0% found this document useful (0 votes)
71 views14 pages

CNS-Targeted T Cells for Brain Therapy

Uploaded by

jxiangcn
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
71 views14 pages

CNS-Targeted T Cells for Brain Therapy

Uploaded by

jxiangcn
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

RES EARCH

◥ RESULTS: We created a set of brain-sensing


RESEARCH ARTICLE SUMMARY T cells programmed to locally deliver ther-
apeutic payloads customized for cancer or
CELL ENGINEERING neuroinflammation. First, we identified a set of
CNS-specific extracellular ligands using publicly
Programming tissue-sensing T cells available expression data to establish potential
brain “GPS” markers. We identified proteins such
that deliver therapies to the brain as brevican (BCAN), which are components of
the brain’s highly unique extracellular matrix
Milos S. Simic†, Payal B. Watchmaker†, Sasha Gupta, Yuan Wang, Sharon A. Sagan, Jason Duecker, and might be exploited for tissue-specific recog-
Chanelle Shepherd, David Diebold, Psalm Pineo-Cavanaugh, Jeffrey Haegelin, Robert Zhu, Ben Ng, nition. We screened for antibodies against these
Wei Yu, Yurie Tonai, Lia Cardarelli, Nishith R. Reddy, Sachdev S. Sidhu, Olga Troyanskaya, CNS-specific antigens and used them to build
Stephen L. Hauser, Michael R. Wilson, Scott S. Zamvil*, Hideho Okada*, Wendell A. Lim* CNS-activated synthetic Notch (synNotch) re-
ceptors, engineered receptors that sense an
extracellular antigen and respond by inducing
INTRODUCTION: Treatment of central nervous ideal delivery vehicles for the CNS. In princi- a transcriptional response.
system (CNS) disorders such as brain tumors, ple, if we program cells to selectively and auto- To demonstrate the therapeutic potential of
neuroinflammation, and neurodegeneration nomously deliver therapeutic payloads to the this approach, we used this platform to locally

Downloaded from [Link] at Washington University on December 18, 2024


remains challenging because it is difficult to brain, then we could reduce systemic off-target induce a set of genetically encoded payloads
effectively deliver molecular therapeutics to toxicity and increase efficacy. We hypothesized directed toward different CNS diseases. Brain-
the brain. Moreover, it is difficult to restrict the that it might be possible to engineer immune sensing T cells that induced CAR expression
action of these therapeutics to the brain to avoid cells to act only in a tissue-specific manner. One were able to treat primary and secondary brain
peripheral or systemic toxicities. way to harness T cells to deliver payloads se- cancers, including mouse models of glioblas-
lectively to the brain would be to engineer them toma and breast cancer metastases, without
RATIONALE: Immune cells have evolved to in- to recognize normal (nondisease) CNS-specific off-target attack of tissues outside of the brain.
filtrate diverse tissues, integrate information antigens and to use this anatomical cue to lo- Conversely, CNS-induced expression of the
about their surroundings, and reshape tissue cally induce the production of a therapeutic immunosuppressive cytokine interleukin-10
ecosystems. T cells, for example, can cross the agent. This cell-based CNS-specific delivery (IL-10) ameliorated neuroinflammation in ex-
blood–brain barrier under healthy and patho- system could serve as a general platform for perimental autoimmune encephalomyelitis, a
genic conditions. These properties make them treating diverse CNS diseases. mouse model of multiple sclerosis.

A CNS-sensing T cell B Brain-priming CONCLUSION: This tissue-targeted cell induc-


tion strategy provides two levels of specificity.
First, the cell shows anatomically restricted spe-
Payload induction

CAR cificity, as cells are only induced in the CNS, and


synNotch Treat brain tumor Spleen second, the payload (e.g., CAR, cytokine, anti-
body) has its own intrinsic molecular targeting
Payload IL-10 specificity. This nested, multiscale targeting
Suppress
neuroinflammation Brain
strategy mimics the principles of natural bi-
ological specificity, avoiding potential unwanted
CNS-specific antigens CD3
systemic cross-reactions of the molecular pay-
load while focusing its actions more effectively
C Glioblastoma treatment D Brain-specific action on the target tissue. These results suggest that
9 brain-sensing cells could be used as a general
Tumor size (p/s/cm2/sr)
Tumor size (p/s/cm2/sr)

10 9 10 Flank
Control Brain 8 platform to treat a broader set of CNS diseases,
10 8 10
T cells implanted including brain tumors, brain metastases, neuro-
10 7 tumor 10
7

10 6
inflammation, and neurodegeneration. Although
6
10 5 CNS-primed 10 we focused here on targeting the CNS, this con-
5
10 4 CAR circuit Flank 10 cept could be applied to a broader set of tissues.
BRAIN
10 3 implanted 10
4 Tissue-targeted therapeutic cells provide an
0 20 40 60 80 tumor 10 20 30 40 approach to integrating endogenous and dis-
Days post tumor inoculation i.v. inject T cells Days post tumor inoculation ease signals to generate therapies that are more

Programming tissue-sensing T cells to deliver therapeutics to the brain. (A) We designed T cells that can
specific and effective.

recognize normal endogenous CNS-specific antigens using a synNotch receptor to induce the production of
therapeutic payloads specifically in the brain. For example, induction of a chimeric antigen receptor (CAR) could
The list of author affiliations is available in the full article online.
be used to target brain tumors, or induction of an anti-inflammatory cytokine such as IL-10 could be used to
*Corresponding author. Email: zamvil@[Link]
suppress neuroinflammation. This CNS-specific delivery system could be a general platform for treating diverse (S.S.Z.); [Link]@[Link] (H.O.); [Link]@[Link]
CNS diseases without the risk of systemic toxicity. (B) When injected in a mouse, CNS-sensing T cells specifically (W.A.L.)
†These authors contributed equally to this work.
expressed the synNotch-induced payload in the brain, but not in the periphery (spleen). (C) In a glioblastoma
Cite this article as M. S. Simic et al., Science 386, eadl4237
mouse model, CNS-sensing T cells equipped to express an anti–ephrin type A receptor 2/IL-13 receptor a2 (2024). DOI: 10.1126/science.adl4237
(EphA2/IL13Ra2) CAR efficiently and durably cleared the brain tumors. (D) In a two-tumor model, the CNS-
sensing T cells only cleared the brain-implanted tumor (solid red line), but not a flank-implanted tumor expressing READ THE FULL ARTICLE AT
the identical CAR target antigens (dotted pink line). Therefore, the T cells are selectively primed only in the brain. [Link]

Simic et al., Science 386, 1109 (2024) 6 December 2024 1 of 1


RES EARCH

◥ (EAE), a mouse model of multiple sclerosis


RESEARCH ARTICLE (MS). This tissue-targeted cell strategy pro-
vides dual-level targeting specificity: Produc-
CELL ENGINEERING tion of the therapeutic payload is anatomically
restricted only to the tissue of interest (here,
Programming tissue-sensing T cells the CNS), and the payload itself also has its
own intrinsic molecular targeting specificity
that deliver therapies to the brain within the target tissue. Such a local delivery
strategy thereby avoids potential toxic sys-
Milos S. Simic1†, Payal B. Watchmaker2†, Sasha Gupta3, Yuan Wang4,5, Sharon A. Sagan3, temic cross-reactions of the molecular pay-
Jason Duecker1, Chanelle Shepherd1, David Diebold2, Psalm Pineo-Cavanaugh2, Jeffrey Haegelin2, load in other nondisease tissues.
Robert Zhu1, Ben Ng1, Wei Yu1, Yurie Tonai1, Lia Cardarelli6, Nishith R. Reddy1, Sachdev S. Sidhu6,
Olga Troyanskaya4,5,7, Stephen L. Hauser3, Michael R. Wilson3, Scott S. Zamvil3,8*, Bioinformatic screening for CNS-specific
Hideho Okada2,9,10*, Wendell A. Lim1,9* recognition antigens
Myelin oligodendrocyte glycoprotein (MOG), a
To engineer cells that can specifically target the central nervous system (CNS), we identified extracellular surface molecule on myelinating oligodendro-
CNS-specific antigens, including components of the CNS extracellular matrix and surface molecules cytes, can be used to help target brain cancers
expressed on neurons or glial cells. Synthetic Notch receptors engineered to detect these antigens were (5). In diseases involving demyelination and

Downloaded from [Link] at Washington University on December 18, 2024


used to program T cells to induce the expression of diverse payloads only in the brain. CNS-targeted neuroinflammation, however, molecules such
T cells that induced chimeric antigen receptor expression efficiently cleared primary and secondary brain as MOG are likely to be disrupted. Therefore,
tumors without harming cross-reactive cells outside of the brain. Conversely, CNS-targeted cells that we wanted to systematically identify and eval-
locally delivered the immunosuppressive cytokine interleukin-10 ameliorated symptoms in a mouse model uate a broader range of candidate brain-specific
of neuroinflammation. Tissue-sensing cells represent a strategy for addressing diverse disorders in an antigens. We performed a comprehensive bio-
anatomically targeted manner. informatic search for brain-specific surface or
extracellular molecular features that might be

M
used for specific delivery to the brain (Fig. 1A).
ost drugs act systemically, and even if and autonomously deliver therapeutic payloads Ideal target antigens should be expressed only
they have strong specificity for their to the brain could reduce systemic off-target tox- within the CNS and not in other tissues. Such
molecular target, they can show toxici- icity and also increase efficacy. Immune cells an antigen should also be expressed through-
ties because most targets are expressed have evolved to infiltrate diverse tissues, re- out the brain in large amounts. To identify anti-
in both diseased and normal tissues. spond to injury or infection, and reshape tissue gens that fit these criteria, we used a pipeline
Ideally, we would like to restrict the activity of ecosystems, all properties that may make them of bioinformatic filters (fig. S1A). We used the
these drugs only to specific, disease-relevant suitable to act as local therapeutic delivery ve- publicly available Genotype Tissue Expression
tissues. Targeting central nervous system (CNS) hicles. T cells can cross the blood–brain barrier project (GTEx) RNA-sequencing (RNA-seq)
disorders such as brain tumors, neuroinflam- (BBB) under both healthy and pathogenic con- data from healthy tissues to establish a list of
mation, and neurodegeneration is a particularly ditions (3). One way to harness T cells to deliver the top 500 brain-specific extracellular anti-
challenging example (1). Achieving efficacy and payloads selectively to the brain would be to gens using a weighted clustering-based score
minimizing toxicity is very difficult because of engineer them to recognize normal (nondisease) that selected for maximum separation of RNA
the barriers to delivering molecular therapeu- CNS-specific antigens and then use these to trig- abundance in the brain relative to that in other
tics to the brain and because drug targets can ger the production of a therapeutic agent. Such tissues (6). We further narrowed our list down
often also be expressed in tissues outside of the a cell-based, CNS-specific delivery system could to 59 candidate extracellular antigens using
brain (2). serve as a common platform to treat diverse the Human Protein Atlas (HPA) to confirm pro-
Cell therapies potentially provide a solution types of CNS diseases. tein expression (versus RNA) and expression
to this conundrum because it may be possible We created a set of programmable brain- throughout the brain (fig. S1B). This analysis
to engineer a cell to act only in a tissue-specific sensing T cells engineered to locally deliver identified candidate extracellular molecules
manner. For example, using a cell to selectively therapeutic payloads customized for cancer or that are expressed both specifically and in
neuroinflammation. We identified a set of CNS- large amounts throughout the brain. A gene
specific extracellular ligands, screened for anti- ontology (GO) term analysis for cellular com-
1
UCSF Cell Design Institute and Department of Cellular & bodies against these, and used them to generate ponents of the 59 candidates further con-
Molecular Pharmacology, University of California San
Francisco, San Francisco, CA, USA. 2Department of CNS-activated synthetic Notch (synNotch) re- firmed their CNS and anatomical location
Neurological Surgery, University of California San Francisco, ceptors (engineered receptors that sense an enrichment (fig. S1C).
San Francisco, CA, USA. 3Weill Institute for Neurosciences, extracellular antigen and respond by inducing
Department of Neurology, University of California San CNS extracellular matrix proteins and
Francisco, San Francisco, CA, USA. 4Department of
a transcriptional response) (4). As a proof-of-
Computer Science, Princeton University, Princeton, NJ, principle, we harnessed this platform to locally surface proteins on neurons and glial cells
USA. 5Lewis-Sigler Institute of Integrative Genomics, produce a set of genetically encoded payloads are highly brain specific
Princeton University, Princeton, NJ, USA. 6School
of Pharmacy, University of Waterloo, Waterloo, Ontario,
directed toward different CNS diseases. CNS- The top two candidate genes to emerge from
Canada. 7Center for Computational Biology, Flatiron triggered expression of chimeric antigen re- this analysis, chondroitin sulfate proteoglycan 5
Institute, New York, NY, USA. 8Program in Immunology, ceptors (CARs) was used to treat primary and (CSPG5) and brevican (BCAN), are part of the
University of California San Francisco, San Francisco,
secondary brain cancers, including mouse mod- CNS extracellular matrix (ECM). The brain
CA, USA. 9Parker Institute for Cancer Immunotherapy,
San Francisco, CA, USA. 10Helen Diller Cancer Center, els of glioblastoma and breast cancer meta- has a distinct ECM composition that includes
University of California San Francisco, San Francisco, stases. Conversely, CNS-induced expression of perineural net structures that stabilize syn-
CA, USA. the immunosuppressive cytokine interleukin-10 apses and surround neural cell bodies (7). These
*Corresponding author. Email: zamvil@[Link]
(S.S.Z.); [Link]@[Link] (H.O.); [Link]@[Link] (W.A.L.) (IL-10) ameliorated neuroinflammation in ex- structures are composed of tenascin R and
†These authors contributed equally to this work. perimental autoimmune encephalomyelitis hyaluronan, which are associated with a family

