. Eur J Dent.
lateral incisor over the canine ratios for both 2017;11(1):117-21.
mesiodistal and incisogingival dimensions but such 3. Aslan BI, Üçüncü N. Clinical consideration and
statistical difference was not found in the buccolingual management of impacted maxillary canine teeth,
dimension. emerging trends in oral health sceince and
dentistry. InTech. 2015:465.
The results of the current study coincide with Eliason
4. Heravi F, Shafaee H, Forouzanfar A, Hoseini
and Lindauer, who stated in their study that the only
Zarch SH, Merati M. The effect of canine
significant differences were in the mesiodistal and
disimpaction performed with temporary
incisogingival ratios(15). Regarding the sex difference
anchorage devices (TADs) before comprehensive
the current study, compared the male and female
orthodontic treatment to avoid root resorption of
unilateral PIC cases separately. In the results, the
adjacent teeth. Dental Press J Orthod.
difference in the dimensions of the impacted canine
2016;21(2):65-72.
and its adjacent lateral incisor compared to the
5. Naoumova J, Kjellberg H, Palm R. Cone-beam
contralateral side were the same in males and females.
computed tomography for assessment of palatal
Chaushu et al made a study in 2002, which used dental
displaced canine position: a methodological
casts to make the comparison of the maxillary dentition
study. Angle Orthod. 2014;84(3):459-66.
size between PIC cases and the control group. They
6. Machado GL. CBCT imaging–A boon to
observed in their results that the size of the lateral
orthodontics. Saudi Dent J. 2015;27(1):12-21.
incisors was significantly smaller in the PIC cases than
7. Migliorati M, Cevidanes L, Sinfonico G, Drago S,
in the control group for both males and females with no
Dalessandri D, Isola G, Biavati AS. Three-
difference, which is in agreement with the findings of
dimensional movement analysis of maxillary
this study. This may be due to the fact they used dental
impacted canine using TADs: a pilot study. Head
casts and not radiographic methods in measuring the
Face Med. 2021;17(1):1-10.
size of the impacted maxillary canine(30). In this study,
8. Anuraj Singh Kochhar, Gurkeerat Singh, Harshita
there was an only a significant difference in the MD
Gupta. Applications of cone beam computerized
and LP of the maxillary canine and GI of the lateral
incisors.

37
Crown size and unilateral palatally impacted canine Sulaimani Dent. J. June 2022

tomography in orthodontics: a mini review. On J 20. Leonardi R, Muraglie S, Crimi S, Pirroni M,

Dent & Oral Health. 2020;3(3):1-6. Musumeci G, Perrotta R. Morphology of palatally
9. Rasheed TA, Al Hamdany AKS, Rauf AM. displaced canines and adjacent teeth, a 3-D
Comparative reliability assessment of tooth evaluation from cone-beam computed
volume measurement with different three- tomographic images. BMC Oral Health.
dimensional imaging software. Biomed Res Int. 2018;18(1):1-9.
2020;2020(2):1-12. 21. Fokas G, Vaughn VM, Scarfe WC, Bornstein
10. Schubert M, Proff P, Kirschneck C. Improved MM. Accuracy of linear measurements on CBCT
eruption path quantification and treatment time images related to presurgical implant treatment
prognosis in alignment of impacted maxillary planning: A systematic review. Clin Oral
canines using CBCT imaging. Eur J Orthod. Implants Res. 2018;16(Suppl.):393-415.
2018;40(6):597-607. 22. Yan B, Sun Z, Fields H, Wang L, Luo L.
11. Gkantidis N, Schauseil M, Pazera P, Zorkun B, Etiologic factors for buccal and palatal maxillary
Katsaros C, Ludwig B. Evaluation of 3- canine impaction: a perspective based on cone-
dimensional superimposition techniques on beam computed tomography analyses. Am J
various skeletal structures of the head using Orthod Dentofacial Orthop. 2013;143(4):527-34.
surface models. PLoS One. 2015;10(2):e0118810. 23. Paschos E, Huth KC, Fässler H, Rudzki-Janson I.
12. Ponce-Garcia C, Lagravere-Vich M, Cevidanes Investigation of maxillary tooth sizes in patients
LHS, de Olivera Ruellas AC, Carey J, Flores-Mir with palatal canine displacement. J Orofac
C. Reliability of three-dimensional anterior Orthop. 2005;66(4):288-98.
cranial base superimposition methods for 24. Kim Y, Hyun HK, Jang KT. Morphological
assessment of overall hard tissue chamges: a relationship analysis of impacted maxillary
systematic review. Angle Orthod. canines and the adjacent teeth on 3-dimensional
2018;88(2):233-45. reconstructed CT images. Angle Orthod.
13. Alam MK, Shahid F, Purmal K, Ahmad B, 2017;87(4):590-7.
Khamis MF. Tooth size and dental arch 25. Becker A, Smith P, Behar R. The incidence of
dimension measurement through cone beam anomalous maxillary lateral incisors in relation to
computed tomography: effect of age and gender. palatally-displaced cuspids. Angle orthodo
Res. J. Recent Sci. 2014;3(IVC-2014):85-94. 1981;51(1):24-9.
14. Forst D, Nijjar S, Flores-Mir C, Carey J, Secanell 26. Liuk W, Olive R J, Griffin M, Monsour P.
M, Lagravere M. Comparison of in vivo 3D cone- Maxillary lateral incisor morphology and
beam computed tomography tooth volume palatally displaced canines: a case- controlled
measurement protocols. Prog orthod. cone-beam volumetric tomography study. Am J
2014;15(1):1-3. Orthod Dentofacial Orthop. 2013;143(4):522-6.
15. Eliason J, Lindauer SJ. Crown size comparisons 27. Dubovska I, Hermanek J, Urbanova W, Borbely
in patients with unilateral palatally displaced P. Lateral incisor morphology in patients with
canines. (Thesis). 2015. impacted canine: a CT study. JDMS.
16. Baumgaertel S., Palomo J. M., Palomo L. Hans 2015;14(7):1-5.
M. G. Reliability and accuracy of cone-beam 28. Joseph LE and Steven JL. Crown size
computed tomography dental measurements. Am comparisons in patients with unilateral palatally
J Orthod Dentofacial Orthop. 2009;136(1):19-25. displaced canines. Virginia Commonwealth
17. Scheid R. C. Woelfel's dental anatomy, Lippincott University, VCU (Theses). 2015.
Williams and Wilkins 2012. 29. Kanavakis G, Curran KM, Wiseman KC, Barone
18. Alqerban A, Jacobs R, van Keirsbilck PJ, Aly M, NP, Finkelman MD, Srinivasan S, Lee MB,
Swinnen S, Fieuws S, Willems G. The effect of Trotman CA. Evaluation of crown-root angulation
using CBCT in the diagnosis of canine impaction of lateral incisors adjacent to palatally impacted
and its impact on the orthodontic treatment canines. Prog Orthod 2015;16(1):1-6.
outcome. J Orthod Sci. 2014;3(2):34-40. 30. Chaushu S, Sharabi S, Becker A. Dental
19. Grisar K, Piccart F, Al‐Rimawi AS, Basso I, morphologic characteristics of normal versus
Politis C, Jacobs R. Three‐dimensional position delayed developing dentitions with palatally
of impacted maxillary canines: Prevalence, displaced canines. Am J Orthod Dentofacial
associated pathology and introduction to a new Orthop. 2002;121(4):339-46.
classification system. Clin Exp Dent Res.
2019;5(1):19–25.

38
Vol 9(1) Rasheed and Ahmed

29. Kanavakis G, Curran KM, Wiseman KC, Barone 30. Chaushu S, Sharabi S, Becker A. Dental
NP, Finkelman MD, Srinivasan S, Lee MB, morphologic characteristics of normal versus
Trotman CA. Evaluation of crown-root angulation delayed developing dentitions with palatally
of lateral incisors adjacent to palatally impacted displaced canines. Am J Orthod Dentofacial
canines. Prog Orthod 2015;16(1):1-6. Orthop. 2002;121(4):339-46.

39
Vol 9(1) Rasheed and Ahmed

29. Kanavakis G, Curran KM, Wiseman KC, Barone 30. Chaushu S, Sharabi S, Becker A. Dental
NP, Finkelman MD, Srinivasan S, Lee MB, morphologic characteristics of normal versus
Trotman CA. Evaluation of crown-root angulation delayed developing dentitions with palatally
of lateral incisors adjacent to palatally impacted displaced canines. Am J Orthod Dentofacial
canines. Prog Orthod 2015;16(1):1-6. Orthop. 2002;121(4):339-46.

39
Vol 9(1) Azeez and Khalid

Original Article

Evaluating Diagnostic Validity of Various Sagittal

Cephalometric Parameters (a Comparative
Retrospective Study)
Saya Mustafa Azeez 1*, Ribwar F. Khalid 2

Abstract
Objective: The goal of this study was to determine the accuracy and reliability of numerous skeletal analyses for determining the
sagittal skeletal pattern.

Methods: A total of 105 cephalometric x-rays were used. The Steiner’s ANB angle, anteroposterior dysplasia indicator (APDI), and
angle of convexity by Down’s assessed the anteroposterior skeletal pattern. According to the diagnostic results of the majority of the
criteria, the samples were divided into three classes: I, II, and III. The analyses' validity and reliability were assessed using Kappa
statistics, positive predictive value, and sensitivity.

Results: There was a moderate agreement between the ANB angle and the final diagnosis (K= 0.593). The ANB angle demonstrated
the highest sensitivity in class II and III groups (1.00).

Conclusions: The ANB angle and down's angle of convexity was the most accurate markers for class I and III groups, respectively,
while the Down's angle of convexity and APDI were the most accurate indicators for class III group.

Keywords: Cephalometry, Maxilla, Mandible, Malocclusion.

Submitted: September 14, 2021, Accepted: February 22, 2022, Published: June 1, 2022.

Cite this article as: Azeez SM, Khalid RF. Evaluating diagnostic validity of various sagittal cephalometric parameters
(a comparative retrospective study). Sulaimani Dent J. 2022;9(1):39-44.

DOI: https://doi.org/10.17656/sdj.10147

1. Orthodontics Department, Faculty of Dentistry, Tishk International University, Erbil, Iraq.

2. Diagnosis and Radiology Department, Faculty of Dentistry, Tishk International University, Erbil, Iraq

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

39
Diagnostic validity of various sagittal cephalometric parameters Sulaimani Dent. J. June 2022

Introduction

Orthodontic clinical examinations are completed using Materials and methods

cephalometry, which is also used for diagnosis and
individualized treatment plans(1). Over the past 50 years, This comparative study was conducted on a total (of
cephalometry has been continuously improving. It is 105) standardized lateral cephalometric radiographs
also used to track patients’ growth providing descriptive (male & female). The sample size was calculated using
diagnosis, morphology, and clinical application. This the coefficient of correlation (r) value = 0.704 reported
can help predict the effects of conventional therapy and by Ahmad et al.(15) with study power (β) of 80% and
surgical treatment(2). In addition, skeletal and significance level (α) of 95%. Therefore, the minimum
dentoalveolar malocclusions can be compared by required sample size was 13 per group. These
cephalometry. It shows the craniomaxillofacial radiographs were collected from the digital files of the
complex's spatial relationships at a given time and radiology department of the faculty of dentistry at Tishk
permits comparisons over time(3,4). International University. A good quality lateral
cephalometric x-rays were included, and subjects with a
Malocclusions can be caused by variations in normal history of previous orthodontic treatment were
craniofacial growth in the vertical, sagittal, or transverse excluded. Therefore, to an extent, all the radiographs
planes(5). For example, a convex or concave profile have different degrees of either dentoalveolar or skeletal
might come from a difference in sagittal development. malocclusion.
This might be related to the face's hard or soft tissue
changes. A convex profile with increased overjet and The lateral cephalographs chosen for this study were
inadequate lips might result from a sagittal maxillary taken in natural head position (NHP) by Italian
excess or mandibular deficit. A sagittal maxillary deficit equipment’s (new toms) GiANO, 1-10mA, for 10 sec
or mandibular excess, on the other hand, might result in from a fixed distance of 4 inches from the same
a prognathic profile and an anterior crossbite(6). cephalostat. The same investigator did all the tracing
with a digital cephalometric analyzing tool (WebCeph).
Various assessment methods assess anteroposterior
relationships between mandibular and maxillary The following sagittal measurements were traced by
structures(7). Different techniques have been suggested Webceph (Figure 1):
to determine the diagnosis of sagittal discrepancies.
1- The angle of Convexity by Down(8): The angle of
Downs(8) 1948 explained the AB plane angle as a plan
convexity is formed by the intersection of N-A
to estimate the anteroposterior abnormality followed by
point to A-Pog point.
the Downs angle of convexity. Riedel(9) 1952 presented
the popular ANB point, which Steiner(10) generalized in 2- ANB angle by Steiner(10): The intersection of lines
1953. Studies have shown that the ANB angle differs connecting Nasion to point A and Nasion to point B
with the position of Nasion and the vertical pattern of creates the angle.
growth(11,12). Jacobson(12) proposed Wit’s appraisal
using the occlusal plane as the reference plane to solve 3- Anteroposterior dysplasia indicator (APDI) by
this. Due to alterations in the occlusal plane(13). Kim and Kim(14): Is the mathematical sum of three angles
Vietas(14) in 1978 created an anteroposterior dysplasia Frankfort horizontal plane to the facial plane, A-B
predicator, assuming that a specific cause does not cause plane to the facial plane, and palatal plane to
discrepancies in the dentofacial complex. The diagnosis Frankfort horizontal plane.
could be reliable with the combination of several
different measurements. We have multiple criteria that
have been and are still being implemented to deal with
the shortcomings of current parameters for the effective
diagnosis of sagittal discrepancies(6).

For treatment planning and treatment outcomes, reliable

diagnostic criteria are required. Although several
researchers have previously demonstrated the
relationship between various skeletal analyses, only a Figure 1: Cephalometric parameters traced by Webceph
few have examined different analyses' diagnostic (A= ANB angle, B= Down’s angle of convexity, C=
validity and application. Therefore, this research aimed APDI) .
to determine the diagnostic agreement among various
Cephalometric norms for each one of the sagittal
cephalometric techniques to measure anteroposterior
skeletal parameters were previously determined in the
parameters.

40
Vol 9(1) Azeez and Khalid

literature review used in this study(14,16) (Table 1). The shows the means and standard deviations for each
subjects in this research were classified into three parameter in all three sagittal malocclusions classes I, II,
classes based on normal parameters: Class I, Class II, and III.
and Class III. Subjects with a similar sagittal skeletal
pattern across all parameters were removed from the Table 2: Intraclass coefficient.
investigation. At least one parameter in the remaining Parameters 1st tracing 2nd tracing ICC
105 patients (42 men, 63 females) with ages ranging ANB 3.95 ± 1.8 3.96 ± 1.8 0.997*
from (13-51) years old gave conflicting diagnoses of the
sagittal skeletal relation. The final diagnosis was based Down’s angle
2.56 ± 5.1 2.18 ± 5.1 0.999*
on the most consistent results of the sagittal analyses. of convexity
The sample size result per group (Class I, II, III) after
APDI 79.71 ± 4.0 78.33 ± 4.0 0.990*
the final diagnosis were as follows: n =59, 31, 15;
respectively. Then when particular sagittal analyses in a * ICC < 0.5 poor agreement, ICC between (0.5-0.75)
subject agreed with the final diagnoses, it was labeled moderate agreement, ICC between(0.75-0.9) Good
“properly diagnosed subjects.” agreement, ICC > 0.9 Excellent agreement.

