1
Genes
1. Aims and Objectives
This project intends to create a virtual manufacturing mode in which the selective
protein of interest, the Cystic Fibrosis Trans- membrane Conductance Regulator (CFTR), will
be processed using the most appropriate strategies and methodologies for its optimum
production. CFTR protein provides the necessary salt and water gradient-sensitive pumps in
different cell types across the whole body.
2. Introduction (Literature Review):
The CFTR protein (Cystic Fibrosis Trans-membrane Conductance Regulator) is the
cornerstone of maintaining an ionic relationship, especially between chloride ions and water,
when crossing the cellular membrane within the body. This glycolipid with an approximate
molecular weight of 170 kDa, a self-assembled complicated protein, acts like a secure
channel for the transportation of these necessary molecules.
Mehta et al. (2021) considered the important factor of treatment compliance in CFTR
modulator therapy. The research work thus clarified the details regarding the extent of
compliance of those with cystic fibrosis with the required CFTR modulators, which constitute
the backbone of the health management of these conditions. The study completes a thorough
review of the prescription compliance levels of medications.
Fukuda and Okiyoneda (2020) stated that the gene for CFTR concerned with
codifying this protein itself is the gene that is considered to be very important with regard to
various tissues like the lungs, pancreas, and sweat glands. The disease, however, can occur in
cases where mutations in the gene exist, with the unmitigated consequences leading to cystic
fibrosis, a genetic disorder that affects different body systems. Cystic fibrosis refers to the
2
accumulation of mucus, which is thick and sticky in certain organs, mainly resulting in lungs
and pancreas obstruction. The formation of very thick mucus that blocks the airways makes it
possible for many infections to happen, and eventually breathing becomes challenging, and
respiratory failure is the effect.
Hanssens et al. (2021), another area in which the gut environment is highly involved
is the digestive system, which often causes malnutrition and other digestive symptoms that
arise from the altered functioning of the pancreas and other digestive organs. The degree and
expression of CF depend significantly on the type of fault in the CFTR gene and the
mutations present in the affected protein; thus, there is a wide variation in how the disorder
appears and causes symptoms among individuals. Some mutations may cause no CFTR
protein at all or a functionally non-effective one, while others may give way to partial
impairment or altered regulation of its activity if they occur. Being the proteins causing the
defects, the scientific community is there to study the various strategies they can use in the
biosynthesis and function of this relevant protein.
ncbi (2021) states that recombinant CFTR proteins could be produced through
functional expression systems, e.g., one that uses Escherichia coli, which is probably the most
common. This provides for the short time required to double the population, while the
handling and directing of these organisms become more straightforward with time; hence,
high yields are feasible as well. But a drawback that secretly might happen here is that
bacterial hosts cannot do some of the mature modifications, as this can affect protein
maturation and function. On the contrary, eukaryotic expression systems, for example, yeast
or mammalian cell cultures, have also been harnessed to obtain CFTR proteins in appropriate
amounts. These systems provide the operations that are advantageous, and they involve the
proper folding of proteins after translational modifications (e.g., glycosylation) and also have
3
the potential to represent the structure and function of the protein in a more accurate manner.
However, such systems can be many-fold more complicated, lengthy, and not as scalable as
bacterial expression systems.
3. Identify the Open Reading Frame (ORF):
The determination of ORF plays an important role in DNA sequence research because
it helps in not only characterization but also understanding of the genetic information. The
ORF represents the region of a gene that encodes this part of the DNA sequence, which is
responsible for the protein sentry. In this particular background of the CFTR gene sequence,
the ORF can be described as beginning with the start codon (ATG) and finishing with the end
codon (TAG, TAA, or TGA). These point to molecular signals that rule the limits of
transcribing the codons and create the genetic sequence that accounts for the corresponding
amino acid strings. Using FASTA format, scientists can spot the exact location of start and
stop codons by analyzing the ordered sequence of nucleotides included in the given DNA
sequence. The ATG codon, known as the start of the translation process in proteome
synthesis, is the beginning of the ORF. The reverse side of the coin is the creation of the
termination codon, which is either TAG, TAA, or TGA, and this stops the process of
translation and thus the end of the coding sequence.
The starting and end codons can be identified in a gene sequence once the direction is
specified, and it is possible to determine the code region between these two points as the ORF
of the CFTR gene. The key portion of the nucleotide string contains accurate genetic
information that is needed for the fabrication of the CFTR protein, which is a major
component in maintaining the proper balance of chloride ions and water across cell
membranes, among other lipid bilayers. The correct identification of the ORF of genes is the
first step in studying and applying them for various scientific and clinical purposes. Such
means permit scientists to narrow down the region in which the relevant region is to be
4
focused. This allows advancements in expression, cloning, and analysis of the gene,
thereafter, in a relevant expression system. Another consequence of the ORF designation is
the facilitation of primers for PCR amplification as well as the subsequent cloning of the gene
into appropriate expression vectors. Researchers can pinpoint the coding region where
treatment is essential and go on to generate that respective CFTR protein for follow-up
studies or potential therapeutic measures.
