Data Mining: Data
Lecture Notes for Chapter 2
Introduction to Data Mining , 2nd Edition
by
Tan, Steinbach, Kumar
01/27/2021 Introduction to Data Mining, 2nd Edition 1
Tan, Steinbach, Karpatne, Kumar
Outline
Attributes and Objects
Types of Data
Data Quality
Data Preprocessing
Similarity and Distance
01/27/2021 Introduction to Data Mining, 2nd Edition 2
Tan, Steinbach, Karpatne, Kumar
What is Data?
Collection of data objects Attributes
and their attributes
An attribute is a property or Tid Refund Marital Taxable
Status Income Cheat
characteristic of an object
1 Yes Single 125K No
– Examples: eye color of a
2 No Married 100K No
person, temperature, etc.
3 No Single 70K No
– Attribute is also known as
variable, field, characteristic, 4 Yes Married 120K No
Objects
dimension, or feature 5 No Divorced 95K Yes
A collection of attributes 6 No Married 60K No
describe an object 7 Yes Divorced 220K No
8 No Single 85K Yes
– Object is also known as
record, point, case, sample, 9 No Married 75K No
entity, instance, vector, or 10 No Single 90K Yes
observation
10
Attribute Values
Attribute values are numbers or symbols assigned to
an attribute for a particular object
Distinction between attributes and attribute values
– Same attribute can be mapped to different attribute
values
Example: height can be measured in feet or meters
– Different attributes can be mapped to the same set of
values
Example: Attribute values for ID and age are integers
– But properties of attribute can be different than the
properties of the values used to represent the attribute
01/27/2021 Introduction to Data Mining, 2nd Edition 4
Tan, Steinbach, Karpatne, Kumar
Measurement of Length
The way you measure an attribute may not match the
attributes properties.
5 A 1
B
7 2
C
This scale This scale
8 3
preserves preserves
only the the ordering
ordering D and
property of additivity
length. 10 4 properties of
length.
E
15 5
Properties of Attribute Values
The type of an attribute depends on which of the
following properties/operations it possesses:
– Distinctness: = and =
– Order: <, < , >, and >
– Addition + and -
– Multiplicaton * and /
– Nominal attribute: distinctness
– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & meaningful
differences
– Ratio attribute: all 4 properties/operations
01/27/2021 Introduction to Data Mining, 2nd Edition 6
Tan, Steinbach, Karpatne, Kumar
Types of Attributes
There are different types of attributes
– Nominal
Examples: ID numbers, eye color, zip codes
– Ordinal
Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height {tall, medium, short}
– Interval
Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
Examples: temperature in Kelvin, length, counts, elapsed
time (e.g., time to run a race)
01/27/2021 Introduction to Data Mining, 2nd Edition 7
Tan, Steinbach, Karpatne, Kumar
Types of Attributes - Nominal
01/27/2021 Introduction to Data Mining, 2nd Edition 8
Tan, Steinbach, Karpatne, Kumar
Types of Attributes - Ordinal
01/27/2021 Introduction to Data Mining, 2nd Edition 9
Tan, Steinbach, Karpatne, Kumar
Types of Attributes - Interval
01/27/2021 Introduction to Data Mining, 2nd Edition 10
Tan, Steinbach, Karpatne, Kumar
Types of Attributes - Ratio
01/27/2021 Introduction to Data Mining, 2nd Edition 11
Tan, Steinbach, Karpatne, Kumar
Difference Between Ratio and Interval
Is it physically meaningful to say that a
temperature of 10 ° is twice that of 5° on
– the Celsius scale?
– the Fahrenheit scale?
– the Kelvin scale?
Consider measuring the height above average
– If Bill’s height is three inches above average and
Bob’s height is six inches above average, then would
we say that Bob is twice as tall as Bill?
– Is this situation analogous to that of temperature?
01/27/2021 Introduction to Data Mining, 2nd Edition 12
Tan, Steinbach, Karpatne, Kumar
Different attribute types
Attribute Description Examples Operations
Type
Nominal Nominal attribute zip codes, employee mode, entropy,
values only ID numbers, eye contingency
distinguish. (=, ) color, sex: {male, correlation, 2
Categorical
Qualitative
female} test
Ordinal Ordinal attribute hardness of minerals, median,
values also order {good, better, best}, percentiles, rank
objects. grades, street correlation, run
(<, >) numbers tests, sign tests
Interval For interval calendar dates, mean, standard
attributes, temperature in deviation,
differences between Celsius or Fahrenheit Pearson's
Quantitative
Numeric
values are correlation, t and
meaningful. (+, - ) F tests
Ratio For ratio variables, temperature in Kelvin, geometric mean,
both differences and monetary quantities, harmonic mean,
ratios are counts, age, mass, percent variation
meaningful. (*, /) length, current
This categorization of attributes is due to S. S. Stevens
Transformations that define attribute levels
Attribute Transformation Comments
Type
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Categorical
Qualitative
Ordinal An order preserving change of An attribute encompassing
values, i.e., the notion of good, better best
new_value = f(old_value) can be represented equally
where f is a monotonic function well by the values {1, 2, 3} or
by { 0.5, 1, 10}.
Interval new_value = a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
Quantitative
Numeric
differ in terms of where their
zero value is and the size of a
unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.
This categorization of attributes is due to S. S. Stevens
Discrete and Continuous Attributes
Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a
collection of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete
attributes
Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and
represented using a finite number of digits.
– Continuous attributes are typically represented as floating-
point variables.
01/27/2021 Introduction to Data Mining, 2nd Edition 15
Tan, Steinbach, Karpatne, Kumar
Asymmetric Attributes
Only presence (a non-zero attribute value) is regarded as
important
Words present in documents
Items present in customer transactions
If we met a friend in the grocery store would we ever say
the following?
“I see our purchases are very similar since we didn’t buy most of
the same things.”
01/27/2021 Introduction to Data Mining, 2nd Edition 16
Tan, Steinbach, Karpatne, Kumar
Critiques of the attribute categorization
Incomplete
– Asymmetric binary
– Cyclical
– Multivariate
– Partially ordered
– Partial membership
– Relationships between the data
Real data is approximate and noisy
– This can complicate recognition of the proper attribute type
– Treating one attribute type as another may be approximately
correct
01/27/2021 Introduction to Data Mining, 2nd Edition 17
Tan, Steinbach, Karpatne, Kumar
Key Messages for Attribute Types
The types of operations you choose should be
“meaningful” for the type of data you have
– Distinctness, order, meaningful intervals, and meaningful
ratios are only four (among many possible) properties of data
– The data type you see – often numbers or strings – may not
capture all the properties or may suggest properties that are
not present
– Analysis may depend on these other properties of the data
Many statistical analyses depend only on the distribution
– In the end, what is meaningful can be specific to domain
01/27/2021 Introduction to Data Mining, 2nd Edition 18
Tan, Steinbach, Karpatne, Kumar
Important Characteristics of Data
– Dimensionality (number of attributes)
High dimensional data brings a number of challenges
– Sparsity
Only presence counts
– Resolution
Patterns depend on the scale
– Size
Type of analysis may depend on size of data
01/27/2021 Introduction to Data Mining, 2nd Edition 19
Tan, Steinbach, Karpatne, Kumar
Types of data sets
Record
– Data Matrix
– Document Data
– Transaction Data
Graph
– World Wide Web
– Molecular Structures
Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data
01/27/2021 Introduction to Data Mining, 2nd Edition 20
Tan, Steinbach, Karpatne, Kumar
Record Data
Data that consists of a collection of records, each
of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
01/27/2021 Introduction to Data Mining, 2nd Edition 21
Tan, Steinbach, Karpatne, Kumar
Transaction Data
A special type of data, where
– Each transaction involves a set of items.
– For example, consider a grocery store. The set of products
purchased by a customer during one shopping trip constitute a
transaction, while the individual products that were purchased are the
items.
