Carsten Carlberg · Stine Marie Ulven

Ferdinand Molnár

Nutrigenomics:
How Science
Works
Nutrigenomics: How Science Works
Carsten Carlberg • Stine Marie Ulven
Ferdinand Molnár

Nutrigenomics: How Science

Works
Carsten Carlberg Stine Marie Ulven
Institute of Biomedicine Department of Nutrition
University of Eastern Finland University of Oslo
Kuopio, Finland Oslo, Norway

Ferdinand Molnár
Department of Biology
Nazarbayev University
Nur-Sultan, Kazakhstan

ISBN 978-3-030-36947-7    ISBN 978-3-030-36948-4 (eBook)

https://doi.org/10.1007/978-3-030-36948-4

© Springer Nature Switzerland AG 2020

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of
the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information
storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology
now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book
are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the
editors give a warranty, expressed or implied, with respect to the material contained herein or for any
errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.

This Springer imprint is published by the registered company Springer Nature Switzerland AG.
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
Preface

Our daily diet is more than a collection of carbohydrates, lipids, and proteins, min-
erals, and vitamins that provide energy and serve as building blocks of our life. It is
also the most dominant environmental signal to which we are exposed from womb
to death. The availability of the sequence of the complete human genome and the
consequent development of next-generation sequencing technologies have signifi-
cantly affected nearly all areas of bioscience. This was the starting point for new
disciplines, such as genomics and its subdiscipline nutrigenomics. The fascinating
area of nutrigenomics describes the daily communication between dietary mol-
ecules, their metabolites, and our genome. Its genomic components comprise not
only the variation of the human genome, such as SNPs (single-nucleotide polymor-
phisms), but also the dynamic packaging of the genome into chromatin, including
all information stored in this epigenome. Moreover, this book discusses the proteins
that are involved in the signal transduction between dietary molecules and the
genome, such as nuclear receptors, chromatin-modifying enzymes, and energy
status-­sensing kinases, and their mechanism of action.
Most noncommunicable diseases, such as T2D (type 2 diabetes) and CVDs (car-
diovascular diseases), are the basis of lifestyle decisions. They have not only a
genetic, inherited component, but to some 80%, they are based on epigenetics
(meaning “above” genetics), i.e., on our lifestyle choices and environmental expo-
sures, such as what we eat. We cannot change the genes that we are born with, but
we can take care of the rest being primarily based on our epigenome. This means
that the genetic predisposition for a disease can be counterbalanced by an appropri-
ate healthy lifestyle that modulates the epigenome of the affected tissues. It is well
known that there is a high level of individual responsibility for staying healthy, but
a detailed understanding of epigenetics provides a molecular explanation for this
life attitude. This book describes how nutrition shapes human evolution and demon-
strates its consequences for our susceptibility to diseases, such as T2D and athero-
sclerosis, the underlying cause of most CVDs. Inappropriate diet can yield stress for
our cells, tissues, and organs, and then it is often associated with low-grade chronic
inflammation. Overnutrition paired with physical inactivity leads to overweight and
obesity and results in increased burden for a body that originally was adapted for a

v
vi Preface

life in the savannas of East Africa. Thus, this book does not only discuss about a
theoretical topic in science, but it especially talks about real life and our lifelong
“chat” with diet. We are all food consumers; thus, each of us is concerned by the
topic of this book and should be aware of its mechanisms of how our key daily
lifestyle decision affects our health.
The purpose of this book is to provide an overview on the principles of nutrig-
enomics and their relation to health and disease. We are not aiming to compete
with more comprehensive textbooks on molecular nutrition, evolutionary biology,
genomics, gene regulation, or metabolic diseases but rather will focus on the essen-
tials and will combine, in a compact form, elements from different disciplines. In
order to facilitate the latter, we favor a high figure-to-text ratio following the rule “a
picture tells more than thousand words.”
The content of the book is linked to a series of lecture courses in “Molecular
Medicine and Genetics,” “Molecular Immunology,” “Cancer Biology,” and
“Nutrigenomics” that are given by one of us (C. Carlberg) in different forms since
2002 at the University of Eastern Finland in Kuopio. This book represents an
updated version of our textbook Nutrigenomics (ISBN 978-3-319-30415-1).
However, we shortened and simplified the content in order to give also undergradu-
ate students and other people engaged in life sciences an easier start into the topic.
This book also relates to our textbooks Mechanisms of Gene Regulation (ISBN
978-94-017-7741-4), Human Epigenomics (ISBN 978-981-10-7614-8), and Human
Epigenetics: How Science Works (ISBN 978-3-030-22906-1), the studying of which
may be interesting to readers who like to get more detailed information. Following
two introductory chapters, the first five chapters of this book will explain the molec-
ular basis of nutrigenomics, while the last three chapters will provide examples for
the impact of nutrigenomics on our health and disease. A glossary in the appendix
will explain the major specialist’s terms.
We hope that the readers will enjoy this rather visual book and get as enthusiastic
about nutrigenomics as the authors are.

Kuopio, Finland Carsten Carlberg

Oslo, Norway  Stine Marie Ulven
Nur-Sultan, Kazakhstan  Ferdinand Molnár
October 2019
Acknowledgments

The authors would like to thank Eunike Velleuer, MD, and Andrea Hanel, BSc, for
extensive proofreading and constructive criticism.

vii
Contents

1 Nutrition and Common Diseases������������������������������������������������������������    1

1.1 Evolution of Human Nutrition����������������������������������������������������������    1
1.2 Principles of Metabolism������������������������������������������������������������������    4
1.3 Dietary Molecules����������������������������������������������������������������������������    5
1.4 Nutrition and Metabolic Diseases����������������������������������������������������    7
1.5 Nutrition and Cancer������������������������������������������������������������������������   10
1.6 Impact of Physical Activity��������������������������������������������������������������   12
Additional Readings����������������������������������������������������������������������������������   15
2 Human Genomic Variation ��������������������������������������������������������������������   17
2.1 Migration and Evolutionary Challenges of Homo sapiens ��������������   17
2.2 Diversity of Human Populations������������������������������������������������������   19
2.3 Genetic Variants of the Human Genome������������������������������������������   21
2.4 Haplotype Blocks and GWAS����������������������������������������������������������   24
2.5 The 1000 Genomes Project��������������������������������������������������������������   27
Additional Readings����������������������������������������������������������������������������������   29
3 Sensing Nutrition ������������������������������������������������������������������������������������   31
3.1 Nutrient-Sensing Mechanisms����������������������������������������������������������   31
3.2 Nuclear Receptors as Nutrient Sensors��������������������������������������������   35
3.3 Functions and Actions of PPARs������������������������������������������������������   39
3.4 Integration of Lipid Metabolism by LXRs and FXR������������������������   41
3.5 Coordination of the Immune Response by VDR������������������������������   44
3.6 Circadian Control of Metabolic Processes����������������������������������������   46
Additional Readings����������������������������������������������������������������������������������   48
4 Interference of the Human Genome with Nutrients ����������������������������   49
4.1 Human Genetic Adaptions����������������������������������������������������������������   49
4.2 Genetic Adaption to Dietary Changes����������������������������������������������   51
4.3 Regulatory SNPs and Quantitative Traits ����������������������������������������   53
4.4 Definition of Nutrigenomics ������������������������������������������������������������   56

ix
x Contents

4.5 Personal Omics Profiles��������������������������������������������������������������������   59

Additional Readings����������������������������������������������������������������������������������   62
5 Nutritional Epigenetics����������������������������������������������������������������������������   65
5.1 Epigenetic Mechanisms��������������������������������������������������������������������   65
5.2 Intermediary Metabolism and Epigenetic Signaling������������������������   68
5.3 Nutrition-Triggered Transgenerational Epigenetic Inheritance��������   73
5.4 Population Epigenetics����������������������������������������������������������������������   76
Additional Readings����������������������������������������������������������������������������������   79
6 Nutritional Signaling and Aging ������������������������������������������������������������   81
6.1 Aging and Conserved Nutrient-Sensing Pathways ��������������������������   81
6.2 Neuroendocrine Regulation of Aging ����������������������������������������������   84
6.3 Principles of Insulin Signaling����������������������������������������������������������   86
6.4 Central Role of FOXO Transcription Factors ����������������������������������   88
6.5 Calorie Restriction from Yeast to Mammals ������������������������������������   91
6.6 Cellular Energy Status Sensing by Sirtuins and AMPK ������������������   93
Additional Readings����������������������������������������������������������������������������������   98
7 Chronic Inflammation and Metabolic Stress����������������������������������������   99
7.1 The Central Role of Monocytes and Macrophages��������������������������   99
7.2 Acute and Chronic Inflammation������������������������������������������������������ 103
7.3 Reverse Cholesterol Transport and Inflammation���������������������������� 107
7.4 Sensing Metabolic Stress via the ER������������������������������������������������ 109
Additional Readings���������������������������������������������������������������������������������� 112
8 Obesity������������������������������������������������������������������������������������������������������ 113
8.1 Definition of Obesity������������������������������������������������������������������������ 113
8.2 Adipogenesis������������������������������������������������������������������������������������ 114
8.3 Inflammation in Adipose Tissue������������������������������������������������������� 122
8.4 Energy Homeostasis and Hormonal Regulation of Food Uptake ���� 124
8.5 Genetics of Obesity�������������������������������������������������������������������������� 127
Additional Readings���������������������������������������������������������������������������������� 129
9 Insulin Resistance and Diabetes ������������������������������������������������������������ 131
9.1 Glucose Homeostasis������������������������������������������������������������������������ 132
9.2 Insulin Resistance in Skeletal Muscle and Liver������������������������������ 135
9.3 β Cell Failure������������������������������������������������������������������������������������ 138
9.4 Definition of Diabetes ���������������������������������������������������������������������� 141
9.5 Failure of Glucose Homeostasis in T2D and Its Treatment�������������� 143
9.6 Genetics and Epigenetics of T2D����������������������������������������������������� 145
Additional Readings���������������������������������������������������������������������������������� 151
10 Heart Disease and the Metabolic Syndrome����������������������������������������� 153
10.1 Hypertension ���������������������������������������������������������������������������������� 153
10.2 Mechanisms of Atherosclerosis������������������������������������������������������ 154
10.3 Lipoproteins and Dyslipidemias ���������������������������������������������������� 159
10.4 Whole body’s Perspective of the Metabolic Syndrome������������������ 163
Contents xi

10.5 Metabolic Syndrome in Key Metabolic Organs������������������������������ 167

10.6 Genetics and Epigenetics of the Metabolic Syndrome ������������������ 169
Additional Readings���������������������������������������������������������������������������������� 172

Glossary������������������������������������������������������������������������������������������������������������ 173
Abbreviations

1,25(OH)2D3 1,25-dihydroxyvitamin D3
25(OH)D3 25-hydroxyvitamin D3
3D 3-dimensional
α-MSH α-melanocyte-stimulating hormone
ABC ATP-binding cassette
ABL abetalipoproteinemia
AC adenylate cyclase
ACAT1 acetyl-CoA acetyltransferase 1
ACC acetyl-CoA carboxylase
ACL ATP citrate lyase
ADAMTS ADAM metallopeptidase with thrombospondin motif
ADH alcohol dehydrogenase
ADP adenosine diphosphate
ADRB3 adrenoceptor beta 3
AGRP agouti-related peptide
AKT AKT serine/threonine kinase
ALOX5 arachidonate 5-lipoxygenase
ALOX15 arachidonate 15-lipoxygenase
AMPK adenosine monophosphate-activated protein kinase
AMY amylase
ANGPTL2 angiopoietin-like protein 2
APEH N-acylaminoacyl-peptide hydrolase
AP1 activating protein 1
APO apolipoprotein
APPL1 adaptor protein, phosphotyrosine interacting with PH domain and
leucine zipper 1
AR androgen receptor
ARC arcuate nucleus
ARID AT-rich interaction domain
ARL4C ADP-ribosylation factor-like 4C
ARNTL aryl hydrocarbon receptor nuclear translocator-like

xiii
xiv Abbreviations

ASC apoptosis-associated speck

ASIP agouti-signaling protein
ATF6 activating transcription factor 6
ATP adenosine triphosphate
β-OHB β-hydroxybutyrate
BAAT bile acid-CoA:amino acid N-acetyltransferase
BAT brown adipose tissue
BDNF brain-derived neurotrophic factor
BLK B lymphoid tyrosine kinase
BMI body mass index
BMP bone morphogenetic protein
bp base pair
BRD bromodomain containing
CAMKK Ca2+/calmodulin-dependent protein kinase kinase
CAMP cathelicidin
CAR constitutive androstane receptor
CASP caspase
CBL Cbl proto-oncogene, E3 ubiquitin protein ligase
CCK cholecystokinin
CCL chemokine (C-C motif) ligand
CCR C-C chemokine receptor
CD36 CD36 molecule
CDC42 cell division cycle 42
CDKAL1 CDK5 regulatory subunit associated protein 1-like 1
CDKN cyclin-dependent kinase inhibitor
CDP common dendritic cell progenitor
CDX2 caudal type homeobox 2
CEBP CCAAT-binding protein
CEL carboxyl ester lipase
CETP cholesterol ester transfer protein
CETPD CETP deficiency
CHD coronary heart disease
CHGA chromogranin A
ChIP chromatin immunoprecipitation
CLOCK clock circadian regulator
CLP common lymphoid progenitor
CMP common myeloid progenitor
CNS central nervous system
CNV copy number variant
CPT1A carnitine palmitoyltransferase 1A
CREB3L3 cAMP responsive element binding protein 3-like 3
CREBBP CREB-binding protein, also called KAT3A
CRP C-reactive protein
CRTC2 CREB-regulated transcription coactivator 2
CRY1 cryptochrome circadian clock 1
Abbreviations xv

CSF2 colony-stimulating factor 2

CTNS cystinosin, lysosomal cystine transporter
CVD cardiovascular disease
CXCL5 chemokine (C-X-C motif) ligand 5
CXCR C-X-C motif chemokine receptor
CYP cytochrome P450
DAF abnormal dauer formation
DAG diacylglycerol
DALY disability-adjusted life year
DAMP damage-associated molecular pattern
DBL dysbetalipoproteinemia
DC dendritic cell
DCT dopachrome tautomerase
DEFB4 defensin, beta 4A
DNMT DNA methyltransferase
DOHaD Developmental Origins of Health and Disease
E% percent of total energy
EDAR ectodysplasin A receptor
EIF2A eukaryotic translation initiation factor 2A
EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3
EGIR European Group for the Study of Insulin Resistance
EHMT euchromatic histone-lysine N-methyltransferase
ENCODE Encyclopedia of DNA Elements
ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1
EP300 E1A binding protein p300, also called KAT3B
eQTL expression quantitative trait locus
ER endoplasmic reticulum
ERN1 endoplasmic reticulum to nucleus signaling 1
FABP6 ileal fatty acid binding protein
FAD flavin adenine dinucleotide
FANTOM functional annotation of the mammalian genome
FAS Fas cell surface death receptor
FASN fatty acid synthase
FCH familial combined hyperlipidemia
FFA free fatty acid
FGF fibroblast growth factor
FGFR4 FGF receptor 4
FH familial hypercholesterolemia
FHC familial hyperchylomicronemia
FHTG familial hypertriglyceridemia
FOXO forkhead box O
FTO fat mass and obesity-associated
FXR farnesoid X receptor
G6PC glucose-6-phosphatase
GAB1 GRB2-associated binder 1
xvi Abbreviations

GATA GATA binding protein

GCK glucokinase
GC gas chromatography
GH1 growth hormone 1
GIS1 GIg1-2 suppressor
GLP1 glucagon-like peptide 1
GMP granulocyte-monocyte progenitor
GPAT glycerol-3-phosphate acyltransferase
GPR G-protein-coupled receptor
GR glucocorticoid receptor
GRB growth factor receptor-bound protein
GSK3 glycogen synthase kinase 3
GSV GLUT4-containing storage vesicles
GWAS genome-wide association study
GYS glycogen synthase
HAT histone acetyltransferase
HBL hypobetalipoproteinemia
HDAC histone deacetylase
HDM histone demethylase
HDL high-density lipoprotein
HHEX hematopoietically expressed homeobox
HIF1 hypoxia-inducible factor 1
HIV human immunodeficiency virus
HLA human leukocyte antigen
HLD hepatic lipase deficiency
HLP hyperlipoproteinemia
HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase
HMT histone methyltransferase
HNF hepatocyte nuclear factor
HPT hypothalamic-pituitary-thyroid
HSC hematopoietic stem cell
HSF1 heat shock transcription factor 1
HSP heat shock protein
HTG hypertriglycerolemia
IAP intracisternal A particle
IDF International Diabetes Federation
IDH isocitrate dehydrogenase
IDOL inducible degrader of LDLR
IGF insulin-like growth factor
IGF1R IGF1 receptor
IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2
IKBK inhibitor of kappa light polypeptide gene enhancer in B cells, kinase
IL interleukin
IL1RN IL1 receptor antagonist
IMCL intramyocellular lipid
Abbreviations xvii

indel insertion-deletion
INFG interferon γ
INS insulin
iPOP integrative personal omics profiling
IR insulin receptor
IRE1 inositol-requiring enzyme
IRF interferon regulatory factor
IRS insulin receptor substrate
IRX iroquois homeobox
JAK Janus kinase
KATP ATP-sensitive K+
kb kilo base pairs (1000 bp)
KCNJ11 potassium inwardly rectifying channel, subfamily J, member 11
KCNQ1 potassium voltage-gated channel subfamily Q, member 1
KDM lysine demethylase
KLF Krüppel-like factor
KMT lysine methyltransferase
LCAT lecithin cholesterol acyltransferase
LCATD LCAT deficiency
LCR locus control region
LCT lactase
LDL low-density lipoprotein
LDLR LDL receptor
LDLRAP1 LDLR accessory protein 1
LEP leptin
LEPR leptin receptor
LINE long interspersed element
LIPC hepatic lipase
LIPE hormone-sensitive lipase
LIPG endothelial lipase
LPCAT3 lysophospholipid acyltransferase 3
LPL lipoprotein lipase
LRH-1 liver receptor homolog 1
LRP1 LDLR-related protein 1
LTR long terminal repeat
LXR liver X receptor
MAF minor allele frequency
MAFA v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
A
MAN2A1 mannosidase, alpha, class 2A, member 1
MAPK mitogen-activated protein kinase
Mb mega base pairs (1,000,000 bp)
MC1R melanocortin 1 receptor
MC4R melanocortin 4 receptor
M-CFU myeloid stem cells
xviii Abbreviations

MCM6 minichromosome maintenance type 6

MDP macrophage and dendritic cell progenitor
MHC major histocompatibility complex
MHL mixed hyperlipidemia
mmHg millimeters of mercury
MODY maturity onset diabetes of the young
MPO myeloperoxidase
MPP multipotent progenitor
MS mass spectrometry
MSN multicopy suppressor of SNF1 mutation
MSR1 macrophage scavenger receptor 1
MTHFR methylenetetrahydrofolate reductase
MTNR1B melatonin receptor 1B
MTTP microsomal triglyceride transfer protein
MUFA monounsaturated
MYCL v-myc avian myelocytomatosis viral oncogene lung carcinoma
derived homolog
MYF5 myogenic factor 5
MYO5A myosin VA
NAD nicotinamide adenine dinucleotide
NAFLD nonalcoholic fatty liver disease
NAMPT nicotinamide mononucleotide phosphoribosyltransferase, also
called visfatin
NANOG nanog homeobox
NCOA nuclear receptor coactivator
NCEH1 neutral cholesterol ester hydrolase 1
NCEP National Cholesterol Education Program
ncRNA noncoding RNA
NEUROD1 neuronal differentiation 1
NEUROG3 neurogenin 3
NFκB nuclear factor κB
NLR NOD-like receptor
NLRP NLR protein
NO nitric oxide
NOS2 inducible nitric oxide synthase 2
NPC1L1 Niemann-Pick C1-like protein 1
NPY neuropeptide Y
NTS nucleus tractus solitarius
OCA2 OCA2 melanosomal transmembrane protein
OGTT oral glucose tolerance test
ORL1 oxidized low-density lipoprotein receptor 1
PAMP pathogen-associated molecular pattern
PAX paired box
PBMC peripheral blood mononuclear cell
PC pyruvate carboxylase
Abbreviations xix

PCK phosphoenolpyruvate carboxykinase

PCSK1 proprotein convertase subtilisin/kexin type 1
PDH pyruvate dehydrogenase
PDPK 3-phosphoinositide dependent protein kinase 1
PDX1 pancreatic and duodenal homeobox 1
PER1 period circadian clock 1
PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
PI3K phosphoinositide 3-kinase
PIP3 phosphatidylinositol-3,4,5-triphosphate
PKA protein kinase A
PLAU plasminogen activator, urokinase
PLTP phospholipid transfer protein
PNPLA patatin-like phospholipase domain-containing protein-3
Pol II RNA polymerase II
POMC proopiomelanocortin
POU1F1 POU class 1 homeobox 1
POU5F1 POU class 5 homeobox 1
PPAR peroxisome proliferator-activated receptor
PPARGC1A PPAR gamma, coactivator 1 alpha
PPP2 protein phosphatase 2
PRK protein kinase
PROP1 PROP paired-like homeobox 1
PRR pattern recognition receptor
PUFA polyunsaturated fatty acid
PTEN phosphatase and tensin homolog
PTGS2 prostaglandin-endoperoxide synthase 2 (also known as COX2)
PTPN1 protein tyrosine phosphatase, non-receptor type 1
PXR pregnane X receptor
RAPTOR regulatory-associated protein of TOR
RAR retinoic acid receptor
RBP4 retinol binding protein 4
RE response element
REV-ERB Reverse-Erb, official gene symbol NR1D1
RHOQ Ras homolog family, member Q
RIG1 retinoic acid-inducible gene 1
RLR RIG1-like helicase receptors
RNA-seq RNA sequencing
ROR RAR-related orphan receptor
ROS reactive oxygen species
RPS6K ribosomal protein S6 kinase
RXR retinoid X receptor
S6K S6 kinase
SAH S-adenosylhomocysteine
SAM S-adenosylmethionine
SCAP SREBF chaperone
xx Abbreviations

SCARB1 scavenger receptor class B member 1

SCD1 steroyl-CoA desaturase 1
SCN suprachiasmatic nucleus
SCNN1 sodium channel, non-voltage-gated 1
SERPINE1 serpin peptidase inhibitor, clade E (also called PAI-1)
SF-1 steroidogenic factor 1
SFA saturated fatty acids
SFRP5 frizzled-related protein 5
SH2 Src homology 2
SHC Src homology 2 domain-containing
SHP2 SH2-domain-containing tyrosine phosphatase 2
SI sucrase-isomaltase
SIM1 single-minded family bHLH transcription factor 1
SINE short interspersed element
SIRT sirtuin
SITO sitosterolemia
SLC solute carrier family
SLCO solute organic anion transporter
SNP single-nucleotide polymorphism
SNS sympathetic nervous system
SOCS suppressor of cytokine signaling
SORBS1 sorbin and SH3 domain-containing 1
SOS Son of Sevenless
SORT1 sortilin 1
SPI1 spleen focus-forming virus proviral integration oncogene, also
called PU.1
SREBF1 sterol regulatory element-binding transcription factor 1
STAT signal transducer and activator of transcription
SULT2A1 sulfotransferase family 2A, member 1
T1D type 1 diabetes
T2D type 2 diabetes
TAS1R2 taste receptor, type 1, member 2
TBC1D TBC1 domain family, member 1
TCA tricarboxylic acid
TCGA The Cancer Genome Atlas
TD Tangier disease
TET ten-eleven translocation
TGFB1 transforming growth factor beta 1
TH T helper
THRSP thyroid hormone responsive
TLR Toll-like receptor
TNF tumor necrosis factor
TNFR TNF receptor
TOR(C) target of rapamycin (complex)
TRAF2 TNF receptor-associated factor 2
Abbreviations xxi

TREG regulatory T
TSC2 tuberous sclerosis 2
TSS transcription start site
TYR tyrosinase
UBR1 ubiquitin protein ligase E3 component n-recognin 1
UCP uncoupling protein
UGT2B4 UDP glucuronosyltransferase 2 family, polypeptide B4
UNC5B unc-5 homolog B
UV ultraviolet
VDR vitamin D receptor
VLDL very low-density lipoprotein
VNN vanin 1
WAT white adipose tissue
WHO World Health Organization
WHR waist-hip ratio
WNT wingless-type MMTV integration site family member
YWHA tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activa-
tion protein (also called 14-3-3)
XBP1 X-box binding protein 1
Chapter 1
Nutrition and Common Diseases

Abstract This chapter will provide a first overview of the role of nutrition on our
health and disease. During the past 50 years a significant lifestyle change has hap-
pened to nearly all humans worldwide. This is characterized by the use of energy-­
rich, highly processed food paired with reduced physical activity. Diet is one of the
key environmental factors particularly involved in the pathogenesis and progression
of many chronic non-communicable diseases, such as obesity, T2D and CVDs like
hypertension, myocardial infarction and stroke as well as cancer. We will describe
the evidence of dietary factors for these diseases and the impact of physical activity
on their prevention. Obesity and cancer and will serve as examples, in order to
describe the link between inflammation and nutrition-triggered diseases.

Keywords Nutrition · Evolution · Catabolism · Anabolism · Non-communicable

diseases · Obesity · Cancer · Physical activity · Inflammation

1.1 Evolution of Human Nutrition

Nutrition is essential for life, but the effects of nutritional molecules on our health
are complex and influenced by many factors. Our diet is composed of food groups
that collectively provide our body with its nutritional needs of macro- and micronu-
trients (Sect. 1.3). In addition to nutrients, food also contains hundreds of bioactive
compounds that have an effect on our metabolism. Single nutrients or food groups
have relatively small effects on our health, but the overall quality of diet and the
interaction among many nutrients is critical. In this context the impact of healthy
dietary patterns, such as Mediterranean or Nordic diet (Box 1.1), needs to be
understood.
The main theme of this book is the daily communication between our diet
and our genome, which modulates gene regulatory networks in our metabolic
organs, such as in skeletal muscle, adipose tissue, pancreas and liver, as well as in
our immune system and brain. The molecular and cellular processes controlled by
these networks keep our body in homeostasis and prevent the onset of non-­

© Springer Nature Switzerland AG 2020 1

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_1
2 1 Nutrition and Common Diseases

Box 1.1 Mediterranean and Nordic diet

Mediterranean diet is based on the eating habits of Greece and Italy in the
1960s. It includes rather high amounts of olive oil, unrefined cereals, fruits
and vegetables, moderate consumption of fish and dairy products, such as
cheese, and yogurt, and red wine as well as low consumption of non-fish meat
products. Mediterranean diet is associated with a reduction in mortality, pri-
marily by lowering the risk of heart disease and T2D. Nordic diet highlights
the local, seasonal and nutritious foods from Denmark, Norway, Sweden,
Finland and Iceland. Like Mediterranean diet it is high in plant-based foods,
i.e., it emphasizes whole grains, such as barley, rye and oats, berries, vegeta-
bles and fatty fish as well as low-fat dairy and low consumption of red meat.
However, instead of olive oil, the Nordic diet is rich in rapeseed oil.

communicable diseases, such as obesity, T2D, CVDs and cancer. Thus, an appro-
priate diet in combination with sufficient physical activity (Sect. 1.6) will keep
us healthy.
Anatomically modern humans (Homo sapiens) evolved some 300,000 years ago
in Africa and started some 60–80,000 years ago to spread in larger numbers over the
whole planet (Sect. 2.1). Until some 10,000 years ago they lived as hunters and
gatherers, i.e., their diet was based on wild animals and plants (Table 1.1). Depending
on season and geographic region they were eating meat, fish, eggs, fruits, nuts and
seeds. Accordingly, food was of rather low energy density, i.e., it provided fewer
calories per gram, had medium fiber content, was rich in starch and low in fat, had
rather high micronutrient density and anti-oxidant capacity and was low in salt.
Thus, the biochemistry of our body had the time span of some 300,000 years,
i.e., approximately 12,000 generations, to adapt to this food.
Agricultural revolution, i.e., the use of domesticated plants and animals, started
some 10,000 years ago and shifted the human diet pattern to even higher rates in
starch, the introduction of sugar and the use of salt for conservation. This increased
the energy density of food but also its fiber content and resulted in a high salt load.
However, relative to the diets of many hunter-gatherer societies the agricultural
transition resulted in reduced nutritional diversity, since starch alone already repre-
sented more than 60% of the daily caloric intake.
The industrial revolution over the past 250 years, such as the use of machines,
trains and cars, reduced the need of physical activity for work and transport. In par-
allel, the use of refined food, such as grains and oils, increased. This made diet
lower in starch and fiber but enriched in white sugar and fat, leading to higher
energy density and glycemic load. Finally, in modern times we primarily use indus-
trially processed dietary products and so-called “fast food”. In particular, the latter
is of very high sugar and fat content, i.e., of high energy density but low fiber con-
tent. In parallel, technical revolutions in transportation and computerization further
1.1 Evolution of Human Nutrition 3

Table 1.1 Evolution of human nutrition. Change of human diet from the Paleolithic era via
agricultural and industrial revolution to modern times is indicated
Time period Diet Nutritional characteristics
Paleolithic era (more Wild animals and plants, varied by Low energy density
than 10,000 years geography and season, such as meat, Medium fiber content (40 g/
ago) fish, eggs, fruits, nuts and seeds day)
Macronutrients: 15–20%
protein, 50–70% starch and
15–20% fat
Low glycemic load
Low salt (1 g/day): Na/K
ratio < 1
Agricultural Largely based on domesticated animals Medium energy density
revolution (starting and plants, such as grains, dairy High fiber content (60–120 g/
10,000 years ago) products, vegetables. Use of fermented day)
foods and beverages Macronutrients: 10–15%
protein, 60–75% starch, 5%
sugar and 10–15% fat
High glycemic load
High salt (5–15 g/day):
Higher Na/K ratio
Industrial revolution Increased reliance of refined grains and High energy density
(starting 250 years oils, fatty meat, alcoholic beverages Medium fiber content (40 g/
ago) day)
Macronutrients: 12% protein,
40–50% starch, 10% sugar
and > 30% fat
High glycemic load
High salt (10 g/day): Higher
Na/K ratio
Modern era (starting Mainly industrially produced foods, Very high energy density
50 years ago) such as refined grains and oils, fatty Low fiber content (20 g/day)
meat from domesticated animals, Macronutrients: 15% protein,
alcoholic beverages. 25% starch, > 20% sugar and
> 40% fat
Consumption of highly processed “fast Very high glycemic load
food” High salt (10 g/day): Higher
Na/K ratio

reduced the need of physical activity, so that an increasing proportion of the popula-
tion got a positive energy balance leading to a worldwide epidemic of overweight
and obesity (Sect. 8.1). The “energy flipping point” happened in high-income
countries already some 50 years ago but nowadays reached nearly every soci-
ety worldwide. Thus, the most significant change in our nutritional habits happened
in less than two generations, i.e., in a time span that is far too short for expecting any
genetic adaptation (Sect. 4.1).
4 1 Nutrition and Common Diseases

1.2 Principles of Metabolism

Life follows the laws of thermodynamics indicating that a constant intake of energy
is essential for the maintenance of highly ordered structures, such as cells, organs
and whole organisms. Thus, we have to eat, in order to keep our body intact. Our
nutrition is the provision to obtain a sufficient amount of macro- and micronutrients
necessary to support essential functions of life, such as energy supply, reproduction
and growth. The main macronutrients in diet are carbohydrates (digested to glu-
cose), proteins (digested to amino acids) and lipids (dissolved into fatty acids and
cholesterol) (Fig. 1.1), whereas micronutrients consist of vitamins and minerals
(Chap. 3). In catabolism macronutrients provide the body with energy when they

Energy Macronutrients
Glucose
Amino acids
Fatty acids
Anabolism

Catabolism

Lactate and
Macromolecules other
intermediates
Glycogen
storage

ROS
Energy

Waste

Triacylglycerols Energy CO2

Proteins Urea
Triacylglycerols
Growth

Proteins
Nucleic acids
Polyamines

Fig. 1.1 Simplified view of metabolic principles. Macronutrients provide our body with energy
via catabolic processes or are used for energy storage in form of glycogen (from glucose) and tria-
cylglycerols (from fatty acids). During starvation also skeletal protein is used as a source of energy.
When macronutrients are catabolized to generate energy, lactate and other intermediates, such as
ROS (reactive oxygen species), carbon dioxide and ammonia, are produced. The body needs to get
rid of this waste via endogenous anti-oxidant defense systems, i.e., exhaling via the lungs and urea
excretion via kidney and bladder, in order to avoid intoxication. Furthermore, our body also uses
amino acids for the synthesis of nucleic acids and polyamines for normal growth and
regeneration
1.3 Dietary Molecules 5

are metabolized. When there is excess of energy-rich nutrients, they are stored in
form of glycogen in liver and skeletal muscle or triacylglycerols (i.e., glycerol ester-
ified with three fatty acids) in adipose tissue. Equally, these nutritional compounds
can be used in anabolism for the synthesis of new macronutrients. Both catabolism
and anabolism are represented by a series of tightly controlled biochemical path-
ways composed of enzyme cascades, many of which require micronutrients as co-­
enzymes (Fig. 1.1).
Food intake is based on the interaction between homeostatic regulation and
hedonic sensations. During and shortly after a meal a variety of hormones and nutri-
ents are released by the gastrointestinal tract and associated glands, and these are
transported in the blood to the CNS (central nervous system). Thus, our brain con-
trols satiety and hunger and regulates in this way the energy balance of our
whole body (Sect. 8.4).
After a meal, the liver is the first organ to receive via the portal vein nutrients
absorbed in the intestine. The liver plays a major role in energy storage, in particular
of carbohydrates (Sect. 9.1), but it also metabolizes amino acids and fatty acids.
Adipose tissue (Sect. 8.2) stores most of our body’s energy as triacylglycerols,
while in a process called lipolysis this organ releases fatty acids when other tissues
need energy. For storing energy, fat (9 kcal/g) is more than double as efficient than
carbohydrates (4 kcal/g). Thus, we use stored fat for surviving the daily and sea-
sonal feast-famine cycles.
Fat powers up running endurance, which is the evolutionary basis for predatory
behavior of hunters and gatherers. Skeletal muscle is a highly active organ that uses
both types of stored energy, i.e., glycogen and triacylglycerols, and takes up glucose
and fatty acids directly from the circulation depending on the type of exercise per-
formed (Sect. 1.6). However, the continuous food exposure and the sedentary life-
style of modern civilization made properties, such as surviving starvation or running
long distances to track down animals, dispensable. Thus, permanent obesity
became a key trait of modern humans.

1.3 Dietary Molecules

Dietary carbohydrates consist of

• polysaccharides, such as starch
• disaccharides, such as sucrose, maltose and lactose
• free monosaccharides, such as glucose and fructose.
To maintain health and prevent non-communicable diseases, the acceptable dis-
tribution range of carbohydrates in our diet should represent 50–60 percent of total
energy (E%), while added sugars should not exceed 10 E%. Glucose is the most
common dietary monosaccharide and is absorbed directly into the bloodstream dur-
ing digestion of polysaccharides and disaccharides. Glucose serum concentration
is strictly regulated by the peptide hormones insulin and glucagon (Sect. 9.1),
6 1 Nutrition and Common Diseases

because the CNS is largely reliant on glucose as its metabolic fuel and red blood
cells are even entirely dependent on it. Nutrients or their metabolites regulate the
expression of genes involved in these metabolic pathways either directly or indi-
rectly via insulin. Therefore, disturbances in insulin signaling (Sect. 6.3) are the
major cause of the metabolic syndrome (Sect. 10.4). After digestion, glucose is
taken up in all tissues by specific transport proteins and phosphorylated to glucose-­6-­
phosphate (Sect. 3.1) before entering the pathways of glycogenesis (storage) or
­glycolysis (anaerobic energy production). The end product of glycolysis is pyruvate
that enters the TCA (tricarboxylic acid) cycle, in order to generate energy more
efficiently due to use of oxygen (oxidative phosphorylation). During overnight fast-
ing, glycogen is broken down to glucose via glycogenolysis and the body starts to
synthesize glucose from amino acids or other small molecules via gluconeogenesis,
in order to ensure energy supply from sufficient concentration of glucose in the
blood (5 mM).
Proteins are polymers of a set of 20 different amino acids. Nine of these amino
acids are “essential”, i.e., our body cannot synthesize them and we must obtain them
from our diet. All processes in life, ranging from control of metabolism via immune
functions to physical movement, are dependent on these “workers” of the cell. The
recommended daily intake of protein is 10–20 E%. In addition, a number of amino
acids are used for other purposes than protein synthesis, such as the synthesis of the
nucleic acid components purines and pyrimidines. Normally, the rate of amino acid
breakdown balances the rate of their intake, i.e., our body does not store amino
acids as an energy source. However, during extreme situations, such as starvation
or disease, our body breaks down proteins to amino acids, in order to use their car-
bon backbone as substrates for the synthesis of glucose, fatty acids and ketone bod-
ies. Thus, amino acids can play an important role in whole body energy homeostasis.
Lipids are a major source of energy for our body with a recommended daily
intake up to 35 E%. Triacylglycerols represent the majority of dietary fat, while
cholesterol and phospholipids are of lower amount. Fatty acids are classified into
saturated (SFAs), monounsaturated (MUFAs) or polyunsaturated (PUFAs) depend-
ing on the number of double bonds in their backbone structure. The proportion of
the fatty acids in food depends on its source, such as animal (SFAs) or plant origin
(MUFAs and PUFAs). The recommended daily intake of MUFAs should be in the
order of 10–15 E%, that of SFAs less than 10 E% and that of PUFAs 5–10 E%.
Lipids are insoluble in aqueous solutions and are therefore found in all cells associ-
ated with membranes: in adipocytes as triacylglycerol droplets and in blood plasma
as major components of differently sized lipoproteins (Sect. 10.3). Dietary lipids are
not only important suppliers of energy (via fatty acid β-oxidation), but some of
them, such as selected fatty acids, steroid hormones and eicosanoids (i.e., oxidized
PUFAs with 20 carbon atoms), also act as co-enzymes and biological active mole-
cules (Box 1.2) with critical roles in the control of whole body’s homeostasis (Chap.
3 and 9). Disturbances in lipid metabolism, i.e., dyslipidemias (Sect. 10.3), are
common in chronic metabolic diseases.
1.4 Nutrition and Metabolic Diseases 7

Box 1.2 Dietary components acting as signaling molecules

Biological active molecules either carry signals over long distances (endo-
crine signaling), act locally to transfer information between neighboring cells
(paracrine signaling) or communicate within the cell itself (autocrine signal-
ing). The lipophilic fraction of these molecules, such as steroid hormones or
eicosanoids (e.g., prostaglandins), can cross the plasma membrane and bind
to transcription factors in the cytoplasm or nucleus (Sect. 3.2), whereas the
larger hydrophilic fraction of signaling molecules binds to membrane proteins
on the surface of target cells. Macronutrients, such as fatty acids, cholesterol,
glucose and amino acids, and micronutrients, such as vitamin A, vitamin D,
vitamin E, calcium and iron, can either act as ligands of nuclear receptors or
as co-factors to enzymes. Nutrients can also bind to membrane proteins and
initiate intercellular signaling pathways leading to changes in the activity of
transcription factors (Sect. 4.4). Target genes regulated by transcription fac-
tors are encoding for proteins that play important roles in transport, uptake
and storage of nutrients and as enzymes in metabolic pathways. Thus, these
dietary components play critical roles in the control of energy homeostasis
(Sect. 3.3).

1.4 Nutrition and Metabolic Diseases

Non-communicable diseases, such as cancer, CVD and T2D, cause more than 70%
of early deaths worldwide and represent the leading cause of premature disability.
However, 70–90% of non-communicable diseases are preventable. A common
cause of these diseases is obesity, which is defined by the WHO (World Health
Organization) as excessive fat accumulation (BMI (body mass index) ≥ 30 kg/m2).
Obesity leads to 5–20 years decreased life expectancy of the individual (Sect. 8.1).
The Global Burden of Disease Study indicated that in 2017 11 million deaths and
255 million DALYs (disability-adjusted life-years) were attributable to dietary risk
factors, of which the main risks were high intake of sodium (three million deaths
and 70 million DALYs), low intake of whole grains (three million deaths and 82
million DALYs) and low intake of fruits (two million deaths and 65 million DALYs)
(Sect. 10.1). Fiber is a dietary factor that convincingly reduces the risk of
weight gain and obesity (Table 1.2). Moreover, regular physical activity also con-
vincingly reduces the risk of obesity (Sect. 1.6). In contrast, the dietary factor that
convincingly increases the risk of weight gain and obesity is a high intake of pro-
cessed foods that are not only energy dense but also micronutrient poor (also
referred as “empty calorie” foods). Typical energy dense foods are high in fat (but-
ter, oils and fried foods), sugar or starch. In contrast, energy-dilute foods have high
content of water and fiber, such as fruits, vegetables, legumes and whole grain cere-
8 1 Nutrition and Common Diseases

Table 1.2 Overview of lifestyle factors and risk of developing obesity

Evidence Decreased risk No relationship Increased risk
Convincing Walking Sugar sweetened drinks
Screen time (children)
Probable Regular physical “Western type” dietary patternb
activitya
Foods containing fiber “Fast foods”
“Mediterranean type” Screen time (adults)
dietary pattern
Having been breastfed
Possible Low glycemic index Protein content Large portion sizes
foods of the diet High proportion of food prepared
outside the home (developed
countries)
“Rigid restraint/periodic
disinhibition” eating patterns
Insufficient Increased eating Alcohol
frequency
a
Aerobic physical activity only
b
Such diets are characterized by high intakes of free sugar, meat and dietary fat

als. Other dietary factors that increase the risk of weight gain and obesity are sugar-­
sweetened soft drinks and fruit juices.
Obesity leads to low-grade chronic inflammation (Sect. 7.2), which is the central
cause of many lifestyle-related diseases, such as insulin resistance (Sect. 9.2), T2D
(Sect. 9.4) and atherosclerosis (Sect. 10.2) (Fig. 1.2). Moreover, also neurodegen-
erative disorders, such as Alzheimer’s disease, most types of cancer, allergy, auto-
immune diseases and inflammatory bowel diseases, such as Crohn’s disease and
ulcerative colitis, are closely linked to inflammation. Immune reactions in general,
and inflammation in particular, are related to cellular metabolism. The proliferation
of immune cells and their action in defense and tissue repair require high levels of
energy metabolism. Thus, metabolic stress, which is often caused by lipid over-
load in the blood and in adipose tissue (lipotoxicity), stimulates low-grade
chronic inflammation.
Among non-communicable diseases CVDs are the major contributor to the
global burden of disease (46% worldwide, Sect. 10.1). Ischemic heart disease and
stroke are the leading causes of death across all countries. Tobacco use, physical
inactivity and unhealthy diet are responsible for about 80% of CHD (coronary heart
disease) and cerebrovascular disease, i.e., of heart attack and stroke. Ischemic dis-
ease or CHD, i.e., the failure to supply oxygen to the heart muscle, is the major
cause of CVD deaths (42.5%), while cerebrovascular disease, i.e., the failure to
supply oxygen to the brain, causes 35.5% of the CVD deaths. Atherosclerosis is the
1.4 Nutrition and Metabolic Diseases 9

Cancer
Inflammatory bowel disease

Genetic
predis-
position Inflammation

Neurodegenerative Allergy
diseases Changes of Autoimmunity
epigenome
and transcriptome

Epigenomic
Metabolism programming
Diet of immune
Physical system
activity
Lifestyle
decisions Obesity
Insulin resistance
T2D
Atherosclerosis

Fig. 1.2 Immune-mediated pathologies as key driver processes of diseases in various target
organs. Inflammation and cellular metabolism are closely linked via coordinated changes in the
epigenome and transcriptome of target tissues and cell types

basic pathophysiological lesion of CVDs, which tends to occlude the arteries to a

varying extent (Sect. 10.2). A variety of cell types and lipids are involved in the
pathogenesis of atherosclerotic plaques and arterial thrombosis.
There is convincing evidence that
• a plant-based diet composed of fruits, vegetables, leafy greens (polyphenols,
anti-oxidants, folate, fibers, potassium etc.), nuts and seeds, such as walnuts,
flaxseed and rapeseed oil (foods rich in the essential ω-3 fatty acid α-linolenic
acid)
• fish and fish oil (containing the marine ω-3 fatty acids eicosapentaenoic acid and
docosahexaenoic acid)
• physical activity, normal-range BMI and low alcohol intake
• avoiding SFAs (animal products, palm oil, coconut oil) and trans-fatty acids
(hardened fats)
all contribute to the reduction of CVD risk (Table 1.3).
10 1 Nutrition and Common Diseases

Table 1.3 Overview of lifestyle factors and risk of developing CVDs

Evidence Decreased risk No relationship Increased risk
Convincing Regular physical activity Vitamin E Myristic and palmitic
Linoleic acid supplements acids
Fish and fish oils (eicosapentaenoic Trans fatty acids
and docosahexaenoic acid) High sodium intake
Vegetables and fruits (including Overweight
berries) High alcohol intake
Potassium (for stroke)
Low to moderate alcohol intake (for
coronary heart disease)
Probable α-Linolenic acid Stearic acid Dietary cholesterol
Oleic acid Unfiltered boiled
Non-starch polysaccharides coffee
Wholegrain cereals, nuts (unsalted)
plant sterols/stanols, folate
Possible Flavonoids Fats rich in lauric acid
Soy products Impaired fetal
nutrition
Beta-carotene
supplements
Insufficient Calcium Carbohydrates
Magnesium Iron
Vitamin C

1.5 Nutrition and Cancer

Cancer is the second leading cause of death globally. Unfortunately, every second
of us will be diagnosed cancer at some point of his/her life. Cancer is defined as a
disease, in which the normal control of cell division is lost, so that an individual cell
multiplies inappropriately forming a primary tumor. The tumor cells may eventually
spread through the body and form metastases. Cancer can arise from different tis-
sues and organs, thus there are many different types of cancer. Some oncogenes and
tumor suppressor genes encode for enzymes regulating the metabolism of nutrients,
i.e., the mutation of these genes can lead to the production of onco-metabolites
affecting chromatin modifying enzymes (chromatin modifiers, Sect. 5.1). Thus,
dietary molecules affecting the epigenome can both increase or reduce the risk
of cancer. Migrant studies showed that moving from a region with low risk to one
with a high risk leads within one generation to the same cancer pattern of the host
country, i.e., the environment and lifestyle causes the cancer rather than the
individual’s genome. Studies with monozygotic twins support these findings.
Approximately, one third of cancer deaths are due to lifestyle choices, such a
high BMI, low fruit and vegetable intake, lack of physical activity, tobacco and/
or alcohol use. However, only a few definite relationships between specific nutrient-­
related factors and cancer are established. For example, there is convincing evi-
dence that overweight and obese individuals have increased risk of cancer of
esophagus, colorectum, breast (in post-menopausal women), pancreas, liver and
1.5 Nutrition and Cancer 11

Table 1.4 Overview of lifestyle factors and risk of developing cancer

Evidence Decreased risk Increased risk
Convincinga Physical activity (colon) Overweight and obesity (esophagus,
colorectum, pancreas, liver, breast in
postmenopausal women, endometrium,
kidney)
Alcohol (oral cavity, pharynx, larynx,
esophagus, liver, colorectum, breast
postmenopausal)
Processed meat (colorectum)
Aflatoxin (liver)
Probablea Fruits and vegetables (oral cavity, Red meat (colorectum)
esophagus, stomach, colorectum∗∗)
Physical activity (breast in Salt-preserved foods and salt (stomach)
postmenopausal women,
endometrium)
Whole grain, fiber, dairy products Alcohol (breast in premenopausal women)
(colorectum)
Coffee (liver, endometrium) Chinese-style salted fish (nasopharynx)
Alcohol (kidney) Glycemic load (endometrium)
Possible/ Fiber Animal fats
insufficient Soya Heterocyclic amines
Fish Polycyclic aromatic hydrocarbons
ω-3 fatty acids Nitrosamines
Carotenoids
Vitamins B2, B6, folate, B12, C, D,
E
Calcium, zinc and selenium
Non-nutrient plant constituents
(e.g., allium compounds,
flavonoids, isoflavones, lignans)
a
The “convincing” and “probable” categories in this report is taken from the WCRF network report
Recommendations and public health and policy implications 2018
b
For colorectal cancer, a protective effect of fruit and vegetable intake has been suggested by many
case-control studies but this has not been supported by results of several large prospective studies,
suggesting that if a benefit does exist it is likely to be modest

kidney, while individuals who consume a high amount of alcohol are prone to can-
cers of the oral cavity, pharynx, larynx, esophagus, liver, colorectum and breast.
Individuals who consume high amounts of processed meat have increased risk of
colorectum cancer. Moreover, aflatoxins contribute to the development of liver can-
cer (Table 1.4). Importantly, there is convincing evidence that physical activity
(Sect. 1.6) decreases the risk of colon cancer. Dietary factors that increase cancer
risk include high intake of red meat (colorectum), salt-preserved foods (stomach),
food with high glycemic index (endometrium) and alcohol (stomach, breast in pre-
menopausal women). In contrast, protective factors are foods high in dietary fiber,
such as whole grain products, fruits and vegetables (colorectal cancer), coffee (liver
12 1 Nutrition and Common Diseases

and endometrium cancers) and physical activity (endometrium and breast cancer in
post-menopausal women).
Cancer and obesity are examples of non-communicable diseases, in which
inflammation is part of the underlying cause of the disease (Sects. 7.4 and 8.3). WAT
(White adipose tissue) is an important endocrine and metabolic organ consisting of
both lipid-laden adipocytes and a stromal-vascular fraction, which contains preadi-
pocytes, macrophages, other immune cells and endothelial cells (Fig. 1.3a). Obesity
increases the size of adipocytes (hypertrophy) and number of adipocytes (hyperpla-
sia) and is accompanied by infiltration of macrophages in the adipose tissue (Sect.
8.3). Elevated levels of circulating pro-inflammatory cytokines and acute phase pro-
teins, such as CRP (C-reactive protein), characterize inflammatory responses that
are triggered by obesity. In addition, increased release of pro-inflammatory adipo-
kines (i.e., hormones secreted by adipocytes), such as leptin, IL (interleukin) 6,
resistin, SERPINE1 (serpin peptidase inhibitor, clade E, also called plasminogen
activator inhibitor 1) and TNF (tumor necrosis factor), and reduced release of anti-­
inflammatory adipokines, such as adiponectin, is associated with obesity (Sect. 8.2).
The link between obesity and cancer initiation as well as the molecular mecha-
nisms underlying how obesity converses normal epithelial cells to tumor cells is not
completely understood (Fig. 1.3b). However, it is known that in cancer cells, in
addition to low-grade inflammation and the release of inflammatory cytokines, also
lipid metabolism is altered. Furthermore, obesity influences insulin signaling, which
may provide further energy to cancer cells, i.e., elevated insulin promotes their pro-
liferation. For example, patients with insulin resistance have a poorer response to
cancer treatment or bear a more aggressive cancer phenotype, probably due to their
increased circulating insulin levels. Moreover, elevated levels of leptin and
reduced levels of adiponectin stimulate tumor growth. Adiponectin signal trans-
duction acts via transmembrane proteins activating the kinase AMPK (adenosine
monophosphate-activated protein kinase, Sect. 6.6). AMPK is a critical negative
regulator of proliferation in response to energy status as it induces growth arrest and
apoptosis. Furthermore, adiponectin activates the nuclear receptor PPAR (peroxi-
some proliferator-activated receptor) α that controls fatty acid β-oxidation (Sect. 3.3).

1.6 Impact of Physical Activity

Some two million years ago, our ancestors made the unique adaption of “striding
bipedalism”, which significantly increased the capacity for long-distance walking
and endurance running. These properties were essential for avoidance of predation,
effective scavenging and persistent hunting. In parallel, humans lost most of their
body hair, in order to allow better thermoregulation during this intense physical
activity. Thus, in the past efficient physical activity was essential for survival.
From the historical and evolutionary perspective, an exercise-trained state is the
biologically normal condition for humans. However, in Western or Westernized
societies a sedentary lifestyle is nowadays so widespread that often exercise is
1.6 Impact of Physical Activity 13

A
Leptin
Adiponectin
TNF
IL6
SERPINE1

Leptin
Adiponectin
TNF
IL6
SERPINE1

White M1 M2 Other Endothelial

adipocytes Macrophages Macrophages inflammatory cells cells

B
OBESITY

Inflammation Increased lipids and Insulin Fat mobilization

other macromolecules signaling

Basement membrane

Blood vessel

NORMAL CANCER

Fig. 1.3 Obesity, cancer and inflammation. WAT is an endocrine and metabolic organ consisting
of lipid-laden adipocytes and preadipocytes, macrophages, other cells of the immune system and
endothelial cells (a). In subjects with normal weight, the adipose tissue secretes high levels of
adiponectin. During weight gain, WAT expands, which mediates the infiltration of macrophages
and other inflammatory cells and leads to the secretion of the cytokine TNF from macrophages.
Furthermore, the secretion of IL6, SERPINE1 and leptin is also increased. Elevated inflammation,
increased availability of lipids and other macromolecules, impaired insulin signaling and changes
in adipokine signaling leading to fat mobilization all contribute to the conversion of epithelial cells
to an invasive tumor (b)
14 1 Nutrition and Common Diseases

referred to as already having “health benefits”. An inactive lifestyle and access to

energy-dense nutrition over an extended lifespan increases the risk for non-­
communicable diseases, such as atherosclerosis, T2D and cancer. Thus, physical
activity reduces the risk of these diseases and prevents obesity, since exercise
increases the consumption of energy, i.e., it burns off the body fat that would other-
wise accumulate.
The increased metabolic activity of contracting skeletal muscles affects whole-­
body homeostasis by communicating with other organs, such as adipose tissue,
liver, pancreas, bone and brain. For example, regular exercise promotes cardiovas-
cular health, since it is beneficial for the profile of serum lipids via decreasing
plasma triacylglycerols and increases of HDL (high-density lipoprotein) cholesterol
(Sect. 10.3). In addition, physical activity also has an anti-inflammatory effect that
can protect against low-grade chronic inflammation-associated diseases. Thus,
exercise-induced restoration or maintenance of metabolism and bioenergetics
of the whole body changes homeostatic signals affecting nutrient uptake and
growth factor availability in a multitude of tissues, both in health and disease.
Reliable epigenetic biomarkers for the assessment of the interindividual variation of
the effect of exercise training in the prevention and therapy of metabolic diseases
are desired. A promising candidate is the epigenetic modification of regulatory
regions of the gene PPARGC1A (PPAR gamma, co-activator 1 alpha, Sect. 6.2) via
DNA methylation in skeletal muscle of T2D patients.
Physical activity has also a positive effect on disorders that are not directly con-
nected with energy metabolism, such as cancer, mental disorders and neurodegen-
erative diseases. To a large extent this is due to the anti-inflammatory effect of
exercise that causes a higher production and release of myokines (i.e., anti-­
inflammatory cytokines of skeletal muscle) and the reduced expression of TLRs
(Toll-like receptors) in associated immune cells. TLRs are PRRs (pattern recogni-
tion receptors) on the surface of monocytes and macrophages that detect pathogens
and initiate the innate immune response (Sect. 7.2). These anti-inflammatory effects
inhibit the production of pro-inflammatory cytokines. Exercise also reduces the
number of pro-inflammatory monocytes and increases the count of circulating regu-
latory T cells (TREG). TREG are a specialized subpopulation of T cells suppressing the
activation of the immune system (Sect. 7.1). Since regular exercise reduces fat mass,
there is less infiltration of macrophages to adipose tissue and a switch from M1- to
M2-type macrophages (Sect. 7.4). This leads to an increase in adiponectin levels
and a decrease in pro-inflammatory adipokines, such as IL6, TNF and leptin, in the
circulation. Physical exercise also influences the CNS. Impulses from the brain and
contracting muscles elevate plasma cortisol and adrenaline production in adrenal
glands. These hormones suppress inflammation by decreasing the production of
pro-inflammatory cytokines by monocytes and macrophages.
The worldwide obesity epidemic (Sect. 8.1) is paired with too low physical
activity among the concerned persons. Therefore, pharmacologic intervention
with exercise mimetics is considered. These molecules can mimic the effect of exer-
cise by acting as key components of exercise-induced muscle adaptation, such as
mitochondrial remodeling and bioenergetics. In this way, they are able to produce
Additional Readings 15

the benefits of fitness, such as increased mitochondrial oxidative phosphorylation

and fatty acid metabolism leading to lower blood glucose levels, reduced inflamma-
tion and increased endurance. For example, the synthetic compounds AICAR and
GW501516 activate the kinase AMPK and the nuclear receptor PPARδ, respec-
tively. Both proteins play key roles in the pathways of mitochondrial biogenesis and
fatty acid β-oxidation. This induces energy expenditure without any change in activ-
ity, i.e., it allows calorie burning without physical activity. Mechanistically, this
works via the induction of the UCP (uncoupling protein) 2 and UCP3, which con-
vert the H+ gradient at the inner mitochondrial membrane into heat (Sect. 8.2).
Although the potential of exercise mimetics to efficiently promote fat burning rep-
resents an interesting medical opportunity, there is also the risk that the com-
pounds are used for doping of endurance athletes.

Additional Readings

Afshin A, Sur PJ, Fay KA, Cornaby L, Ferrara G, Salama JS, Mullany EC, Abate KH, Abbafati C,
Abebe Z et al (2019) Health effects of dietary risks in 195 countries, 1990–2017: a systematic
analysis for the global burden of disease study 2017. Lancet 393:1958–1972
Blüher M (2019) Obesity: global epidemiology and pathogenesis. Nat Rev. Endocrinol 15:288–298
Fan W, Evans RM (2017) Exercise mimetics: impact on health and performance. Cell Metab
25:242–247
Hawley JA, Hargreaves M, Joyner MJ, Zierath JR (2014) Integrative biology of exercise. Cell
159:738–749
Koelwyn GJ, Quail DF, Zhang X, White RM, Jones LW (2017) Exercise-dependent regulation of
the tumour microenvironment. Nat Rev. Cancer 17:620–632
NCD-Risk-Factor-Collaboration (2017) Worldwide trends in body-mass index, underweight, over-
weight, and obesity from 1975 to 2016: a pooled analysis of 2416 population-based measure-
ment studies in 128.9 million children, adolescents, and adults. Lancet 390:2627–2642
Chapter 2
Human Genomic Variation

Abstract This chapter will briefly describe the genetic adaption of anatomically
modern humans due to migration to new geographic and climatic environments in
Asia and Europe. This includes also the challenges provided by the shift from hunt-
ers and gatherers to farmers. Genetic differences between human populations are
most pronounced in tissues, such as the skin, the intestinal tract or the immune
system, that are directly affected by the environment. This led not only to obvi-
ous differences in skin color among the populations, but also in different resistance
to diseases and diversity in dietary intake, such as the ability to digest lactose (milk
sugar). The genetic basis of the variation of human populations and individuals has
recently been studied and catalogued by large consortia, such as the 1000 Genomes
Project. Genome-wide genotyping and whole genome sequencing allows the study
and analysis of complex diseases, such as T2D and CVDs, on the basis of dozens to
hundreds of genetic variants, such as SNPs and CNVs (copy number variations).

Keywords Human evolution · Human populations · Single nucleotide variants ·

Copy number variants · Haplotype blocks · Next-generation sequencing · HapMap
Project · Genome-wide association studies · 1000 Genomes Project

2.1 Migration and Evolutionary Challenges of Homo sapiens

Approximately 300,000 years ago anatomically modern humans developed in East

Africa. The main characteristic of Homo sapiens is a superior locomotive abil-
ity that is essential for encountering predators and food procurement. Some
50–75,000 years ago, reasonable numbers of these modern humans started to
migrate to Asia and Europe and replaced there through interbreeding already preva-
lent archaic (i.e., nowadays extinct) human species, such as the Neanderthals
(Fig. 2.1). Due to their new environments our ancestors were exposed to a number
of divergent selective pressures, such as thermoregulation in colder climates, toler-
ance to hypoxia (i.e., oxygen supply deprivation) at high altitude and light skin
pigmentation in regions with lower levels of UV-B (ultraviolet B radiation, Sect. 4.1).

© Springer Nature Switzerland AG 2020 17

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_2
18 2 Human Genomic Variation

12-20,000

50-75,000
40,000

65-70,000

130-200,000

48,000

Fig. 2.1 Migrations of Homo sapiens. The spread of anatomically modern humans from East
Africa over the rest of the continent was followed by an expansion from the same area to Asia,
probably by both a southern and northern route some 50–75,000 years ago. Oceania, Europe and
the Americas were settled from Asia in that order. The migration patterns are primarily based on
analyses of changes in mitochondrial DNA

Some 10,000 years ago our ancestors started to give up their hunter and gatherer
habit and became farmers. This significant lifestyle change was associated with
distinct foods, such as cereals and milk (Sect. 1.1). The improved nutrition supply
allowed higher population densities but was compromised with an increased
load with infectious diseases, many of which were acquired from domesticated
animals. Both dietary changes and immunological challenges caused dominant evo-
lutionary pressure and rather rapid genetic adaption. The phenotypic consequences
of these genetic adaptations did not only shape the biological variation but also the
health and disease risk of the 7.8 billion people presently living on Earth.
In chap. 1 we already started to discuss the significant increase in obesity and the
resulting increase in the rates of cancer and metabolic diseases. Worldwide it took
several thousand years, i.e., clearly more than 100 generations, to turn most humans
from hunters and gatherers to farmers but only less than 50 years to be preferential
users of cars, supermarkets and fast-food. This means that humans simply had no
time to adapt genetically to the rapidly changing “obesogenic environment”. In
the context of an inactive lifestyle combined with energy-dense foods, the genetic
variations that had been initially evolved for an efficient energy storage and physical
mobility turned to be an increased risk for developing chronic non-communicable
diseases, such as T2D or CVDs (Chap. 9 and 10).
2.2 Diversity of Human Populations 19

2.2 Diversity of Human Populations

When humans became distributed to the different continents, i.e. geographically

isolated, new gene variations could not be spread anymore to all members of the
species. Since in the past distant human populations were less likely to exchange
migrants, they cluster genetically in relation to their geographic distance from each
other. Thus, human genetic variation diverted geographically, when individuals
accumulated further mutations during the past 50,000 years. Since anatomically
modern humans lived in Africa already for some 300,000 years, populations on this
continent are more diverse than in the rest of the world. Although there are obvi-
ous phenotypic differences of populations concerning skin color, body height
and facial features, there are no absolute genetic differences between them. For
example, there is no single nucleotide difference that can distinguish Africans from
Eurasians, but population differences are based on thousands of gene loci. This
implies that a property (often referred to as a “trait”), such as skin color (Sect. 4.1),
can change rather rapidly, when the allele frequencies shift at the respective loci
contributing to the trait (Box 2.1). Some 500 years ago, when navigation over the
oceans became possible, voluntary and involuntary (slaves) migration started, which
caused significant population admixtures, particularly in the Americas, but also in
other continents. Before that time there had been at least two major events of admix-
ture in Europe, where first some 9000 years ago early farmers from Anatolia inter-
fered with indigenous European hunters and gatherers and then some 5000 years
ago Yamnaya pastoralists from the Eurasian steppe migrated to Europe, i.e., the
phenotype of present-day Europeans is largely the product of this Bronze Age col-
lision of this three ancestral tribes.

Box 2.1 Natural selection

Positive natural selection, i.e., the force that drives the increase in prevalence
of advantageous traits, has played a central role in human evolution.
Individuals with advantages (referred to as “adaptive traits”) tend to be more
successful in reproduction, i.e., they contribute with more offspring to the fol-
lowing generation than others. Due to inheritance from one generation to the
other, the selection process increases the prevalence of the respective adaptive
trait. Under persistent selection pressure such adaptive traits, step by step,
may become universal to the population. Factors fostering selection, i.e.,
evolutionary pressures include, e.g., limits on resources, such as food, or
threats, such as pathogens. However, adaptive traits not always become
prevalent within a population. Gene frequency alteration in a population can
also happen via a genetic drift of genes that are not under selection (Sect. 5.4).
In this context, even a deleterious allele may become universal to the mem-
bers of a population, e.g., under the influence of a weak selection or in small
populations.
20 2 Human Genomic Variation

Hundreds of complex phenotypic traits determine how an individual looks and

behaves as well as his/her risks to develop non-communicable diseases. Furthermore,
each complex trait is based on dozens to hundreds of gene variants and environmen-
tal influences, i.e., for an understanding the molecular basis of a trait its genetic
architecture needs to be uncovered, such as
• the number of variants that influence a heritable phenotype
• their relative magnitude concerning different traits
• the population frequency of the respective variants
• their interactions with each other and the environment.
Whole genome sequencing has indicated that every individual carries, on aver-
age, 4–5 million genetic variants (Sect. 2.4) covering about 12 Mb (million base
pairs) of sequence (0.3% of all). Most of these genetic variants are neutral, i.e., they
do not contribute to phenotypic differences or disease risk, and are achieved simply
by chance significant frequencies within respective human populations. In this con-
text, the sum of rare, high-penetrance variants is of significant influence. However,
there is a large number of common variants with a small to modest effect size that
have a dominant role in common complex traits. For example, the trait “body
height” is dependent on at least 180 gene loci, i.e., it is a prime example of a com-
plex/polygenic trait (for further examples see Chaps. 8, 9 and 10). In Europe, this
trait has changed significantly (in average by 10 additional centimeters) within the
last few generations under the environmental trigger of improved quality and quan-
tity of nutrition.
During evolution of Homo sapiens up to 10% of all protein-coding genes,
i.e., some 2000 genes, may have been affected by positive natural selection. In
particular, the immune system, the digestive tract and the skin (including hair, sweat
glands and sensory organs) had been susceptible to positive selection (Sect. 4.1).
This is due to the fact that these organ systems are more likely in contact with the
environment than other parts of our body. For example, variants of the innate and
adaptive immune system (Box 2.2), such as genes encoding for membrane immune
receptors, had been under special positive selection by pathogenic microbes. An
interesting example is CCR5 (C-C chemokine receptor 5), which is essential for the
entry of HIV (human immunodeficiency virus) 1 into T cells, since a 32 bp deletion
in the CCR5 gene protects its carriers from HIV infection. This mutation is currently
becoming positively selected in populations where HIV1 infections occur on larger
scale, such as in South Africa. Moreover, some alleles that were introduced into
modern humans through interbreeding with archaic human species have been posi-
tively selected. For example, a Neanderthal variant of the SLC16A11 (solute carrier
family 16 member 11) gene, which encodes for a lipid transporter in the ER (endo-
plasmic reticulum), reached high frequencies, e.g., in native Americans, where it is
associated with increased T2D risk.
2.3 Genetic Variants of the Human Genome 21

Box 2.2 The innate and adaptive immune system

In general, the immune system is composed of biological structures, such as
lymph nodes, cell types, such as monocytes, macrophages, T and B lympho-
cytes (i.e., cellular immunity), and proteins, such as complement proteins and
antibodies (i.e., humoral immunity), that protect the organism against infec-
tious diseases. The immune system detects a wide variety of molecules,
known as antigens, of potential pathogenic origin, such as on the surface of
microbes, and distinguishes them from the organism’s own healthy tissue.
The immune system is classified into innate and adaptive immunity. The
innate immune system is evolutionary older, bases on monocytes, macro-
phages, neutrophils and natural killer cells, and uses destructive mechanisms
against pathogens, such as phagocytosis, with the support of anti-microbial
peptides from the complement system. Adaptive immunity applies more
sophisticated defense mechanisms, in which T and B cells use highly antigen-­
specific surface receptors, such as T cell receptors and B cell receptors, the
latter finally turning into secreted antibodies. Moreover, after an initial spe-
cific response to a pathogen the adaptive immune system creates an immuno-
logical memory that leads to an enhanced response to subsequent encounters
with that same antigen.

2.3 Genetic Variants of the Human Genome

The reference haploid sequence of the human genome (Box 2.3) was released in
2001 by the first “big biology” project, the Human Genome Project (Box 2.4), and
reflects the assembly of sequences derived from a few male donors. SNPs are vari-
ants of the sequence of the reference genome where exactly one nucleotide (A, T, G
or C) is altered (Fig. 2.2). In contrast, structural variants of the genome mostly affect
more than one nucleotide. These can be insertion-deletion (indel) variants, where in
most cases only a few bases are added or removed, respectively, but there are also
indels of up to 80 kb (kilo bp) in length. Indels that are not multiples of 3 bp in
length and are located within protein coding regions result in frameshift mutations,
i.e., from the position of the mutation onwards the whole amino acid sequence of the
encoded protein is changed. Furthermore, CNVs consist of deletions or insertions of
DNA stretches in one genome compared to another. These variants can be heterozy-
gous or homozygous. A predominant class of insertions is that of ancient transpo-
sons. These DNA stretches persist in the genome as SINEs (short interspersed
elements, e.g., Alu elements) and LINEs (long interspersed nuclear elements).
22 2 Human Genomic Variation

Box 2.3 The human genome

The human genome is the complete sequence of the anatomically modern
human and was obtained by the Human Genome Project (www.genome.
gov/10001772) via whole genome sequencing. This reference sequence is
accessible via different genome browsers (e.g., genome.ucsc.edu or www.
ensembl.org) and represents the assembly of the genomes of a few young
healthy male donors. With the exception of germ cells, i.e., female oocytes
and male sperm, each human cell contains a diploid genome formed by 2x
3.235 billion bp (3235 Mb) that is distributed on 2x 22 autosomal chromo-
somes and two X chromosomes for females and a XY chromosome set for
males. In addition, every mitochondrion contains 16.6 kb mitochondrial
DNA. The haploid human genome contains some 20,000 protein-coding
genes and about the same number of non-coding RNA (ncRNA) genes. The
protein-coding sequence covers less than 2% of our genome, i.e., the 98% of
the genome is non-coding and primarily has regulatory function.
Almost 50% of the sequence of our genome is formed by repetitive DNA
(often also referred to as “junk DNA”), which is sorted into the following
categories (by order of frequency):

LINEs (500–8000 bp) 21%

SINEs (100–300 bp) 11%
Retrotransposons, such as LTRs (long terminal repeats) (200–5000 bp) 8%
DNA transposons (200–2000 bp) 3%
Minisatellite, microsatellite or major satellite (2–100 bp) 3%

LINEs and SINEs are identical or nearly identical DNA sequences that are
separated by large numbers of nucleotides, i.e., the repeats are spread through-
out the whole human genome. LTRs are characterized by sequences that are
found at each end of retrotransposons. DNA transposons are full-length
autonomous elements that encode for a transposase, i.e., an enzyme that trans-
poses DNA from one to another position in the genome (also known as “jump-
ing DNA”).
2.3 Genetic Variants of the Human Genome 23

Box 2.4 Big biology projects

With a delay of some 20 years molecular biologists followed the example of
physicists and realized that some of their research aims could only be reached
through multinational collaborations of dozens to hundreds of research teams
and institutions in so-called big biology projects. The Human Genome Project
(www.genome.gov/10001772), which was launched in 1990 and finished in
2003, was the first example. Together with follow-up studies the project had a
tremendous impact on the understanding of the architecture and function of
human genes. The HapMap Project (http://hapmap.ncbi.nlm.nih.gov) was
one of these follow-ups benefitting from advancing genotyping technologies.
In parallel, improved next-generation sequencing methods allowed personal
genome sequencing of both normal and cancer genomes. This made large-­
scale genome sequencing studies possible, such as the 1000 Genomes Project
(www.1000genomes.org) and The Cancer Genome Atlas (TCGA) (www.can-
cer.gov/about-nci/organization/ccg/research/structural-genomics/tcga).
Furthermore, the Encyclopedia of DNA elements (ENCODE) Project (www.
genome.gov/encode) and the Functional Annotation of the Mammalian
Genome (FANTOM5) Project (http://fantom.gsc.riken.jp/5) focused on the
functional characterization of the human genome. The ENCODE follow-up
project Roadmap Epigenomics (www.roadmapepigenomics.org) provided
human epigenome references from 111 primary human tissues and cell lines.

Deletion (homozygous)
Reference genome GCAGCTGACAA...GTTGCATG
Target genome GCAGCTGA---------GCATG
SNP (heterozygous) Indel (homozygous) GCAGCTGA---------GCATG
Reference genome GACTGAGGCA AGGCTATG
Target genome GACTGGGGCA AGG--ATG
GACTGAGGCA AGG--ATG De novo insertion (heterozygous)
Reference genome GCTGCATG---------GATGC
Target genome GCTGCATGATC---GATGATGC
Phased SNPs GCTGCATG---------GATGC
Reference genome TAGCTGTAGC CTGATAGCT
Target genome TAGCTGTAGC CTGATTGCT
TAGCTCTAGC CTGATAGCT Inversion (heterozygous)
Reference genome ACTTGACTGCAAATCGTCAGTC
Target genome ACTTGACTACGATTTGCCAGTC
ACTTGACTGCAAATCGTCAGTC

Fig. 2.2 Types of variations present in human genome sequences. The haploid reference genome
is indicated at the top of each variant example, while the individual’s diploid genome is shown
below. The genetic variants can be either heterozygous or homozygous. Phased SNPs refers to
their order within a haplotype
24 2 Human Genomic Variation

The different types of human genetic variants are referred to as common (or
polymorphisms), when they have a MAF (minor allele frequency) of at least 1%
within the studied population, or as rare, when they have a MAF of less than 1%.
SNPs represent the most common class of genetic variations among individuals and
approximately seven million SNPs show a MAF of more than 5% (www.ncbi.nlm.
nih.gov/SNP). The 1000 Genomes Project (Sect. 2.5) indicated that in addition
there is a huge number of rare and novel SNPs. Nevertheless, the majority of vari-
ants of any given individual are common in the whole population. In parallel, some
60,000 unique CNVs are known and some of them are quite common in human
populations. Since the detection of structural variants needs advanced technology,
basically all initial associations between genome variations and complex traits, such
as observed by GWAS (genome-wide association studies), were done only with
SNPs. Nevertheless, per individual structural variants cover between 9 and 25 Mb
of sequence, i.e., 0.3–0.8% of the whole genome.
The average difference in nucleotide sequence of a pair of familial unrelated
humans lies in the order of 1 in 1000. This proportion is low compared with other
species and confirms the recent origin of Homo sapiens from a small founding
population. The impact of SNPs on the coding sequence of the human genome is
well established. Synonymous mutations do not alter the encoded protein, while
non-synonymous mutations cause a change in the amino acid sequence (missense)
or introduce a premature stop codon (nonsense). Indels as well as CNVs in exonic
sequences can result in either non-frameshift or frameshift mutations. Moreover,
CNVs in intronic sequences may lead to alternative splicing. The impact of genetic
variations in the non-coding region of the human genome will be discussed in
Sect. 4.3.

2.4 Haplotype Blocks and GWAS

The genetic approach of linkage analysis was used in the past, in order to identify
genes responsible for monogenetic disorders, such as the neurodegenerative
Huntington’s disease. However, these rare diseases represent only a relatively small
fraction of all disorders. In contrast, most human diseases have a complex origin,
i.e., they involve many gene loci in a complex interaction pattern (Sect. 4.2). For
these cases the genome-wide identification of SNPs via GWAS was found to be a
more suitable approach. With an average SNP density of 1 in 1000 nucleotides these
studies require the testing of millions of SNPs per individual and hundreds to thou-
sands of subjects. For this purpose, large-scale studies (Box 2.4), such as the Human
Genome Diversity Project and the HapMap Project, had been launched. They used
high-throughput SNP genotyping technologies, such as arrays with up to a million
SNPs. HapMap started in 2002 with 270 samples from the three major human popu-
lations, which were
• 90 samples from Yoruba individuals living in Ibadan, Nigeria
2.4 Haplotype Blocks and GWAS 25

• each 45 samples from Han Chinese individuals living in Beijing, China, and
Japanese individuals living in Tokyo, Japan
• 90 samples from individuals with European ancestry living in Utah, USA.
In its latest version, HapMap 3, the study extended to 1184 individuals from 11
global populations. The consortium performed genotyping for 1.6 million common
SNPs and CNVs and used knowledge from linkage disequilibrium analysis of hap-
lotype blocks.
Haplotype blocks are stretches of genomic DNA of typically 10–100 kb in length
that are inherited from generation to generation in blocks, i.e., they are not inter-
rupted by meiotic recombination events (Fig. 2.3). In contrast, the borders of haplo-
type blocks represent recombination events that had happened many generations
ago in our ancestors. In fact, gene conversion during meiosis is some 100 times
more frequent than point mutations and therefore a more efficient mechanism
of evolution. For this reason, sexual reproduction evolved. Since African popula-
tions have existed far longer than European and Asian populations, their haplotype
blocks are shorter, i.e., the blocks had more time to decay because of the accumula-
tion of recombination events in a higher number of generations. In contrast, all non-­
African humans derived from a small population of eastern African origin, i.e., they
went through a demographical bottleneck that is clearly visible in the limited diver-
sity of their genomes.
GWAS employs an “agnostic” approach in the search for unknown disease vari-
ants, i.e., they interrogate a large number of SNPs covering the entire human
genome. 15 years of intensive GWAS research resulted in more than 4000 publica-
tions reporting some 150,000 SNPs (as of August 2019) being statistically robustly
associated with one out of more than 500 complex diseases and traits (Catalog of
Published Genome-Wide Association Studies, www.ebi.ac.uk/gwas). Nowadays,
GWAS meta-analyses include more than 100,000 individuals and can explain a
larger proportion of trait heritability. For example, the heritability of about 20% of
CHD cases is explained by some 80 genetic loci, 20% of T2D by some 100 loci,
20% of inherited breast cancer by some 150 loci, 33% of inherited prostate cancer
by some 100 loci and 30% of Alzheimer’s disease by some 20 loci.
Despite this notable success, in average not much more than 10% of the heri-
tability of most complex, polygenic traits have been explained by common vari-
ants assessed by GWAS. In general, the missing or unsolved heritability does not
allow assigning an individual with any reliable estimation about his/her risk for a
particular disease, when exclusively SNP analysis is performed (for more advanced
analyses, see Sect. 4.5). The only well-known exceptions are age-related macular
degeneration and type 1 diabetes (T1D), for which the combinations of common
and rare variants can provide a quantifiable risk profile. GWASs with 2000–5000
individuals confidently identify common variants with effect sizes, referred to as
ORs (odds ratios), of 1.5 or greater, i.e., the odds of having, e.g., T1D are 1.5 times
higher the odds of being without the disease when carrying common variants. This
makes it unlikely that further common SNPs with moderate or even large ORs in
complex traits will be discovered in future. Limited statistical power to detect small
 Genetic variant A

Ancestral
chromosomes

Recombinantion
through many generations

Descendant chromosomes

A A

Fig. 2.3 The origin of haplotypes. Two plain ancestral example chromosomes get scrambled
through meiotic recombination over many generations, in order to yield different descendant chro-
mosomes. For example, after 30,000 years a typical chromosome will have undergone more than
one crossover per 100 kb. In the case of a genetic variant (marked by an A) on one ancestral chro-
mosome the risk of a particular disease increases. Thus, the two individuals (red) in the current
generation who inherited that region of the ancestral chromosome will be at increased risk. Within
the haplotype block that carries the disease-causing variant there are many SNPs that can be used
to identify the location of the variant
2.5 The 1000 Genomes Project 27

gene-gene and gene-environment interactions requires increasing sample sizes,

which may be achieved by pooling several GWASs through meta-analysis. For
example, sample sizes of 60,000 subjects are necessary to provide sufficient power
to identify the majority of variants with ORs of 1.1 (i.e., a 10% increased risk for the
tested trait). Some of the missing heritability may be explained by rare variants with
high ORs, which are poorly captured by standard GWASs. In addition, environ-
mental exposures, including those experienced as fetus (Sect. 5.3), affect the
epigenome and may explain large parts of the missing heritability.
For any investigated trait or disease a larger number of SNPs with high linkage
disequilibrium to the genomic variants are described on the same haplotype block,
but only a very few of them may explain the mechanistic basis of the trait. This
implies that most disease-associated SNPs are not functionally relevant to mecha-
nisms of the respective trait. Moreover, extensive sequencing of associated regions
may identify additional, previously unknown, rare variants with a possible biologic
role. This was one of the goals of the 1000 Genomes Project (Sect. 2.5). However,
only for protein-coding regions, which carry some 12% of all trait-associated SNPs,
a straightforward mechanistic explanation of the impact of the genetic variation is
possible, i.e., many of the remaining 88% variations are regulatory SNPs affecting
the genomic binding sites of transcription factors (Sect. 4.3).

2.5 The 1000 Genomes Project

Important technological advances in high-throughput sequencing have led to a rapid

decrease in the costs of DNA sequencing. As a result, whole genome sequencing
became an affordable tool in understanding the genomic basis of health and disease.
At present, already huge amounts of data have been obtained from whole genomes
of both healthy and diseased individuals. This information has not only helped in
disease stratification and in the identification of their molecular mechanisms, but
also is transforming the perspective of future health care from disease diagno-
sis and treatment to personalized health monitoring and preventive medicine
(Sect. 4.5).
Whole genome sequencing results in the identification of the complete set of
genetic variants of a given individual (Fig. 2.4). As a natural extension of the
HapMap Project, the 1000 Genomes Project was initiated in 2008 with the aim to
sequence the genomes of at least 1000 individuals from different populations around
the world. HapMap populations were included in the project (Table 2.1), and in total
2504 genomes from 26 populations covering all five continents were investigated.
In total, the project describes 88 million genome variants, of which 84.7 million are
SNPs, 3.6 million short indels and 60,000 structural variants. Individuals from
African ancestry populations show most variant sites confirming the out-of-Africa
model of human origin (Sect. 2.1). A typical human genome carries 200,000 vari-
ants, most of which are common and only 20% are rare (MAF < 0.5%). In average,
a typical genome contains some 150 variants resulting in protein truncation, 10,000
28 2 Human Genomic Variation

Sequencing of the genomes Identification of variations Characterization of differences

of various primate species between individuals between tissues

H. sapiens
P. troglodytes
Immunogenomics
Epigenomics
e.g., Roadmap Cancer genomics
Epigenomics e.g., TCGA
Metagenomics
H. neanderthalensis
is G. gorilla

Human Genome Project 1000 Genomes Project

Deciphering cellular mechanisms

Genome state
me3

Ac
DNA binding
Ac

Me
Ac
mRNA-degradation
Me me3

tone modifications Looping

folding
Genome foldin
Transcription
ncRNA

RNA folding
RNA-binding protein

RNA splicing
RNA life cycle Protein
RNA export
Poly(A)

Translation

Fig. 2.4 Roadmap of sequencing science. The Human Genome Project (Box 2.4) created a refer-
ence genome. Nowadays, also the genomes of all other primate species are known including some
extinct human species (top left). Whole genome sequencing of several thousand individuals was
performed in large consortia, such as the 1000 Genomes Project (top center). Moreover, the
genetic and epigenetic differences between tissues and cell types of the same individual were col-
lected in cancer genomics and epigenomics projects, such as TCGA and the Roadmap Epigenomics
(top right). The application of different next-generation sequencing methods allows integrating
many different processes within the cell (bottom)

changing amino acids and 500,000 affecting transcription factor binding sites.
Interestingly, each individual is heterozygous for 50–100 genetic variants that
can cause inherited disorders in homozygous offspring. This will provide a large
demand and challenge for genetic counseling based on whole-genome sequencing.
Moreover, gene-environment interactions provided by lifestyle factors, such as the
personal choice of food, will create an additional level of complexity (Sect. 4.5).
The rapid maturation of next-generation sequencing technologies led to the
exponential development of methods for nearly all aspects of cellular processes, i.e.,
sequencing allows their detailed and comprehensive analysis. For example,
epigenome-­wide methods investigate various aspects of chromatin biology, such as
DNA methylation, histone modification state and 3-dimensional (3D) chromatin
structure (Fig. 2.4, Sect. 5.1). Next-generation sequencing methods have the advan-
tage that they provide, in an unbiased and comprehensive fashion, information on
the entire epigenome. Individual research teams as well as large consortia, such as
the ENCODE Project and the Roadmap Epigenomics Project (Box 2.4), have
already produced thousands of epigenome maps from hundreds of human tissues
and cell types. The integration of these data, e.g., transcription factor binding and
characteristic histone modifications, allows the prediction of enhancer and promoter
Additional Readings 29

Table 2.1 Populations of the 1000 Genomes Project. Human populations that were included in
the 1000 Genomes Project are listed. The numbers of individuals that were investigated deep-­
coverage sequencing (i.e., some 50 unique reads) of 2504 subjects are indicated. Individuals across
26 populations were sequenced. These populations were classified into 5 major continental groups
(red): East Asia (EAS), Europe (EUR), Africa (AFR), America (AMR) and South Asia (SAS).
Original HapMap populations are highlighted in bold

regions as well as monitoring their activity and many additional functional aspects
of the epigenome. In Chap. 4 we will discuss further applications of these projects
including the identification and characterization of regulatory SNPs (Sect. 4.3) and
the iPOP (integrative personal omics profile) of individuals (Sect. 4.5).

Additional Readings

Genomes Project C, Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO,
Marchini JL, McCarthy S, McVean GA et al (2015) A global reference for human genetic
variation. Nature 526:68–74
Pääbo S (2014) The human condition-a molecular approach. Cell 157:216–226
30 2 Human Genomic Variation

Reich D (2018) Who we are and how we got here: ancient DNA and the new science of the human
past. Oxford University Press, Oxford ISBN 978-0-19-882125-0
Tam V, Patel N, Turcotte M, Bosse Y, Pare G, Meyre D (2019) Benefits and limitations of genome-­
wide association studies. Nat Rev Genet 20:467–484
Timpson NJ, Greenwood CMT, Soranzo N, Lawson DJ, Richards JB (2018) Genetic architecture:
the shape of the genetic contribution to human traits and disease. Nat Rev Genet 19:110–124
Veeramah KR, Hammer MF (2014) The impact of whole-genome sequencing on the reconstruc-
tion of human population history. Nat Rev Genet 15:149–162
Chapter 3
Sensing Nutrition

Abstract This chapter will describe distinct mechanisms of sensing the abundance
of fatty acids, amino acids and glucose via membrane receptors, metabolic enzymes,
regulatory kinases and transcription factors. The latter, in particular members of the
nuclear receptor superfamily, play a key role in nutrient-sensing pathways. Many
nuclear receptors bind macro- and micronutrients or their metabolites, such as fatty
acids to PPARs, oxysterols to LXRs (liver X receptors) and vitamin D metabolites
to VDR (vitamin D receptor), i.e., nuclear receptors are able to translate nutrient
fluctuations into responses of the genome. In metabolic organs nuclear receptors
respond to nutrient changes and specifically activate hundreds of their target genes.
Moreover, also the immune system is triggered in its inflammatory and antigen
response by nuclear receptors and their ligands. In addition, nuclear receptors
belong to those transcription factors that play a central role in managing the circa-
dian clock both in the CNS as well as in peripheral organs. Basically all tissues and
cell types of our body display a functional molecular clock, the coordination of
which is essential for optimal physiology including metabolism.

Keywords Lipid sensing · Amino acid sensing · Glucose sensing · Nuclear

receptors · Gene regulation · Lipid metabolism · PPARs · LXRs · VDR · Innate
immunity · Adaptive immunity · Circadian clock

3.1 Nutrient-Sensing Mechanisms

Periodical scarcity of nutrients was a strong evolutionary pressure to select

efficient mechanisms of nutrient sensing. This sensing process may be either the
direct binding of the macro- or micronutrient to its sensor or an indirect mechanism
that is based on the detection of metabolite that reflects the nutrient’s abundance.
The respective sensor is a protein that binds the nutrient with an affinity in the order

© Springer Nature Switzerland AG 2020 31

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_3
32 3 Sensing Nutrition

of the fluctuations of its physiological concentrations. The sensing of nutrients may

then trigger the release of hormones or other signaling molecules to the circulation,
in order to achieve a coordinated response of the whole organism.
Due to their non-polar nature, i.e., their insolubility in aqueous solutions, lipids
are rarely found free in soluble form. For example, in serum they are either
­transported in lipoproteins and chylomicrons (Sect. 10.3) or bound by albumin.
GPRs (G protein-coupled receptors), such as GPR40 and GPR120, bind long-chain
unsaturated fatty acids, e.g., in the membrane of β cells of the pancreas, and enhance
in these cells glucose-triggered insulin release (Fig. 3.1a). In enteroendocrine cells
of the intestine the binding of lipids to GPRs leads to the release of incretins (i.e.,
gastrointestinal hormones that amplify insulin secretion). In the intestinal lumen,
fatty acids are bound by the scavenger receptor CD36 (CD36 molecule) that initi-
ates their uptake (Fig. 3.1b). In taste buds CD36 triggers calcium release from the
ER and neurotransmission, while in enterocytes it promotes fatty acid uptake.
Adequate sensing of internal cholesterol levels is important, in order to
avoid, in case of abundant external supply, the activation of the energetically
demanding cholesterol biosynthetic pathway and to prevent toxic levels of free
cholesterol in the cell. Cholesterol binds to the protein SCAP (SREBF chaperone)
(Fig. 3.1c). In case of high intracellular cholesterol levels, SCAP increases its affin-
ity for INSIG1 (insulin-induced gene 1) protein that anchors SCAP and the tran-
scription factor SREBF1 (sterol regulatory element-binding transcription factor 1)
within the ER membrane. When cholesterol levels are low, the SCAP-SREBF com-
plex dissociates from INSIG and shuttles to the Golgi apparatus, where SREBF is
released, translocates to the nucleus and activates genes involved in lipid anabolism,
i.e., cholesterol biosynthesis and lipogenesis (Fig. 3.1d). In addition, at low choles-
terol levels the enzyme HMGCR (HMG-CoA reductase), which is also located in
the ER membrane, catalyzes a rate-limiting step of the cholesterol de novo synthesis
(Fig. 3.1e). In contrast, high levels of intermediates in the cholesterol biosynthesis
pathway, such as lanosterol, trigger the binding of HMGCR to INSIG, which leads
to the ubiquitin-mediated degradation of the enzyme (Fig. 3.1f). LXRs are activated
by elevated cholesterol levels (Sect. 3.4), i.e., the pathways of SREBF and LXRs
work in a reciprocal fashion, in order to maintain cellular and systemic cholesterol
homeostasis.
In case of shortage in amino acids, cellular proteins are used as a reservoir and
degraded via the proteasome or by autophagy (Box 3.1). The latter is a basic cata-
bolic mechanism that involves the degradation of unnecessary or dysfunctional cel-
lular components through the actions of lysosomes. The lysosome is an organelle,
in which amino acids and other nutrients are scavenged from cellular components.
Accordingly, a protein located at the outer surface of lysosomes, the TOR (target of
rapamycin) complex 1 (TORC1), acts as the key amino acid sensor (Sect. 6.1).
Thus, high levels of amino acids within the lysosome reflect their abundance in
the cell. This process promotes survival during starvation by maintaining cellular
energy levels. In contrast, during periods of prolonged starvation and hypoglyce-
mia, amino acids can be catabolized for the production of glucose and ketone bod-
ies, i.e., they provide essential energy sources for the brain.
3.1 Nutrient-Sensing Mechanisms 33

A B
Fatty acids Fatty acids

GPR40/ CD36
GPR120 G-protein

Cytoplasm

C D
Cholesterol NO Cholesterol

INSIG1

SREBF1 SCAP

HMGCR
SREBF1 3’
5’

Pol II

Nucleus

E F
Lanosterol NO Lanosterol
Ub UBC7 UBC7

VCP VCP

INSIG1 AMFR INSIG1 AMFR

HMGCR

Fig. 3.1 Lipid-sensing mechanisms. Fatty acid detection mechanisms by GPR40 and GPR120 (a)
and CD36 (b). In the presence of cholesterol (c), the SCAP-SREBF1 complex binds INSIG pro-
teins and remains anchored to the ER. In the absence of cholesterol (d), SCAP-SREBF1 does not
bind INSIG1 but moves to the Golgi, where the cytoplasmic tail of SREBF1 is cleaved acting as a
transcription factor regulating genes involved in cholesterol synthesis. The ER-embedded enzyme
HMGCR catalyzes a rate-limiting step in cholesterol synthesis and is expressed at low cholesterol
levels (e). When intermediates of the cholesterol biosynthetic pathway, such as lanosterol, are
abundant, HMGCR interacts with INSIG proteins leading to HMGCR ubiquitination and degrada-
tion (f)
34 3 Sensing Nutrition

Box 3.1 Autophagy

Mechanisms that deliver cytoplasmic molecules of endogenous or exogenous
origin to the lysosome for degradation. In microautophagy the cargo is
directly internalized in small vesicles that fuse with the lysosome, while in
chaperone-mediated autophagy proteins bearing KFERQ-like motifs are
recognized by HSPs (heat-shock proteins) A8 and translocated across the
lysosomal membrane. In macroautophagy the molecules that should
degraded are progressively sequestered within the autophagosome (a double-­
membrane organelle), which eventually fuses with the lysosome. Lysosomal
hydrolases initiate the degradation of the autophagic cargo and recycling of
the autophagic products back to the cytoplasm, in order to feed bioenergetics
metabolism or repair pathways. All eukaryotic cells exhibit constitutive
autophagic flux in physiological conditions, which is essential for the preser-
vation of homeostasis. Autophagic degradation increases in response to a
variety of nutritional, hormonal, chemical and physical stresses (Sect. 7.4).

The plasma membrane protein GLUT2 (encoded by the gene SLC2A2) is a trans-
porter with a rather low affinity for glucose (Fig. 3.2a). In contrast to other high-­
affinity glucose transporters, GLUT2 acts as a true sensor for glucose, since it is
only active at high but not at low physiologic glucose concentrations. Therefore,
GLUT2 has a central role in directing the handling of glucose after feeding. At peri-
ods of hypoglycemia, hepatic gluconeogenesis increases the glucose levels within
liver cells, and GLUT2 exports glucose to the circulation. The intracellular sensing
of glucose is mediated by the enzyme GCK (glucokinase) that catalyzes the first
step in the storage and consumption of glucose, i.e., glycogen synthesis and gly-
colysis. GCK has a significantly lower affinity for glucose than the other hexoki-
nases, i.e., it is only active at high glucose concentrations. Thus, GCK functions,
similar to GLUT2, as a glucose sensor (Fig. 3.2b). At low glucose levels this prop-
erty allows GCK (in collaboration with GLUT2) to export non-phosphorylated glu-
cose from the liver to the brain and skeletal muscles.
β cells of the pancreas sense systemic glucose levels. Glucose is imported into
β cells by GLUT2 and phosphorylated by GCK leading to an increased ATP (ade-
nosine triphosphate)/ADP (adenosine diphosphate) ratio. This depolarizes the
membrane via closing of potassium channels at the plasma membrane, leads to a
transient increase of intracellular Ca2+ concentrations, stimulates the fusion of
insulin-­laden vesicles with the plasma membrane and allows their release into sys-
temic circulation (Fig. 3.2c). In taste buds the detection of high energetic food is
mediated by the TAS1R2 (taste receptor, type 1, member 2) in complex with
TAS1R3 (Fig. 3.2d). Millimolar concentrations of glucose, fructose or sucrose but
also artificial sweeteners, such as saccharine, cyclamate and aspartame, activate the
T1R2-T1R3 receptor resulting in the sense “sweet”.
Further insight on nutrient sensing systems, including that via nuclear receptors
(Sect. 3.2), will allow a more integrative view of the molecular reactions of our body
3.2 Nuclear Receptors as Nutrient Sensors 35

A High glucose D Glucose EXTRACELLULAR

K+
Low glucose

Insulin

G-protein
GLUT2 GLUT2
TAS1R2 TAS1R3
Low glucose Ca2+

High glucose ATP

B C
Glc-6P

GCK

High intracellular glucose Glycogen Vesicle Glc-6P CYTOPLASM

Fig. 3.2 Glucose-sensing mechanisms. Due to its low affinity for glucose the transporter GLUT2
imports glucose only, when it has high concentrations (a, right) and exports glucose from hepato-
cytes into the circulation at hypoglycemic conditions (left). The enzyme GCK has low affinity for
glucose, i.e., only at high glucose concentrations it produces Glc-6P (glucose-6-phosphate) for the
use in glycolysis or glycogen synthesis (b). The release of insulin from β cells of the pancreas is a
multistep process that involves the phosphorylation of glucose by GCK, subsequent ATP produc-
tion and ATP-mediated blocking of potassium channels (c). A resulting calcium influx facilitates
the release of insulin from vesicles into the bloodstream. The heterodimeric oral taste receptors
TAS1R2-TAS1R3 bind only high concentrations of glucose, sucrose, fructose and artificial sweet-
eners and trigger signal transduction through G proteins (d)

to dietary molecules. This will not only address the cross-regulation between differ-
ent nutrient-sensing pathways, but will also incorporate other signaling pathways,
such as those controlling cellular growth or mediating chronic inflammation
(Sect. 1.5).

3.2 Nuclear Receptors as Nutrient Sensors

Most extracellular signaling molecules, such as growth factors and cytokines, are
hydrophilic and cannot pass cellular membranes, i.e., they need to interact with
membrane receptors, in order to activate a signal transduction pathway that eventu-
ally leads via the activation of a transcription factor to changes in gene expression
(Sect. 5.2). Thus, transcription factors serve as sensors of a multitude of cellular
perturbations. In contrast, in case of lipophilic signaling molecules, such as steroid
hormones, the signal transduction process is more straightforward, since these com-
pounds can pass cellular membranes and bind directly to nuclear receptors, i.e., to
ligand-sensitive transcription factors that are often already located in the nucleus
(Fig. 3.3).
36 3 Sensing Nutrition

Growth factors, peptide hormones, cytokines

Extracellular ligand Extracellular ligand

Membrane receptor Cellular membrane

Intracellular ligand CYTOPLASM

s
way
Metabolized or de novo Ribosome
HSP

path
synthesized in the cell

tion c
nsdu
al tra
NR partner receptor NR dimer NR-HSP
complex mRNA Protein

Sign
Changed
cellular
Nuclear pore
function

tion
e.g. p dification al
lation

horyla
trans

Co-factors hosp mRNA

post-
mo

Co-factors
RNA Pol II RNA Pol II
Nuclear
Nuclear DNA envelope
RE TATA TSS Primary target gene NUCLEUS

Fig. 3.3 Principles of nuclear receptor signaling. Some nuclear receptors, such as GR and AR,
reside in the cytoplasm in a complex with chaperone proteins, such as HSPs, but most nuclear
receptors are already located in the nucleus, where they are activated through the binding of their
specific lipophilic ligand. The ligand is either of extracellular origin and has passed cellular mem-
branes or is a metabolite that was synthesized inside the cell. After ligand binding, cytoplasmic
nuclear receptors dissociate from their chaperones and translocate to the nucleus, where they bind,
like the other members of the superfamily, to their specific genomic binding sites, referred to as
REs, in the relative vicinity of TSS (transcription start site) regions of their primary target genes.
Ligand-activated nuclear receptors interact with nuclear co-factors that build a bridge to the basal
transcriptional machinery with Pol II (RNA polymerase II) in its core. This then leads to changes
in the mRNA and protein expression of the target genes

The superfamily of nuclear receptors has 48 members in humans and comprises

special types of transcription factors that are able to bind and to be activated by
small lipophilic molecules called ligands. Many of these nuclear receptor ligands
are micro- and macronutrients or their metabolites. This includes the vitamin A
derivative retinoic acid (activating RAR (retinoic acid receptor) α, β and γ), fatty
acids and other lipids (activating PPARα, δ and γ), 1,25(OH)2D3
(1,25-­dihydroxyvitamin D3, activating VDR), oxysterols (activating LXRα and β),
bile acids (activating FXR (farnesoid X receptor)) and other hydrophobic food
ingredients CAR (constitutively androstane receptor) and PXR (pregnane X recep-
tor). The affinity of these nuclear receptors for their respective ligands ranges
between 0.1 nM (for VDR) and more than 1 mM (for PPARs) and reflects the physi-
ological concentrations of the molecules. Thus, some nuclear receptors represent
3.2 Nuclear Receptors as Nutrient Sensors 37

true sensors for micro- and macronutrients. In contrast, other nuclear receptors,
such as HNF (hepatocyte nuclear factor) 4α and 4γ, LRH-1 (liver receptor homolog-
­1), REV-ERB (Reverse-Erb) α and β, ROR (RAR-related orphan receptor) α, β and
γ as well as SF-1 (steroidogenic factor 1), bind nutrient derivatives, such as fatty
acids, phospholipids, heme and sterols, but this interaction is constitutive and does
not represent any sensing process.
All true nutrient sensing nuclear receptors form heterodimers with the sensor for
9-cis retinoic acid, RXR (retinoid X receptor) α, β, γ, and bind to specific nucleotide
sequences, referred to as REs (response elements). However, other nuclear recep-
tors form homodimers or contact DNA even as monomers. RXR heterodimer com-
plexes permanently locate in the nucleus, i.e., in contrast to GR (glucocorticoid
receptor) and AR (androgen receptor) they do not have first to dissociate from chap-
erone proteins and then to translocate into the nucleus. This indicates that the
macro- and micronutrient sensing process via nuclear receptors takes place in the
nucleus. Thus, nutrients can act as switches of genes by inducing a conforma-
tional change to the ligand-binding domains of their specific nuclear receptors. This
results in the coordinated dissociation of co-repressors and the recruitment of co-­
activator proteins, in order to enable transcriptional activation of up to 1000 genes
per nuclear receptor (Box 3.2).

Box 3.2 Genome-wide nuclear receptor analysis

Different next-generation sequence methods, such as ChIP-seq(chromatin
immunoprecipitation followed by sequencing), which were intensively used
by the ENCODE Project (Box 2.4), have also been applied for the genome-­
wide analysis of the action of nuclear receptors. The total sum of individual
binding sites for an individual nuclear receptor, referred to as its cistrome,
collectively for multiple tissues can exceed 20,000 loci. Moreover,
transcriptome-­wide methods, such as RNA-seq (RNA sequencing), identified,
in the sum of all tissues, more than 1000 primary target genes for most nuclear
receptors or their specific ligands. Not all of these binding sites and target
genes are equally important, but their huge numbers indicate that nuclear
receptors and their ligands are involved in the control of more physiological
processes than formerly assumed. On many, if not on all of their genomic
binding sites nuclear receptors co-locate with other transcription factors, such
as SPI1 (spleen focus forming virus proviral integration oncogene, also called
PU.1), FOX (forkhead box) A1 or NFκB (nuclear factor κB), that either work
as pioneer factors to open the local chromatin structure or to interact with
other signal transduction pathways, of which these proteins are the end points.
In addition, nuclear receptors do not directly contact DNA on all of their
genomic binding sites but can sometimes act as co-factors to other DNA-­
binding transcription factors.
38 3 Sensing Nutrition

Members of the nuclear receptor superfamily are involved in the regulation of

nearly all physiological processes of our body. They represent a class of transcrip-
tion factors that can easily and very specifically be regulated by small lipophilic
compounds. Nuclear receptors and their ligands play an important role in the
maintenance of homeostasis of our body that represents “health”. The evolu-
tionary oldest and likely still the most important role of nuclear receptors is the
regulation of metabolism. There is an interrelationship of lipid metabolism (supple-
mented by micro- and macronutrients taken up by diet), metabolites and their con-
verting enzymes, such as CYPs (cytochrome P450s), transporters and key
representatives of the nuclear receptor superfamily. There are many examples
(RAR, CAR, PXR, PPAR, VDR, LXR and FXR, differently color-coded in Fig. 3.4),
where a metabolite activates a nuclear receptor, which in turn regulates the expres-
sion of the enzyme or transporter handling the metabolite. Nuclear receptor-­
controlled CYP enzymes have also a central role in receptor ligand inactivation and
clearance. These triangle regulatory circuits are found at several critical posi-
tions in lipid metabolism pathways and allow a fine-tuned control on metabo-
lite concentrations and nuclear receptor activity. This suggests that dietary
metabolites are ancestral precursors of endocrine signaling molecules, such as ste-

CYP3A
PXR CYP2B ABCA1, G1, G5, G8
ER Vitamin E
Vitamin K
Flavonoids
LXR
Flavonoids
Oxysterols

Retinoic acid Micronutrients Diet Macronutrients Cholesterol Steroids

(Steroid hormone NRs)
RAR

RXR
Xenobiotics CYP7A1
CYP4A PPAR Fatty acids
CAR PXR

CYP26 Acetyl CoA Bile Acids

ABCB4, D2, D4
CYP3A PXR VDR FXR
CYP2B Isoprenoids

Lanosterol CYP7A1
ABCB1, C2, C3 CYP3A4
CYP8B1
1,25-Dihydroxy- 7-Dehydro-
vitamin D 3 CYP27B1 Cholesterol
ABCB11
VDR

Cholesterol
De novo synthesis
CYP24A1

Fig. 3.4 Triangle regulatory circuits of nuclear receptors, their ligands and metabolite handling
enzymes and transporters. The interrelationship between micro- and macronutrient metabolism
involves enzymes, transporters and nuclear receptors. Only a selected number of metabolites and
proteins are shown. There are many examples of triangle relationships (differently color-coded), in
which the metabolite regulates its nuclear receptor, the receptor the expression of the metabolite
converting enzyme and the enzyme the metabolite levels
3.3 Functions and Actions of PPARs 39

roid hormones. In turn this emphasizes the nutrigenomics principle (Sect. 4.4), that
diet is not only a supply for energy but has also important signaling function.
An immediate implication that followed from understanding the function of
nuclear receptors is their potential as therapeutic targets. In fact, nuclear receptor
targeting drugs are widely used and commercially successful. For example, bexaro-
tene and alitretinoin (RXRs), fibrates (PPARα), and thiazolidinediones (PPARγ) are
already approved drugs for treating cancer, hyperlipidemia and T2D, respectively.
Moreover, FXR and LXR agonists are in development for treating NAFLD (non-­
alcoholic fatty liver disease) and preventing atherosclerosis (Sect. 10.2). However,
natural nuclear receptor ligands that are taken up by healthy diet may avoid
any drug treatment.

3.3 Functions and Actions of PPARs

The different steps in handling fatty acids, such as resorbing them in the intestine,
metabolizing them in the liver, burning them in active tissues and collecting their
excess for long-term storage in adipose tissue, is coordinated by the three members
of the PPAR family (Fig. 3.5). PPARs are activated by various fatty acids and
their derivatives, such as PUFAs, eicosanoids and oxidized phospholipids. Each
PPAR subtype has unique functions, which is based on its distinct tissue distribu-
tion. PPARα is expressed predominantly in the liver, heart and kidney. PPARδ is
ubiquitously expressed but has most important functions in skeletal muscle (Sect.
1.6), liver and heart. PPARγ is highly expressed in adipose tissue and acts there both
as a master regulator of adipogenesis (Sect. 8.2) and a potent modulator of lipid
metabolism and insulin sensitivity. Due to alternative splicing and differential
­promoter usage, there are two PPARγ isoforms, of which PPARγ1 is expressed in
many tissues, while the expression of PPARγ2 is restricted to adipose tissue.
During fasting or starvation, PPARα is the primary regulator of the adaptive
response in the liver (Fig. 3.5a). This receptor senses the reversed flux of fatty acids
and activates a gene network to oxidize fatty acids, in order to generate energy in
liver and muscle and to convert fatty acids into a usable energy source, such as
ketone bodies during starvation. PPARα is also the molecular target of fibrates,
which are widely used drugs that reduce serum triacylglycerol levels through
increased fatty acid β-oxidation. In addition, PPARα stimulates the production and
secretion of the hepatokine FGF (fibroblast growth factor) 21, which acts as a stress
signal to other tissues, in order to adapt to an energy-deprived state in case of fast-
ing. After a meal, PPARα and PPARδ are sensing increasing fatty acid efflux from
the liver and start to manage lipid metabolism via the promotion of fatty acid
β-oxidation and ATP production in mitochondria of skeletal muscles and the heart.
Thus, fatty acids stimulate their breakdown.
PPARα, PPARδ and PPARγ interfere with the transcription factors NFκB and
AP1 (activating protein 1) in macrophages, endothelial cells, epithelial cells and
other tissues, causing the attenuation of pro-inflammatory signaling by decreasing
40 3 Sensing Nutrition

A B
Acetyl-CoA Macrophages and other cells
β/δ
β/δ α α
ATP
Acetyl-CoA
Fatty acids
ATP
Fatty acids
NFκB
α β/δ γ
α AP1
β/δ
α
Acetyl-CoA
Triacylglycerols TNF, IL6, CCL2 and VCAM
γ2 Fatty acids α ATP
Adipogenesis
C Osteoblast
activity
α
α β/δ
Insulin β/δ Fatty acids
sensitivity

Glucose

γ
Terminal Osteoclast
β/δ differentiation
activity

Fig. 3.5 Physiological roles of PPARs. PPARα regulates the expression of enzymes that lead to
the mobilization of stored fatty acids in adipose tissue and of fatty acid catabolizing enzymes in the
liver, heart and kidney (a). PPARδ (also called PPARβ in rodents) is expressed at high levels in the
intestine where it mediates the induction of terminal differentiation of epithelium. Activating
PPARδ or PPARγ can increase insulin sensitivity. PPARδ regulates the expression of fatty acid
catabolizing enzymes in skeletal muscle where released fatty acids are oxidized to generate
ATP. PPARγ promotes the differentiation of adipocytes. PPARα, PPARδ and PPARγ can interfere
with the transcription factors NFκB and AP1 causing the attenuation of pro-inflammatory signal-
ing (b). All tree PPAR subtypes also act in bone (c)

the expression of pro-inflammatory cytokines, chemokines and cell adhesion

­molecules (Fig. 3.5b). For example, PPARα and PPARδ neutralize via transrepres-
sion the p65 subunit of NFκB and in this way inhibit the expression of NFκB-
controlled cytokines, such as TNF, IL1B and IL6. Thus, PPARs are involved in the
control of inflammation (Sect. 7.2).
PPARδ decreases serum triacylglycerol levels, prevents high-fat diet-induced obe-
sity and increases insulin sensitivity through the regulation of genes encoding fatty
acid metabolizing enzymes in skeletal muscle and genes encoding for lipogenic pro-
teins in the liver. Moreover, PPARδ increases serum HDL-cholesterol levels via stimu-
lating the expression of the reverse cholesterol transporter ABC (ATP-binding cassette)
A1 and APO (apolipoprotein) A1, which is specific for cholesterol efflux (Sect. 10.2).
Moreover, the activation of PPARα and PPARδ promotes osteoblast activity in bone,
whereas the activation of PPARγ leads to osteoclast stimulation (Fig. 3.5c).
3.4 Integration of Lipid Metabolism by LXRs and FXR 41

In adipose tissue, PPARγ controls glucose uptake via regulating the expression
of the SLC2A4 gene (encoding for GLUT4). Furthermore, PPARγ together with
FGF1 mediates adipose tissue remodeling for maintaining metabolic homeostasis
during famine. Since high concentrations of circulating fatty acids can cause insulin
resistance (Sect. 9.2), enhanced uptake of fatty acids in adipose tissue, the stimula-
tion of the secretion of adiponectin and the inhibition of resistin production via
PPARγ improve the condition of the disease. Thus, activating PPARs by specific
synthetic ligands (glitazones) can inhibit obesity-related insulin resistance.
However, the increased uptake of fatty acids as well as the enhanced adipogenic
capacity in WAT after PPARγ activation is responsible for thiazolidinedione-­
associated weight gain. Moreover, the thiazolidinedione rosiglitazone was found to
increase the risk of heart failure, myocardial infarction and CVD, leading to
restricted access in the United States and a market withdrawal in Europe.
Nevertheless, the activation PPARγ via its natural ligands, such as PUFAs taken up
by healthy diet, may be sufficient.