Results
The data analysis should not be an exceptional part because, for the final stages to happen,
the next steps should include the expression of the cloning of the CFTR gene. It encompasses
four key elements: in short, it provides information on the codon sequence, nucleotide
sequence, restriction enzyme map, and primers for the PCR procedure.
a. Amino Acid Sequence
Precisely, with the correct matching of the cystic fibrosis trans-membrane
conductance regulator amino acid sequence, the protein structure will also function. Also, the
protein will engage in the biological system's interactions. Through a process of translation of
the open reading frame region and then genetic codons, researchers can gain insight into the
specific DNA sequences that make up the CFTR protein structure. With the help of this
sequence strategy platform, the scientists can be more specific in the protein's structure and
also determine the processing, folding, and functional domains, which is exactly the way
towards their successful research and application.
b. Nucleotide Sequence
Nucleotide sequences of the CFTR gene (FASTA format) function as the base
template on which the DNA sequences that carry the encoded protein's information are
developed (Blokh et al., 2020). In both diagnostic and research settings, primer design, such
5
as in polymerase chain reaction (PCR) amplification, cloning and genetic alterations in
expression vectors, genetic variation organization, or bio-informatical studies, all carry
different implications. It functions as both a delivery person and the decoder of the CFTR
gene, and other drugs are made to fit into this mode of action.
c. Restriction Enzyme Map
Constructing a restriction enzyme map that will give a momentary space for the
cloning methodology is a good technique. These sequences help with the knowledge of which
regions are potentially going to lose as the enzyme gets snipped. By extrapolation, this means
the protein encoded by the CFTR gene. Here, the scientists deal with the doublets that the 5'
sequences of DNA form and the address of the cut-off (Maiden, 2019). Researchers, with the
help of DNA sequences, will now be fearless to ligate and manipulate gene insertion into the
host organism. CFTR gene editing with precision is enabled by the policy enzyme map,
which is supposed to be one of the most important tools to cut the genetic.
d. PCR Primers
The CFTR gene probing is done by some exclusive forward and reverse primers that
facilitate graphically showcasing the results. This helps the scientists pick up a certain DNA
strand, which is the 3'-UTR part of the gene, using the polymerase chain reaction (PCR).
Such a process makes it possible to find and investigate the part of the DNA required for the
genetic spread of HIV (Kennedy et al., 2023). The precise primer design is the fundamental
base that will be used for the target sequence identification of the gene and is necessary for a
reaction with the gene for further expression.
6. Cloning Strategy
Implementing a good cloning strategy in the production of the CFTR gene for
improved expression of plasmid DNA vectors and protein production is at the core of the
6
process. Such a method requires us to be extremely attentive to so many components,
including the choice of approach, genes, and the effect that this will have on the body. One
method that is widely used is to construct deoxyribonucleic acid-nipped ends for the purpose
of ligation using restriction enzymes. Researchers can first accurately pin-point the enzymes
that will be used for the cut points in the CFTR gene and the expression vector because the
map was created for restriction enzymes(Wang et al., 2021). The resulting actions will be the
complementary overhangs being produced through the ligation reaction. Along that line,
modern cloning techniques, including Gateway cloning or Gibson assembly, that recombine
genes provide a more straightforward and rapid approach to genetic engineering by inserting
the gene into the vector. This design is fusion technique-oriented, which makes use of site-
specific recombination or enzymatic assembly to allow individuals to directly integrate the
CFTR gene into the expression vector without the traditional need for restriction enzyme
digestion and ligation steps.
7. Expression System:
The choice of the proper movement system is the key question that has to be resolved
for the virtual mass manufacture of the CFTR proteins. Whether the expression system
should be selected or not might notably overturn the quality of the protein in terms of
solubility, post-translational modification, and overall yield. Therefore, it is imperative to
have a have an optimum expression system for the success and efficacy of the production of
the desired protein. Prokaryotic expression systems like E. coli (E. coli) have some benefits
for which recombinant protein production is facilitated. These systems typically operate
according to low cost efficiency, are highly flexible, but at the same time yield a high
concentration of target proteins (Stanke et al., 2023). However, since this process can occur
in the cytoplasm of eukaryotic cells and allows proper protein folding and some specific post-
translational modifications that are required for the proper functional activity of this protein,
7
prokaryotic systems may have certain limitations that can’t fully substitute eukaryotic cells
ability to complete these critical post-translational transformations.