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 1 of 13


RES EARCH | R E S E A R C H A R T I C L E

Fig. 1. Identification of CNS-specific extra- A Molecular features unique to CNS extracellular environment
cellular antigens that can be recognized
by synNotch receptors. (A) Conceptual Brain extracellular matrix
rationale for the design of therapeutic T cells BCAN, VCAN, NCAN,
CSPG5, PTPRZ1
that can recognize CNS-specific antigens (chondroitin sulfate proteoglycans)
Hyaluronic acid Tenascin
to trigger a therapeutic response locally.
Specific extracellular molecular features of Myelin/white matter
the CNS that could be used for recognition MOG
are highlighted. (B) Box plots showing
tissue-specific expression of candidate CNS- Synapses/neuron surface
specific genes BCAN, CSPG5, PTPRZ1, CDH10, GRM3
NrCAM, CDH10, GRM3, and MOG across a
T
subset of tissue samples in GTEx v7. Units neurons astrocytes
shown are normalized RNA-seq counts brain-targeted T cell oligodendrocytes microglia
(transcripts per million) taken from GTEx
portal v7. Brain expression is shown in red. B CNS-specific gene expression
See fig. S1 for the pipeline used to identify BCAN CSPG5 PTPRZ1 NRCAM CDH10 GRM3 MOG
CNS-specific targets. (C) Validation of synNotch

Downloaded from [Link] at Washington University on December 18, 2024


Brain
receptors that recognize CNS antigens. AdrnlGln
Pituitary
Receptors (see fig. S2 for more on the gen- Skin
Nerve
eration of receptors) were expressed in primary Spleen
human CD4+ T cells with a GFP synNotch Pancreas
Lung
activation reporter. These cells were cocultured AdipsTss
Kidney
with mouse primary neurons and glia to test Breast
Thyroid
activation. Flow cytometry histograms show Testis
induction of the GFP reporter only in the FmlRprdS
Prostate
presence of primary neuronal and glial cultures. SmllInts
Esophags
(D) Time-lapse images (for full movie, see Colon
movie S1) showing primary human CD8+ T cells Stomach
SlvryGln
sensing BCAN expressed by primary astro- Bladder
BlodVssl
cytes (red). Primary human CD8+ T cells Blood
Heart
expressing BCAN-sensing synNotch are shown Muscle
in blue. The cells turn green when they are Liver

50

100

150
0

100

25

50

50

50

10

20
0

25

50
activated and induce the GFP reporter. Scale
bar, 20 mm. (E) The a-BCAN synNotch receptor TPM
recognizes extracellular matrix-bound C Engineering CNS-sensing synNotch receptors
primary
recombinant BCAN. The a-BCAN synNotch neurons/glia
receptor was expressed in primary human anti-BCAN anti-CSPG5 anti-PTPRZ1 anti-NRCAM
synNotch synNotch synNotch synNotch
CD4+ T cells with a GFP synNotch activation
mode

reporter. These cells were cultured with


TF
mouse or human recombinant BCAN presented GFP
no input
on hyaluronic acid–coated plates to test +primary
activation. Flow cytometry histograms show synNotch neurons/glia
T cells
the induction of GFP reporters only in the 0 103 104 0 103 104 105 0 103 104 0 103 104

presence of recombinant BCAN. synNotch activation (GFP reporter)

D 55 min 135 min 240 min 280 min E anti-BCAN synNotch


on reconstituted ECM
mode

no input
+mouse
BCAN
+human
20 um BCAN
3 4 5
0 10 10 10

Astrocytes T cell: anti-BCAN synNotch GFP synNotch activation (GFP) synNotch activation (GFP)

of chondroitin sulfate proteoglycans, including priming that might be exploited for tissue- as MOG; and (iii) proteins found on neuron sur-
CSPG5, BCAN, versican (VCAN), and neurocan specific recognition. faces such as CDH10 (brain-specific cadherin)
(NCAN) (Fig. 1, A and B). Many of these pro- Overall, the 59 putative CNS-specific markers (see fig. S1B for a complete antigen list).
teoglycans are secreted by glial cells such as identified in our bioinformatic analysis fell in
astrocytes and neuronal cells. This ECM is three broad categories (Fig. 1A): (i) proteins of Engineering synNotch sensors for CNS-specific
estimated to account for 20% of the adult the CNS-specific ECM, such as BCAN and CSPG5; extracellular molecules
brain by volume (8), thus potentially provid- (ii) proteins on the myelin sheath produced by To construct brain-sensing cells, we designed
ing an ample ligand source for synNotch oligodendrocytes that surround the axons, such and tested synNotch receptors that recognized

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 2 of 13


RES EARCH | R E S E A R C H A R T I C L E

our candidate antigens. These synNotch sen- of BCAN. Therefore, to test the activity of the cells do express some BCAN, the amount is not
sors were then used to conditionally induce a-BCAN synNotch receptor, we cultured pri- sufficient for strong synNotch activation. How-
the transcription of the desired genetically en- mary T cells expressing this receptor with ever, synNotch priming by neighboring BCAN+
coded therapeutic payloads. Briefly, synNotch primary mouse astrocytes in vitro. The T cells K562 cells strongly induced CAR expression and
receptors consist of a variable extracellular (blue) contacted the surface of astrocytes the subsequent killing of GBM6 cells (Fig. 2B
recognition domain (e.g., a single-chain anti- (red), and subsequently turned green from and fig. S3A) without causing toxicity to the
body), a cleavable Notch-based transmembrane activation of the synNotch reporter (Fig. 1D BCAN+ K562 cells (fig. S3B).
domain, and a transcriptional intracellular and movie S1). Thus, cultured primary mouse We tested this circuit in vivo, in mice bearing
domain (4). Upon antigen binding, the intra- astrocytes produce enough BCAN to drive ac- GBM xenografts. GBM6 cells were inoculated in
membrane receptor is cleaved, releasing the tivation of this synNotch receptor. Recon- the brains of immunodeficient NCG mice, which
transcriptional domain that can enter the stituted BCAN-containing hydrogels can also were then infused intravenously with either
nucleus to activate the expression of a trans- activate cells with the a-BCAN synNotch T cells bearing the a-BCAN synNotch→a-EphA2-
gene of choice from the synNotch-responsive receptor (Fig. 1E), indicating that this in- IL13Ra2 CAR circuit or untransduced control
promoter. Therapeutic payloads can be cho- duction can occur in a cell-free manner. Over- T cells (Fig. 2C). All of the mice receiving the
sen depending on the nature of the target all, these findings highlight that cells can be untransduced T cells (n = 5) died of tumor
disease. engineered to sense specific noncellular mi- progression by day 51 after tumor cell inocu-
We selected seven antigens for use in build- croenvironmental features (e.g., the ECM) as lation. All mice treated with the synNotch-CAR
ing cognate synNotch receptors (figs. S1D and a means of recognizing a particular tissue T cells showed complete control and long-term

Downloaded from [Link] at Washington University on December 18, 2024


S2) including: three CNS ECM proteins, CSPG5, such as the brain. remission of the GBM6 tumors (P = 0.018,
BCAN, and PTPRZ1; three neural surface pro- mixed-effects analysis), as reflected in their
teins, CDH10 (cadherin 10), NrCAM (neural cell Using BCAN sensor to anatomically target significantly increased survival [P = 0.003,
adhesion molecule), and GRM3 [a metabotropic primary brain tumors in vivo log-rank (Mantel-Cox) test]. Additional repeats
glutamate receptor (mGluR)]; and one oligoden- We explored whether CNS-sensing synNotch highlighted the robustness of this circuit (fig.
drocyte surface protein, MOG. We screened a receptors could be used to direct CAR T cell S3C). The BCAN-primed T cells were more ef-
phage antibody library for binding to the hu- killing of brain tumors such as glioblastoma fective than similar MOG-primed T cells (5),
man versions of these proteins, and identified (GBM). As with most solid tumors, there is no because they cleared GBM6 tumors more rap-
one to 10 antibody recognition domains that perfect single antigen to target on GBM that is idly and with near-perfect consistency, sug-
bound each specific target. MOG binder se- both absolutely tumor specific and homoge- gesting that this brain ECM target is a more
quences were identified from the literature. neously expressed on tumor cells. Nonetheless, prevalent and effective brain-priming antigen.
Based on the binding properties of these anti- there are several glioma-associated antigens, To determine where these BCAN-primed
bodies, we narrowed down the list to design including ephrin type A receptor 2 (EphA2) T cells were active with higher resolution, we
and build a total of 40 new synNotch receptors and the IL-13 receptor a2 (IL13Ra2), that are performed confocal imaging on mouse brain
using single-chain fragment variables (scFvs) homogeneously expressed on the surface of samples at 10 days after T cell infusion (Fig.
designed from the antibody sequences (40 re- most of GBM cells in large amounts (9–11). 2D and fig. S4). We observed synNotch-primed
ceptors including the different antigen targets, However, these antigens are also expressed T cells throughout the brain slices (induced
antibodies, and heavy- and light-chain scFv in normal tissues and are only specific to GBM expression of CAR-GFP), but only observed kill-
orientations). We screened these receptors for within the confines of the brain (neither EphA2 ing or apoptosis (as shown by active caspase 3
surface expression and then again for antigen- nor IL13Ra2 is expressed in nondisease brain staining) within the tumor. Adjacent neurons
inducible synNotch activity with low basal back- cells). Therefore, if T cells could be engineered (stained for NeuN) did not show apoptosis.
ground. Because we wanted to evaluate the to only induce the expression of an anti-EphA2 Thus, these T cells did not kill the normal brain
in vivo targeting function of these receptors and anti-IL13Ra2 CAR when in the brain, then cells but only specifically killed the EphA2/
in mice, we screened for synNotch receptors we could potentially achieve effective GBM IL13Ra2–expressing tumor cells.
that were also cross-reactive against the hu- killing but also prevent CAR killing of cross- To further investigate whether BCAN synNotch
man and mouse cognate antigen. To function- reactive tissues outside of the brain (12–15). induction was restricted to the brain, we per-
ally test synNotch receptor cross-reactivity, we RNA-seq data from the Cancer Genome Atlas formed flow cytometric analysis of a-BCAN
expressed the receptors in CD4+ T cells with Program (TCGA) (16) indicated that BCAN is synNotch→a-EphA2-IL13Ra2 CAR T cells iso-
an inducible green fluorescent protein (GFP) the most strongly expressed of our brain-specific lated from the blood, spleen, and brain of GBM6
reporter. The engineered T cells were cocul- antigens within GBM tumor samples. We thus tumor-bearing mice at day 6 after T cell in-
tured with either primary mouse brain cell evaluated T cells engineered with a synNotch jection. Induced CAR expression was higher in
cultures or K562 cells (an immortalized chronic circuit in which a-BCAN synNotch promoted T cells harvested from the brain, consistent
myelogenous leukemia cell line) expressing the expression of a single CAR receptor recog- with brain-restricted synNotch activation (Fig.
the cognate mouse antigen (fig. S2). Constructs nizing either EphA2 or IL13Ra2 (a tandem 2E and fig. S5A). The T cells isolated from the
showing antigen-specific induction of GFP CAR that kills cells expressing either antigen) brain also showed induced expression of CD69
without background expression in the absence (Fig. 2A). and CD103, markers of T cell activation and
of antigen were selected for further study. This We then tested whether CD8+ T cells engi- retention, respectively (fig. S5A). Altogether,
process resulted in a set of synNotch receptors neered with this BCAN-induced CAR circuit these data are consistent with a brain-restricted
that could be used to sense six candidate CNS- could kill the GBM patient-derived xenograft antitumor response. The brain-only localiza-
specific antigens (Fig. 1C). (PDX) tumor cell line GBM6 in vitro. We ob- tion of synNotch-activated T cells is consistent
We were intrigued by the synNotch recep- served killing of GBM6 cells in vitro, which with prior studies showing that that synNotch-
tors targeting the ECM because the ECM is was further enhanced in the presence of K562 induced CAR expression decays with a half-
abundant and distributed throughout the cells engineered to express BCAN (only low life of a few hours upon removal of the priming
brain (8). BCAN, in particular, is one of the levels of GBM6 killing were observed when antigen (5).
most highly prevalent molecules in the brain cocultured with K562 cells not engineered to We observed that a-BCAN synNotch→a-EphA2-
ECM. Astrocytes synthesize large amounts express BCAN; Fig. 2B). Thus, although GBM6 IL13Ra2 CAR T cells persisted in the brains for