3.4 Integration of Lipid Metabolism by LXRs and FXR

LXRs and FXR are sensors for the cholesterol derivatives oxysterols and bile acids,
respectively. These nuclear receptors do not only regulate cholesterol and bile acid
metabolism but also have a central role in the integration of sterol, fatty acid and
glucose metabolism. LXRα is expressed in tissues with a high metabolic activity,
such as liver, WAT and macrophages, whereas LXRβ is found ubiquitously. LXRs,
similarly to PPARs, have a large hydrophobic ligand-binding pocket that can bind
to a variety of different ligands, such as the oxysterols 24(S)-hydroxycholesterol,
25-hydroxycholesterol, 22(R)-hydroxycholesterol and 24(S),25-epoxycholesterol,
at their physiological concentrations. FXR is expressed mainly in the liver, intes-
tine, kidney and adrenal glands. Bile acids, such as chenodeoxycholic acid and cho-
lic acid, are endogenous FXR ligands, but the molecules can also activate the nuclear
receptors PXR, CAR and VDR.
LXR is known best for its ability to promote reverse cholesterol transport
(Sects. 7.3 and 10.2), i.e., cholesterol delivery from the periphery to the liver for
excretion (Figs. 3.6, 7.5 and 10.3). This involves the transfer of cholesterol to
APOA1 and pre-β HDLs via the transporter protein ABCA1, which is encoded by
one of the most prominent LXR target genes. Further important LXR targets are
ABCG1 and ABCA1 that promote cholesterol efflux from macrophages, and the
intracellular trafficking protein ARL4C (ADP-ribosylation factor-like 4C) that
facilitates cholesterol delivery to the plasma membrane. LXR also downregulates
the LDLR (low-­density lipoprotein (LDL) receptor) gene and upregulates the
IDOL (inducible degrader of LDLR) gene. Thus, activation of LXR attenuates
LDL uptake by macrophages counteracting the pathogenesis of atherosclero-
sis (Sect. 10.2).
42 3 Sensing Nutrition

LIVER

Lipogenesis WHITE ADIPOSE TISSUE

Conversion
SREBF1
to bile acids Fatty acid oxidation
FASN LPL
ACC
CYP7A1 SCD1

VLDL Fatty acids

Cholesterol
Triacylglycerols Mitochondria
APOD (β-oxidation)
APOE Bile acids THRSP
VLDL
Glucose uptake
GLUT4
HDL

APOAI
ABCA1 Pre-β
HDL
Reverse ABCA1
ABCG5
cholesterol ABCG8
transport Absorption
ABCG1
ARL7

Cholesterol
IDOL

LDL
MACROPHAGE LDLR INTESTINE
(peripheral tissue)

Fig. 3.6 Effects of LXR on metabolism. LXR has effects on multiple metabolic pathways. In
macrophages, LXR induces the expression of the genes IDOL, ARL4C, ABCA1 and ABCG1. In the
liver, LXR promotes fatty acid synthesis via induction of the transcription factor SREBF1 and its
target genes FASN, ACC and SCD1. Triglyceride-rich VLDLs (very low-density lipoproteins) in
the liver serve as transporters for lipids to peripheral tissues, including adipose tissue, where the
action of LPL liberates fatty acids from VLDLs. In adipose tissue, LXR regulates the expression
of APOD and THRSP and promotes fatty acid β-oxidation and glucose uptake via induction of
GLUT4. Finally, in the intestine, LXR inhibits cholesterol absorption by inducing the expression
of the ABCG5-ABCG8 complex

In the liver, LXR induces the expression of a cluster of apolipoprotein genes

including APOE, APOC1, APOC2 and APOC4, being involved in lipid transport
(Sect. 10.3) and catabolism. LXR also upregulates genes encoding for lipid remod-
eling proteins, such as PLTP (phospholipid transfer protein), CETP (cholesterol
ester transfer protein) and LPL (lipoprotein lipase) (Fig. 3.6). Furthermore, LXR
induces the expression of several genes that mediate the elongation and the desatu-
ration of fatty acids, which leads to synthesis of long-chain PUFAs, such as ω-3
fatty acids. This increase in long-chain PUFAs results in decreased expression of
NFκB target genes via epigenetic silencing of their regulatory regions. Long-chain
PUFAs also function as substrates for the enzymes that synthesize eicosanoids and
other specialized inflammation-resolving lipid mediators, such as resolvins and pro-
tectins. Furthermore, LXR induces the gene for the enzyme LPCAT3 (lysophospho-
lipid acyltransferase 3) mediating the synthesis of phospholipids containing
3.4 Integration of Lipid Metabolism by LXRs and FXR 43

long-chain PUFAs. Thus, LXR activation decreases ER stress and inflammatory

responses (Sect. 7.5).
A major function of LXR in the liver is the promotion of de novo biosynthesis of
fatty acids through the stimulation of the transcription factor SREBF1 and the
enzymes ACC, FASN and SCD1 (steroyl-CoA desaturase 1). Some of these fatty
acids are esterified with cholesterol, in order to avoid toxic levels of free cholesterol.
In the intestine, LXR induces the expression of genes encoding the transporters
ABCG5 and ABCG8 that mediate the apical efflux of cholesterol from enterocytes.
In adipose tissue, LXR also affects glucose metabolism via the stimulation of
GLUT4 expression. In this tissue, LXR regulates the expression of lipid-binding
and metabolic proteins, such as APOD and THRSP (thyroid hormone responsive),
and increases fatty acid β-oxidation.
FXR often acts in a complementary or reciprocal way to LXR in the control of
lipid metabolism. Since high bile acid concentrations are toxic to cells, a central
function for FXR is to control these levels. Bile acids are cholesterol derivatives that
facilitate the efficient digestion and absorption of lipids and lipid-soluble vitamins
after a meal, but they represent also the major way to eliminate cholesterol from the
body. Nevertheless, most bile acids are recycled via enterohepatic circulation, i.e.,
they pass from the intestine back to the liver. FXR controls this bile acid flux via
modulating their synthesis, modification, absorption and uptake. In the liver, FXR
inhibits bile acid synthesis by repressing the expression of the genes CYP7A1 and
CYP8B1. FXR stimulates the secretion of FGF19 from the intestine, which then
activates FGFR4 (FGF receptor 4) in the liver and in this way provides a comple-
mentary mechanism for the feedback inhibition of bile acid synthesis.
In the gall bladder, FXR upregulates the expression of the enzymes SLC27A7
(bile acid-CoA synthase) and BAAT (bile acid-CoA-amino acid N-acetyltransferase),
which catalyze the conjugation of bile acid with the amino acids taurine or glycine,
and that of the bile salt export pumps ABCB11 and ABCB4. In the intestine, FXR
inhibits the absorption of bile salts via the downregulation of the apical sodium-­
dependent bile salt transporter SLC10A2 and promotes the movement of bile salts
from the apical to the basolateral membrane of enterocytes via the upregulation of
FABP6 (ileal fatty acid-binding protein). FXR limits hepatic bile salt levels by the
downregulation of the bile acid transporters SLCOs (solute carrier organic anion
transporters) A1 and A2. Furthermore, in order to protect the liver from toxicity,
FXR induces the expression of the enzymes CYP3A4 and CYP3A11, which
hydroxylate bile acids, as well as SULT2A1 (sulfotransferase family 2A, member 1)
and UGT2B4 (UDP glucuronosyltransferase 2 family, polypeptide B4), which sul-
phate and glucuronidate bile acids, respectively. In addition, in the liver FXR
reduces lipogenesis via the repression of SREBF1 and FASN gene expression, i.e.,
the receptor decreases triacylglycerol levels. Finally, FXR also influences hepatic
carbohydrate metabolism and inhibits gluconeogenesis via the downregulation of
G6PC (glucose-6-phosphatase) and PCK (phosphoenolpyruvate carboxykinase) 2.
Thus, FXR is an important regulator of lipid metabolism.
44 3 Sensing Nutrition

3.5 Coordination of the Immune Response by VDR

The immune system is composed by a multitude of highly specialized cells (Box

2.2) that are all created by a differentiation process of blood cells, referred to as
hematopoiesis. Cellular differentiation is controlled by epigenetic mechanisms
(Sect. 5.1), in which a number of developmental transcription factors play a key
role. Cells of the immune system have a rapid turnover and are therefore able
to show a maximal adaptive response to environmental changes. Lipid sensing
and signaling via nuclear receptors has an important role in the differentiation and
subtype specification of immune cells, such as T cells, macrophages and DCs (den-
dritic cells, Sect. 7.1). Importantly, these cells are very mobile and are found in a
wide range of subtypes nearly everywhere in our body, i.e., also in metabolic tissues
and in disease scenarios, such as obesity (Sect. 8.1). Thus, macrophages and DCs
as well as their precursors, monocytes, coordinate metabolic, inflammatory
and general stress-response pathways via changes of their transcriptome pro-
file and respective subtype specification. Nuclear receptors, such as VDR, RAR,
LXR and PPAR, have central functions in sensing these endogenous and exogenous
stimuli as well as in adapting the respective gene expression profiles of the immune
cells. As a representative of all micro- and macronutrient-sensing nuclear receptors,
in the following we will focus on VDR and its ligand 1,25(OH)2D3.
Vitamin D3 and its most abundant metabolite, 25-hydroxyvitamin D3 (25(OH)
D3), either derive from diet, such as fatty fish, or from endogenous production of
vitamin D3 in response to UV-B exposure of the skin. Since vitamin D and its
metabolites can be stored in adipose tissue, there are rather seasonal than daily
variations in the vitamin D status of our body. Worldwide more than one billion
people are vitamin D deficient, i.e., their 25(OH)D3 serum levels are below
50 nM. Bone malformations, such as rickets and osteomalacia, are extreme exam-
ples of the effects of vitamin D deficiency, but since vitamin D is involved in a broad
range of physiological processes, it can increase the risk for various diseases and
susceptibility for infections. Living at higher latitudes, i.e., at significant seasonal
variations of UV-B exposure, increases the risk of the autoimmune diseases T1D,
multiple sclerosis and Crohn’s disease.
VDR is expressed in all important cell types of the immune system, i.e., these
cells are sensitive to changes in 25(OH)D3 serum levels. Importantly, macrophages
and DCs express the enzyme CYP27B1 that converts 25(OH)D3 into the VDR
ligand 1,25(OH)2D3, i.e., in these cells vitamin D can act autocrine or paracrine
(Fig. 3.7). Interestingly, while CYP27B1 expression in the kidneys is negatively
regulated by a number of signals, such as Ca2+, parathyroid hormone, phosphate and
1,25(OH)2D3, antigen-presenting cells do not respond to these inhibitory signals but
rather further upregulate CYP27B1 expression after stimulation with cytokines and
TLR ligands.
TLRs and other PRRs detect pathogens on the surface of macrophages and initi-
ate an immune response (Sect. 7.2), e.g., against the intracellular bacterium M. tuber-
culosis. Notably, no other infectious disease than tuberculosis had so many human
3.5 Coordination of the Immune Response by VDR 45

SKIN 7-Dehydro Dietary intake

Vitamin D3 Vitamin D2 and D3
cholesterol

DIET
LIVER
CAMP
CYP27B1 DEFB4
CYP27B1 Paracrine 25-hydroxy Autocrine
VDR 1α,25-dihydroxy Monocyte/
vitamin D3 vitamin D3 VDR
macrophage
TH DC

CYP27B1
CYP27B1 Epithelial cell
Autocrine 25-hydroxy Autocrine
VDR VDR trophoblast
vitamin D3
decidua
?
DC e
rin
TH
toc
Au

e
in
cr
do
En
CYP27B1 KIDNEY
VDR Endocrine Endocrine Neutrophil
1α,25-dihydroxy
vitamin D3 VDR
TH
ANTIGEN PRESENTATION/ ANTI-BACTERIAL
T-CELL FUNCTION ACTIVITY

Fig. 3.7 Innate and adaptive immune responses to vitamin D. Macrophages and DCs express the
vitamin D-activating enzyme CYP27B1 and VDR can then utilize 25(OH)D3 for autocrine and
paracrine responses via localized conversion to active 1,25(OH)2D3. In monocytes and macro-
phages, this promotes the response to infection via the anti-bacterial peptides CAMP and DEFB4.
1,25(OH)2D3 inhibits DC maturation and modulates T helper (TH) cell function. Intracrine immune
effects of 25(OH)D3 may also occur in CYP27B1/VDR-expressing epithelial cells. In contrast,
most other cells, such as TH cells and neutrophils, depend on the circulating levels of 1,25(OH)2D3
that are synthesized by the kidneys, i.e., they are endocrine targets of 1,25(OH)2D3

victims (in total up to one billion). In macrophages, the TLR-triggered increased

expression of VDR target genes encoding for anti-microbial peptides, such as
CAMP (cathelicidin) and DEFB4 (defensin, beta 4A), efficiently kill intracellular
M. tuberculosis (Fig. 3.7). This vitamin D-dependent anti-microbial mechanism can
explain, why sun or artificial UV-B exposure is efficient in the supportive treatment
of tuberculosis, vitamin D deficiency is associated with more aggressive tuberculo-
sis, some variations of the VDR gene increase the susceptibility to M. tuberculosis
infection and humans with dark skin living distant from the equator have an
increased susceptibility to tuberculosis infection.
Moreover, vitamin D-induced cytokine production of T cells and monocytes
modulate CAMP expression. Thus, the availability of the micronutrient vitamin
D is essential for an appropriate response to infections. Like many other nuclear
receptors, VDR can antagonize, via transrepression of transcription factors, such as
NFAT, AP1 and NFκB, the inflammatory response of immune cells. The resulting
46 3 Sensing Nutrition

decreased expression of cytokines, such as IL2 and IL12, demonstrates the anti-­
inflammatory potential of vitamin D metabolites.
VDR is a key transcription factor in the differentiation of myeloid progenitors
into monocytes and macrophages (Sect. 7.1). In contrast, in DCs vitamin D inhibits
differentiation, maturation and immuno-stimulatory capacity via the repression of
the genes encoding for the different variants of MHC (major histocompatibility
complex) and its co-stimulatory molecules CD40, CD80, CD86 and the upregula-
tion of inhibitory molecules, such as CCL22 (chemokine (C-C motif) ligand 22) and
IL10. This tolerogenic (i.e., immune tolerance inducing) phenotype of DCs is asso-
ciated with the induction of TREG cells (Fig. 3.7).

3.6 Circadian Control of Metabolic Processes

Light-sensitive organisms, such as humans, synchronize their daily behavioral and

physiological rhythms with the rotation of the Earth around its axis, i.e., they dis-
play circadian (i.e., “approximately one day”) activity cycles, such as sleep/wake
and fasting/eating. These circadian rhythms are under control of a molecular clock,
which is a hierarchical network of transcription factors and associated nuclear pro-
teins that adapts to environmental changes. These rhythms are generated by the
SCN (suprachiasmatic nucleus) of the hypothalamus (Fig. 3.8a). The SCN is com-
posed of only 15–20,000 neurons, which autonomously oscillate in a 25 h rhythm.
Via a direct connection with the retina this central clock is adjusted to the daily
light-dark cycle. The SCN is the main driver of circadian fluctuations in blood
glucose levels via scheduling food ingestion to the activity phases. Moreover, the
SCN directs the peripheral clocks in all other tissues and cells of our body via syn-
chronizing rhythmic food intake. The output of the oscillating system is coordinated
physiology via the control of various processes in metabolism and behavior. Thus,
the circadian clock is a critical interface between nutrition and homeostasis
directing and maintaining proper rhythms in metabolic pathways.
The core of the circadian clock is a series of transcription-translation feedback
loops of the transcription factors ARNTL (aryl hydrocarbon receptor nuclear
translocator-­like, also called BMAL1) and CLOCK (clock circadian regulator) and
their co-repressor proteins. This ARNTL-CLOCK complex activates in a circadian
fashion the expression of hundreds of genes both in the brain and in peripheral
metabolic tissues, including also the genes PER1 (period circadian clock 1) and
CRY1 (cryptochrome circadian clock 1). The PER1-CRY1 co-repressor complex
inactivates ARNTL-CLOCK, but phosphorylation and ubiquitylation of CRY1 dur-
ing the night initiates the proteosomal degradation of the repressors and re-activates
ARNTL-CLOCK. The genes encoding for the nuclear receptors REV-ERBα and
RORα are further targets of ARNTL-CLOCK. REV-ERBα negatively and RORα
positively regulates the expression of the ARNTL gene, i.e., these nuclear receptors
form additional feedback loops in the control of the circadian clock (Fig. 3.8b). In
total, the expression of some 10–15% of genes in all organs and tissues displays a
circadian rhythm.
3.6 Circadian Control of Metabolic Processes 47

A B
SCN

L
CK
NT
CLO
AR
E-box PER1 PER1
CRY1

TL
CK
N
CLO
AR
12 E-box CRY1
DAY/NIGHT

L
9 3

CK
NT
CLO

CK
TL
AR
6

N
CLO
AR
Master clock E-box RORA RORα
hormones
metabolites

L
CK
NT
CLO
AR
E-box NR1D1 REV-ERBα

12 12 12 12 12 12

Peripheral clocks 9

6
3 9

6
3 9

6
3 9

6
3 9

6
3 9

6
3
ARNTL RORE

Cyclic gene expression target target target target target target

CLOCK

Peripheral organs

Fig. 3.8 The circadian clock. Electrical and humoral signals from the SCN synchronize phases of
circadian clocks in peripheral organs, which then generate time-dependent rhythms in gene expres-
sion, metabolism and other physiological activities (a). In the feedback loop of the molecular cir-
cadian oscillator positive elements, such as the transcription factors ARNTL, CLOCK and ROR,
are shown in green, and negative elements, such as PER1, CRY1 and REV-ERBα, in red (b). The
combined actions of hundreds of ARNTL-CLOCK target genes provide a circadian output in
physiology

In the absence of external stimulation, the release of the stress hormone cortisol
as well as some peptide hormones, such as thyrotrophin and GH1 (growth hormone
1), follow a circadian rhythm, i.e., the respective endocrine glands are under the
influence of circadian clocks. Food intake is organized into distinct meals during the
daily cycle, i.e., in the active part of the day energy stores are replenished, while the
sleep phase represents a daily period of fasting and mobilization of energy stores.
Bad lifestyle decisions are able to reprogram the circadian clock. For example,
eating at night, artificial light, shift work, travel across time zones and temporal
disorganization have disrupted for many humans the alignment between the exter-
nal light-dark cycle and their internal clock. This is of disadvantage for metabolic
health. Longitudinal population studies and clinical investigations both have indi-
cated an association between shift work and diseases, such as T2D, gastrointestinal
disorders and cancer that can be modulated by changes in the circadian rhythm.
Furthermore, the habit of altering bedtime on weekends, the so-called “social jet
lag”, is associated with increased body weight.
The circadian clock can be modulated by metabolites, in particular by those
representing energetic flux (Box 3.3). For example, the AMP sensor AMPK (Sect.
6.6) connects the internal clock function to the nutrient state via phosphorylation
and subsequent proteasomal degradation of the ARNTL-CLOCK repressor CRY1.
48 3 Sensing Nutrition

In parallel, the cyclical activity of ARNTL-CLOCK is modulated by the chromatin

modifier KDM (lysine demethylase) 5A (Sect. 5.2), which in turn is linked via its
co-factors iron and α-ketoglutarate to cellular redox and mitochondrial energetics.
The bidirectional interaction between circadian and metabolic signaling is the inhi-
bition of ARNTL-CLOCK by the NAD (nicotinamide adenine dinucleotide)-depen-
dent HDAC (histone deacetylase) SIRT (sirtuin) 1. This represents another feedback
control of the circadian clock, since the gene encoding for the critical enzyme for
NAD+ synthesis, NAMPT (nicotinamide mononucleotide phosphoribosyltransfer-
ase, also known as visfatin), is a direct ARNTL-CLOCK target. Since NAD+-
dependent sirtuins are important regulators of metabolic pathways in response to
calorie restriction (Sect. 6.6), the link between the circadian clock and sirtuin
activity has implications for aging.

Box 3.3 Modulating the circadian clock by metabolic systems

The proteins of the circadian clock are not only expressed in the SCN but also
at peripheral sites, such as the liver. Entrainment of the liver clock to feeding
involves glucocorticoid signaling, temperature via HSF1 (heat shock tran-
scription factor 1) and ADP-ribosylation. In this way, the circadian clock
coordinates daily behavioral cycles of sleep-wake and fasting-feeding with
anabolic and catabolic processes in the periphery. The central and peripheral
clocks are also synchronized via post-translational modifications of transcrip-
tion factors and histones that tune gene expression rhythms into changes of
the metabolic state. Therefore, in addition to the transcription-translation-­
based feedback systems, mammals and other species use NAD+ oscillation,
redox flux, ATP availability and mitochondrial function, in order to influence
acetylation and methylation reactions. For example, the redox-based clock
represents oscillations in the redox state of the family of peroxiredoxin anti-­
oxidant enzymes that rhythmically anticipate the generation of ROS. Moreover,
NAD+ is an electron shuttle in oxidoreductase reactions and also acts as a co-­
factor in HDAC and ADP-ribosylation modifications (Sect. 5.2).

Additional Readings

Carlberg C, Molnár F (2016) Mechanisms of gene regulation. Springer Textbook ISBN:

978-94-017-7740-7
Challet E (2019) The circadian regulation of food intake. Nat Rev Endocrinol 15:393–405
Efeyan A, Comb WC, Sabatini DM (2015) Nutrient-sensing mechanisms and pathways. Nature
517:302–310
Greco CM, Sassone-Corsi P (2019) Circadian blueprint of metabolic pathways in the brain. Nat
Rev Neurosci 20:71–82
Reinke H, Asher G (2019) Crosstalk between metabolism and circadian clocks. Nat Rev Mol Cell
Biol 20:227–241
Chapter 4
Interference of the Human Genome
with Nutrients

Abstract This chapter will discuss the complex relation between our environment,
diet and genome. Genes influence our response to diet, while nutrients, or the lack
of them, can affect gene expression. More than 90% of our genes have not changed
since the life in the stone ages, where food availability meant survival. In this con-
text, the molecular basis for the recent adaption of our genome to environmental
changes, such as less UV-B exposure after migrating north, and dietary opportuni-
ties due to dairy farming, such as lactose tolerance, will be discussed. The majority
of trait-associated variants of our genome are located outside of protein-coding
regions, e.g., often they are regulatory SNPs within transcription factor binding
sites. Nutrigenomics has taken up many elements from molecular biology and next-­
generation sequencing technologies for investigating the effects of food on the level
of our epigenome, genome, transcriptome, proteome and metabolome. These meth-
ods can be applied for comprehensive assessment of individuals, such as in iPOP
(integrated personal omics profile)-style analyses. The respective datasets are the
basis for the optimization of personalized nutrition, preserving health via the pre-
vention of nutrition-related diseases.

Keywords Immunity · Skin color · Positive selection · Lactose tolerance ·

Expression quantitative trait locus · Regulatory SNPs · Nutrigenomics · Omics
technologies · Integrative personal omics profile · Polygenic risk score ·
Personalized nutrition

4.1 Human Genetic Adaptions

Changes in environment and nutrition have been a major driver of human evolution
and may have been the main factor that enabled Homo sapiens to survive and prog-
ress (Sect. 1.1). Humans have spread from Africa around the world, experienced an
ice age, domesticated hundreds of plant species and more than a dozen animals for
the start of agriculture and dairy farming (Sect. 2.1). Thus, during the migration of
the past 50,000 years, selective pressures in local environments in combination

© Springer Nature Switzerland AG 2020 49

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_4
50 4 Interference of the Human Genome with Nutrients

with random genetic drifts resulted in population-specific genetic adaptations.

In parallel, humans significantly increased in population density, i.e., they shifted
from small groups of mobile hunters and gatherers to permanent settlement of larger
numbers of families in villages. This human-modified habitat favored vector insects,
such as mosquitos, and involved close proximity to domesticated animals, such as
chicken and pigs, both of which act as reservoirs of zoonotic pathogens, such as
viruses, bacteria and parasites. Thus, compared to hunters and gatherers the bur-
den of infectious diseases in agricultural societies increased drastically. The
exposure to novel pathogens served as strong challenges for the immune system and
selective pressures in recent human evolution.
Interestingly, the admixture of Homo sapiens with archaic homini, such as
Neanderthals and Denisovans, who already had adapted genetically to environmen-
tal conditions of Eurasia for more than 300,000 years, led to the transfer of gene
variations and improved the fitness for survival outside of Africa. Although in total
only 1–2% of the genome of today’s populations in Europe and Asia relates to
archaic homini, some of these variants cluster to larger haplotype blocks. Due to this
adaptive introgression process alleles of Neanderthal origin are associated with
traits of medical relevance, such as the risk for the autoimmune disease lupus ery-
thematosus, biliary cirrhosis and Crohn’s disease and T2D (Sect. 2.2). Thus, sea-
sonal variations and exposure to cold had made the Neanderthal’s immune
system more robust, the underlying gene variants of which improved the adap-
tion of Homo sapiens to environmental conditions of Eurasia.
A very obvious phenotypic difference between today’s human populations is the
color of skin, hair and eyes. These traits largely influence our appearance and may
also have impact on reproductive success. Skin is our largest organ and it mediates
direct interaction with the environment, such as absorption of UV radiation, tactile
sensitivity, detection of pain and thermoregulation. People that live close to the
equator or at high altitude, such as in the Himalayas or the Andes, have the darkest
skin, while on the northern hemisphere at higher latitude lighter skin types are
observed. Before the migration out of Africa the skin of Homo sapiens was dark,
because some 2 million years earlier their ancestors turned dark when they lost most
of their body hair, in order to better regulate their body temperature via sweating
during endurance physical activity (Sect. 1.6). Permanent dark skin better protects
against the deleterious effects of solar UV-B radiation, such as sunburns and skin
cancer, and may prevent the degradation of the photosensitive B vitamin folate.
Variations in genes affecting pigmentation represent a key example of adap-
tion to the environment in Europe and Asia. In the process of melanogenesis the
amino acids phenylalanine, tyrosine and cysteine are converted to melanin.
Variations in genes, such as SLC24A5, SLC45A2, OCA2 (OCA2 melanosomal
transmembrane protein), TYR (tyrosinase), MC1R (melanocortin 1 receptor), IRF4
(interferon regulatory factor 4), DCT (dopachrome tautomerase), CTNS (cystinosin,
lysosomal cystine transporter) and MYO5A (myosin VA), encoding for the enzymes
of this pathway as well as for ion channels in melanocytes or transport molecules
involved in melanosome maturation and export can result in light hair, light skin and
blue eyes, as it is typical in northern European populations. The amount of eumela-
4.2 Genetic Adaption to Dietary Changes 51

nin (black-brown) and pheomelanin (yellowish-redish) production within melano-

some granules affects skin and hair color after they have been transferred from
melanocytes to keratinocytes or hair shafts, respectively. In contrast, melanocytes
within the iris keep their melanosomes and eye color depends on the ratio of phe-
omelanin to eumelanin (14:1 for blue eyes and 1:1 for brown eyes). Furthermore, a
variant of the EDAR (ectodysplasin A receptor) gene, which is required for the
development of hair, teeth and other ectodermal tissues, is associated with increased
hair thickness, a higher number of sweat glands and shovel-shaped incisors. This
variant is dominant in Asian populations.

4.2 Genetic Adaption to Dietary Changes

Humans were the only species that learned some 1 million years ago to use fire for
cooking raw food and thereby created a safer and more easily digestible diet.
Together with the omnivorous choice of diet, the advantage of cooking increased the
energy yield of the meals and allowed the enlargement of glucose-demanding
brains. Moreover, like other plant eating species, humans evolved receptors for
sensing sweet taste (Sect. 3.1), in order to detect the most energy-rich diet, although
this initial survival instinct nowadays causes overweight and obesity.
Our diet is majorly composed of starch from grain flour, rice or potatoes (Sect.
1.1). The polysaccharide starch is digested to glucose by enzymes of the AMY (amy-
lase) gene family, which in some species, including us, are expressed both in saliva
(AMY1) and pancreas (AMY2A and AMY2B). In agricultural societies with starch-­
rich diets individuals tend to have higher copy numbers of the AMY genes than
hunters and gatherers with low starch consumption. For example, in Japan large
amounts of rice and starch from other sources are consumed reflecting many copies
of the AMY1 gene, whereas in the genetically closely related Siberian Yakut popula-
tion (primarily eating fish and meat) significantly less AMY1 copies are found. In
general, in contrast to archaic homini today’s humans have up to 20 copies of the
AMY1 gene, which causes higher levels of salivary AMY protein expression. This
leads to better digestion of starchy foods as well as to a sweet sensation in the
mouth. The amplification of the AMY1 gene is an example of positive evolution-
ary selection (Box 2.1) underlining the long and continuing importance of these
staples in our diet. Interestingly, when wolves became dogs they adapted to a new
source of food, which were starch-rich leftovers of human diet, and also got multi-
ple copies of the AMY genes.
The genes of the ADH (alcohol dehydrogenase) cluster encode for ethanol
metabolizing enzymes and are another example of a gene locus that was positively
selected when agriculture made the production of fermented alcoholic beverages
easy. These examples suggest that the transition to new diet sources after the
advent of agriculture and the colonization of new habitats have been a major
factor for the selection of human genes. Additional examples of genes that were
positively selected due to dietary changes are ADAMTS (ADAM metallopeptidase
52 4 Interference of the Human Genome with Nutrients

with thrombospondin motif) 19 and 20, APEH (N-acyla(minoacyl-peptide hydro-

lase), PLAU (plasminogen activator, urokinase) and UBR1 (ubiquitin protein ligase
E3 component n-recognin 1), which encode for enzymes related to protein metabo-
lism. In addition, there are population-specific examples of variants within genes
involved in metabolizing mannose (MAN2A1 (mannosidase, alpha, class 2A, mem-
ber 1) in West Africa and East Asia), sucrose (SI (sucrase-isomaltase) in East Asia)
and fatty acids (SLC27A4 and PPARD in Europe, SLC25A20 in East Asia, NCOA1
(nuclear receptor co-activator 1) in West Africa and LEPR (leptin receptor) in East
Asia). Thus, human populations have genetically adapted to their traditional
diet, in order to use best their local resources.
The probably most prominent example of the adaption of our genome to dietary
changes is the use of fresh milk from infanthood to adulthood, referred to as lactase
persistence. The disaccharide lactose is the main carbohydrate in milk and is a
major energy source for most infant mammals. Lactose is digested into glucose and
galactose by the intestinal enzyme LCT (lactase). Lactase non-persistence, also
referred to as lactose intolerance, is an autosomal recessive trait that is characterized
by diminished expression of the LCT gene after weaning, i.e., older children and
adults do not express the enzyme anymore. Lactose intolerance was the default
genetic setup of early humans (as well as in most other mammals), probably to
avoid competition for breast milk between newborns and older children or even
adults. Lactose intolerant individuals who consume lactose can have intestinal
symptoms, such as bloating, flatulence, cramps, nausea and diarrhea, which may
result in nutritional loss even beyond not receiving direct energetic benefits from
lactose digestion. Lactose intolerance is still present in some 65% of the global
human population, since the new variant of the LCT gene has emerged only within
the last 5000 years after the domestication of cattle, sheep and goats and the start of
dairy farming in Europe. Lactose tolerance is found also in livestock raising popula-
tions from Africa and Western Asia, but is almost completely absent elsewhere.
Milk drinking created one of the strongest presently known selection pressures on
our genome that drove alleles for lactose tolerance to high frequency. In the past,
children’s mortality rates were very high, since after weaning the loss of immune
input from breast milk was associated with multiple exposures to diarrheal diseases.
As milk is a perfect source of carbohydrates (primarily lactose), fat and calcium, the
ability to use it as a reliable dietary source provides an enormous advantage for
survival. Thus, mutations leading to lactase persistence belong to the most
strongly selected genetic variations of all episodes of positive selection
in humans.
The SNPs associated with lactase persistence are located approximately 14 kb
and 22 kb upstream of the TSS of the LCT gene within introns 13 and 9 of the
MCM6 (minichromosome maintenance type 6) gene (Fig. 4.1). The T/T allele at
position −13,910 relative to the TSS of the LCT gene (rs4988235) binds the tran-
scription factor POU2F1 (POU class 2 homeobox 1) with higher affinity than the
C/T or the C/C variant. Also the transcription factors GATA6 (GATA binding pro-
tein 6), CDX2 (caudal type homeobox 2), HNF3A and HNF4A are associated with
this regulatory region. As expected, the respective SNPs in the Neanderthal’s
4.3 Regulatory SNPs and Quantitative Traits 53

2q21.3 - 2q22.1
≈3 Mb

134,0 134,5 135,0 135,5 136,0 136,5 137,0 137,5 138,0 Mb

136,215,806 136,459,692
Centromere Telomere

UBXD2 LCT
MCM6 DARS
LOC391448

136,350,481 136,313,666
5’ 3’

INTRON 9 INTRON 13
...GGC G/A CGGTGG... ...C G/C TAAGTTACCA... ...AAGATAA T/G GTAG C/T CC C/G TC...

-22,018 bp -14,010 bp -13,915 bp -13,910 bp -13,907 bp

Fig. 4.1 Map of the genomic region of the genes LCT and MCM6. Location of the SNPs
responsible for lactose tolerance within introns 9 and 13 of the MCM6 gene in African and
European populations

genome indicated that ancient human populations were lactose intolerant.

Furthermore, the larger genomic region around the LCT gene demonstrates
­significant difference in the size of the respective haplotype blocks between lactose
tolerant Europeans (more than 1 Mb) and non-Europeans. This reflects strong
selection for the lactase persistence allele in particular in the northern European
population.

4.3 Regulatory SNPs and Quantitative Traits

GWAS analysis has indicated that some 88% of trait-associated variants are located
outside of protein-coding regions of the human genome (Sect. 2.4). The SNP
rs4988235 upstream of the LCT gene (Sect. 4.2) represents a master example of a
regulatory variant being equally important to SNPs affecting a protein-coding
region in determining disease risks and traits (Fig. 4.2). The functional characteriza-
tion of regulatory SNPs, such as the identification of transcription factor binding to
the variant genomic region, can suggest possible therapeutic interventions, e.g.,
when the respective transcription factor is “druggable” (i.e., there is a synthetic or
54 4 Interference of the Human Genome with Nutrients

HMT
HMT Tall
Transcription factor
Me Me Me
Me Gene
expression
5’ G A A C T G T C 3’

3’ C T T G A C A G 5’

ac
ac ac ac RNA Pol II

HAT A HAT

Short
No gene
expression
5’ G A A C C G T C 3’

3’ C T T G G C A G 5’

Fig. 4.2 The basis of human trait variation. Small variations within the DNA binding site for a
transcription factor can facilitate and even enhance the association of this protein, such as the A
(top), or inhibit its binding, when it is a G (bottom). The binding of the transcription factor influ-
ences the local chromatin structure via the activation of chromatin modifiers, such as HATs (his-
tone acetyltransferases) and/or HMTs (histone methyltransferases), eventually leading to the
activation of Pol II and the transcription of the respective gene (Sect. 5.2). This may have a positive
effect on the trait of interest, such as body height. In contrast, when the transcription factor does
not bind, the respective genomic region remains inactive and the gene is not transcribed. This may
have a negative effect on the studied trait

natural compound that modulates its activity). Gene regulatory events that are
related to regulatory SNPs do not only depend on the sequence of the respective
genomic site but also on its accessibility within chromatin (Sect. 5.1). This empha-
sizes the impact of epigenomics on regulatory variation.
In contrast to the genome, which is identical in all 400 tissues and cell types of
an individual, the epigenome and consequently the expression of genes depends on
the individual tissue and the signals that it is exposed to, i.e., it represents the
dynamic state of the cell. The next-generation sequencing method RNA-seq in com-
bination with SNP information is the basis of eQTL (expression quantitative trait
locus) mapping. This approach allows the functional assessment of a genetic variant
on the level of the transcriptome. In general, functional genetic variants can modu-
late various steps in the process of gene expression from genes via mRNAs to active
proteins, which are
• changes of the affinity of transcription factors for their genomic binding sites
within promoters and enhancers
• a disruption of chromatin interactions
4.3 Regulatory SNPs and Quantitative Traits 55

• the modulation of the functionality of ncRNAs

• the induction of alternative splicing
• an alternation in the post-translational modification pattern of proteins.
The effect size of functional SNPs can vary a lot and depends on the affected
regulatory process and its epigenomic context, i.e., it is difficult to predict. At pres-
ent, changes in the association of transcription factors due to variants in their
specific binding sites are the best-understood types of regulatory SNPs (see
examples in Box 4.1).

Box 4.1: Regulatory SNPs with Impact on Obesity and CVD

There are millions of DNA-binding sites for the approximately 1600 sequence-­
specific transcription factors that are encoded by the human genome.
Dependent on their function and position, the regions where these binding
sites are clustering, are called promoters, enhancers or insulators.
Example 1: The SNP rs1421085 is located within an intron of the FTO (fat
mass and obesity associated) gene and shows the most prominent OR for the
trait obesity (Sect. 8.5). Its T-to-C variation disrupts the binding site of the
transcription factor ARID5B (AT-rich interaction domain 5B), which regu-
lates during early adipocyte differentiation the expression of the genes IRX
(iroquois homeobox) 3 and 5. This results in a shift from energy-consuming
beige adipocytes to energy-storing white adipocytes (Sect. 8.2), i.e., in a dras-
tic reduction in mitochondrial thermogenesis and in an increase in lipid stor-
age. Knockdown of IRX3 or IRX5 or repair of the ARID5B binding site by
CRISPR-Cas9 editing restored IRX3 and IRX5 repression, activated adipocyte
browning and restored thermogenesis. Thus, not the FTO gene but its neigh-
boring genes IRX3 and IRX5 functionally explain the prominent effect of
SNP rs1421085 on obesity risk.
Example 2: Myocardial infarction and plasma levels of LDL-cholesterol
were are strongly associated with SNP rs12740374 (Sect. 10.3), for which
eQTL analysis indicated most significant association with the SORT1 (sortilin
1) gene. The more active minor allele created a binding site for the transcrip-
tion factor CEBP (CCAAT/enhancer binding protein), i.e., rs12740374 is a
gain-of-function regulatory SNP. Genomic approaches confirmed SORT1
as a novel lipid-regulating gene and its pathway as a target for potential
therapeutic interventions.

Results of the projects ENCODE, FANTOM5 and Roadmap Epigenomics (Box

2.4) created a unique genome-wide resource that helps to characterize regulatory
SNPs on the level of
• post-translational histone modifications, such as methylations and acetylations at
various positions of the histones H3 and H4, indicating active and repressed
enhancer and promoter regions
56 4 Interference of the Human Genome with Nutrients

• chromatin accessibility
• genomic association of more than 100 transcription factors
• DNA methylation indicating inactive genomic binding profiles
• the non-coding transcriptome of hundreds of cell lines and primary tissues.
The database RegulomeDB (http://regulomedb.org) combines information on
chromatin state, transcriptional regulator binding and eQTLs allowing the identifi-
cation and interpretation of functional DNA elements at the sites of regulatory
variants.

4.4 Definition of Nutrigenomics

Our diet is a complex mixture of biologically active molecules, some of which can
• have a direct effect on gene expression (Fig. 4.3A)
• modulate, after being metabolized, the activity of a transcription factor or chro-
matin modifier (Fig. 4.3B)
• stimulate a signal transduction pathway that ends with the induction of a tran-
scription factor (Fig. 4.3C).
Nutrigenomics aims to describe, characterize and integrate these interactions
between diet and gene expression genome-wide. The results of these investigations
lead to an improved understanding of how nutrition influences metabolic pathways
and homeostatic control. This nutrition-triggered regulation may be disturbed in the
early phase of a diet-related disease, such as T2D. When individuals are classified
according to the interplay of their lifestyle, metabolic pathways and genetic
variation, the molecular insight based on nutrigenomics studies can suggest
tailored diets, referred to as personalized nutrition, for early therapeutic inter-
vention. For example, individuals that are genetically at risk for T2D, but not yet in
a prediabetic state, may be recommended a customized diet, in order to avoid devel-
oping the disease (Sect. 4.5). Using diet for a specific therapy dissolves the distinc-
tion between food and drugs as well as the definition of health and disease. Thus,
the best advice for healthy eating may result in a more individualized lifestyle.
Both nutrigenomics and pharmacogenomics have some similarities concerning
concepts and methodological approaches, i.e., both use high-throughput omics
technologies. However, in pharmacogenomics the effects of a single clearly defined
compound (a drug) of a precise concentration and a specific target are investigated,
whereas nutrigenomics faces the complexity and variability of diets and nutrients.
However, some nutritional compounds can reach up to mM concentrations without
becoming toxic, while most drugs act at clearly lower concentrations.
From the perspective of nutrigenomics, food is a collection of dietary signals that
are detected by cellular sensors, such as membrane proteins and nuclear receptors
(Sects. 3.1 and 3.2), leading to changes in the epigenome, transcriptome, proteome
and metabolome, i.e., the complete set of all chromatin modifications, mRNA mol-
4.4 Definition of Nutrigenomics 57

Diet

Nutrients

Metabolism
Signal transduction
Insulin

cellular
membrane IR A/B

CYTOPLASM PTPN1
SORBS1
CBL IRS1 JAK

CDC42 IRS2
RHOQ p85α
IRS3 STAT
PTEN p110α p55α
IRS4
p110β PI3K p50α
p110γ p85β NODE 1 SOCS

A
Glucose uptake PRKCI PDPK
p55γ
NODE 2
TBC1D4 AKT1
SHC
AKT2
MAPK8
AKT3 Cell growth,
MAPK3
differentiation
NODE 3
MAPK1

GSK3 TOR RPS6K

FOXO1
Glucose synthesis Protein synthesis

Gluconeogenesis

B C

Gene expression

Normal cell growth

Fig. 4.3 Basis of nutrigenomics. Nutrigenomics seeks to provide a molecular understanding for
how dietary nutrients affect health by altering the expression of a larger set of genes. These nutri-
tional compounds have been shown to alter gene expression in a number of ways. For example,
they may (A) act as direct ligands for transcription factors, (B) be modulators for transcription
factors or chromatin modifiers after a chemical conversion in primary or secondary metabolic
pathways or (C) serve as activators of signal transduction pathways that end with the activation of
a transcription factor. All three activation pathways modulate physiological effects, such as cellular
growth
58 4 Interference of the Human Genome with Nutrients

DIET

Isolated ingredient(s)

Ingredient, Read-out systems

Target cells
lead compound Define markers
(in culture)
or mixture

Connectivity
Ingredient Model organism Define and/or
or mixture (mouse, rat) validate markers

DIET Human study Validate markers

Fig. 4.4 Applications of omics technologies in nutrition research. The effect of food or its
ingredients are studied either in cell culture, animal models or human intervention studies. In all
cases, samples are analyzed via the use of omics technologies on the level of the transcriptome,
proteome or metabolome. The integration of these large-scale datasets results in the definition of
biomarkers that can be validated via complementary studies

ecules, proteins and metabolites in a cell or in a biological sample. Thus, individual

dietary components (as well as food as a whole) induce a pattern in chromatin
accessibility, gene expression, protein expression and metabolite production
that can be interpreted as “signatures” of the respective nutritional compound.
These dietary signatures can be investigated in vitro, such as in cell lines represent-
ing metabolic organs, or in vivo, such as in rodent model organisms (Fig. 4.4).
However, the most meaningful results will be obtained from intervention stud-
ies with human subjects.
Nutrigenomic technologies that are based on the use of next-generation sequenc-
ing methods, i.e., the massive parallel sequencing of DNA or RNA molecules, are
presently far more advanced than proteomic and metabolomic methods. Nevertheless,
proteome and metabolome data allow more precise measures of a physiological
state. At present, the method liquid chromatography mass spectrometry (LC-MS/
MS) analysis identifies up to 5000 of the most abundantly expressed proteins. The
analysis of metabolites is performed either targeted via GC-MS (gas chromatography-­
mass spectrometry) and NMR (nuclear magnetic resonance) spectroscopy for a few
hundred metabolites or untargeted via LC-MS/MS, which allows the detection of
several thousand different molecules. Using the metabolome to characterize indi-
viduals has become a powerful tool in nutrition research. Metabotyping describes
4.5 Personal Omics Profiles 59

groups of individuals with similar metabolic profile. This grouping of individuals

has the potential to identify optimal treatment strategies for each metabotype.
A central point in nutrigenomic methodology is the integration of the data that
are obtained from transcriptomic, proteomic and metabolomic profiling with spe-
cific nutrients or diets (Sect. 4.5). Ideally, this results in the identification of bio-
markers that can serve as early warning for nutrient-induced changes to
homeostasis, such as the development of prediabetes (Chap. 9). However, the tight
connection of metabolic pathways makes it difficult to achieve specific responses to
a treatment with one compound, such as natural or synthetic nuclear receptor ligand,
without provoking side effects through compensatory or complementary responses
from other pathways. Nevertheless, future studies that will be performed in a safe
and clever way in humans (rather than in rodents) should provide a level of under-
standing that will lead to more specific ligands and identification of new target
genes regulated by dietary components. Moreover, a better understanding of the
links between circadian biology and metabolism (Sect. 3.6) will allow tailoring pre-
ventive interventions and therapies. Thus, nutrigenomic investigations can pro-
vide basic insight on the interaction between nutrition and our genome but can
also serve as a diagnostic and potentially therapeutic tool.

4.5 Personal Omics Profiles

The field of personalized medicine/nutrition is advancing due to the rapid develop-

ment of omics technologies. For a comprehensive view on health and disease, i.e.,
when acknowledging the entire complexity of biological processes, these technolo-
gies need to be integrated. For example, for a deep understanding of obesity and
T2D deep analyses and longitudinal profiling are necessary. A proof-of-principle
investigation demonstrating the potential of next-generation technologies had been
provided by the iPOP analysis of one individual (Fig. 4.5). The iPOP study included
whole genome sequencing and more than 20 times over a period of 14 months sam-
pling was carried out for mRNA and miRNA expression in PBMCs (peripheral
blood mononuclear cells), proteome profile in PBMCs and in serum as well as the
metabolome and auto-antibodyome in blood plasma. These molecular datasets were
complemented by medical lab tests for regular blood biomarkers. Interestingly, both
RNA-seq transcriptomics and LC-MS/MS proteomics demonstrated that the genes
involved in insulin signaling and response were downregulated during a respiratory
syncytial virus infection, which paralleled with increased blood glucose levels up to
T2D levels (Sect. 9.1). The integrative profile monitored both gradual trend changes
as well as spike changes in particular at the onset of each physiological state adjust-
ment. Thus, the iPOP analysis allowed a most comprehensive view on the bio-
logical pathways that led to the onset of hyperglycemia of the study subject.
Importantly, hyperglycemia was detected in a very early stage, so that it could be
effectively controlled and reversed by changing diet and intensified physical activity
of the individual.
60 4 Interference of the Human Genome with Nutrients

Environment Clinical data

Tissue samples
Body fluids, surface and waste Medical
RNA edits
history
Heteroallelic SNVs
Genome
DNA
Methylome Protein expression

Microbiome Metagenome
iPOP
RNA expression

Integration
RNA Transcriptome
T1 iPOP Indels
Duplications
Deletions

Proteome Chr. ideogram

Protein
Auto-antibodyome
Chr. number

Metabolite Metabolome Int

iPOP eg
iPOP rat
ion
iPOP
Pharmaco- iPOP
genome iPOP

Database
Prevention (de-identified)
Treatment

Report back (MD and

genetic counselor)

Tim
ec
ou
rse

Fig. 4.5 Implementation of iPOP for personalized medicine. Tissue samples (e.g., PBMCs) of
an iPOP participant are collected at time points T1 to Tn, while diet, exercise, medical history and
present clinical data are also recorded. The results of the iPOP analysis can be monitored by Circos
plots (right), in which DNA (outer ring), RNA (middle ring) and protein (inner ring) data match
to chromosome position. The data may be reported back to genetic counselors and/or medical
practitioners, in order to allow most rational choices for prevention and/or treatment, which may
be matched with pharmacogenetic data. (Data are based on Chen et al., Cell 148, 1293–1307
(2012))

The central aim of iPOP-style analyses are early detection of diseases or their
prevention as well as their efficient intervention and therapy. A follow-up ­iPOP-­style
study involving 23 individuals demonstrated that inflammatory signatures affecting
metabolic pathways during weight gain did not to return to baseline after subse-
quent weight loss. In addition, a longitudinal monitoring of 108 individuals over
9 months on the level of their genome, proteome and metabolome in relation to
clinical data connected molecular measurements with physiology and disease. The
Genome Aggregation Database (https://gnomad.broadinstitute.org) collects omics
data of healthy individuals from a wide variety of large-scale sequencing projects
and makes them available to the scientific community.
Disease risk is primarily based on genetic susceptibility, environmental expo-
sures and lifestyle factors. For example, the relative contribution of genetic suscep-
tibility to disease predisposition is quantified by the heritability, i.e., the proportion
of phenotypic variation that can be explained by genetic variation, of the disease in
a given population (Sect. 2.4). Thus, most diseases have a polygenic risk score,
4.5 Personal Omics Profiles 61

Likelihood ratio 1.18 0.85 0.80 0.87 0.91 0.94 1.06 1.15 0.88 1.31 1.07 1.12 1.07 1.03 1.00 1.05 1.07 1.48 1.01 1.09 1.06 0.94 0.96 1.03 1.04 1.02 0.94 1.13 100%

50%
46%
43% 42% 43% 44% 44% 43%
42%
39% 40%

Probability
30% 31%
29% 29% 29% 28% 29%
27% 27% 27%
25%
24%
23%
21%
20%
19% 19% 19%
18%
Prevalence

PPARGC1A

TP53INP1
CDKAL1
SLC30A8

MTNR1B
IGF2BP2

KCNJ11
TCF7L2

THADA
ARAP1
KCNQ1

KCNQ1

RBMS1

HNF1B
JAZF1
Genes

WFS1
EPO
FTO

10%

AG
TC

TC

TC
CT

TC

GG
CT

TT

GG

GG
GG

CC

TT
CC
CC
GG

GT
TT

AA

AA
AA

GG
CC
AA

GA

TA
CT

7 3 0
8 7 1

rs 93 07 5

12 45 54
rs 77 01 2

44 83 7

rs 23 53
02 34

7 0 5

r 17 31

6
rs 52 62

16 01 9

rs 70 71 7
10 36 03
13 54 36
44 66 0

11 52 0
2 1 9

rs 59 68 0

1 9 6
rs 570 6

44 09 1
30 63
1 4 4

10 00 31

rs 46 85 8
2 1 6

Genotypes

rs 15 79
rs 23 66

rs 02 74
rs 05 89

rs 57 84
rs 97 87

79
rs 01 03

1 0 9
rs 26 84

rs rs 96
rs 1 1

rss89 64

rs 77 32
2

rs 83 10
rs 86 22

rs 57 18
rs 81 14

15 13
10 03
rs 79
rs

Fig. 4.6 The potential of personalized medicine. The riskogram illustrates how the iPOP study
volunteer’s post-test probability of T2D was calculated on the basis of 28 independent SNPs (Sect.
9.6). The likelihood ratio is indicated on top, the central graph displays the post-test probability,
while the associated genes, SNPs and the subject’s genotypes are shown on the bottom. (Data are
based on Chen et al., Cell 148, 1293–1307 (2012))

which is mostly calculated as a weighted sum of the number of risk alleles carried
by an individual (Fig. 4.6). Accordingly, a “riskogram” takes age, gender and eth-
nicity as well as multiple independent disease-associated SNPs into account, in
order to determine the subject’s likelihood of developing a disease. The original
iPOP study calculated for the investigated subject a previously unexpected increased
risk to develop hyperglycemia, which in fact was confirmed experimentally after a
viral infection.
Future personalized health care as well as the emerging field of personalized
nutrition will benefit from a longitudinal recording of physiological and biochemi-
cal parameters, such a blood glucose levels, physical activity and blood pressure,
via wearable biosensors (Box 4.2). These basic data in combination with personal
genomic information and tailored iPOP-style studies can be applied to monitor any
disease or physiological state changes of interest. The integrative profile of iPOP-­
style studies is modular and allows the addition of further omics information, such
as epigenome-wide data and the microbiome of skin, oropharynx, nasopharynx,
stomach, intestinal mucosa or urine as well as quantifiable environmental factors.
Thus, iPOP-style analyses may become central to nutrigenomic projects.
62 4 Interference of the Human Genome with Nutrients

Box 4.2: Wearable Biosensors

For a longitudinal description of physiological information of an individual,
wearable biosensors perform a dynamic, non-invasive monitoring of biomark-
ers. The first generation of biosensors is based on physical measurements, i.e.,
they display mobility and vital signs, such as steps, heart rate and sleep qual-
ity. More advanced biosensors use optical and electrochemical processes for
tracking metabolites (e.g., glucose or lactate), electrolytes (e.g., sodium,
potassium or calcium), bacteria and hormones in biofluids like sweat, intesti-
nal fluids, saliva and tears. A prime focus is the sensing of glucose. The new
generation sensors are miniaturized and combined with flexible materials, in
order to improve wearability. The sensors are composed of a bioreceptor, such
as an enzyme, antibody or DNA, and a physico-chemical transducer that
translates the biorecognition event into a useful signal, which is transmitted
wireless to a mobile device, such as a smartphone

Whole genome sequence information is already available for some 1.5 million
individuals and soon it will be common for everyone to have his/her genome
sequenced. The rapid development of omics technologies in combination with
decreasing costs will allow collecting iPOP-style datasets on many individuals. The
integration of such data will allow further exploring the relationship between human
genetic variations and complex diseases and respective traits. In particular, the sys-
tematic exploration of epigenomics (Chap. 5) will provide critical insights into
disease susceptibility. The ability to stratify individuals according to their geno-
type will make clinical trials more efficient by enrolling a lower number of subjects
with an anticipated larger effect when personalizing the intervention. Diseases, such
as T2D (Chap. 9), will be classified into subphenotypes based on the genotype and
the dynamic reply of the individual, e.g., in response to a personalized diet. This
will allow using diet for preserving health and for an improved personalized
therapy, most likely in combination with synthetic drugs, in case of disease.