Table 1: Cephalometric norms of sagittal parameters. Table 3: Mean value of sagittal cephalometric
parameters.
Sagittal Class I Class II Class III
CI C II C III Parameters
parameters n= 59 n= 31 n= 15
Down’s angle Mean ± SD Mean ± SD Mean ± SD
-8.5 º to 10 º > 10 º < -8.5 º
of convexity Down’s
ANB 0 º to 4 º >4 º <0 º angle of 2.83±4.86 9.94±3.33 -5.86±3.14
convexity
ANB 2.65±1.95 5.41±0.91 -1.54±1.24
APDI 81.4 º±3.79 º <77.61 º >85.19 º
APDI 83.80±4.87 77.66±2.76 91.61±4.36

Ten lateral cephalograms were randomly selected and Pearson’s correlation

retraced by the same investigator at six-week intervals.
Finally, the intraclass coefficient (ICC) was calculated Between ANB and Down’s angle of convexity, a weak
to re-assure the reproducibility of all the parameters. positive correlation was statistically significant (p-value
< 0.05). The ANB angle analysis results appear to be
Statistical analysis related to Down’s angle of convexity analysis results
(Table 4).
IBM's Statistical Package for Social Science (SPSS)
application version 22 was utilized for data input and There was a statistically significant (p-value < 0.05)
analysis. The mean and standard deviation were weak negative correlation between APDI with ANB and
calculated as descriptive statistics. Pearson's correlation Down's angle of convexity. The outcomes of the APDI
was used to analyze the anteroposterior skeletal angle analysis appear to be inversely connected to the
parameters. The degree of agreement between the outcomes of the ANB and Down's angle of convexity
skeletal analyses and the final diagnosis obtained from analysis (Table 4).
the 'properly diagnosed subjects' was measured using
Kappa statistics. Two-by-two tables were utilized to Kappa statistics
measure the validity in regard to sensitivity and positive
The agreement between diagnostic criteria of individual
predictive value (PPV).
cephalometric studies was assessed using Kappa
statistics. The final diagnosis obtained from the
'properly diagnosed cases' had a moderate agreement
Results between ANB and down's angle of convexity, and it was
statistically significant (p-value < 0.01). Furthermore,
The agreement between 1st and 2nd cephalometric there was a statistically significant (p-value < 0.01)
tracing readings was excellent (Table 2). The samples in agreement between APDI and final diagnoses made
the research totaled 105 (42 men, mean age = 22.19 ± from the 'properly diagnosed cases' (Table 5).
5.03; 63 females, mean age = 23.38 ± 6.39). Table 3

41
Diagnostic validity of various sagittal cephalometric parameters Sulaimani Dent. J. June 2022

Table 4: Sagittal growth pattern is assessed using a Positive predictive value and sensitivity
correlation.
The chance of having a class I relationship was 100%, a
Down’s angle class II relationship was 57.4%, and a class III
ANB APDI
of convexity relationship was 75% in the ANB angle. The chance of
ANB 0.243 -0.221 identifying a class I relationship was 52.5%, a class II
1
P-value 0.012* 0.024* relationship was 100%, and a class III relationship was
Down’s angle
0.243 -0.199 100% in the ANB angle (Table 6).
of convexity 1
0.012* 0.042*
P-value
The probability of those with class I relationship was
APDI -0.221 -0.199
1 68.6%, class II relationship was 100%, and class III
P-value 0.024* 0.042*
* Pearson’s correlation: weak correlation (±0.01 < r < relationship was 100%. The chance to recognize the
±0.5); moderate correlation (±0.5 < r < ± 0.8); strong class I relationship was 100%, class II relationship was
correlation (±0.8 < r < ± 1). * P value < 0.05 level. 51.6%, and class III relationship was 20% among those
with Down's angle of convexity (Table 6).
Table 5: Agreement of the diagnostic criteria for sagittal
skeletal studies. The likelihood of having a class I relationship was
65.2%, a class II relationship was 83.3%, and a class III
Class Class relationship was 36.6% among those with the APDI
Class I Kappa
Parameter II III n = 105 P-value angle. Conversely, the chance of identifying a class I
n = 59
n = 31 n = 15 relationship was 50.8%, a class II relationship was
ANB 31 54 20 0.593 0.000* 48.4%, and a class III relationship was 100% in this
Down’s parameter (Table 6).
angle of 86 16 3 0.476 0.000*
convexity
APDI 46 18 41 0.338 0.000*
* n = 105, Kappa statistics. (Poor agreement = Less than
0.20, Fair agreement = 0.20 to 0.40, Moderate
agreement = 0.40 to 0.60, Good agreement = 0.60 to
0.80, Very good agreement = 0.80 to 1.00). *. P value <
0.01.

Table 6: Positive predictive value and sensitivity of sagittal skeletal pattern.

Class I (n = 59) Class II (n = 31) Class III (n = 15)
Correctly Correctly Correctly
parameter
diagnosed PPV sensitivity diagnosed PPV sensitivity diagnosed PPV sensitivity
subject subject subject
ANB 31 1.00 0.525 31 0.574 1.00 15 0.75 1.00
Down’s
angle of 59 0.686 1.00 16 1.00 0.516 3 1.00 0.2
convexity
APDI 30 0.652 0.508 15 0.833 0.484 15 0.366 1.00

42
Vol 9(1) Azeez and Khalid

Discussion Another sagittal plane metric for examining jaw

connections is convexity at point A. The location of the
The cephalometric examination of the jaw relation in the maxilla relative to the facial plane (N–Pog) impacts it.
anteroposterior plane has been given a lot of weight in Accordingly, the Class III skeletal relationship can be
orthodontics. Various analyses(8,10-12,17) have evaluated detected in Class I malocclusion participants with a big
the anteroposterior jaw relation since Broadbent chin. However, those with a less pronounced chin may
invented lateral cephalometry(18) in 1931. However, in have a Class II skeletal relationship(22). This might
borderline circumstances, multiple skeletal explain the lack of association between the ANB and
examinations may yield contradictory data, making a Down's angle of convexity.
definitive identification of the anteroposterior skeletal
pattern impossible. By analyzing the diagnostic The amount of correlation does not mean that the
accuracy of the most often used analyses, this study supplied parameter can accurately diagnose the skeletal
intended to condense the diagnosis procedure to sagittal parameter. Consequently, the diagnostic
minimal skeletal criteria. agreement between numerous skeletal studies and the
final diagnosis was examined using Kappa statistics.
There was a weak positive correlation between ANB The angle of ANB and the final diagnosis had a
and Down's angle of convexity in the current study, but moderate agreement. The Kappa statistic demonstrates
it was statistically significant. Ishikawa et al.(19) found a the difference in diagnosis that can happen merely by
strong correlation between the ANB and Down's angle chance(23). Therefore, the angle of ANB was discovered
of convexity, which might be ascribed to sample size to be the most precise predictor for determining a
disparities and the study's inclusion of only Class I patient's sagittal skeletal pattern.
patients. Ahmad et al.(15) also discovered a strong
correlation between ANB and Down's angle of An analysis must diagnose a parameter with consistency
convexity; this difference in results might be because and precision. Therefore, the sensitivity of each
they only considered normal vertical development parameter was determined to verify its diagnostic
patterns, which could be a complicating factor. accuracy. The ANB angle had the most sensitivity in
class II and III. In contrast, Down's angle of convexity
A weak negative correlation between APDI with ANB had the utmost sensitivity in class I, and the APDI had
and down's angle of convexity was discovered in this the greatest sensitivity in class III. Therefore, Down's
research. According to Trivedi et al.(20), the ANB angle angle of convexity can be treated as a legitimate
has a moderately negative but significant relationship indication in examining the sagittal development pattern
with the APDI. On the other hand, according to Ishikawa in a subject with Class I skeletal relation. Likewise, the
et al.(19), APDI and Down's angle of convexity and ANB angle of ANB may be utilized as a legitimate indication
angle have a moderately negative but significant for class II subjects. In contrast, the ANB and APDI can
relationship. This discrepancy in association with the be utilized to properly examine an individual's sagittal
current study's findings might be because they included growth pattern for class III subjects.
class I cases and had a different sample size.
Positive prediction values (PPV) were obtained for each
The interchangeability between the three parameters can group separately in the current investigation to confirm
be assessed by considering the basis for the geometric whether a particular parameter properly depicted the
distortion effects in each parameter. Face, prognathism, skeletal relation. In class I, the angle of ANB showed
age, and the developing rotation of the jaws regarding the highest PPV value followed by Down’s angle of
the cranial reference planes are all anteroposterior and convexity; in class II, the Down’s angle of convexity
vertical factors that influence ANB measurement. The showed the highest PPV value followed by APDI, and
anteroposterior location of the Nasion likewise in class III, the Down’s angle of convexity showed the
influences it. The degree of rotation is related to the face greatest PPV value followed by ANB. We can assume
pattern of the individual. Although face type does not from PPV results when evaluating the skeletal pattern in
affect the relationship between parameters, the sagittal plane in an individual that if certain
dolichofacial facial types have higher mean values than parameters coincide, it is highly possible to be correct
mesiofacial and brachyfacial facial types(21). This could and may not require further investigation.
be because the APDI composite has three separate
values, making it less comparable to other Consequently, the number of sagittal analyses for
parameters(19). determining the skeletal disparity may be limited.
However, these parameters revealed better diagnostic

43
Diagnostic validity of various sagittal cephalometric parameters Sulaimani Dent. J. June 2022

performance when contrasted to other parameters. This 13. Haynes S, Chau MN. The reproducibility and
could lead to an accurate and time-saving diagnosis, repeatability of the Wits analysis. Am J Orthod
boosting the treatment planning process' efficiency. Dentofacial Orthop. 1995;107(6):640-7.
14. Kim YH, Vietas JJ. Anteroposterior dysplasia
indicator: an adjunct to cephalometric differential
diagnosis. Am J Orthod. 1978;73(6):619-33.
Conclusions 15. Ahmed M, Shaikh A, Fida M. Diagnostic Validity
of different cephalometric analyses for assessment
The most precise indicators in measuring sagittal growth
of the sagittal skeletal pattern. Dental Press J
patterns in class I and III groups were the angle of ANB
Orthod. 2018;23(5):75-81.
and down’s angle of convexity. For class II group was
16. Jacobson A, Jacobson RL. Radiographic
down’s angle of convexity and APDI.
cephalometry. 2nd edition. Quintessence
References publishing co.;2006. P.125-28.
17. Baik CY, Ververidou M. A new approach of
1. De Sena LMF, De Sena PPM, Pereira HSG. assessing sagittal discrepancies: the beta angle.
Cephalometric analysis: orthodontists versus oral Am J Orthod Dentofacial Orthop.
radiologists. J World Fed. Orthod. 2016;5(1):18- 2004;126(1):100-5.
21. 18. Broadbent BH. A new X-ray technique and its
2. Medina IPG, Perez DAA, Ruiz GEC, Herrera IDZ, application to orthodontia. Angle orthod.
Ramirez ME, Atoche JRH, Chavez JAR, et al. 1931;1(2):45-66.
Evaluation of diagnostic agreement among 19. Ishikawa H, Nakamura S, Iwasaki H, Kitazawa S.
cephalometric measurements for determining Seven parameters describing anteroposterior jaw
incisor position and inclination. Int. J. Morphol. relationships: postpubertal prediction accuracy and
2020;38(5):1386-91. interchangeability. Am J Orthod Dentofacial
3. Devereux L, Moles D, Cunningham SJ, McKnight Orthop. 2000;117(6):714-20.
M. How important are lateral cephalometric 20. Trivedi R, Bhattacharya A, Mehta F, Patel D,
radiographs in orthodontic treatment planning?. Parekh H, Gandhi V. Cephalometric study to test
Am J Orthod Dentofacial Orthop. the reliability of anteroposterior skeletal
2011;139(2):175-81. discrepancy indicators using the twin block
4. Pittayapat P, Limchaichana-Bolstad N, Willems G, appliance. Prog Orthod. 2015;16(3):1-10.
Jacobs R. Three-dimensional cephalometric 21. Tanaka JLO, Ono E, Filho EM, de Moraes LC, de
analysis in orthodontics: a systematic review. Melo JC, de Moraes MEL. Influence of the facial
Orthod Craniofac Res. 2014;17(2):69-91. pattern on ANB, AF-BF, and Wits appraisal.
5. Proffit WR, Fields HW, Sarver DM. World J Orthod. 2006;7(4):369-75.
Contemporary Orthodontics. 5th ed. St. Louis: 22. Zupančič, S, Pohar M, Farčnik F, Ovsenik M.
Mosby Elsevier. 2019. Overjet as a predictor of sagittal skeletal
6. Ahmed M, Shaikh A, Fida M. Assessment of the relationships, Eur J Orthod. 2008;30(3):269-73.
facial profile: the correlation between various 23. Viera AJ, Garrett JM. Understanding interobserver
cephalometric analyses and the soft tissue angle of agreement: the kappa statistic. Fam Med.
convexity. JPDA. 2017;26(2):59-66. 2005;37(5):360-3.
7. Bock JJ, Fuhrmann RA. Evaluation of vertical
parameters in cephalometry. J Orofac Orthop.
2007;68(3):210-22.
8. Downs WB. Variations in facial relationships;
their significance in treatment and prognosis. Am
J Orthod. 1948;34(10):812-40.
9. Riedel RA. The relation of maxillary structures to
cranium in malocclusion and in normal occlusion.
Angle Orthod. 1958;22(3):142-5.
10. Steiner CC. Cephalometrics for you and me. Am J
Orthod. 1953; 39(1):720-55.
11. Freeman RS. Adjusting A-N-B angles to reflect the
effect of maxillary position. The Angle orthod.
1981;51(2):162-71.
12. Jacobson A. The "Wits" appraisal of jaw
disharmony. Am J Orthod. 1975;67(2):125-38.

44
Vol 9(1) Mohammed et al.

Original Article

Identification and Genotyping of Candida Species

Involved in Oral Candidiasis among Diabetic
Patients
Shene A. Mohammed 1*, Khattab A. Shekhany 1, Paywast J. Jalal 1, Chiman H. Fattah 2

Abstract
Objective: Oral candidiasis is more prevalent among diabetic patients than non-diabetics due to the factors that promote Candida
oral carriage. This study aimed to isolate and identify Candida species involved in oral candidiasis of patients with diabetes mellitus
in Sulaymaniyah city.

Methods: The study was performed from August 2021 to March 2022 on two diabetic patients, Type 1 and Type 2 (n=150) and non-
diabetics (n=50), as a control group. In Iraq's Kurdistan region, oral swabs were taken from 200 participants at the Sulaymaniyah
governorate's Diabetic and Endocrine Center and Shar hospital. Sabouraud dextrose agar (SDA) medium was used to culture the swabs.
Candida isolates were identified using HiCrome™ Candida Differential agar, then confirmed using polymerase chain reaction based
on the ITS region and CHS1 gene detection. Using the CA25S and CA-INT primers, all C. Albicans isolates were genotyped based on
the transposable intron in 25S rDNA. ITS1 and ITS4 primers were used to sequence the 18S region of ribosomal DNA (rDNA).
Descriptive statistics were used for summaries and to describe data.

Results: From the samples of 150 diabetes patients and 50 controls, 64 (42.6%) and 12 (24%) were positive for Candida spp. In the
diabetic patients, 34 (53.1%) of the 64 isolated Candida spp. were identified as C. Albicans, while 6 (50%) of the healthy subjects had
C. albicans. The genotypes A (450 bp), B (840 bp), C (450 and 840 bp) of C. Albicans and D (1040 bp) that belongs to C. dubliniensis
were detected. Genotype A (54.69%) was the most frequent.

Conclusions: This study concluded that there was a difference in the proportion of Candida spp. colonization in the oral cavity of
diabetic patients compared to the healthy group; also, we found that C. Albicans with Genotype A was the most prevalent species
among all other species in both groups.

Keywords: Oral candidiasis, Diabetic, C. Albicans, Genotype A, Phylogenetic tree.

Submitted: April 3, 2022, Accepted: May 23, 2022, Published: June 1, 2022.

Cite this article as: Mohammed SA, Shekhany KA, Jalal PJ, Fattah CH. Identification and genotyping of candida
species involved in oral candidiasis among diabetic patients. Sulaimani Dent J. 2022;9(1):45-53.