In terms of that, prokaryotic expression systems, which contain organisms like
bacteria or E. coli, are the best used for mass production of a protein that perfectly folds and
performs post-translation modifications. These systems are endowed with cellular machinery
capable of accomplishing particular post-translational processes like glycosylation and
disulfide bond formation. These modifications can influence the CFTR protein’s structure as
well as its functionality (Williams et al., 2020). Bayer’s push to test their new product on
eukaryotes rather than prokaryotes does have several long-lasting implications. The primary
one being that the production costs are greater since the maintenance and growth of
eukaryotic systems are not as efficient as compared to prokaryotic systems.
The method of protein expression is critical in the expression of the CFTR protein,
and this consideration should entail things such as the protein's solubility, the presence of
specific post-translational modifications, and production scalability for downstream
applications or interventions that include therapeutic measures as well as repeatable uses. If
cro-translational modifications are critical for the CFTR protein, a eu-karya site may be more
pertinent, although it may probably be at the cost of production volume and feasibility
(Williams et al., 2020). Whether millet, sweet potatoes, or another expression system is going
to be chosen, optimization is going to play a determining factor in the protein yield. Among
others, issues involved in growth media composition, induction conditions (e.g., temperature,
inducer concentration), and the specific harvesting time can lead to significant protein CFTR
expression yield variability. The detailed optimization experiments and the careful
consideration of the important steps of the protein production process should be of essence in
order to make the industrial mass production of proteins cost-effective and efficient.
8
8. Host Selection:
For the species dependent on the chosen expression system, a host organism with an
adequate growth system must be chosen. The popularity of prokaryotic expression systems is
mostly based on Escherichia coli strains BL21 (DE3) and Rosetta, for example (Watcharin
Chumjan et al., 2023). The current guide provides host systems for eukaryotic expression,
including mention of yeast strains (e.g., Pichia pastoris, Saccharomyces cerevisiae), insect
cell lines (e.g., Sf9, High Five), or mammalian cell lines (e.g., CHO, HEK293). The host that
is chosen to make the process proteins expressive efficiently should be a system that is
controlled by proper growth conditions, for example, media composition, pH, temperature,
and strength of induction. In addition, a number of genetic changes may be engineered in a
host organism to improve its product proteins (the production of soluble proteins with a stable
status or easily secreted ones).
9. Purification Protocols:
Extensive purification methodologies have to be designed to allow for achieving high
quality and quantity of the single CFTR protein while all its key structural and performance
features have not been compromised. The strategy of purification will probably be based on a
variety of techniques, like affinity chromatography (e.g., by means of histidine-tag or
glutathione-S-transferase fusion proteins), anion-exchange chromatography, size-exclusion
chromatography, or hydrophobic interaction chromatography (Williams et al., 2020). It is
essential to adopt purification protocols that are highly specific and efficient while also being
scalable and practicing production at a virtual mass scale. Furthermore, storage conditions
and formulations for stability and prolonging the functionality of the purified proteins have
an impact (Williams et al., 2020). By detailing each step and addressing each aspect in detail,
a detailed report can be prepared, which would define strategies and methodologies to be
9
used in the process of mass production of the protein known as CFTR on the basis of virtual
means.
In conclusion, CFTR therapy with engineered DNA sequences for the production of
the CFTR protein in the largest possible number is a complex sequence of stages that starts
with accurate investigation and ends with perfect results. By taking advantage of the whole
data set, such as the amino acid sequence, nucleotide sequence, restriction enzyme map, and
PCR primers, scientists can have the basic scheme for the cloning and expression of the
CFTR gene. A correct decision regarding which technology to use for cloning—either the
traditional restriction enzyme-based strategy or the more advanced recombination protocol—
is very important during the successful process of expression vector design. Besides the
option of an expression system, either prokaryotic or eukaryotic, factors such as protein
solubility, the requirement of protein post-translational modification, and the scale-up of
needs must be considered. Different eukaryotic systems may possess the requisite capabilities
for proper protein folding and modification, but the prokaryotic systems make procedures fast
and yield high yields, although in these cases the quality of the proteins produced should be
considered. Initially, a multi-tiered strategy, which includes computational bioinformatics
analysis, careful experiment setup, and rigorous optimization, will be employed. Through this
process, the CFTR protein will be able to be produced more efficiently and cost-effectively.
The success of addressing this obstacle would give researchers an entryway into further
studies and the development of possible treatments, which might finally give hope to many
cystic fibrosis disease patients.