Additional Readings

James WPT, Johnson RJ, Speakman JR, Wallace DC, Frühbeck G, Iversen PO, Stover PJ (2019)
Nutrition and its role in human evolution. J Intern Med 285:533–549
Karczewski KJ, Snyder MP (2018) Integrative omics for health and disease. Nat Rev Genet
19:299–310
Kim J, Campbell AS, de Avila BE, Wang J (2019) Wearable biosensors for healthcare monitoring.
Nat Biotechnol 37:389–406
Marciniak S, Perry GH (2017) Harnessing ancient genomes to study the history of human adapta-
tion. Nat Rev Genet 18:659–674
Additional Readings 63

Pavan WJ, Sturm RA (2019) The genetics of human skin and hair pigmentation. Annu Rev
Genomics Hum Genet 20:41–72
Prohaska A, Racimo F, Schork AJ, Sikora M, Stern AJ, Ilardo M, Allentoft ME, Folkersen L, Buil
A, Moreno-Mayar JV et al (2019) Human disease variation in the light of population genomics.
Cell 177:115–131
Scheinfeldt LB, Tishkoff SA (2013) Recent human adaptation: genomic approaches, interpretation
and insights. Nat Rev Genet 14:692–702
Chapter 5
Nutritional Epigenetics

Abstract In this chapter, we will present nutritional epigenetics as a subdiscipline

of nutrigenomics and describe how dietary compounds affect our epigenome.
Different epigenetic mechanisms, such as post-translational histone modifications
and DNA methylation, process information provided by dietary molecules.
Accordingly, many chromatin modifiers use intermediary metabolites, such as
acetyl-­CoA, α-ketoglutarate, NAD+ or ATP, as co-substrates and/or co-factors.
Thus, these enzymes act as sensors for the nutritional status of our tissues and cell
types leaving respective marks on their epigenome. Prenatal supplementation in
mice as well as natural human experiments provide insight into the concepts of
epigenetic programming during embryogenesis and epigenetic drift during adult
life. This may explain some of the susceptibility for complex metabolic diseases,
such as T2D.

Keywords Epigenome · Chromatin · DNA methylation · Histone modifications ·

Chromatin modifiers · Intermediary metabolism · Acetyl-CoA · NAD+ · Folate ·
Methylenetetrahydrofolate reductase · Agouti mice · Epigenetic programming ·
Epigenetic epidemiology · Epigenetic drift

5.1 Epigenetic Mechanisms

Chromatin is the 3D complex of genomic DNA and histone proteins (Box 5.1). It is
subdivided into less densely packed euchromatin, which is easily accessible to tran-
scription factors (Fig. 5.1, top left), and compact heterochromatin, which represents
a functionally repressed state (Fig. 5.1, top right). Epigenetics is the study of func-
tionally relevant modifications of chromatin that do not involve a change in the
comprised genome sequence. Epigenetic alternations may remain stable during
cell divisions and can last for multiple (cell) generations. The best example is the
process of cellular differentiation, where due to epigenetic changes formerly totipo-
tent stem cells become various pluripotent cell lines of the embryo, which in turn are
the precursors of terminally differentiated cells. The main epigenetic mechanisms

© Springer Nature Switzerland AG 2020 65

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_5
66 5 Nutritional Epigenetics

Euchromatin Facultative Heterochromatin

KMT hetero- me3
HAT me3 chromatin
CoA Ac
me3 3 Ac DNMT CoR
33 Me
3 Me Me
Me
Me
Me Me Me
Ac
Me Me
KDM Me-CpG
Ac
Ac HDAC
OH OH OH
OH OCH3 OCH3
OH O HO
HO O HO O HO OH
OH OH
OH OH
HO O
OH OH OH O O
Epicatechin Genistein Resveratol Catechin Curcumin

Green tea Soy Grape Cocoa Curcuma

Fig. 5.1 Chromatin, associated proteins and nutrition-based epigenetic modulators.

Chromatin is distinguished into open chromatin (euchromatin, top left) with loose nucleosome
arrangement and closed chromatin represented by dense nucleosome packing (heterochromatin,
top right). There are several stages between these extremes that are summarized as facultative
heterochromatin (top center). Each stage is characterized by a set of chromatin modifiers, such as
HATs, HDACs, HMTs, HDM (histone demethylases) and DNMTs (DNA methyltransferases), that
lead together with CoA (co-activator) and CoR (co-repressor) proteins to the schematically indi-
cated scenarios of acetylation and methylation of histone tails and genomic DNA. The indicated
plant-origin natural compounds have been shown to modulate the activity of chromatin modifiers
(bottom) and to affect in this way the epigenetic status of cells and tissues

are post-translational modifications of nucleosome-forming histone proteins (Box

5.1) and methylation of cytosines within genomic DNA (Box 5.2).
Chromatin density plays an important role in regulating gene expression,
­primarily by controlling the accessibility of genomic binding sites for transcription
factors. The dynamic competition between nucleosomes and transcription factors
for critical binding sites is influenced by a large set of enzymes that either cova-
lently modify histone proteins, termed chromatin modifiers (Box 5.3), or move,
reconfigure or eject nucleosomes, called chromatin remodelers. This process deter-
mines for each genomic region the density, composition and positioning of nucleo-
somes relative to the transcription factor binding sites that it contains.
The ENCODE Project and other big biology consortia (Box 2.4) provide
genome-wide maps of epigenetic marks in more than 100 human cell lines, primary
cells and tissues. These data collectively indicate that in regions of open, active
chromatin histone proteins are acetylated (e.g., at lysine 14 of histone 3, H3K14ac)
and genomic DNA remains unmethylated. In contrast, in repressed, closed chroma-
tin histones are (tri)methylated (e.g., at lysine 27 of histone 3, H3K27me3) and also
the DNA gets methylated. The change in DNA methylation during development
starts with demethylation during cell divisions of the fertilized egg, followed by de
novo methylation after implantation. Due to this epigenetic reprogramming
5.1 Epigenetic Mechanisms 67

Box 5.1: Histone Proteins and Their Modifications

The basic, every 200 bp repeating unit of chromatin is the nucleosome, which
consists of 147 bp genomic DNA that is wrapped nearly twice around an
octamer of four pairs of the histone proteins H2A, H2B, H3 and H4 (Fig. 5.1).
Histone proteins are rich in lysine residues, in particular at their amino-­
terminal tails that stick out from the nucleosome. The lysine residues but also
arginine and serine residues are subject to post-translational, covalent, revers-
ible chemical modifications, such as acetylations, methylations and phosphor-
ylations, carried out by a variety of chromatin modifiers (Box 5.3). These
histone modifications, referred to as epigenetic marks, represent a kind of
chromatin indexing. Most marks are assigned to functional regions of the
chromatin, such as promoters, enhancers or heterochromatin. The rules for
this chromatin indexing are summarized in the histone code, which is the
major determinant for the accessibility of genomic binding sites of transcrip-
tion factors and their associated co-factors. The final outcome is increased or
decreased gene expression, i.e., mRNA levels. Many chromatin modifiers and
other nuclear proteins contain a set of common domains that specifically rec-
ognize different chromatin modifications, i.e., these proteins are able to “read”
the histone code (Sect. 5.2).

Box 5.2: DNA Methylation

From the four DNA forming nucleotides only cytosines gets methylated and
this in particular at the dinucleotide CpG, i.e., at sites where cytosine and
guanine are found on the same DNA strand and are connected by a phospho-
diester bond. CpG islands are genomic regions of at least 200 bp in length
displaying a CG content of at least 55% (compared to the 42% average in the
human genome). In normal human cells, CpG islands are mostly unmethyl-
ated and the genes in their vicinity keep their potential to be activated by
transcription factors. DNMTs use SAM (S-adenosylmethionine) as a methyl
group donor (Sect. 5.3) to methylate the carbon in 5′-position of cytosines.
DNMT1 is a maintenance methyltransferase being active mainly during DNA
replication, while DNMT3A and DNMT3B primarily perform de novo DNA
methylation during embryogenesis and cellular differentiation. The demethyl-
ation of genomic DNA is regulated by TET (ten-eleven translocation ) pro-
teins, which convert 5-methylcytosine to 5-hydroxymethylcytosine,
5-formylcytosine and 5-carboxylcytosine. During DNA replication these
modifications are then removed through multi-step oxidation and base exci-
sion repair.
68 5 Nutritional Epigenetics

Box 5.3: Chromatin Modifying Enzymes

The activity of chromatin is modulated by a group of enzymes that catalyze
rather minor changes in residues of histone proteins, such as the addition or
removal of acetyl or methyl groups. Chromatin acetylation is generally asso-
ciated with transcriptional activation, while the exact amino acid residue of
the histone tails that is acetylated is not critical. The acetylation state of a
given chromatin locus is controlled by two classes of antagonizing histone
modifying enzymes, HATs and HDACs. In analogy, also for histone methyla-
tion there are two classes of enzymes with opposite functions, HMTs and
HDMs. Although histone methylation mainly mediates chromatin repression,
at certain residues, such as H3K4, it results in activation. Therefore, for his-
tone methylation the exact residue in the histone tail and its degree of meth-
ylation (mono-, di- or tri-methylation) is of critical importance.

during development, the intrauterine period is considered critical for long-

term health and disease risk (Sect. 5.4). However, DNA methylation does not only
control the expression of specific genes during the development and differentiation
of individual tissues, but it is also essential for silencing of imprinted genes, the
second female X chromosome and retrotransposons (Box 2.3). Importantly, histone
modifications precede or succeed DNA (de)methylations, i.e., both epigenetic pro-
cesses display a cross-talk. For example, methyl-CpG binding proteins are capable
of recruiting HDACs to methylated regions of genomic DNA.

5.2 Intermediary Metabolism and Epigenetic Signaling

Within a cell, signal transduction pathways result in the activation of gene expres-
sion programs that integrate signals originating from the environment. This could be
the availability of energy substrates, which induce responses of a larger set of genes,
in order to maintain homeostasis of the organism. Numerous connections between
products of intermediary metabolism and chromatin modifiers are known. Our
genome expresses tissue-specifically more than hundred of these enzymes that
interpret (“read”), add (“write”) or remove (“erase”) post-translational histone mod-
ifications (Fig. 5.2). The activity of most of these chromatin modifiers critically
depends on intracellular levels of essential metabolites, such as acetyl-CoA, UDP
(uridine diphosphate)-glucose, α-ketoglutarate, NAD+, FAD (flavin adenine dinu-
cleotide), ATP or SAM. Since the cellular concentrations of several of these metab-
olites represent the metabolic status of the cell, the activities of the chromatin
modifiers reflect the intermediary metabolism.
A wide spectrum of secondary metabolites from fruits, vegetables, teas,
spices, and traditional medicinal herbs, such as genistein, resveratrol, cur-
cumin and polyphenols from green tea, coffee and cocoa, respectively, are able
5.2 Intermediary Metabolism and Epigenetic Signaling 69

Nutrition Metabolism

Signaling metabolites
SAM, FAD, NAD, acetyl-CoA, β-OHB, ATP

Attachment “Code” recognition Removal

Fig. 5.2 Epigenetic mechanisms link metabolites and transcription. Changes in nutrition or
fluctuations in metabolism affect the transcriptional responses of metabolic tissues. Several inter-
mediary metabolites change the activity of chromatin modifiers in a dose-dependent manner.
These proteins use some of these metabolites as co-substrates and/or co-factors and act in this way
as metabolic sensors. “Writer” enzymes create covalent chromatin marks, “reader” enzymes rec-
ognize these marks and “eraser” enzymes remove them. These histone tail modifications create
changes in the local chromatin structure, which has consequences for the activity and regulation of
the neighboring genes

to modulate the activity of transcription factors and chromatin modifiers

(Fig. 5.1, bottom). Next-generation sequencing technologies allow the genome- and
transcriptome-wide assessment of the specificity and efficacy of these compounds,
e.g., for preventing and/or treating cancer.
Bromodomains are found in all type of proteins that are able to recognize acety-
lated residues, such as members of the BRD (bromodomain containing) protein
family, the HATs KAT2B, EP300 (KAT3B) and CREBBP (CREB binding protein,
also called KAT3A), HMTs, chromatin remodeling enzymes, CoAs and EP300, and
general transcription factors. In contrast, chromodomains are far more specific for a
70 5 Nutritional Epigenetics

given chromatin modification, i.e., chromodomain-containing nuclear proteins rec-

ognize their genomic targets with far more accuracy than bromodomain proteins.
Methyl donors are critical during pregnancy and dietary excess as well as defi-
ciency may have an impact on epigenetic programming in mice (Sect. 5.3) and
humans (Sect. 5.4). The methyl donor substrate SAM connects DNA methylation
with intermediary metabolism. SAM is generated from the amino acid methionine
and ATP in the one-carbon metabolism pathway (Box 5.4). When a methyl group of
SAM is transferred to DNA or a histone, the product SAH (S-adenosylhomocysteine)
is recycled back to SAM. Interestingly, SAH acts as a negative feedback regulator
for HMTs, suggesting that the SAM/SAH ratio, referred to as the “methylation
index”, is critical for histone and DNA methylation. A derivative of the B vitamin
folate, tetrahydrofolate, serves as a methyl group donor for feeding of the cyclic
one-carbon pathway. The dependence of the pathway on folate and other micronu-
trients is another example of the direct connection between nutrition and epigenetics.
The function of folate in normal neural tube closure in early gestation (in human
21–28 days after conception) is well known and maternal supplementation with
folate is recommended for prevention of neural tube defects.
The energy status of our tissues and cell types is the most important infor-
mation for our body, in order to interpret and integrate environmental condi-
tions. Nutritional epigenetics investigates how metabolic pathways communicate
with chromatin and provide information about nutrient availability and energy
status. Since key metabolites, such as AMP, NAD+, SAM and acetyl-CoA, act as

Box 5.4: Folate Metabolism and Methylation

A derivative of the B vitamin folate, tetrahydrofolate, feeds the cyclic one-­
carbon pathway by serving as a methyl group donor. This demonstrates a
direct connection between nutrition and epigenetics. Methyl group donors
are critical for epigenetic programing during embryogenesis. A high
homocysteine level is an established biomarker for the disturbance of the one-­
carbon metabolism and related to low concentrations of folate, vitamins B6
and B12, choline and betaine. This may cause an elevated risk of premature
delivery, low birth weight and neural tube defects. Moreover, a low dietary
intake of folate or methionine increases the risk of colon adenomas, while in
utero exposure to higher folate is associated with a reduced risk of child-
hood acute lymphoblastic leukemia, brain tumors and neuroblastoma.
The enzyme methylenetetrahydrofolate reductase, which is encoded by the
MTHFR gene, catalyzes the conversion of 5,10-methylenetetrahydrofolate to
5-methyltetrahydrofolate. 10–15% of Europeans carry the missense SNP
rs1801133 on both alleles, which reduces the activity of the enzyme by more
than 50%. Accordingly, individuals with a TT genotype are affected more by
a low folate intake than those with the CC or CT allele. Accordingly, raised
plasma homocysteine concentrations cause an elevated risk of premature
delivery, low birth weight and neural tube defects.
5.2 Intermediary Metabolism and Epigenetic Signaling 71

Nutrients

O
NH2
O NH2 N
N O O CH3 O O
+
O P O
O
N
Acetyl - lysine N N O P O P CH2O C CH C NH CH2 CH2 C NH CH2 CH2 SH
O
O O CH3 OH

NAD +
O OH OH
CoA
NH2 OH O

N N O P O

O
O P O N N
O
O

OH OH
Protein

NH2

N SIRT Lysine Acetyltransferase

Nicotinamide NH2

N
N O O CH3 O O O
O
O P O P CH2O C CH C NH CH2 CH2 C NH CH2 CH2 S C CH3
N N
O P O

Acetyl
OH O
O O O CH3 OH

O OH O CH3 Acetyl Protein OH O

Acetyl-CoA
NH2 O P O
O
N N
O

O P O N N
O
O

OH OH
Acetyl-ADP-ribose

Nutrients

Fig. 5.3 The relation of protein acetylation and cellular metabolism. NAD+ (left) acts as a
co-factor for HDACs of the sirtuin family that deacetylate proteins, which had been acetylated by
HATs using acetyl-CoA (right). Thus, the acetylation status of key regulatory proteins reflects the
cellular concentration of NAD+ and acetyl-CoA, i.e., of low (top) or high (bottom) nutritional
status, respectively

co-­factors and substrates of chromatin modifiers, gene expression programs of

many central physiological processes, such as proliferation and differentiation, are
modulated by the metabolic status of the cells. The results of these epigenetic
events may be memorized in the epigenome of skeletal muscle and adipose tissue.
The latter two metabolic organs constitute more than half of our body mass.
However, their relative amount is very variable and depends on environmental fac-
tors, such as physical activity and nutritional intake. This means that our lifestyle
creates a metabolic memory. Thus, not only the tissue mass but also the epig-
enome of our muscles and fat memorizes how much we have eaten and
exercised.
The ratio of the oxidized (NAD+) and reduced (NADH) form of the co-factor
NAD reflects the cellular redox state and is inversely proportional to the energy state
of a cell. During fasting, i.e., at low levels of nutritional metabolites, the intracellu-
lar concentration of NAD+ raises. This leads to an increase in the activity of HDACs
of the SIRT family (which use NAD+ as a co-factor) and the deacetylation of their
target proteins (Fig. 5.3, left). The targets are often histones, but also transcription
factors or their co-factors, such as p53 and PPARGC1A, are affected in their acety-
lation status. Calorie restriction, i.e., using only 70–80% of the recommended
dietary intake, is beneficial for metabolic health and may slow down aging
72 5 Nutritional Epigenetics

(Sect. 6.5). Since the NAD+ concentrations fluctuate in a circadian manner, sirtuin-­
mediated gene regulation is linked to the epigenetic clock (Sect. 3.6). Accordingly,
time-restricted feeding can restore daily rhythms and improves number of meta-
bolic responses, such as reducing insulin resistance and increasing glucose toler-
ance. Short-chain fatty acids, such as the ketone body β-hydroxybutyrate (β-OHB),
are potent inhibitors of several HDACs and are produced from dietary fibers in the
lumen of the colon. Fiber-rich diet can prevent colitis (i.e., a chronic inflammation
of the colon) and colon cancer in human, which could be, at least in part, explained
via butyrate-mediated inhibition of HDAC-dependent transcriptional programs of
colonocyte proliferation.
In contrast, nutrients ingested in the feeding state enter the catabolic pathways of
intermediary metabolism and acetyl-CoA is produced. Augmented acetyl-CoA con-
centrations stimulate HAT activity, so that their target proteins get acetylated
(Fig. 5.3, right). When the target proteins are histones, the acetylation of chro-
matin leads to open chromatin. This stimulates the expression of genes involved
in metabolic processes, such as lipogenesis and adipocyte differentiation.
Moreover, a large proportion of acetyl-CoA-responsive genes are involved in cell
cycle progression, i.e., an increase in histone acetylation is associated with cellu-
lar proliferation. However, upon induction of cellular differentiation the acetyl-
CoA level decreases significantly. Accordingly, loss of pluripotency is associated
with decreased glycolysis and lower levels of acetyl-CoA and histone deacety-
lation. Moreover, the acetyl-CoA level also affects cell survival and death deci-
sions. For example, a low acetyl-CoA level induces the catabolic process of
autophagy (Box 3.1), which is crucial for organelle quality control and cell sur-
vival during metabolic stress. Thus, the acetyl-CoA/CoA ratio is an important
regulator of major cellular decisions.
Another example of metabolite sensing is that of the enzyme AMPK, which is
controlled in its activity by the AMP/ATP ratio (Sect. 6.6). When cells consume
more ATP than they are producing, i.e., at conditions of low nutrient availability,
AMP concentrations raise as a signal of energetic stress. AMP binds to the γ-subunit
of the AMPK heterotrimer and activates the kinase. Since histones are AMPK
­substrates, a low energy status of the cell is marked via histone phosphorylation.
Thus, insults to the energy status of a cell are memorized on the level of histone
modifications and can be translated into functional outputs via adaptive gene
regulation. In contrast, a high nutritional level results in low AMP levels, no AMPK
activity, a modified histone phosphorylation pattern and the activity of a different
set of genes. Thus, the metabolic state of a cell can be expressed by the ATP/AMP
ratio, the SAM/SAH ratio, the NADH/NAD+ ratio and the acetyl-CoA/CoA ratio
(Fig. 5.4). Under high nutrient concentrations, such as abundant availability of
methionine and glucose, SAM activates KMTs and acetyl-CoA stimulates HATs,
thus leading to histone methylation and acetylation, respectively. In contrast, at low
nutrient levels, such as during fasting, AMP activates AMPK and NAD+ stimulates
sirtuins resulting in histone phosphorylation and deacetylation. Moreover, in paral-
lel SAH inhibits DNMTs and CoA blocks HATs.
5.3 Nutrition-Triggered Transgenerational Epigenetic Inheritance 73

Nutrients

ac

me

DNMT

KMT HAT
ATP SAM NADH Acetyl-CoA

AMPK SIRT CoA-SH

AMP SAH NAD+

P ac

Nutrients

Fig. 5.4 Epigenetic sensing of the nutritional state. A high nutritional state of a cell (top) is
represented by the abundance of the metabolites ATP, SAM, NADH and acetyl-CoA, while in the
case of low nutrient levels (bottom) the metabolites AMP, SAH, NAD+ and CoA are predominant.
Accordingly, at high nutrient concentrations, KMTs and HATs are stimulated, while at low con-
centrations AMPK and HDACs of the sirtuin family are activated and DNMTs and HATs are
repressed. This results in histone methylation and acetylation or histone phosphorylation and
deacetylation, respectively

5.3 Nutrition-Triggered Transgenerational Epigenetic

Inheritance

The epigenome is able to preserve the results of cellular perturbations by environ-

mental factors in form of changes in DNA methylation, histone modifications and
3D organization of chromatin. Thus, the epigenome has memory functions.
Changes in epigenomic patterns, such as DNA methylation maps, are called epigen-
etic drifts (Sect. 5.4). They primarily describe the lifelong information recording
(“experience”) of somatic cell types and tissues, but may also be inherited to daugh-
ter cells, when the cells are proliferating. In case of germ cells, epigenetic drifts may
be, at least in part, even transferred to the next generation. This leads to the concept
of transgenerational epigenetic inheritance, which suggests that the lifestyle of the
parent and grandparent generation, such as daily habits in food intake or physical
activity, may affect their offspring.
The master example of the transgenerational epigenetic inheritance concept is
the agouti mouse model. The Asip gene encodes for peptide hormone that stimulates
74 5 Nutritional Epigenetics

A Non-supplemented during pregnancy Supplemented during pregnancy

Parents

a/a Avy/a a/a Avy/a

Offspring

C me me me
me

Asip Asip
IAP IAP

Fig. 5.5 Maternal dietary supplementation affects the phenotype and epigenome of Avy/a
offspring. The diets of female wild-type a/a mice are either not supplemented (left) or supple-
mented with methyl-donating compounds (right), such as folate, choline, vitamin B12 and beta-
ine, for 2 weeks before mating with male Avy/a mice, and ongoing during pregnancy and lactation
(a). The fur color of offspring that are born to non-supplemented mothers is predominantly yellow,
whereas it is mainly brown in the offspring from mothers that were supplemented with methyl-­
donating substances (b). About half of the offspring does not contain an Avy allele and is therefore
black (a/a, not shown here). Molecular explanation of DNA methylation and Asip gene expression:
maternal hypermethylation after dietary supplementation shifts the average fur color distribution
of the offspring to brown by causing the IAP retrotransposon upstream of the Asip gene to be more
methylated on average than in offspring that are born to mothers fed a non-supplemented diet (c).
White circles indicate unmethylated CpGs and yellow circles are methylated CpGs

in melanocytes close to hair follicle the synthesis of yellow pheomelanin instead of

black or brown eumelanin, i.e., the fur of the respective mice gets yellowish.
Moreover, the ASIP protein is involved in the neuronal coordination of appetite act-
ing as the physiological antagonist of MC1R (Sect. 4.1). In the transgenic agouti
mouse model the retrotransposon IAP (intracisternal A particle) was inserted into
the regulatory region of the Asip gene (Fig. 5.5). This creates a dominant allele of
the Asip gene (termed Avy), the expression of which is depending on the methylation
level of IAP, i.e., on its epigenetic status. The methylation of the IAP retrotranspo-
son happens stochastically during early embryogenesis, i.e., Avy behaves as a meta-
stable epiallele. Heterozygous Avy/a mice vary in their fur colors from yellow via
5.3 Nutrition-Triggered Transgenerational Epigenetic Inheritance 75

mottled to wild-type dark fur color. When the IAP retrotransposon is methylated,
the synthesis of pheomelanin is downregulated and a dark fur color appears. In con-
trast, non-methylated IAP allows ubiquitous Asip gene expression leading to both
yellow fur color and obesity. When Avy/a mice inherit the Avy allele maternally, Asip
gene expression and fur color correlate with the maternal phenotype. Thus, the fur
color provides an easy phenotypic readout of the epigenetic status of IAP through-
out life. This makes the Avy Asip mouse an ideal in vivo model for the investigation
of a mechanistic link between environmental stimuli, such as nutrition, and epigen-
etic states of the genome.
The agouti mouse model was used for the following experiment: 2 weeks before
mating with male Avy/a mice, female wild-type a/a mice were either supplemented
or not with methyl donors, such as folate, vitamin B12 and betaine (Fig. 5.5, Box
5.4). The supplementation was continued during pregnancy and lactation. While the
F1 generation of non-supplemented mothers displayed the expected number of yel-
low color phenotypes, the offspring of supplemented mothers shifted toward a
brown fur color phenotype. This suggests that maternal methyl donor supplementa-
tion leads to increased Avy methylation in the offspring. Furthermore, this means
that an environmentally induced epigenetic drift in the mothers was inherited to
their children. The inheritance of an epigenetic programming to the next generation
indicates that at least metastable epialleles, such as IAP, are able to resist the global
demethylation of the genome before preimplantation. Taken together, the model
indicates that epigenetic memory can be passed from one generation to another
by inheriting the same indexing of chromatin marks. From the different types of
chromatin marks, DNA methylation is designed in particular for a long-term cell
memory, while short-term “day-to-day” responses of the epigenome are primarily
mediated by non-inherited changes in the histone acetylation level. Histone meth-
ylation levels are in between both extremes.
The mouse models impose the question whether the concept of an epigenetic
memory and inheritance is also valid for humans. There are no comparable natural
human mutants and human embryonal feeding experiments cannot be performed for
ethical reasons. However, there are natural “experiments”, such as the Dutch Hunger
Winter, where individuals were exposed in utero to an extreme undernutrition occur-
ring in the Netherlands during the winter of 1944/45. Fetal malnutrition led to
impaired fetal growth. Low birth weight favors a thrifty phenotype that is epigeneti-
cally programmed to use nutritional energy efficiently, i.e., to be prepared for a
future environment with low resources during adult life. Even many decades after
birth the in utero undernourished individuals showed subtle (<10%) changes in
DNA methylation at several loci in adulthood, for example, at the regulatory region
of the imprinted gene insulin-like growth factor 2 (IGF2). This epigenetic pattern is
associated with an increased risk of obesity, dyslipidemia and insulin resistance,
when the respective individuals are exposed to an obesogenic environment.
Accordingly, for humans there is the same link between prenatal nutrition and
epigenetic changes as described for rodents. Similarly, the famine of 1959–1961 in
China largely contributed to the overproportional high raise of T2D in the country.
These examples led to the DOHaD (Developmental Origins of Health and Disease)
76 5 Nutritional Epigenetics

Nutrient-poor
maternal environment

Nutrient-poor
nt-poor Developmental Nutrient-rich
N
environment
nment programming of environment
e
the epigenome
Survivall advantage
d Increased
d susceptibility
of the offspring to metabolic diseases

Fig. 5.6 The DOHaD concept. Intrauterine stressors, including maternal undernutrition or pla-
cental dysfunction (leading to impaired blood flow with consecutively hypoxia or reduced nutrient
transport) can initiate abnormal patterns of development, histone modifications and DNA methyla-
tion. Additional post-natal environmental factors, including accelerated post-natal growth, obesity,
inactivity and aging further contribute to the risk for T2D, potentially via changes in histone modi-
fications and DNA methylation patterns of metabolic tissues. Obviously, epigenetic changes dur-
ing embryogenesis have a much greater impact on the overall epigenetic status of an individual
than that of adult stem cells or somatic cells, since they affect far more following cell divisions

concept (Fig. 5.6) indicating that early developmental events, such as perturbations
of the nutritional state in utero, have significant effects on disease risk as adult.
Thus, environmental exposures of individuals, in particular during early life,
can be stored as epigenetic memory. In particular, when post-natal environment,
such as being obesogenic, differs from what the epigenome was programmed in the
prenatal phase, such as starvation, responses of the body may be maladaptive, like
developing obesity and T2D.

5.4 Population Epigenetics

The field of epigenetic epidemiology, i.e., the study of epigenetics in populations,

combines epigenome-wide methods (Sect. 2.5) with population-based epidemio-
logical approaches. Epigenetic changes can occur at any time during life, although
increased sensitivity exist during early embryogenesis. Our epigenome primarily
changes due to environmental exposures but also based on stochastic epigene-
tic drifts associated with aging (Sect. 6.5). Epigenetic epidemiology studies dif-
ferent types of human cohorts with the goal to identify both the causes as well as the
phenotypic consequences of epigenomic variations. These are
5.4 Population Epigenetics 77

• cohorts of natural experiments, such the Dutch Hunger Winter

• longitudinal birth cohorts
• longitudinal studies on monozygotic twin cohorts
• prenatal cohorts
• IVF (in vitro fertilization) conception cohorts.
Studies of families are well suited to investigate epigenetic changes in the off-
spring that may be based on environmental exposures of parents during gametogen-
esis. Birth cohorts and in vitro fertilization cohorts track life from as early as
periconception (i.e., around the time of conception) and allow the study of epigen-
etic changes based on the prenatal environment and their association with disease
phenotypes early in life. Cohorts based on natural experiments, i.e., when the expo-
sure to severe environmental conditions was not under experimental control, enable
the investigation of the link of environmental exposures in early life with the onset
of disease phenotypes decades later. Prospective cohorts, in particular those involv-
ing monozygotic twins having identical genomes, parents, birth date and gender,
study in a longitudinally way the contribution of age-related epigenetic modifica-
tions in common diseases, such as T2D, autoimmune diseases and cancer.
Interestingly, twin studies demonstrated that epigenetic variations significantly
increase across lifespan. Short-term interventions, such as dietary studies, can iden-
tify specific environmental exposures that lead to tissue-specific epigenetic changes
(Fig. 5.7).
Epigenetic drifts, such as hypermethylation of CpG islands close to the regula-
tory regions of tumor suppressor genes, contribute to the risk for cancer and other
diseases (Fig. 5.8). In particular the risk for diseases that are related to the exposure
with environmental factors, such as microbes causing inflammation or overeating
leading to obesity and T2D, have a large epigenetic contribution. Of special interest
are diseases that have their onset a long time before the phenotype emerges, i.e.,
where accumulation of epigenetic changes stepwise increase disease susceptibility,
such as Alzheimer’s disease and cancer.
Epigenetic information can also be transmitted via the germ line to the next gen-
eration. Although some 95% of DNA methylation marks are erased throughout the
two rounds of demethylation during primordial germ cell generation, some single-­
copy genomic regions escape both demethylation waves and remain methylated in
gametes. In case the DNA methylation pattern at these escape regions is susceptible
to environmental influences, such as dietary molecules, lifestyle choices of an indi-
vidual may be transmitted to subsequent generations and may lead to pheno-
typic consequences.
78 5 Nutritional Epigenetics

Birth Cumulative
A Pre-natal Post-natal environmental
changes

Epigenomic variation

Cumulative
stochastic
changes

Timing of epigenomic change

Long-lived
B 100 y families
Timing of studies of phenotypic consequence

Natural
experiments

Longitudinal Short-term
Family studies cohort studies interventions
of paternal (including twins)
exposures
40 y

IVF Birth cohorts

conceptions (including twins)

Guthrie
cards
0y
0 8 d 8 w 38 w 0 1 m 1 y 12 y 18 y 40 y 90 y 100 y
Gametogenesis Extreme longevity
Conception Aging
Blastocyst stage Adulthood
Embryogenesis Adolescence
Fetal development Childhood
Infancy
Neonatal period

Fig. 5.7 Epigenetic variation in populations. Epigenetic changes can occur at any time during
life, but there is significantly increased sensitivity during early prenatal development (a). Prenatal
epigenetic changes may be investigated using IVF cohorts, archived newborn metabolic screening
tests (formerly called Guthrie cards) and birth cohorts tracking life from as early as periconception
(b). Historical famines represent the few opportunities to link the prenatal environment to health
outcomes later in life. Longitudinal cohort studies (especially involving twins) sample peripheral
tissues and take biopsies from disease-relevant tissues. Short-term (dietary) interventions can iden-
tify specific dietary compounds that induce tissue-specific epigenetic modifications, while long-­
lived families can help in identifying the importance of maintaining epigenetic control for healthy
aging
Additional Readings 79

Germ line
Reprogrammed
epigenome Aging
Epigenetic drift
Altered transcriptional control
Disease

Adult life Intra-uterine growth

Epigenetic drift Nutrition Establishment of Reprogrammed
Homeostatic Metabolism chromatin landscape epigenome
transcriptional control Environment Control of development Inherited epigenetic lesions
Acquired epigenetic lesions Disease and differentiation

Growth phase Transcriptional

Epigenetic drift inheritance of
Homeostatic transcriptional disease risk
control

Fig. 5.8 Epigenetic drift and transgenerational inheritance. During embryogenesis epigenetic
marks, such as DNA methylation and histone modifications, are established in order to maintain
cell lineage commitment. After birth, this epigenetic landscape stays dynamic throughout lifespan
and responds to nutritional, metabolic, environmental and noxious signals. Epigenetic drifts are
part of homeostatic adaptations and should keep the individual in good health. However, when an
adverse epigenetic drift compromises the capacity of metabolic organs to adequately respond to
challenges as provided by nutrition and inflammation, the susceptibility to diseases, such as T2D
or cancer, increases. Some of these acquired epigenetic marks can be inherited to subsequent gen-
erations when they escape epigenetic reprogramming during gametogenesis

Additional Readings

Barres R, Zierath JR (2016) The role of diet and exercise in the transgenerational epigenetic land-
scape of T2DM. Nat Rev Endocrinol 12:441–451
Carlberg, C., and Molnár, F. (2018). Human epigenomics. Springer Textbook Springer. ISBN:
978-981-10-7614-8
Gut P, Verdin E (2013) The nexus of chromatin regulation and intermediary metabolism. Nature
502:489–498
Heard E, Martienssen RA (2014) Transgenerational epigenetic inheritance: myths and mecha-
nisms. Cell 157:95–109
Kinnaird A, Zhao S, Wellen KE, Michelakis ED (2016) Metabolic control of epigenetics in cancer.
Nat Rev Cancer 16:694–707
Sales VM, Ferguson-Smith AC, Patti ME (2017) Epigenetic mechanisms of transmission of meta-
bolic disease across generations. Cell Metab 25:559–571
Chapter 6
Nutritional Signaling and Aging

Abstract In this chapter, we will present the evolutionary conservation of nutrition-­

sensing pathways and their relation to the process of aging. Mammals use more
complex regulatory circuits for sensing food, which involve the CNS via the GH1
endocrine axis. The molecular basis of this is the sensing of glucose and amino
acids via insulin/IGF and the TOR pathways, respectively, and the integration of the
nutritional and energetic status of cells and tissues via sirtuins and AMPK. The
insulin signaling axis is composed of a number of critical nodes including the recep-
tor IR, the adaptor protein IRS, the kinases PI3K and AKT as well as the transcrip-
tion factor FOXO1. We will analyze the mechanisms how this central signal
transduction pathway interacts with environmental challenges mediated via multi-
ple other pathways, in order to keep cells and tissues in homeostasis. Under condi-
tions of calorie restriction, i.e., at reduced food intake, the lifespan of model
organisms, such as yeast, worms or flies, is increased. Interestingly, signal transduc-
tion pathways related to calorie restriction show also in humans very similar regula-
tory principles. This insight has the potential to prevent age-related diseases,
such as T2D, CVDs and cancer, and to promote healthy aging in human.

Keywords Aging · Model organisms · Nutrient sensing · Insulin/IGF signaling ·

TOR-S6K signaling · Growth hormone endocrine axis · IR · IRS · PI3K · AKT ·
FOXO1 · Calorie restriction · Sirtuins · NAD · AMPK · Cellular energy status

6.1 Aging and Conserved Nutrient-Sensing Pathways

Aging is a complex molecular process that affects all species. It is represented by

the accumulation of molecular, cellular and organ damage, leading to loss of func-
tion and increased risk to disease and finally death. Nutrient-sensing pathways are
fundamental to the aging process. Abundance of food activates nutrient-sensing
pathways that stimulate a diverse set of physiological processes. The latter includes
reproduction but is compromised by a limited lifespan. In contrast, in conditions of
starvation or when the nutrient-sensing pathways are genetically interrupted, repro-

© Springer Nature Switzerland AG 2020 81

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_6
82 6 Nutritional Signaling and Aging

duction is delayed and the lifespan increased. Thus, the availability of food deter-
mines the speed of aging.
Understanding the molecular basis of aging is a central topic of nutrigenomics.
Nevertheless, aging research in humans takes time and ethical reasons restrict many
types of experiments. Therefore, most of the principles of aging were first under-
stood via the use of simple model organisms, such as Saccharomyces cerevisiae
(yeast), Caenorhabditis elegans (roundworm), Drosophila melanogaster (fruit fly)
and Mus musculus (mouse) that have a far shorter lifespan than humans (Box 6.1).

Box 6.1: Model Organisms

A model organism is a non-human species that is studied in vivo, in order to
understand biological processes, such as aging, that due length of lifespan,
costs or ethical reasons cannot be studied in humans. The evolutionary con-
servation of biological pathways allows the transfer of at least some of the
results and insights obtained with the model organisms to humans. In the
unicellular species yeast, not only the survival of a population of non-dividing
cells (chronological lifespan) can be studied, but also the number of daughter
cells generated by a single mother cell (replicative lifespan). The roundworm
C. elegans is a simple multicellular species formed only by some 1000 cells
but already allows studies of different cell types and organs, such as nervous
or digestive systems. C. elegans was the first species, in which lifespan
extending mutations were found. The fruit fly D. melanogaster confirms the
evolutionary conservation of biological pathways. It contains more different
tissues than C. elegans and allows the examination of sex differences. Finally,
the mouse is the most established model organism in biomedical research and
as a mammalian species it is much closer to humans (even though primates
are closest, but for ethical and generation length reasons, research with them
is limited).

Multicellular organisms have developed a nutrient-sensing system allowing

communication between different parts of the body. The intracellular signal trans-
duction pathway of the peptide hormone IGF1 is the same as that of insulin, and
informs cells about the presence of glucose (Sect. 9.1). The insulin/IGF pathway
(Sect. 6.3) is evolutionary very conserved and, depending on the respective species,
starts with one or several specific receptor tyrosine kinase-type membrane receptors
(Fig. 6.1). Via cytosolic adaptor proteins, such as IRS (insulin receptor substrate),
and kinases, such as PI3K (phosphoinositide 3-kinase) and AKT (AKT serine/thre-
onine kinase), the ligand stimulation of the receptors results in the inactivation of
one or several members of the FOXO transcription factor family. FOXOs that con-
trol the expression of genes involved in a wide range of physiological processes,
such as cellular stress response, anti-microbial activity and detoxification of xeno-
biotics and free radicals (Sect. 6.4). At least in lower organisms, such as C. elegans
6.1 Aging and Conserved Nutrient-Sensing Pathways 83

S. cerevisiae C. elegans D. melanogaster M. musculus

Dietary restriction Dietary restriction Dietary restriction Dietary restriction

Glucose Insulin/IGF1-like Insulin/IGF1-like IGF1 GH1

Amino acids

DAF2 IR IGF1R GHR

Inhibition of nutrient GH signaling

-sensing pathways CHICO
RAS RAS
PI3K
TOR TOR TOR PI3K TOR PI3K
(AGE-1)
AC AC

SK6 SK6 SK6 SK6

(Sch9) PKA (RSK1) AKT (RSK1) AKT (Sch9) AKT PKA

Cytoplasm Cytoplasm Cytoplasm Cytoplasm

Nucleus Nucleus Nucleus Nucleus

?
MSN2/4 DAF12 FOXO ? ? FOXO ?
GIS1 HIF1 4E-BP

Activation of anti-aging ? ? ?
transcription factors

? ? ? ?
Anti-aging Anti-aging Anti-aging Anti-aging

Fig. 6.1 Nutrient signaling pathways involved in longevity are conserved in various species.
The activity of various signal transduction pathways is reduced by calorie restriction either directly
(in yeast) or indirectly (in worms, fruit flies and mice) through the reduced levels of growth factors,
such as IGF1. In all four species TOR and S6K activation promote aging (i.e., reduce lifespan).
Moreover, in yeast and mammals activation the AC (adenylate cyclase)-PKA (protein kinase A)
pathway accelerates aging. In addition, aging is promoted by the insulin/IGF1 signaling pathway
directly or indirectly via its upstream factors, such as GH1. Transcription factors, such as GIS1
(GIg1–2 suppressor) and MSN (multicopy suppressor of SNF1 mutation) 2/4 in yeast, DAF
(abnormal dauer formation) 12 and HIF1 (hypoxia-inducible factor 1) in worms and FOXO in flies
and mice as well as the translational inhibitor 4E-BP in flies are inactivated by either the AC-PKA,
the IGF1-AKT or the TOR-S6K pathway. They protect from aging in all major model organisms

and D. melanogaster, the knockout of any gene/protein that leads to the specific
interruption of this signal transduction pathway causes lifespan extension.
Parallel to the glucose-sensing system there is an amino acid-sensing pathway
that is also evolutionary highly conserved (Fig. 6.1). Central to this signal
­transduction pathway are the proteins TOR and S6K (S6 kinase). TOR is a cell-
growth modulator and serine/threonine kinase, which in mammalians exists in two
different complexes, TORC1 and TORC2, of which only TORC1 is sensitive to
amino acids (Sect. 3.1). The TOR-S6K pathway demonstrates crosstalk with the
insulin/IGF pathway and the inhibition of its activity also can increase lifespan, at
least in lower organisms. In mice, mutations in genes for GH1 and the insulin/IGF
signaling pathway can increase lifespan by up to 50%. Moreover, the inhibition of
the TOR pathway increases the lifespan of mice and at the same time reduces the
84 6 Nutritional Signaling and Aging

incidence of age-related pathologies, such as bone, immune and motor dysfunctions

and insulin resistance.
Mouse models have indicated that in mammals the sensing of nutrition involves
additional control circuits, including actions of the CNS and its associated glands
(Sect. 6.2). For example, the somatotrophic axis comprises GH1 that is secreted by
the anterior pituitary and its secondary mediator IGF1 that is produced primarily by
the liver. Interestingly, GHR (GH1 receptor)-deficient primates develop seldomly
diabetes or cancer but due to developmental defects and the increased mortality at
younger ages they do not have an increased life expectancy. However, genetic varia-
tions that reduce the functions of GH, IGF1R (IGF1 receptor), IR (insulin receptor)
or their downstream effectors, such as AKT, TOR and FOXO1 (Fig. 6.1), have been
linked also to longevity in humans. The study of conserved nutrient-sensing path-
ways suggests that the genetic alterations create a physiological state in the investi-
gated model organisms that resembles to periods of food shortage. Thus, calorie
restriction is able to extend the lifespan of diverse species spanning from yeast
to rhesus monkeys (Sect. 6.5).

6.2 Neuroendocrine Regulation of Aging

Aging starts for humans after the peak of their maximal physical ability in the age
of 20–25 years, i.e., already at this age begins a slow progressive decline of the
physiological capabilities of the different tissues and cell types forming our body.
From an age of 45 years onwards, there is a significant increase in the onset of
aging-related complex diseases, such as cancer, T2D, CVDs and Alzheimer’s dis-
ease. For many thousand years the average generation length of Homo sapiens was
approximately 20 years and increased just in the recent past. Assuming some addi-
tional 25 years for raising all offspring, only within the first 45 years of life evolu-
tionary adaption had the chance to select for sufficient fitness and health. This
means that any harm occurring to humans above this age, such as developing T2D
or cardiovascular problems, can not be corrected via evolutionary adaption princi-
ples, such as an increased or decreased number of vital offspring (Sect. 2.2).
Nevertheless, the maximal lifespan of humans extends to approximately 120 years.
The extra time of 75 years, which was realized only in a few subjects, can be con-
sidered as a margin of safety, in order to guarantee that the vast majority of humans
have enough time to fulfill the primary evolutionary sense of life, i.e., to reproduce
and to assure the survival of their children until these start reproduction
themselves.
GH1 is vertebrate-specific peptide hormone that is produced in the pituitary
gland. Loss-of-function mutations in genes encoding for transcription factors
important for pituitary development, such as POU1F1 (POU class 1 homeobox 1)
and PROP1 (PROP paired-like homeobox 1), result in deficiency in GH1 expression
and large lifespan extension, which is mediated, at least in part, by insulin/IGF sig-
naling. Thus, a defensive response of minimized cell growth and metabolism in
6.2 Neuroendocrine Regulation of Aging 85

GH1

IGF1 Dietary restriction

PTEN PI3K

AMPK SIRT1
AKT

FOXO TOR PPARGC1A

Aging

Fig. 6.2 Nutrient-sensing in mammals. Overview of the endocrine somatotrophic axis that
involves GH1 and the insulin/IGF1 signal transduction pathway. Proteins/pathways that favor
aging are shown in green and those with anti-aging properties in red

case of cellular damage or food shortage enables an organism with a constitu-

tively decreased insulin/IGF signaling to survive longer.
For the same reason physiologically or pathologically aged mammals decrease
their insulin/IGF signaling, i.e., during normal aging the levels of GH1 and IGF1
decline. In addition to insulin/IGF signaling sensing glucose, also in mammals high
amino acid concentrations are sensed by TOR and low-energy states by sirtuins via
high NAD+ levels and by AMPK via high AMP levels (Sect. 6.6) (Fig. 6.2). During
aging, TOR activity increases in hypothalamic neurons and contributes to age-­
related obesity, which in mice can be reversed by infusion of the TOR inhibitor
rapamycin to the hypothalamus. However, TOR inhibition creates side effects, such
as impaired wound healing and insulin resistance, i.e., this pathway is not suited for
pharmacological intervention. In contrast, sirtuins and AMPK are counteracting to
insulin/IGF and TOR signaling, i.e., their activity represents low food availability
and catabolism instead of nutrient abundance and anabolism. Interestingly, one of
the activities of AMPK is the direct inhibition of TOR. The deacetylase SIRT1 and
the kinase AMPK are connected in a positive feedback loop concerning sensing
low-energy states of cells.
86 6 Nutritional Signaling and Aging

Human aging is mostly associated with a progressive mitochondrial dysfunction

coming with a decrease in NAD+ levels leading to impaired function of SIRT1 (Sect.
6.6). SIRT1 is one of the best-studied human signaling proteins regulating the
metabolism of glucose and fat in response to energy level changes. Therefore,
SIRT1 acts as a central control of the energy homeostasis network. Furthermore,
SIRT1 controls the activity of the co-activator protein PPARGC1A, which in turn
manages central metabolic pathways counteracting aging, such as mitochondrial
biogenesis, enhanced anti-oxidant defenses and improved fatty acid β-oxidation.
Thus, anabolic signaling accelerates aging, while decreased nutrient signaling
extends the lifespan.

6.3 Principles of Insulin Signaling

Insulin resistance is a major predictor for the development of T2D (Chap. 9) and the
metabolic syndrome (Chap. 10). In order to develop new drugs for the treatment of
T2D and its cardiovascular complications, it is essential to understand the principles
of insulin signaling. The major role of insulin signaling is the regulation of glucose,
lipid and energy homeostasis, predominantly via actions on skeletal muscle, liver
and WAT. Final outcomes of insulin signaling are increased glucose uptake in
muscle and fat tissue and inhibition of glucose synthesis in the liver. In adipose
tissue, insulin also inhibits the release of FFAs (free fatty acids).
Insulin acts via the IR being located in the plasma membrane of insulin sensing
cells. When insulin binds to the α-subunit of the tetrameric receptor complex (two
α- and β-subunits), it undergoes a conformational change that activates the cytosolic
kinase domain of the β-subunit and allows the recruitment of IRS proteins to its
cytosolic component. The activity of IR is upregulated by tyrosine phosphorylation,
while the receptor is negatively regulated by protein tyrosine phosphatases.
Moreover, SOCS (suppressor of cytokine signaling) 1 and 3, GRB10 (growth factor
receptor-bound protein 10) and ENPP1 (ectonucleotide pyrophosphatase/ phospho-
diesterase 1) inactivate the function of IR by blocking its interaction with IRS pro-
teins or by modifying the receptor’s kinase activity. SOCS proteins are upregulated
in insulin resistance (Sect. 9.2).
In particular during insulin resistance IR is inactivated by ligand-stimulated
internalization and degradation. IR has at least 11 intracellular substrates, such as
IRSs 1-6, GAB1 (GRB2-associated binder 1), CBL (Cbl proto-oncogene, E3 ubiq-
uitin protein ligase) and different isoforms of SHC (Src homology 2 domain con-
taining) protein. The interaction of phosphorylated IRS proteins with the regulatory
subunit of the kinase PI3K results in the generation of the second messenger PIP3
(phosphatidylinositol-3,4,5-triphosphate) activating the kinase AKT (Fig. 6.3). IR/
IRS, PI3K and AKT form three important nodes in the insulin signal transduc-
tion pathway being responsible for most of the metabolic actions of insulin, such
as glucose uptake, glucose synthesis and inhibition of gluconeogenesis. In this way,
6.3 Principles of Insulin Signaling 87

Insulin

cellular
membrane IR A/B

CYTOPLASM PTPN1
SORBS1
CBL IRS1 JAK

CDC42 IRS2
RHOQ p85α
IRS3 STAT
PTEN p110α p55α
IRS4
p110β PI3K p50α
p110γ p85β NODE 1 SOCS
Glucose uptake PRKCI PDPK
p55γ
NODE 2
TBC1D4 AKT1
SHC
AKT2
MAPK8
AKT3 Cell growth,
MAPK3
differentiation
NODE 3
MAPK1

GSK3 TOR RPS6K

FOXO1
Protein synthesis
Glycogen synthesis

Gluconeogenesis

Fig. 6.3 Critical nodes in insulin signaling. Three important nodes of the insulin signaling net-
work are IR/IRS, PI3K with its several regulatory and catalytic subunits and the three isoforms of
AKT. Downstream of these nodes are the proteins TBC1D4 (TBC1 domain family member 4),
PRK (protein kinase) C1, sorbin and SORBS1 (SH3 domain containing 1), CDC42 (cell-division
cycle 42), GSK3 (glycogen synthase kinase 3), RPS6K (ribosomal protein S6 kinase), PDPK
(3-phosphoinositide dependent protein kinase) 1 and 2, PTEN (phosphatase and tensin homo-
logue), PTPN1 (protein tyrosine phosphatase, non-receptor type 1), RHOQ (ras homolog family
member Q), CBL, JAK, FOXO1, TOR, SHC, SOCS, STAT, MAPK (mitogen-activated protein
kinase) 1, 3 and 8

the three nodes explain the diversification and fine-tuning of insulin signaling both
in health and disease.
IRS1 and IRS2 are ubiquitously expressed, while IRS3 is found primarily in
adipocytes and the brain and IRS4 in embryonic tissues. After IR phosphorylates
IRS’ tyrosine sites the protein interacts with the SH2 (Src homology 2) domain-­
containing adaptor proteins, such as the regulatory subunits of PI3K or GRB2.
GRB2 then associates with the adaptor protein SOS (son of sevenless) to activate
the MAPK pathway via MAPK1, MAPK3 and MAPK8. This links the action of
insulin to the control of cell growth and differentiation. Like for IR, the signaling
function of IRS proteins is also regulated by the action of tyrosine phosphatases,
such as SHP2 (SH2-domain-containing tyrosine phosphatase 2). SHP2 dephosphor-
ylates the IRS binding sites of PI3K and GRB2 and interrupts their respective signal
transduction pathways. In response to insulin, FFAs and cytokines IRS proteins are
phosphorylated at serine residues. Most of these serine phosphorylations negatively
regulate IRS signaling, i.e., they represent a negative-feedback mechanism for the
insulin signaling. Interestingly, serine phosphorylation of IRS1 strongly correlates
88 6 Nutritional Signaling and Aging

with insulin resistance (Sect. 9.2). Moreover, reduced expression of IRS proteins or
IR contributes to insulin resistance.
The kinase PI3K is formed by a regulatory and a catalytic subunit, each of which
has several isoforms. The catalytic subunit is activated via the interaction of two
SH2 domains in the regulatory subunit of IRS proteins. Inhibition of the enzyme
blocks most of insulin’s actions on glucose transport, glycogen synthesis, lipid syn-
thesis and adipocyte differentiation, i.e., PI3K has a central role in the metabolic
actions of insulin. The most important downstream target of PI3K is the serine/
threonine kinase AKT, which phosphorylates a number of key proteins, such as
GSK3, TBC1D4 and FOXO1. AKT has three isoforms, of which AKT2 is most
important in controlling metabolic functions. Phosphorylation of GSK3 decreases
the kinases’ inhibitory activity on GS leading to increased glycogen synthesis, but
GSK3 has also a number of additional targets. Activated TBC1D4 stimulates small
GTPases that are involved in cytoskeletal re-organization, which is required for the
translocation of the glucose transporter GLUT4 to the plasma membrane, i.e.,
TBC1D4 controls glucose uptake. Finally, AKT controls the activity of FOXO1
(Sect. 6.4).

6.4 Central Role of FOXO Transcription Factors

The FOX transcription factor family contains over 100 members, some of which are
crucial for the regulation of metabolism. The proteins FOXO1, FOXO3, FOXO4
and FOXO6 form a subclass of the family. FOXO1 is highly expressed in organs
that control glucose homeostasis, such as in liver, skeletal muscle and adipose tis-
sue, as well as in β cells. FOXOs are activated by oxidative stress and ER stress via
MAPK8 and are negatively regulated by the insulin signaling pathway via PI3K and
AKT (Fig. 6.4a). In C. elegans and other model organisms the IR-PI3K-AKT-­FOXO
signaling axis shows central functions in aging (Sect. 6.1). Optimal FOXO signal-
ing ensures longer lifespan, while the de-regulation of this pathway contributes
to the age-related diseases cancer and T2D. This provides FOXO with a central
role at the interconnection of aging and disease and suggests that the main function
of FOXOs is to maintain homeostasis in response to environmental stress, such as
an increased oxidative stress, starvation or overnutrition. In the liver, FOXO1 is
activated during starvation or low glucose levels. Under these conditions the tran-
scription factor changes metabolism so that it ensures glucose homeostasis, i.e., it
initiates the breakdown of glycogen and gluconeogenesis. At moderate insulin resis-
tance, reduced insulin signaling results via FOXO-stimulated gluconeogenesis in
hyperglycemia. At severe insulin resistance, high levels of FOXO-triggered lipid
oxidation lead to ketoacidosis. FOXO1 also affects the fasting response via actions
in the CNS, such as in AGRP (agouti-related peptide) neurons (Sect. 8.4). Thus, a
balanced regulation of FOXOs via the IR-IRS-PI3K-AKT axis is essential for
normal transcriptional control during the metabolic response.
6.4 Central Role of FOXO Transcription Factors 89

A Insulin B
cellular Phosphorylation
membrane IR A/B
AKT MAPK8
IKK MST1
ROS CYTOPLASM
CSNK1 MAPK14
IRS
DYRK1A AMPK

PI3K PTEN MAPK8

MAPK LRKK2
FOXO
NLK
PDPK1 AKT
MAPKAPK5
CDK1

EP300 SETD7
FOXO1 Methylation
Anabolic Cell cycle HDAC PRMT1
metabolism inhibition SIRT1 MDM2
Catabolic USP7
Acetylation Ubiquitylation
metabolsim

Oxidative stress Apoptosis

resistance

Fig. 6.4 Control and outcome of FOXO activation. Antagonistic control of FOXO through
PI3K-AKT and MAPK8 signaling (a). Insulin and growth factors signal converge in their signaling
at PI3K and activate PDPK1 and AKT. This is counteracted by PTEN. Active AKT can inhibit the
transcriptional activity of FOXOs through phosphorylation at three conserved residues, resulting
in cytoplasmic retention of FOXO. Oxidative stress induces the nuclear translocation of FOXOs
via MAPK8 and thereby activates FOXO target genes. MAPK8 can inhibit the action of insulin at
multiple levels and thereby counteracts the inhibition of FOXO. The activation of FOXO inhibits
the cell cycle, increases oxidative stress resistance, induces apoptosis and shifts cellular metabo-
lism away from anabolic pathways towards catabolic metabolism. FOXOs are regulated via post-­
translational modifications, such as phosphorylation, acetylation, methylation and ubiquitylation,
by various signal transduction pathways (b)

FOXOs are regulated by a large number of signal transduction pathways and

post-translational modifications (Fig. 6.4b). This is similar to other intensively stud-
ied transcription factors, such as p53, and suggests that combinatorial codes of post-­
translational modification regulate the function of key transcription factors. For
example, the meaning of FOXO acetylation may be to switch FOXO-induced gene
expression from an apoptotic to a pro-survival response. Such a code is analogous
to the histone code (Box 5.1). FOXOs interact with SIRT1 during oxidative stress,
but only when active PI3K signaling also promotes uptake of SIRT1 into the nucleus.
Moreover, the energy sensor AMPK (Sect. 6.6) phosphorylates FOXOs, i.e., AMPK
directs the transcriptional action of FOXOs. In this way, AMPK activates alternative
energy sources and stress resistance, as it is observed under conditions of calorie
restriction (Sect. 6.5). Interestingly, AMPK activates FOXOs without influencing its
subcellular localization, but it affects the shuttling of FOXO co-regulators. Thus,
90 6 Nutritional Signaling and Aging

A Insulin B FOXO1cyt
β cells
Insulin+
cellular
IR membrane
Metabolic stress

Oxidative FOXO1
stress CYTOPLASM translocation
to nucleus

FOXO1nuc β cells
Insulin+
Metabolic stress
PI3K Stressed ER under increased
MAPK8 demand
FOXO1–
Insulin– De-differentiation
CREBBP
Endocrine CHGA –
+
Ac P NEUROG3
FOXO1 FOXO1 Insulin

POU5F1+
AKT Pluripotency NANOG+
MYCL+ Re-differentiation FOXO1

YWHA
P Ac P
FOXO1 FOXO1 FOXO1 FOXO1–
Glucagon+
NUCLEUS

Fig. 6.5 FOXO1 signaling is affected by metabolic and oxidative stress. Continuous insulin
stimulation activates AKT, which in turn phosphorylates serine and threonine sites of FOXO1, so
that the transcription factor is retained to the cytoplasma (a). However, under oxidative stress con-
ditions FOXO1 is acetylated by CREBBP and locates preferentially in the nucleus. The acetylation
prevents the ubiquitination of FOXO1, i.e., the protein is stabilized and retained in the nucleus. In
addition, oxidative stress also activates MAPK8, which phosphorylates FOXO1 at serine and thre-
onine sites distinct from those phosphorylated by AKT and further enhances nuclear retention of
FOXO1. Furthermore, also ER stress can induce nuclear retention of FOXO1 via MAPK8 activa-
tion. Under severe hyperglycemic conditions, β cells no longer express FOXO1, insulin, PDX1 and
MAFA but the pluripotency markers POU5F1, NANOG and MYCL, indicating de-differentiation
into progenitor-like cells (b). Some of these cells start to express glucagon suggesting they re-­
differentiate into α cells

FOXO transcription factors function as scaffolds that are post-­transcriptionally

modified by a number of common signal transduction pathways.
Under conditions of tissue homeostasis FOXOs are inactive and located in the
cytoplasma (Fig. 6.5A). The signal transduction of both insulin and growth factors
converge at PI3K, the activation of which leads to an increased level of PIP3. This
second messenger then activates PDPK1 (3-phosphoinositide dependent protein
kinase 1), which in turn stimulates AKT. Active AKT translocates to the nucleus and
phosphorylates FOXOs at three conserved residues, resulting in increased binding
of the transcription factors to YWHA (tyrosine 3-monooxygenase/tryptophan
5-monooxygenase activation protein, also called 14-3-3). YWHA proteins bind
more than 200 functionally diverse signaling proteins, such as transcription factors,
kinases and transmembrane receptors, when they are phosphorylated at serine or
threonine residues and retain them in inactive form in the cytoplasma. In contrast,
6.5 Calorie Restriction from Yeast to Mammals 91

under cellular stress, in particular at high ROS levels, FOXOs translocate into the
nucleus and activate their target genes (Fig. 6.5a). MAPK8 counteracts the activity
of insulin at multiple levels, such as by decreasing IRS activity (Sect. 6.3) and by
inducing the release of FOXOs from YWHA proteins.
In mild hyperglycemia, i.e., at metabolic stress, FOXO1 translocates into the
nucleus of β cells. Under condition of additional stress, such as severe hyperglyce-
mia, FOXO1 is downregulated and the cells loose the expression of insulin and the
transcription factors PDX1 (pancreatic and duodenal homeobox 1) and MAFA
(v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A) (Fig. 6.5b).
Then β cells change their transcriptional profile and instead express the endocrine
progenitor markers CHGA (chromogranin A) and NEUROG3 (neurogenin 3) and
the pluripotency markers POU5F1 (POU class 5 homeobox 1), NANOG (Nanog
homeobox) and MYCL (v-myc avian myelocytomatosis viral oncogene lung carci-
noma derived homolog). This is one mechanism of β cell failure (Sect. 9.3), in
which the cells de-differentiate into progenitor-like cells and re-differentiate
into glucagon-producing α cells.

6.5 Calorie Restriction from Yeast to Mammals

For thermodynamic reasons life does not function without energy supply, i.e., there
would be no life without high-energy nutrients, such as fatty acids or glucose (Sect.
1.2). When lowering food intake of model organisms, such as yeast, worms or flies,
their lifespan rises to a maximum but then declines rapidly. This indicates that there
is a species-specific optimal percentage of dietary reduction and an amplitude of
response in terms of life extension (Fig. 6.6). In general, calorie restriction i­ nactivates
one or several nutrient signaling pathways, such as those of insulin/IGF1 or
TOR. During periods of food scarcity the organisms enter a standby mode, in which
cell division and reproduction are minimized or even stopped, in order to save
energy for maintenance systems putting survival in preference before reproduction.
Thus, most species have developed an anti-aging system, in order to overcome
periods of starvation.
In humans and other mammals, extreme calorie restriction causes detrimental
health effects, such as infertility and immune deficiencies. However, beneficial
effects of moderate calorie restriction are obtained both by reducing carbohydrate
intake as well as by reducing fat or protein consumption, i.e., also in mammals sev-
eral nutrition sensing pathways respond to reduction in food intake. Calorie restric-
tion can increase the lifespan of rodents by up to 60%. In general, dietary-restricted
rodents show many levels of metabolic, hormonal and structural adaptations when
reducing body fat mass, such as higher insulin sensitivity, reduced inflammation and
oxidative damage (Table 6.1). This is also observed in calorie-restricted monkeys.
For example, in rhesus monkeys a 30% calorie restriction over 20 years reduced the
incidence of cancer and CVDs by 50% compared with controls. In analogy, also in
humans, calorie restriction provides beneficial effects against obesity, insulin resis-
92 6 Nutritional Signaling and Aging

Life-span increase [fold] Beneficial health effects

Dietary Mutations/ Dietary Mutations/
restriction drugs restriction drugs

S. cerevisiae 3 10 Extended Extended reproductive

with starvation reproductive period, decreased DNA
period damage mutations

C. elegans 2-3 10 Resistance in Extended motility,

misexpressed toxic resistance in mis-expressed
proteins toxic proteins and germ-
line cancer

D. melanogaster 2 1.6-1.7 None reported Resistance to bacterial

infection, extended ability
to fly

M. musculus 1.3-1.5 1.3-1.5 Protection against Reduced tumor incidence;

100% in combi- cancer, diabetes, protection against age-
nantion with atherosclerosis, cardiomyopathy, dependent cognitive decline,
dietary restriction autoimmune, kidney and cardiomyopathy, fatty liver and
respiratory diseases, reduced renal lesions, extended insulin
neurodegenation sensitivity

M. mulatta trend noted not tested Prevention of obesity, not tested

protection against diabetes,
cancer and CVDs

H. sapiens not tested not tested Prevention of obesity, Possible reduction in

GHR-deficient diabetes, hypertension cancer and diabetes
subjects reach reduced risk factors for
old age cancer and CVDs

Fig. 6.6 Calorie restriction. In a number of model organisms experiments of calorie restriction
have been performed, where nutrient-sensing pathways have been modulated genetically or chemi-
cally. However, there is a wide range of results and the long-term effects in human are not yet
known

Table 6.1 Effects of calorie restriction on mammalian tissues

Tissue Effects on dietary restriction
Liver Increase in gluoconeogenesis and glycolysis
Decrease in glycolysis
Muscle Increase in mitochondrial biogenesis and respiration
Increase in β-oxidation of fatty acids
Increase in protein turnover
Fat Decrease in storage of triacylglycerols
Decrease in secreted leptin
Increase in secreted adiponectin
Pancreatic β Decrease in secreted insulin
cells
Brain Decrease in pituitary secretion of growth hormone, thyroid hormone,
gonadotropins
Increase in adrenal secretion of corticoids
Whole organism Increase in insulin sensitivity and decrease in blood glucose
Increase in metabolism
6.6 Cellular Energy Status Sensing by Sirtuins and AMPK 93

tance, inflammation and oxidative stress. Moreover, humans also show adaptations
in their hormonal circuits, such as increased levels of adiponectin and reduced con-
centrations of the hormones triiodothyronine, testosterone and insulin. Moreover,
reduced concentrations of cholesterol and CRP are observed and also blood pres-
sure decreases. Thus, in rodents, monkeys and even in humans calorie restric-
tion protects against age-related diseases, such as T2D, CVDs and cancer.
Despite convincing evidence of health benefits from calorie restriction, in the
general population this approach may not be socially and ethically accepted for
reducing the risk of age-related diseases, i.e., for increasing the healthspan. An
alternative may be repeated fasting and eating cycles, which, at least in rats, pro-
longed the lifespan by more than 80%. Moreover, mice that got a high-fat diet with
regular fasting breaks were lean, had lower levels of circulating inflammatory mark-
ers and no fatty liver compared to mice that consumed an equivalent total number of
calories ad libitum. There are different strategies in altering energy intake or the
duration of fasting and feeding periods that can improve the health in mam-
mals, such as
• classical caloric restriction, i.e., a daily decrease of the recommended intake by
15–40%
• time-restricted feeding, i.e., daily food intake within a 4–12 h window
• intermittent, periodic full or partial fasting, i.e., a periodic, full- or multiday
decrease in food intake
• fasting-mimicking diets; i.e., reducing caloric intake and modifying diet compo-
sition but not fasting
Cycles of fasting or fasting-mimicking diets and refeeding promote the activa-
tion of HSCs (hematopoietic stem cells) and the regeneration of immune cells,
modulate the gut microbiome and promote the T cell-dependent elimination of can-
cer cells.
Our body is genetically still largely adapted to a life as hunter and gatherer,
where the feeding pattern was most likely shifting between starvation and times of
overeating after a successful hunt. However, the efficacy of most fasting strategies
are probably limited, if they are not combined with diets that have health-associated
benefits, such as Mediterranean or Nordic diet (Box 1.1). Thus, the switch between
nutrient intake, usage and storage, i.e., between feeding and fasting, is a fine-­
tuned regulatory, evolutionarily conserved program that involves the nutrient-­
sensing insulin/IGF1 and TOR signaling pathways and the food restriction
pathways involving sirtuins and AMPK.

6.6 Cellular Energy Status Sensing by Sirtuins and AMPK

The combination of nutritional epigenetics (Chap. 5) and beneficial health effects of

calorie restriction and feeding-fasting alternations (Sect. 6.5) suggests that proteins,
such as the HDACs of the sirtuin family, may be the key molecules in this nutrige-
94 6 Nutritional Signaling and Aging

Table 6.2 Mammalian sirtuins. The subcellular localization of sirtuins, their mode of action and
their functions in different compartments are listed
Molecular Cellular
Sirtuins mass [kDa] localization Activity Key regulatory functions
SIRT1 81.7 Nucleus and Deacetylase Metabolism, inflammation
cytosol
SIRT2 43.2 Cytosol Deacetylase Cell cycle and motility,
myelination
SIRT3 43.6 Mitochondria Deacetylase Fatty acid oxidation,
antioxidant defences
SIRT4 35.2 Mitochondria ADP-ribosyl-­ Amino acid-stimulated insulin
transferase secretion, suppression of fatty
acid oxidation
SIRT5 33.9 Mitochondria Deacetylase, Urea cycle
Demalonylase,
Desuccinylase
SIRT6 39.1 Nucleus Deacetylase, Genome stability, metabolism
ADP-ribosyl-­
transferase
SIRT7 44.8 Nucleus Deacetylase? Ribosomal DNA transcription

nomic process. Sirtuins combine epigenetically important enzymatic activity

with the sensing of the energy status of cells, i.e., the NAD+/NADH ratio. In
humans the sirtuin family has seven members, SIRT1 to SIRT7, that act in different
cellular compartments (Table 6.2). In the nucleus, the substrates of sirtuins are his-
tones and transcription factors, but also in the cytoplasm and in mitochondria they
remove acetyl groups from post-translationally modified regulatory proteins. SIRT1,
SIRT2, SIRT3, SIRT6 and SIRT7 are specific protein deacetylases, whereas SIRT4
and SIRT5 preferentially remove other acyl groups from lysines. SIRT1, SIRT6 and
SIRT7 are predominantly localized in the nucleus but at least SIRT1 is also found in
the cytosol. In contrast, SIRT2 is mainly cytosolic and enters the nucleus only dur-
ing the G2 to M phase transition of the cell cycle. SIRT3, SIRT4 and SIRT5 are
preferentially located in mitochondria.
In a simplified view, the deacetylase activity of sirtuins counterbalances nutrient-­
driven protein acetylation. During fasting and/or exercise, levels of the sirtuin
co-factor NAD+ rise in skeletal muscle, liver and WAT, while high-fat diet
reduces the NAD+/NADH ratio. Pharmacological targeting of sirtuins, in particu-
lar of SIRT1, is promising for the treatment of T2D. The search for further natural
or synthetic sirtuin activators led to the identification of several compounds, of
which resveratrol, a polyphenol found in red grapes and berries (Fig. 5.1), received
most attention. Resveratrol improves mitochondrial activity and metabolic control
in humans, i.e., it may also increase our healthspan. The most prominent synthetic
sirtuin activator is SRT2104, which protects against diet-induced obesity by improv-
ing mitochondrial function. However, both resveratrol and SRT1720 do not activate
sirtuins directly, but at least resveratrol acts via AMPK.
6.6 Cellular Energy Status Sensing by Sirtuins and AMPK 95

AMPK is activated by stress that inhibits the catabolic production of ATP, such
as starvation for glucose or oxygen, as well as by stress that increases ATP con-
sumption, such as muscle contraction (Box 6.2). Furthermore, numerous synthetic
compounds, such the anti-diabetic drugs metformin, phenformin and thiazolidine-
diones, as well as plant products, such as resveratrol, epigallocatechin gallate (green
tea), capsaicin (peppers) and curcumin (turmeric) activate AMPK. However, the
activation by most of these compounds, including metformin and resveratrol, is
indirect via the increase of cellular AMP and ADP through the inhibition of mito-
chondrial ATP synthase. Since these AMPK activators also extend the lifespan of
C. elegans, they may act as mimetics of calorie restriction (Sect. 6.5) and/or exer-
cise (Sect. 1.6). Both processes decrease the cellular energy status and have benefi-
cial effects on the healthspan.

Box 6.2: Regulation of AMPK

ATP is mainly generated by oxidative phosphorylation in the mitochondrial
membrane. A high ATP/ADP ratio is essential to promote nearly all processes
in living cells, since they all require energy and mostly are driven by the
hydrolysis of ATP to ADP. Then, approximately every second ADP molecule
is converted by the enzyme adenylate kinase to AMP. Therefore, falling cel-
lular energy is associated with a decreased ATP/ADP ratio on one side and
with increases in both ADP and AMP on the other side. Thus, the energy
status of a cell can be monitored either via the ATP/ADP or the ATP/AMP
ratio. The ATP/AMP ratio is directly sensed by a few enzymes, such as gly-
cogen phosphorylase and phosphofructokinase (both get activated) and
fructose-­1,6-bisphosphatase (which gets inhibited). However, the main sen-
sor of the energy status of cells is AMPK. AMPK is a heterotrimeric com-
plex of its catalytic α-subunit and the regulatory β- and γ-subunits and is
activated by various types of metabolic stresses, drugs and xenobiotics involv-
ing increases in cellular AMP, ADP or Ca2+. The major upstream kinases of
AMPK are LKB1 (liver kinase B1) and CAMKK2 (Ca2+/calmodulin-­
dependent protein kinase kinase 2). LKB1 provides a high basal level of
AMPK phosphorylation that is modulated by the AMP binding, while the
alternative activation pathway via CAMKK2 responds to increases in cellular
Ca2+ but is independent of AMP or ADP level changes.

AMPK activation has multiple effects on cellular metabolism (Fig. 6.7). In gen-
eral, the activation of AMPK by lack of energy stimulates catabolic pathways that
generate ATP, while it turns off anabolic pathways that consume ATP. The AMPK-­
controlled catabolic processes include
• upregulation of glucose uptake by promoting the expression and function of glu-
cose transporters
96 6 Nutritional Signaling and Aging

Mitochondrial biogenesis
and autophagy
+
+ +
Mitochondrial
biogenesis Autophagy
(mitophagy) Fatty acid uptake Lipid
CD36 metabolism
+
+ Glucose uptake
Fatty acid synthesis
GLUT1 PPARGC1A
+ SIRT1 ULK1/2 ?
Glycolysis
PFKL ? ACC1 Fatty acid oxidation -
PFKFB3/4 ACC2
Gluconeogenic
+ Lipogenic enzymes +
enzymes CRTC2, HDACs AMPK SREBF1
(transcription)
(transcription)
GYS1/2 GPAT?
Triacylglycerol
+ Glycogen synthesis TBC1D1 HMGR
synthesis
+
TIFIA
RAPTOR TSC2
Glucose
metabolism Glucose uptake Cholesterol synthesis +
GLUT4
- rRNA synthesis Protein
POLR1 Protein
synthesis
synthesis
- mTOR
mTOR
+
+
Protein
metabolism

Fig. 6.7 Consequences of AMPK activation. This scheme displays the metabolic effects of
AMPK activation. Proteins shown with question marks may not be directly phosphorylated by
AMPK. CRTC2 CREB-regulated transcription co-activator 2, GPAT glycerol phosphate acyl trans-
ferase, RAPTOR regulatory associated protein of TOR, TBC1D TBC1 domain, TIFIA transcription
initiation factor IA; TSC2 tuberous sclerosis 2

• promotion of glycolysis under anaerobic conditions by phosphorylating and acti-

vating PFKFB2 (6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2), the
enzyme responsible for the synthesis of glycolytic activator fructose
2,6-bisphosphate
• stimulating mitochondrial biogenesis
• inhibiting gluconeogenesis
• reducing glycogen synthesis via the inhibition of GYS (glycogen synthase).
6.6 Cellular Energy Status Sensing by Sirtuins and AMPK 97

Furthermore, AMPK increases fatty acid synthesis by stimulating ACC (acetyl-­

CoA carboxylase) 1, the key regulatory enzyme in fatty acid synthesis. Moreover,
AMPK upregulates the expression of enzymes involved in fatty acid synthesis and
inhibits the lipogenic transcription factor SREBF1. Furthermore, AMPK promotes
uptake and fatty acid β-oxidation in mitochondria via inhibition of ACC2.
Mitochondrial biogenesis is another important process activated by AMPK and is
mediated via SIRT1 and PPARGC1A as well as via increased clearance of dysfunc-
tional mitochondria via ULK1 (UNC-51-like kinase 1). Finally, this generates
increased capacity for the oxidative catabolism of both fatty acids and glucose.
AMPK also conserves ATP by inactivating anabolic pathways, such as the biosyn-
thesis of lipids, carbohydrates, proteins and ribosomal RNA. AMPK can downregu-
late the expression of the proteins involved in these pathways. Moreover, AMPK
also influences whole-body metabolism and energy balance via mediating effects of
hormones and other agents acting on neurons of the primary appetite control center,
the arcuate nucleus of the hypothalamus, that regulates intake of food and energy
expenditure actions (Sect. 8.4).
The circadian clock is a conserved mechanism that allows anticipating and
responding to environmental changes, such as feeding and fasting (Sect. 3.6). Since
there is a strong relation between the circadian clock and metabolism, time-­
restricted feeding can restore the cycling of metabolic regulators. Epigenetics of
the circadian clock coordinates daily behavioral cycles of sleep-wake and fasting-­
feeding with anabolic and catabolic processes in the periphery. Thus, NAD+ oscilla-
tion, redox flux, ATP availability and mitochondrial function are used in order to
influence acetylation and methylation reactions of chromatin modifiers (Sect. 5.2).
Moreover, gene expression changes related to dietary restriction promote global
preservation of genome integrity and chromatin structure, such as maintenance of
heterochromatin (Fig. 6.8). Since nutrition signaling pathways via insulin, TOR and
NAD+-sensing sirtuins integrate metabolic signals into chromatin responses, they
inform the epigenome on nutrient availability and thus have a key role in determin-
ing lifespan. In contrast, artificial light, shift work, travel and temporal disorganiza-
tion disrupt the alignment between the external light-dark cycle and their internal
clock and cause a disadvantage for metabolic health (Sect. 3.6).
In humans physical fitness and longevity are strongly associated, since regular
exercise reduces morbidity and mortality (Sect. 1.6). Moreover, physical activity
promotes healthy aging via preventing cognitive decline. It induces changes in the
chromatin of skeletal muscles, such as increased H3K36ac levels and the cellular
localization of HDAC4 and HDAC5. Thus, physical activity has direct effects on
the epigenome promoting healthy aging.
98 6 Nutritional Signaling and Aging

Survival
Time

Environmetal Effects on healthspan

Effect on chromatin
inputs and lifespan

• Modulation of chromatin modifiers

Diet • Heterochromatin maintenance
(dietary restriction) • Inhibition of recombination Increased
• Nucleosome positioning

Circadian cycle
Circadian epigenome
(regular)
Increased

Circadian cycle
Modulation of chromatin modifiers
(perturbed)
Decreased

• Modulation of chromatin modifiers

Exercise
• Chromatin modifications
Increased

Fig. 6.8 Effects of environmental inputs on chromatin and longevity. Many environmental
signals that modulate lifespan also affect chromatin. These are dietary restriction, the circadian
cycle and physical activity. More details are provided in the text

Additional Readings

Campisi J, Kapahi P, Lithgow GJ, Melov S, Newman JC, Verdin E (2019) From discoveries in
ageing research to therapeutics for healthy ageing. Nature 571:183–192
Di Francesco A, Di Germanio C, Bernier M, de Cabo R (2018) A time to fast. Science 362:770–775
Haeusler RA, McGraw TE, Accili D (2018) Biochemical and cellular properties of insulin receptor
signalling. Nat Rev Mol Cell Biol 19:31–44
Lopez-Otin C, Galluzzi L, Freije JMP, Madeo F, Kroemer G (2016) Metabolic control of longevity.
Cell 166:802–821
Singh PP, Demmitt BA, Nath RD, Brunet A (2019) The genetics of aging: a vertebrate perspective.
Cell 177:200–220
Steinberg GR, Carling D (2019) AMP-activated protein kinase: the current landscape for drug
development. Nat Rev Drug Discov 18:527–551
Chapter 7
Chronic Inflammation and Metabolic
Stress

Abstract In this chapter, we will present monocytes and macrophages as the key
players in acute and chronic inflammation. Macrophages react stimulus- and tissue-­
specifically and either develop from monocytes that are circulating in the blood or
from self-renewing embryonal cell populations. M1-type macrophages are key cells
in the initiation of the acute inflammatory response, while M2-type macrophages
are resolving inflammation and coordinate tissue repair. Tissue inflammation is not
only caused by bacterial infection or tissue injury but also derives from changes in
the concentration of nutrients and metabolites. We will provide examples of meta-
bolic stress, such as disturbance of reverse cholesterol transport and ER stress. The
latter is, in contrast to infectious or traumatic stress, often caused by lipid overload
in the blood and in adipose tissue. Thus, the immune system is implicated in the
regulation of metabolic homeostasis, while perturbations in this immune-­
metabolic network are often the basis of the different features of the metabolic
syndrome.

Keywords Monocytes · M1- and M2-type macrophages · Dendritic cells ·

Cytokines · Acute inflammation · Chronic inflammation · Inflammasome · Reverse
cholesterol transport · Metabolic stress · ER stress · Unfolded protein response

7.1 The Central Role of Monocytes and Macrophages

Monocytes constitute 1–5% of circulating leukocytes and are produced in the bone
marrow from common myeloid progenitors of granulocytes (i.e., primarily neutro-
phils) and monocytes, referred to as M-CFUs (colony-forming units) (Fig. 7.1). The
differentiation of myeloid progenitors is orchestrated by pioneer transcription fac-
tors, such as SPI1 and CEBPA, in cooperation with changes of the epigenome
(Chap. 5). After their differentiation, monocytes are released into the blood stream
and migrate through the endothelium of blood vessels into those tissues that send
out activating signals. This movement is mediated by the cytokine- and chemokine-­
induced expression of adhesion molecules, such as selectins, on the surface of endo-

© Springer Nature Switzerland AG 2020 99

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_7
100 7 Chronic Inflammation and Metabolic Stress

Fetal liver

M-CFU

M-CFU Osteoclast

Adult MDP
bone
marrow
Pro-DC

Pro-monocyte CDP

Adult
peripherial Pro-DC
blood
Monocyte Monocyte

Lymphoid-
derived DC

Resident tissue Monocyte-

Microglial cell Tumor-associated Inflammatory
macrophage: liver,
Langerhans cell macrophage macrophage derived DC
lung, intestine

Sentinel Trophic functions M2 macrophage M1 macrophage

Function Trophic functions Immune supression Fibrosis Pro-inflammatory
Wound healing Antimicrobial
Antiinflammatory

Fig. 7.1 Differentiation of monocytes. M-CFUs in the bone marrow are the precursors to MDPs
(macrophages and DC progenitors). In the bone marrow, MDPs differentiate to CDPs (common
DC progenitors) or to pro-monocyte precursors. Langerhans cells in the skin, microglial cells in
the brain and a number of other tissue-resident macrophages initially develop during embryogen-
esis from M-CFUs in the yolk sac or fetal liver. The remaining tissue macrophages get polarized,
depending on the inflammatory milieu, into M1- or M2-type macrophages (Fig. 7.2). Monocytes
are also the precursors to DCs

thelial cells. Within tissues, monocytes differentiate into macrophages or DCs, i.e.,
into the central cellular components of the innate immune system (Box 2.2). Thus,
a central role of monocytes is to refill the pool of macrophages and DCs in
response to inflammation and other stimuli.
Nutrient deprivation and infection by pathogens are the most challenging events
for the survival of an organism. Thus, there was a co-evolution for the responses
to food via the endocrine regulation of metabolism and to infectious diseases
via the innate immune system. The interface between metabolism and immunity
is largely mediated by macrophages. Tissue-resident macrophages, such as microg-
lia and Langerhans cells, have a wide variety of homeostatic and immune surveil-
lance functions ranging from the clearance of cellular debris, the response to
infections and the resolution of inflammation. A substantial proportion of these
macrophages is self-renewing and derives during embryogenesis from the yolk sac
and the fetal liver (Fig. 7.1). Populations of tissue-resident macrophages are found
7.1 The Central Role of Monocytes and Macrophages 101

Fig. 7.2 Classical and alternative macrophage activation. Different stimuli activate mono-
cytes/macrophages to develop into functionally distinct populations. Classically activated macro-
phages (M1-type) are induced by cytokines, such as IFNγ, and microbial products, such as
LPS. They are microbicidal and involved in potentially harmful inflammation. Alternatively acti-
vated macrophages (M2-type) are induced by the cytokines IL4, IL13 and TGFB1, which are
produced by TH2 cells, and are important in tissue/wound repair and fibrosis

in most tissues of our body, such as Kupffer cells in the liver, microglia in the CNS,
osteoclasts in the bone and alveolar macrophages in the lung. In response to their
activation by pathogens or metabolites, macrophages secrete a number of signaling
molecules, such as cytokines, chemokines and growth factors, which affect the
migration and activity of other immune cells. This response is called acute inflam-
mation, when it is caused by infection or injury, and is often associated with ery-
thema, hyperthermia, swelling and pain. However, it resolves within a few days to
weeks. In contrast, low-grade chronic inflammation, such as in obesity (Sect. 8.3),
does not cause heat or pain, but it can last over months and years, when the origin
of the stimulus cannot be resolved (Sect. 7.2).
Macrophages are often grouped into two classes, M1- and M2-type macro-
phages, which represent two extremes of a continuum of functional profiles
(Fig. 7.2). Pro-inflammatory molecules, such as INFγ (interferon gamma), TNF and
TLR activators, such as LPS (lipopolysaccharide), induce M1-type macrophages
that in turn secrete further pro-inflammatory molecules, in order to sustain the
102 7 Chronic Inflammation and Metabolic Stress

inflammatory reaction. This classical pathway of IFNγ-dependent macrophages

activation provokes the adaptive immune system to respond through the prolifera-
tion of type 1 TH cells (TH1) (Box 7.1).

Box 7.1: Subsets of T Lymphocytes

T cells constitute up to 30% of all circulating leukocytes and are a major com-
ponent of the adaptive immune system (Box 2.2). They occur in a number of
important subtypes, such as TH and cytotoxic T cells. TH cells are character-
ized by the expression of the CD4 glycoprotein on their surface and support
other cells of the immune system, such as maturation of B cells into antibody
producing plasma cells and memory B cells as well as they activate of cyto-
toxic T cells and macrophages. Antigen-presenting cells, such as DCs, acti-
vate TH cells via the presentation of microbe-derived peptides on MHC II
receptors. Depending on their cytokine expression profile TH cells are subdi-
vided into TH1 (IFNγ and IL2), TH2 (IL4, IL5 and IL13) and TH17 (IL17)
cells. Moreover, TH cells can differentiate into TREG cells that are involved in
immune tolerance and inhibit overboarding immune responses. Cytotoxic T
cells (also called T killer cells) are characterized by CD8 expression and can
destroy virus-infected cells and tumor cells. They get activated via the presen-
tation of peptides (derived from intracellular proteins) on MHC I receptors on
the surface of all nucleated cells.

In contrast, M2-type macrophages exert an almost opposite immuno-phenotype.

They do not produce nitric oxide (NO) or radicals required for killing of microbes
but provoke immunotolerance and TH2-type immune responses. M2-type macro-
phages produce anti-inflammatory molecules, such as TGFB1 (transforming growth
factor beta 1), IL10 or IL1RN (IL1 receptor antagonist), and inhibit the secretion of
pro-inflammatory cytokines. This alternate macrophage pathway is induced by anti-­
inflammatory molecules, such as CSF2 (colony stimulating factor 2), TGFB1 and
the TH2-type cytokines IL4 and IL13, and nuclear receptor ligands, such as gluco-
corticoids. The main role of M2-type macrophages is resolution, such as tissue
repair, wound healing, angiogenesis and extracellular matrix deposition. For
example, M2-type macrophages can be induced by the nuclear receptor PPARγ and
maintain adipocyte function, insulin sensitivity and glucose tolerance, which pre-
vents the development of diet-induced obesity and T2D (Chaps. 8 and 9). However,
when obesity-associated danger signals are sensed by the NLRP (NOD-like recep-
tor protein) 3 inflammasome (Box 7.2), this protein complex serves as a molecular
switch that let the adipose tissue-associated macrophages turn from an M2- to an
M1-type phenotype.
7.2 Acute and Chronic Inflammation 103

Box 7.2: The NLRP3 Inflammasome

A large protein complex composed of NLRPs, the adaptor protein ASC
(apoptosis-associated speck) and the pro-inflammatory CASP (caspase) 1 that
is formed in response to the rise of the levels of a number of PAMPs (pathogen-­
associated molecular patterns) and DAMPs (damage-associated molecular
patterns) (Fig. 7.3). Inflammasome activation requires a priming signal from
PPRs, such as TLR4, and a second signal involving potassium ion efflux,
lysosomal damage or ROS generation. Cholesterol crystals in lysosomes can
provide this second signal, either as a result of phagocytosis of extracellular
cholesterol crystals or via uptake of modified LDLs and free cholesterol
released from LDLs. Inflammasome activation leads to the secretion of the
pro-inflammatory cytokines IL1B and IL18.

7.2 Acute and Chronic Inflammation

Acute inflammatory responses to insults, such as injury and infection, are critical
for organism’s health and recovery. Infection or tissue damage is initially sensed by
PRRs, such as TLRs, NLRs, RLRs (retinoic acid-inducible gene 1 (RIG1)-like heli-
case receptors), lectins and scavenger receptors, that bind to PAMPs and DAMPs
(Fig. 7.4a). PRRs are evolutionarily highly conserved and their initial function was
providing anti-microbial immunity and regulating autophagy (Box 3.1). In response
to nutrient deprivation this group of receptors had been optimized, in order to
increase inflammation and insulin resistance, both of which are a strategies to com-
bat pathogens. Thus, a variety of different molecular motifs and stimuli con-
verge on a small number of sensing receptors that trigger the innate immune
response, cause inflammation and induce an appropriate adaptive metabolic
response. PAMP- or DAMP-stimulated PRRs start signal transduction pathways
that end in most cases in the activation of inflammation-associated transcription fac-
tors, such as NFκB and AP1. Major targets of these transcription factors are genes
encoding for pro-inflammatory cytokines, such as TNF and IL1B, anti-microbial
factors, such as NOS2 (inducible nitric oxide synthase 2), and cell-recruiting
­chemokines, such as CCL2 and CCL5. Another important component of the DAMP
sensing system is the inflammasome (Box 7.2) that primarily enhances IL1B pro-
duction and secretion (Fig. 7.3).
On the cellular level, the microbial challenge of resident macrophages stimulates
the influx of cells from the blood, such as neutrophils and monocytes (as a source of
inflammatory macrophages) (Sect. 7.1). Most inflammatory lesions are initially
dominated by these monocyte-derived macrophages. The changed expression pro-
file of the macrophages activates further cells of the innate immune system as well
as the adaptive immune system. The early inflammatory response comprises a num-
ber of redundant components and is further amplified in cytokine-mediated feed-­
104 7 Chronic Inflammation and Metabolic Stress

SELF-DERIVED Bacteria
ed
Amyloid-β eriv Virus
ATP g e n-d rs Fungi
ho to
Glucose Pat activa Protozoa
Hyaluronan
MSU crystals Steril NLR
Cholesterol crystals activ e
ators
ENVIRONMENTALLY PYD NACHT
DERIVED CASP1
Alum
Asbestos CARD p20/p10
Silica ASC
UV radiation

CARD PYD

IL1B
Host inhibitors IL18 Pathogen inhibitors
Pyroptosis

Resolution of infection
and/or inflammation
Chronic inflammation

Homeostasis

Fig. 7.3 Central role of the inflammasome. During acute or chronic inflammation, inflamma-
somes are directly or indirectly activated by a wide array of DAMPs and PAMPs. The initial event
leads to the activation of CASP1, the release of IL1B and IL18 as well as sometimes to pyroptosis
(a form of apoptosis associated with anti-microbial responses during inflammation). The release of
IL1B and IL18 induces the recruitment of effector cell populations of the immune response and
tissue repair, i.e., the activation of inflammasomes results in the resolution of infection or inflam-
mation and contributes to homeostatic processes. However, constant activation of the inflamma-
some can lead to chronic inflammatory diseases. Pathogen-derived inhibitors can block
inflammasome activation and thus the resolution of infection, while host-derived inflammasome
inhibitors will prevent chronic inflammation

forward loops. For example, adipose tissue of lean persons contains deactivated
macrophages, eosinophils and TREG cells, while within the initial phase of the acute
inflammation there is rapid invasion of neutrophils that is followed by the recruit-
ment of monocyte-derived macrophages, T cells and stromal cells. Thus, under
resting conditions most tissues contain only a few resident macrophages, while
at acute inflammation the number of immune cells drastically increases and
the characteristics of these cells changes.
7.2 Acute and Chronic Inflammation 105

The combined action of innate and adaptive immune cells eradicates infectious
microbes but also results in collateral tissue damage, such as cytotoxicity due to
ROS production and the degradation of extracellular matrix via proteases. After the
clearance of pathogens and the removal of apoptotic neutrophils by phagocytes,
there is recruitment or phenotypic switching of macrophages into the M2-type, i.e.,
into a pro-resolving phenotype (Fig. 7.2). This results in an overall repair and nor-
malization of the tissue architecture and function, including the re-establishment of
the vascularization. Most of these processes are activated by PUFAs and their deriv-
atives, such as eicanosoids. These metabolites function as signaling molecules bind-
ing to membrane proteins, such as GPR120, or directly activate nuclear receptors
and initiate intracellular pathways leading to an anti-inflammatory response (Chap.
3). This also involves anti-inflammatory cytokines, such as IL10 and TGFB1, and
small lipid mediators, such as lipoxins, resolvins, protectins and maresins that are
produced by the enzymes arachidonate 5- and 15-lipoxygenase (ALOX5 and
ALOX15) from arachidonic acid and ω-3 fatty acids. Thus, nutrition-derived sig-
naling molecules are critical for resolving inflammation.
In humans the basal inflammatory response increases with age, which is often
referred to as “inflammaging”, and leads to low-grade chronic inflammation that is
maladaptive and further promotes the aging process. This may be due to
• the accumulation of senescent cells that secrete pro-inflammatory cytokines
• an increased likelihood that a failure of the immune system does not effectively
clear pathogens and dysfunctional host cells
• overactivity of the transcription factor NFκB
• a defective autophagy response ultimately leading to increased ROS
production.
In all these cases, not microbes but the excess of endogenous molecules, such as
lipoproteins, SFAs or protein aggregates initiate the inflammatory response
(Fig. 7.4b). Metabolic dysregulation associated with chronic inflammation accom-
panies not only aging itself but also most common age-related diseases, such as
T2D and CVDs. Thus, sterile (i.e., non-bacterial) induction of low-grade chronic
inflammation is a critical characteristic of aging as well as of metabolic dis-
eases. In both cases an enhanced activation of the inflammasome (Box 7.2) and
other pro-inflammatory pathways leads to the increased production of IL1B, TNF
and interferons. This inflammatory response amplifies the production of disease-­
specific DAMPs resulting in positive-feedback loops that accelerate the underlying
disease process (Sect. 7.3). For example, inflammation stimulates the formation of
oxidized phospholipids that can serve as DAMPs in atherosclerosis (Sect. 10.2).
Thus, an inhibition of chronic inflammation can reduce the rate of disease pro-
gression to a point of substantial clinical benefit, although it does not alter the
underlying pathogenic process and its cause.
106 7 Chronic Inflammation and Metabolic Stress

A Acute inflammatory response

Infection
PAMP

Normal tissue

Macrophage/lymphocyte recruitment

Resolution and repair

Resolvines, TGFs, etc. Pathogen clearance

Efferocytosis Reversible
Leukocyte collateral tissue
recruitment damage

Chronic Low-grade inflammatory response

B inflammatory
disease
Persistant stimulus
Primary
pathophysiology

DAMP
Macrophage/lymphocyte recruitment

Normal tissue

Amplification of inflam-
matory responses
Tissue damage

Fig. 7.4 Acute and chronic inflammation. Acute inflammatory response to infection is initiated
by the presentation of PAMPs to PRRs (a). Eradication of the pathogen eliminates the stimulus but
may cause some collateral but reversible tissue damage. The resolution/repair phase leads then to
the restoration of normal tissue homeostasis. Chronic inflammation is caused by non-immune
pathophysiological processes that trigger an initial sterile inflammatory response involving
DAMPs and is amplified by cytokines and chemokines (b). However, this response does not elimi-
nate the initial stimulus, so that non-resolving inflammation persists and results in continuous tis-
sue damage
7.3 Reverse Cholesterol Transport and Inflammation 107

7.3 Reverse Cholesterol Transport and Inflammation

The protective role of macrophages against antigenic substances, such as patho-

genic microbes, enables them to recognize also lipid molecules, such as cholesterol
crystals, when these accumulate within tissues. This process links macrophages to
metabolism and assigns the cells with critical roles in atherosclerosis and lipid stor-
age diseases (Chap. 10). There are a number of interactions between inflammation
and metabolism, such as that pathogens and inflammation alter metabolic processes
as well as that metabolic diseases lead to abnormal immune reactions. A central
example is the process of reverse cholesterol transport. The transporter proteins
ABCA1 and ABCG1 in the membrane of cholesterol-laden macrophages interact
with the main HDL protein APOA1 and mediate the efflux of cholesterol from the
arterial wall to HDLs in the circulation (Fig. 7.5). The enzyme LCAT (lecithin-­
cholesterol acyltransferase) esterifies free cholesterol in HDLs forming cholesteryl
esters. In the liver some of the free cholesterol or cholesteryl esters are selectively
taken up via the transporter protein SCARB1 (scavenger receptor class B member
1) without degrading the HDLs. The liver either recycles the cholesterol as a com-
ponent of secreted lipoproteins or excretes them as bile acids via the action of the
transporters ABCG5 and ABCG8. In the plasma, the transporter protein CETP
transfers cholesteryl esters from HDLs to VLDLs and LDLs in exchange for triac-
ylglycerols. The enzymes LPL and LIPC (hepatic lipase) hydrolyze the triacylglyc-
erols of VLDLs, so that primarily cholesteryl esters remain and the lipoproteins
transform into LDLs.
Increased LDL-cholesterol levels in the circulation are the principal drivers of
atherosclerosis (Sect. 10.2), since this causes cholesterol accumulation and inflam-
matory response in the artery wall (Fig. 7.5). Under healthy conditions, HDLs can
oppose this process and are able to reduce inflammation by promoting the choles-
terol efflux from foam cells. However, acute inflammation impairs reverse choles-
terol transport at two central steps. This downregulates the expression of the genes
ABCA1 and ABCG1 in macrophages, i.e., it reduces cholesterol efflux from macro-
phages. In addition, it decreases the hepatic expression of the genes APOA1, CETP,
ABCG5, ABCG8 and CYP7A1, which results in the reduced excretion of choles-
terol. Moreover, acute inflammation causes the accumulation of triacylglycerols
within VLDLs leading to increased hepatic production of these lipoproteins and
their reduced clearance from circulation by LPL. The increased VLDL levels main-
tain high lipid levels in peripheral tissues, in order to suppress infection and to allow
tissue repair. Increased lipid levels may even be beneficial, at least for the short
period of an acute microbe infection. However, during acute sepsis HDLs have a
decreased ability to mediate cholesterol efflux from macrophages (Fig. 7.5). Under
these conditions, HDLs do not act anymore as anti-inflammatory lipoproteins that
suppress monocyte adhesion to endothelial cells but in contrast support the ­monocyte
recruitment. Moreover, oxidized and aggregated LDLs can activate PPRs, such as
TLRs, on the surface of macrophages and thus directly trigger the inflammatory
108 7 Chronic Inflammation and Metabolic Stress

INTESTINE ARTERY WALL

ABCA1
Bile acids 25% ABCG1
MACROPHAGE
APOAI ABCA1
APOA1 production secretion ABCA1 on hepatocytes
ABCG5 and enterocytes Cholesterol
ABCG8 APOAI efflux
Pre-β
HDL
75% ABCG1
Cholesterol
ABCG5 and ABCG8
Cholesterol excretion
HDL content LDL uptake
SCARB1 Serum amyloid A LCAT Foam cell formation
Cholesterol Oxidized phospholipids HDL MPO production
HDL LCAT APOA1 oxidation
and inactivation
CETP Inflammation

CETP expression HDL

LPL
LPLC
VLDL production VLDL oxidized LDL
Clearance of VLDL LDL
LDL aggregate
LPL activity
LIVER Modified LDL

Fig. 7.5 Reverse cholesterol transport and the effect of inflammation. After secretion of
APOA1 from the liver and the intestine, it interacts with ABCA1 on hepatocytes and enterocytes
and is assembled into preβ-HDLs. In macrophages, these lipoproteins are loaded via the action of
ABCA1 and ABCG1 with cholesterol and phospholipids and form HDLs. LCAT catalyzes the
esterification of free cholesterol in HDLs. In the liver, SCARB1 removes some of the free choles-
terol or cholesteryl esters from HDLs. In the liver, cholesterol is then either recycled into VLDLs
via the action of CETP or is transformed into bile acids that are excreted by the transporters
ABCG5 and ABCG8. In the blood stream, VLDLs undergo a lipolytic cascade mediated by the
enzymes LPL and hepatic lipase and are transformed into cholesterol-rich LDLs. A small propor-
tion of the LDLs end up in the arterial wall, where they are modified by oxidation or aggregation
and are taken up by macrophages. This leads to the formation of macrophage foam cells, the pro-
duction of MPO (myeloperoxidase) and inflammation. Red boxes indicated how inflammation
negatively affects this reverse cholesterol transport

response. These modified LDLs are taken up and cause cholesterol accumulation
within macrophages, which in turn amplifies the signal transduction downstream of
TLRs. Via the increased production of cytokines and chemokines this boosts inflam-
mation. Thus, in a feed-forward mechanism the acute inflammation changes
cellular cholesterol homeostasis, which further amplifies the inflammatory
response.
Chronic infections, such as HIV-1, and autoimmune diseases, such as systemic
lupus erythematosus, rheumatoid arthritis and psoriasis, are often associated with
reduced HDL-cholesterol levels, increased concentrations of atherogenic lipopro-
teins and accelerated atherosclerosis. Similar mechanisms may also contribute to
other metabolic disorders. For example, on adipose tissue macrophages of obese
7.4 Sensing Metabolic Stress via the ER 109

persons TLRs and NLRs are activated by lipids, such as ceramides or SFAs. This
can lead to chronic inflammation, insulin resistance and NAFLD (Sect. 9.2). During
chronic inflammation, stimuli in atherosclerotic lesions, such as intracellular cho-
lesterol crystals that activate the inflammasome (Fig. 7.3), induce the enzyme MPO
that oxidizes APOA1 in HDLs. In this way, the lesions further compromise the
capability of the lipoproteins concerning reverse cholesterol transport. In individu-
als with CHD, the levels of oxidized APOA1 inversely relate to the ABCA1 efflux
capacity and positively correlate with atherosclerotic disease (Sect. 10.2). Therefore,
the inflammatory response of macrophages leads to local inactivation of APOA1 in
the arterial wall and reduces cholesterol efflux from macrophages. In turn, this
causes cholesterol accumulation in macrophages and further enhances the inflam-
matory responses. Moreover, HDL-cholesterol levels decrease and their composi-
tion changes, and through the oxidation of APOA1 they become dysfunctional.
The inflammatory response in macrophages is primarily mediated via TLR3 and
TLR4 and downregulates through the induction of the transcription factor IRF3 the
expression of the LXR target genes ABCA1 and ABCG1 (Sect. 3.4). Although this
reduces cholesterol efflux, promotes cholesterol accumulation and enhances the
inflammatory response, the increased levels of cholesterol result in higher oxysterol
concentrations and respective LXR activation. In this way, increased cholesterol
levels can stimulate their own efflux. Thus, the innate immune system can use
changes in cholesterol metabolism, in order to amplify the inflammatory
response, but also for restoring homeostasis.

7.4 Sensing Metabolic Stress via the ER

Humans have a multitude of mechanisms of cellular adaptation to stress.

Perturbations that induce cell stress include
• infectious agents, which can drive a large set of stress responses by activating
PRRs (Sect. 7.2)
• nutrient deprivation, which activates autophagy in most cells, hence enabling
them to catabolize their own components for survival (Sect. 3.1, Box 3.1)
• hypoxia, respiratory poisons and xenobiotics that cause mitochondrial stress
• DNA-damaging agents, such as ionizing radiation and some xenobiotics, that
activate repair pathways
• heat shock or chemical toxins that cause protein denaturation, both of which
activate the unfolded protein response in the ER.
The ER is an organelle that has a vital role in maintaining cellular and whole
body metabolic homeostasis. It is the primary site of the 3D folding of all membrane
proteins and secreted proteins that are produced in the cell and also performs their
quality control. Although the ER has significant adaptive capacity to manage the
periodic cycles associated with feeding, fasting and other metabolic demands of
110 7 Chronic Inflammation and Metabolic Stress

A Glucose Insulin Amino acids

B
cellular cellular
membrane GLUT2 Insulin receptor membrane

Free CYTOPLASM
cholesterol

AKT TOR
Unfolded protein
Stressed ER
response
GOLGI EIF2AK3
Protein synthesis
ERN1
ATF6

Fatty acids ER
EIF2AK3
CREB3L3
P
Altered metabolic Inflammatory IKBK XBP1 MAPK8
P
response response IRS1
P
IκB AP1

CYTOPLASM NFκB
ATF6f Altered metabolic
response

Inflammatory
ATF6f NFκB XBP1 AP1 response
NUCLEUS

Fig. 7.6 The unfolded protein response. The ER responds to multiple nutrient-associated sig-
nals, such as those induced by fatty acids, glucose, free cholesterol, insulin and amino acids (a).
ER stress due to nutrient overload induces the unfolded protein response, which activates inflam-
matory signaling pathways that result in altered metabolic and inflammatory responses. The three
ER transmembrane proteins EIF2AK3, ERN1 and ATF6 are the molecular mediators of the
unfolded protein response (b). ERN1 activates via the phosphorylation of the kinases IKBK and
MAPK8 the transcription factors NFκB and AP1, which lead to an increase in the expression of
inflammatory genes. This response is further enhanced by translocation of ATF6 to the Golgi and
processing there to an active transcription factor, upregulation of the expression of the transcription
factor XBP1 and the transcription factor CREB3L3. MAPK8 also phosphorylates IRS1 resulting
in an altered metabolic response. A functional and molecular integration between the different
organelles can mediate the spread of the stress

limited duration, it is less flexible to respond appropriately to chronic and escalating

metabolic challenges. Thus, an accumulation of unfolded proteins in the ER
lumen triggers an adaptive, protective mechanism, referred to as unfolded pro-
tein response (Fig. 7.6a). For example, hepatocytes and adipocytes of obese human
show increased ER stress compared with lean controls. Moreover, multiple CVD
risk factors, such as inflammation, dyslipidemia, hyperhomocysteinemia and insu-
lin resistance, can lead to the development of ER stress in atherosclerotic lesions.
On the molecular level, the ER stress response is primarily mediated by the pro-
teins EIF2AK3 (eukaryotic translation initiation factor 2-alpha kinase 3), ERN1
(endoplasmic reticulum to nucleus signaling 1) and ATF6 (activating transcription
factor 6). In the absence of a stress signal, these three transmembrane proteins are
bound by the chaperone HSPA5 and are kept inactive. An increased protein load, in
7.4 Sensing Metabolic Stress via the ER 111

particular improperly folded proteins, activates EIF2AK3 and ERN1, i.e., they dis-
sociate from HSPA5 and initiate signal transduction pathways. EIF2AK3 phosphor-
ylates EIF2A (eukaryotic translation initiation factor 2A) and suppresses general
protein translation. ERN1 interacts with TRAF2 (TNF receptor-associated factor 2)
and activates the kinases IKBK (inhibitor of kappa light polypeptide gene enhancer
in B cells) and MAPK8. This activates the transcription factors NFκB and AP1 and
increases the expression of inflammatory cytokines. In metabolic tissues, such as
WAT and liver, the activation of MAPK8 also leads via serine phosphorylation of
IRS1 to defective insulin actions, such as insulin resistance (Sect. 9.2).
ERN1 has also endoribonuclease activity and cleaves, e.g., the XBP1 mRNA
encoding for the transcription factor X-box binding protein 1, which results in the
translation of an activated form of XBP1 responsible for upregulation of many
chaperone genes. Furthermore, ATF6 translocates from the ER to the Golgi appara-
tus, where it is processed by proteases to an active transcription factor (ATF6f).
Finally, ER stress also leads to the cleavage and activation of the transcription factor
CREB3L3 (cAMP responsive element binding protein 3-like 3), which induces,
particularly in the liver, the production of the acute-phase protein CRP. The goal of
activating the three arms of the unfolded protein response is to restore ER homeo-
stasis by
• reducing general protein synthesis
• facilitating protein degradation
• increasing the protein folding capacity (Fig. 7.6b).
The lipophilic environment of the large ER membrane is provided with impor-
tant functions in the metabolism of lipids, in particular of phospholipids and choles-
terol. For example, cholesterol sensing is initiated at the ER membrane through
SREBF1 (Sect. 3.1). This indicates a direct connection between lipid metabolism
and the unfolded protein response, such as the control of ER phosphatidylcholine
synthesis and ER membrane expansion by XBP1. Moreover, ER stress is linked to
the production of inflammatory mediators, such as the enzyme PTGS2 (prostaglandin-­
endoperoxide synthase 2, also known as COX2) and ROS. This disturbs lipid
metabolism and glucose homeostasis leading to abnormal insulin action, promotes
hyperglycemia through insulin resistance, stimulates hepatic glucose production
and suppresses glucose disposal. When the unfolding protein response cannot
reconstitute proper ER function or when the metabolic stress continues, apoptotic
pathways are initiated, i.e., the affected cells are dying. This happens, e.g., to foam
cells during atherosclerosis. Thus, nutrient and inflammatory responses are inte-
grated in metabolic homeostasis, but dysfunction of the ER affects this integra-
tion and results in chronic metabolic disease (Chap. 10). For example, the
reciprocal regulation between ER stress and insulin signaling pathways leads to a
vicious cycle explaining the interdependence of insulin resistance (Sect. 9.2) and
atherosclerosis (Sect. 10.2).
112 7 Chronic Inflammation and Metabolic Stress

Additional Readings

Franceschi C, Garagnani P, Parini P, Giuliani C, Santoro A (2018) Inflammaging: a new immune-­

metabolic viewpoint for age-related diseases. Nat Rev. Endocrinol 14:576–590
Galluzzi L, Yamazaki T, Kroemer G (2018) Linking cellular stress responses to systemic homeo-
stasis. Nat Rev. Mol Cell Biol 19:731–745
Tall AR, Yvan-Charvet L (2015) Cholesterol, inflammation and innate immunity. Nat Rev.
Immunol 15:104–116
Wang A, Luan HH, Medzhitov R (2019) An evolutionary perspective on immunometabolism.
Science 363
Zmora N, Bashiardes S, Levy M, Elinav E (2017) The role of the immune system in metabolic
health and disease. Cell Metab 25:506–521
Chapter 8
Obesity

Abstract In this chapter, we will define obesity as the consequence of excess WAT
accumulation that increases the risk of non-communicable diseases. We will
describe adipocytes as the central cellular component of adipose tissue and adipo-
genesis as the key process creating fat cells. In response to appropriate signals, such
as low temperature, white adipocytes are able to transform to beige adipocytes dis-
playing a phenotype similar to brown adipocytes. During the development of over-
weight and obesity, adipocytes first grow in size and then in number attracting many
M1-type macrophages. The latter form together with T cells the major stromal-­
vascular fraction of adipose tissue and can lead to chronic inflammation in the tis-
sue. We will show that adipokines have a major impact during hypertrophy and
hyperplasia of WAT and for the communication with the CNS. Studying monogenic
forms of obesity provides strong evidence for a central role of appetite regulation in
obesity susceptibility. The leptin-melanocortin pathway has an integral role in this
satiety signaling. Variations in genes of this pathway as well as numerous others
will be presented as important drivers of common obesity in context of the modern
obesogenic environment.

Keywords Obesity · BMI · Visceral fat · Subcutaneous fat · White, beige and
brown adipocytes · Adipogenesis · Chronic inflammation · Adipokines · Leptin ·
Hindbrain · Hypothalamus · MC4R · FTO

8.1 Definition of Obesity

No other tissue of our body can change its dimension as dramatically as adipose
tissue. This is accomplished first by increasing the size of individual cells up to a
critical threshold (hypertrophy) and then increasing the number by recruiting new
adipocytes from the resident pool of progenitors (hyperplasia). The WHO defines
overweight and obesity as “abnormal or excessive fat accumulation that may impair
health”. Obesity is the consequence of excess WAT growth and develops when
energy intake exceeds energy expenditure. The most commonly used measure of

© Springer Nature Switzerland AG 2020 113

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_8
114 8 Obesity

obesity is the BMI (Sect. 1.4). A person is defined as normal weight if his/her BMI
is 18.5–24.9 kg/m2, overweight if the BMI is 25–29.9 or obese if the BMI >30.
Individuals with adult-onset of obesity mostly exhibit increased adipocyte size,
whereas persons with early-onset obesity show both adipocyte hypertrophy and
hyperplasia. Thus, the number of adipocytes in a given fat depot is determined early
in life and is mostly stable through adulthood. However, differentiated adipocytes
have remarkable hypertrophic potential, since they are able to increase in size to
several hundred μm in diameter. Moreover, the location of WAT in the body plays
an important role for the risk to develop the metabolic syndrome (Chap. 10). High
amount of visceral fat (distributed in the abdominal cavity), referred to as central or
“apple-shaped” obesity, increases the risk, while rise in subcutaneous fat (local-
ized beneath the skin), referred to as peripheral or “pear-shaped” obesity, exerts
far less risk (Fig. 8.1a).
Obesity is rare to occur in the wild life, but there are examples of animals living
in harsh climates, such as polar bears and seals, that are obese. This indicates that a
high degree of natural obesity can even contribute to evolutionary fitness. However,
in humans obesity mostly occurs with low-grade chronic inflammation (Sect. 8.3)
and consecutively is often accompanied by the different features of the metabolic
syndrome (Chap. 10). In fact, most of today’s world population lives in countries
where individuals are more likely to die from the consequences of being obese than
starving (Box 8.1). Of note, human obesity does not always result in disease sug-
gesting that the threshold for tolerable BMI differs among individuals and may be
determined by environmental and genetic variables (Sect. 8.5).

8.2 Adipogenesis

Adipose tissue is not only a passive storage container for nutrients but also an active
endocrine organ that communicates with our body. This communication is mediated
by nutritional mechanisms, neural pathways (Sect. 8.4) and autocrine, paracrine and
endocrine actions of secreted proteins that are collectively referred to as adipokines
(Table 8.1). Since most adipokines act pro-inflammatory and only a few anti-­
inflammatory, their overall expression is increased in the obese state compared to
the lean state. The adipokine secretion profile of adipocytes significantly changes
during the onset of obesity. Pro-inflammatory adipokines are the peptide hor-

Fig. 8.1 (continued) body can also be measured using anthropometric measures, such as waist
circumference or waist-to-hip ratio (WHR). Obese subjects with a low WHR, characterized as
pear-shaped obesity with predominantly increased subcutaneous fat, have a lower risk of T2D and
metabolic syndrome. In contrast, obese subjects with a high WHR, characterized as apple-shaped
obesity with increased visceral fat, have a high risk of for these diseases. WAT is found in all areas
of our body (b). The subcutaneous and the intraabdominal depots are the main fat storage compart-
ments. BAT is abundant at birth and is still present in adults, but to a lesser extent
 A Pear-shaped
LOW WHR
Apple-shaped
HIGH WHR
LESS visceral fat MORE visceral fat
LOWER risk of weight- HIGHER risk of weight-
related health problems related health problems

Above the
waist
Bellow the
waist

Cranial S
B WAT
Retroorbital
Cervical Facial S
Supraclavicular
Bone marrow
Paraventrical Periarticular region
Intramuscular
Pericardial
OmentalI I

BAT Visceral I
Abdominal S
Retroperitoneal I

Gluteal S

Interscapular
S Subcutaneous
I Intraabdominal

Newborn Adult

Fig. 8.1 Fat distribution influences obesity-associated risks. Obesity is defined by a BMI of
≥30 and in general is a consequence of fat accumulation (a). The respective fat distribution in the
116 8 Obesity

Box 8.1: Worldwide Increase of Overweight and Obesity

The prevalence of obesity has increased worldwide in the past 40 years and
reached pandemic levels. Between 1980 and 2013, the proportion of over-
weight or obese adults (BMI >25) increased worldwide from 28.8% to 36.9%
in males and from 29.8% to 38.0% in females. Obesity substantially increases
the risk of many non-communicable diseases, such as T2D, fatty liver disease,
hypertension, myocardial infarction, stroke, dementia, osteoarthritis, obstruc-
tive sleep apnoea and several cancers (Sects. 1.4 and 1.5). Thus, obesity con-
tributes to a decline in both quality of life as well as of life expectancy.
Worldwide prevalence of obesity increased from 1975 to 2016 in children and
adolescents from 0.7% to 5.6% in boys and 0.9% to 7.8% in girls. Within the
same time period, the worldwide prevalence of obesity increased from 3.2%
to 10.8% in adult men and from 6.4% to 14.9% in adult women. The obesity
prevalence in adults varies by country and ranges from 3.7% in Japan to
38.2% in the United States. Since 2006 the dynamics in adult obesity has
slowed down in developed countries, while the prevalence of obesity exceeded
50% in men in Tonga and in women in Kuwait, Kiribati, Micronesia, Libya,
Qatar, Tonga and Samoa. Nevertheless, at all ages prevalence of overweight
and obesity was higher in developed than in developing countries. During
the last three decades no single country showed a significant decrease in obe-
sity implying the danger that over time most countries are on a trajectory to
reach the same high rates as already observed in Tonga or Kuwait.

mones leptin and resistin, the transport proteins RBP4 (retinol binding protein 4)
and lipocalin 2, the growth factors ANGPTL2 (angiopoietin-like protein 2), the
enzyme NAMPT, the cytokines TNF, IL6 and IL18 and the chemokine CXCL5
(C-X-C motif ligand 5). In contrast, only the adipokines adiponectin and SFRP5
(secreted frizzled-related protein 5) act anti-inflammatory. The balance between
pro-inflammatory and anti-inflammatory adipokines is crucial for determining
homeostasis throughout the body based on the nutritional status (Box 8.2).
Thus, adipose tissue influences and communicates via adipokines with many
other organs, such as the brain, heart, liver and skeletal muscle, and vasculariza-
tion, respectively. During adipose tissue expansion adipocyte dysfunction often
occurs, such as a dysregulation of adipokine production, which has both local and
systemic effects on inflammatory responses. This significantly contributes to the
initiation and progression of obesity-induced cardiovascular and metabolic diseases
(Chap. 10).
Storing excess fat in vesicles is an evolutionary adapting process, which already
started in worms, such as C. elegans. Most vertebrate species store fat in a tissue of
a mesodermal origin, named WAT. Also in humans WAT is the large majority of
adipose tissue, i.e., it is the primary site of energy storage. In contrast, minor
amounts of fat are BAT (brown adipose tissue), which is a site of basal and inducible
8.2 Adipogenesis 117

Table 8.1 Sources and functions of key adipokines

Binding partner or
Adipokine Primary source(s) receptor Function
Adiponectin Adipocytes Adiponectin receptors 1 Insulin sensitizer,
and 2, T-cadherin, antiinflammatory
calreticulin-CD91
SFRP5 Adipocytes WNT5A Suppression of pro-­
inflammatory, WNT signaling
Leptin Adipocytes Leptin receptor Appetite control through the
central nervous system
Resistin PBMCs Unknown Promotes insulin resistance
and inflammation through IL6
and TNF secretion from
macrophages
RBP4 Liver, adipocytes, Retinol (vitamin A), Implicated in systemic insulin
macrophages transthyretin resistance
Lipocalin 2 Adipocytes, Unknown Promotes insulin resistance
macrophages and inflammation through TNF
secretion from adipocytes
ANGPTL2 Adipocytes, other Unknown Local and vascular
cells inflammation
TNF Stromal vascular TNF receptor Inflammation, antagonism of
fraction cells, insulin signaling
adipocytes
IL6 Adipocytes, stromal IL6 receptor Changes with source and target
vascular fraction tissue
cells, liver, muscle
IL18 Stromal vascular IL18 receptor IL18 binding protein,
fraction cells broad-spectrum inflammation
CCL2 Adipocytes, stromal CCR2 Monocyte recruitment
vascular fraction cells
CXCL5 Stromal vascular CXCR2 Antagonism of insulin
fraction cells signaling through the
(macrophages) JAK-STAT pathway
NAMPT Adipocytes, Unknown Monocyte chemotactic activity
macrophages, other
cells

Box 8.2: Adipokines

Leptin is the most important hormone produced by adipose tissue, since it
regulates feeding behavior through the CNS (Sect. 8.4). Moreover, leptin has
effects on cells of the immune system and stimulates the production of pro-­
inflammatory cytokines and chemokines in monocytes and macrophages,
such as TNF, IL6 and CXCL5. Furthermore, leptin polarizes T cells towards
a TH1 phenotype. The peptide hormone resistin is also associated with inflam-

(continued)
118 8 Obesity

Box 8.2 (continued)

mation, since it promotes the expression of the pro-inflammatory cytokines
TNF and IL6. Resistin induces insulin resistance via SOCS3, which is an
inhibitor of insulin signaling (Sect. 6.3). Moreover, resistin directly counter-
acts the anti-inflammatory effects of adiponectin on vascular endothelial cells.
The main source of RBP4 is the liver, but also adipocytes and macrophages
can produce the transporter of vitamin A (retinol). In an auto- or paracrine
manner RBP4 inhibits insulin-induced phosphorylation of IRS1, i.e., the adi-
pokine is involved in the regulation of glucose homeostasis in adipocytes.
Lipocalin 2 belongs to the same protein superfamily as RBP4 and transports
various small lipophilic substances, such as retinoids, arachidonic acid and
steroids. The protein is induced by inflammatory stimuli through the activa-
tion of NFκB. High lipocalin 2 concentrations are found in obese individuals.
ANGPTL2 is a growth factor that induces inflammatory responses and acti-
vates integrin signaling in endothelial cells, monocytes and macrophages. It
can induce insulin resistance and its serum levels are associated with obesity,
insulin resistance and CRP concentrations. The enzyme NAMPT (also called
visfatin) is mainly expressed and secreted by adipose tissues. NAMPT is
essential for the biosynthesis of NAD and has an important role in controlling
the insulin secretion of β cells (Sect. 3.6). TNF is a pro-inflammatory cyto-
kine with a prominent role in basically all inflammatory and autoimmune dis-
eases. The cytokine is mainly produced by monocytes and macrophages, but
it can also be secreted by activated adipocytes. TNF promotes insulin resis-
tance in skeletal muscle and adipose tissues by reducing the phosphorylation
of IR and IRS1 (Sect. 6.3). TNF concentrations are increased in adipose tissue
and plasma of obese individuals. IL6 is also a pro-inflammatory cytokine that
is involved in obesity-related insulin resistance. Adipose tissue is a major
source of the cytokine, since more than 30% of all circulating IL6 is produced
there. Another pro-inflammatory cytokine produced by adipose tissues is
IL18. Atherosclerotic lesions show high IL18 levels and indicate plaque
instability. The chemokine CXCL5 is secreted by macrophages within the
stromal vascular fraction of adipose tissue and is associated with inflamma-
tion and insulin resistance. CXCL5 interferes with insulin signaling in mus-
cles by activating the JAK (Janus kinase)-STAT (signal transducer and
activator of transcription) pathway through its receptor CXCR2 (CXC-­
chemokine receptor 2). The peptide hormone adiponectin is exclusively syn-
thesized by adipocytes and is found at high levels in serum. Adiponectin is
expressed at the highest levels in functional adipocytes of lean persons, while
its expression is downregulated in dysfunctional adipocytes of obese individ-
uals. The beneficial effects of adiponectin on insulin sensitivity are mediated
via increased Ca2+ levels in skeletal muscle that activate CAMKK2, AMPK
and SIRT1 and result in the upregulation of PPARGC1A expression (Sect.

(continued)
8.2 Adipogenesis 119

Box 8.2 (continued)

6.6). The main function of the anti-inflammatory adipokine SFRP5 is to pre-
vent the binding of WNT (wingless-type MMTV integration site family mem-
ber) proteins to their respective receptors. The WNT signaling pathway has a
number of important downstream targets, such as MAPK8, leading to pro-­
inflammatory cytokine production in macrophages.

energy expenditure (Fig. 8.1b). WAT is found throughout our body, such as around
the omentum, intestines and perirenal areas, as well as subcutaneously in the but-
tocks, thighs and abdomen. Moreover, WAT arises also on the face and extremities
and within the bone marrow. In newborns, BAT occurs in the neck, kidneys and
adrenal regions, while in adults it locates in the neck as well as in supraclavicular
and paravertebral regions.
WAT buffers nutrient availability and demand by storing excess calories and pre-
venting toxic lipid levels in non-adipose tissues. This is an essential function for
survival, because it allows intervals of fasting between meals and intervals of pro-
longed fasting. BAT maintains core body temperature in response to cold stress by
generating heat, i.e., it is primarily used for non-shivering thermogenesis. White
adipocytes have one large lipid droplet filling 90% of the cell, while brown adipo-
cytes carry many single lipid compartments and a far larger number of mitochondria
than WAT. These mitochondria are enriched with the long-chain fatty acid/H+ sym-
porter UCP1, which causes a proton leak across the inner mitochondrial membrane,
i.e., it uncouples fuel oxidation from ATP synthesis. When white adipocytes express
high amounts of UCP1, they turn into “beige” adipocytes (Fig. 8.2), a process
referred to as “browning”. In reverse, these cells can again increase lipid storage and
then morphologically resemble classic white adipocytes, referred to as “whitening”.
This tissue conversion is an adaptive process, i.e., it depends on environmental
challenges, such as low temperatures for browning or a high-fat diet for
whitening.
Mesenchymal stem cells are the precursors to fat, bone and muscle cells. Growth
factors, such as BMPs (bone morphogenetic proteins) and FGFs, are central in the
first phase of adipogenesis. In this commitment phase, the multipotent mesenchy-
mal stem cells differentiate to WAT and BAT precursors. Both brown adipocytes
and myocytes derive from paraxial mesoderm-derived progenitor cells that express
the transcription factors MYF5 (myogenic factor 5) and PAX7 (paired box 7)
(Fig. 8.2). However, in adults brown adipocytes can also develop from skeletal mus-
cle satellite cells. White adipocytes derive from both MYF5− and MYF5+ progeni-
tors. In the second phase of adipogenesis, the differentiation phase, transcription
factors, such as the nuclear receptor PPARγ (Sect. 3.3) and the pioneer factors
CEBPA, CEBPB and CEBPD, are both necessary and sufficient for adipogenesis.
Moreover, co-factors of these transcription factors, such as PPARGC1A (Sect. 6.2),
120 8 Obesity

Adipocyte
Mesenchymal
precursor
precursor
(lineage origins)
MYF5– MYF5+

Adult origins

WAT adipocyte Endothelial BAT adipocyte Muscle

precursor precursor precursor satellite cell

Mature
adipocytes

White Beige Brown

UCP1 – UCP1+ UCP1+
WAT BAT

Fig. 8.2 Origins of white, beige and brown adipocytes. BAT contains UCP1 expressing brown
adipocytes (UCP1+), whereas WAT is formed by UCP1− white adipocytes and UCP1+ beige adipo-
cytes. In adults, the expansion of adipose tissue is mainly achieved through the growth and differ-
entiation of preadipocytes (i.e., adipocyte precursors). The precursors of WAT and BAT adipocytes
origin from mesenchymal cells: for WAT they derive from both MYF5+ and MYF5− lineages,
whereas for BAT they come exclusively from the MYF5+ lineage. Beige adipocytes are obtained
from WAT adipocyte precursors or directly from mature white adipocytes. In contrast, brown adi-
pocytes can derive from stem cell-like skeletal muscle satellite cells. In addition, brown and white
adipocytes are generated from endothelial precursors

support adipogenesis. Furthermore, chromatin modifiers, such as the lysine methyl-

transferase EHMT1 or the deacetylase SIRT1 (Sect. 6.6), control in adipocytes the
access of chromatin for transcription factors and their co-factors, i.e., adipogenesis
involves epigenome-wide changes.
White, beige and brown adipocytes can undergo adaptive and dynamic changes
in response to starvation or overfeeding as well as in response to cold environment
via energy-sensing pathways. One central and illustrative example is the transfor-
mation of white adipocytes into beige adipocytes at cold temperature exposure
(Fig. 8.3). Some of the signals that regulate this tissue conversion are synthesized
locally within the adipose tissue, i.e., they act paracrine. However, other essential
factors are of endocrine nature, as they are produced by metabolic organs, such as
brain, muscle, heart and liver. In response to exposure to cold temperature, catechol-
amines, such as adrenaline, are released by the SNS (sympathetic nervous system).
Interestingly, in response to cold stress catecholamines are also secreted by M2-type
8.2 Adipogenesis 121

Cold
Functional activity
energy uptake
energy processing
? energy expenditure
Obesity Sympathetic
nervous system

? Transcriptional activity
M1 Macrophage M2

Catecholamines
Energy-sensing pathways
FGF21, BMP4, BMP7, PKA, MAPK, AMPK
prostaglandins, T4

White FGF21, ANP, BNP, FGF21, Beige

adipocytes Bile acids? Irisin? Irisin? adipocytes

LIVER HEART
EA SKELETAL MUSCLE

Fig. 8.3 Hormonal control of WAT browning. Metabolic adaptions to environmental factors are
regulated by the release of endocrine and paracrine factors from metabolic tissues. In response to
(thermal) cold, catecholamines are released by the SNS and from M2-type macrophages in adipose
tissue. This activates energy-sensing pathways in white adipocytes and stimulates their transforma-
tion to beige adipocytes. This beige phenotype is generated through the actions of transcription
factors that induce activities characteristic of their phenotype, such as increase energy uptake,
energy processing and energy expenditure

macrophages in adipose tissue. This is counteracted by M1-type macrophages that

are present in hypertrophic adipose tissue of obese individuals (Sect. 8.3).
Catecholamine-activated β3-adrenergic receptors, PTGS2-generated prostaglan-
dins and growth factors are the key molecules that promote browning of white adi-
pocytes (Fig. 8.3). BMP4 and BMP7 directly regulate thermogenesis in mature
brown adipocytes by increasing their responsiveness to catecholamines and upregu-
lating intercellular lipase activity via the PKA-MAPK signal transduction pathway.
The transformation of white into beige adipocytes is further supported by the growth
factors FGF21 and BDNF (brain-derived neurotrophic factor) as well as the peptide
hormone irisin, which is primarily produced by skeletal muscle in response to exer-
cise. Interestingly, the amount of BAT in our body correlates with the month when
122 8 Obesity

we were conceived. Individuals conceived in cold months have significant differ-

ences in BAT characteristics and metabolic phenotypes than those, who were con-
ceived in warm months or environment. An analogous mouse experiment confirmed
the observation in rodents and demonstrated that only the cold exposure of the
fathers before conception affected the amount of brown adipose tissue in the
offspring.

8.3 Inflammation in Adipose Tissue

Adipose tissue is a metabolic organ that is formed by parenchymal cells and stromal
cells. In WAT, lipid-laden adipocytes represent only 20–40% of the cell number but
more than 90% of its volume. Every gram of adipose tissue contains 1–two million
adipocytes but 4–six million stromal-vascular cells, of which more than half are
immune cells, such as macrophages and T cells. In the healthy state (Fig. 8.4,
stage 1), these cell types work together, in order to maintain metabolic homeostasis.
Also in disease these tissues try to interact, in order to adapt to altered conditions,
such as increased nutritional needs of the affected organs.
Adipose tissue can be classified into at least three structural and functional
groups. Lean individuals with normal metabolic function store excess nutrients as
triacylglycerols in WAT. The WAT in these lean subjects contains M2-type macro-
phages and TH2 cells that respond to nutrient-derived signals by promoting lipid
storage and suppressing lipolysis (Fig. 8.4, stage 1). When obesity develops as the
result of chronic overnutrition, the storage capacity is exceeded causing cellular
dysfunction, such as lipid dysregulation, mitochondrial dysfunction, oxidative
stress and ER stress (Sect. 7.4), leading to reduced metabolic control. This causes
adipocytes to secrete chemokines, such as CCL2, that attract monocytes into the
adipose tissue that become M1-type macrophages (Fig. 8.4, stage 2). Adipocytes
increase in size until they reach a structurally critical condition, in which the vascu-
larization of the tissue is reduced, so that adipocytes experience hypoxic conditions.
When these alterations escalate, they lead to adipocyte death. In order to remove
remnants of dead adipocytes, additional macrophages infiltrate the WAT. They sur-
round the dead cells and create crown-like structures that are associated with
increased inflammation (Fig. 8.4, stage 3).
Stromal cells, such as macrophages, support adipocytes in WAT in their main
metabolic function, the long-term storage of lipids. The number and activation state
of macrophage both reflect the metabolic health of WAT. In lean persons, only
10–15% of the stromal cells are macrophages and most of them are of M2-type.
These M2-type macrophages secrete IL10 that potentiates insulin action in adipo-
cytes, i.e., it maintains or even increases the insulin sensitivity of these cells. During
the development of obesity, WAT recruits monocytes that differentiate into M1-type
macrophages and finally can comprise up to 60% of all stromal cells in the tissue.
These M1-type macrophages are a major driver of insulin resistance in WAT, but
8.3 Inflammation in Adipose Tissue 123

STAGE 1 STAGE 2 STAGE3

Lean with normal Obese with mild Obese with full
metabolic fuction metabolic dysfuction metabolic dysfuction
Inflammation Inflammation Inflammation
Metabolic control Metabolic control Metabolic control
Vascular function Vascular function Vascular function

CD4+ T cell CD8+ T cell

Necrotic
M2 macrophage adipocyte

White adipocytes M1 macrophages

Crown-like
Blood vessels structure

Antiinflammatory adipokines Proinflammatory adipokines

• Adiponectin • Leptin • ANGPTL2 • CXCL5
• SFRP5 • Resistin • TNF • NAMPT
• RBP4 • IL6, IL18 • Lipocalin 2

Fig. 8.4 Functional classification of adipose tissue. Adipose tissue can be distinguished into at
least three stages. In normal-weight tissue with normal metabolic function (stage 1) adipocytes are
associated with a rather low number of M2-type macrophages. This tissue produces preferentially
anti-inflammatory cytokines, such as adiponectin and SFRP5 (Sect. 8.2). During onset of obesity,
adipocytes increase their triglyceride storage, i.e., they become hypertrophic. At limited obesity
(stage 2) adipocytes still retain relatively normal metabolic function and display low levels of
immune cell activation and sufficient vascular function. However, in obesity with full metabolic
dysfunction (stage 3) the tissue has recruited a large number of M1-type macrophages and pro-
duces preferentially pro-inflammatory adipokines, such as leptin, resistin, RBP4, lipocalin,
ANGPTL2, NAMPT, TNF, IL6, IL18 and CXCL5

they are also involved in the remodeling of the enlarging adipocytes. Thus, the two
types of macrophages coordinate homeostatic adaptations of adipocytes in the
lean and the obese state.
T cells in adipose tissue also play a role in obesity-induced inflammation. TH1
cells produce pro-inflammatory cytokines, such as IFNγ, while TH2 cells and TREG
cells secrete anti-inflammatory cytokines, such as IL10, inducing differentiation of
macrophages into M2 type. In lean individuals, TH2 and TREG cells dominate in
WAT, while in obese persons there are far more TH1 cells. Compared to subcutane-
ous fat, visceral fat accumulates a larger number of macrophages and secretes
greater amounts of pro-inflammatory cytokines. In addition, adipocytes in visceral
fat are more fragile and reach earlier a critical size triggering cell death than subcu-
taneous adipocytes. This explains, at least in part, the different health risk between
the apple and pear shapes of fat depots (Sect. 8.1).
The long-term exposure of adipocytes with pro-inflammatory cytokines pro-
duced by M1-type macrophages can induce insulin resistance of WAT (Sect. 9.2).
124 8 Obesity

Like in acute microbe infection, this reduced insulin sensitivity initially tries to
react to the increased levels of nutrients by limiting their storage. However, the
strategy of inducing insulin resistance becomes maladaptive in case of a constant,
long-term nutrient overload. Thus, the hallmarks of obesity-induced inflammation,
also referred to as “metaflammation”, are that it
• is a nutrient-induced inflammatory response orchestrated by WAT-associated
macrophages
• changes the polarization of these macrophages from M2 to M1 phenotype
• represents a moderate/low-grade and local expression of inflammatory cytokines
is chronic without apparent resolution.
In other metabolic organs, polarized macrophages play a comparable role. In the
BAT, resident macrophages differentiate into M2-type after exposure to cold tem-
peratures. These M2-type macrophages induce thermogenic genes in BAT and
lipolysis of stored triacylglycerols in WAT via the secretion of the catecholamine
noradrenaline. Kupffer cells, the resident macrophages of liver, enable the meta-
bolic adaptations of hepatocytes during increased caloric intake. The M2 phenotype
of Kupffer cells is induced via PPARδ and the TH2-type cytokines IL4 and IL13.
Under the condition of obesity M2-type macrophages regulate fatty acid β-oxidation
in the liver and support in this way hepatic lipid homeostasis. Similar to WAT, in the
pancreas high-fat diet induces the infiltration of M1-type macrophages. The
increased intake of dietary lipids results in β cell dysfunction, which induces the
expression of chemokines recruiting inflammatory macrophages to the islets. The
secretion of IL1B and TNF by the infiltrating macrophages further augments β cell
dysfunction (Sect. 9.5).

8.4  nergy Homeostasis and Hormonal Regulation of Food

E
Uptake

Energy homeostasis in adults is achieved by a combination of processes that man-

age energy intake, energy storage in form of glycogen in liver, kidney and skeletal
muscles and triacylglycerols in WAT and energy usage, in order to maintain a stable
body weight. Thus, food intake is an integrated response over a prolonged period of
time that maintains the levels of energy stored in adipocytes. However, as the result
of a daily tiny but cumulative positive energy balance, overweight and obesity
can develop in the course of many years. This misbalanced energy homeostasis is
multifactorial and complex (Fig. 8.5). Food consumption has changed radically the
last generation(s), leading to dramatic changes in our macronutrient intake (Sect.
1.1). This is based on reduced physical activity, computer-based work dominating
most occupations, leisure time entertainment becoming dependent on information
technology, reduction in home cooking, greater reliance on convenience food, a
growing habit of snack consumption and promotion of large portions. Thus, today’s
obesogenic environment is the most likely cause of the obesity epidemic
(Sect. 8.1).
8.4 Energy Homeostasis and Hormonal Regulation of Food Uptake 125

Largely intrinsic variables:

Variation in Energy
Largely intrinsic variables: Basal metabolic rate, energetic
food intake expediture efficiency of physical activity,
Satiety vs. hunger
diet induced thermogenesis
Largely extrinsic variables:
Food - availability, advertising Complex variables:
palatability, portion size, cost Amount of physical activity

Complex variables:
Mood, hedonic effect of food,
relative rating or alternative,
Extrinsic influenses: Intrinsic influences:
pleasurable activities
Environmental “the drive to move”
determinants
How much energy is stored? of the need and
How much stored as fat vs. lean? opportunity
for physical activity
in work, domestic
and leasure time

Variation in nutrient Unknown:

Likely to be intrinsic
partitioning

Fig. 8.5 Variables of energy homeostasis. Energy homeostasis is regulated by a complex inter-
action between the variation in food intake, the tendency to store excess energy as fat or lean mass,
referred to as nutrient partitioning, and the variation in energy expenditure. The intrinsic variables
that have an impact on energy homeostasis causing obesity are influenced by food intake through
effects on satiety and hunger

The feelings of hunger and satiety are the main involuntary motivations for
feeding-related behavior of humans and animals. The coordinated secretion of
numerous hormones from the CNS prepares the digestive system for the anticipated
caloric load. Ideally, satiation hormones (being secreted in response to ingested
nutrients) control the amount of food intake. In turn, obesity hormones (indicating
the fat content of the body) modify these signals. However, many non-homeostatic
factors, such as stress, cultural habits and social influences interact with these hor-
monal controllers of food intake. In theory, establishing a negative energy balance,
i.e., eating less calories than daily consumed by the basal metabolic rate and
­additional physical activity, would be an easy solution in reducing the problem of
overweight and preventing the development of obesity. However, hormonal and
neuronal control circuits have been trained by evolutionary adaption to make
hunger the first ranking desire of nearly all humans, which strongly counter-
acts to most attempts losing body weight. In addition, changes in environmental
exposures early in life, before, during or after pregnancy, i.e., nutrition-triggered
epigenetic programming (Sect. 5.4), cause a sustained long-term effect on the pre-
disposition to develop overweight and obesity. In general, genetic variants that
cause severe familial obesity largely influence food intake through effects on hunger
and satiety (Sect. 8.5). Accordingly, variations associated with obesity are pre-
dominantly in genes expressed in the brain.
126 8 Obesity

Energy homeostasis is largely based on the coordinated activity of multiple pep-

tide hormones. Prior an anticipated meal, the gastrointestinal tract is prepared for
the digestion of nutrients and for avoiding extreme metabolic consequences of the
pending caloric load. For example, individuals who habitually eat at the same time
each day begin these CNS-initiated hormone secretions, such as insulin, before food
serving. This is important for the efficient disposal of absorbed glucose (Sect. 9.1).
Moreover, CNS signals also stimulate secretion of the peptide hormone ghrelin
from the stomach approximately 30 min before the meal and the incretine GLP1
(glucagon-like peptide 1) from the intestine rises even 1 h earlier. When food is
consumed, numerous hormones and enzymes are secreted, in order to allow nutrient
digestion and absorption. Most of the hormones related to digestion, such as
CCK (cholecystokinin), are satiety signals. GLP1, glucagon, APOA4 and peptide
YY are further gastrointestinal peptides that influence the hindbrain to reduce the
meal size. The half-life of these peptides is short and the function of most of them
is redundant, i.e., they can compensate each other. Satiation signals converge in the
NTS (nucleus tractor solitarius) and the adjacent area postrema of the hindbrain
(Fig. 8.6).
The peptide hormones insulin and leptin are obesity signals, i.e., their secre-
tion is proportional to the amount of body fat. Together with ghrelin, they enter the
brain through the blood-brain barrier via receptor-mediated active transport and act
directly on the ARC (arcuate nucleus) of the hypothalamus (Fig. 8.6). This area of
the brain also receives information from the hindbrain on the progress of meals and
from limbic centers reflecting non-homeostatic influences. In addition, the peptide
hormone amylin that is secreted like insulin from β cells of the pancreas, as well as
cytokines derived from adipose tissue, such as IL6 and TNF, all act on the brain, in
order to increase energy expenditure.
The ARC contains two populations of neurons that either express NPY (neuro-
peptide Y) and AGRP or POMC (proopiomelanocortin) (Fig. 8.6). POMC is a pro-­
hormone that is cleaved to produce α-MSH (α-melanocyte-stimulating hormone)
being a ligand of MC4R (melanocortin 4 receptor). In contrast, insulin and leptin
activate POMC neurons that release α-MSH counteracting AGRP and stimulating
MC4R neurons. This results in reduced food intake and decreased body weight in
the long-term inhibition of food intake. Ghrelin stimulates NPY-AGRP neurons that
secrete AGRP acting as an antagonist of MC4R neurons. This leads to increased
food intake and induction of weight gain. These areas of the forebrain also receive
information from the hindbrain concerning the progress of the meal and information
from non-homeostatic factors. Reduced leptin and insulin signaling in the ARC
results in increased food intake and eventually weight gain. In contrast, the cytokine
TNF, derived from macrophages within adipose tissue, reduces food intake. Insulin
and leptin can also regulate ongoing food intake by directly adjusting the sensitivity
to incoming satiation signals in the NTS of the hindbrain. For example, when an
individual loses weight, the secretion of insulin and leptin decreases and the reduced
obesity signal in the brain results in reduced sensitivity to the satiating action of
CCK and GLP1. This leads to an increase in meal size until lost weight is regained
and the levels of obesity signals are restored. The opposite can be observed when
8.5 Genetics of Obesity 127

Area
TNF post-
Hindbrain rema
Macrophage +
Amylin

ARC +
POMC
NPY- + neurons + Insulin
Hypo-
AGRP thalamus
neurons – α-MSH Pancreas
– + AGRP + + NTS +
Leptin – MC4R + Food
neurons
– intake
Ghrelin

CCK Vagus
Adipocytes APOA4 nerve

Gastroinstestinal
tract

Fig. 8.6 Hormonal signals from the periphery influence multiple brain areas. Insulin and
amylin from the pancreas stimulate POMC neurons in the ARC of the hypothalamus and in the
area postrema of the hindbrain, respectively. Ghrelin stimulates NPY-AGRP neurons in the ARC,
while leptin from adipocytes inhibits these cells. However, leptin and TNF stimulate POMC neu-
rons. Gastrointestinal peptides, such as CCK and APOA4, either stimulate the NTS directly or
stimulate vagal afferent nerves whose axons end in the NTS. Most of these peptide hormones enter
the brain via active transport

people overeat and gain weight. Thus, the homeostatic control of food intake is
integrated within the brain by an intermingled network of hypothalamic and
brainstem structures.

8.5 Genetics of Obesity

Some rare forms of severe obesity result from mutations in an individual gene or
chromosomal region, i.e., they represent monogenic obesity (Table 8.2). The impor-
tance of the leptin-melanocortin pathway in hyperphagia (i.e., increased appetite)
128 8 Obesity

Table 8.2 Monogenic cases of obesity

Genomic
Gene position Mode of inheritance Associated phenotype
POMC 2p23.3 Autosomal recessive Severe pediatric-onset obesity
Hyperphagia
Red hair pigmentation
Pale skin
LEP 7q32.1 Autosomal recessive Severe early-onset obesity
Extreme hyperphagia
Hyperinsulinemia
Hypothalamic hypothyroidism
Hypogonadotropic hypogonadism
LEPR 1p31.3 Autosomal recessive Severe obesity with hyperphagia
Delayed or absent puberty
Reduced IGF1 levels
Growth abnormalities
PCSK1 5q15 Autosomal recessive Severe childhood obesity
Abnormal glucose homeostasis
Reduced plasma insulin with elevated
proinsulin levels
Hypogonadotropic hypogonadism
Hypocortisolemia
MC4R 18q21.32 Autosomal dominant/ Severe early-onset obesity
recessive Hyperphagia
Highly elevated plasma insulin
concentrations
Increased bone mineral density
SIM1 6q16.3 Autosomal dominant Early-onset obesity
Hypotonia
Developmental delay
Short extremities

and obesity susceptibility is indicated by the fact that so far primarily mutations in
the genes LEP (leptin), LEPR, POMC, PCSK1 (proprotein convertase subtilisin/
kexin type 1), MC4R and SIM1 (single-minded family bHLH transcription factor 1)
were found as causes of monogenetic obesity. PCSK1 encodes for an enzyme
responsible for post-translational processing of POMC, while SIM1 encodes for a
transcription factor that is both an upstream and downstream target of
MC4R. Accordingly, MC4R mutations are responsible for up to 6% of child-
hood obesity and 2% of adult obesity cases. Importantly, the very rare obesity
phenotype of patients with homozygous LEP mutations can be reversed by admin-
istration of leptin.
The rapid increase in the number of obese people (Sect. 8.1) can be explained by
radical changes in lifestyle, such as high intake of energy-dense food and physical
inactivity (Sect. 8.3). However, some subjects are more susceptible to these lifestyle
Additional Readings 129

changes than others, suggesting a relevant genetic component. Polygenic common

obesity results from the combined effect of multiple genetic variants in concert with
environmental risk factors. Linkage analysis, candidate gene approaches and in par-
ticular GWAS (Sect. 2.4) in various populations have indicated dozens of genes to
be associated with the traits BMI and obesity. Widely replicated candidate genes are
MC4R, BDNF, PCSK1, ADRB3 (adrenoceptor beta 3) and PPARG. The most prom-
inent result from GWAS analysis was the identification of a strong association of the
chromosomal region of the FTO gene with BMI and obesity. However, not the FTO
gene but its neighboring genes IRX3 and IRX5 encoding for transcription factors
functionally explain the prominent effect on obesity risk (Box 4.1) Although the
effect size of the genetic variations at the FTO locus is not comparable to that of
monogenic forms, it represents the most established association with common obe-
sity, primarily due to its high frequency (47%) in the European population.
GWAS meta-analysis of nearly 340,000 individuals identified 97 genomic loci
associated with BMI, confirming the central role of the CNS, in particular of genes
expressed in the hypothalamus, in the regulation of body mass. Thus, obesity can
be considered as a neurobehavioral disorder with high susceptibility to an obe-
sogenic environment. However, the known risk genes in total account only for
2.7% of the variation of the trait. This observation questions, whether genetic varia-
tions are the key cause of obesity. Thus, a substantial portion of the predicted heri-
tability of obesity and interindividual variability in BMI remains unexplained. This
implies that the understanding of obesity needs to be extended by epigenetic and
social-behavioral components.

Additional Readings

Afshin A, Sur PJ, Fay KA, Cornaby L, Ferrara G, Salama JS, Mullany EC, Abate KH, Abbafati C,
Abebe Z et al (2019) Health effects of dietary risks in 195 countries, 1990–2017: a systematic
analysis for the Global Burden of Disease Study 2017. Lancet 393:1958–1972
Blüher M (2019) Obesity: global epidemiology and pathogenesis. Nat Rev Endocrinol 15:288–298
Challet E (2019) The circadian regulation of food intake. Nat Rev Endocrinol 15:393–405
Fetissov SO (2017) Role of the gut microbiota in host appetite control: bacterial growth to animal
feeding behaviour. Nat Rev Endocrinol 13:11–25
Ghaben AL, Scherer PE (2019) Adipogenesis and metabolic health. Nat Rev Mol Cell Biol
20:242–258
Ng M, Fleming T, Robinson M, Thomson B, Graetz N, Margono C, Mullany EC, Biryukov S,
Abbafati C, Abera SF et al (2014) Global, regional, and national prevalence of overweight and
obesity in children and adults during 1980–2013: a systematic analysis for the Global Burden
of Disease Study 2013. Lancet 384:766–781
Chapter 9
Insulin Resistance and Diabetes

Abstract In this chapter, we will describe the molecular principles of glucose

homeostasis and insulin signaling as well as their dysregulation leading to insulin
resistance and β cell failure. Since our blood glucose levels need to stay within a
physiological range of 4–6 mM, glucose intake, storage, mobilization and break-
down are tightly regulated. Insulin plays a key role in these regulatory processes.
When normal concentrations of insulin cause an insufficient response of the major
insulin target tissues, such as skeletal muscle, liver and adipose tissue, insulin resis-
tance has developed. Ectopic overload of lipids, chronic inflammatory response and
ER stress are the main processes that can lead to insulin resistance. Moreover, glu-
cotoxic and lipotoxic stress to β cells of the pancreas are mediated via inflammatory
response, oxidative stress and ER stress eventually resulting in the failure of the
cells, i.e., in the inability to produce insulin. We will describe diabetes as a disease
of dysregulation of glucose and lipid homeostasis that does not only affect the insu-
lin production in pancreatic β cells but also the metabolism in organs, such as liver,
muscle and fat. Worldwide, the prevalence of T2D is rapidly increasing, which,
when not properly treated, ultimately leads to reduced life expectancy due to micro-
vascular (retinopathy, nephropathy and neuropathy) and macrovascular (heart dis-
ease and stroke) complications. Both genetic and environmental factors contribute
to the development of the disease. We will realize that despite large GWAS screen-
ing for risk genes less than 10% of the inheritance of T2D is understood. Therefore,
epigenome-wide changes, both prenatal as well as in adult life, play an important
role in the disease.

Keywords Glucose homeostasis · Insulin resistance · Chronic inflammation ·

Ectopic lipid deposition · Glucotoxicity · Lipotoxicity · ER stress · Oxidative stress
· Unfolded protein response · β cell failure · T1D · T2D · OGTT · Insulin · β cells ·
Liver · Skeletal muscle · Adipose tissue · Inflammation · MODY · GWAS ·
Epigenetic programming

© Springer Nature Switzerland AG 2020 131

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_9
132 9 Insulin Resistance and Diabetes

9.1 Glucose Homeostasis

Glucose homeostasis results both from the hormonal and neural control of glucose
production and use, which even at physiological challenges, such as food ingestion,
fasting and intense physical activity, maintains the blood glucose level within a
range of 4–6 mM. This constant level is essential for providing energy to tissues,
most importantly for an uninterrupted glucose supply to the brain and red blood
cells, which almost exclusively use glucose as an energy source. Hypoglycemia,
i.e., a blood glucose level below 4 mM, can lead in the brain to a number of neuro-
glycopenic effects. In contrast, a constant concentration above 10 mM, i.e., chronic
hyperglycemia, causes glucotoxicity in blood vessels leading to a number of
complications in the cardiovascular system, the kidneys, the eyes and nerves
(Box 9.1).

Box 9.1: Complications of Chronic Hyperglycemia

People with diabetes (both T1D and T2D) are at risk of developing a number
of troubling, disabling and life-threatening health problems. Chronically high
blood glucose levels, i.e., glucotoxicity, can lead to serious diseases affecting
the blood vessels of brain, heart, eyes, kidneys and peripheral nerves. In
almost all high-income countries, diabetes is a leading cause of CVD, blind-
ness, kidney failure and lower-limb amputations.
CVDs: This is the most common cause of disability and death among people
with diabetes. CVDs that accompany diabetes include cerebral stroke,
myocardial ischemia, congestive heart failure and peripheral artery disease
(Chap. 10).
Kidney insufficiency: Nephropathy finally resulting in kidney failure is caused
by damage to small blood vessels, through which the kidneys function less
efficiently or even fail. Diabetes is one of the leading causes of chronic
kidney disease.
Eye disease: In retinopathy the network of blood vessels, which supply the
retina becomes blocked and damaged. In addition, pathological neovascu-
larization leads to increasingly loss of vision, finally to complete
blindness.
Nerve damage: In neuropathy nerves throughout the body are damaged,
which can lead to problems with digestion and micturition (a reflex pro-
ducing a series of contractions of the urinary bladder), erectile dysfunction
and a number of other dysfunctions. The most commonly affected areas
are the extremities, particularly the lower legs and feet (peripheral neu-
ropathy) leading to pain, paresthesia (abnormal dermal sensation) and loss
of feeling. The latter is particularly dangerous because even small injuries
will be unnoticed, leading to ulcerations, superinfections and finally to
major amputations (diabetic foot syndrome).
9.1 Glucose Homeostasis 133

The principal regulators of glucose homeostasis are the peptide hormones

glucagon and insulin that are secreted by α and β cells, respectively, of the endo-
crine pancreas (forming Langerhans islets). Glucagon is secreted when blood glu-
cose concentration is low, such as between meals and during exercise. Glucagon has
the greatest effect on the liver, where it stimulates the release of glucose that was
stored in form of glycogen into the blood and the production of glucose via the
gluconeogenesis pathway.
In contrast, rising blood glucose levels directly after food ingestion stimulates
insulin secretion. The glucose transporter GLUT2 in the plasma membrane of β
cells and the hexokinase GCK in the cytoplasma both sense glucose (Sect. 3.1) and
initiate glucose import and its metabolism via glycolysis (Fig. 9.1). The increasing
ATP-ADP ratio stimulates the closing of ATP-sensitive K+ (KATP) channels, plasma
membrane depolarization, activation of voltage-gated Ca2+ channels and Ca2+-
mediated stimulation of exocytosis of insulin granules. This KATP channel-­dependent
mechanism is a triggering signal that is particularly important for the acute phase of
insulin release, i.e., during the first 10 min after glucose rise. In the second phase of
insulin secretion, the mitochondrial glucose metabolism generates signals addi-
tional to the ATP-ADP ratio, which are important for gaining insight into the func-
tional failure of β cells during T2D. Pyruvate, the final product of glycolysis, flows
into mitochondria through an anaplerotic (i.e., “refilling”) process via the enzyme
PC (pyruvate carboxylase) and an oxidative pathway via the PDH (pyruvate dehy-
drogenase) complex (Fig. 9.1). The conversion of pyruvate to oxaloacetate via PC
and the following metabolism of oxaloacetate to malate, citrate or isocitrate in the
TCA cycle provides several possibilities for the reconversion of these metabolites
into pyruvate via cytosolic and mitochondrial pathways. These metabolic path-
ways are important for the regulation of glucose-stimulated insulin secretion.
One of these pathways is the export of citrate from the mitochondria through the
citrate-isocitrate carrier SLC25A1 and the subsequent conversion of isocitrate to
α-ketoglutarate by the cytosolic NADP-dependent IDH (isocitrate dehydrogenase)
complex. The metabolic byproducts of this pyruvate-isocitrate cycling may also act
as amplifying signals for the control of glucose-stimulated insulin secretion.
After food ingestion, carbohydrates are digested in the gastrointestinal tract and
glucose is absorbed into the circulation primarily via the hepatic portal vein. The
liver has a central role in monitoring and regulating post-prandial (i.e., after a meal)
glucose levels (Fig. 9.2, left). Insulin promotes hepatic synthesis of triacylglycerol
and their storage in WAT upon feeding. Moreover, insulin also suppresses the
release of stored lipids from adipose tissue. Ingested nutrients in intestinal endo-
crine cells stimulate the release of incretins, such as GLP1, that together with the
rise in blood glucose stimulate β cells to deliver insulin. The first phase of insulin
secretion primarily prevents the liver from producing more glucose by stimu-
lating glycogen synthesis and suppressing gluconeogenesis. The second phase,
approximately 1–2 h after the meal, stimulates glucose uptake by insulin-­
sensitive tissues, such as skeletal muscle and adipose tissue.
During fasting (Fig. 9.2, right), hepatic glycogenolysis decreases as hepatic gly-
cogen stores deplete. Low insulin levels combined with elevated counter-regulatory
134 9 Insulin Resistance and Diabetes

Membrane
depolarization Insulin granule
Activation
exocytosis

K+ Voltage-2+
Ca
gated Ca2+
Extracellular space channel

KATP channel GLUT2

Cytoplasm
Inhibition
Ca2+
Glucose
ATP
ATP:ADP ratio
GSK Insulin granules
Glycolysis
NADH, FADH, electron
transport chain

Pyruvate Dicarboxylate Pyruvate

Amplifying signals
PDH or malate (NADPH, GTP,
carrier α-Ketoglutarate)
PC
Acetyl-CoA
Malate

Oxaloacetate
Oxaloacetate

Malate Citrate Citrate

Fumarate Isocitrate Isocitrate

TCA Citrate- NADP
cycle isocitrate
α-Ketoglutarate
carrier
Succinate α-Ketoglutarate

Succinyl-CoA Mitochondrion
Pancreatic β cell

Fig. 9.1 Glucose-stimulated insulin secretion in β cells. Rising blood glucose levels stimulate
GLUT2 in the membrane of β cells to import glucose and GCK to start glucose breakdown via
glycolysis generating ATP. The increased ATP-ADP ratio inhibits KATP channels resulting in mem-
brane depolarization, activation of voltage-gated Ca2+ channels, influx of Ca2+ and stimulation of
insulin granule exocytosis. Moreover, pyruvate is the end product of glycolysis and enters mito-
chondrial metabolism via PDH or PC. β cells also exhibit active “pyruvate cycling” via the anaple-
rotic entry of pyruvate or other substrates into the TCA cycle generating excess of intermediates
that then exit the mitochondria to engage in various cytosolic pathways leading back to pyruvate.
Pyruvate-isocitrate cycling generates an amplifying signal that enhances the Ca2+-mediated trig-
gering signal for insulin exocytosis

hormones, such as glucagon, adrenaline and corticosteroids, promote hepatic glu-

cose production via gluconeogenesis, so that blood glucose levels remain stable
across a wide range of physiological conditions, such as fasting. Moreover, glu-
cagon and adrenaline stimulate lipolysis in WAT and fatty acid β-oxidation in other
tissues when nutrients are in limited supply. Although the hormonal regulation of
glucose homeostasis is essential, also the CNS can sense and respond to acute
changes in glucose and nutrient needs through innervation of the intestine, the liver,
the pancreas, the portal vein and all other glucose-demanding tissues (Sect. 8.4).
9.2 Insulin Resistance in Skeletal Muscle and Liver 135

Glycogen Glycogen
Liver
Intake Glycogen synthesis
Glycogen synthesis Gluconeogenesis
Gluconeogenesis De novo

Glucose
Glucose

Triacylglycerols
glycerols Pancreas
β cells Fatty acids

Fatty acids
Glucose
Lipolysis
Li l i
Glucose transport Lipolysis
Glycogen synthesis

Skeletal muscle
WAT
Glycogen
TTriacylglycerols
Triacylglycerols

FED STATE FASTED STATE

Fig. 9.2 Insulin action in health. In the fed state, dietary carbohydrates increase plasma glucose
levels and promote insulin secretion from β cells. In skeletal muscle, insulin increases the transport
of glucose and permits glucose entry and glycogen synthesis. In adipose tissue, insulin suppresses
lipolysis and promotes de novo lipogenesis. In the liver, insulin stimulates glycogen synthesis and
de novo lipogenesis and inhibits gluconeogenesis. In the fasted state, insulin secretion is decreased,
which increases hepatic gluconeogenesis and promotes glycogenolysis. Under these conditions,
hepatic lipid production diminishes while adipose lipolysis increases

9.2 Insulin Resistance in Skeletal Muscle and Liver

Insulin resistance is a condition, in which normal concentrations of insulin produce

a subnormal biological response in insulin target tissues. β cells compensate this
reduced response by increasing the production of insulin. As long as this hyperinsu-
linemia is adequate to overcome the insulin resistance, glucose tolerance remains
relatively normal. In patients destined to develop T2D, the β cell compensatory
response fails (Sect. 9.5) and insulin insufficiency develops leading to impaired
glucose tolerance and eventually T2D. Impaired insulin sensitivity causes
impaired insulin-stimulated glucose uptake into skeletal muscle, impaired
insulin-mediated inhibition of hepatic glucose production in liver and a reduced
ability of insulin to inhibit lipolysis in WAT.
There are three main mechanisms to explain insulin resistance, in particular in
muscle cells (Fig. 9.3a) and liver cells (Fig. 9.3b). These are
• an ectopic (i.e., unusual) lipid accumulation in muscle and liver
136 9 Insulin Resistance and Diabetes

Insulin
A Transcriptional
activation
Activation Inactivation

1 PNPLA2
TAG DAG PRKCQ IRS IR A/B
PNPLA3
PRKCZ
Glycogen
ceramide
2 synthesis PPP2 AKT GS
GLUT4

TBC1D4
GSV
Glucose
TLR4 GLUT4
LPS
TNF

IKBK MAPK8

TNFR Adaptive response

TAG

Lipogenic PPARGC1A
enzymes
unfolded protein
AFT6
ER response in the ER
Skeletal muscle 3

Insulin

B
1 PNPLA2
TAG DAG PRKCQ IRS IR A/B
PNPLA3
PRKCZ
Glycogen synthesis
2 Ceramide
PPP2 AKT FOXO1
synthesis
Gluconeogenesis

SREBF1
TLR4
LPS
TNF

IKBK MAPK8 Lipogenesis

TNFR
TAG

XBP1
Lipogenic
enzymes
unfolded protein
ER CEBP
response in the ER
Liver 3

Fig. 9.3 Pathways involved in skeletal muscle (a) and hepatic (b) insulin resistance. The
insulin-­IR-IRS-PI3K-AKT signaling axis promotes via TBC1D4 the translocation of GSVs
(GLUT4-containing storage vesicles) to the plasma membrane permitting the entry of glucose into
the cell and also stimulates glycogen synthesis via the enzyme GS. This central signal transduction
pathway is connected to a number of additional pathways. Green shaded (1): DAG-mediated acti-
vation of the kinase PRKCQ and the subsequent inhibition of IRS, ceramide-mediated increases in
the AKT inhibitor PPP2 and increased sequestration of AKT by the kinase PRKCZ. Impaired
9.2 Insulin Resistance in Skeletal Muscle and Liver 137

• a chronic inflammatory response of the tissues

• ER stress mediated via the unfolding protein response.
All three mechanisms are originally derived from an evolutionary advantage in
adapting to a changing environment. The evolutionary oldest pathway, the unfolded
protein response (Sect. 7.5), was designed to integrate metabolic signals, such as
metabolic stress through lipid overload, and to adapt accordingly. The inflammatory
response (Sect. 7.2) also represents an evolutionary old pathway that is highly inter-
connected with the unfolded protein response, in order to provide a coordinated
response to various environmental stimuli, such as nutrient scarcity. This requires
the dampening of the insulin response, in order to allow a metabolic shift from glu-
cose to lipid oxidation.
Humans that perform long-term fasting shift into an insulin resistant mode in one
or several tissues, such as muscle, liver or WAT, in order to preserve blood glucose
for the brain. This insulin resistance leads to increased fatty acid concentrations in
the circulation as well as in skeletal muscle and liver. The elevated lipid levels in
these tissues also cause a parallel increase in lipids with signaling function, such as
DAG (diacylglycerol) and ceramides. This then enhances the insulin resistance of
the tissues and ensures the preservation of glucose for the CNS. However, this nat-
ural mechanism for survival became pathogenic in the modern times, where
often the level of energy intake exceeds the level of energy expenditure, i.e., in
conditions of misbalanced energy homeostasis (Sect. 8.4).
The lipid content in muscle cells reflects a net balance between fatty acid uptake
and their oxidation in mitochondria. Thus, acquired mitochondrial dysfunction is
an important predisposing factor for ectopic lipid accumulation and insulin
resistance in the elderly. LPL (Sects. 3.4 and 7.3) is a key enzyme for the hydroly-
sis of circulating triacylglycerols (e.g., within VLDLs) that permits the uptake of
fatty acids in muscle and liver through a complex of fatty acid transport proteins of
the SLC27A family with the scavenger receptor CD36 (Fig. 9.3). Upon entry into
the cell, fatty acids are rapidly esterified to acyl-CoAs. These are successively trans-
ferred to a glycerol backbone to form mono, di-, and triacylglycerols or esterify with
sphingosine to form ceramides. This means that the levels of the second messengers
DAG and ceramide rise in parallel to the increased lipid load of the cells. Intracellular
lipid droplets carry on their surface enzymes, such as the lipases PNPLA (patatin-
like phospholipase domain containing) 2 and PNPLA3, that regulate the entry and
exit of lipid molecules and catalyze their lysis, e.g., from triacylglycerols to
DAG. Thus, PNPLAs are essential both for the access of the energy stored in
triacylglycerols and the generation of lipid mediators of insulin resistance.

Fig. 9.3 (continued) AKT2 activation limits translocation of GSVs to the plasma membrane,
resulting in impaired glucose uptake. It also decreases insulin-mediated glycogen synthesis. Yellow
shaded (2): Inflammatory pathways, such as the activation of IKBK affecting ceramide synthesis
and the activation of MAPK8 inhibiting IRS via phosphorylation. Pink shaded (3): The unfolded
protein response in the ER leading to activation of ATF6 and a PPARGC1A-mediated response.
Key lipogenic enzymes in the ER membranes stimulate lipid droplet formation.
TAG = triacylglycerol
138 9 Insulin Resistance and Diabetes

Both in muscle and in liver DAG activates members of the PRKC family, such as
PRKCQ, that impair insulin signaling via inhibition of IRS1 and IRS2 resulting in
a decreased glucose uptake via GLUT4 (Fig. 9.3a). Ceramides dampen insulin sig-
naling by the activation of PPP2 (protein phosphatase 2) dephosphorylating AKT
and via PRKCZ that binds AKT and prevents its activation. When in the liver the
rates of DAG synthesis from fatty acid re-esterification and de novo lipogenesis
exceed the rates of lipid oxidation in the mitochondria, i.e., when there is an increase
of DAG levels, PRKCE is activated, IR tyrosine kinase activity is inhibited, GSK3
is hyperphosphorylated and glycogen synthesis is decreased. Furthermore, this
leads to increased translocation of FOXO to the nucleus promoting elevated expres-
sion of gluconeogenic enzymes (Fig. 9.3b). Inflammatory mediators and adipo-
kines, such as TNF, secreted from adipose tissue, can act locally in a paracrine
manner or they leak out of the adipose tissue causing a systemic effect (endocrine
action) on insulin sensitivity in muscle and liver cells. Via the TNFR (TNF receptor)
signaling axis this activates MAPK8 and IKBK. Thus, the inflammatory response
results in the inactivation of IRS1 and leads to insulin resistance.
Stress of the ER caused by the accumulation of unfolded proteins in its lumen
plays a special role in the pathogenesis of insulin resistance in the liver (Fig. 9.3).
Activation of three key proteins of the unfolded protein response, EIF2AK3, ERN1
and ATF6, results in increased membrane biogenesis, stop of protein translation and
elevated expression of chaperone proteins in the ER. Via the activation of MAPK8
this leads to inhibitory serine phosphorylation of IRS1. Moreover, the unfolded pro-
tein response results in an expansion of the ER membrane and increases the expres-
sion of SREBF1 (Sect. 3.1), which stimulates lipogenesis. Thus, the unfolded
protein response causes hepatic insulin resistance, when it is able to alter the
balance of lipogenesis and lipid export to promote hepatic lipid accumulation.

9.3 β Cell Failure

The failure of β cells during the progression to T2D involves their chronic expo-
sure to glucose and lipids, also known as glucotoxicity and lipotoxicity, or in
combination “glucolipotoxicity”. A chronic glucose exposure increases glucose
metabolism in β cells leading to the formation of citrate, which acts as a signal for
the formation of malonyl-CoA in the cytosol (Fig. 9.4a). Malonyl-CoA inhibits the
key fatty acid transporter in mitochondria, CPT1A (carnitine palmitoyltransferase

Fig. 9.4 (continued) protein misfolding. The protein unfolding response is initially able to balance
this ER stress, but over time this becomes less effective, and the deleterious effects of ER stress
leads to cell death. Insulin hypersecretion is accompanied by amylin secretion forming amyloid
fibrils that accumulate at the surface of β cells and induce dysfunction and apoptotic death to the
cells. Prolonged hyperglycemia results in oxidative, ER and hypoxic stress and in increased expo-
sure of β cells with cytokines (b). Therefore, β cells may cease their proliferation, de-differentiate
or undergo uncontrolled autophagy or apoptosis. All these processes reduce the number of β cells
and their function. This leads dysfunction and depletion of β cells and to progress of T2D
 A Insulin and amylin
Glucose Lipids
hypersecretion Amyloid fibrils
cellular
membrane

CYTOPLASM
Apoptosis, dysfunction Pyruvate LC-CoA
PC Acetyl-CoA
Secretary
granules Secretion Pyruvate Oxalacetate
signals cycling β-oxidation CPT1A
Demand for
insulin biosynthesis,
ENDOPLASMIC RETICULUM MITOCHONDRION
amylin secretion
IRE1 Apoptosis, cell stress
level
Increased workload ER stress Protein
Protein synthesis
misfolding
Lipid synthesis
level
XBP1

Stress relief

Unfolded protein
XBP1
response
NUCLEUS

B Hyperglycemia

Oxidative stress
β cells ER stress
Hypoxic stress
Cytokine induction

Failure of
Apoptosis proliferation

Autophagy De-differentiation

Decrease of β cell number and function

β cell failure in T2D

Fig. 9.4 β cell failure. Overnutrition and/or increased lipid supply induces in mitochondria of β
cells enzymes of fatty acid β-oxidation, such as CPT1A, resulting in increased acetyl-CoA levels,
allosteric activation of PC and constitutive upregulation of pyruvate cycling (a). This leads to
increased basal secretion of insulin and a loss of the glucose-stimulated increment in the flux of
pyruvate cycling, i.e., blunting of glucose-stimulated insulin secretion. The elevated demand for
synthesis of insulin in the ER increases the stress to this organelle, resulting in elevated rates of
140 9 Insulin Resistance and Diabetes

1A) and blocks in this way fatty acid β-oxidation. This causes accumulation of SFA-­
CoAs in β cells. The high demand for insulin secretion during hyperglycemia
­creates significant metabolic stress to the ER of β cells and results in the overpro-
duction of ROS in their mitochondria. This oxidative stress is a central element of
glucotoxicity.
When intracellular glucose concentrations exceed the glycolytic capacity of β
cells, some of the molecules are converted to enediol intermediates, leading to
superoxide formation. Since β cells contain only low levels of anti-oxidant enzymes,
such as catalase, glutathione peroxidase and superoxide dismutase 2, they are very
susceptible to superoxide damage. Moreover, β cells have many mitochondria and
consume more oxygen than most other cell types. Therefore, at high glucose condi-
tions, such as directly after a meal, the accelerated mitochondrial function enhances
the oxygen consumption and causes hypoxia. This parallels with the increased
expression of hypoxia-inducible genes. In addition, T2D patients have an expanded
ER in their β cells indicating increased stress to the organelle. One of the stress sen-
sors is the ER transmembrane protein IRE1 (inositol-requiring enzyme), which can
induce apoptosis. Moreover, the hyperinsulinemia in response to chronic hypergly-
cemia disrupts ER homeostasis in β cells due to the exceeded capacity for proinsulin
biosynthesis. This leads to accumulation of misfolded proteins and induction of the
unfolded protein response via XBP1 (Sect. 7.5), which enhances the oxidative stress
and eventually results in β cell dysfunction.
Patients with a long clinical history of T2D commonly have a decreased β cell
number and function, respectively, which is often referred to as “β cell exhaustion”.
Compared with weight-matched healthy individuals, obese T2D patients have a
63% reduction of β cell mass, while lean T2D patients only show a 41% loss. This
suggests that β cell dysfunction has a primary role in the pathogenesis of T2D. In
response to ER stress, hypoxic stress and exposure to pro-inflammatory cytokines,
β cells fail to proliferate or undergo apoptosis or uncontrolled autophagy (Fig. 9.4b).
Moreover, the β cells can de-differentiate or trans-differentiate into other pancreatic
cell types, such as α cells. β cells proliferate via the replication of preexisting β cells
and the differentiation of progenitor cells, referred to as neogenesis. In the pancreas
of adults, the dominant mechanism for increasing β cell numbers is replication
rather than neogenesis. The mass of β cells is controlled by the balance between the
rate of proliferation and the rate of apoptosis. The FAS (Fas cell surface death recep-
tor) pathway, a central apoptosis regulatory mechanism, is upregulated in patients
with poorly controlled T2D. Thus, both increased apoptosis or decreased prolif-
eration can reduce the β cell mass of T2D patients.
Moreover, high levels of saturated FFAs, i.e., lipotoxicity, also induce β cell
apoptosis. Interestingly, in patients who are genetically predisposed to T2D, but not
in healthy individuals, a sustained increase in plasma FFA levels causes β cell
dysfunction.
9.4 Definition of Diabetes 141

9.4 Definition of Diabetes

Diabetes is a condition of chronically elevated plasma glucose levels, referred to as

hyperglycemia, that eventually causes toxicity to blood vessels (Box 9.1). There are
two major forms of diabetes, T1D and T2D. T1D results from an autoimmune
destruction of insulin-producing β cells in the pancreas. As a result, the body can no
longer produce insulin and the respective patients need insulin injections every day
for the rest of their life, in order to control the levels of glucose in their blood.
Without insulin, a person with T1D will die premature. This type of diabetes has a
sudden onset and usually affects children of 10 years or older, i.e., in an age when
their immune system has reached full potency. The number of people who develop
T1D is increasing, which may be due to changes in environmental risk factors,
prenatal events, diet early in life or viral infections.
T2D is the most common type of diabetes, representing more than 90% of all
diabetes cases. It usually occurs in adults, but is increasingly seen in children and
adolescents. In initial stages of T2D, β cells are still able to produce insulin, but
either the amounts are insufficient or the body is unable to respond to its effects
(known as insulin resistance, Sect. 9.2), both leading to elevated glucose levels in
the blood. T2D often remains unnoticed and undiagnosed for years, i.e., the respec-
tive persons are unaware of the already smouldering long-term damage being caused
by their disease. In contrast to people with T1D, the majority of T2D patients usu-
ally do not require daily doses of insulin to survive. Many T2D patients are able to
manage their hyperglycemia through a healthy diet and increased physical activity
or by oral medication for a rather long time (Sect. 9.5). However, when they reach a
stage, in which they are unable to regulate their blood glucose levels, they need
insulin substitution.
Women, who during pregnancy (mostly around the 24th week) develop a resis-
tance to insulin and subsequent high blood glucose levels, have gestational diabetes
(17% of live births to women in 2013). Uncontrolled gestational diabetes can
have serious consequences for both the mother and her baby and increases the
risk of the child to develop T2D later in life.
An OGTT (oral glucose tolerance test) with measurements of glucose at defined
times (e.g., at 0, 30, 60 and 120 min) after oral uptake of a defined amount of glu-
cose (often 75 g) is the easiest way to determine the glucose homeostasis status of
prediabetic individuals. Healthy persons have a fasting blood glucose level in the
order of 5 mM, already 1 h after the glucose bolus show a peak below 10 mM and
return to less than 7.8 mM after 2 h (Fig. 9.5, No. 1). Individuals that start at normal
glucose concentrations but after 2 h still have levels higher than 7.8 mM have
impaired glucose tolerance (Fig. 9.5, No. 2). However, when the fasting glucose
level exceeds 7 mM and after 2 h still is higher than 11.1 mM, the person is consid-
ered diabetic (Fig. 9.5, No. 3). The response measured in the OGTT reflects the
ability of β cells to secrete insulin and the responsiveness of the whole body to
142 9 Insulin Resistance and Diabetes

11
7.8 .1
mM
mM
Prediabetes

Normal Diabetes

1 2 3

12

person 3

10
Serum glucose (mM)

person 2
8

6
person 1

4
0 30 60 90 120 150
Time after oral glucose administration (min)

Fig. 9.5 Oral glucose tolerance test. The test measures how the human body responds to an oral
challenge of glucose (usually as a drink of 75 g). Blood glucose is measured in a time course (e.g.,
every 30 min over 2 h). The glucose level increases quickly, but the secretion of insulin should
manage the normalization of the glucose concentration after 2 h (5 mM, person No. 1). Person No.
2 has normal fasting plasma glucose levels, but due to impaired glucose tolerance does not return
after 2 h to normal concentrations (below 7.8 mM). In contrast, person No. 3 is diabetic, since his/
her fasting glucose level already exceeds 7.8 mM, and the 2 h value is clearly elevated,
respectively

insulin. For example, a person with a fasting glucose in the range of 6.1–7.0 mM is
categorized to have impaired fasting glucose and may have established insulin resis-
tance (Sect. 9.2). These individuals have impaired glucose homeostasis and are
at increased risk to develop T2D.
The worldwide T2D prevalence of adults is 8.5% (2017) and this rate will further
increase (Fig. 9.6). The incidence of diabetes rises when countries become more
industrialized, people eat a more sugar- and fat-rich diet and are less physical active.
Despite the predominantly urban impact of the T2D epidemic, is rapidly becoming
also a major health concern in rural communities in low- and middle-income coun-
tries. In high-income countries, primarily people above the age of 50 years get T2D,
while in middle-income countries the highest prevalence is in younger persons. As
9.5 Failure of Glucose Homeostasis in T2D and Its Treatment 143

these populations age, the prevalence will rise further due to the increase of older
age groups. The mortality rate of diabetes varies sharply with the economy of
the country being significantly lower in high-income countries with a more
developed healthcare system.

9.5  ailure of Glucose Homeostasis in T2D and Its

F
Treatment

T2D is an age-related disease that is strongly promoted by overnutrition and

physical inactivity. In the early stages of T2D, insulin levels rise to maintain glu-
cose tolerance by compensating for increased insulin resistance of skeletal muscles
and adipose tissue (Sect. 9.2). While the insulin resistance of an individual remains
relatively constant over time, the deterioration of the insulin-secretory capacity of β
cells increases continuously. Under these conditions, insulin is less potent in sup-
pressing hepatic glucose production, i.e., also the liver becomes insulin resistant. In
later stages of the disease, β cells get exhausted and lose their ability to compensate

South and Africa

Central America 2017 2045
Middle East 425 Million 629 Million
Western
and North Africa Pacific expected increase 48%
North America 77%
and Caribbean of people with diabetes
live in low- and middle-
income countries
Europe South
East Asia
425 Million (8.5%)
46% undiagnosed

58 M
(7.3%)
33%
46 M undiagnosed

(11.4%)
27% 82 M
undiagnosed
(8.6%)
39 M 53%
undiagnosed
(13.7%)
49%
undiagnosed

16 M 159 M
(7.1%) (8.4%)
26 M 63% 54%
undiagnosed undiagnosed
(8.1%)
27%
undiagnosed

Fig. 9.6 T2D in numbers. The majority of the 425 million people with T2D (2017) are between
40 and 59 years old. The worldwide prevalence of the disease is 8.5%. Until 2045, the number of
people with diabetes will increase by 48%. No country escapes the T2D epidemic. Data were
obtained from https://diabetesatlas.org
144 9 Insulin Resistance and Diabetes

via the increase of insulin release. This results in reduced circulating insulin con-
centrations and often occurs in parallel with increased glucagon levels. The shift in
the glucagon/insulin ratio leads to a further rise in hepatic gluconeogenesis, i.e., the
liver releases more glucose to the circulation. When basal in addition to post-­
prandial blood glucose levels are chronically increased, the individual develops
hyperglycemia. Moreover, defective insulin signaling also causes dyslipidemia
(Sect. 10.3), including perturbed homeostasis of fatty acids, triacylglycerols and
lipoproteins (Fig. 9.7).
The defective insulin secretion and responses in T2D have several reasons.
Firstly, constant exposure of β cells to elevated levels of glucose and lipids, i.e.,
glucolipotoxicity, induces their dysfunction and ultimately triggers their death
(Sect. 9.3). These processes are related to chronic inflammation of pancreatic islets.
Elevated glucose levels increase the metabolic activity of the islet cells, in which via
increased ROS production, the NLRP3 inflammasome is activated (Sect. 7.1).
Secondly, increased insulin demand and production induces ER stress to β cells

Triacylglycerols Triacylglycerols
Liver
Carbohydrate
intake Glycogen synthesis
Glycogen synthesis Gluconeogenesis

Lipid re-esterification
o lipogene
De novo llipogenesis
pogenesis
po
ogene
gen
en
ne

Glucose
G
Triac
Triacylglycerols

Pancreas
β cells Glucose
Fatty acids FFatty acids

Lipolysis
Glucose transport Lipolysis
Glycogen synthesis

Glycogen Glycogen
Skeletal
muscle IMCL IMCL
White
adipose tissue

T2D FED STATE T2D FASTED STATE

Fig. 9.7 Insulin actions in diabetes. In T2D, insulin-mediated skeletal muscle glucose uptake is
impaired, which directs glucose to the liver. Increased hepatic lipid levels impair the ability of
insulin to regulate gluconeogenesis and to stimulate glycogen synthesis. However, lipogenesis in
liver is not affected. In combination with increased delivery of dietary glucose, this stimulates
lipogenesis causing NAFLD. Impaired insulin action in adipose tissue increases lipolysis, which
promotes re-esterification of lipids in other tissues, such as the liver, and further exacerbates insu-
lin resistance. In combination with a decline in the number of active β cells, this leads to the devel-
opment of hyperglycemia. IMCL intramyocellular lipid
9.6 Genetics and Epigenetics of T2D 145

(Sect. 7.4) further activating the inflammasome. Like in other inflammatory sce-
narios, this cytokine production leads to the attraction of macrophages and other
immune cells. Furthermore, the islets produce an amyloid polypeptide that aggre-
gates to form amyloid fibrils in patients with T2D. Thus, resident islet macro-
phages adopt a pro-inflammatory M1 phenotype that induces islet
dysfunction.
Current treatments for T2D include insulin, the indirect AMPK activator metfor-
min, KATP channel inhibiting sulphonylureas, PPARγ-activating thiazolidinediones
(glitazones), incretin mimetics and their degradation-inhibitors, and inhibitors of
either starch- and disaccharides-digesting α-glucosidase or of glucose transporters.
Each of these therapies can improve hyperglycemia and some may even delay the
onset of diabetes. However, none of these drugs can slow down the progressive
decline in insulin secretion. Intensive diabetes treatment results in tight glycemic
control and therefore a substantial reduction in the risk of microvascular complica-
tions (Box 9.1). Since T2D is often associated with hypertension (Sect. 10.1) and
dyslipidemia (Sect. 10.3), respective drugs are prescribed to most patients with T2D
in addition to glucose-lowering medications. Importantly, T2D can be prevented
by lifestyle changes. For example, already a moderately increase in physical activ-
ity combined with a decrease in caloric intake, aiming for a persistent 5–10% weight
loss, reduces the risk for T2D by more than 50%.

9.6 Genetics and Epigenetics of T2D

A range of monogenetic disorders result in chronic hyperglycemia (Table 9.1). They

are summarized as MODY (maturity onset diabetes of the young), because they
often occur already in young adults. However, the therapy of these inherited forms
of diabetes does not require insulin, i.e., they are of non-T1D type. Most of the
MODY genes encode for transcription factors, such as HNF4A, HNF1A, HNF1B,
PDX1, NEUROD1 (neuronal differentiation 1), KLF11 (Krüppel-like factor 11) and
PAX4. In contrast GCK, CEL (carboxyl ester lipase) and BLK (B lymphoid tyrosine
kinase) encode for enzymes, ABCC8 and KCNJ11 (potassium inwardly-rectifying
channel, subfamily J, member 11) for ion channels, APPL1 (adaptor protein, phos-
photyrosine interacting with PH domain and leucine zipper 1) for an adaptor protein
and INS (insulin) for a hormone.
Monogenetic forms of T2D represent only 1–2% of all diabetes cases world-
wide. In contrast, typical obesity-related T2D is often found to carry a cluster of
genetic variations that confer enhanced susceptibility to environmental factors, such
as overnutrition and stress. All MODY genes are expressed in β cells and affect
insulin secretion, while the normal control of glucose metabolism via insulin
involves a number of additional organs, such as muscle, liver and fat (Sect. 9.1).
This suggests that insulin secretion in β cells is a more important parameter for
diabetes than insulin resistance in peripheral organs.
146 9 Insulin Resistance and Diabetes

Table 9.1 MODY genes

Gene/
Type OMIM protein Description
MODY 125850 HNF4A Due to a loss-of-function mutation in the HNF4A gene. 5–10%
1 of cases.
MODY 125851 GCK Due to any of several mutations in the GCK gene. 30–70% of
2 cases. Mild fasting hyperglycemia throughout life. Small rise
on glucose loading.
MODY 600496 HNF1A Mutations of the HNF1A gene. 30–70% of cases. Tend to be
3 responsive to sulfonylureas. Low renal threshold for glucose.
MODY 606392 PDX1 Mutations of the PDX1 gene. Less than 1% of cases.
4 Associated with pancreatic agenesis in homozygotes and
occasionally in heterozygotes.
MODY 137920 HNF1B Defect in HNF1B gene. 5–10% of cases. Atrophy of the
5 pancreas and several forms of renal disease
MODY 606394 NEUROD1 Mutations of the NEUROD1 gene. Very rare.
6
MODY 610508 KLF11 Mutations of the KLF11 gene.
7
MODY 609812 CEL Mutations of the CEL gene. Very rare. Associated with
8 exocrine pancreatic dysfunction.
MODY 612225 PAX4 Mutations of the PAX4 gene.
9
MODY 613370 INS Mutations in the INS gene. Usually associated with neonatal
10 diabetes. Less than 1% of cases.
MODY 613375 BLK Mutated BLK gene. Very rare.
11
MODY 606391 ABCC8 Mutated ABCC8 gene. Very rare.
12
MODY 616329 KCNJ11 Mutated KCNJ11 gene. Very rare.
13
MODY 616511 APPL1 Mutated APPL1 gene. Very rare.
14
80% of cases of early-onset, autosomal-dominant, familial hyperglycemia are represented by the
14 MODY genes

T2D belongs to those diseases that have been extensively studied by GWAS. Figure
10.4 provides an overview on 18 genetic variants that were the first to be associated
with T2D. They all represent common SNPs with MAFs ranging from 7.3% to 50%.
The gene TCF7L2 (transcription factor 7-like 2) has an OR of 1.37 for developing
T2D (i.e., a 37% increased T2D risk), while the ORs for the 17 remaining genes
range only between 1.05 and 1.15 (5–15% increased risk). These numbers are com-
parable to what is observed as genetic risk for other common traits and diseases,
such as obesity (Sect. 8.5). Some of the T2D risk genes, such as CDKAL1 (CDK5
regulatory subunit associated protein 1-like 1), SLC30A8 encoding for a zinc trans-
porter, HHEX (hematopoietically expressed homeobox) encoding for a transcrip-
9.6 Genetics and Epigenetics of T2D 147

tion factor, and KCNJ11, are involved in insulin secretion in β cells. Thus, the
common risk for T2D agrees with the findings of monogenetic diabetes.
However, the genetic propensity to develop T2D involves also genes in a number
of additional pathways that affect β cell formation and function, as well as pathways
affecting fasting glucose levels and obesity. The cluster of CDKN (cyclin-dependent
kinase inhibitor) 2A and CDKN2B controls β cell growth, MTNR1B (melatonin
receptor 1B) links circadian rhythms with fasting glucose levels (Sect. 3.6),
FTO/IRX3/IRX5 is the key risk gene locus for obesity (Sect. 8.5), PPARG encodes
for the master regulator of adipogenesis (Sect. 8.2) and IGF2BP2 (insulin-like
growth factor 2 mRNA binding protein 2) is involved in insulin signaling (Sect.
6.3). However, for the eight remaining T2D risk genes no direct link to metabolic
homeostasis had been identified indicating that not always the closest genes to the
T2D-associated SNP provide a functional explanation but in some cases more dis-
tant genes may be involved (Fig. 9.8). The 18 genetic variants explain only some 4%
of the heritable risk for T2D. Nevertheless, in personalized medicine approaches,
such as exemplified by iPOP (Sect. 4.6), most prominent T2D risk genes are already
used as predictive markers. Larger study populations and meta-analyses of existing
studies increased the number of T2D risk gene loci to more than 100 (www.genome.
gov/gwastudies). The additional genes have similar or even lower MAFs and ORs.
Thus, from the genetic perspective T2D is a very heterogenous disease that can
be segregated into multiple subtypes, which should be treated on a personal-
ized basis taking the individual’s genetic background and phenotype into
account.
In general, common SNPs are characterized by low ORs, while rare monogenetic
forms of T2D have high ORs (Fig. 9.9). However, both extremes do not explain all
genetic basis of T2D. Like for many other common diseases and traits, also for T2D
risk there is a large number of low frequency SNPs with intermediate ORs. Some of
these genetic variants are expected be identified by the use of whole genome
sequencing (Sect. 2.5), but will not be able to explain all heritability of T2D. Thus,
prenatal and post-natal epigenetic programming will demonstrate its contribu-
tion to the disease risk.
The experience from the already discussed Dutch hunger winter (Sect. 5.3) pro-
vides a molecular explanation for an increased obesity and T2D risk. Similar obser-
vations for a rise in T2D prevalence had been made for survivors of the Ukraine
famine (1932–1933) and the Chinese famine (1959–1961). The in utero ­environment
has a strong impact on fetal epigenetic programming, as individuals exposed to
either famine or maternal gestational diabetes during fetal development develop
more likely obesity and/or T2D later in life (Fig. 9.10a). Food-deprived conditions
of the mother change the epigenome of the fetus, so that genes involved in
energy homeostasis are more sensitive to food intake. The DOHaD concept
(Sect. 5.3) indicates that in times of continued famine, this epigenetic sensitizing is
a survival advantage, while in times of plenty food it may drive the individual into
obesity and T2D. DNA methylation is particularly sensitive to events during devel-
opment in utero, because genomic DNA gets almost fully demethylated in the days
 148

1 2 3 4 5 6 7 8 9 10 11 12

PPARG WFS1
CDKAL1 CDKN2A-2B CAMK1D KCNJ11
JAZF1
THADA
ADAMT59 TSPAN8
HHEX-IDE MTNR1B
NOTCH2 SLC30A8 TCF7L2

IGF2BP2

13 14 15 16 17 18 19 20 21 22 X Y

HNF1B
FTO (IRX3/5)
9

β cell formation Adipocyte differentiation

β cell fuction insulin secretion Insulin pathway regulation
Fasting glucose levels Unknown role in T2D
Body mass index

Fig. 9.8 Insights into the genetic basis of T2D. Examples of 18 genes are shown that were identified by GWAS to be associated with T2D. Only four genes
were previously known as T2D candidate genes. The genes that participate in β cell disturbance have diverse functions, such as pancreatic islet proliferation,
insulin secretion and cell signaling. The functional role of eight genes in T2D has not yet been identified
Insulin Resistance and Diabetes
9.6 Genetics and Epigenetics of T2D 149

50.0 Rare alleles

leles Few examples of
causing
ing high-effect
High common variants
com
Mendelian
elian
disease
ase iinfluensing
(OR)

3.0 common disease

com
Effect size (O

Low
Low-frequency
Intermediate

variants
var with
intermediate
interm effect
Common
Com
C mon
1.5 Rare variant of variant
Modest

small effect imp

plicated in
implicated
very hard to identify com
common disease
1.1 by genetic means b GWAS
by
Low

Very rare Rare Low Common

0.001 0.005 0.05
Allele frequency

Fig. 9.9 Identifying genetic variants by risk allele frequency. The strength of the genetic effect
is indicated by odds ratios. Most emphasis and interest lies in identifying associations with char-
acteristics shown within the diagonal box

after zygote formation and specific methylation is re-established throughout

embryogenesis. For example, patterns of DNA methylation at candidate genes, such
as the LEP gene, associate with in utero exposure to famine and with maternal
impaired glucose tolerance during pregnancy.
Epigenetic programming happens not only during the prenatal phase, but occurs
also in the post-natal and adult phases of life. For example, T2D patients maintain-
ing intense glucose control remain at increased risk of macrovascular complications
and organ damage even years after the initial diagnosis. This “glycemic memory” is
an epigenetic effect, i.e., histone methylation changes within human aortic endothe-
lial cells in response to increased glucose exposure. Individuals that carry an epig-
enome, which during their anthropologic development was programed by suboptimal
nutrition in utero, despite normal post-natal nutrition, transgenerationally transmit a
predisposition for obesity (Fig. 9.10b).
It is not clear how many generations epigenetic marks can be inherited, but it is
obvious that epigenetic inheritance is not comparably persistent as genetic inheri-
tance. Within more or less one generation (between 1981 and 2014) the worldwide
prevalence for both obesity and T2D doubled. Thus, populations that made a
transition from famine to food surplus just within 1–2 generations are under
significantly higher risk for obesity, T2D and the metabolic syndrome, than
those that were improving their nutritional conditions over many generations.
150 9 Insulin Resistance and Diabetes

A
Prenatal and early infant life Adult life
(Fetal/early infant malnutrition) (Good or overnutrition)

Decreased growth of Obesity Age

Maternal fetus/infant
malnutrition
during pregnancy Decreased islet function T2D and
Fetal Decreased adult
(or other maternal/ malnutrition and impaired β cell growth metabolic
β cell function
placental syndrome
In utero hormonal and
abnormalities)
metabolic adaptations to
maternal malnutrition

MATERNAL NEWBORN CHILDHOOD ADULT

First generation

Normal Normal Normal Normal

Intrauterine Enhanced survival

Undernutrition
growth restriction and catch up growth
Obese
Normal/increased
Macrosomic/
Overnutrition food availability
increased body fat
High fat/calorie diet

Macrosomic/
OBESE Obese
increased body fat

Fig. 9.10 Transgenerational view on T2D and obesity. T2D and the metabolic syndrome (Chap.
10) can be the outcome of maternal-fetal malnutrition, such as poor maternal diet, low maternal fat
stores or reduced transfer of nutrients because of placental abnormalities (a). The fetus adapts to
this environment by being nutritionally thrifty, resulting in decreased fetal growth, islet function
and β cell mass and other hormonal and metabolic adaptations. A transition to overnutrition later
in adult life exposes the impaired islet function to increased metabolic stress, which is further
enhanced by obesity and age, so that T2D results. Non-obese mothers usually give birth to non-­
obese children, which develop into adults with a normal metabolic profile and a normal body fat
content (b). However, undernutrition combined with improved neo-natal survival, formula feeding
and exposure to a Western post-natal diet increases the incidence of prematurity and intrauterine
growth restriction. This results in increased obesity of the offspring and higher risk for developing
the metabolic syndrome, when prenatally exposed to Western diet. Some obese mothers may give
birth to newborns with increased body fat, as a result of consumption of a high-fat diet. All these
processes contribute to a shift of the population toward an obese phenotype. This also includes that
second generation obese women have an increased risk to give birth to infants with increased body
fat content and a further increased risk to develop obesity and the metabolic syndrome
Additional Readings 151

For example, Polynesians show an overproportional high prevalence for

T2D. One possible explanation is that their ancestors experienced a number of chal-
lenges, such as cold stress and starvation. This happened a few hundreds years ago
during long open-ocean travels over the Pacific, which may have let only the ini-
tially most obese members of the group survive. These ancestors may have been
evolutionary selected for energetic efficiency, referred to as thrifty metabolism.
Accordingly, present-day Polynesians have inherited an increased T2D susceptibil-
ity, because their ancestors went through an evolutionary bottleneck. In contrast,
populations, which did not experience long periods of starvation in the past centu-
ries, such as the Europeans, have a low prevalence for T2D. Similar explanation
may apply to other indigenous populations, such as the Pima Indian tribe in Arizona
who had adapted to life of deprivation in the desert. When exposed to Western diet
both Polynesians and Pima Indians get far more likely obese than Europeans. Thus,
populations who are born and live in countries that had particularly rapid
changes in urbanization and economic development have an increased risk of
the different features of the metabolic syndrome.
Diabetes is a very heterogenous disease that in future will be diagnosed and
treated on the basis of its molecular features, i.e., on a far more personalized basis.
One particular goal will be to use personalized lifestyle and medication, in order to
reduce the risk of cardiovascular complications of T2D. Since most cases of T2D
are preventable, in future far more effort will be taken in detecting early genetic and
epigenetic markers for increased T2D susceptibility. Such epigenetic markers will
help to detect children or families, for whom intensive lifestyle intervention are
likely to prevent the onset of metabolic disease.

Additional Readings

Ashrafzadeh S, Hamdy O (2019) Patient-driven diabetes care of the future in the technology era.
Cell Metab 29:564–575
Flannick J, Johansson S, Njolstad PR (2016) Common and rare forms of diabetes mellitus: towards
a continuum of diabetes subtypes. Nat Rev Endocrinol 12:394–406
Ling C, Ronn T (2019) Epigenetics in human obesity and type 2 diabetes. Cell Metab 29:1028–1044
Perry RJ, Samuel VT, Petersen KF, Shulman GI (2014) The role of hepatic lipids in hepatic insulin
resistance and type 2 diabetes. Nature 510:84–91
Stenvers DJ, Scheer F, Schrauwen P, la Fleur SE, Kalsbeek A (2019) Circadian clocks and insulin
resistance. Nat Rev Endocrinol 15:75–89
Wells JCK (2017) Body composition and susceptibility to type 2 diabetes: an evolutionary per-
spective. Eur J Clin Nutr 71:881–889
Zimmet P, Shi Z, El-Osta A, Ji L (2018) Epidemic T2DM, early development and epigenetics:
implications of the Chinese famine. Nat Rev Endocrinol 14:738–746
Chapter 10
Heart Disease and the Metabolic Syndrome

Abstract In this chapter, we will link three important risk factors for heart disease:
hypertension, atherosclerosis and dyslipidemia. Chronically elevated blood pres-
sure, i.e., hypertension, increases the risk of ischemic heart disease, stroke, periph-
eral vascular disease and other CVDs. This is the most important preventable
risk factor for premature death. The low intake of fruit and vegetables and whole
grain fiber and high consumption of saturated fat and high-cholesterol diets can lead
to hypercholesterolemia and atherosclerosis, especially in genetically predisposed
individuals. Atherosclerosis is a chronic inflammatory disease caused by the accu-
mulation of cholesterol-laden macrophages in the artery wall, i.e., it is based on
dyslipidemia and an overreaction of the immune system. Accordingly, the suscepti-
bility to CVDs is associated with genes affecting the serum levels of plasma lipids
and lipoproteins. Furthermore, we will discuss the role of insulin resistance and
obesity in the major metabolic tissues liver, skeletal muscle, pancreas and WAT
causing the metabolic syndrome. The importance of inflammation and regulation of
energy metabolism will be highlighted. The genetic risk for the metabolic syndrome
overlaps with that of its major components obesity, T2D and dyslipidemia. However,
like in these traits, common genetic variations can explain only a minor part of the
disease risk. Therefore, we will present the important role of epigenetics in the
origin and development of the metabolic syndrome.

Keywords Hypertension · Atherosclerosis · Chronic inflammation · Foam

cells · Cholesterol · Lipoproteins · LDL · HDL · Apolipoproteins · Dyslipidemia ·
Obesity · Insulin resistance · Metabolic syndrome · Liver · Adipose
tissue · Skeletal muscle · Pancreas · Macrophages · Inflammation · Susceptibility
genes · Epigenetics

10.1 Hypertension

Each cycle of heart contraction pumps some 70 ml blood into the systemic arterial
system, in order to supply all cells and tissues of our body with oxygen and nutri-
ents. This pulsation creates pressure on the vascular walls that depends on the

© Springer Nature Switzerland AG 2020 153

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4_10
154 10 Heart Disease and the Metabolic Syndrome

amount of pumped blood and the resistance created by the vasculature. Due to the
periodic ejection of blood from the heart, this pressure is highest at the peak of a
passing amount of blood (systolic) and lowest after its passage (diastolic). Blood
pressure displays a circadian rhythm with highest values in the afternoon and lowest
at night. For healthy adults blood pressure values should be in the order 120 mm Hg
(millimeters of mercury) systolic and 80 mm Hg diastolic, respectively (Fig. 10.1).
Blood pressure is tightly regulated by signals from the SNS, in order to permit unin-
terrupted blood perfusion of all vital organs. For example, even transient interrup-
tion in blood flow to the brain causes loss of consciousness and longer
interruptions will result in death of non-perfused tissues, such as in cerebral
stroke or myocardial infarction.
Hypertension is defined as the blood pressure level above which therapeutic inter-
vention has clinical benefit. Chronic hypertension in combination with atherosclerosis
(Sect. 10.2) is the major risk factor for stroke, CHD, congestive heart failure and end-
stage renal disease (Fig. 10.1). Obesity increases the risk of hypertension five-fold as
compared with normal weight. Accordingly, more than 85% of hypertension cases are
attributed to a BMI > 25. In 90–95% of all cases, hypertension results from a complex
interaction of genes and environmental factors. GWAS identified more than 30 com-
mon SNPs with small effects on blood pressure. In addition, there are some rare
genetic variants with large effects, which converge on a common pathway that alters
blood pressure by changing the net renal salt balance. This emphasizes salt homeosta-
sis in the kidney as a key risk factor for hypertension. Since humans originated from a
notoriously salt-poor environment of sub-Saharan Africa (Sect. 1.1), gene variants that
promoted salt and water retention provided a strong adaptive advantage. Nowadays,
our body’s biochemistry is still not fully adapted to the rather high salt load of our diet.
Therefore, after a salty meal increased salt reabsorption in the kidneys requires water
reabsorption, in order to maintain plasma sodium concentration at 140 mM. This
results in an increased intravascular volume boosting venous blood return to the heart.
Thus, dietary factors significantly influence blood pressure: reduced dietary salt
intake as well as increased consumption of fruits and low fat food, exercise,
weight loss and reduced alcohol intake can reduce hypertension (Sect. 1.4).

10.2 Mechanisms of Atherosclerosis

The endothelium is a single layer of endothelial cells that covers blood vessels and
serves as a barrier between the circulating blood and subendothelial tissues. In ath-
erosclerosis, cholesterol deposition below the endothelium causes a macrophage-­
dominated inflammatory response in large and medium arteries. Atherosclerotic
plaques tend to accumulate at the inner curvatures and branch points of arter-
ies, i.e., at positions where laminar flow is either disturbed or insufficient, in order
to maintain the normal, quiescent state of the endothelium. Some atherosclerotic
lesions can develop already in the first years of life and 95% of humans by the age
of 40 have some type of lesion. However, in most cases clinical manifestations do
not occur before the age of 50–60 years.
10.2 Mechanisms of Atherosclerosis 155

Blood pressure Systolic mm Hg Diastolic mm Hg

category (upper level) (lower level)

Normal less than 120 and less than 80

Prehypertension 120-139 or 80-89

Hypertension, stage 1 140-159 or 90-99

Hypertension, stage 2 160 or higher or 100 or higher

Hypertensive crisis higher than 180 or higher than 110

1 Stroke
Vision problem 2

3 Heart attack

Blood vessel 4 Kidney failure

5
damageg

Fig. 10.1 Hypertension and its complications. Systolic blood pressure indicates how much pres-
sure blood is exerting against the artery walls while the heart is pumping blood. The diastolic blood
pressure measures the pressure while the heart is resting between beats. The ranges for normal
blood pressure, prehypertension, hypertension (stages I and II) and hypertensive crisis are defined.
Hypertension increases the risk of ischemic heart disease, strokes, peripheral vascular disease and
other CVDs, including heart failure, aortic aneurysms, diffuse atherosclerosis and pulmonary
embolism. It is also a risk factor for cognitive impairment and dementia as well as for chronic
kidney disease. Other complications include hypertensive retinopathy and hypertensive
nephropathy
156 10 Heart Disease and the Metabolic Syndrome

A first sign of lesion formation is the accumulation of cholesterol within the arte-
rial wall, referred to as fatty streaks. This is initiated by LDLs, which are cholesterol-­
rich, APOB-containing lipoproteins (Sect. 10.3). When LDLs are modified by
oxidation, enzymatic and non-enzymatic cleavage and/or aggregation, they become
pro-inflammatory and stimulate endothelial cells to produce chemokines, such as
CCL5 and CXCL1, glycosaminoglycans and P-selectin for the recruitment of
monocytes. Hypercholesterolemia (Sect. 10.3) and cholesterol accumulation in
hematopoietic stem cells promote the overproduction of monocytes and their
increased adherences to endothelial cells (Fig. 10.2). The monocytes then move into
the space below the endothelial cells, referred to as “intima”, where they differenti-
ate into macrophages. These macrophages ingest normal and modified lipoproteins,

Cross-section of arteria
Progressing Regressing
Lumen plaque plaque

Necrotic core Collagen

Circulating
monocytes Adhesion
Chemokine
gradient Reverse transmigration

Apoptosis Migration Netrin 1

Defective efferocytosis Semaphorin 3E Macrophage
Cadherins
Proliferation
ER stress ABCA1 CCR7
UNC5B Macrophage
emigration
Lipid unloading Effective
efferocytosis
Foam cell oxidized native M
MSR1
Intima LDL LDL Chemostasis

Media

Fig. 10.2 Monocyte recruitment and accumulation in plaques. Hyperlipidemia increases the num-
ber of monocyte subsets that are recruited to atherosclerotic plaques. Different chemokine-­
chemokine receptor pairs and endothelial adhesion molecules mediate the infiltration of the
monocytes into the intima. There the monocytes differentiate into macrophages or DCs and inter-
act with atherogenic lipoproteins. Macrophages take up native and oxidized LDLs via macropino-
cytosis or scavenger receptors, such as MSR1 (macrophage scavenger receptor 1) and CD36,
resulting in the formation of foam cells (Box 10.1). Imbalances in the lipid metabolism of macro-
phages within the progressing plaque can lead to the retention of the cells and subsequently to
chronic inflammation. Retention molecules, such as netrin 1 and its receptor UNC5B (unc-5
homolog B), semaphorin 3E and cadherins, are expressed by lipid-laden macrophages and pro-
mote their chemostasis. Lipid unloading via ABCA1 and cholesterol efflux can reverse foam cell
accumulation. In parallel, in myeloid-derived cells the chemokine receptor CCR7 is upregulated
and the expression of retention factors is decreased
10.2 Mechanisms of Atherosclerosis 157

such as oxidized LDL, which at the onset of the inflammatory response is a benefi-
cial clearance. In addition to hypercholesterolemia, also immunological and
mechanical injuries, as well as bacterial and viral infections, contribute to the
­pathogenesis of atherosclerosis via the recruitment of macrophages. When the
inflammation turns chronic, the macrophages transform into cholesterol-laden foam
cells (Box 10.1). These foam cells persist in plaques, i.e., they have lost their
ability to migrate and cannot resolve inflammation.

Box 10.1 Foam cells

One of the earliest pathogenic events in the nascent atherosclerotic plaque is
lipoprotein uptake by monocyte-derived macrophages. This results in the
development of foam cells (Fig. 10.3). Increased oxidative stress in the artery
wall promotes modifications of LDLs, which are primarily oxidations that are
recognized by macrophages via scavenger receptors, such as MSR1, CD36
and ORL1 (oxidized low density lipoprotein receptor 1). These receptors
internalize the lipoproteins and cholesteryl esters of the lipoproteins are
hydrolyzed to free cholesterol and fatty acids. Importantly, the scavenger
receptors are not downregulated by cholesterol via a negative-feedback mech-
anism, such as in the case of LDLR. Moreover, via macropinocytosis and
phagocytosis of aggregated LDLs, macrophages can internalize native LDLs
and VLDLs as well as oxidized lipoproteins. The internalized lipoproteins
and their associated lipids are digested in the lysosome releasing free choles-
terol. The free cholesterol is transported to the ER, where it is re-esterified by
the enzyme ACAT1 (acetyl-CoA acetyltransferase 1) providing the “foam” in
foam cells. Enrichment of ER membranes with free cholesterol can result in
defective cholesterol esterification by ACAT1 in macrophages, promoting the
accumulation of free cholesterol. Lipophagy represents the delivery of lipid
droplets to lysosomes for efflux, while lipolysis by NCEH1 (neutral choles-
terol ester hydrolase 1) mobilizes these lipids. The nuclear receptor LXR is
activated by the accumulation of cellular cholesterol (Sect. 3.4) and upregu-
lates the expression of the transporter proteins ABCA1 and ABCG1 leading
the reverse cholesterol transport (Sect. 7.3). These proteins mediate the trans-
fer of free cholesterol to lipid-poor APOA1, in order to form nascent HDLs or
mature HDLs, in which free cholesterol is esterified and stored in the core of
the particle. Cholesterol crystal formation in the lysosome is stimulated by
excessive free cholesterol accumulation and activates the NLRP3 inflamma-
some (Sect. 7.1), promotes ER stress and leads to apoptosis. Moreover, lipid
rafts that are enriched in sphingomyelin form a complex with free cholesterol
and promote TLR4 signaling. This leads to the activation of NFκB and the
production of pro-inflammatory cytokines and chemokines.
158 10 Heart Disease and the Metabolic Syndrome

LIPOPROTEIN UPTAKE

oxidized VLDL
ORL1
MACROPINOCYTOSIS MSR1 LDL
LDL
SCARB1

CD36
PHAGOCYTOSIS OF
LYSOSOMAL oxidized
AGGREGATED LDLs Endosome DYSFUNCTION LDL
LIPID EFFLUX
Lipid-poor APOAI NLRP3
ACID LIPOLYSIS Cholesterol INFLAMMASOME TLR4-6
crystal ACTIVATION CD36
Nascent PROINFLAMMATORY
HDL Free cholesterol SIGNALING
ABCA1 Lysosome
ER
TLR4

Mature ABCG1
Cholesterol-rich
HDL
Autophagosome lipid rafts

LXR–RXR NFκB
LIPOLYSIS
LIPOPHAGY CYTOKINES AND
NCEH1 CHEMOKINES

Nucleus

ACAT1 ER STRESS
Phagophore

Lipid droplets
Macrophage APOPTOSIS

Fig. 10.3 Lipoprotein uptake and efflux in macrophages. Details are provided in the text

Many different cell types, such as endothelial cells, monocytes, DCs, lymphocytes,
eosinophils, mast cells and smooth muscle cells, contribute to the process of
atherosclerotic plaque formation, but foam cells are central to the pathophysiology
of the disease. The TLR-dependent activation of these monocyte-derived cells
polarizes them to M1-type macrophages (Sect. 7.1) that secrete proatherosclerotic
cytokines, such as IL6 and IL12, matrix-degrading proteases as well as ROS, such
as NO radicals. The plaque macrophages are subject to both retention and emigration
signals and a misbalance of these processes contributes to the net accumulation of
plaque macrophages. Dysregulation of lipid metabolism in foam cells contributes to
ER stress ultimately resulting in apoptotic cell death. Since defective lipid
metabolism pathways, such as cholesterol esterification and efflux, impair efficient
clearance of apoptotic cells, this results in necrosis and in the release of cellular
components and lipids that form the necrotic core.
Chronic inflammation stimulates the migration of smooth muscle cells into the
intima region, where they transform into fibroblasts that proliferate and produce
larger amounts of extracellular matrix. This leads to the formation of fibrous athero-
sclerotic plaques. Due to the calcification of the plaques, the artery wall becomes
rigid, i.e., sclerotic and fragile. Most humans have small atherosclerotic lesions that
do not compromise blood flow. However, when the lesions grow and inward arterial
remodeling, they gradually narrow the diameter of the blood vessels and the blood
10.3 Lipoproteins and Dyslipidemias 159

flow is decreased (referred to as stenosis). When this stenosis applies to more than
80% of the coronary arteries, the heart muscle becomes ischemic, especially when
a high cardiac workload increases oxygen demand. Finally, the originally stable
lesion changes into an unstable vulnerable plaque that can easily rupture the
endothelium leading to the formation of intravascular blood clots that can
cause myocardial infarction or, in the case of damage of brain supplying arter-
ies, in cerebral stroke.

10.3 Lipoproteins and Dyslipidemias

Cholesterol is essential for membrane structure and fluidity and is a precursor to

steroid hormones, vitamin D3, oxysterols and bile acids that are ligands of nuclear
receptors (Sect. 3.2). Only a small amount of circulating cholesterol originates from
nutrition, while approximately 80% derive from endogenous synthesis. Cholesterol
levels are tightly regulated by the coordinated actions of the transcription factors
SREBF1 (Sect. 3.1) and LXR (Sect. 3.4). At low cholesterol levels, SREBF1 acti-
vates genes that are involved in endogenous cholesterol production and cholesterol
uptake, such as LDLR. Since already low concentrations of free cholesterol can be
toxic, cholesterol is mostly esterified with fatty acids. Cholesterol and cholesteryl
esters are insoluble in plasma, which requires their transport in spheroidal macro-
molecules, referred to as lipoproteins. These lipoproteins have a hydrophobic core
formed by phospholipids, fat-soluble anti-oxidants, vitamins and cholesteryl esters
and a hydrophilic coat that contains free cholesterol, phospholipids and
apolipoproteins.
There are four main types of lipoproteins: chylomicrons, VLDLs, LDLs and
HDLs, which are differentiated based on their density and size (Box 10.2). The
density of lipoproteins depends on the abundance of apolipoproteins. Chylomicrons
and VLDLs are important for triacylglycerol transport and delivering fatty acids to
peripheral tissues, while LDLs deposit cholesterol in peripheral tissues. Increased
levels of cholesterol-rich LDLs are associated with elevated risk of CVDs.
LDLs carry preferentially APOB and can deliver cholesterol to artery walls leading
to the formation of atherosclerotic plaques (Sect. 10.2). HDLs have a high amount
of APOA1 and mediate the reverse cholesterol transport to the liver (Sect. 7.3).
Thus, in contrast to LDLs, high levels of HDLs are associated with reduced risk
for CVD. The ratio of APOB to APOA1 is the strongest predictor of CHD risk, but
the ratio of total cholesterol to HDL-cholesterol is equally predictive to this trait.
For example, an increase of total cholesterol of 5.2–6.2 mM is associated with a
three-­fold elevated risk of death from heart attack, while a HDL-cholesterol level
lower than 0.9 mM is the most common lipid disturbance of patients below the
age of 60.
The main lipids in lipoproteins are free and esterified cholesterol and triacylglyc-
erols (Fig. 10.4a). In triacylglycerol metabolism, hydrolyzed dietary fats enter intes-
tinal cells via fatty acid transporters. Through a vesicular pathway, MTTP
160 10 Heart Disease and the Metabolic Syndrome

Box 10.2 Lipoproteins

The composition of the four types of lipoproteins is listed.
Chylomicrons: With 50–200 nm diameter they represent the largest lipopro-
teins and show low density (< 1.006 g/ml). They are composed of approx.
85% triacylglycerols, 9% phospholipids, 4% cholesterol and 2% protein,
such as APOB48.
VLDLs: Very low density (0.95–1.006 g/ml) lipoproteins of 30–70 nm diam-
eter containing approx. 50% triacylglycerols, 20% cholesterol, 20% phos-
pholipids and 10% protein, such as APOB100.
LDLs: Low density (1.016–1.063 g/ml) lipoproteins of 20–25 nm diameter
that are composed of approx. 45% cholesterol, 20% phospholipids, 10%
triacylglycerols and 25% protein, such as APOB.
HDLs: High density (1.063–1.210 g/ml) lipoproteins with a diameter of
8–11 nm that are formed of approx. 40–55% protein, such as APOA1, 25%
phospholipids, 15% cholesterol and 5% triacylglycerols.