DOI: https://doi.org/10.17656/sdj.10148

1. Biology Department, College of Science, University of Sulaimani, Sulaimani, Iraq.

2. Anatomy Department, College of Medicine, University of Sulaimani, Sulaimani, Iraq.

* Corresponding author: [email protected]

Published by College of Dentistry, University of Sulaimani

45
Identification and genotyping of Candida species Sulaimani Dent J. June 2022

Introduction parts: macroscopic of the colony on a plate surface and

microscopic observation of fungal structures(14). To
Fungal pathogens can cause life-threatening invasive quickly identify Candida spp. chromogenic medium is
infections, chronic conditions, and recurring superficial required. In mixed cultures of Candida on Sabouraud’s
infections(1). Candida is the main human fungal Dextrose Agar based on colony color, these media
pathogen that causes candidiasis infections(2). Even contain chromogenic substrates that react with enzymes
while Candida spp. is a part of the oral microbiota in secreted by microorganisms generating colonies with
symbiosis, under specific conditions, it may induce various pigmentation; these enzymes are species-
microbial imbalance leading to dysbiosis, resulting in specific, allowing organisms to be identified at the
oral diseases(3). Candidiasis generally manifests as a species level by their color and colony features(15,16).
mild disease of the oral mucous membranes but Polymerase chain reaction-based techniques for
occasionally may be resistant to therapy or become detection and identification of Candida spp. have also
relapsing or recurring(4). Carriage rates in the general been reported; a single-step PCR using universal
population have been observed to range between 20% primers [internal transcribed spacer (ITS)1 and ITS4] to
and 75% without causing any symptoms(5). amplify the ITS1-5.8S-ITS2 region of ribosomal DNA
(rDNA) (genes encoding for ribosomal RNA), the most
Diabetes mellitus (DM) is a long-term metabolic extensively used genetic marker in identifying
disorder marked by persistent hyperglycemia. It might species(17,18). Thus, this study aimed to isolate and
be caused to a lack of insulin secretion, resistance to identify Candida spp. involved in oral candidiasis in
insulin's peripheral activities, or both(6). Several causes diabetic patients.
are related to greater Candida spp. propensity among
DM patients depending on the local or systemic
infection. The identified host factors for candidal
colonization and eventual infection include yeast Patients and methods
attachment to epithelial cell surfaces, greater salivary
glucose levels, lower salivary flow(7), microvascular Sample collection
degeneration, and diminished candidacidal activity of
Oral swabs were collected from 200 participants in the
neutrophils(8). These situations are especially dangerous
Diabetic and Endocrine center and Shar hospital of
if the patient has hyperglycemia, which causes the
Sulaymaniyah governorate, Kurdistan region-Iraq, from
production of many degradative enzymes, or if the
August 2021 to January 2022, on two groups of diabetic
patient has a widespread immunosuppressive state.
patients (n=150) and non-diabetics (n=50) as a control
These factors greatly influence the host-yeast balance,
group. The samples were collected from different ages
favoring Candida spp. The transformation from
ranging from 16 years to 95 years old. The samples
commensal to pathogen and infection(9). Only 40 species
included both sexes, males 49 (32.66%) and females 101
of Candida are capable of causing illness out of the over
(67.33%) from different types of diabetes (Type 1 and
200 that have been identified. In both symptomatic and
Type 2), with males 21 (42%) and females 29 (58%) in
asymptomatic candidiasis infections, C. albicans is the
the control group. Before collecting the samples, ethical
most frequently isolated species(10). C. krusei, C.
approval was obtained from the Research Protocol
glabrata, C. tropicalis, C. kefyr, C. parapsilosis, C.
Ethics Committee of the College of the Science/
lusitaniae, C. dubliniensis, C. guilliermondii, and C.
University of Sulaimani, and informed consent was
stellatoidea are a few more species that have been
obtained from all study participants.
discovered to be pathogenic to humans(11).
Heterogeneity of virulence features in clinical C. Culturing and isolating candida species
albicans isolates is frequently found. Hence, molecular
subtyping provides a helpful technique to detect Swabs were cultured on a Sabouraud dextrose agar
pathogenic subpopulations within this species(12) C. (SDA) medium [Mumbai, India]. Supplemented with
albicans can be divided into four subtypes depending on chloramphenicol [0.5 mg/mL, Sina Darou_Tehran-
the existence and size of transposable intron region in IRAN] and incubated at 370C for 48 hours. As
the large ribosomal subunit 25S rDNA, namely preliminary identification, pure colonies were
genotype A (450 bp), genotype B (840 bp), genotype C transferred on HiCrome™ Candida Differential agar
(450- and 840-bp), and genotype E (1080 bp) ) as well [Mumbai, India] and incubated at 37ºC. The growth was
as also genotype D (1040 bp) belong to C. checked after 48 hours of incubation; this method is used
dubliniensis(13). to distinguish distinct Candida spp. based on color and
morphology(19,20).
To identify yeast species isolated from clinical samples,
phenotypic methods are used. They are divided into two

46
Vol 9(1) Mohammed et al.

Molecular identification of Candida spp. used in the first round of PCR, CA25S primers were
used Forward CA25S-F (5’-
The PCR was performed to amplify intergenic spacer CGATTCAGGGGAGGTAGTGAC-3’) and revers
regions (ITS) of the gene encoding 5.8 S rDNA using CA25S-R(5’-GGTTCGCCATAAATGGCTACCAG-
forward ITS1-F (5’-TCCGTAGGTGAACCTGCG-3’) 3’)(12). The PCR program was as follows: one cycle of
and reverse ITS4-R (5’- the initial denaturation at 95⁰C for 5min. Then, the PCR
TCCTCCGCTTATTGATATGC -3’) primers(17). A was continued with the 35 cycles of denaturation at 95⁰C
single colony was directly used as a template for PCR for 30sec and annealing at 64⁰C for 30sec and extension
without the extraction of pure DNA (colony PCR). A at 72⁰C for 40sec, then the final extension at 72⁰C for
large amount of material and the time-consuming 5min. The first round's amplicon was utilized as a
process of extracting genomic DNA can be saved using template for the second PCR, which was performed
colony PCR. A single colony was taken from the using the same program with CA-INT primers forward
overnight culture and resuspended in 40µl of ddH2O. CA-INT-F (5’-
The DNA was released after a 20-minute incubation at ATAAGGGAAGTCGGCAAAATAGATCCGTAA-
95°C, according to Shekhany (2021)(21). The DNA was 3’) and revers CA-INT-R (5’-
purified by centrifugation at 12000 rpm for 2 minutes; CCTTGGCTGTGGGTTTCGCTAGATAGTAGAT-
then, the supernatant was used as a PCR template. The 3’) and 70°C annealing temperature(12).
PCR was performed using [Taq Master (2x conc.) /
addbio. South Korea] master mix according to manual Sequencing
instructions. The method was started with one cycle of
initial denaturation at 95⁰C for 5min, followed by 40 Sequencing was performed on 22 samples that were
amplification cycles of denaturation at 95⁰C for 30sec, amplified using ITS1-F and ITS4-R forward and
annealing at 57⁰C for 30sec, and extension at 72⁰C for reversed primers(10pmol) (Sanger sequencing/ ABI
40sec, then finalized with the final extension at 72⁰C for 3500, Macrogen Genome Center, Republic of Korea).
5min. The amplicon was separated by 2% gel
Phylogenetic analysis
electrophoresis and then visualized by ethidium
bromide. Aligned sequences were used for phylogenetic analysis
performed with Mega 7 software. The Neighbor-Joining
Confirmation of the Candida spp. by detection of
method was used to infer the evolutionary history(24).
CHS1 gene
The optimal tree is shown, with a branch length sum of
CHS1 gene is regarded as a virulence gene present in 1.74846739. The confidence probability (multiplied by
four Candida species (C. albicans, C. glabrata, C. 100) that the interior branch length is greater than 0, as
tropicalis, and C. parapsilosis), A portion of the chitin estimated using the bootstrap test (100 replicates are
synthase gene (CHS1) from Candida spp. (122bp) can shown next to the branches(25,26). The branch lengths are
be amplified using conventional PCR using C. krusei as in the same units as the evolutionary distances used to
negative control(22). The colony PCR was carried out infer the phylogenetic tree, and the tree is drawn to scale.
with the same DNA polymerase kit as previously The Poisson correction method was used to calculate the
mentioned using forward CHS1-F (5’- evolutionary distances(27), and are in the units of the
CGCCTCTGATGGTGATGAT-3’) and revers CHSI-R number of amino acid substitutions per site. A gamma
(5’-TCCGGTATCACCTGGCTC-3’) primers(23). The distribution (shape parameter = 1) was used to model
samples were placed in a thermocycler. The rate variation between sites. A total of 40 amino acid
amplification programs were configured as follows: one sequences were examined. The standard genetic code
cycle of the initial denaturation at 95⁰C for 5min, then table was used to translate the coding data. Gaps and
40 cycles of denaturation at 95⁰C for 30sec, annealing at missing data were removed from all positions. The final
52⁰C for 30sec, and extension at 72⁰C for 30sec were dataset contained a total of 81 positions(28).
applied. The PCR was finished with one cycle of final
Statistical analysis
extension at 72⁰C for 7min. PCR products were resolved
on 2% agarose gel. In this study, descriptive statistics were used to describe
the basic features of the data.
Genotypes detection by Nested PCR

Genotype determination was based on the transposable

intron in 25S rDNA. The nested PCR technique was

47
Identification and genotyping of Candida species Sulaimani Dent J. June 2022

Results Furthermore, amplicons of the CHS1 gene (122 bp)

were observed in C. albicans, C. glabrata, C.
The current study was conducted by involving 200 parapsilosis, and C. tropicalis and not in the negative
participants in two groups of diabetic patients (n=150) control C. krusei (Figure 3).
and non-diabetics (n=50) as a control group. Among the
samples of 150 diabetes patients and 50 controls, 64 Then all C. albicans and C. dubliniensis isolates were
(42.6%) and 12 (24%) were positive for Candida then submitted to genotypic analysis based on the
species. All isolates were identified on HiCrome™ transposable intron in 25S rDNA using CA25S and CA-
Candida Differential agar (Table, Figure 1), then INT primers. It has been observed that C. albicans
confirmed with PCR based on the ITS region (Table, isolates belong to three genotypes where are genotype A
Figure 2). In the DM patients, 34 (53.1%) of the 64 (450 bp), genotype B (840 bp), genotype C (450 and 840
isolated Candida spp. were identified as C. albicans, bp), and C. dubliniensis belongs to genotype D (1040
while 6 (50%) of the healthy subjects had been identified bp) (Table 2).
as C. albicans. The current result revealed that oral
Results showed that out of 34 isolates from the diabetic
Candida colonization was more common in diabetes
group; Genotype A was the most abundant with (26)
patients than in the non-diabetic group.
isolates, followed by Genotype B with (6) isolates and
PCR amplification of the internal transcribed spacer Genotype C (2) isolates. In comparison, all six isolates
(ITS) regions and genotyping analysis of C. albicans from the control group belonged to
genotype A. furthermore, in the current study (4),
Positive cultures of samples taken from both groups isolates of genotype D were found, as shown in (Table
revealed the following bands after performing PCR 2). None of the PCR products was 1080 bp long in our
amplification, as mentioned in Table 1 and Figure 2. In study, which relates to genotype E.
this study, the results of the molecular technique and the
colony features of the isolates on HiCrome™ Candida
Differential agar exhibited perfect Identity.

Table 1: Identification and distribution of Candida spp. isolated in the oral cavity of the diabetic and control.
groups.
Fragment size
Diabetic group Non-diabetic Color on found by PCR
Candida Species
No. (%) group No. (%) HiCrome agar with ITS1-ITS4
primers

C. albicans 34 (53.1%) 6 (50%) Light green 532 bp

C. kefyr 13 (20.3%) - pink 722 bp
C. glabrata 12 (18.7%) 4 (33.4%) Cream to white 874 bp
C. dubliniensis 3 (4.7%) 1 (8.3%) Pale green 540 bp
C. tropicalis 1 (1.6%) - blue 521 bp
C. parapsilosis - 1 (8.3%) Cream to white 516 bp
C. krusei 1 (1.6%) - Purple, fuzzy 500 bp
Total 64 (100%) 12 (100%) - -

48
 Vol 9(1) Mohammed et al.

Figure 1: Different colony colors and morphologies of

various Candida spp. on HiCrome™ Candida Differential
Agar a/ C. Albicans, b/ C. glabrata, c/ C. kefyr, d/ C.
dubliniensis, e/ C. krusei, f/ C. parapsilosis, g/ C.
tropicalis.

Figure 2: Candida spp. identification showing seven species, from left the DNA
marker 100bp [GeneDireX, Inc. United States], negative control, C. albicans
(532bp), C. kefyr (722bp), C. dubliniensis (540bp), C. glabrata (874bp), C.
tropicalis (521bp), C. parapsilosis (516bp) and krusei (500bp).

Figure 3: Confirmation of the C. albicans, C. glabrata,

C. parapsilosis, and C. tropicalis identification with
CHS1 primers (122bp). The marker was 100bp DNA
[GeneDireX, Inc. United States].

49
Identification and genotyping of Candida species Sulaimani Dent J. June 2022

Figure 4: Detection of three genotypes of C. albicans, and

genotype D of C. dubliniensis. The marker was 100bp
DNA [GeneDireX, Inc. United States].

Table 2: Frequency of C. albicans and C. dubliniensis genotypes in diabetic and control groups for 44
isolates.
Source No. (%) of strains of the following genotype:
Total Genotype A Genotype B Genotype C Genotype D
Diabetic group 37 26 6 2 3
Control group 7 6 0 0 1
Total 44 (100%) 32 (72.7%) 6 (13.6%) 2 (4.6%) 4 (9.1%)_

MT539317.1 Candida albicans

OM662276.1 Candida albicans
MK805512.1 Candida albicans
MH534938.1 Candida albicans
OK030637.1 Candida albicans
ON046190 Candida albicans Suli-DP140
ON046189 Candida albicans Suli-DP135
ON046188 Candida albicans Suli-DP91
ON046187 Candida albicans Suli-DP89
ON046185 Candida albicans Suli-DP46
ON046184 Candida albicans Suli-DP45
ON046183 Candida albicans Suli-DP7
ON046182 Candida albicans Suli-DP6
ON046186 Candida albicans Suli-DP78
MT539204.1 Candida albicans
ON059989 Candida dubliniensis Suli-DP34
ON059990 Candida dubliniensis Suli-DP103
MH545916.1 Candida dubliniensis
MN559579.1 Candida dubliniensis
ON059987 Candida tropicalis Suli-DP1
MT539196.1 Candida tropicalis
ON059988 Candida parapsilosis Suli-DP8
OM959655.1 Candida parapsilosis
ON059992 Candida glabrata Suli-DP2
LR757916.1 Candida glabrata
ON059991 Candida glabrata Suli-DP117
LC389261.1 Candida glabrata
ON045849 Candida kefyr (Kluyveromyces marxianus) Suli-DP13
ON045850 Candida kefyr (Kluyveromyces marxianus) Suli-DP37
ON045851 Candida kefyr (Kluyveromyces marxianus) Suli-DP76
ON045852 Candida kefyr (Kluyveromyces marxianus) Suli-DP126
ON045853 Candida kefyr (Kluyveromyces marxianus) Suli-DP198
MH748641.1 Candida kefyr (Kluyveromyces marxianus)
KM921933.1 Candida kefyr (Kluyveromyces marxianus)
MZ333460.1 Candida kefyr (Kluyveromyces marxianus)
KX905267.1 Candida kefyr (Kluyveromyces marxianus)
ON045847 Candida krusei (Pichia kudriavzevii) Suli-DP34
OL470264.1 Pichia kudriavzevii
DQ674354.1 Candida krusei(Pichia kudriavzevii)
OM859339.1 Pichia kudriavzevii

Figure 5: Phylogenetic tree based on ITS1-5.8S-ITS4 region sequences for 21 isolated

Candida spp. with reference strains.

50
Vol 9(1) Mohammed et al.

Discussion Furthermore, about 95.2% of the studied isolates were

placed in clade I, and 4.8% were in clade II (Figure 5).
Candidiasis is the most common opportunistic yeast Therefore, it is clear that some isolates were 100%
infection globally(29). Diabetic patients are more identical and also identical to the reference sequence
predisposed to oral candidiasis than non-diabetics representing C. albicans, C. dubliniensis, and C. kefyr.
because of the conditions favoring oral carriage of Also, we had variation in one isolate of C. albicans
Candida(30). High salivary glucose levels enhance (Suli-PD78) that was more similar to the C. albicans
Candida adhesion to buccal epithelial cells. Salivary strain from Iran (MT539204.1) and C. glabrata which
glucose produces chemically reversible glycosylation are located in different subclades, notably found that C.
products with proteins in tissues during hyperglycemic glabrata (Suli-PD2) was more similar to strain from
episodes, which leads to a buildup of glycosylation Kuwait (LR757916.1) and C. glabrata (Suli-PD117)
products on buccal epithelial cells, potentially was more similar to strain from Iran (LC389261.1).
increasing the number of Candida-accessible
receptors(31). Also, poor oral hygiene in diabetes patients
may raise Candida spp. as part of the oral flora and
might alter the superficial and systemic fungal Conclusions
infections compared to healthy individuals(8).
This study concluded that Candida spp. colonization
In the current study, the incidence of Candida spp. from was more common in diabetes patients than in the non-
the oral cavity of the diabetic patient was (42.6%) and diabetic group. Also, the current study found that C.
(24%) in the control group; this result for the diabetic albicans with Genotype A was the most prevalent
group was lower than that reported in Baghdad/ Iraq species among all other species in both groups. The
(77.3%)(32), and Iran (55%)(8), but it was more than that study will continue to determine the capabilities of
reported in Jordan (8.3%)(33). In the control group, the Candida albicans that are isolated from diabetic patients
result was higher compared to Al-Badri et al. (18.7%)(32) to produce biofilm and study the relation between
and Abu-Elteen et al. (0%)(33), but lower than those of biofilm production and the prevalence of virulence gene
the Iran study (35.5%)(8). C. albicans was the most markers.
predominant species among all other isolated species
(53.1%), followed by other species of Candida; these
results are compatible with all above previous
studies(8,32,33). Gomes et al. demonstrated that the Strains
References
of C. albicans isolated from diabetic patients increased
1. Ksiezopolska E, Gabaldón T. Evolutionary
virulence compared to normoglycemic patients. Several
emergence of drug resistance in Candida
researches studied the association between C. albicans
opportunistic pathogens. Genes (Basel).
different genotypes and pathogenicity of subpopulation
2018;9(9):461.
within this species, thereby assist in creating effective
2. Sardi JC, Scorzoni L, Bernardi T, Fusco-Almeida
therapeutic options to combat the disease(34,35). In
AM, Giannini MM. Candida species: current
another study that done in Diyala province 25(83.3%) of
epidemiology, pathogenicity, biofilm formation,
isolates belonged to the genotype A and 5 (16.6%) to
natural antifungal products and new therapeutic
genotype C of the C. albicans. There were no results for
options. J Med Microbiol. 2013;62(1):10-24.
genotype B(36). These results are inconsistent with our
3. Rodrigues CF, Rodrigues ME, Henriques MC.
findings in that in total number of isolate in diabetics
Promising alternative therapeutics for oral
group 37 the genotype A was the most abundant with 26
candidiasis. Curr Med Chem. 2019;26(14):2515-
isolates (70.3%) followed by genotype B with 6 isolates
28.
(16.2%) and genotype C 2 isolates (5.4%), also in
4. Quindós G, Gil-Alonso S, Marcos-Arias C,
current study 3 isolates of genotype D (8.1%) in diabetic
Sevillano E, Mateo E, Jauregizar N, et al.
groups that are not reported by previous studies.
Therapeutic tools for oral candidiasis: current and
Notably, there is limited information concerning the new antifungal drugs. Med Oral Patol Oral Cir
phylogeny and genetic diversity of Candida spp. Strains Bucal. 2019;24(2):e172-80.
isolated in the oral cavity of a diabetic patient in Iraq. In 5. Akpan A, Morgan R. Oral candidiasis. Postgrad
this study, the phylogenetic analyses showed that there Med J. 2002:78(922):455-59.
are two main clades and ten different subclades. 6. Goyal R, Jialal I. Diabetes mellitus type 2. 2018.

51
Identification and genotyping of Candida species Sulaimani Dent J. June 2022

7. Nguyen TD, Nguyen TTH, Tran QV. The 19. Baradkar VP, Mathur M, Kumar S. Hichrom
incidence of oral candidiasis in patients with Candida agar for identification of Candida species.
diabetes mellitus: a cross-sectional study in Indian J Pathol Microbiol. 2010;53(1):93-5.
southern Vietnam. J Crit Rev. 2020;7(4):82-6. 20. Charles MP, Kali A, Joseph NM. Performance of
8. Mohammadi F, Javaheri MR, Nekoeian S, chromogenic media for Candida in rapid
Dehghan P. Identification of Candida species in presumptive identification of Candida species
the oral cavity of diabetic patients. Curr Med from clinical materials. Pharmacogn Res.
Mycol. 2016;2(2):1-7. 2015;7(Suppl 1):S69-73.
9. Rodrigues CF, Rodrigues ME, Henriques M. 21. Shekhany KA. Isolation and genotyping of
Candida sp. infections in patients with diabetes Candida albicans involved in vaginal candidiasis
mellitus. J Clin Med. 2019;8(1):76-117. among pregnant women in Sulaymaniyah and
10. Alrayyes SF, Alruwaili HM, Taher IA, Elrahawy Erbil cities. Zanco J Med Sci. 2021;25(1):493-502.
KM, Almaeen AH, Ashekhi AO, et al. Oral 22. Nimri LF, Kaplan NM, Ishaq RI. Bloodstream
candidal carriage and associated risk indicators yeast species and in vitro antifungal susceptibility
among adults in Sakaka, Saudi Arabia. BMC oral profiles. Med Sci. 2021;6(2):117-23.
health. 2019;19(1):1-7. 23. Jordan JA. PCR identification of four medically
11. Hani U, Shivakumar HG, Vaghela R, Osmani RA, important Candida species by using a single primer
Shrivastava A. Candidiasis: a fungal infection- pair. J Clin Microbiol. 1994;32(12):2962-7.
current challenges and progress in prevention and 24. Saitou N, Nei M. The neighbor-joining method: a
treatment. Infect Disord Drug Targets. new method for reconstructing phylogenetic trees.
2015;15(1):42-52. Mol Biol Evol. 1987;4(4):406-25.
12. Tantivitayakul P, Panpradit N, Maudcheingka T, 25. Dopazo J. Estimating errors and confidence
Klaophimai A, Lapirattanakul J. Genotyping of intervals for branch lengths in phylogenetic trees
Candida albicans and Candida dubliniensis by 25s by a bootstrap approach. J Mol Evol.
rDNA analysis shows association with virulence 1994;38(3):300-4.
attributes in oral candidiasis. Arch Oral Biol. 26. Rzhetsky A, Nei M. A simple method for
2019;97(1):18-24. estimating and testing minimum-evolution trees.
13. Baker M.H.A. Genotype comparisons of strains of Mol Biol Evol. 1992;9(5):945-67.
Candida albicans from patients with vaginal 27. Zuckerkandl E, Pauling L. Evolutionary
candidiasis. 2012; Ph.D. diss divergence and convergence in proteins, in
14. Hemaid AS, Abdelghany MM, Abdelghany TM. Evolving genes and proteins. Elsevier. 1965;97-
Isolation and identification of Candida spp. from 166.Academic Press.
immunocompromised patients. Bull Natl Res Cent. 28. Kumar S, Stecher G, Tamura K. MEGA7:
2021;45(1):1-8. molecular evolutionary genetics analysis version
15. Mehta R, Anupama SW. Evaluation of hicrome 7.0 for bigger datasets. Mol Biol Evol.
Candida differential agar for species identification 2016;33(7):1870-4.
of Candida isolates from various clinical samples. 29. Vázquez‐González D, Perusquía‐Ortiz AM,
Int J Contemp Med Res. 2016;3(4):1219-22. Hundeiker M, Bonifaz A. Opportunistic yeast
16. Kaup S, Sankarankutty J, Balasubrahmanya HV, infections: candidiasis, cryptococcosis,
Kulkarni S, Nirmala M. Speciation of Candida trichosporonosis and geotrichosis. J Dtsch
using HiCrome Candida Differential Agar. Int J Dermatol Ges. 2013;11(5):381-94.
Curr Microbiol App Sci. 2016;5(7):267-74. 30. Zomorodian K, Kavoosi F, Pishdad GR, Mehriar
17. Fujita SI, Senda Y, Nakaguchi S, Hashimoto T. P, Ebrahimi H, Bandegani A, et al. Prevalence of
Multiplex PCR using internal transcribed spacer 1 oral Candida colonization in patients with diabetes
and 2 regions for rapid detection and identification mellitus. J Mycol Med. 2016;26(2):103-10.
of yeast strains. J Clin Microbiol. 31. Chouhan S, Kallianpur S, Prabhu KT, Tijare M,
2001;39(10):3617-22. Kasetty S, Gupta S. Candidal prevalence in
18. Barbedo LS, Figueiredo-Carvalho MH, Muniz diabetics and its species identification. Int J Appl
MD, Zancopé-Oliveira RM. The identification and Basic Med Res. 2019;9(1):49-54.
differentiation of the Candida parapsilosis 32. Al-Badri AS, Ali EN, Ajah HA, Ajah HA.
complex species by polymerase chain reaction- Assessment frequency of oral fungal infection with
restriction fragment length polymorphism of the type 2 diabetes mellitus in Iraqi patients. Acad Glo
internal transcribed spacer region of the rDNA. Indersci Res. 2022;3(01):16-26.
Mem Inst Oswaldo Cruz. 2016;111(4):267-70. 33. Abu-Elteen KH, Hamad MA, Salah SA.
Prevalence of oral Candida infections in diabetic
patients. Bahrain Med Bull. 2006;28(1):1-8.

52
Vol 9(1) Mohammed et al.

34. da Silva-Rocha WP, Lemos VL, Svidizisnki TI, Candida albicans clinical isolates from Yangzhou
Milan EP, Chaves GM. Candida species region in China. Afr J Microbiol Res.
distribution, genotyping and virulence factors of 2011;5(25):4406-10.
Candida albicans isolated from the oral cavity of 36. Athab AM, Rasheed MM. Detection of Candida
kidney transplant recipients of two geographic species phenotype and genotype in diabetes
regions of Brazil. BMC Oral Health. 2014;14(1):1- mellitus patient in baquba teaching hospital. Indian
9. J Forensic Med Toxicol. 2019;13(4):518-22.
35. Zhu X, Dong N, Wang Q, Cheng B, Zhu L, Tao J,
et al. Genotyping and antifungal susceptibility of

53
Vol 9(1) Khwakaram and Hama Rasheed

Original Article

Assessment of Clinical Attachment Level in Anxious

Patients
Azhin K. Khwakaram1*, Harem Jaafar Hama Rashed1

Abstract
Objective: This study aimed to assess the clinical attachment level in anxious patients with periodontitis using the Hamilton Anxiety
Scale Rate.

Methods: The study was conducted at the University of Sulaimani, and Shorsh Dental Center teaching hospital; 100 individuals (50
males and 50 females) were included in the study ranging from (30- 65) years old. The individuals' anxiety level was evaluated using
Hamilton Anxiety Scale Rate (HAM-A), and the WHO probe measured the clinical attachment level (CAL). The collected data were
analyzed using the Chi square test and Spearman correlation, and p≤0.05 was significant.

Results: Among 100 individuals that participated in the study,38% had mild anxiety, and the remaining (21,12,18 and 11) % had
moderate, severe, very severe, and no anxiety, respectively. In these groups, the majority of participants had stage II periodontitis,
followed by stage I, none periodontitis, stage III, and stage IV periodontitis, respectively. There’s no significant difference in CAL
between genders (P=0.81). But there were significant differences in anxiety between genders (P=0.028), and there was no significant
association between anxiety and CAL (P= 0.803).

Conclusions: In the present study, the severity of anxiety was stronger in males than in females. Anxiety didn't cause CAL.

Keywords: Periodontist, Clinical attachment level, Anxiety, Hamilton anxiety rate scale.

Submitted: April 3, 2022, Accepted: May 27, 2022, Published: June 1, 2022.

Cite this article as: Khwakaram AK, Hama Rashed HJ. Assessment of Clinical Attachment Level in Anxious
Patients. Sulaimani Dent J. 2020;9(1):54-61.

DOI: https://doi.org/10.17656/sdj.10149

1. Periodontics Department, College of Dentistry, University of Sulaimani, Sulaimani, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

54
Clinical attachment level related to anxiety Sulaimani Dent. J. June 2022

Introduction The inclusion criteria of the study were as follows:

Anxiety is a natural and frequently healthy emotion. 1- Individuals should have a minimum of 20 teeth with
When an individual usually feels disproportionate wisdom teeth excluded.
anxiety levels, it might become a medical disorder(1).
2- Individuals have never received professional
Anxiety disorders form a mental health diagnosis
treatment for anxiety or mental health issues and have
category that leads to excessive nervousness, fear,
no prior history of anxiety or anxiety-related conditions.
apprehension, and worry(2). It is generally equated with
sadness, a protean feeling state in its manifestation, 3- Smoker, alcoholic drinking, and drug abuse
ranging from mild, transient disappointment to severe, conducting exclude from the sample.
confusing, enduring melancholy. Anxiety persists for at
least two weeks but can last for months or years(3). 4- Pregnant women and diabetic patient excludes from
Periodontitis affects millions of people every year due the sample.
to the periodontium's bacterially induced chronic
inflammatory disease that marks the periodontium's The severity of anxiety was determined after
destruction(4). The presence of periodontitis indicates consultation with the psychiatrist. The Hamilton
that the integrity of tooth-supporting tissues has been Anxiety Rating Scale is one of the best psychological
compromised(5); also, periodontitis can result in tooth assessment tools for anxiety and is more dependable in
loss, atherosclerosis(6), aspiration pneumonia(7) and this study.
some cancers(8). The development of periodontal
diseases has been related to periopathogenic bacteria,
with positive correlations between psychological Hamilton anxiety rating scale (HAM-A)
factors(9), such as anxiety(10,11), and periodontal diseases.
The literature will identify and discuss some biological The HAM-A allows an examination of the severity of
and behavioral risk factors that can further increase anxiety symptoms and is commonly used in clinical and
periodontitis onset. These behavioral habits are research settings(16). The HAM-A is a clinical-based
associated with periodontitis development, such as questionnaire that consists of 14 symptom-defined
smoking(12) and poor oral hygiene(13). The biological elements while providing consideration for
factors are associated with periodontitis development as psychological and somatic symptoms of anxiety(17). The
advancing age(14) and diseases such as diabetes(15). The scale was rated using a 4 point-Likert scale consisting of
relationship between periodontitis and psychological 0 = none, 1 = mild, 2 = moderate, 3 = severe, and 4 =
factors can provide different understandings regarding very severe(16). With a total score ranging from (0-56)
the potential improvements which can be made (appendix). Following recommendations from
following treatment, or prevention, for the onset of (17)
Thompson , the scores below 17 were considered
periodontal disease. The need to provide further insight non-anxiety, scores between 17-25 were considered
into this relationship is critical as it can provide an mild anxiety, whereas scores of 25-30 were considered
understanding of the additional benefits of prevention moderate to severe.
and treatment of periodontitis and the psychological
benefits which could be produced from it. Scores of 30 or higher were considered very severe
anxiety. The recruited individuals were of the Kurdish
nationality, so the (HAM-A) questionnaire was
translated into the Kurdish language and then blindly
Patients and methods translated back into the English language by another
person to ensure that there were no errors in translation.
The survey was recruited at The University of
Sulaimani, and the Shorsh Dental Center teaching Periodontal evaluation
hospital. A total of 100 individuals (50 males and 50
females) were included ranging from 30 to 65 years. The Upon completion of the questionnaires, a clinical
individuals' psychological condition was evaluated periodontal examination was conducted. The procedure
using Hamilton Anxiety Scale Rate (HAM-A), and CAL was replicated in a previous study by Nayak and
was measured using a WHO probe. colleagues(18). The examination was done using a WHO
probe, with the CAL measurement being made at four
proximal sites on all teeth, the buccal, lingual, mesial,

55
Vol 9(1) Khwakaram and Hama Rasheed

and distal sides of each tooth. According to the new The sample distribution according to the HAM-A is
periodontal disease classification, the severity of the mild (38%), moderate (21%), severe (12%), very severe
periodontal disease is determined by staging. Stage Ι (18%), and none present (11%). Chi-squared test was
(CAL 1-2 mm), stage Π (CAL 3-4 mm), stage ΠΙ & ΙV used to test significant differences between variables. A
(CAL ≥5 mm), to make a difference between stage III P-value of <0.05 was regarded as significant, as shown
&IV, in stage III (≤4 teeth loss due to periodontitis, in Table 1.
vertical bone loss, furcation involvement class II or III,
moderate ridge defects) in stage IV (≥5 teeth loss due to The genders-wise distribution of subjects according to
periodontitis, Masticatory dysfunction, secondary CAL categories, in both males and females. Most of the
occlusal trauma, tooth mobility degree ≥ 2, severe ridge subjects corresponding belonged to stage II periodontitis
defects, – bite collapse, drifting, flaring, less than 20 (40% male, 30% female), followed by non-periodontitis
remaining teeth(19). (24% male, 28% female) and stage I periodontitis (22%
male, 30% female), stage III (10% male, 8% female),
Statistical Analysis: and stage IV (4% male, 4% female). Chi‑square value:
1.59, P=0.81 there's no significant difference between
The Statistical Package analyzed the Social Sciences genders in any periodontal CAL categories (Figure 2).
(SPSS ver. 20) data to describe continuous and
descriptive analysis; mean, standard deviation (SD), and The genders distribution of individuals according to
percentage frequency was used, respectively. The anxiety, most males have mild anxiety (52%). In
minimum, maximum, and Range were also reported for comparison, most females have very severe anxiety
each questionnaire item. The association between the (26%), and males and females showed significant
questionnaire data and accumulative periodontal CAL differences, Chi‑square value: 10.91, P=0.028, as shown
was analyzed using the Chi‑square test and Spearman in (Figure 3).
correlation. The significance level of p≤0.05 was
adopted throughout the study. The sample distribution on the HAMA scale Anxiety
categories with periodontitis. Individuals who didn't
have periodontitis had mild anxiety 11%, very severe
anxiety 6%, moderate anxiety 5%, severe anxiety 4%,
Results and no one had non-anxiety 0%. Individuals with
periodontitis in stage I had mild anxiety 9 %, moderate
In this study, among 100 individuals that participated in anxiety 6%, severe and very severe anxiety 4%, and
the study, the mean age was 41.83 ± 7.8 years (Figure non-anxiety 3%. Individuals with stage II periodontitis
1). The gender distribution of the sample is equal for had mild anxiety 13%, non-anxiety 7%, moderate and
both genders, male (50%) and female (50%). There were very severe 6%, and severe 3%. Mild and moderate
four age groups in the sample: 30–40 (53 %), 41–50 anxiety 3% of those with stage III periodontitis, very
(33%), 51–60 (12%), and >60. (2%). severe anxiety 2%, non-anxiety 1%, and no one had
severe anxiety 0%. Those with stage IV periodontitis
The sample is divided into four stages of periodontitis:
had 2% mild anxiety, 1% moderate and 1% severe
stage I (26%), stage II (35%), stage III (9%), stage IV
anxiety, and 0% non-anxiety and severe anxiety.
(4%), and none (26 %).
Chi‑square value: 11.09, P: 0.803, rho=0.087, p=0.392.
However, there was no significant association between
anxiety and CAL, as shown in Tables 2 and 3.
Age

7.8
Mean

standard
deviation
41.83

Figure 1: The mean age.

56
Clinical attachment level related to anxiety Sulaimani Dent. J. June 2022

Table 1: Selected demographic indicators of the participants,

Characteristics of respondents (n=100).

Characteristics No of cases (N) Percentage (%)

Male 50 50.0
Gender
Female 50 50.0

30 – 40 53 53.0

>40 – 50 33 33.0
Age
>50 – 60 12 12.0

>60 2 2.0

Stage I 26 26.0

Stage II 35 35.0

Periodontitis Stage III 9 9.0

Stage IV 4 4.0

None 26 26.0

Mild 38 38.0

HAM-A Moderate 21 21.0

Scale
Severe 12 12.0

Very 18 18.0
Severe
Not 11 11.0
Present
Chi-squared test was used to test significant difference between variables.
Differences between men and women in nominal data were tested by the Chi-squared
test.
A P-value of <0.05 was regarded as significant.

45

40

35

30

25
Male
20 40
Female
15 30 30
28
24 22
10

5 10 8
4 4
0
None (%) Stage I (%) Stage II Stage III Stage IV
(%) (%) (%)
Chi‑square value: 1.59, P=0.81 (Not significant).
Figure 2: CAL distribution according to the gender.

57
Vol 9(1) Khwakaram and Hama Rasheed

60
52
50

40

30 24 26
22 Male
20
20 14 16
Female
8 8 10
10

0
Not Mild (%) Moderate Severe Very
present (%) (%) Severe
(%) (%)

Chi‑square value: 10.91, P=0.028 (Significant at level of P=0.05).

Figure 3: HAM-A distribution of anxiety individuals. according to the gender.

Table 2: The distribution of samples that had HAMA scale anxiety with periodontitis.

HAMA scale
Not
Periodontitis Moderate Very P value
present Mild (%) Severe (%)
(%) Severe (%)
(%)
None 0 11 (42.3) 5(19.2) 4(15.4) 6(23.1)
Stage I 3(11.5) 9(34.6) 6(23.1) 4(15.4) 4(15.4)
Stage II 7(20.0) 13(37.1) 6(17.1) 3(8.6) 6(17.1) 0.803
Stage III 1(11.1) 3(33.3) 3(33.3) 0 2(22.2)
Stage IV 0 2(50) 1(25) 1(25) 0
Chi‑square value: 11.09, P: 0.803

Table 3: Correlations of periodontitis to HAMA scale anxiety.

Periodontitis HAM-A
Correlation 1.000 .087
Coefficient
Periodontitis
Sig. (2-tailed) . .392
Spearman's N 100 100
rho Correlation .087 1.000
Coefficient
HAM-A
Sig. (2-tailed) .392 .
N 100 100

58
Clinical attachment level related to anxiety Sulaimani Dent. J. June 2022

Discussion Acknowledgment

Periodontitis is a chronic multifactorial inflammatory Special thanks to the University of Sulaimani, the
disease characterized by the progressive destruction of College of Dentistry, and the Shorsh Dental Center
the tooth-supporting apparatus and inflammation that teaching hospital.
results in periodontal attachment loss(20). Anxiety is
characterized by a sense of unease, such as fear or
worry, which can be mild or severe. Anxiety is a fact of
life, and it can be viewed as a process that includes both References
psychological and physiological components. The study
evaluated the association between CAL and anxiety by 1. Racic M, Todorovic R, Ivkovic N, Masic S,
using the Hamilton anxiety scale rate HAM-A scale. In Joksimovic B, Kulic M. Self-perceived stress in
the present study, males have higher anxiety levels than relation to anxiety, depression and health-related
females in mild and moderate anxiety stages. quality of life among health professions students:
A cross-sectional study from Bosnia and
In comparison, females have higher anxiety levels than Herzegovina. Zdr Varst. 2017;56(4):251-9.
males in the severe and very severe anxiety stages. 2. Crocq MA. The history of generalized anxiety
Findings agree with Peeran and Kumar 2014 and disorder as a diagnostic category. Dialogues Clin
disagree with McLean et al. 2011(21). It may be because Neurosci. 2017;19(2):107-16.
anxiety is generally more common in females than 3. Bystritsky A, Khalsa SS, Cameron ME, Schiffman
males(21). Also, the present study found that there was no J. Current diagnosis and treatment of anxiety
significant difference between males and females in the disorders. P T. 2013;38(1):30-44.
CAL. Some studies have indicated a positive 4. Darveau RP. Periodontitis: a polymicrobial
relationship between gender and periodontal attachment disruption of host homeostasis. Nat Rev Microbiol.
loss(22). There is no significant association between 2010;8(7):481-90.
periodontal CAL and anxiety in the current research, 5. Hajishengallis G. Periodontitis: from microbial
agrees with Peeran and Kumar 2014(23); otherwise, immune subversion to systemic inflammation. Nat
according to other studies, there was a significant Rev Immunol. 2016;15(1):30-44.
association between periodontal CAL and anxiety(24,25). 6. Velsko IM, Chukkapalli SS, Rivera MF, Lee JY,
It could be interpreted because the type of the study is a Chen H, Zheng D, et al. Active invasion of oral and
prevalence study in which the data was taken at a aortic tissues by Porphyromonas gingivalis in
specific point of time which doesn’t include any follow- mice causally links periodontitis and
ups, so conducting the incidence study which will atherosclerosis. PloS one. 2014;9(5):e97811.
follow the cases within the period may result in a 7. Pace CC, McCullough GH. The association
different result(26), the periodontal CAL was the only between oral microorganisms and aspiration
periodontal parameter examined, although it is the best pneumonia in the institutionalized elderly: review
among the clinical parameters; the clinical parameters and recommendations. Dysphagia.
cannot assess precisely the loss of periodontal 2010;25(4):307-22.
attachment, which can only be done by histometric 8. Fitzpatrick SG, Katz J. The association between
methods(27), whereas the psychometric scales generally periodontal disease and cancer: a review of the
measure the state for a limited period in an individual literature. J Dent. 2010;38(2):83-95.
near short-memory, which for example in the case of 9. Aragão WAB, Souza-Monteiro de D, Frazão DR,
HAM-A is two weeks. Né YG de S, Ferreira R de O, Rivera LFS, et al. Is
there any association between chronic
periodontitis and anxiety in adults? A systematic
review. Front Psychiatry. 2021;12(8):710606.
Conclusions 10. López R, Ramírez V, Marró P, Baelum V.
Psychosocial distress and periodontitis in
Both the genders have periodontitis without significant
adolescents. Oral Health Prev Dent.
differences. However, in the Sulaimani governed
2012;10(3):211-8.
Kurdistan-Iraq, males have a high level of anxiety than
11. Kesim S, Unalan D, Esen C, Ozturk A. The
females, and anxiety doesn't affect CAL.
relationship between periodontal disease severity

59
Vol 9(1) Khwakaram and Hama Rasheed

and state-trait anxiety level. J Pak Med. 22. Ioannidou E. The sex and gender intersection in
2012;62(12):1304-8. chronic periodontitis. Public Health Front.
12. Tymkiw KD, Thunell DH, Johnson GK, Joly S, 2017;4(5):189.
Burnell KK, Cavanaugh JE, et al. Influence of 23. Peeran SW, Kumar NPG, Abdelkader F, Azaruk
smoking on gingival crevicular fluid cytokines in A, Alsaid FM, Abdalla KA, et al. Association
severe chronic periodontitis. J Clin Periodontol. between mental well-being, depression, and
2011;38(3):219-28. periodontal attachment level among young adults
13. Kolawole KA, Oziegbe EO, Bamise CT. Oral of the postwar Sebha city, Libya: A pilot study. J
hygiene measures and the periodontal status of Nat Sci Biol Med. 2014;5(2):308-12.
school children. Int J Dent Hyg. 2011;9(2):143–8. 24. Shrestha S, Sharma S, Sapkota N, Giri DK, Baral
14. Mckenna G, Burke FM. Age-related oral changes. D. Association between anxiety and depression
Dent Update. 2010;37(8):519-23. with chronic periodontitis. JCMS-Nepal.
15. Tanwir F, Altamash M, Gustafsson A. Effect of 2017;13(2):268-74.
diabetes on periodontal status of a population with 25. Aragão WAB, Souza-Monteiro de D, Frazão DR,
poor oral health. Acta Odontol Scand. Né YG de S, Ferreira R de O, Rivera LFS, et al. Is
2009;67(3):129-33. there any association between chronic
16. Hamilton M. The assessment of anxiety states by periodontitis and anxiety in adults? A systematic
rating. Br J Clin Psychol. 1959;32(1):50-5. review. Front Psychiatry. 2021;12:710606.
17. Thompson E. Hamilton rating scale for anxiety 26. Buechley RW, Drake RM, Breslow L.
(HAM-A). Occup. 2015;65(7):601. Relationship of amount of cigarette smoking to
18. Nayak SU, Nayak DG, Uppoor AS, Pai KK. coronary heart disease mortality rates in men.
Evaluation of cortisol levels in gingival crevicular Circulation. 1958;18(6):1085-90.
fluid and saliva in anxious and non-anxious 27. Karmakar S, Prakash S. Clinical attachment level:
patients with chronic periodontitis. J Dent Res. An usung hero in periodontal diagnosis. Int j adv
2013;10(4):474-81. res. 2019;7(4):106-11.
19. Babay N, Alshehri F, al Rowis R. Majors
highlights of the new 2017 classification of
periodontal and peri-implant diseases and
conditions. Saudi Dent J. 2019;31(3):303-5.
20. Könönen E, Gursoy M, Gursoy UK. Periodontitis:
A multifaceted disease of tooth-supporting tissues.
J Clin Med. 2019;8(8):11-35.
21. McLean CP, Asnaani A, Litz BT, Hofmann SG.
Gender differences in anxiety disorders:
Prevalence, course of illness, comorbidity and
burden of illness. J Psychiatr Res.
2011;45(8):1027-35.

60
Clinical attachment level related to anxiety Sulaimani Dent. J. June 2022

Appendix

61
Vol 9(1) Abdel-Rahman et al.

Original Article

Effect of Adding Titanium Dioxide Nanoparticles on

Some Mechanical Properties of Dental Alginate
Hoshang k. Abdel-Rahman 1*, Ranj A. Omer 2, Mahabad M. Saleh 1, Sazgar S. Al-Hawezi 3, Fahd S. Ikram 1

Abstract
Objective: This study aimed to evaluate the effect of adding titanium dioxide nanoparticles (TiO2NPs) on Shore A hardness, Young’s
modulus, and tear strength of alginate impression material.

Methods: Each test consists of one control group (alginate without TiO2NPs), and three test groups (2%, 3%, and 5%) of TiO2NPs
were added, respectively. For each group, seven samples were constructed. For Shore A hardness, the samples were prepared according
to ISO standards (7619-1:2010); Young’s modulus was calculated from the obtained Shore A hardness value according to a special
standard equation. In contrast, for tear strength, the samples were prepared according to ASTM D 624-00.

Results: The Control group exhibited a significantly less Shore A hardness value than all the other groups except the group that
contained 2% TiO2NPs, where the increase in the hardness value was non-significant. A similar result was observed for Young’s
modulus test, where the addition of TiO2NPs significantly increased Young’s modulus compared to the control group. Although, on
the contrary, the tear strength was significantly improved by adding 3% TiO2NPs compared to control and other groups, there was a
significant drop in the value of tear strength when 5% TiO2NPs were added to alginate.

Conclusions: The addition of 3% TiO2NPs to dental alginate increased Shore A hardness, Young’s modulus, and significantly
improved tear strength.

Keywords: Alginate, Hardness, Nanoparticles, Tear strength, Young’s modulus.

Submitted: May 5, 2022, Accepted: May 27, 2022, Published: June 1, 2022.

Cite this article as: Abdel-Rahman HK, Omer RA, Saleh MM, Al-Hawezi SS, Ikram FS. Effect of Adding Titanium
Dioxide Nanoparticles on Some Mechanical Properties of Dental Alginate. Sulaimani Dent J. 2022;9(1):62-67.

DOI: https://doi.org/10.17656/sdj.10150

1. Prosthodontics Department, College of Dentistry, Hawler Medical University, Erbil, Iraq.

2. Department of dental technology, Gasha technical institute, Erbil, Iraq.
3. Conservative Department, College of Dentistry, Hawler Medical University, Erbil, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

62
Titanium dioxide nanoparticles and dental alginate Sulaimani Dent. J. June 2022

Introduction modified groups to which TiO2NPs (20 nm size, 99%

purity) at (2%, 3%, and 5%) respectively by using an
Many materials have been used for dental impressions, electronic balance (OHAUS Europe GmbH-
but the most commonly used material is alginate, an Switzerland) with 0.0001 mg of precision were added to
irreversible hydrocolloid material due to its elasticity. (Alginplus) extra high precision alginate ISO 21563
Impression material will be placed in the patient mouth (Major- Italy), the alginate and the TiO2NPs powder was
to make negative reproduction of teeth and oral tissue. dispensed in a container and mixed(11) in a circular
The impression is then poured with gypsum product to motion manually for 90 seconds to ensure a uniform
obtain a working model(1,2). distribution of the TiO2NPs within the alginate powder.
The powder/water mixing ratio was done according to
The major advantages of this material are its elastic the manufacturer's recommendation. The exact weight
property, easy manipulation, comfort for patients, and of the powder was mixed with distilled water using an
relatively low cost because it does not require any electronic automatic alginate mixer machine (Cavex-
special equipment(3). At the same time, the main Netherlands) for ten seconds. The impression
shortcoming of this material is the dimensional procedures were performed in a controlled temperature
instability due to syneresis or imbibition phenomenon(4). (25ºC) room. The samples were removed after alginate
Disinfection of impression is an integral and necessary gelation.
procedure in dentistry to prevent cross-infection among
patients, dentists, and dental technicians, a variety of Shore A hardness test
methods have been employed for this purpose, such as
immersion and spraying methods, but they are Sample preparation and measurement for Shore A
associated with the unwanted dimensional changes in hardness were done according to the ISO standards
the alginate impression due to its hydrophilic nature(5,6). 7619(14). Seven samples for each group were constructed
from a plastic mold with a diameter of 50 mm and a
thickness of 6 mm; the mold was placed on a glass slab,
filled with the alginate, and covered by the second slab.
Recently, studies have reported that metallic oxide The pressure was applied manually until the two glass
nanoparticles, such as silver and magnesium oxide slabs were in contact with the mold to ensure even
nanoparticles, were very effective against many bacteria alginate thickness during gelation, then 5 kilograms of
and fungi(7,8). As a result, many researchers have weight was placed over the slab until the setting was
experimented with incorporating silver nanoparticles complete. After 10 min, the alginate discs were carefully
into alginate impression materials, and they found removed. Each sample was divided into six equal zones;
evidence of antimicrobial activity(9,10) without any one measurement was made for each zone. Digital
significant change in its physical properties(11). Shore A Hardness Durometer tester kit (Yueqing ABE
model LX-A-4. China), as shown in Figure1, was used
The effect of adding TiO2NPs has been studied in
to measure the hardness of the samples that were loaded
dentistry, and its role was proven to improve some
with 10 N for 15 seconds, the mean of the six
mechanical properties(12,13) alongside effective
(13) measurements was considered as the value of the Shore
antimicrobial activity .
A hardness.
No previous study has been conducted on the efficacy
of incorporating TiO2NPs into dental alginate
impression material. Therefore, this study was
performed to evaluate the effect of adding TiO2NPs on
Shore A hardness, Young’s modulus, and tear strength
of the alginate.

Materials and methods

A total of 56 samples were prepared (28 samples) for the

Shore A hardness test and (28 samples) for the Tear
strength test. The study design for each test consists of Figure 1: Shore A hardness durometer testing kit.
four major groups, one control group, and three

63
Vol 9(1) Abdel-Rahman et al.

Young’s Modulus test Statistical analysis

The Young’s Modulus value was calculated from the The obtained data post hoc test (multiple comparisons
Shore A hardness value according to an equation by with LSD) was done using SPSS software version 22,
(Gent 1958)(15), who found that there is a very close and the P. Value for the level of significance was 0.05
correlation between Durometer Shore A hardness and (α = 0.05).
Young’s Modulus using this equation:

0.0981(56+7.62336s) Results
E=
0.137505(254-2.45s) Shore A hardness test

The Durometer Shore A hardness results showed that

Where E = Young’s modulus in MPa, S = Shore A the control group (0% TiO2NPs) had the optimum and
Hardness. least Shore A hardness of 10.485, while the group to
which 5% TiO2NPs were added showed the highest
Tear strength test
Shore A hardness of 13.128, as shown in Table 1.
Sample parameters and testing were done according to
As mentioned earlier, Young’s modulus value was
ASTM D624-00(16); 28 samples were divided into four
extracted from the Shore A hardness value and
groups, and each group (n=7) was prepared from a V-
calculated according to the early mentioned Gent (1958)
shaped mold of 3mm thickness (Figure 2 A). First, the
equation. The control group presented with the least
mold was placed on a glass slab, filled with the alginate,
Young’s Modulus value (0.426MPa) compared to other
and covered by the second slab in the same manner as
groups, followed by the group to which 2% TiO2NPs
described previously for Shore A hardness sample
were added, having Young’s modulus mean value
preparation to ensure uniform alginate thickness, then 5
(0.4268MPa). In comparison, the highest Young’s
kilograms of weight was placed over the second slab
Modulus (0.503 MPa) was found in the group modified
until the setting was complete after 10 minutes. Then,
by adding 5% TiO2NPs. The results of all groups are
the V-shaped alginate specimens were removed from
presented in Table 1.
the mold and immediately subjected to the tear strength
test. The testing procedure was done using a computer As shown from the LSD test result in the table.2, the
programmed universal testing machine (DRK101SA, addition of up to 2% of TiO2NPs to the alginate doesn’t
China), with a 50 mm/min crosshead speed, as seen in significantly affect the mean Shore hardness. In
Figure 2 B. The ultimate tear strength calculation was comparison, the other added concentrations
done according to this equation. significantly increased the Shore hardness from
(10.485) for the control group to (11.142) for the group
T= F/A
to which 3% of TiO2NPs were added and (13.128) to
Where T is tear strength (N/mm), F is the force at the the alginate impregnated with 5% of the nanoparticle.
rapture (N), and A is the initial cross-sectional area Fortunately, the increased mean of hardness remains
(mm2). within the acceptable range for the elastomeric materials
since it is below the scale of 70(2).

The Young’s modulus for the control group was (0.4260

MPa), although adding 2% of TiO2NPs increased the
alginate's stiffness (0.4268 MPa), but this effect was
statistically non-significant. However, increasing the
added concentration to 3% and 5% significantly
increased Young’s modulus of the material compared to
the control group (LSD test), as shown in Table 3.

Tear strength

As observed in Table 4, the tear strength increased by

A B increasing the percentage of added TiO2NPs to the
alginate. The control group value was (0.5205 N/mm),
Figure 2: (A) Tear strength mold, (B) Universal testing while the highest was for the 3% TiO2NPs group
machine. (0.5337 N/mm).

64
Titanium dioxide nanoparticles and dental alginate Sulaimani Dent. J. June 2022

At 5% TiO2NPs to the alginate, the value of tear strength group values. Table.5 shows the post hoc test (multiple
dropped significantly (LSD test) compared to the 3% comparisons-LSD) for all the tested groups.
TiO2NPs group, but still greater than the control and 2%

Table 1: Mean and Standard deviation of Shore A hardness and

Young’s modulus (MPa).
N Shore A hardness Young’s modulus
Mean (SD) Mean MPa (SD)
Control 7 10.485 (0.134) 0.4260 (0.0036)
2 % TiO2NPs 7 10.614 (0.069) 0.4268 (0.0028)
3 % TiO2NPs 7 11.142 (0.139) 0.4452 (0.0041)
5 % TiO2NPs 7 13.128 (0.138) 0.5038 (0.0041)

Table 2: Post hoc tests (Multiple comparisons- LSD) for shore A hardness.

Group Group Mean Difference Sig. (p < 0.05)

2% TiO2NPs 0.12857 0.064 NS

*
Control 3% TiO2NPs 0.65714 0.000 HS
*
5% TiO2NPs 2.64286 0.000 HS
*
3% TiO2NPs 0.52857 0.000 HS
2%TiO2NPs *
5% TiO2NPs 2.51429 0.000 HS
*
3%TiO2NPs 5% TiO2NPs 1.98571 0.000 HS
NS= Non-significant, HS= highly-significant

Table 3: Post hoc tests (Multiple comparisons- LSD) for Young’s modulus.

Group Group Mean Difference Sig. (p < 0.05)

2% TiO2NPs 0.000857 0.672 NS

*
Control 3% TiO2NPs 0.019286 0.000 HS
*
5% TiO2NPs 0.077857 0.000 HS
*
3% TiO2NPs 0.018429 0.000 HS
2% TiO2NPs *
5% TiO2NPs 0.077000 0.000 HS
*
3% TiO2NPs 5% TiO2NPs 0.058571 0.000 HS
NS= Non-significant, HS= highly-significant

Table 4: Mean and Standard deviation of Tear

strength (N/mm).
N Mean N/mm (SD)
Control 7 0.5205 (0.007)
2 % TiO2NPs 7 0.5215 (0.0017)
3 % TiO2NPs 7 0.5337 (0.0011)
5 % TiO2NPs 7 0.5242 (0.0007)

65
Vol 9(1) Abdel-Rahman et al.

Discussion adding 5% TiO2NPs to alginate impression material

decreases the tear strength significantly compared to the
Shore hardness is defined as resistance to indentation. It previous group, the possible reason for this is the
is expressed in terms of a Hardness Number calculated agglomeration of the TiO2NPs within the matrix so that
from an indentation test(17). the polymeric crosslink chains detached or weakened(23).

The elasticity is considered an essential criterion that

should be available in the elastic dental impression
materials, especially when recording the undercut areas, Conclusions
the presence of viscoelastic properties in these materials
allows it possesses some degree of deformation during Within the limitation of this study, adding TiO2NPs
the removal of impression from the undercut areas then improves the tear strength of alginate impression
undergoing elastic recovery(18). material, but the shore hardness and Young's modulus
significantly increased when increasing the
In this study, The Shore A hardness increased concentration of TiO2NPs; this increase is within the
significantly when increasing the addition of TiO2NPs acceptable range.
above 2% to the alginate. From the literature, no
previous studies had been done to evaluate the effect of
adding nanoparticles on the Shore A hardness for
irreversible hydrocolloid impression materials References
(alginate). Still, the results of several studies(19,20) on
some elastic impression materials showed that the
1. Imbery TA, Nehring J, Janus C, Moon PC.
nanoparticles increased the hardness of the material; this
Accuracy and dimensional stability of extended-
may be due to more crosslinking of the polymer since
pour and conventional alginate impression
there is no additives that affect the polymerization of the
materials. J Am Dent Assoc. 2010;141(1):32-9.
alginate. Therefore there is more polymer crosslink
2. Sakaguchi R, Ferracane J, Powers J. Craig’s
chain mobility, and after the modification, by adding
Restorative dental materials. 14th ed. St. Louis
TiO2NPs, these crosslinks become stronger(6,7,21) so that
Elsevier: Missouri; 2019. p 231.
there was a resistance to penetration by the durometer
3. Hamrun N, Rachman SA. Measuring sodium
indenter(20).
alginate content of brown algae species padina sp.
The elastic modulus property is considered an important as the basic matter for making dental impression
factor because it gives an idea of the force that this material (irreversible hydrocolloid impression
material could withstand when the impression is material). J Dentomaxillofac Sci. 2016;1(2):129-
removed from the oral cavity(22). 33.
4. Coleman RM, Hembree JH, Weber FN.
The control group exhibited the maximum elastic Dimensional stability of irreversible hydrocolloid
property compared to the other groups, the increase of impression material. Am J Orthodont.
Young’s modulus was inversely related to the 1979;75(4):438-46.
concentration of the added TiO2NPs. This finding may 5. Mantena SR. Mohd I, Dev KP, Suresh Sajjan MC,
be because inert small-sized TiO2NPs (20nm) were well Ramaraju AV, Bheemalingeswara Rao D.
dispersed in the polymer matrix. Thus, the Disinfection of impression materials: a
intermolecular gaps were occupied by such nano-sized comprehensive review of disinfection methods. Int
particles, causing an alteration in crosslinking density or J Dent Mater. 2019;1(1):7-16.
changing the crosslinks' geometry, which may have led 6. Amalan A, Ginjupalli K, Upadhya N. Evaluation
to decreasing the elasticity(20). of properties of irreversible hydrocolloid
impression materials mixed with disinfectant
Tear strength is the ability of the impression material to liquids. Dent Res J. 2013;10(1):65-73.
resist tear while removed from the oral cavity or during 7. Ginjupalli K, Shaw T, Tellapragada C, Alla R,
the cast removal from the impression; tear strength Gupta L, Perampalli NU. Does the size matter?
depends on the water powder ratio of the used material; Evaluation of effect of incorporation of silver
the higher powder/water ratio shows higher tear strength nanoparticles of varying particle size on the
than a material mixed with a lower powder/water ratio. antimicrobial activity and properties of irreversible
The addition of TiO2NPs up to 3% to alginate increased hydrocolloid impression material. Dent Mater.
the tear strength compared to the control group; this may 2018;34(7):158-65.
be due to the surface energy of this nanoparticle that 8. Abdel-Rahman HK, Al-Sammaraie SAS. Effect of
caused a reinforcement of the crosslinked matrix while adding magnesium oxide nanoparticles on the

66
Titanium dioxide nanoparticles and dental alginate Sulaimani Dent. J. June 2022

antimicrobial activity of a denture soft liner. 16. ASTM D 624-00 (2020). Standard test method for
Polytechnic J. 2020;10(2):132-7. tear strength of conventional vulcanized rubber
9. Nia AF, Ataei M, Zeighami H. A comparative and thermoplastic elastomers.
study on the antimicrobial activity of irreversible 17. Anusavice KJ, Shen C, Rawls HR. Phillips’
hydrocolloid mixed with silver nanoparticles and science of dental materials. 12th ed. St. Louis.
chlorhexidine. Dent Res J (Isfahan). Missouri: Elsevier.2013. p 493-4.
2020;17(2):120-5. 18. King S, See H, Thomas G, Swain M, Determining
10. Jafari A, Fard RMN, Shahabi S, Abbasi F, the complex modulus of alginate irreversible
Shahedin GJ, Bakhtiari R. Optimization of hydrocolloid dental material. Dent Mater,
antimicrobial efficiency of silver nanoparticles 2008;24(11):1545-48.
against three oral microorganisms in irreversible 19. Aziz T, Waters M, Jagger R. Analysis of the
hydrocolloid impressions. Iran J. Microbiol. properties of silicone rubber maxillofacial
2021;13(6):862-70. prosthetic materials. J Dent. 2003;31(1):67-74.
11. Omidkhoda M, Hasanzadeh N, Soleimani F, 20. Abdelrahman HK, Al-Sammaraie SAS. Effect of
Shafaee H. Antimicrobial and physical properties addition of Magnesium Oxide Nanoparticles on
of alginate impression material incorporated with surface hardness and tensile bond strength of
silver nanoparticles. Dent Res J (Isfahan). denture soft liner. Indian J Forensic Med Toxicol.
2019;16(6):372-6. 2020;14(3):2479-85.
12. Sun J, Forster AM, Johnson PM, Eidelman N, 21. Ginjupalli K, Alla RK, Tellapragada C, Gupta L,
Quinn G, Schumacher G, et al. Improving Perampalli NU. Antimicrobial activity and
performance of dental resins by adding titanium properties of irreversible hydrocolloid impression
dioxide nanoparticles. Dent Mater. materials incorporated with silver nanoparticles. J
2011;27(10):972-82. Prosthet Dent. 2016;115(6):722-8.
13. Al-Hawezi SSQ. The effect of addition of titanium 22. Balkenhol M, Haunschild S, Erbe C, Wöstmann B.
dioxide nanofillers on the properties of flowable Influence of prolonged setting time on permanent
composite resin (in vitro study). Ph.D.Thesis. deformation of elastomeric impression materials. J
2021, Hawler Medical University. Iraq. Prosth Dent. 2010;103(5):288-94.
14. ISO 7619-1:2010. Rubber, vulcanized or 23. Ikram FS. The effect of calcium carbonate
thermoplastic-determination of indentation nanofillers on some properties of room
hardness- part 1: durometer method (Shore temperature vulcanized maxillofacial silicone
hardness). elastomers. Ph.D. Thesis (2013), Hawler Medical
15. Gent AN, On the relation between indentation University. Iraq.
hardness and young’s modulus, Rubber Chem
Technol. 1958;31(4):896-906.

67
Vol 9(1) Mahdi et al.

Original Article

Preference for Using Posts to Restore

Endodontically Treated Teeth among Dentists in
College of Dentistry/ Hawler Medical University
Sohela F. Mahdi 1, Niaz H. Hamasaeed 1, Hidayat A. khudhur 1*, Hozan F. Tawfiq 2

Abstract
Objective: Traditional restorative approaches are being modified as newer materials become available and patient preferences shift.
The purpose of the study was to see if dentists' preferences for using posts and other materials associated to post used to restore
endodontically treated teeth are influenced by practical experience, whether measured by the length of clinical practice time or level
of specialty.

Methods: A cross-sectional study was conducted with dentists (n = 108) working at Hawler Medical University/College of Dentistry
utilizing a questionnaire. Data on sociodemographics, clinical experience, postgraduate training, and post-endodontic restoration
characteristics (posts/types of cement, rubber dam application) were obtained. The samples only included general and specialist
dentists. A descriptive analysis was performed on the data. The Chi-square test and Fisher's exact test investigated the relationships.

Results: The most chosen materials were metal posts (53.7 %) and resin cement (50 %). There was a statistically significant association
between clinical practice duration and post-use type (P = 0.017). In addition, there was a highly significant relationship (P = 0.001)
between clinical practice time, level of specialty, and the use of rubber dams.

Conclusions: Dentists favored metal posts for post endodontic restorations, while resin-based cement was the preferred luting cement
for the posts' cementation. Additional training and more clinical practice time were factors in several dental post-selection decisions.

Keywords: Metal post, Fiber post, Rubber dam, Endodontic restoration.

Submitted: April 30, 2022, Accepted: May 30, 2022, Published: June 1, 2022.

Cite this article as: Mahdi SF, Hamasaeed NH, Khudhur HA, Tawfiq HF. Preference for Using Posts to Restore
Endodontically Treated Teeth among Dentists in College of Dentistry/ Hawler Medical University. Sulaimani Dent J.
2022;9(1):68-76.

DOI: https://doi.org/10.17656/sdj.10151

1. Conservative Department, College of Dentistry, Hawler Medical University, Erbil, Iraq.

2. Pedodontics, Orthodontics and Preventive Dentistry, College of Dentistry, Hawler Medical University, Erbil, Iraq.

* Corresponding author: [email protected].

Published by College of Dentistry, University of Sulaimani

68
Using Posts to Restore Endodontically Treated Teeth Sulaimani Dent. J. June 2022

Introduction and techniques and their level of understanding of how

to use these materials correctly so that their experience
Endodontic treatment is used extensively on teeth with can be used to teach undergraduate dental students and
severe caries, multiple restorations, or fractures. The presented in dental education courses(15).
management of pulp conditions is known as endodontic
treatment. It is generally intended to maintain or restore Several studies have been published concerning the
the health of the dental pulp and periradicular tissues by knowledge and practices of post-endodontic restoration
filling or blocking all root canals and forming a fluid- abroad. Though, the information given is not strong
tight seal on the apical foramen of the tooth to prevent enough to apply it to a proper treatment procedure for
secondary infection from the mouth cavity or the dentists(16). Such data exist for Brazil(15), Sweden(16),
periradicular tissue leakage into the root canal system(1). Saudia Arabia(17), Palestine(18), India(19), and
When compared to unrestored vital teeth, endodontic Switzerland(20). However, there is a lack of such studies
treated teeth experience tooth structure loss and physical in Erbil, Iraq. Questionnaires are valuable for
alterations, leading to greater fracture risk(2). To restore understanding dentists' knowledge and treatment
endodontically treated teeth, various materials and methods in root canal-treated teeth. The objective of this
procedures are currently available. Past restorative research was to see if a dentist's choice for using
practices are updated as newer materials emerge and posts/materials relevant to posts used to restore
patient preferences change(3). As a restorative material, endodontic-treated teeth is influenced by clinical
amalgam and composite resin are commonly used in experience, whether concerning the length of practice
core foundations(4). A post is routinely put into the root time and level of specialization among dentists in Erbil,
canal system to retain the core in a badly Iraq.
traumatized tooth. The goal of post-placement is to keep
the core foundation intact. Its purpose is not
to strengthen a tooth with a root canal(5).
Subjects and methods
For restoring endodontic-treated teeth, there are a
A cross-sectional survey of dentists registered at the
variety of post and cement options. There is a wide range
Hawler Medical University/College of Dentistry was
of techniques that use various types of metal posts and
conducted in Erbil, Iraq. A total of 108 dentists were
cores and the newer fiber-reinforced polymer post(6-9).
invited to take part in the research. A self-applied closed
Physical properties close to dentin, such as modulus of
survey was designed to collect data. The following
elasticity, compressive strength, and coefficient of
details were gathered: Clinical experience (years
thermal expansion, are ideal for post material.
following graduation, classified as 0-4 years, 5–9 years,
Furthermore, posts should not corrode, bond easily, and
and ten years), level of specialization (BDS, MSc., or
bond effectively to dentin within the root. The bond
Ph.D. degree), and divided into general dentist and
should be formed with the proper cement so that the
specialist. The following data were obtained on the
entire post and core assembly appear like the original
frequency of root canals treated per week, the need for
tooth(10). Several factors, including factors related to
post-placement in every endodontic treated tooth, post-
posts and factors associated with teeth, have been
insertion frequency, and post usage to restore root canal
observed to influence post-selection and restoration
treated teeth. The most commonly utilized post (metal
durability. Material, esthetics, design, and cementing
or fiber post), the cement used to lute these posts (glass
procedures are all factors to consider regarding post
ionomer cement, resin cement, or zinc phosphate
selection. However, surviving coronal tooth structure,
cement), and the application of a rubber dam (yes or no).
ferrule existence, and the root length are the
There was no information in the data that could be used
characteristics associated with teeth(11-14).
to identify the dentist. Each dentist who was asked to
Additionally, characteristics associated with dentists can participate in the study at the College of Dentistry
influence decision-making, particularly in terms of received the questionnaire in person. The significance of
clinical experience and postgraduate training. A dentist's the study and its details were explained. Only dentists
skills can be improved with more clinical experience. with a Bachelor's or Postgraduate degree were included
However, dentists must be trained and have up-to-date in the study. The undergraduates were not included in
expertise when new materials are introduced. This is so the research.
that dentists can apply the new materials properly. It's
crucial to understand dentists' preferences for materials

69
Vol 9(1) Mahdi et al.

Statistical analysis Table 5 represents no significant relationship between

the level of specialization and type of post-use (p >
The descriptive analyses were calculated as absolute 0.05). However, the metal post-use among general
frequencies and good percentages. The Chi-square test dentists 30 (55.6%) was slightly higher than the metal
and Fisher's exact test were used to assess the existing post-use among specialists 28 (51.9%), and the fiber
relationship between postgraduate education, post-use among the specialists 26(48.1%) was slightly
professional experience, and dentist preferences (type of higher than the fiber post-use among general dentists
post/cement use and rubber dam application). The 24(44.4%). Table 5 also shows no significant
significance level was adjusted at (p = 0.05). SPSS association between the level of specialization and the
software version 23 was used for the analysis. type of luting cement (p > 0.05). However, the use of
glass ionomer among the general dentists 24(44.4%)
was higher than that of specialists. The use of resin
cement among specialists 32(59.3%) was higher than
Results
that of general dentists. It is revealed in Table 5 that
The mean ± standard deviation (32.1389 ± 6.91937) of there was a highly significant association between level
the dentists' ages was calculated using descriptive of specialization and rubber dam use where it is evident
statistics, as seen in Table 1. that the use of rubber dam among specialists 26 (48.1%)
was significantly higher than the use of the rubber dam
Table 1 shows that most of the dentists who answered among general dentists 7 (13%), (p=0.001).
had a practical clinical experience of 0-4 years 52
(48.1%). The respondents included 54 (50%) general
dentists and 54 (50%) specialist, dentists. It is revealed
in Table 1 that the number of root canal treatments Discussion
carried out per week by the dentists was mostly around
In the last decade, the frequency of endodontic therapies
5-9 (51.9%). The results in Table 1 show that 86 (79.6%)
has continuously risen, with relatively predictable
of general dentists and specialists both widely thought
outcomes. As a result, tooth restoration following root
that for every root canal-treated tooth, a post was
canal therapy is an important aspect of dentistry's
unnecessary. However, this study showed that 79
restorative practice. However, although numerous novel
(73.1%) dentists claimed that they sometimes place a
restorative materials have been available in recent years,
post to restore an endodontic-treated tooth. In Table 1, it
several basic aspects of restoring endodontic-treated
is evident that 58 (53.7%) of the surveyed dentists chose
teeth remain the same. Therefore, full knowledge of the
metal post as the preferred technique for restoring
materials is required to make the best choice(10).
endodontic treated teeth, while 50 (46.3%) of the
dentists chose fiber post as the preferred technique for The current study gathered data from general and
restoring endodontic treated teeth. Regarding the type of specialized dentists at Erbil's Hawler Medical
luting cement, Table 1 also shows that 54 (50%) of the University/College of Dentistry on their preferences for
dentists selected resin cement as the preferred luting utilizing posts and features associated with posts for
cement. 75 (69.4%) dentists who participated in this restoring root canal-treated teeth. In the current
study reported not using the rubber dam. research, most dentists (general and specialized dentists)
believed that every root canal-treated tooth does not
There was a statistically significant association between
need a post (79.6%). In vivo and in vitro research show
clinical practice time and type of post-use where it is
that the strength of an endodontic-treated tooth is
evident in Table 2 that the use of fiber post among
directly proportional to the residual tooth structure but
dentists who had clinical experience 5-9 years (72.7%)
that the use of a post does not reinforce such a tooth. As
was significantly higher than the use of fiber posts
a result, a post may not be required in all endodontically
among the dentists who had clinical experience 0-4
treated teeth(16,18.19). Accordingly, placing a post in an
years (p = 0.017). Table 3 shows no significant
endodontic-treated tooth should be made individually,
association between clinical practice time and type of
evaluating the benefits and drawbacks before
luting cement use (p > 0.05). Table 4 reveals that there
proceeding(16,18.19).
was a highly significant association between clinical
practice time and rubber dam application where it is According to the survey, most general and specialized
evident that the use of rubber dam among dentists who dentists prefer metal posts (53.7%) to restore an
have had practical clinical experience ≥10 years 20 (58.8 endodontic-treated tooth. According to the literature,
%) was significantly higher than the use of rubber dam metal posts and glass fiber posts have dissimilar
among the dentists who have clinical experience 0-4 mechanical qualities. In comparison to dentin, metal
years 5 (9.6%) and 5-9 years 8 (36.4%), (p = 0.001). posts exhibit a high elastic modulus. As a result,

70
Using Posts to Restore Endodontically Treated Teeth Sulaimani Dent. J. June 2022

Table 1: Descriptive analysis, Frequency of clinical practice time and level of specialization, No. of RCT per week,
necessity & frequency of post-placement, and Frequency of type of post-use and variables related to post.
Frequency of type of
Frequency of clinical No. of RCT per week,
post-use and variables
Mean age of the participants practice time and level necessity & frequency of
related to post
of specialization post-placement
S. Clinical No. of
Mean Median Type of
Deviation practice No. % RCT per No. % No. %
post-use
32.1389 6.91937 30.0000 time week
Metal
0-4 years 52 48.1 0-4 28 25.9 58 53.7
Post
5-9 years 22 20.4 5-9 56 51.9 Fiber Post 50 46.3
≥10
34 31.5 ≥10 24 22.2 Total 108 100.0
years
Total 108 100.0 Total 108 100.0
The necessity of post-use
Level of Specialization Type of luting cement
for every RCT
use
General Glass
54 50.0 Yes 22 20.4 42 38.9
Dentist Ionomer
Resin
Specialist 54 50.0 No 86 79.6 54 50.0
Cement
Zinc
Total 108 100.0 Total 108 100.0 12 11.1
Phosphate
Frequency of post Total 108 100.0
placement Rubber dam use
Always 22 20.4 Yes 33 30.6
Sometimes 79 73.1 No 75 69.4
Rarely 7 6.5 Total 108 100.0
Total 108 100.0

Table 2: Association between the length of clinical practice time and type of post-use.

Type of post-use
X2, df, p-
Metal post Fiber post Total
Clinical practice time value
No. % No. % No. %
0-4 years 30 57.7% 22 42.3% 52 100% X2= 8.170
5-9 years 6 27.3% 16 72.7% 22 100% df= 2
≥10 years 22 64.7% 12 35.3% 34 100% p= 0.017
Total 58 53.7% 50 46.3% 108 100%

Table 3: Association between the length of clinical practice time and type of luting cement.

Type of luting cement

Glass ionomer Resin cement Zinc phosphate Total X2, df, p-value
Clinical practice time
No. % No. % No. % No. %
0-4 years 22 42.3% 20 38.5% 10 19.2% 52 100%
X2= 9.404
5-9 years 8 36.4% 14 63.6% 0 0.0% 22 100% df= 4
≥10 years 12 35.3% 20 58.8% 2 5.9% 34 100% p > 0.05, NS
Total 42 38.9% 54 50.0% 12 11.1% 108 100%

71
Vol 9(1) Mahdi et al.

Table 4: Association between the length of clinical practice time and rubber dam use.

Rubber dam use

Clinical practice time Yes No Total X2, df, p-value
No. % No. % No. % X2= 23.899
0-4 years 5 9.6% 47 90.4% 52 100% df= 2
5-9 years 8 36.4% 14 63.6% 22 100% p=.001
≥10 years 20 58.8% 14 41.2% 34 100%

Total 33 30.6% 75 69.4% 108 100%

Table 5: Association between the level of specialization, type of post, type of luting cement, and rubber dam use.
Association between the level of specialization and type of post-use
Metal post Fiber post Total
Level of specialization X2, df, p-value
No. % No. % No. %
General Dentist 30 55.6% 24 44.4% 54 100% X2= .149
Specialist 28 51.9% 26 48.1% 54 100% df= 1
Total 58 53.7% 50 46.3% 108 100% p > 0.05, NS
Association between the level of specialization and type of luting cement
Glass Zinc
Resin cement Total
ionomer phosphate
Level of specialization X2, df, p-value
No. % No. % No. % No. %
General dentist 24 44.4 22 40.7 8 14.8 54 100% X2= 4.042
Specialist 18 33.3 32 59.3 4 7.4 54 100% df= 2
p > 0.05, NS
Total 42 38.9 54 50.0 12 11.1 108 100%
Association between the level of specialization and rubber dam use
Yes No Total
Level of specialization X2, df, P-value
No. % No. % No. %
General dentist 7 13.0% 47 87.0% 54 100% X2= 15.753
Specialist 26 48.1% 28 51.9% 54 100% df= 1
Total 33 30.6% 75 69.4% 108 100% p=.001

enhancing the risk of root fracture and failure, whereas treated. When determining the type of post to utilize in
fiber posts possess mechanical properties likewise to restoring ETT, numerous aspects should be considered,
those of dentin, minimizing the chance of failure and including intact coronal structure, ferrule availability,
subsequent failures relative to their utilization. Post and post material(24). Indeed in root endodontically teeth,
debonding is the most common cause of fiber post maintaining at least one wall ensures greater tooth
failures(21). longevity(28).