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 3 of 13


RES EARCH | R E S E A R C H A R T I C L E

Fig. 2. SynNotch recognition of the A Brain ECM primed anti-glioblastoma circuit B Killing of GBM6 tumor cells in vitro (t=72h)
CNS-specific ECM molecule BCAN
directs CAR antitumor activity specif-

Tumor Cell Survival (%)


BCAN synNotch recognition program
ically and potently to the intracerebral 100
IF detect Detect brain untransduced T cells
GBM PDX. (A) Design of a brain-targeted TF BCAN
CAR T cell. The a-BCAN synNotch CAR 50
+ Kill glioblastoma
receptor was used to drive the expres-
sion of antitumor CAR only in the brain. 0
This tissue-specific priming circuit was BCAN- BCAN+
K562 priming cells
designed to restrict the expression of CAR
only to the CNS, preventing damage to C In vivo killing of GBM6 tumor by BCAN circuit T cells
normal, non-CNS tissues that express the
T cells GBM6 PDX endogenous GBM6 tumor clearance Mouse survival
CAR target antigens EphA2 and IL13Ra2. tumor BCAN (brain)
9
This circuit should selectively identify 10
100
control

Percent survival
10 8
GBM cells, which are the only cells TF BCAN

Tumor size
CAR
10 7

2
circuit
expressing EphA2 or IL13Ra2 in the CNS. 10 6 50
(B) Killing of GBM6 PDX tumors in vitro. 10 5 BCAN
Primary CD8+ T cells transduced with the
i.v. inject
10 4
circuit
control

Downloaded from [Link] at Washington University on December 18, 2024


T cells
a-BCAN synNotch→a-EphA2/IL13Ra2 orthotopic Glioblastoma
10 3 0
0 20 40 60 80
xenograft tumor model 0 20 40 60 80
CAR circuit (or with the constitutively Days post tumor inoculation Days post tumor inoculation
Day 0 Day 10 Day 15
expressed a-EphA2/IL13Ra2 CAR) were
monitor tumor
cocultured with GBM6 target cells and inject tumors i.v. inject T cells growth (luminescence)
K562 priming cells either expressing or GBM6 2e6
CD4 and CD8

not expressing BCAN. Relative cell


survival of target GBM6 cells is shown at
D
72 hours (relative to untransduced T cell
controls, n = 3, error bars indicate
SEM). See fig. S3, A and B, for further
details and controls. (C) In vivo clearance
Tumor
of GBM6 tumors. GBM6 tumors Activated
1mm 200 um Tumor Apoptosis NeuN
expressing mCherry and luciferase were synNotch
orthotopically inoculated in the brains
of NCG mice. Ten days after tumor E F BRAIN-FLANK dual tumor (GBM6) model
inoculation, mice were infused intravenously CAR T cells
+ +
with 2 million each of CD4 and CD8 10
9

T cells expressing the a-BCAN synNotch→a- 8 BRAIN tumor


4% T cells BRAIN tumor 10
EphA2/IL13Ra2 CAR circuit (n = 5) or no 7 control
CAR expression (GFP reporter)

10
construct (negative control) (n = 5). 6
2
TF brain 10
CAR
Tumor size and survival were monitored Blood WT GBM6 PDX
antigen
10
5
BCAN
over time by bioluminescence imaging. 4 circuit
10
Thick line shows mean tumor size; 0 10 20 30 40 50
5% no priming
thin lines show individual mice. Dotted 10
9
FLANK tumor
line shows background bioluminescence. i.v. inject
synNotch GBM6 PDX 10
8

T cells control
P = 0.018, mixed-effects analysis. 10
7
BCAN
Spleen
Survival was analyzed over 80 days by Day 0 Day 10 Day 15 10
6 circuit
synNotch
log-rank (Mantel-Cox) test (P = 0.003). activation
monitor tumor 10
5

growth (luminescence)
See additional repeats in fig. S3C. 36% inject tumors i.v. inject T cells 10
4
0 10 20 30 40 50
BCAN KO GBM6 tumors (fig. S7C) were Days post tumor inoculation
also cleared with similar efficiency.
(D) GBM6 tumor–bearing mice were
CD3
euthanized 10 days after a-BCAN
SynNotch→CAR T cell infusion (3 million
each of CD4+ and CD8+). Representative confocal fluorescent microscopy of brain sections shows synNotch activation (green) and reveals that T cell–mediated killing
(cleaved caspase 3 staining, red stain) is restricted to the tumor (adjacent neurons are not apoptotic, gray NeuN stain). Scale bars, 1 mm (left) and 200 mm
(right, enlargement of outlined region). See fig. S4 for further analysis of brain-localized T cells in nontumor regions. (E) Flow cytometry of a-BCAN synNotch→a-
EphA2/IL13Ra2 CAR T cells isolated from blood, spleen, and brain of a GBM6-bearing mouse at day 6 after T cell injection demonstrating the higher presence
of GFP+ primed T cells in the brain compared with the blood or the spleen. See fig. S5 for further analysis of brain-localized T cells. (F) Brain-flank dual GBM6
tumor model. GBM6 tumor cells were inoculated in the brains of NCG mice, whereas BCAN KO GBM6 cells were inoculated in the flanks of the identical mice
(fig. S7, A and B). Both tumors expressed the CAR-target antigens EphA2 and IL13Ra2, but BCAN was only expressed in the brain. Ten days after tumor inoculation,
mice were infused intravenously with 2 million each of CD4+ and CD8+ T cells expressing no construct (control) (n = 4) or a-BCAN synNotch→a-EphA2/IL13Ra2
CAR circuit (n = 5). Tumor size in the brain and in the flank were monitored over time by bioluminescence imaging. Only the tumor inoculated in the brain was
reduced over time; the flank tumor grew at the same rate as in the mice treated with nontransduced T cells. Data are representative of two independent experiments.
Thick line indicates the mean and shaded area the SEM (see fig. S8 for studies showing efficient in vivo killing of brain-inoculated GBM39 tumors in the PDX
line lacking BCAN expression).

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 4 of 13


RES EARCH | R E S E A R C H A R T I C L E

weeks to months after tumor regression, con- is sufficient to prime the killing of neighboring CAR circuit. The BCAN-primed T cells efficiently
sistent with the durable antitumor response tumor cells lacking BCAN expression. controlled the BT-474–inoculated brain tumors
(fig. S5B). Flow cytometric analysis of these To confirm that induced tumor-killing CAR and increased survival compared with mice
brain-resident a-BCAN synNotch→a-EphA2- activity was restricted to the brain, we inocu- treated with untransduced T cells (Fig. 3C).
IL13Ra2 CAR T cells isolated from the brain lated GBM6 tumor cells in both the brain and Using a similar strategy, we examined triple-
showed increased levels of the homing recep- in the flank of the same animal. To eliminate negative breast cancer (TNBC, meaning the cells
tors CXCR3 and CD49d (fig. S5B). To determine possible priming from BCAN expressed in the do not express estrogen, progesterone, or HER2
whether these persisting a-BCAN synNotch→a- GBM6 flank tumors, we used the GBM6 tumor receptors), which is associated with an even
EphA2-IL13Ra2 CAR T cells were still functional cells lacking BCAN (GBM6 BCAN KO) de- lower patient survival rate compared with HER2+
in vivo, we rechallenged long-term tumor- scribed above, which cleared when inoculated tumors (24–26). The surface antigen trophoblast
cleared mice with GBM6 cells inoculated in in the brain (fig. S7C). Thus, the flank-inoculated cell surface antigen 2 (TROP2) is overexpressed
the contralateral hemisphere (opposite site tumor lacked both intrinsic and environmental in TNBCs and can be effectively targeted with
of the previously cleared initial tumor). This re- BCAN expression but still expressed the tar- an antibody-drug conjugate therapy (27–30).
challenge was done 86 days after the first tumor get CAR antigens EphA2 and IL13Ra2. We TROP2 is also expressed in other nondisease
cell inoculation. Three of four mice showed re- then treated the mice with intravenously infused tissues, but its presence in the normal brain is
sistance to tumor rechallenge: They did not T cells expressing the a-BCAN synNotch→CAR minimal (fig. S9B). Thus, TROP2 could be a
show detectable tumor growth and survived at circuit and monitored the size of both tumors. good CAR target for brain metastases when
least 300 days after initial tumor inoculation Only the brain-inoculated tumor was cleared, combined with brain-restricted induction. CD8+

Downloaded from [Link] at Washington University on December 18, 2024


(with the one other rechallenged mouse show- whereas the flank tumor grew and failed to T cells engineered with the a-BCAN synNotch→
ing slower progression than the control cohort; regress (Fig. 2F). Thus, CAR killing activity was a-TROP2 CAR circuit effectively killed BT-20
fig. S5C). not observed outside of the brain, even for po- tumor cells, a TNBC TROP2+ cell line (31), in vitro,
To further examine the underlying mecha- tential target cells expressing the CAR antigens. but only in the presence of BCAN+ K562s to
nisms by which the a-BCAN synNotch→a-EphA2- Antigen-expressing cells outside of the brain induce priming (BT-20 cells do not express
IL13Ra2 CAR T cells home to and infiltrate were not harmed even while the T cells actively BCAN) (fig. S9C). We inoculated BT-20 tumors
the brain tumor, we stained them for adhesion killed the tumors within the brain. This high in the brains of immunodeficient NSG mice to
molecules and chemokine receptors (fig. S6). degree of specific anatomical targeting is con- emulate breast cancer brain metastases and
a-BCAN synNotch→a-EphA2-IL13Ra2 CAR sistent with the induced expression of T cell re- treated them a week later with T cells bearing
T cells expressed the adhesion molecules tention molecules (CD69 and CD103), as well as the a-BCAN synNotch→a-TROP2 CAR circuit.
CD18, CD29, and CD49d, which are required previous measurements showing that synNotch- The BCAN-primed T cells efficiently cleared the
for T cell trafficking to the CNS (17), as well as induced CAR expression rapidly decays with BT-20 tumors and increased mouse survival
the chemokine receptors CCR2, CCR4, CCR5, a half-life of hours after the loss of synNotch relative to control mice treated with untrans-
CCR6, CCR7, CXCR3, and CXCR4, which have stimulation (5). duced T cells (Fig. 3C).
ligands that are up-regulated in patients with In summary, the a-BCAN–sensing synNotch
GBM (18). Using BCAN synNotch sensor to circuit induced clearance of breast cancer tu-
To confirm that endogenous brain BCAN anatomically target secondary mors inoculated within the brain and thus offers
is sufficient to induce CAR activity, we used brain tumors a potential strategy to target both HER2+ and
CRISPR-Cas9 to knock out the BCAN gene in Equipped with a reliable in vivo CNS-sensing TNBC metastases to the brain, which are of-
the GBM6 tumor cells, which still expressed synNotch platform, we wanted to test its versa- ten far more resistant to standard therapies
the CAR target antigens EphA2 and IL13Ra2. tility by expanding its use to other brain tumors than the primary tumor. Such a brain metastasis–
We confirmed in vitro that the GBM6 BCAN such as secondary, metastatic brain tumors. targeting strategy, however, would need to be
knockout (KO) cells could only be killed by Breast cancer is the most common cancer world- used in conjunction with a systemic therapeutic
a-BCAN synNotch→CAR T cells when cultured wide (19), and a major unmet need is the treat- (most of which are less effective against brain
together with BCAN-expressing K562s cells ment of the associated secondary lethal brain metastases).
(but not with parental K562 cells) (fig. S7, A metastases (extracerebral disease can be con-
and B). Next, we inoculated the GBM6 BCAN trolled in 50% of HER2+ breast cancer patients) Engineering brain-targeted immune
KO cells intracranially in mice, treated them (20). For HER2+ breast cancers, an a-HER2 CAR suppressor cells
with a-BCAN synNotch→CAR circuit T cells, is predicted to exhibit toxicity to nontumor cells Neuroinflammatory diseases such as MS present
and monitored tumor size. Even without BCAN because HER2 is expressed in several healthy another difficult therapeutic challenge. We in-
expression by the GBM6 cells, the a-BCAN tissues (15). However, because HER2 expression vestigated whether it is possible to effectively
synNotch→CAR circuit T cells could control is minimal in the normal brain (fig. S9A), we suppress inflammation in the CNS without
the tumors in the brain, presumably because tested whether restricting the killing action of causing systemic immune suppression (32).
of priming by the endogenous brain BCAN a HER2 CAR to the CNS might allow for effec- Currently approved MS therapies act primar-
(fig. S7C). Because BCAN was not required tive and safe clearance of breast cancer brain ily within the peripheral immune system and
on the tumor cells, we tested whether other metastases (Fig. 3A). In vitro, CD8+ T cells en- are effective for relapsing-remitting MS but not
GBM PDX cells lacking BCAN might also be gineered with the a-BCAN synNotch→a-HER2 for progressive MS (33–35). This is thought to
efficiently cleared, making this approach more CAR circuit effectively killed BT-474 tumor cells, be due to compartmentalized inflammation in
generalizable. We identified a different GBM a HER2+ breast cancer model cell line (21), but the form of chronic active lesions that histolog-
PDX line, GBM39, that did not express BCAN, only in the presence of BCAN+ K562 cells to in- ically are composed primarily of T cells and
and confirmed that GBM39 cells were not duce priming (BT-474 cells do not to express activated microglia or macrophages (36). There-
killed by BCAN synNotch→CAR circuit T cells BCAN) (Fig. 3B). fore, a major goal in MS is to identify and ad-
in vitro (fig. S8, A to C). However, the a-BCAN We inoculated BT-474 HER2+ breast cancer vance therapeutics that can penetrate the BBB
synNotch→CAR circuit T cells efficiently cleared tumors in the brains of NSG mice to emulate and may promote CNS immune modulation
GBM39 tumors inoculated in the mouse brain metastases (22, 23) and infused the mice with and prevent neurodegeneration, the hallmark
(fig. S8D). Thus, BCAN in normal brain tissue T cells bearing the a-BCAN synNotch→a-HER2 feature of progressive MS.