(microsomal triglycerole transfer protein) packs reconstituted triacylglycerols with

cholesteryl esters and APOB48 into chylomicrons. Chylomicrons also contain the
apolipoproteins APOA5, APOC2 and APOC3. In adipocytes, the enzyme DGAT1
(diacylglycerol O-acyltransferase 1) re-synthesizes triacylglycerols that had been
hydrolyzed by PNPLA2 and LIPE (hormone sensitive lipase). Chylomicron rem-
nants are taken up by hepatic LDLR or LRP1 (LDLR-related protein 1). In liver
cells, triacylglycerols are packaged with cholesterol and APOB100 into VLDLs.
The triacylglycerols in VLDLs are hydrolyzed releasing fatty acids and VLDL rem-
nants that are hydrolyzed by LIPC yielding LDLs. Sterols in the intestinal lumen
enter intestinal cells via the transporter NPC1L1 (Niemann-Pick C1-like protein 1)
and some are re-secreted by ABCG5 and ABCG8. In intestinal cells, dietary choles-
terol is packaged with triacylglycerols into chylomicrons. In hepatocytes, choles-
terol is recycled or synthesized de novo by a pathway, in which HMGCR is rate
limiting. LDLs transport cholesterol from the liver to the periphery, where they are
endocytosed. In HDL-cholesterol metabolism, APOA1 in HDLs mediates reverse
cholesterol transport by interacting with ABCA1 and ABCG1 transporters on non-­
hepatic cells. LCAT esterifies cholesterol for the use in HDL-cholesterol, which is
remodeled by CETP and LIPG (endothelial lipase), in order to enter hepatocytes.
In contrast to most other chronic inflammatory diseases, there is the potential to
remove the inflammatory stimulus in atherosclerosis. Lowering of plasma LDL lev-
els by drugs, such as statins that target HMGCR can prevent subendothelial reten-
tion of lipoproteins and thereby decrease inflammatory atherosclerotic disease. The
enzyme PCSK9 (proprotein convertase subtilisin/kexin type 9) binds to LDLR and
induces its degradation, which reduces the metabolism of LDL-cholesterol and can
lead to hypercholesterolemia (Fig. 10.4a). The inverse correlation between HDL
levels (causing increased triacylglycerol levels) and the risk of CHD is due to the
10.3 Lipoproteins and Dyslipidemias 161

SCARB1
LIVER
A
HMGCR X Peripheral
PCSK9 cell
X
PCSK9

APLDLR
INTESTINE TG B100

B100 LDL LDL

A5 C3 VLDL ABCA1
B48 LRP1
Free ABCG1
cholesterol B100 IDL
C2
LIPC HDL
CMR VLDL FA

NPC1L1 BLOODSTREAM
FA
PIPE
ABCG5/G8 DGAT1
PNPLA2
Intestinal
cell TG
FA FA transporter
ADIPOCYTE

0 1 10
B
FHC HLP1
FH HLP2A
FCH HLP2B
DBL HLP3
FHTG HLP4
MHL HLP5
ABL
HBL
TD
LCATD
HLD
CETPD
SITO
APOA5
APOE
ABCG5/G8
CETP
LIPC
LCAT
ABCA1
MTTP
LDLRAP1
PCSK9
APOB
LDLR
APOC2
LPL
Renal abnormalities
Enlarged tonsils
Splenomegaly
Fatty liver
Night blindness
Red blood cell abnormality
Coagulopathy
Myopathy
Ataxia
Peripheral neuropathy
Retinal abnormalities
Corneal abnormalities
Xanthelasma
Tendon xanthomata
Plantar xanthomata
Palmar xanthomata
Eruptive xanthomata
Pancreatitis
Peripheral vacular disease
Stroke
Coronary heart disease
Elevated plant sterols
Fasting chylomicronaemia
IDL present
HDL cholesterol
LDL cholesterol
Triglyceride
Total cholesterol

Common Rare
SNPs mutations

Molecular Clinical Biochemical

Fig. 10.4 Lipid metabolism and description of selected dyslipidemias. Details of lipid metabolism
are described in the text (a). Dyslipidemias and their defining features are listed in rows and col-
umns, respectively (b). The color intensity indicates for biochemical traits and for susceptibility to
CHD, stroke and peripheral vascular disease (white: no difference from normal; red: a fold-­
increase above normal; blue: a fold-decrease below normal), for qualitative clinical features (white:
absence of feature, i.e., normal state; red: presence of the feature), for rare mutations (white: no
role; red: a major etiologic role for the gene; pink: a minor etiologic role) and for common poly-
morphisms (white: no role; gradations of red: risk associated with the genotype). CETPD CETP
deficiency, FCH familial combined hyperlipidemia, FH familial hypercholesterolemia, FHC
familial hyperchylomicronemia, FHTG familial hypertriglyceridemia, HBL hypobetalipoprotein-
emia, HLD hepatic lipase deficiency, HLP hyperlipoproteinemia, LCATD LCAT deficiency, MHL
mixed hyperlipidemia, SITO sitosterolemia
162 10 Heart Disease and the Metabolic Syndrome

importance of HDL-cholesterol in reverse cholesterol transport from the periphery

to the liver (Sect. 7.3). The association between HDL-cholesterol and CHD is com-
plex, since HDLs contain a variety of proteins that are implicated in a number of
biological pathways, such as oxidation, inflammation, hemostasis and innate immu-
nity. This heterogeneity in the biological function of HDLs suggests that the mea-
surement of HDL-cholesterol levels alone is insufficient for reflecting the role of
HDLs in atherosclerosis.
Levels of certain plasma lipids and lipoproteins are key risk factors for
CVD. Some 10% of the hypercholesterolemia cases have a monogenic basis, such
as heterozygous familial hypercholesterolemia, familial defective APOB and auto-
somal dominant hypercholesterolemia that is based on a gain of function of the
PCSK9 gene (Fig. 10.4b). In contrast, different homozygous loss-of-function muta-
tions in the genes APOB or PCSK9 cause homozygous HBL (hypobetalipoprotein-
emia), in which almost no LDL-cholesterol is present. Homozygous mutations in
MTTP cause a similar disease called ABL (abetalipoproteinemia). Rare monogenic
disorders, such as TD (Tangier disease), affect HDL levels and are based on homo-
zygous mutations in the ABCA1 gene or deficiencies in the genes APOA1, LCAT,
CETP or LIPC. Moreover, there are also rare monogenic disorders causing severe
HTG (hypertriglycerolemia) that are due to homozygous loss-of-function mutations
of the genes LPL, APOC2 and APOA5.
Like in the case of monogenetic forms of obesity (Sect. 8.5) and T2D (Sect. 9.4),
the identification of the genes causing monogenic dyslipoproteinemias significantly
increased the understanding of the disease. For example, plasma LDL-cholesterol
levels depend crucially on LDLR function, which in turn requires proper binding of
APOB, the presence of LDLRAP1 (LDLR accessory protein 1) and intracellular
LDLR degradation by PCSK9. The majority of hypercholesterolemia cases is based
on common variants in genes, such as APOE, LDLR, APOB, PCSK9 and HMGCR
for LDL-cholesterol and CETP, LIPC, LPL, ABCA1, LIPG and LCAT for
­HDL-­cholesterol, that display low ORs or epigenetic programming (Sect. 5.4). The
genetic variants were identified either by SNP arrays or by targeted re-sequencing
(Fig. 10.5). For example, an excess of mutations in the NPC1L1 gene causes low
intestinal sterol absorption or heterozygous mutations in the LIPG gene lead to high
HDL levels.
The variations in lipoprotein levels that are based on common genetic variants
are often too small to be meaningful in the clinical practice. However, these insights
have a high value in basic research for the identification of novel pathways.
Moreover, (epi)genetic profiling of individuals for metabolic diseases, such as dys-
lipidemias, allows a genetic risk stratification far earlier than the onset of the meta-
bolic syndrome (Sect. 10.4). Such personalized medicine approaches will provide
for the respective individuals longer and more effective periods of lifestyle changes.
Since diet is a key determinant of lipoprotein levels, early dietary interventions
are the most efficient and most economic strategies for CVD prevention.
Furthermore, the results of biochemical assays, such as measurements of lipopro-
tein serum levels, should be integrated from multiple time points of the patient’s
lifetime.
10.4 Whole body’s Perspective of the Metabolic Syndrome 163

Trait frequency

Increasing plasma
concentration of
lipid or lipoprotein

Rare (ho) Rare (he) Common Rare (ho) Rare (he)

MTTP ABCA1 MTTP APOB ABCA1 APOB APOE CETP APOA5 APOB CETP LPL APOB CETP LPL
APOB APOA1 PSCK9 PCSK9 APOA1 PSCK9 LDLR ABCA1 LPL PCSK9 LIPC APOC2 PCSK9 LIPC APOC2
PCSK9 LCAT LCAT ANGPTL3 PCSK9 LIPC GCKR LDLR LIPG APOA5 LDLR APOA5
A
APOC3 FADS2,3 LIPG TRIB1 LDLRAP1 LMF1
APOB LPL CHREBP GPIHBP1
HMGCR GALNT2 GALNT2
LDL HDL TAG LDL HDL TAG SORT1 PLTP ANGPTL3 LDL HDL TAG
Cholesterol Cholesterol CILP2 MVK DOCK7 Cholesterol LDL HDL TAG
WWOX FADS1,2,3 Cholesterol
LIPC
APOB
CILP2
APOA5
LPL
GCKR
TRIB1
CHREBP
GALNT2
ANGPTL3
A

LDL HDL TAG

Cholesterol
Cholesterol

Fig. 10.5 Genetic variants affecting plasma lipoprotein distribution. The frequency of the traits
LDL-cholesterol, HDL-cholesterol and triacylglycerol levels (y axis) is plotted over plasma con-
centrations (x axis). The bottom and top fifth percentiles of the distribution are indicated by shaded
areas. The genes (no shading: by classical genetic or biochemical methods; orange: by re-­
sequencing; blue: by GWAS) that determine lipoprotein concentrations in specific segments of the
distribution are shown below the respective graphs. The extremes of the distribution represent
homozygotic (ho) monogenic disorders, the less extremes heterozygous (he) mutations and the
center common variants. The green shading indicates small to moderate effect sizes associated
with severe HTG

10.4 Whole body’s Perspective of the Metabolic Syndrome

Nowadays the metabolic syndrome is a very common aging-related condition that

occurs primarily as a result of overweight and obesity caused by a sedentary life-
style, i.e., physical inactivity, and the consumption of diet containing excess of calo-
ries (Sect. 8.4). The syndrome is composed of different factors that either alone or
in combination significantly increase the risk of T2D and CVDs. Most of these risk
factors have been discussed in the previous chapters, such as visceral obesity (Sect.
8.1), ectopic lipid overload (Sect. 9.2), insulin resistance (Sect. 9.2), β cell failure
(Sect. 9.3), hypertension (Sect. 10.1) and dyslipidemias with high plasma concen-
164 10 Heart Disease and the Metabolic Syndrome

Changes in
Caloric excess Physical inactivity
lifestyle

Primary factors
Visceral adiposity Ectopic lipid overload
underlying the
syndrome

Plasma lipids Insulin resistance

HDL reduced TAG elevated Inflammation Hypertension β cell failure Cardiac dysfunction

Atherosclerosis T2D

Microvascular disease
Myocardial infarction

HEART FAILURE

Fig. 10.6 Interactions of metabolic syndrome traits. Changes in lifestyle, such as increased con-
sumption of high-caloric diets combined with reduced physical activity, play important roles in the
worldwide dramatic increase in the metabolic syndrome. Visceral obesity, ectopic lipid overload,
dyslipidemias and insulin resistance are the primary factors underlying the syndrome. These fac-
tors cause inflammation, hypertension and β cell failure. Individuals with the metabolic syndrome
are therefore at increased risk for the development of atherosclerosis, T2D, microvascular diseases,
myocardial infarction and finally heart failure

trations of triacylglycerols and low concentrations of HDL-cholesterol (Sect. 10.3)

(Fig. 10.6). The dramatic worldwide increase in obesity and the parallel rise in
life expectancy, i.e., the increased number of elderly around the world, make
the metabolic syndrome a major global health problem.
Historically, the concept of “syndrome X” was used to describe the metabolic
syndrome in the end of 1980s as a condition with increased risk of T2D and CVD
caused by insulin resistance in metabolic tissues. Since then the National Cholesterol
Education Program (NCEP), the WHO, the European Group for the study of Insulin
Resistance (EGIR) and the International Diabetes Federation (IDF) used slightly
different thresholds to define the metabolic syndrome based on rate of obesity,
hyperglycemia, dyslipidemias and hypertension (Table 10.1). While the NCEP defi-
nition does not require any defined parameter, the WHO proposes that an evidence
of insulin resistance, such as impaired glucose tolerance, impaired fasting glucose
or T2D, is essential. In contrast, the EGIR emphasizes hyperinsulinemia as main
10.4 Whole body’s Perspective of the Metabolic Syndrome 165

Table 10.1 Definitions of the metabolic syndrome

NCEP (2005) WHO (1998) EGIR (1999) IDF (2005)
Absolutely None Insulin resistance Hyperinsulinemia Central obesity
required
Criteria Any of the 5 Insulin resistance or Hyperinsulinemia Obesity
below T2D
Plus 2 of 5 below Plus 2 of the 4 Plus 2 of the 4
below below
Obesity Waist Waist/hip ratio: Waist Central obesity
circumference: circumference:
Males > Males >0.90 Males > 94 cm
101.6 cm
Females > Females >0.85 Or Females > 80 cm
88.9 cm BMI > 30 kg/cm2
Hyperglycemia Fasting glucose Insulin resistance Insulin resistance Fasting glucose
> 5.6 mM > 5.6 mM
Dyslipidemia I Triacylglycerols Triacylglycerols > Triacylglycerols > Triacylglycerols
> 1.7 mM 1.7 mM 2.0 mM > 1.7 mM
Or HDL < 0.9 mM Or HDL < 1.0 mM
Dyslipidemia II HDL: HDL:
Males < 1.0 mM Males < 1.0 mM
Females Females
<1.25 mM <1.25 mM
Hypertension > 130 mm hg > 140/90 mm hg > 140/90 mm hg > 130 mm hg
systolic or systolic or
> 85 mm hg > 85 mm hg
diastolic diastolic
Other criteria Microalbuminuria

criterium, while for the IDF central obesity is essential. At present, the definitions
of NCEP and IDF are most widely used.
Our body has integrated mechanisms to become either catabolic, when energy
demands cannot be met by food intake, or anabolic, when calorie supply exceeds
energy demands. The key regulator of these mechanisms is insulin, which is
secreted by β cells in the pancreas after a meal and promotes carbohydrate resorp-
tion, energy utilization (via glycolysis), storage of carbohydrates (as glycogen),
storage of fat (as triacylglycerols) and synthesis of fat from carbohydrates (via
activating de novo lipogenesis) in key metabolic tissues. In parallel, insulin inhibits
lipolysis, i.e., the release of energy from triacylglycerols, and the synthesis of glu-
cose (via gluconeogenesis) after a meal. Thus, the actions of insulin create an
integrated set of signals that represent the nutrient availability and the energy
demands of our body. In turn, a disturbance in insulin actions, such as obesity-
triggered insulin resistance in one or multiple metabolic organs, such as skeletal
muscle, liver and WAT, often serves as the onset of the metabolic syndrome
(Fig. 10.7). These conditions can lead to organ-specific consequences, such as β
166 10 Heart Disease and the Metabolic Syndrome

CVD

HOMEOSTASIS OBESITY
Meal size
Lipotoxicity Weight
METABOLIC SYNDROME
Impaired
Brain regula
g tion
regulation HPT
NAFLD
Gut
SYSTEMIC LOW-GRADE hormones
FA
Liver INFLAMMATION

Effect on major FA
LIPOLYSIS metabolically
active organs
LONG-TERM ISLET
Insulin EXHAUSTION
resistance
Insulin
Insulin
resistance
Pancreas
WAT Glucotoxicity Glucose Insulin
uptake
Intestine

Hepatic T2D
glucose
Complications
VLDL
Skeletal muscle
secretion

Glucose
in circulation
Kidney Nerve Non-healing
Blindness
disease damage skin ulcers

TAG

FOOD INTAKE = ENERGY NEEDS FOOD INTAKE >> ENERGY NEEDS

Fig. 10.7 Whole body’s view on the metabolic syndrome. Under normal conditions, energy intake
and utilization is perfectly balanced with our body’s energy needs (left). Intestine, pancreas and
brain sense food after a meal and send signals to muscle, liver, fat and back to the brain, in order
to maintain metabolic homeostasis via the coordination of uptake and storage of nutrients and
energy production. The metabolic syndrome often starts with obesity, triggering a state of systemic
low-grade inflammation that affects various major organs involved in metabolic homeostasis
(right). The brain’s ability to regulate meal size or frequency is impaired leading to weight gain
and further organ dysfunction. The autonomic nervous system and the hypothalamic-pituitary-­
thyroid (HPT) axis are disrupted causing a change in the release of gut hormones. Insulin resis-
tance is a further important trigger of the metabolic syndrome. In the pancreas, the islets expand to
release more insulin (hyperinsulinemia) in an attempt to overcome insulin resistance of muscle,
liver and WAT. However, over time the islets become exhausted and little or no insulin is produced,
so that T2D occurs. Insulin resistance in the muscle leads to excessive glucose uptake in the liver
that is primarily converted to fatty acids often causing NAFLD. Moreover, in the liver, glucotoxic-
ity and insulin resistance result in inefficient downregulation of hepatic glucose production leading
to further increase of circulating glucose levels. The fat excess in the liver can be released into the
circulation as VLDLs leading to elevated serum triacylglycerol levels. Insulin resistance of adipose
tissue increases its lipolytic activity, thus also releasing excess fatty acids. All together these lipid
sources result in lipotoxicity that further contributes to organ dysfunction and disease, especially
CVD. Lipotoxicity and glucotoxicity worsen T2D and lead to numerous complications, such as
kidney disease, blindness, nerve damage and non-healing skin ulcers

cell failure and NAFLD, but also to systemic effects, such as glucotoxicity, lipotox-
icity and low-grade inflammation. All these conditions are key factors of the meta-
bolic syndrome and accelerate the risk of diabetes, heart disease and their
complications.
10.5 Metabolic Syndrome in Key Metabolic Organs 167

10.5 Metabolic Syndrome in Key Metabolic Organs

Systemic effects of the metabolic syndrome influence the metabolism in key meta-
bolic organs, such as liver, muscle, pancreas and WAT. Hepatic insulin resistance
causes elevated activity of the key gluconeogenesis enzymes G6PC and PCK, and
increased glycogenolysis, both leading to increased glucose output from the liver
(Fig. 10.8a). In parallel, the expression of enzymes that regulate glycogen synthesis
and glycolysis, such as GCK and pyruvate kinase, is reduced, driving GLUT2 to
transport glucose out of hepatocytes. All these alterations in the glucose metabolism
pathways accelerate systemic glucotoxicity. In addition, a decreased insulin sensi-
tivity in the liver increases the uptake of FFAs and the formation of triacylglycerols.
These are loaded to VLDLs for transport in the circulation and thus cause dyslipid-
emia. The increase of glucose levels in the liver increases lipogenesis via the activ-
ity of SREBF1 and FASN, which are both not impaired by insulin resistance. This
accumulation of lipids in liver can cause NAFLD. Hepatic insulin resistance also
contributes to hyperlipidemia through the downregulation of LDLR (Sect. 10.3). In
this way, liver insulin resistance causes decreased clearance of LDLs and VLDLs,
leading to increased LDL and VLDL levels in the circulation, respectively.
Skeletal muscle is the main tissue for glucose storage and utilization. After a
meal approximately 80% of the glucose load of the blood is taken up by the muscle.
Insulin resistance in muscles leads to reduced insulin-stimulated GLUT4-mediated
glucose transport into the myocytes (Fig. 10.8b). Decreased glucose uptake reduces
the levels of glucose-6-phosphate to be used for glycogen synthesis and glycolysis.
This increases the glucose concentration in the bloodstream and causes systemic
glucotoxicity. Like the liver, systemic lipotoxicity also overloads the muscle with
FFAs. These lipids are taken up and stored in form of triacylglycerols in intramus-
cular lipid droplets.
In the early stages of insulin resistance, β cells increase the production and secre-
tion of insulin, in order to maintain glucose tolerance (Fig. 10.9a). Since under these
conditions insulin is less potent in suppressing hepatic glucose production, the liver
becomes insulin resistant. When insulin resistance progresses, β cells lose their abil-
ity to compensate for decrease insulin response via an increase of insulin release.
This finally results in reduced circulating insulin concentrations and often comes
along with increased glucagon levels. This shift in the glucagon-insulin ratio leads
to a further rise in hepatic gluconeogenesis and advanced hyperglycemia occurs.
Systemic glucotoxicity and lipotoxicity, i.e., constant exposure of β cells to elevated
levels of glucose and lipids, both increase glucose metabolism in β cells and cause
metabolic stress leading to the unfolding protein response of the ER in these cells.
In response to ER stress, hypoxic stress and pro-inflammatory cytokines, the β cells
fail to proliferate and undergo uncontrolled autophagy or even apoptosis. This leads
to β cell dysfunction and ultimately their death.
In obesity, the storage capacity of adipocytes is often exceeded causing cellular
dysfunctions, such as increased formation of ceramides, ER stress and hypoxia
leading to reduced metabolic control and cell death. An increase in number and size
168 10 Heart Disease and the Metabolic Syndrome

OBESITY
A

Glucose Leptin
Insulin Adiponectin
resistance disposal
Insulin

Pancreas Skeletal muscle LIPOLYSIS

Plasma
Insulin
Circulating
immune cells White adipose tissue Re-routing
Ectopic lipids

Cytokines Resident liver

FA
Chemokines macrophage Hepatic
insulin
resistance Glucose
Cholesterol
gallstone Abnormalities in bile VLDL
FA
formation acid production secretion

Brain
LIPOLYSIS GLUCONEOGENESIS

Cortisol NAFLD
LIPOGENESIS
Dyslipidemia
Adrenal gland FA
KETOGENESIS VLDL
Atherosclerosis
Energy for CVD
Liver other organs

White adipose tissue

B Leptin
Adiponectin

Insulin
LIPOLYSIS Pancreas

Cytokines
Chemokines TAG
Postprandial Liver
Hyperinsulinemia
DE NOVO
INFLAMMATION LIPOGENESIS

FA
DAGs
Ceramides Glucose
Insulin uptake
resistance in
skeletal muscle
INCOMPLETE
β-OXIDATION Glycogen

Acyl-
carnitines
GLYCOGEN SYNTHESIS
Branched-chain Intramuscular
Skeletal muscle amino acids, ROS lipid droplets

Fig. 10.8 Metabolic syndrome in the liver and skeletal muscle. Early stages of the metabolic syn-
drome are associated with insulin resistance causing a decreased glucose disposal in skeletal mus-
cle. Obesity also alters the secretion pattern of adipokines, such as increased levels of leptin and
decreased adiponectin concentrations. Together this leads to a re-routing of glucose and lipids (as
a consequence of increased lipolysis from adipose tissue) to the liver (a). As intracellular lipid
levels in the liver rise, along with the increased plasma insulin, hepatic insulin signaling rapidly
deteriorates and this impairment turns the liver into a “co-conspirator” in the further progression
of the metabolic syndrome and its complications. Hepatic insulin resistance leads to increased
hepatic glucose production. Further hormones can contribute to decreased insulin sensitivity of the
10.6 Genetics and Epigenetics of the Metabolic Syndrome 169

of adipocytes also influences the secretion of adipokines. In addition, adipocytes

attract monocytes into WAT that become M1-type macrophages, secreting pro-­
inflammatory cytokines, together with adipokines leading to low-grade systemic
inflammation. All this contributes to insulin resistance in WAT causing a reduced
insulin-stimulated import of glucose via GLUT4 (Fig. 10.9b). Moreover, lipolysis is
increased due to the impaired inhibition of LIPE activity leading to an increase in
FFA release from adipocytes. The ability of insulin to stimulate the re-esterification
of FFAs is also impaired, and consecutively systemic lipotoxicity occurs.
The metabolic and inflammatory response of metabolic tissues, such as WAT,
integrates the actions of the innate immune system, i.e., primarily of the monocyte-­
derived macrophages, with those of adipocytes (Fig. 10.9b). This integrated action
of two or more different tissues has developed during evolution. Responses of the
immune system to pathogen invasions use substantial amounts of energy for new
protein synthesis and rapid growth of cells. Thus, under these conditions it makes
sense that metabolic organs are insulin insensitive, i.e., that they use less energy
from circulating glucose and lipids during limited time periods. For this reason,
inflammatory mediators control energy metabolism so that pathogens are defended
most efficiently, e.g., through the ability to shift rapidly from glucose oxidation to
lipid oxidation. With a similar protective attempt lipids can trigger insulin resis-
tance, in order to preserve glucose for glucose-dependent organs, such as the CNS
and erythrocytes.

10.6 Genetics and Epigenetics of the Metabolic Syndrome

GWAS analysis for central factors of the metabolic syndrome, such as BMI, T2D
and dyslipidemia, have identified for each of these traits highly statistically signifi-
cant associations with 40 to 100 genetic variants (Sects. 8.5, 9.6 and 10.3). The key
genes of these lists, such as LPL, APOE, MC4R, FTO and TCF7L2 (Table 10.2), are

Fig. 10.8 (continued) liver. For example, cortisol increases glucose production, promotes lipoly-
sis and increases lipid deposition. Insulin resistance increases the secretion of VLDLs from the
liver and causes dyslipidemia. Excessive hepatic secretion of VLDLs plays an important role in
promoting atherosclerosis and CVDs. Insulin resistance also increases intrahepatic fat accumula-
tion finally causing to NAFLD. Activation of inflammatory pathways occurs both systemically, as
a result of cytokines released from circulating immune cells, and locally through resident liver
macrophages. This further accelerates lipid accumulation and storage. Liver insulin resistance also
causes abnormalities in bile acid production and increases the risk for cholesterol gallstone forma-
tion. Insulin resistance in skeletal muscle causes reduced insulin-stimulated glucose uptake and
therefore less glucose is available for insulin-stimulated glycogen synthesis (b). Overload of lipids
increases the level of intramyocellular lipids in the form of DAG and ceramides as well as increases
in acyl-carnitines (due to incomplete mitochondrial fatty acid β-oxidation). Pro-inflammatory adi-
pokines, branched-­chain amino acids and ROS further contribute to this defect in insulin signaling.
Insulin resistance in skeletal muscle promotes post-prandial hyperinsulinemia and diversion of
ingested carbohydrates away from storage as glycogen in skeletal muscle to liver where they are
converted to triacylglycerols through increased hepatic de novo lipogenesis
170 10 Heart Disease and the Metabolic Syndrome

A
OBESITY
OBESIT β cell death
AMYLOID
DEPOSITION

β cell Pancreatic islet

Insulin expansion hypertrophy
β cell
OXIDATIVE STRESS
Insulin
Ins
ER STRESS
resistance

INFLAMMATION

β cell proliferation
and survival
Metabolic syndrome FA
Changes in signaling Circulation
Intestine Insulin
Peptide secretion Glucose
Leptin
Osteocalcin
Adiponectin

Glucose uptake
Glycolysis
Glycogenesis
Lipogenesis
Protein synthesis
Bone White adipose tissue Skeletal muscle Liver

B
TREG

M1-type macrophage INFLAMMATION

Cytokines
NECROSIS APOPTOSIS Chemokines
Cellular hypertrophy
and hyperplasia
Dead adipocyte
TLR4
TL
LR4

Adipocytes
LOCAL HYPOXIA
TNFR
TNF
Impaired
β3-adrenergic OXIDATIVE STRESS
stimulation ER STRESS IL6

Adipocytes
Leptin
Adiponectin Insulin
Brain sensitivity

Cortisol
Glucose
uptake
FA
Adrenal gland
LIPOGENESIS

Fig. 10.9 Metabolic syndrome in the pancreas and adipose tissue. Obesity promotes the develop-
ment of insulin resistance leading to compensatory increases in insulin release from β cells (a).
Chronic overproduction of insulin leads to β cell expansion, i.e., pancreatic islet hypertrophy. As
insulin resistance progresses, the effects of insulin on target tissues diminish, thereby leading to
impairments in glucose uptake, glycolysis, glycogenesis, lipogenesis and protein synthesis. This
leads to hyperglycemia and elevated FFA levels in the circulation that negatively affect β cell pro-
liferation and survival. This results in a vicious cycle that further reduces β cell function. In the
setting of the metabolic syndrome, many tissues show alterations in hormone levels that directly
10.6 Genetics and Epigenetics of the Metabolic Syndrome 171

also the central determinants for the genetic risk for the metabolic syndrome.
However, the dilemma with all these common SNPs remains that their individual
ORs are clearly below 2, i.e., they contribute considerably less than 100% increased
risk for the disease. This implies that the common SNPs can explain only a small
fraction of the cases of the metabolic syndrome. This suggests that socio-­
environmental factors and epigenetic mechanisms rather than variations of the
core genome play a role in the obesity epidemic and its associated metabolic
abnormalities.
Integrative genomic approaches can combine large-scale genome- and
transcriptome-­wide data, in order to construct gene networks that underlie meta-
bolic traits, such as plasma lipoproteins levels. For example, plasma HDL-­
cholesterol levels were linked to variants in the regulatory region of the VNN1
(vanin 1) gene using RNA expression profiles in lymphocytes. This type of analysis
indicates that metabolic traits are the products of molecular networks being modu-
lated by sets of complex genetic loci and environmental factors. This re-emphasizes
that the genetic predisposition for a metabolic disease, such as atherosclerosis,
is comprised of multiple common genetic variants that each have a small to
moderate effect on the trait, either alone or in combination with modifier genes
or environmental factors.
There are more and more epidemiological and clinical evidences that the DOHaD
concept (Sects. 5.4 and 9.6), i.e., a prenatal epigenetic programming in utero, may
be the key cause for the metabolic syndrome. So far, there is no comprehensive
analysis of the epigenome of persons suffering from the metabolic syndrome, i.e.,
no concrete genomic regions of elevated risks have been identified. However, it can
be assumed that due to the complexity of insulin signaling and its interference with
multiple pathways (Sect. 6.3) a high number of regions will be affected in an
individual-­specific way. Nevertheless, since epigenetic modifications respond
dynamically to environmental conditions (Chap. 5), there is potential for interven-
tion and reversibility.

Fig. 10.9 (continued) impact β cell function. The intestine changes the secretion of signaling
peptides, the bone secretes less osteocalcin and WAT secretes more leptin but less adiponectin.
These hormonal changes together with oxidative stress, ER stress, inflammation and intracellular
amyloid deposition cause β cell death. In the presence of excess energy supply WAT expands as a
result of cellular hypertrophy and hyperplasia (b). These enlarged adipocytes become dysregulated
through an increased rate of local necrosis, apoptosis and pro-inflammatory responses. Dead adi-
pocytes attract macrophages that are conventionally skewed towards an M1-like pro-inflammatory
profile. Under obese conditions there is also a reduction of TREG cells. This causes an increase in
the local pro-inflammatory environment that can ultimately spill over to systemic increases in pro-
inflammatory cytokines. The rapid tissue expansion during obesity leads to local hypoxia and the
activation of ER stress response causing a reduced release of insulin-sensitizing adipokines, such
as adiponectin. Moreover, increased levels of cortisol and the activation of TLRs and other pro-
inflammatory cytokine receptors, such as TNFR and IL6 receptors, further reduce insulin sensitiv-
ity. This leads to reduced rates of triacylglycerol synthesis, increasing levels of FFAs and a decrease
in insulin-­mediated glucose uptake. In contrast, the impaired β3-adrenergic response downstream
of SNS activity leads to reduced metabolic flexibility, since FFAs cannot be appropriately activated
in response to β3-adrenergic stimulation
172 10 Heart Disease and the Metabolic Syndrome

Table 10.2 Central genes in the development of metabolic syndrome

Gene Disease
locus Gene function context Affected parameter
LPL Hydrolyzes triacylglycerols (Sect. 3.4) Cardiovascular HDL concentration
APOE Removing lipoproteins from circulation Cardiovascular HDL concentration
(Sect. 10.3)
MC4R Membrane receptor on neurons binding Obesity Waist
α-MSH (Sect. 8.4) circumference
FTO Function mediated by IRX3 and IRX5 (Sect. Obesity Waist
8.7) circumference
TCF7L2 Transcription factor in β cells (Sect. 9.6) T2D Glucose
concentration

Healthy dietary patterns, such as Mediterranean or Nordic diet (Box 1.1), lower
the risk of the metabolic syndrome. Studies understanding the molecular mecha-
nism of diet on epigenetic programming in the prenatal, post-natal and adult
phases of life are of major importance, in order to understand how diet can
prevent the metabolic syndrome. Thus, cleverly designed dietary intervention
studies and observational studies will investigate the impact of individual nutrients,
such as vitamin D3 or PUFAs, within a healthy dietary pattern, in order to improve
the conditions of the metabolic syndrome. In these studies, a larger number of epig-
enome-, transcriptome-, proteome- and metabolome-wide data will need to be
integrated.

Additional Readings

Barroso I, McCarthy MI (2019) The genetic basis of metabolic disease. Cell 177:146–161
Drummond GR, Vinh A, Guzik TJ, Sobey CG (2019) Immune mechanisms of hypertension. Nat
Rev Immunol 19:517–532
Hunter PM, Hegele RA (2017) Functional foods and dietary supplements for the management of
dyslipidaemia. Nat Rev Endocrinol 13:278–288
Jensen MK, Bertoia ML, Cahill LE, Agarwal I, Rimm EB, Mukamal KJ (2014) Novel metabolic
biomarkers of cardiovascular disease. Nat Rev Endocrinol (11):659–672
Tall AR, Yvan-Charvet L (2015) Cholesterol, inflammation and innate immunity. Nat Rev Immunol
15:104–116
Glossary

Acute inflammation a short-term immunological process occurring in response to

tissue injury or microbe infection usually appearing within minutes or hours. It
is characterized by pain, redness, swelling and heat.
Adaptive introgression movement of genetic material from the genome of one
species into the genome of another through repeated interbreeding.
Admixture interbreeding between previously isolated populations.
Adipogenesis the process whereby fibroblast-like progenitor cells restrict their fate
to the adipogenic lineage, accumulate nutrients and become triglyceride-­filled
mature adipocytes.
Adipokines cytokines secreted by adipose tissue.
Adiponectin a peptide hormone produced in adipose tissue that is involved in regu-
lating glucose levels as well as fatty acid breakdown.
Anabolism the building-up aspect of metabolism, in which a set of metabolic path-
ways construct molecules from smaller units by the use of energy.
Anatomically modern humans individuals classified as Homo sapiens on the basis
of a set of morphological characteristics that distinguish them from other, now
extinct, archaic humans. According to the fossil record they emerged approxi-
mately 300,000 years ago.
Atherosclerosis a disease in which the inside of an artery narrows due to the build
up of plaque. It can result in coronary artery disease, stroke, peripheral artery
disease or kidney problems, depending on which arteries are affected.
Atherosclerotic plaques are the underlying entities of atherosclerotic diseases.
Autophagy a natural, regulated mechanism cells that removes unnecessary or dys-
functional components.
β-oxidation the catabolic process by which fatty acid molecules are broken down
in the mitochondria in eukaryotes, in order to generate acetyl-CoA.
Bioactive compound a type of chemical found in small amounts in plants and
certain foods, such as fruits, vegetables, nuts, oils and whole grains promoting
good health.

© Springer Nature Switzerland AG 2020 173

C. Carlberg et al., Nutrigenomics: How Science Works,
https://doi.org/10.1007/978-3-030-36948-4
174 Glossary

Bromodomain a protein module of ~110 amino acids that mediates interaction

with acetylated lysines and is often found in HATs and ATP-dependent chroma-
tin remodeling proteins.
Brown adipose tissue (BAT) Highly specialized adipose tissue, the main function
of which is to produce heat (thermogenesis).
Calorie restriction a dietary regimen that reduces calorie intake daily without
incurring malnutrition or a reduction in essential nutrients.
Cancer a group of diseases involving abnormal cell growth with the potential to
invade or spread to other parts of the body.
Cardiovascular disease (CVD) a class of diseases that involve the heart or blood
vessels, such as coronary artery diseases, stroke, heart failure and more.
Catabolism the set of metabolic pathways breaking down molecules into smaller
units that are either oxidized to release energy or used in anabolic reactions.
Chromatin the molecular substance of chromosomes being a complex of genomic
DNA and histone proteins.
Chromatin immunoprecipitation followed by sequencing (ChIP-seq) a method
for genome-wide mapping of the distribution of histone modifications and chro-
matin associated proteins that relies on immunoprecipitation with antibodies to
modified histones or other chromatin proteins. The enriched DNA is sequenced
to create genome-wide profiles.
Chromatin modifying enzymes/chromatin modifiers proteins that are either
recognizing (reading) chromatin (i.e., post-translationally modified histones and
methylated genomic DNA), adding (writing) marks or removing (erasing) them.
Chromodomain a modular methyl-binding domain of 40–50 amino acids that is
commonly found in chromatin remodeling proteins.
Chronic inflammation long-term inflammation lasting for prolonged periods of
several months to years. Chronic inflammation plays a central role in most com-
mon non-communicable diseases, such as cancer, T2D, asthma and Alzheimer’s.
Circadian clock a biochemical oscillator that cycles with a stable phase and is
synchronized with solar time.
CpG CG dinucleotides (the “p” indicates the phosphate linking the two nucleo-
sides). Out of 16 possible dinucleotides, CpGs are the only ones that can be
methylated symmetrically; i.e., DNA methylation can be inherited only via CpGs
to both daughter cells.
Cytokines a category of small proteins (~5–20 kDa) that are important in cell sig-
naling involved in autocrine, paracrine and endocrine signaling as immunomod-
ulating agents.
Damage-associated molecular patterns (DAMPs) also known as alarmins,
are molecules often released by stressed cells undergoing necrosis that act as
endogenous danger signals to promote and exacerbate inflammatory responses.
Examples of non-protein DAMPs include cholesterol crystals and SFAs. DAMPs
are associated with many inflammatory diseases, including arthritis, atheroscle-
rosis, Crohn’s disease and cancer.
Diploid an organism or cell with a double set of chromosomes, so that each posi-
tion is represented by two genes or alleles.
Glossary 175

DNA methylation the covalent addition of a methyl group to the C5 position of

cytosine.
DNA methyltransferases (DNMTs) family of enzymes catalyzing the transfer of
a methyl group to cytosines of genomic DNA.
Developmental Origins of Health and Disease (DOHaD) an approach to investi-
gate the role of prenatal and perinatal exposure to environmental factors, such as
undernutrition, in determining the development of human diseases in adulthood.
Dyslipidemia an abnormal amount of lipids, such as triglycerides, cholesterol and/
or fat phospholipids, in the blood.
Embryogenesis the process by which an embryo forms and develops. In mammals,
the term is use exclusively to the early stages of prenatal development, whereas
the terms fetus and fetal development describe later stages.
Energy balance a measurement of the biological homeostasis of energy in living
systems.
Enhancer a stretch of genomic sequence that (like a promoter) contains clusters
of transcription factor binding sites that regulate a gene within the same TAD.
Epigenetic drift a divergence of the epigenome as a function of age due to stochas-
tic changes in DNA methylation or stable histone modifications.
Epigenetic epidemiology the study of the relationship between epigenetic variants
and disease phenotype in the population.
Epigenetic memory a heritable change in gene expression that is induced by a
previous developmental or environmental stimulus. It requires chromatin-­based
changes, such as DNA methylation, histone modifications or incorporation of
variant histones.
Epigenetic programming the process leading to stable and long-lasting altera-
tions of the epigenome based on specific covalent modifications of the DNA and
histones.
Epigenetics the study of heritable changes in gene function that do not involve
changes in the DNA sequence. Epigenetic mechanisms include the covalent
modifications of DNA and histones.
Epigenome the complete set of epigenetic modifications across an individual’s
genome.
Epigenomics studies of the epigenome.
Expression quantitative trait locus (eQTL) genomic loci that explain all or a
fraction of variation in expression levels of mRNAs.
Euchromatin light-staining, decondensed and transcriptionally accessible regions
of the genome.
Evolution change in the heritable characteristics of biological populations over
successive generations.
Evolutionary pressure any cause that reduces reproductive success in a portion of
a population driving natural selection.
Gene expression process by which information from a gene is used in the synthe-
sis of a functional gene product. These products are often proteins, but can also
be ncRNAs.
176 Glossary

Genetic architecture the landscape of genetic contributions to a given phenotype.

It comprises the number of genetic variants that influence a phenotype, the size
of their effects on the phenotype, the frequency of those variants in the popula-
tion and their interactions with each other and the environment.
Genetic drift changes in genetic variation over time that are due to random (by
chance) processes, i.e., different from natural selection in evolution.
Gene regulatory networks represent units of interacting proteins that are func-
tionally constrained by defined regulatory relationships. These interactions
provide a structure and determine an output in the form of a pattern of gene
expression. Networks are usually visualized by nodes (proteins) and edges (their
interactions).
Genome the complete haploid DNA sequence of an organism comprising all cod-
ing genes and far larger non-coding regions. The genome of all 400 tissues and
cell types of an individual is identical and constant over time (with the exception
of cancer cells).
Genome-wide association study (GWAS) studies that aim to identify genetic loci
(mostly SNPs) associated with an observable trait, disease or condition.
Genotype the genetic makeup of an organism, i.e., its complete heritable genetic
identity.
Glucagon a peptide hormone produced by α cells of the pancreas raising the con-
centration of glucose and fatty acids in the bloodstream.
Gluconeogenesis a metabolic pathway for the synthesis of glucose from precursor
substrates, such as lactate and amino acids.
Glucotoxicity the toxic effects of excessive levels of glucose in the blood (as in
T2D).
Glycemic index a number from 0 to 100 (for pure glucose) representing the rela-
tive rise in the blood glucose level 2 h after consumption.
Glycogenolysis the breakdown of glycogen to glucose-1-phosphate.
Glycogenesis the process of glycogen synthesis, in which glucose molecules are
added to chains of glycogen for storage.
Glycolysis the metabolic pathway converting glucose into pyruvate.
Haploid a single set of chromosomes.
Haplotype block a genomic region with no evidence of a history of genetic
recombination.
Healthspan the duration of disease-free physiological health within the lifespan
of an individual. In human, for instance, this corresponds to the period of high
cognitive abilities, immune competence and peak physical condition.
Hematopoiesis the formation of blood cellular components derived from HSCs.
Hematopoietic stem cells (HSCs) stem cells located in the bone marrow that can
develop into all types of blood cells.
Heritability the proportion of total variation between individuals within a popula-
tion that is due to genetic factors.
Heterochromatin dark-staining, condensed and gene-poor regions of the genome.
High-density lipoprotein (HDL) an 8–11 nm high-density (1.063–1.210 g/ml)
lipoprotein with 40–55% protein (with APOA1 as the major apolipoprotein),
Glossary 177

25% phospholipids, 15% cholesterol and 5% triglycerides. HDL particles carry

cholesterol from peripheral tissues to the liver.
Histone code an epigenetic code that is based on post-translational modifications
of histone proteins. The histone modifications serve to recruit other proteins by
specific recognition of the modified histone via specialized protein domains. The
code comprises more than 130 post-translational modifications serving as an
“alphabet” for the instructions, how the epigenome directs transcriptional regu-
lation and stores information.
Homeostasis the state of steady internal physical and chemical conditions main-
tained by living systems.
Hyperglycemia permanently elevated blood glucose levels as a result of an insuf-
ficient use or production of insulin.
Hyperplasia formation of new cells through differentiation of resident precursors.
Hypertension a long-term medical condition, in which the aterial blood pressure
is persistently elevated.
Hypertrophy increase in size of existing cells.
Impaired glucose tolerance blood glucose levels that are raised beyond normal
levels (7.8–11.0 mM 2 h after a 75 g OGTT) but not high enough to warrant a
diabetes diagnosis.
Imprinted genes represent more than 100 human genes that are expressed in a
parent-or-origin manner, i.e., this epigenetic phenomenon is independent of clas-
sical Mendelian inheritance.
Inflammaging a chronic low-grade inflammation developing with advanced age
and accelerating the process of biological aging and worsening many age-related
diseases.
Inflammasome a supramolecular complex responsible for the CASP1- dependent
maturation of IL1B and IL18 in response to microbial products or other danger
signals.
Insulin a peptide hormone produced by β cells of the pancreatic islets serving as
the main anabolic hormone of the body.
Insulin resistance a pathological condition, in which the systemic and cellular
response to insulin action is impaired.
Integrative personal omics profiling (iPOP) an analysis method that combines
genomic, transcriptomic, proteomic, metabolomic and autoantibody profiles
from individuals in a longitudinal over a period of multiple months to years.
Lactase persistence the continued activity of the lactase enzyme in adulthood.
Linkage analysis an approach attempting to identify regions in chromosomes that
co-segregate with the trait of interest in related individuals.
Linkage disequilibrium an association between two alleles that are located so
close to each other on the genome that they are inherited together more fre-
quently than expected by chance.
Lipogenesis a metabolic pathway for the synthesis of fatty acids and triglycerides.
Lipolysis the metabolic pathway through which lipid triglycerides are hydrolyzed
into glycerol and three fatty acids.
178 Glossary

Lipoproteins a vesicle whose primary purpose is to transport lipids in water, such

as in blood plasma or other extracellular fluids.
Lipotoxicity a cellular dysfunction arising from accumulation of lipid intermedi-
ates in cells other than adipocytes.
Low-density lipoprotein (LDL) a 20–25 nm low-density (1.016–1.063 g/ml) lipo-
protein with ~45% cholesterol, 20% phospholipids, 10% triglycerides and 25%
protein (with APOB as the major apolipoprotein).
Macrophage a type of white blood cell engulfs and digesting cellular debris, for-
eign substances, microbes and cancer cells in a process called phagocytosis.
Massive parallel sequencing also called next-generation sequencing (NGS), high-
throughput approach to DNA sequencing using the concept of massively parallel
processing.
Metabolic syndrome a cluster of conditions, such as increased blood pressure,
high blood sugar, excess body fat around the waist and abnormal cholesterol or
triglyceride levels, that occur together, increasing the risk of heart disease, stroke
and T2D.
Metaflammation low levels of inflammation throughout the body due to excessive
nutrient consumption.
Meiotic recombination the reciprocal physical exchange of chromosomal DNA
between the parental chromosomes occurring at meiosis during spermatogenesis
and oogenesis.
Missing heritability the fact that genetic variations cannot account for all of the
heritability of diseases, behaviors and other phenotypes.
Monocytes leukocytes of the innate immune system that can differentiate into
macrophages and myeloid lineage DCs.
Myocardial infarction also known as a heart attack occurring when blood flow
decreases or stops to a part of the heart, causing damage to the heart muscle.
Myokines small proteins or proteoglycans that are released by myocytes upon con-
traction to mediate autocrine, paracrine or endocrine effects.
Neutrophils the most abundant type of granulocytes and the most abundant type of
white blood cells belonging to the innate immune system.
Non-alcoholic fatty liver disease (NAFLD) A very common disease in humans in
which there is an excessive accumulation of fat in the liver (steatosis) in individu-
als who are not alcoholic.
Non-coding RNA (ncRNA) an RNA molecule that is not translated into a protein.
Non-communicable disease a disease that is not transmissible directly from one
person to another, such as autoimmune diseases, CDVs, most cancers, diabetes
and Alzheimer’s disease.
Nuclear receptor a transcription factor that can be activated by a small lipophilic
ligand in the size of cholesterol.
Nucleosome a basic unit of DNA packaging in eukaryotes, consisting of 147 bp of
genomic DNA wound around a histone octamer.
Nutrigenomics a discipline studying the relationship between human genome,
nutrition and health.
Glossary 179

Obesity a medical condition in which excess body fat has accumulated to an extent
that it may have a negative effect on health.
Odds ratio (OR) the mathematical expression of the relation between the presence
or absence of a variant, e.g., a SNP, and the presence or absence of a trait, e.g., a
disease, in the population.
Oxidative phosphorylation the metabolic pathway in which cells use enzymes to
oxidize nutrients, thereby releasing energy, which is used to produce ATP.
Pattern recognition receptors evolutionarily conserved receptors that elicit
inflammation and innate immunity upon recognition of conserved microbial
products or endogenous danger signals, such as DAMPs.
Pathogen-associated molecular patterns (PAMPs) small molecular motifs
derived from microbes, such a lipopolysaccharides. They are recognized by toll-
like receptors and other pattern recognition receptors on the surface of cells of
the innate immune system.
Personalized nutrition a conceptual analog to personalized medicine, where indi-
viduals are recommended to take certain food products based on nutrigenomics
approaches.
Phenotype primarily physical, externally visible traits of an organism, but also
may include internal and microscopic or biochemical traits.
Polygenic risk scores a weighted sum of the number of risk alleles carried by an
individual, where the risk alleles and their weights are defined by the loci and
their measured effects as detected by genome wide association studies.
Post-translational modifications covalent modifications, such as phosphoryla-
tions, acetylations or methylations, by which most proteins reach their full func-
tional profile. Due to post-translational modifications the proteome is far more
complex than the transcriptome and also varies a lot in response to extra- and
intracellular signals.
Promoter stretches of genomic DNA for productive transcription initiation encom-
passing at least one TSS.
Proteome in analogy to the transcriptome, the complete set of all expressed pro-
teins in a given tissue of cell type. The proteome depends on the transcriptome,
but is not its 1:1 translation.
Quantitative trait loci (QTLs) genomic regions at which genetic variation is asso-
ciated with molecular variation across individuals. For example, individuals with
a particular single nucleotide variant have altered expression levels of a gene
(eQTL), altered DNA methylation (meQTL; also known as mQTL) or altered
chromatin state (chromQTL).
RNA sequencing (RNA-seq) a method using massive parallel sequencing to reveal
the presence and quantity of RNA in a biological sample at a given moment.
(Retro)transposon a transposon (also called transposable element or “jumping
DNA”) is a DNA sequence that can change its position within a genome. When
this transposition is mediated via an RNA intermediate, the term retrotransposon
is used.
180 Glossary

Reverse cholesterol transport a multi-step process resulting in the net movement

of cholesterol from peripheral tissues back to the liver first via entering the lym-
phatic system and the bloodstream.
Signal transduction pathway a process by which a chemical or physical signal is
transmitted through a cell membrane as a series of molecular events, such as pro-
tein phosphorylation catalyzed by protein kinases. Mostly, signal transduction
pathways end in the activation of a transcription factor or a chromatin modifier.
Single nucleotide polymorphism (SNP) a substitution of a single nucleotide at
a specific position in the genome, which is present to some appreciable degree
within a population (e.g., more than 1%).
Sirtuins (SIRTs) a family of seven NAD+-dependent HDACs that are structurally
and mechanistically distinct from Zn2+-dependent HDACs. Sirtuins influence a
wide range of cellular processes such as aging, transcription, apoptosis, inflam-
mation and stress resistance.
Stenosis is an abnormal narrowing in a blood vessel.
Stroke a medical condition in which poor blood flow to the brain results in cell
death.
Thermogenesis a process by which cells generate heat.
Toll-like receptor (TLR) a class of PPRs that play a key role in the innate immune
system.
Trait a distinguishing quality or characteristic belonging to a person.
Transcription factors proteins that sequence-specifically bind to genomic
DNA. Our genome encodes approximately 1600 transcription factors, referred to
as trans-acting factors, since they are not encoded by the same genomic regions,
which they are controlling. Accordingly, the process of transcriptional regulation
by transcription factors is often called trans-activation.
Transcription start sites (TSSs) nucleotides within a promoter that are the first to
be transcribed by Pol II into a particular RNA.
Transcriptome the complete set of all transcribed RNA molecules of a tissue or
cell type. It significantly differs between tissues and depends on extra- and intra-
cellular signals.
Transgenerational epigenetic inheritance transmission of epigenetic information
that is passed on to gametes without alteration of the DNA sequence.
Transrepression a process whereby one protein represses (i.e., inhibits) the activ-
ity of a second protein through a protein-protein interaction.
Tricarboxylic acid (TCA) cycle a series of chemical reactions used by all aerobic
organisms to release stored energy through the oxidation of acetyl-CoA derived
from carbohydrates, fats, and proteins.
Type 2 diabetes (T2D) a form of diabetes being characterized by high serum glu-
cose levels, insulin resistance and relative lack of insulin.
Unfolded protein response a cellular stress response of the ER.
Variant a difference from the reference or standard sequence, i.e., a polymorphic
site, including SNPs and structural deletions or insertions (indels). It can also
encompass much larger chromosomal rearrangements (translocations, duplica-
tions, or deletions) that result in CNVs.
Glossary 181

Western diet a dietary pattern characterized by high intakes of red meat, processed
meat, prepackaged foods, butter, fried foods, high-fat dairy products, eggs,
refined grains, potatoes, corn and high-sugar drinks.
White adipose tissue (WAT) the major type of adipose tissue primarily storing
triglycerides in one large vacuole per cell.
Zoonotic pathogens pathogens naturally transmitted between animals and humans.