This study's findings matched those of research In this study, most dentists favored resin cement over
conducted in Saudi Arabia(15), Palestine(17), lute posts (50 %). In 2015, Sarkis-Onofre et al.(15), and
Switzerland(18), and Brazil(20) on post-endodontic in 2013, Kon et al.(20) showed similar findings to the
restorations, where metal posts were more commonly present study where the preferred luting cement was also
used. The subject of the best post material has been hotly seen as resin cement. In contrast, Akbar(17) sought that
debated in the literature for years(22-25). According to the preferred choice of luting cement among dentists
recent systematic reviews on prospective clinical was glass ionomer cement.
research, glass-fiber posts have improved survival rates
(26,27)
. Because of its higher advantages, lower risk of The long-term clinical performance of the various
tooth damage, and likeness to dentin, it's better to raise cement used for post cementation is hardly
awareness and shift dentists' attitudes about employing understood(17); Zinc phosphate has the longest track
fiber posts more often than metal posts(27). There is, record of success. It is well-suited with zinc oxide
however, no evidence to support the "optimal eugenol (ZOE), which is incorporated in most root canal
technique" to restore a tooth that has been root canal sealers and has a long working duration. Furthermore,

72
Using Posts to Restore Endodontically Treated Teeth Sulaimani Dent. J. June 2022

when an endodontic failure occurs, a metal post same time, those with more practical clinical experience
cemented in the root canals with zinc phosphate is easier (time after graduation) tend to utilize fiber posts, resin
to remove and has a reduced risk of root fracture than a cement, and rubber dam more than the general dental
metal post cemented in the root canal space with resin- practitioners. There was a link between clinical practice
based composite cement(10). However, our findings time, post-use type, and rubber dam application. Those
contradicted the literature because zinc phosphate was who graduated a while ago used the rubber dam more
the least popular luting cement among the respondents frequently to restore a root canal-treated tooth. These
(11.1 %); this is most likely due to dentists' lack of findings may be because those who have graduated a
understanding of the benefits of utilizing zinc phosphate while ago may have had some kind of post-graduation
for post cementation(10). training or attended continuing education courses,
suggesting that they are more likely to be exposed to
When utilizing glass ionomer cement, microleakage is a new techniques(35).
big issue. Compared to zinc phosphate and dentin, these
types of cement have a substantially lower modulus of When it comes to postgraduate education, the evidence
elasticity. The capacity of resin-based composite to suggests that dental specialists are better informed with
bond to dentin, on the other hand, is gaining popularity. the literature and attend meetings more frequently,
Some authors have worried about the thermocycling of directly influencing their clinical decisions and, as a
resin cement and microleakage(29,30). However, others result, their practices. These dentists are better equipped
have found that using resin cement instead of another to incorporate new technology into their clinical
cement increases post retention, reduces microleakage, practice(35-37). However, there was no significant
and increases tooth fracture resistance(31-33). relationship between the level of expertise and the type
of post used in this investigation. This study revealed
Some dentists claimed to utilize resin cement in that postgraduate dentists are more likely to use metal
conjunction with metal posts. However, the use of resin supports to restore root canal-treated teeth. However, an
to bond a metal post raises the possibility that the post almost equal number of fiber posts to metal posts were
will be difficult to remove in the event of endodontic registered. A similar finding was seen in a study carried
failure. A well-bonded resin cemented metal post is out in Saudia Arabia(17). Previous research found that
difficult and time-consuming to remove, and the specialist dentists selected fiber posts as their first option
potential of a root fracture remains a major challenge. for restoring endodontic-treated teeth, while non-
However, when fiber-reinforced posts are used in specialists preferred metal posts(15). The results or
conjunction with resin cement, this difficulty is avoided findings of the present study may be due to the
because fiber-reinforced posts can be removed. As a geographical region and the cost of fiber posts(38). Many
result, more people should be urged to utilize fiber posts dentists, whether specialists or non-specialists, may
with resin cement(33). know the importance of using a fiber post but refuse to
use it because it is more expensive than the metal post.
The usage of rubber dams for isolation is a significant
Also, some dentists claim that they face more problems
concern. According to Goldfein et al.(34), using a rubber
when using fiber posts because of the chance of
dam during prefabricated post insertion increases the
debonding(21). However, they may find the metal post
success rate substantially of endodontic-treated teeth.
preferable because if the metal post is tightly screwed
Furthermore, they also said applying a rubber dam for
within the root canal and is cemented well, they won't
nonsurgical root canal therapy is already a recognized
suffer from replacing the posts(33).
standard of care. This finding is significant because
many dentists in the study didn’t use rubber dams to Regarding the cement used to lute the posts, there was
cement posts; this could be because dentists were not no significant association between the level of
taught how to apply and use the rubber dam during specialization and the type of luting cement used in this
clinical practice as undergraduates in dentistry study. The general dentists used the glass ionomer, and
school(34). This study's findings are comparable to those the resin cement was used mostly by the specialists. In
of a study conducted in Brazil(15), which found that non- contrast, Akbar(17) found that practically all of the
use of rubber dams dominated. participants, both general and specialized dentists,
applied glass ionomer to lute the post.
Metal posts, glass ionomer, and non-use of rubber dam
were used more frequently by dentists with less practical There was a highly significant association between the
clinical experience (time since graduation) (0-4 years) level of specialization and rubber dam use in this study.
than dentists with more time since graduation. At the

73
Vol 9(1) Mahdi et al.

In contrast to specialized dentists, more than half of post-related materials like luting cement and rubber
general dentists did not use a rubber dam to isolate the dam.
operative field during a post insertion to restore a root
canal-treated tooth; this could be because, as an
undergraduate in Hawler Medical University/ College of
Dentistry, the students were not taught to apply and use References
the rubber dam in clinical situations. Specialists with
1. Ratnakar P, Bhosgi R, Metta KK, Aggarwal K,
some postgraduate education, on the other hand, were
Vinuta S, Singh N. Survey on restoration of
taught the importance of utilizing a rubber dam and were
endodontic treated anterior teeth: A questionnaire
compelled to use one for any restoration of an
based study. J Int Oral Health. 2014;6(6):41-5.
endodontically treated tooth during their training(34).
2. Chadwick J, Gonzales A, McLean C, Naghavi A,
The findings of this study are consistent with those of Rosati S, Yau S. Restoration of endodontically
questionnaire-based studies undertaken in another treated teeth: An evidence based literature review.
country(35). According to a study, applying a rubber dam Community Dent. 2008;22(1):1-21.
during prefabricated post-placement considerably 3. Bateman G, Ricketts DNJ, Saunders WP. Fiber-
enhances the chances of teeth with endodontic based post systems: a review. Br Dent J.
management. Furthermore, they said that placing a 2003;195(37):43-8.
rubber dam for nonsurgical root canal therapy is already 4. Nagasiri R, Chitmongkolsuk S. Long-term
a recognized standard of care(34). According to Lynch survival of endodontically treated molars without
and McConnell(39), specialists tend to be more subjected crown coverage: a retrospective cohort study. J
to rubber dam insertion throughout their specialty. Also, Prosthet Dent. 2005; 93(2):164-70.
specialists are more likely to do more difficult 5. Schwartz RS, Robbins JW. Post placement and
treatments requiring a more qualified sensitive restoration of endodontically treated teeth: a
technique(36). literature review. J Endod. 2004;30(5):289-301.
6. Fokkinga WA, Kreulen CM, Bronkhorst EM,
Because it relied on a self-administered applied closed Creugers NH. Up to 17-year controlled clinical
questionnaire, this study has several limitations. The study on post-and-cores and covering crowns. J
downside was that the respondents did not always Dent. 2007; 35(10):778-86.
answer all of the questionnaire's questions honestly, and 7. Piovesan EM, Demarco FF, Cenci MS, Pereira-
open-ended questions were not permitted(15). Also Cenci T. Survival rates of endodontically treated
another limitation may be that there was more chance of teeth restored with fiber-reinforced custom posts
errors due to the small sample size. and cores: a 97-month study. Int J Prosthodont.
2007;20(7):633-9.
8. Naumann M, Koelpin M, Beuer F, Meyer-Lueckel
H. 10-year survival evaluation for glass-fiber-
Conclusions supported postendodontic restoration: a
prospective observational clinical study. J Endod.
Teeth with substantial coronal damage after root canal
2012;38(4):432-5.
therapy may require intracanal posts for retention. The
9. Sarkis-Onofre R, Jacinto RC, Boscato N, Cenci
best way to restore endodontically treated teeth is
MS, Pereira-Cenci T. Cast metal vs. glass fibre
unknown. Various aspects such as the type of coronal
posts: a randomized controlled trial with up to 3
restoration, the extent of residual coronal structure, the
years of follow up. J Dent. 2014;42(5):582-7.
type of luting agent, and dentist-related factors should
10. Cheung W. A review of the management of
all be considered into account. Correlating practice,
endodontically treated teeth post, core and the final
knowledge, and scientific interpretation have been
restoration. J Am Dent Assoc. 2005;136(5):611-9.
identified as the most effective way of resolving
11. Goracci C, Ferrari M. Current perspectives on post
selection issues, and it may be adopted quickly and
systems: a literature review. Aust Dent J.
effectively in clinical practice. Overall, the study's
2011;56(1):77-83.
findings revealed that most dentists do not believe that
12. Faria-e-Silva AL, Mendonça AA, Garcez RM,
every root canal-treated tooth requires a post. Metal
Oliveira AS, Moreira AG, Moraes RR. Adhesion
posts were the preferred type of post used for post
strategy and early bond strengths of glass-fiber
endodontic restorations, and the resin-based cement
posts luted into root canals. Braz Oral Res.
dominated as the preferred luting cement for
2012;26(5):485-7.
cementation of the posts. Continuing education and
13. Faria-e-Silva AL, Menezes MS, Silva FP, Reis
more clinical practice experience influenced some of the
GR, Moraes RR. Intra-radicular dentin treatments
choices about which dental posts to select and other

74
Using Posts to Restore Endodontically Treated Teeth Sulaimani Dent. J. June 2022

and retention of fiber posts with self-adhesive resin 25. Heydecke G, Peters MC. The restoration of
cements. Braz Oral Res. 2013;27(1):14-9. endodontically treated, single-rooted teeth with
14. Santos Filho PC, Soares PV, Reis BR, Veríssimo cast or direct posts and cores: a systematic review.
C, Soares CJ. Effects of threaded post placement J Prosthet Dent. 2002;87(4):380-6.
on strain and stress distribution of endodontically 26. Cagidiaco MC, Goracci C, Garcia-Godoy F,
treated teeth. Braz Oral Res. 2013;27(4):305-10. Ferrari M. Clinical studies of fiber posts: a
15. Sarkis-Onofre R, Cenci TP, Opdam NJ, Demarco literature review. Int J Prosthodont.
FF. Preference for using posts to restore 2008;21(4):328-36.
endodontically treated teeth: findings from a 27. Theodosopoulou JN, Chochlidakis KM. A
survey with dentists. Braz Oral Res. 2015;29(1):1- systematic review of dowel (post) and core
6. materials and systems. J Prosthodont.
16. Eckerbom M, Magnusson T. Restoring 2009;18(6):464-72.
endodontically treated teeth: a survey of current 28. Naumann M, Kiessling S, Seemann R. Treatment
opinions among board-certified prosthodontists concepts for restoration of endodontically treated
and general dental practioners in Sweden. Int J teeth: A nationwide survey of dentists in Germany.
Prosthodont. 2001;14(3):245-9. J Prosthet Dent. 2006;96(5):332-8.
17. Akbar I. Knowledge, Attitudes and practice of 29. Scianamblo M. Restorations and endodontic
restoring endodontically treated teeth by dentists in success: the correlationship of post-endodontic
north of Saudi Arabia. Int J Health Sci (Qassim). restorations and endodontic success: rationale and
2015;9(1):41-9. materials. Endodontic Practice. 2002, p29-39.
18. Rabi TH. Attitudes of palestinian dentists toward 30. Tjan AH, Grant BE, Dunn JR. Microleakage of
restoration of endodontically treated teeth. Int J composite resin cores treated with various dentin
Prosthodont Restor Dent. 2015;5(2):44-50. bonding systems. J Prosthet Dent. 1991;66(1):24-
19. Kavlekar AA, Aras MA, Chitre V. Treatment 9.
concepts for restoration of endodontically treated 31. Chan FW, Harcourt JK, Brockhurst PJ. The effect
teeth: a survey among general practitioners, of post adaptation in the root canal on retention of
prosthodontists, and endodontists in India. J posts cemented with various cements. Aust Dent J.
Contemp Dent. 2016;6(2):129-36. 1993;38(1):39-45.
20. Kon M, Zitzmann NU, Weiger R, Krastl G. 32. Nissan J, Dmitry Y, Assif D. The use of reinforced
Postendodontic restoration: A survey Among composite resin cement as compensation for
Dentists in Switzerland. Schweiz Monatsschr reduced post length. J Prosthet Dent.
Zahnmed. 2013;123(12):1076-82. 2001;86(3):304-8.
21. Zarone F, Sorrentino R, Apicella D, Valentino B, 33. Mezzomo E, Massa F, Libera SD. Fracture
Ferrari M, Aversa R, et al. Evaluation of the resistance of teeth restored with two different post-
biomechanical behavior of maxillary central and-core designs cemented with two different
incisors restored by means of endocrowns cements: an in vitro study, Part I. Quintessence Int.
compared to a natural tooth: a 3D static linear finite 2003;34(4):301-6.
elements analysis. Dent Mate. 2006;22(11):1035- 34. Goldfein J, Speirs C, Matthew F, Amato R. Rubber
44. dam use during post placement influences the
22. Peroz I, Blankenstein F, Lange KP, Naumann M. success of root canal–treated teeth. J Endod.
Restoring endodontically treated teeth with posts 2013;39(12):1481-4.
and cores--a review. Quintessence Int. 35. Nascimento GG, Correa MB, Opdam N, Demarco
2005;36(9):737-46. FF. Do clinical experience time and postgraduate
23. Dietschi D, Duc O, Krejci I, Sadan A. training influence the choice of materials for
Biomechanical considerations for the restoration posterior restorations? Results of a survey with
of endodontically treated teeth: a systematic Brazilian general dentists. Braz Dent J.
review of the literature – part i. composition and 2013;24(6):642-6.
micro- and macrostructure alterations. 36. Brunthaler A, König F, Lucas T, Sperr W, Schedle
Quintessence Int. 2007;38:733-43. A. Longevity of direct resin composite restorations
24. Fernandes AS, Shetty S, Coutinho I. Factors in posterior teeth. Clin Oral Investig.
determining post selection: a literature review. J 2003;7(2):63-70.
Prosthet Dent. 2003;90(6):556-62. 37. Burke FJ, Lucarotti PS, Holder R. Outcome of
direct restorations placed within the general dental

75
Vol 9(1) Mahdi et al.

services in England and Wales (Part 4): influence

of time and place. J Dent. 2005;33(10):837-47.
38. Demarco FF, Corrêa MB, Cenci MS, Moraes RR,
Opdam NJ. Longevity of posterior composite
restorations: not only a matter of materials. Dent
Mater. 2012;28(1):87-101.
39. Lynch CD, McConnell RJ, Wilson NH. Teaching
the placement of posterior resin-based composite
restorations in U.S. dental schools. J Am Dent
Assoc. 2006;137(5):619-25.

76