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 5 of 13


RES EARCH | R E S E A R C H A R T I C L E

A CNS metastases B +

BT-474 breast cancer cells

Primary breast

Tumor cell survival


cancer tumor
+K562
100

General circuit for brain metastases


50
rain synNotch (BCAN) +K562 BCAN+
IF detect 0
TF BRAIN 0 20 40 60
CAR hours

Downloaded from [Link] at Washington University on December 18, 2024


breast cancer
brain metastasis
untransduced

Brain implanted BT-474 tumors (HER2+)


Tumor clearance Mouse survival
1010
control 100 BCAN

Percent survival
109
T cells BRAIN implanted circuit
Tumor size
2

108 75
breast cancer cells BCAN
+ 107
or TROP2+) circuit 50
synNotch 106
105
25
TF 104
control
CAR
103 0
0 100 200 300 0 100 200 300
endogenous
BCAN (brain) Days post tumor inoculation Days post tumor inoculation
i.v. inject Untransduced T cell
T cells
+
or TROP2+
xenograft tumor model Brain implanted BT-20 tumors (TROP2+)
Day 0 Day 8 Day 15 Mouse survival
Timeline tumor clearance
109
monitor tumor control 100
Percent survival

growth via luminescence 108 BCAN


Tumor size

inject tumors i.v. inject T cells circuit


2

107 75
1e5 BT-474 3e6 CD4 and CD8 106
or BT-20 cells BCAN 50
105
circuit 25
104
control
103 0
0 20 40 60 80 100 120 0 20 40 60 80 100 120 140

Days post tumor inoculation Days post tumor inoculation


Untransduced T cell

Fig. 3. CNS-specific priming of synNotch-CAR T cells is a generalizable tool cells with K562 cells expressing the priming antigen BCAN. Killing of BT-474 cells
for effective killing of brain metastases such as HER2+ and TNBC brain was only observed in the presence of BCAN+ K562 cells (n = 3, error bars
metastases. (A) Treatment for CNS metastases is a major unmet need, indicate SEM). See fig. S9C for in vitro killing studies of BT-20 breast cancer
particularly for breast cancer. A CNS-specific priming circuit could be used as a cells, a model of TNBC. (C) In vivo tumor experiments with BT-474 (HER2+
general platform to target such metastases. Restricting CAR expression only breast cancer) and BT-20 (TNBC) tumors. BT-474 or BT-20 tumors expressing
to the brain could prevent damage to normal, nonbrain tissues that express target- GFP and luciferase were orthotopically inoculated in the brains of NSG mice.
killing antigens. Tumor-specific antigens are particularly hard to find for TNBC. Seven days after tumor inoculation, mice were infused intravenously with 3
Our strategy could be applied to target brain metastases for HER2+ breast million each of CD4+ and CD8+ T cells expressing no construct (control) (n = 5)
cancer or TROP2+ TNBC (fig. S9). (B) Real-time in vitro killing of BT-474 breast or a-BCAN synNotch→CAR T cells (for BT-474: a-HER2 CAR; for BT-20:
cancer cells, a model of HER2+ breast cancer. BT-474 cells express HER2 but are a-TROP2 CAR) (n = 5). Tumor size and survival were monitored over time by
negative for BCAN. Therefore, to mimic brain priming, we cocultured BT-474 bioluminescence imaging. Thick line shows mean ± SEM (shaded area).

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 6 of 13


RES EARCH | R E S E A R C H A R T I C L E

IL-10, a potent anti-inflammatory cytokine, clonal MOG-autoreactive T helper 17 (TH17) CD4+ clinical scoring system, which scores increas-
has been considered an attractive molecule for T cells were harvested after direct immuniza- ing levels of paralysis and neurological dys-
treatment in both relapsing-remitting and pro- tion with MOG peptide into a mouse. These function (47–49) (Fig. 5A). Adoptive transfer of
gressive MS. However, intravenous infusion pathogenic cells were adoptively transferred a-MOG–autoreactive T cells resulted in severe
of IL-10 in mouse models and in human into a recipient immunocompromised RAG-1−/− EAE disease in the recipient RAG-1−/− mice,
clinical trials did not show efficacy (37, 38), mouse, inducing severe and usually fatal neuro- yielding clinical scores close to the maximum
likely because of its short half-life (∼3 hours in logical disease. Using this model, we could test of 5 (full paralysis and death). To test our sup-
both humans and mice) and its inability to cross whether infusion of engineered T cells reduced pressor cells, the mice were injected intra-
the BBB (39–41). IL-10 might be effective at disease severity. Neurological disease sever- venously every 4 days with the therapeutic
ameliorating neuroinflammation if it could be ity and progression was tracked with the EAE synNotch suppressor T cells or control T cells
effectively delivered to the CNS. Indeed, admin-
istration of IL-10 directly in the brain through A Induce anti-inflammatory payload IL-10 B Suppressor T CELL
adenovirus injection successfully ameliorated
disease in mouse models of neuroinflammation suppressor T CELL brain antigen
(42). This irreversible viral approach, however, α-BCAN synNotch IL-10 secretion(ELISA)
is unlikely to be practical for treatment of MS. BCAN+
Receptor
Here, we tested whether brain-sensing T cells 3

[IL-10 ] (ng/mL)
could be used as a vehicle to produce IL-10 se-

Downloaded from [Link] at Washington University on December 18, 2024


TF
lectively in the CNS (Fig. 4A). We engineered 2
IL-10
CD4+ T cells with an a-BCAN synNotch→IL-10
circuit and demonstrated that these cells could 1
effectively produce IL-10 in vitro, but only in IL-10
the presence of BCAN+ K562 cells (Fig. 4B). To 0
BCAN- BCAN+
evaluate their anti-inflammatory potential, we circuit: α-BCAN synNotch→IL-10 K562 priming cells
tested their ability to inhibit the inflammatory
activation of both CNS-autoreactive T cells
C In vitro inhibition of CNS autoreactive T cell and microglial inflammation
and microglia cells in vitro. We tested CNS-
autoreactive T cells from genetically engineered Activated
mouse microglia Microglia MOG-specific TCR
a-MOG–specific, TCR (2D2) transgenic mice activation T cell activation
(LPS+IFN-γ)
(43) (Fig. 4C), and found that their activation [as Time: 24h Time: 96h
determined by CD25 staining and interferon-g 300 800
(IFN-g) secretion] was inhibited by a-BCAN

[IL-6] (pg/mL)
600
synNotch→IL-10 CD4+ T cells in the presence of

CD25 MFI
therapeutic T cell: 200

BCAN+ K562 cells (Fig. 4C). Analogously, we ex- proinflammatory α-BCAN synNotch→IL-10 400
cytokines 100
amined mouse microglia cells activated with lipo- 200
(IL-6/TNFα)
polysaccharides (LPS) and IFN-g, as previously IL-10 0 0
described (44) (Fig. 4C). In the presence of BCAN+
TF

K562 inducer cells, the a-BCAN synNotch→IL-10 IL-10 400


800
] (pg/mL)

[IFN- ] (pg/mL)
CD4+ T cells reduced secretion of the proinflam- 300
matory cytokines IL-6 and TNF-a by activated 400
microglia cells (Fig. 4C). Thus, the a-BCAN T BCAN+
200

synNotch→IL-10 CD4+ T cells can exert im- K562 cells 100

munosuppressive activity against T cells and MOG TCR


[

0 0

microglia in vitro. MOG-specific TCR control T cells


CD4 T cell α-BCAN synNotch →IL-10
Brain-targeted suppressor cells
ameliorate disease in a mouse model Fig. 4. CNS-specific synNotch circuits can be programmed to produce the anti-inflammatory cytokine
of neuroinflammation IL-10. (A) CNS-specific synNotch cells could in principle be used to modulate neuroinflammation. For example,
To determine which brain-priming antigens CNS priming could be used to trigger the expression of IL-10, a potent anti-inflammatory cytokine. For more
might be best to direct cell therapies against analysis of optimal CNS antigens to target in neuroinflammation, see fig. S10. (B) Primary human T cells
neuroinflammation, we examined published were engineered with the a-BCAN synNotch→IL-10 circuit and cocultured with K562 cells engineered to
RNA-seq analyses of chronically active MS le- express BCAN. Supernatants were collected after 48 hours, and IL-10 was quantified by enzyme-linked
sions compared with healthy CNS tissue of immunosorbent assay (ELISA). Quantification shows the specific secretion of IL-10 only when the engineered
patients (45). Expression of both BCAN and T cells are cultured with BCAN+ K562 cells (n = 3). (C) In vitro inhibition assays of microglia and T cell
CDH10 was maintained in MS lesions, but MOG activation. BV2 mouse microglia were cultured with control or therapeutic T cells (a-BCAN synNotch→IL-10)
expression was decreased, likely due to de- in the presence of BCAN+ K562 cells to induce payload expression. Two hours later, IFN-g and LPS were
myelination and oligodendrocyte loss in pro- added to induce activation of the microglia. Cells were cultured for 24 hours, and the supernatant was
gressive MS (fig. S10). Thus, both BCAN and collected to assess inflammation by assaying for secretion of IL-6 and TNF-a by ELISA (n = 3, mean ± SD).
CDH10 are good candidates for priming brain- Conventional CD25– TCR+ CD4+ T cells were sorted from MOG-specific TCR (2D2)–transgenic mice and
targeted responses in neuroinflammatory dis- cocultured with antigen-presenting cells presenting MOG peptide to induce their activation. To assay the
eases such as MS. To test the efficacy of these inhibition of activation, MOG-specific TCR 2D2 CD4 T cells were cocultured at a 1:1 ratio with control transduced or
brain-targeted suppressor cells in vivo, we used engineered with a-BCAN synNotch→IL-10 T cells for 4 days in the presence of BCAN+ K562 cells to stimulate
an established adoptive transfer disease model IL-10 induction. Activation of the MOG-specific TCR 2D2 CD4 T cells was analyzed by flow cytometry using
of EAE (46) (Fig. 5A), in which pathogenic poly- the activation marker CD25 or by ELISA to measure IFN-g secretion (n = 3, mean ± SD).