10
References
Blokh, D., Gitarts, J., & Stambler, I. (2020). An information-theoretical analysis of gene nucleotide
sequence structuredness for a selection of aging and cancer-related genes. Genomics &
Informatics/Genomics & Informatics, 18(4), e41–e41.
https://doi.org/10.5808/gi.2020.18.4.e41
Fukuda, R., & Okiyoneda, T. (2020). Cystic Fibrosis Transmembrane Conductance Regulator
(CFTR) Ubiquitylation as a Novel Pharmaceutical Target for Cystic Fibrosis.
Pharmaceuticals, 13(4), 75. https://doi.org/10.3390/ph13040075
Hanssens, L. S., Duchateau, J., & Casimir, G. J. (2021). CFTR Protein: Not Just a Chloride Channel?
Cells, 10(11), 2844. https://doi.org/10.3390/cells10112844
Kennedy, M., Hosford, C. J., Azumaya, C. M., Luyten, Y. A., Chen, M., Morgan, R. D., & Stoddard,
B. (2023). Structures, activity and mechanism of the Type IIS restriction endonuclease
PaqCI. Nucleic Acids Research, 51(9), 4467–4487. https://doi.org/10.1093/nar/gkad228
Maiden, M. C. J. (2019). The Impact of Nucleotide Sequence Analysis on Meningococcal Vaccine
Development and Assessment. Frontiers in Immunology, 9.
https://doi.org/10.3389/fimmu.2018.03151
Mehta, Z., Kamal, K. M., Miller, R., Covvey, J. R., & Giannetti, V. (2021). Adherence to cystic
fibrosis transmembrane conductance regulator (CFTR) modulators: analysis of a national
specialty pharmacy database. Journal of Drug Assessment, 10(1), 62–67.
https://doi.org/10.1080/21556660.2021.1912352
ncbi. (2021). Homo sapiens CF transmembrane conductance regulator (CFTR), mRNA. NCBI
Nucleotide. https://www.ncbi.nlm.nih.gov/nuccore/NM_000492.4?report=fasta
Parisi, G. F., Mòllica, F., Giallongo, A., Papale, M., Manti, S., & Leonardi, S. (2022). Cystic fibrosis
transmembrane conductance regulator (CFTR): beyond cystic fibrosis. Egyptian Journal of
Medical Human Genetics, 23(1). https://doi.org/10.1186/s43042-022-00308-7
11
Stanke, F., Pallenberg, S. T., Tamm, S., Hedtfeld, S., Eichhorn, E. M., Minso, R., Hansen, G., Welte,
T., Sauer-Heilborn, A., Ringshausen, F. C., Junge, S., Tümmler, B., & Dittrich, A.-M. (2023).
Changes in cystic fibrosis transmembrane conductance regulator protein expression prior to
and during elexacaftor-tezacaftor-ivacaftor therapy. Frontiers in Pharmacology, 14.
https://doi.org/10.3389/fphar.2023.1114584
Wang, W., Zheng, G., & Lu, Y. (2021). Recent Advances in Strategies for the Cloning of Natural
Product Biosynthetic Gene Clusters. Frontiers in Bioengineering and Biotechnology, 9.
https://doi.org/10.3389/fbioe.2021.692797
Watcharin Chumjan, Akira Sangchalee, Cholthicha Somwang, Nattida Mookda, Sriwannee Yaikeaw,
& La-or Somsakeesit. (2023). Outer membrane protein N expressed in Gram-negative
bacterial strain of Escherichia coli BL21 (DE3) Omp8 Rosetta strains under osmoregulation
by salts, sugars, and pHs. PloS One, 18(8), e0288096–e0288096.
https://doi.org/10.1371/journal.pone.0288096
Williams, R. M., Harvey, J. D., Budhathoki-Uprety, J., & Heller, D. A. (2020). Glutathione-S-
transferase Fusion Protein Nanosensor. Nano Letters, 20(10), 7287–7295.
https://doi.org/10.1021/acs.nanolett.0c02691
12
DNA sequence
>NM_000492.4 Homo sapiens CF transmembrane conductance regulator (CFTR), mRNA
ATGGTGCGCGGCGGCGGCGATGCTGCTGTGCTGGCCCCTGCTGCCCGGCGCTGCG
GCTGCC
CGCTGCTGCTGGTCTGGGGCCGCTGCTGCCCGGCGGCGGCGGCGGCGGCGGCGG
CGGCGGC
GGAGACGCGCCAGGGCCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC
GGCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
13
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
14
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
15
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG
GCGGCGG
CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG