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 7 of 13


RES EARCH | R E S E A R C H A R T I C L E

Fig. 5. CNS-targeted anti- A Adoptive transfer EAE model


inflammatory circuit ameliorates
EAE model. (A) Schematic of 5 Death, euthanasia criteria met:
MOG autoreactive therapeutic both hindlimbs and both front
the adoptive transfer EAE model. CD4 T cell CD4 T cell
RAG-1–/– mice received an adop- B6 mouse immunized
with MOG P35-55 peptide
4.5 Both hindlimbs paralyzed, or
IL-10 IL-10 TF non-functional movement
tive transfer of TH17–polarized T 4 Both hindlimbs paralyzed and
i.p. i.v.
6 CD4+ cells cultured under ront limbs
CD4 T cells [20 × 10 in (B) and Th17 polarization conditions endogenous 3.5 Both hindlimbs paralyzed
6 MOG TCR
25 × 10 in (C)] from P35-55 synNotch BCAN (brain) 3 One hindlimb paralyzed
2
MOG–immunized C57BL/6J mice. 1
At the indicated days after adop- 0 Clinically normal

tive transfer (arrows), mice


received primary human CD4
T cells transduced with either control
B Survival
scores
(no circuit, n = 5) or a-BCAN Therapeutic T cells i.v.
synNotch→IL-10 circuit (n = 5) at 5 80 100
s

the indicated times (10 × 106). BCAN

Percent survival
4

AUC (days 7-25)


The EAE neurological disease priming 60 75
3
scoring scale is shown. (B) Treat-

Downloaded from [Link] at Washington University on December 18, 2024


40 50
ment with a-BCAN synNotch→IL-10 2
T cells yields improved EAE 20 25
1 BCAN synNotch BCAN synNotch
0
scores and increased survival. 0
0
0 0
Ten million T cells were injected 0 5 10 15 20 25 0 5 10 15 20 25

l
tro
on each day, as indicated by a

on
.c
black arrow. P < 0.05, two-way

eg
N
ANOVA. EAE severity was assessed
by the area under the curve of
each animal starting from the day C Survival
scores
of first treatment, day 7 until day 25 Therapeutic T cell i.v.
(n = 5, mean ± SE). P < 0.05, 5 80 100
s

unpaired t test. Survival curves show

Percent survival
4 CDH10 p < 0.05
AUC (days 7-25)

75
improved protection by the a-BCAN priming 60
3
synNotch→IL-10 T cell treatment 40 50
2 p < 0.05
as analyzed by log-rank (Mantel-Cox)
20 25 CDH10 synNotch
test. The effects of the two treat- 1 CDH10 synNotch
0 0
ments on mouse mobility are shown 0 0
0
0 5 10 15 20 25
in fig. S11. Additional repeats of this 0 5 10 15 20 25
l
tro
on

experiment are shown in figs. S12


.c
eg

and S13. (C) Treatment with


N

a-CDH10 synNotch→IL-10 T cells


yielded improved EAE scores and
increased survival. Ten million D Potential use of brain/CNS targeted therapeutic cells
T cells were injected on each day,
Brain-sensing T cells Therapeutic payloads CNS diseases
indicated by a black arrow. EAE
Primary and secondary brain tumors
scores showed significant improve- synNotch
ments with CNS-targeted a-CDH10 Anti-inflammatory molecules Neuroinflammation, brain injury
synNotch→IL-10 T cells. P < 0.05,
Regenerative molecules Degeneration, brain injury
two-way ANOVA. EAE severity was
assessed by the area under the
curve of each animal starting from the day of first treatment, day 7, until day 25 (n = 7, mean ± SE). P < 0.05, unpaired t test. Survival curves show improved protection
by the a-CDH10 synNotch→IL-10 T cell treatment as analyzed by log-rank (Mantel-Cox) test. (D) Brain-sensing cells could be used as a general platform to treat a broad set of
CNS diseases such as primary and secondary brain tumors, neuroinflammation, or even neurodegeneration. This customizable platform can be used to locally deliver any
genetically encodable molecular therapy that is appropriate for a specific CNS disease, thereby improving on-target action and alleviating off-target toxicity.

expressing blue fluorescent protein (BFP) start- ration of EAE disease by the therapeutic cells provided similar protection (figs. S12 and S13A).
ing 7 days after the adoptive transfer of the was supported by the overall increased mobility Similar to the a-BCAN synNotch→CAR T cells,
disease-causing a-MOG–autoreactive T cells. in the mice treated with a-BCAN synNotch→ a-BCAN synNotch→IL-10 CD4+T cells ex-
The a-BCAN synNotch→IL-10 CD4+ T cells sig- IL-10 CD4+ T cells (control-treated mice had pressed molecules important for trafficking, in-
nificantly improved disease outcome. We ob- more severe paralysis; fig. S11). Similarly, treat- cluding the adhesion molecules CD18, CD29,
served less severe EAE scores (P = 0.003, mixed ment with the a-CDH10 synNotch→IL-10 CD4+ and CD49d and the chemokine receptors
analysis), lowering of cumulative EAE scores, T cells also resulted in significantly lower EAE CCR2, CCR4, CCR5, CCR6, CCR7, CXCR3,
and increased mouse survival relative to mice severity scores and improved survival (Fig. 5C). and CXCR4 (fig. S6). Thus, IL-10 produced
treated with control T cells (Fig. 5B). Amelio- Different dosing regimens of therapeutic T cells by brain-sensing T cells (using either BCAN or

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 8 of 13


RES EARCH | R E S E A R C H A R T I C L E

CDH10 as a priming antigen) was able to im- Our engineered cells effectively delivered var- localized delivery of IL-10, which can block mul-
prove symptoms in this EAE model. ious model payloads directed locally against tiple inflamed cell types (including T cells and
To evaluate the importance of brain-primed two distinct types of CNS diseases: cancer and microglia) could provide an important addi-
IL-10 production, we treated EAE mice with autoimmunity. These observations highlight tional line of treatment in combination with
analogous suppressor T cells that constitutive- the broad spectrum of CNS diseases that could B cell–depleting therapies. This proof-of-principle
ly express IL-10 (or control T cells constitu- potentially be targeted with this approach. study opens the door to a broader examination
tively expressing BFP). T cells were injected In the case of brain cancer, and cancer in and screening of diverse cell-delivered anti-
intravenously every 4 days starting 7 days after general, it is almost impossible to find a target inflammatory payloads. It may be possible to
adoptive transfer of the disease-causing a-MOG– antigen for CAR T cell therapy that is both develop more effective combinatorial payloads
autoreactive T cells (fig. S13A). Treatment with homogeneously expressed on all the cancer (59) or to use further optimized versions of key
T cells constitutively expressing IL-10 failed to cells and not expressed in any healthy tissues biologics to further improve therapeutic out-
protect the animals from EAE, consistent with (53–55). This explains why the field has had to comes (60, 61). The use of allogeneic T cells
prior reported failure of systemic IL-10 deliv- focus on intracranial T cell injection in the could help lower the costs of repeated dosing if
ery to improve EAE or MS (37, 38). Thus, lo- past, with the assumption that the T cells would necessary. Further improving pharmacody-
calized delivery of IL-10 by brain-primed T cells remain primarily in the brain. As shown here, namic and specificity features of the payload
is more effective than constitutive IL-10 produc- this conundrum can in some cases be resolved cytokine will undoubtedly also lead to more
tion by T cells. by restricting killing action to a specific anatom- optimized therapies (39–41).
To evaluate whether the a-BCAN synNotch→ ical compartment such as the brain. This new Nonetheless, future questions remain as to

Downloaded from [Link] at Washington University on December 18, 2024


IL-10 T cells led to any systemic accumulation strategy is compatible with intravenous deliv- when and how cell-mediated cytokine delivery
of IL-10 in the periphery (i.e., outside of the ery of CAR T cells, because the risk of off-target would ultimately be best deployed for neuro-
CNS), we measured IL-10 levels in the serum toxicity is limited. In the clinical context, cou- logical diseases compared with, for example,
on day 12, after two rounds of therapeutic pling the intravenous route with lymphodeple- viral or nonviral vectors with tissue tropism (62).
T cell injections (see fig. S13A). No differences tion will be important to provide more favorable Future developments in cell manufacturing and
in IL-10 levels were detected compared with niches for postinfusion expansion, longer-term increased cell durability will be critical. Ulti-
negative controls (fig. S13B). However, we ob- T cell survival, and potentially a more durable mately, however, living cells offer the promise
served increased levels of IL-10 in the CNS of response, as shown for blood cancer CAR T cell of more sophisticated and controlled cytokine
mice treated with the a-BCAN synNotch→IL-10 treatments. In the intraventricular injection release programs using circuits that spatially
T cells. We also evaluated any signs of systemic context, CAR T cells have to survive in the cere- and temporally integrate complex environ-
IL-10 activity. One of the immunosuppressive brospinal fluid, where the glucose concentra- mental cues to achieve more balanced homeo-
mechanisms of IL-10 is to disable antigen tion is approximately two-thirds that of the static control.
presentation and T cell activation through the blood and the protein concentration is 100 times Many additional ways could be explored in
inhibition of CD80 (B7-1) and CD86 (B7-2) lower (56). Therefore, this work opens a broad the future to improve the specificity and effi-
expression on myeloid cells, thereby blocking new alternative approach for potentially attack- ciency of brain or CNS targeting by therapeu-
costimulation (50, 51). Neither group of mice ing brain cancers in a safer and more effective tic cells. This could include ways to improve
showed a difference in CD80 and CD86 ac- way by targeting antigens that are absent in cell trafficking and residence in the brain, as
tivation markers or PD-1 inhibitory marker the brain even if they are expressed on healthy well as to improve cell migration through the
expression on the myeloid cells of the spleen, tissues elsewhere. BBB. Other important issues to address will be
an organ where T cells can accumulate (fig. Therapeutic cells that can deliver immuno- ways to amplify and tune the level of payload
S13C). Prior studies showed that administra- modulatory cytokines or other biologics to a production and to increase the durability and
tion of recombinant IL-10 to healthy patients target tissue such as the CNS can not only survival of the introduced cells.
could result in lower platelet counts in their make delivery more effective but also reduce Overall, our current results suggest that
blood (39, 52), but we observed no differ- the risk of systemic toxicity. Many of these brain-sensing cells could be used as a general
ences between the groups (fig. S13D). Thus, biologics have pleiotropic effects on multiple platform to treat a broad set of CNS diseases,
IL-10 produced by brain-sensing T cells does tissues, which can lead to major toxicities out- including brain tumors, brain metastases, neu-
not lead to measurable systemic immune sup- side of the target tissue. For example, in the roinflammation, or even neurodegeneration
pression or off-target toxicity. These findings case of chronic inflammation, such as MS, sys- (Fig. 5D).
validate that brain-sensing cells can serve temic treatment with anti-inflammatory drugs The targeting capabilities of engineered im-
as a vehicle to deliver anti-inflammatory pay- can result in an increased risk of infections mune cells likely exceed the biophysical targeting
loads to the brain with a higher overall ther- and other pathologies. properties of isolated molecular therapeutics.
apeutic index. We tested a model anti-inflammatory mol- This approach is inspired by biological speci-
ecule, IL-10, and validated that its delivery by ficity, in which many important regulatory mol-
Discussion a brain-sensing T cell improved outcomes in an ecules are reused throughout the body, but their
We developed a general cell platform for deliver- animal model of neuroinflammation without specific outcomes are restricted by the anatom-
ing diverse therapeutic payloads to the brain. measurable systemic immune suppression or ical locations of the cells that produce them (63).
We identified several classes of CNS-specific off-target toxicity. Further, T cells that produced In this case, the molecular-scale specificity of
antigens that can be used for CNS targeting of IL-10 in a CNS-induced manner showed greater the therapeutic payload is layered on top of the
therapeutic cell activity (Fig. 1). These target efficacy than analogous T cells that constitu- anatomical-scale specificity of the cell, yield-
antigens include components of the specific tively produced IL-10. It is noteworthy that ing much higher combinatorial therapeutic
brain ECM, which offers an abundant and persistent inflammation in MS, which is char- specificity compared with systemic payload ad-
widely distributed targetable substrate be- acterized by chronic lesions, ectopic menin- ministration. Although we focused here on ap-
cause it has a highly distinct molecular com- geal follicles, and glial activated states, occurs plying this cellular targeting strategy to the
position (8). SynNotch receptors that detected despite current B cell depletion treatments brain, this concept could in principle also be
the brain ECM component BCAN effectively and is a major driver of progressive disability applied to target diseases that occur within a
sensed the native CNS in an in vivo context. accumulation and atrophy (57, 58). Therefore, broader set of specific tissues. Tissue-targeted

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 9 of 13


RES EARCH | R E S E A R C H A R T I C L E

cell delivery provides a general strategy to make day and, after 24 hours in culture, were stim- puromycin selected or with pHR based con-
therapies more specific and effective and to ulated with 25 µl of anti-CD3/CD28 coated structs and selected.
reduce systemic toxicity. beads [Dynabeads Human T-Activator CD3/ GBM6 and GBM39 cells were cultured in
CD28 (Gibco)] per 1 ×106 T cells. In some in- DMEM/F12 medium, with supplements of
Materials and methods stances, freshly isolated T cells were used. At epidermal growth factor (EGF, 20 µg/ml), fib-
Construct design 48 hours, viral supernatant was harvested. roblast growth factors (FGF, 20 µg/ml), and
SynNotch receptors were built by fusing the var- Primary T cells were exposed to the lentivirus heparin (5 µg/ml). K562 and BT-20 cells were
ious scFv sequences (Sidhu lab or patents) to for 24 hours or spinoculated on retronectin- cultured in DMEM 10% FBS. BT-474 cells
mouse Notch1 (NM_008714) minimal regula- coated plates. At day 5 after T cell stimulation, were cultured in RPMI with 10% FBS.
tory region (residues 1427 to 1752) and Gal4 Dynabeads were removed and T cells were
DBD VP64. All synNotch receptors contain sorted with a BD Biosciences FACSARIA Fu- In vitro stimulation of synNotch T cells
N-terminal CD8a signal peptide (MALPVTAL- sion or Sony SH800S Cell Sorter. T cells exhib- For in vitro synNotch induction, the engineered
LLPLALLL HAARP) for membrane targeting iting basal CAR expression were gated out T cell and tumor/target cells were cocultured
and a-myc-tag (EQKLISEEDL) for detecting sur- during sorting. T cells were expanded until at a 1:1 ratio, with 1 × 105 cells each in a flat-
face expression with a-myc A647 (Cell Signaling rested and could be used in assays. bottomed, 96-well tissue culture plate for
Technology, catalog no. 2233). See Morsut et al. 48 hours. When using reconstituted matrix,
(4) for the synNotch sequence. Receptors were Human T cell staining 2 × 104 cells were cultured for 48 hours on
cloned into a modified pHR’SIN:CSW vector T cell expression of adhesion and chemokine wells coated with hyaluronic acid (200 µg/ml,

Downloaded from [Link] at Washington University on December 18, 2024


containing a PGK or SFFV promoter. The receptors were assessed using the following Thermo Fisher Scientific, catalog no. J60566.
pHR’SIN:CSW vector was also used to make re- antibodies: APC anti-CD18 (BioLegend, catalog MA) and recombinant BCAN (25 µg/ml,
sponse element plasmids with five copies of no. 373405), APC anti-CD29 (BioLegend, cata- R&D Systems, catalog nos. 7188-BC-050 and
the Gal4 DNA-binding domain target sequence log no. 303007), APC anti-CD49d (BioLegend, 4009-BC-050). Cells were analyzed by flow cy-
(GGAGCACTGTCCTCCGAACG) upstream from catalog no. 304307), APC anti-CD69 (BioLegend, tometry using a BD Fortessa; analysis was
a minimal CMV promoter. Response element catalog no. 310910), APC anti-CD103e (Invitro- performed with FlowJo software (TreeStar).
plasmids also contain a PGK promoter that gen, catalog no. 2549693), APC anti-LFA-1 When cytokine release assays were conducted,
constitutively drives BFP expression to easily (BioLegend, catalog no. 141009), APC anti- the supernatant was collected and processed
identify transduced T cells. CARs were built by CCR1 (BioLegend, catalog no. 362907), APC by ELISA.
fusing IL-13 Mutein [E13K,K105R]-G4Sx4-EphA2 anti-CCR2 (BioLegend, catalog no. 357207),
scFv (5), a-Her2 (4D5) (21), or a-TROP2 (hRS7) AF647 anti-CCR3 (BioLegend, catalog no. In vitro mixed neuronal/glial cultures
(64) to the hinge region of the human CD8a 310709), AF647 anti-CCR4 (BioLegend, catalog Cortexes were dissected from postnatal C57BL/6
chain and transmembrane and cytoplasmic re- no. 335401), APC anti-CCR5 (BioLegend, catalog (The Jackson Laboratory #000664) day 0 (P0)
gions of the human 4-1BB, and CD3z signaling no. 359121), APC anti-CCR6 (BioLegend, cata- mice of both sexes, dissociated in 0.25% trypsin,
domains. Inducible CAR constructs or cytokines log no. 353415), APC anti-CCR7 (BioLegend, washed three times with Hank’s balanced salt
were cloned into a site 3' to the Gal4 response catalog no. 353213), APC anti-CXCR1 (BioL- solution (HBSS) containing 10 mM HEPES and
elements and minimal CMV promoter. CARs egend, catalog no. 320612), AF647 anti-CXCR2 20 mM glucose, triturated, and plated on poly-L-
were tagged c-terminally with GFP or red fluo- (BioLegend, catalog no. 320714), APC anti- lysine–coated coverslips at 350 cells/mm2. Cells
rescent protein (RFP), or N-terminally with myc CXCR3 (BioLegend, catalog no. 353707), APC were plated in minimal essential medium con-
tag or flag tag to verify surface expression. anti-CXCR4 (BD Biosciences, catalog no. taining B27 (Gibco, catalog no. 17504044), 2 mM
560936), APC anti-CXCR6 (BioLegend, cata- glutaMAX (Thermo Fisher Scientific, catalog no.
Primary human T cell isolation and culture log no. 356005), and corresponding isotype 35050061), 5% FBS, 21 mM glucose (Sigma,
Primary CD4+ and CD8+ T cells were isolated controls. Briefly, post-transfected T cells were catalog no. G8769), and 1× penicillin/streptomycin
from donor blood after apheresis by negative sorted, expanded, and rested for ~10 days (Thermo Fisher Scientific, catalog no. 15070063).
selection (STEMCELL Technologies). Blood and then analyzed by flow cytometry. We After 1 day in vitro (DIV1), 3/4 of the medium
was obtained from StemExpress or Allcells, as used a 1:50 antibody dilution. A total vol- was changed to Neurobasal (Thermo Fisher
approved by the University of California San ume of 30 µl per staining reaction was used Scientific, catalog no. 21103049) with B27,
Francisco (UCSF) institutional review board. in staining buffer (PBS with 2% fetal bovine glutaMAX, and penicillin/streptomycin.
T cells were cryopreserved either in Cellbanker serum and 2 mM EDTA). Samples were in-
1 or in RPMI-1640 with 20% human AB serum cubated at 4 °C for 15 min and washed with In vitro astrocyte culture
(Valley Biomedical) and 10% dimethyl sulfoxide. staining buffer. T cells were analyzed by flow Astrocytes were isolated from the adult female
After thawing, T cells were cultured in human cytometry. NCG mouse (Charles River Laboratories) brain
T cell medium consisting of X-VIVO 15 (Lonza), tissue using the Adult Brain Disassociation kit
5% human AB serum, 55 µM b-mercaptoethanol, Cell lines (Miltenyi Biotec, catalog no. 130-107-677). Briefly,
and 10 mM neutralized N-acetyl-L-cysteine sup- Cell lines used were K562 myelogenous leu- the extracellular matrix was enzymatically di-
plemented with 30 units/ml IL-2. kemia cells (ATCC catalog no. CCL-243), GBM6, gested along with mechanical dissociation
GBM39 PDX cells (gift of Frank Furnari, Ludwig on gentleMACS dissociator with heat. After
Lentiviral transduction of human T cells Institute and UCSD), BT-474 (ATCC catalog no. disassociation, myelin and cell debris were
Pantropic vesicular stomatitis virus G (VSV-G) HTB-20) and BT-20 (ATCC catalog no. HTB-19). removed using a debris removal solution. The
pseudotyped lentivirus was produced through Cells were lentivirally transduced to stably ex- anti–ASCA-2 microbead kit (Miltenyi Biotec,
transfection of Lenti-X 293T cells (Takara Bio, press GFP or mCherry, and enhanced firefly catalog no. 130-097-678) was used to isolate
catalog no. 632180) with a pHR SIN:CSW trans- luciferase under control of the spleen focus- astrocytes from the single-cell suspension.
gene expression vector and the viral packaging forming virus (SFFV) promoter and sorted as The astrocytes were cultured in a precoated
plasmids pCMV and pMD2.G using Fugene previously shown (5). For transgene expres- glass-bottomed, six-well plate in AstroMACS
HD (Promega) or TransIT-VirusGen (Mirus sion, K562s were transduced with the lenti- medium (Miltenyi Biotec, catalog no. 130-117-
Bio). Primary T cells were thawed the same viral vector CD510-B1 (System Biosciences) and 031) for 7 days.

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 10 of 13


RES EARCH | R E S E A R C H A R T I C L E

Assessment of astrocyte-synNotch CAR mCherry cells were inoculated intracranially (1 to 2 days). Subsequently, brains were em-
T cell interaction into 6- to 8-week-old female NCG mice (Charles bedded in optimal cutting temperature (OCT)
The cultured astrocytes, labeled with MemGlow River Laboratories). For the orthotopic model compound (Tissue-Tek; Sakura Finetek, catalog
590 (20 nM, Cytoskeleton, catalog no. MG03- with BT-474 and BT-20, 1.0 × 105 luc-GFP ex- no. 4583). Serial 10-mm coronal sections were
02), were coincubated with a-BCAN synNotch pressing cells were inoculated intracranially then cut on freezing microtome and stored at
CD8+ T cells and loaded onto a prewarmed into 8- to 12-week-old female NSG mice (The –80°C. Sections were later thawed, fixed with
stage (37°C, 5% CO2) of Zeiss spinning disk Jackson Laboratory #005557). 10% formalin for 10 min, incubated in block-
confocal microscope. The live-cell imaging (20× After anesthesia with 1.5% isofluorane, ste- ing buffer (PBS with 5% normal donkey serum)
magnification) was done for 8 hours with im- reotactic surgery for tumor cell inoculation for 40 min, and stained with primary antibodies
age acquisition at every 5 min. (injection volume: 2 µl) was performed with overnight at 4°C. Primary antibodies used were
the coordination of the injection site at 2 mm as follows: CD45 (D9M8I) XP rabbit mAb (Cell
Assessment of synNotch-CAR T cell cytotoxicity right and 1 mm anterior to the bregma and Signaling Technologies, catalog no. 1:100), Cleaved
CD8+ synNotch-CAR T cells were stimulated 3 mm into the brain. Before and for 3 days Caspase 3 (Asp175) rabbit mAb (Cell Signaling
for up to 72 hours with target cells expressing after surgery, mice were treated with an anal- Technologies, catalog no. 1:250), and NeuN mouse
the killing antigens and, when needed, prim- gesic and monitored for adverse symptoms in mAb (Millipore, clone A60, 1:500).
ing K562 cells ([Link], 5 × 104). The degree of accordance with the IACUC. Conjugated secondary antibodies were used
specific lysis of target cells was determined by In the subcutaneous model, NCG mice were at 4°C for 2 hours to detect primary labeling.
comparing the fraction of target cells alive in injected with 1.2 × 105 GBM6-luc-mcherry cells Sections were stained with DAPI (Thermo

Downloaded from [Link] at Washington University on December 18, 2024


the culture with treatment with nontrans- subcutaneously in 100 ml of HBSS on day 0. Fisher). Images were acquired using either a
duced T cell controls unless stated otherwise. Tumor progression was evaluated by lumi- Zeiss Axio Imager 2 microscope (20× magni-
Cell death was monitored by shift of target nescence emission on a Xenogen IVIS Spec- fication) with TissueFAXS scanning software
cells out of the side scatter and forward scatter trum after intraperitoneal injection of 1.5 mg of (TissueGnostics) or a Stellaris 8 WLL Confocal
region normally populated by the target cells. D-luciferin (GoldBio, injection volume 100 ml). microscope (20×, 40× magnification) with
Alternatively, cell viability was analyzed using Background bioluminescence was estimated Leica LAS X imaging software. Exposure times
the IncuCyte Zoom system (Essen Bioscience). by measuring a nontumor-affected area of the and thresholds were kept consistent across
Tumor cells were plated into a 96-well plate at mouse. Before treatment, mice were randomized samples within imaging sessions. When needed
a density of 2.5 × 104 cells per well in triplicate such that initial tumor burden in control and to improve the visibility of an image, linear
overnight. Then, 5 × 104 T cells (and K562 cells treatment groups were equivalent. Mice were adjustment of contrast and brightness was
when specified) were added into each well the treated with engineered or nontransduced T applied to the entire image in accordance
next day. Target cells and T cells were cocultured cells at indicated doses intravenously through with Science guidelines (Fig. 2D).
as described above. At least two fields of view the tail vein in 100 ml of PBS. Survival was eval-
were taken per well every 2 to 3 hours. The target uated over time until predetermined IACUC- Assessment of engineered T cells in vivo
cell area was calculated using IncuCyte Zoom approved endpoint (e.g., hunching, neurological For all experiments involving phenotyping of
software (Essen BioScience) to determine target impairments such as circling, ataxia, paralysis, adoptively transferred engineered T cells, brain
cell survival. Data were summarized as mean ± SE. limping, head tilt, balance problems, seizures, and spleen were harvested after perfusion with
and weight loss) was reached. cold PBS. Brains were mechanically minced
Assessment of autoreactive T cell activation In the EAE experiments, we used an adop- and treated at 37°C for 30 min with a digestion
CD4+ control or synNotch–IL-10 T cells were tive transfer model as previously described (46). mixture consisting of Collagenase D (30 mg/
cultured with K562s expressing BCAN, CD4+, Briefly, naive 8‑ to 14-week‑old C57BL/6 female ml) and DNAse (10 mg/ml) and soybean tryp-
and CD25+ MOG TCR [isolated from C57BL/ mice (The Jackson Laboratory #000664) were sin inhibitor (20 mg/ml). The resulting brain
6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J mice, The injected subcutaneously with 100 µg/mouse of homogenate was resuspended in 30% Percoll
Jackson Laboratory #006912], APC [splenic MOG peptide in 0.1 ml of an emulsion of CFA (GE Healthcare), underlaid with 70% Percoll,
cells that are CD4–, isolated from C57BL/6- containing 4 mg/ml Mycobacterium tuber- and then centrifuged for 30 min at 650g. En-
Tg(Tcra2D2,Tcrb2D2)1Kuch/J mice, The Jackson culosis H37Ra (DIFCO Laboratories) and PBS riched brain-infiltrating T cells were recovered
Laboratory] in the presence of MOG P35-55 (1:1). Ten days later, draining lymph nodes and at the 70%–30% interface and stained with
(50mg/ml) at [Link] ratio (5 × 104 each) for 4 days. spleens were collected, single‑cell suspensions fluorescently conjugated antibodies against
Cells and supernatant were further processed were prepared, and cells were stimulated at CD3 (5 µl, BD Biosciences, catalog no. 555342),
as described in the figures. 4.5 × 106 cells/ml with 10 µg/ml of MOG P35- CD45 (5 µl, BD Biosciences, catalog no. 564357),
55 peptide in the presence of 20 ng/ml CD69 (5 ml, BD Biosciences, catalog no. 567066),
Assessment of microglial inflammation inhibition recombinant mouse IL-23 (R&D Systems, cat- and CD103 (5 ml, Thermo Fisher Scientific, cat-
CD4+ control or synNotch–IL-10 T cells were alog no. 1887-ML-010) and 10 ng/ml recombi- alog no. 25-1038-42), CD49d (4 ml, BD Bio-
cultured with K562s expressing BCAN and BV2 nant mouse IL-6 (R&D Systems, catalog no. sciences, catalog no. 563458), CXCR3 (3 ml,
microglia cells at 1 × 105, 1 × 105, and 1 × 104, 406-ML-005). After three days of culture, cells BD Biosciences, catalog no. 741005) for 1 hour
respectively, for 24 hours in medium contain- were harvested, washed, and 20 to 25 × 106 at 4°C. Before staining with antibodies, cells were
ing LPS (100 ng/ml) and murine IFN-g (0.5 ng/ cells were injected intraperitoneally into each stained with BD Horizon Fixability Viability
ml). Cells and supernatant were further pro- naive recipient 8- to 14-week-old RAG1–/– Stain 780 (BD Biosciences) to discriminate live
cessed as described in the figures. mouse (The Jackson Laboratories #002216). from dead cells. Data were collected on an
Attune NxT Flow Cytometer and the analysis
In vivo mouse experiments Immunofluorescence was performed in FlowJo software (TreeStar).
All mouse experiments were conducted ac- Mice were euthanized before being perfused
cording to institutional animal care and use transcardially with cold PBS. Brains were Quantification of IL-10 from the serum and
committee (IACUC)–approved protocols. For then removed and fixed overnight in 4% CNS homogenates
the orthotopic model with GBM6, and GBM39 paraformaldehyde–PBS before being transfer- Blood was collected from intracardial puncture
5.0 × 104 GBM6-luc-mCherry or GBM39-luc- red to 30% sucrose and were allowed to sink and let to clot at room temperature, followed

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 11 of 13


RES EARCH | R E S E A R C H A R T I C L E

by centrifugation to collect the serum. Because 9. K. Bielamowicz et al., Trivalent CAR T cells overcome interpatient 30. E. Makhoul, F. Dadmanesh, High expression of trophoblast cell
in the EAE model, most of the inflammatory antigenic variability in glioblastoma. Neuro-oncol. 20, 506–518 surface antigen 2 in triple-negative breast cancer identifies a
(2018). doi: 10.1093/neuonc/nox182; pmid: 29016929 novel therapeutic target. Am. J. Clin. Pathol. 152
demyelinating lesions occur in the spinal cord 10. M. Hegde et al., Combinational targeting offsets antigen escape (Supplement_1), S37 (2019). doi: 10.1093/ajcp/aqz113.001
(65), we collected the spinal cord as represen- and enhances effector functions of adoptively transferred 31. D. Liu et al., Trop-2-targeting tetrakis-ranpirnase has potent
tative of the CNS in the context of EAE. Mice T cells in glioblastoma. Mol. Ther. 21, 2087–2101 (2013). antitumor activity against triple-negative breast cancer.
doi: 10.1038/mt.2013.185; pmid: 23939024 Mol. Cancer 13, 53 (2014). doi: 10.1186/1476-4598-13-53;
were perfused with PBS, and the spinal cords 11. J. Wykosky, D. M. Gibo, C. Stanton, W. Debinski, EphA2 as a pmid: 24606732
were collected and immediately flash frozen in novel molecular marker and target in glioblastoma multiforme. 32. G. Schett, M. F. Neurath, Resolution of chronic inflammatory
liquid nitrogen. The tissues were then mecha- Mol. Cancer Res. 3, 541–551 (2005). doi: 10.1158/1541-7786. disease: Universal and tissue-specific concepts. Nat.
MCR-05-0056; pmid: 16254188 Commun. 9, 3261 (2018). doi: 10.1038/s41467-018-05800-6;
nically dissociated in homogenizing buffer [1% 12. L. A. Johnson et al., Gene therapy with human and mouse pmid: 30111884
Triton X-100, 0.5% NP-40 (tergitol), 25 mM T-cell receptors mediates cancer regression and targets 33. Y. N. Lamb, Ocrelizumab: A review in multiple sclerosis.
Tris-HCl, pH 7.5, 100 mM NaCl, supplemented normal tissues expressing cognate antigen. Blood 114, Drugs 82, 323–334 (2022). doi: 10.1007/s40265-022-01672-9;
535–546 (2009). doi: 10.1182/blood-2009-03-211714; pmid: 35192158
with HaltProtease and Phosphatase Inhibitor
pmid: 19451549 34. P. Maggi et al., B cell depletion therapy does not resolve
Cocktail from Thermo Fisher Scientific) using 13. M. R. Parkhurst et al., T cells targeting carcinoembryonic chronic active multiple sclerosis lesions. EBioMedicine 94,
beads and shaking on the Qiagen TissueLyser II. antigen can mediate regression of metastatic colorectal cancer 104701 (2023). doi: 10.1016/[Link].2023.104701;
After BCA protein concentration quantification, but induce severe transient colitis. Mol. Ther. 19, 620–626 pmid: 37437310
(2011). doi: 10.1038/mt.2010.272; pmid: 21157437 35. X. Montalban et al., Ocrelizumab versus placebo in primary
the samples were resuspended at 2 mg/ml. 14. R. A. Morgan et al., Cancer regression and neurological progressive multiple sclerosis. N. Engl. J. Med. 376, 209–220
The serum was analyzed by Luminex per the toxicity following anti-MAGE-A3 TCR gene therapy. J. Immunother. (2017). doi: 10.1056/NEJMoa1606468; pmid: 28002688
manufacturer’s instructions after a 1:2 dilution. 36, 133–151 (2013). doi: 10.1097/CJI.0b013e3182829903; 36. J. Zhan, M. Kipp, W. Han, H. Kaddatz, Ectopic lymphoid follicles

Downloaded from [Link] at Washington University on December 18, 2024


pmid: 23377668 in progressive multiple sclerosis: From patients to animal
The tissue homogenates were analyzed with an 15. R. A. Morgan et al., Case report of a serious adverse event models. Immunology 164, 450–466 (2021). doi: 10.1111/
IL-10 ELISA kit (BioLegend, catalog no. 431414) following the administration of T cells transduced with a imm.13395; pmid: 34293193
after a 1:2 dilution. chimeric antigen receptor recognizing ERBB2. Mol. Ther. 18, 37. H. Wiendl, O. Neuhaus, L. Kappos, R. Hohlfeld, [Multiple
843–851 (2010). doi: 10.1038/mt.2010.24; pmid: 20179677 sclerosis. Current review of failed and discontinued clinical
16. S. E. Syafruddin, W. F. W. M. Nazarie, N. A. Moidu, B. H. Soon, trials of drug treatment]. Nervenarzt 71, 597–610 (2000).
Assessment of mouse motility M. A. Mohtar, Integration of RNA-Seq and proteomics data doi: 10.1007/s001150050636; pmid: 10996910
Mice movements were recorded using an iPhone identifies glioblastoma multiforme surfaceome signature. 38. B. Cannella, Y. L. Gao, C. Brosnan, C. S. Raine, IL-10 fails to
BMC Cancer 21, 850 (2021). doi: 10.1186/s12885-021-08591-0; abrogate experimental autoimmune encephalomyelitis.
after the experimenter introduced their hand in pmid: 34301218 J. Neurosci. Res. 45, 735–746 (1996). doi: 10.1002/(SICI)1097-
the cage and either gave a gentle push or moved 17. B. Engelhardt, T cell migration into the central nervous system 4547(19960915)45:6<735::AID-JNR10>[Link];2-V; pmid: 8892085
the mice to the center of the cage. Individual during health and disease: Different molecular keys allow 39. R. D. Huhn et al., Pharmacodynamics of subcutaneous
access to different central nervous system compartments. recombinant human interleukin-10 in healthy volunteers.
traces of the mice were obtained using the
Clin. Exp. Neuroimmunol. 1, 79–93 (2010). doi: 10.1111/j.1759- Clin. Pharmacol. Ther. 62, 171–180 (1997). doi: 10.1016/
Fiji plugin Manual Tracking for the next 240 1961.2010.009.x S0009-9236(97)90065-5; pmid: 9284853
frames (8 s). To account for camera move- 18. P. M. Kollis et al., Characterising distinct migratory profiles of 40. A. J. Kastin, V. Akerstrom, W. Pan, Interleukin-10 as a CNS
ments, the corners of the cage were also tracked, infiltrating T-cell subsets in human glioblastoma. Front. Immunol. therapeutic: The obstacle of the blood-brain/blood-spinal cord
13, 850226 (2022). doi: 10.3389/fimmu.2022.850226; barrier. Brain Res. Mol. Brain Res. 114, 168–171 (2003).
and the mouse displacements were adjusted pmid: 35464424 doi: 10.1016/S0169-328X(03)00167-0; pmid: 12829328
accordingly. 19. L. Wilkinson, T. Gathani, Understanding breast cancer as a 41. L. Li, J. F. Elliott, T. R. Mosmann, IL-10 inhibits cytokine
global health concern. Br. J. Radiol. 95, 20211033 (2022). production, vascular leakage, and swelling during T helper
Statistical analysis doi: 10.1259/bjr.20211033; pmid: 34905391 1 cell-induced delayed-type hypersensitivity. J. Immunol. 153,
20. J. P. Leone, B. A. Leone, Breast cancer brain metastases: 3967–3978 (1994). doi: 10.4049/jimmunol.153.9.3967;
All statistical analyses were performed with The last frontier. Exp. Hematol. Oncol. 4, 33 (2015). doi: 10.1186/ pmid: 7930605
Prism software version 9.0 (GraphPad) as de- s40164-015-0028-8; pmid: 26605131 42. D. J. Cua, B. Hutchins, D. M. LaFace, S. A. Stohlman,
21. R. A. Hernandez-Lopez et al., T cell circuits that sense R. L. Coffman, Central nervous system expression of IL-10
scribed in the figures and legends. antigen density with an ultrasensitive threshold. Science inhibits autoimmune encephalomyelitis. J. Immunol. 166,
371, 1166–1171 (2021). doi: 10.1126/science.abc1855; 602–608 (2001). doi: 10.4049/jimmunol.166.1.602;
pmid: 33632893 pmid: 11123343
RE FE RENCES AND N OT ES 22. D. P. Kodack et al., Combined targeting of HER2 and VEGFR2 43. E. Bettelli et al., Myelin oligodendrocyte glycoprotein-specific
1. V. L. Feigin et al., Global, regional, and national burden of for effective treatment of HER2-amplified breast cancer brain T cell receptor transgenic mice develop spontaneous
neurological disorders during 1990-2015: A systematic analysis metastases. Proc. Natl. Acad. Sci. U.S.A. 109, E3119–E3127 autoimmune optic neuritis. J. Exp. Med. 197, 1073–1081
for the Global Burden of Disease Study 2015. Lancet Neurol. (2012). doi: 10.1073/pnas.1216078109; pmid: 23071298 (2003). doi: 10.1084/jem.20021603; pmid: 12732654
16, 877–897 (2017). doi: 10.1016/S1474-4422(17)30299-5; 23. J. Ni et al., Combination inhibition of PI3K and mTORC1 yields 44. N. Gresa-Arribas et al., Modelling neuroinflammation in vitro:
pmid: 28931491 durable remissions in mice bearing orthotopic patient-derived A tool to test the potential neuroprotective effect of anti-
2. G. C. Terstappen, A. H. Meyer, R. D. Bell, W. Zhang, Strategies xenografts of HER2-positive breast cancer brain metastases. inflammatory agents. PLOS ONE 7, e45227 (2012).
for delivering therapeutics across the blood-brain barrier. Nat. Med. 22, 723–726 (2016). doi: 10.1038/nm.4120; doi: 10.1371/[Link].0045227; pmid: 23028862
Nat. Rev. Drug Discov. 20, 362–383 (2021). doi: 10.1038/ pmid: 27270588 45. M. L. Elkjaer et al., Molecular signature of different lesion
s41573-021-00139-y; pmid: 33649582 24. C. Aversa et al., Metastatic breast cancer subtypes and central types in the brain white matter of patients with progressive
3. J. Smolders et al., Tissue-resident memory T cells populate the nervous system metastases. Breast 23, 623–628 (2014). multiple sclerosis. Acta Neuropathol. Commun. 7, 205 (2019).
human brain. Nat. Commun. 9, 4593 (2018). doi: 10.1038/ doi: 10.1016/[Link].2014.06.009; pmid: 24993072 doi: 10.1186/s40478-019-0855-7; pmid: 31829262
s41467-018-07053-9; pmid: 30389931 25. N. U. Lin et al., Sites of distant recurrence and clinical 46. S. A. Sagan et al., T cell deletional tolerance restricts AQP4
4. L. Morsut et al., Engineering customized cell sensing and outcomes in patients with metastatic triple-negative breast but not MOG CNS autoimmunity. Proc. Natl. Acad. Sci. U.S.A.
response behaviors using synthetic Notch receptors. Cell 164, cancer: High incidence of central nervous system metastases. 120, e2306572120 (2023). doi: 10.1073/pnas.2306572120;
780–791 (2016). doi: 10.1016/[Link].2016.01.012; pmid: 26830878 Cancer 113, 2638–2645 (2008). doi: 10.1002/cncr.23930; pmid: 37463205
5. J. H. Choe et al., SynNotch-CAR T cells overcome challenges of pmid: 18833576 47. Y. Sonobe et al., Chronological changes of CD4(+) and CD8(+)
specificity, heterogeneity, and persistence in treating 26. C. K. Anders et al., The prognostic contribution of clinical T cell subsets in the experimental autoimmune
glioblastoma. Sci. Transl. Med. 13, eabe7378 (2021). breast cancer subtype, age, and race among patients with encephalomyelitis, a mouse model of multiple sclerosis.
doi: 10.1126/scitranslmed.abe7378; pmid: 33910979 breast cancer brain metastases. Cancer 117, 1602–1611 (2011). Tohoku J. Exp. Med. 213, 329–339 (2007). doi: 10.1620/
6. R. Dannenfelser et al., Discriminatory power of combinatorial doi: 10.1002/cncr.25746; pmid: 21472708 tjem.213.329; pmid: 18075237
antigen recognition in cancer T cell therapies. Cell Syst. 11, 27. W. Zhao et al., Trop2 is a potential biomarker for the promotion 48. P. M. Mathisen, M. Yu, J. M. Johnson, J. A. Drazba, V. K. Tuohy,
215–228.e5 (2020). doi: 10.1016/[Link].2020.08.002; of EMT in human breast cancer. Oncol. Rep. 40, 759–766 Treatment of experimental autoimmune encephalomyelitis
pmid: 32916097 (2018). doi: 10.3892/or.2018.6496; pmid: 29901160 with genetically modified memory T cells. J. Exp. Med. 186,
7. J. W. Fawcett, T. Oohashi, T. Pizzorusso, The roles of 28. A. Shvartsur, B. Bonavida, Trop2 and its overexpression in 159–164 (1997). doi: 10.1084/jem.186.1.159; pmid: 9207010
perineuronal nets and the perinodal extracellular matrix cancers: Regulation and clinical/therapeutic implications. 49. M. K. Shaw et al., Local delivery of interleukin 4 by retrovirus-
in neuronal function. Nat. Rev. Neurosci. 20, 451–465 (2019). Genes Cancer 6, 84–105 (2015). doi: 10.18632/ transduced T lymphocytes ameliorates experimental
doi: 10.1038/s41583-019-0196-3; pmid: 31263252 genesandcancer.40; pmid: 26000093 autoimmune encephalomyelitis. J. Exp. Med. 185, 1711–1714
8. C. Nicholson, E. Syková, Extracellular space structure revealed 29. M. Trerotola et al., Upregulation of Trop-2 quantitatively (1997). doi: 10.1084/jem.185.9.1711; pmid: 9151908
by diffusion analysis. Trends Neurosci. 21, 207–215 (1998). stimulates human cancer growth. Oncogene 32, 222–233 50. C. H. Chang, M. Furue, K. Tamaki, B7-1 expression of
doi: 10.1016/S0166-2236(98)01261-2; pmid: 9610885 (2013). doi: 10.1038/onc.2012.36; pmid: 22349828 Langerhans cells is up-regulated by proinflammatory

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 12 of 13


RES EARCH | R E S E A R C H A R T I C L E

cytokines, and is down-regulated by interferon-gamma or by genetic cargos for cancer therapy. Drug Deliv. Transl. Res. 13, P.P-C., J.H., R.Z., B.N., W.Y., Y.T., L.C., N.R.R., O.T., S.H., M.R.W.,
interleukin-10. Eur. J. Immunol. 25, 394–398 (1995). 2719–2738 (2023). doi: 10.1007/s13346-023-01362-3; S.S.Z., H.O., W.A.L.; Methodology: M.S.S., P.B.W., S.G., S.S.Z.,
doi: 10.1002/eji.1830250213; pmid: 7533084 pmid: 37301780 H.O., W.A.L.; Project administration: M.S.S., S.G., M.R.W.,
51. L. Ding, P. S. Linsley, L. Y. Huang, R. N. Germain, E. M. Shevach, 63. W. A. Lim, The emerging era of cell engineering: Harnessing S.S.Z., H.O., W.A.L.; Supervision: M.R.W., S.S.Z., H.O., W.A.L.;
IL-10 inhibits macrophage costimulatory activity by the modularity of cells to program complex biological function. Visualization: M.S.S., P.B.W., Y. W., H.O., W.A.L.; Writing – original
selectively inhibiting the up-regulation of B7 expression. Science 378, 848–852 (2022). doi: 10.1126/science.add9665; draft: M.S.S., [Link]., H.O., W.A.L.; Writing – review & editing:
J. Immunol. 151, 1224–1234 (1993). doi: 10.4049/ pmid: 36423287 M.S.S., P.B.W., S.G., Y.W., M.R.W., S.S.Z., H.O., W.A.L. Competing
jimmunol.151.3.1224; pmid: 7687627 64. A. Bardia et al., Sacituzumab Govitecan-hziy in refractory interests: Several patents have been filed related to this work.
52. J. A. Sosman et al., Interleukin 10-induced thrombocytopenia in metastatic triple-negative breast cancer. N. Engl. These include, but are not limited to, US APP # 63/464,497,
normal healthy adult volunteers: Evidence for decreased J. Med. 380, 741–751 (2019). doi: 10.1056/NEJMoa1814213; 17/042,032, 17/040,476, 17/069,717, 15/831,194, 15/829,370,
platelet production. Br. J. Haematol. 111, 104–111 (2000). pmid: 30786188 15/583,658, 15/096,971, and 15/543,220. W.A.L. is shareholder
pmid: 11091188 65. H. Lassmann, M. Bradl, Multiple sclerosis: Experimental of Gilead Sciences, Allogene, and Intellia Therapeutics, and
53. A. J. Hou, L. C. Chen, Y. Y. Chen, Navigating CAR-T cells models and reality. Acta Neuropathol. 133, 223–244 (2017). previously consulted for Cell Design Labs, Gilead, Allogene, and
through the solid-tumour microenvironment. Nat. Rev. Drug doi: 10.1007/s00401-016-1631-4; pmid: 27766432 SciFi Foods. H.O. is on the on the scientific advisory boards
Discov. 20, 531–550 (2021). doi: 10.1038/s41573-021-00189-2; for Neuvogen and Eureka Therapeutics. S.L.H. currently serves on
pmid: 33972771 ACKN OWLED GMEN TS the scientific advisory boards of Accure, Alector, and Annexon;
54. W. A. Lim, C. H. June, The Principles of Engineering Immune We thank N. Blizzard, R. Almeida, M. Broeker, P. Lopez Pazmino, has previously consulted for BD, Moderna, NGM Bio, and
Cells to Treat Cancer. Cell 168, 724–740 (2017). doi: 10.1016/ S. Sidhu, J. Garbarino, and members of the W.A.L., S.S.Z. and H.O. Pheno Therapeutics; and previously served on the board of
[Link].2017.01.016; pmid: 28187291 laboratories for assistance, advice, and helpful discussions. We directors of Neurona. S.L.H. has received travel reimbursement
55. D. J. Irvine, M. V. Maus, D. J. Mooney, W. W. Wong, The future of thank the UCSF Flow Cytometry Core and Microscopy Core. Funding: and writing support from F. Hoffmann-La Roche and Novartis
engineered immune cell therapies. Science 378, 853–858 (2022). This work was supported by the Weill Institute for Neurosciences, AG for anti-CD20 therapy–related meetings and presentations.
doi: 10.1126/science.abq6990; pmid: 36423279 the National Cancer Institute (NCI) of the National Institutes of The remaining authors declare no competing interests. Data and
56. S. B. Hladky, M. A. Barrand, Mechanisms of fluid movement Health (NIH grant U54CA244438 to W.A.L.); the National Institute materials availability: All data are available in the main

Downloaded from [Link] at Washington University on December 18, 2024


into, through and out of the brain: Evaluation of the evidence. of Neurological Disorders and Stroke of the NIH (NINDS grant manuscript or supplementary materials. Reagents are available
Fluids Barriers CNS 11, 26 (2014). doi: 10.1186/2045-8118-11-26; R35NS105068 to H.O.); the National Cancer Institute (grant from the corresponding author upon reasonable request.
pmid: 25678956 P50CA097257 to H.O.); the Sandler Foundation Glioma Precision Plasmids from this paper will be made available on Addgene.
57. B. A. C. Cree et al., Silent progression in disease activity-free Medicine Program (H.O. and W.A.L.); the Emerson Collective License information: Copyright © 2024 the authors, some rights
relapsing multiple sclerosis. Ann. Neurol. 85, 653–666 (2019). Cancer Research Fund (W.A.L.); the Mary Jane and Carl Panattoni reserved; exclusive licensee American Association for the
doi: 10.1002/ana.25463; pmid: 30851128 Charitable Foundation (H.O.); the Parker Institute for Cancer Advancement of Science. No claim to original US government
58. G. Giovannoni et al., Smouldering multiple sclerosis: The ‘real Immunotherapy (H.O.); the Marcus Program (Transformative works. [Link]
MS’. Ther. Adv. Neurol. Disord. 15, 17562864211066751 (2022). Integrated Research Award to W.A.L.); the Advanced Research article-reuse. This research was funded in whole or in part
doi: 10.1177/17562864211066751; pmid: 35096143 Projects Agency for Health (ARPA-H contract D24AC00084-00 by NIH/NCI grant U54CA244438 through the Cancer
59. N. R. Reddy et al., Engineering synthetic suppressor T cells to W.A.L.); the National Multiple Sclerosis Society (grant FG-1907- Moonshot initiative. The author will make the Author Accepted
that execute locally targeted immunoprotective programs. 34738 to M.S.S.); the UCSF Living Therapeutics Initiative (W.A.L.); Manuscript (AAM) version available under a CC BY public
Science 386, eadl4793 (2024). doi: 10.1126/science.adl4793 the Valhalla Foundation (W.A.L.); the UCSF Cell Design Institute copyright license.
60. A. M. Levin et al., Exploiting a natural conformational switch to (W.A.L.); and the UCSF Helen Diller Family Comprehensive Cancer
engineer an interleukin-2 ‘superkine’. Nature 484, 529–533 Center (HDFCCC) Laboratory for Cell Analysis Shared Resource SUPPLEMENTARY MATERIALS
(2012). doi: 10.1038/nature10975; pmid: 22446627 Facility (supported by NIH NCI award P30CA082103). The content
[Link]/doi/10.1126/science.adl4237
61. R. A. Saxton et al., Structure-based decoupling of the pro- is solely the responsibility of the authors and does not necessarily
Figs. S1 to S13
and anti-inflammatory functions of interleukin-10. Science 371, represent the official views of the NIH. Author contributions:
Movie S1
eabc8433 (2021). doi: 10.1126/science.abc8433; pmid: 33737461 Conceptualization: M.S.S., P.B.W., S.G., S.S.Z., H.O., W.A.L.;
62. D. M. Dogbey et al., Technological advances in the use of Funding acquisition: M.S.S., S.G., M.R.W., S.S.Z., H.O., W.A.L.; Submitted 20 October 2023; accepted 23 September 2024
viral and non-viral vectors for delivering genetic and non- Investigation: M.S.S., P.B.W., S.G., Y.W., S.A.S., J.D., C.S., D. D., 10.1126/science.adl4237

Simic et al., Science 386, eadl4237 (2024) 6 December 2024 13 of 13

You might also like