– Can represent transaction data as record data
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
01/27/2021 Introduction to Data Mining, 2nd Edition 22
Tan, Steinbach, Karpatne, Kumar
Data Matrix
If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
Such a data set can be represented by an m by n matrix,
where there are m rows, one for each object, and n
columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load
10.23 5.27 15.22 2.7 1.2
12.65 6.25 16.22 2.2 1.1
01/27/2021 Introduction to Data Mining, 2nd Edition 23
Tan, Steinbach, Karpatne, Kumar
Document Data
Each document becomes a ‘term’ vector
– Each term is a component (attribute) of the vector
– The value of each component is the number of times
the corresponding term occurs in the document.
timeout
season
coach
game
score
play
team
win
ball
lost
Document 1 3 0 5 0 2 6 0 2 0 2
Document 2 0 7 0 2 1 0 0 3 0 0
Document 3 0 1 0 0 1 2 2 0 3 0
01/27/2021 Introduction to Data Mining, 2nd Edition 24
Tan, Steinbach, Karpatne, Kumar
Graph Data
Examples: Generic graph, a molecule, and webpages
2
5 1
2
5
Benzene Molecule: C6H6
01/27/2021 Introduction to Data Mining, 2nd Edition 25
Tan, Steinbach, Karpatne, Kumar
Ordered Data
Sequences of transactions
Items/Events
An element of
the sequence
01/27/2021 Introduction to Data Mining, 2nd Edition 26
Tan, Steinbach, Karpatne, Kumar
Ordered Data
Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
01/27/2021 Introduction to Data Mining, 2nd Edition 27
Tan, Steinbach, Karpatne, Kumar
Ordered Data
Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean
01/27/2021 Introduction to Data Mining, 2nd Edition 28
Tan, Steinbach, Karpatne, Kumar
Data Quality
Poor data quality negatively affects many data processing
efforts
Data mining algorithms gives results(extracts) only what is
there in the data.
If data quality issues are not handled carefully, then Data
mining algorithms will produce erroneous or spurious
output.
Data mining example: a classification model for detecting
people who are loan risks is built using poor data
– Some credit-worthy candidates are denied loans
– More loans are given to individuals that default
01/27/2021 Introduction to Data Mining, 2nd Edition 29
Tan, Steinbach, Karpatne, Kumar
Data Quality ..
To overcome the poor data quality problem, Data mining
focuses on:
1) The detection and correction of data quality problem ( is
often called data cleaning)
2) The use of algorithms that can tolerate poor data quality
01/27/2021 Introduction to Data Mining, 2nd Edition 30
Tan, Steinbach, Karpatne, Kumar
Data Quality …
What kinds of data quality problems?
How can we detect problems with the data?
What can we do about these problems?
Examples of data quality problems:
– Noise and outliers
– Wrong data
– Fake data
– Missing values
– Duplicate data
01/27/2021 Introduction to Data Mining, 2nd Edition 31
Tan, Steinbach, Karpatne, Kumar
Noise
For objects, noise is an extraneous object
For attributes, noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor phone and
“snow” on television screen
– The figures below show two sine waves of the same magnitude and
different frequencies, the waves combined, and the two sine waves with
random noise
The magnitude and shape of the original signal is distorted
Two sine waves Observed signal (sum of the two sine waves) Observed signal with noise
1 3 3
0.8
2 2
0.6
0.4
1 1
0.2
magnitude
magnitude
magnitude
0 0 0
-0.2
-1 -1
-0.4
-0.6
-2 -2
-0.8
-1 -3 -3
0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5 0 0.1 0.2 0.3 0.4 0.5
time (seconds) time (seconds) time (seconds)
01/27/2021 Introduction to Data Mining, 2nd Edition 32
Tan, Steinbach, Karpatne, Kumar
Outliers
Outliers are data objects with characteristics that
are considerably different than most of the other
data objects in the data set
–
For example: In fraud and
network intrusion detection,
the goal is to find unusual
objects or events from
among a large number of
normal ones.
01/27/2021 Introduction to Data Mining, 2nd Edition 33
Tan, Steinbach, Karpatne, Kumar
Missing Values
Reasons for missing values
– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
Handling missing values
– Eliminate data objects or variables
– Estimate missing values
Example: time series of temperature
Example: census results
– Ignore the missing value during analysis
– Replace with all possible values(weighted by their probabilities)
01/27/2021 Introduction to Data Mining, 2nd Edition 34
Tan, Steinbach, Karpatne, Kumar
Duplicate Data
Data set may include data objects that are
duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeneous
sources
Examples:
– Same person with multiple email addresses
Data cleaning
– Process of dealing with duplicate data issues
01/27/2021 Introduction to Data Mining, 2nd Edition 35
Tan, Steinbach, Karpatne, Kumar
Data Quality - In a nutshell
Data mining algorithms gives results(extracts) only what is
there in the data.
If data quality issues are not handled carefully, then Data
mining algorithms will produce erroneous or spurious output.
So the Preprocessing is indeed a very important step to
solve the data quality problems. (next topic)
01/27/2021 Introduction to Data Mining, 2nd Edition 36
Tan, Steinbach, Karpatne, Kumar
Data Preprocessing
Aggregation
Sampling
Dimensionality Reduction
Feature Subset Selection
Feature Creation
Discretization and Binarization
Variable Transformation
01/27/2021 Introduction to Data Mining, 2nd Edition 37
Tan, Steinbach, Karpatne, Kumar
Aggregation
Combining two or more attributes (or objects) into a single
attribute (or object)
Purpose
– Data reduction - reduce the number of attributes or objects
– Change of scale
Cities aggregated into regions, states, countries, etc.
Days aggregated into weeks, months, or years
– More “stable” data - aggregated data tends to have less variability
01/27/2021 Introduction to Data Mining, 2nd Edition 38
Tan, Steinbach, Karpatne, Kumar
Aggregation
An obvious issue is how an aggregate transaction is created?
Quantitative attributes
– such as price, are typically aggregated by taking a sum or an average
Qualitative attributes
– such as item, can either be omitted or summarized in terms of a higher level
category, e.g., televisions versus electronics
Disadvantages of aggregation
– Potential loss of interesting details
– In store example: aggregation over months loses information about which day of the
week has the highest sales.
01/27/2021 Introduction to Data Mining, 2nd Edition 39
Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia
This example is based on precipitation in Australia
from the period 1982 to 1993.
The next slide shows
– A histogram for the standard deviation of average
monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in
Australia, and
– A histogram for the standard deviation of the average
yearly precipitation for the same locations.
The average yearly precipitation has less variability
than the average monthly precipitation.
All precipitation measurements (and their standard
deviations) are in centimeters.
01/27/2021 Introduction to Data Mining, 2nd Edition 40
Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia …
Variation of Precipitation in Australia
Standard Deviation of Average Standard Deviation of
Monthly Precipitation Average Yearly Precipitation
01/27/2021 Introduction to Data Mining, 2nd Edition 41
Tan, Steinbach, Karpatne, Kumar
Sampling
Sampling is the main technique employed for data
reduction.
– It is often used for both the preliminary investigation of the
data and the final data analysis.
Statisticians often sample because obtaining the entire
set of data of interest is too expensive or time
consuming.
Sampling is typically used in data mining because
processing the entire set of data of interest is too
expensive or time consuming.
01/27/2021 Introduction to Data Mining, 2nd Edition 42
Tan, Steinbach, Karpatne, Kumar
Sampling …
The key principle for effective sampling is the
following:
– Using a sample will work almost as well as using the
entire data set, if the sample is representative
– A sample is representative if it has approximately the
same properties (of interest) as the original set of data
01/27/2021 Introduction to Data Mining, 2nd Edition 43
Tan, Steinbach, Karpatne, Kumar
Sample Size
8000 points 2000 Points 500 Points
Figure 2.9. Example of the loss of structure with
sampling
01/27/2021 Introduction to Data Mining, 2nd Edition 44
Tan, Steinbach, Karpatne, Kumar
Types of Sampling
Simple Random Sampling
There is an equal probability of selecting any particular item
Sampling without replacement
As each item is selected, it is removed from the population
Sampling with replacement
– Objects are not removed from the population as they are
selected for the sample.
In sampling with replacement, the same object can be picked up
more than once
Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition
01/27/2021 Introduction to Data Mining, 2nd Edition 45
Tan, Steinbach, Karpatne, Kumar
Types of Sampling
Simple Random Sampling
01/27/2021 Introduction to Data Mining, 2nd Edition 46
Tan, Steinbach, Karpatne, Kumar
Types of Sampling
Stratified Sampling
01/27/2021 Introduction to Data Mining, 2nd Edition 47
Tan, Steinbach, Karpatne, Kumar
Sample Size
What sample size is necessary to get at least one
object from each of 10 equal-sized groups.
01/27/2021 Introduction to Data Mining, 2nd Edition 48
Tan, Steinbach, Karpatne, Kumar
Curse of Dimensionality
When dimensionality increases, data becomes increasingly sparse in
the space that it occupies
Definitions of density and distance between points, which are critical for
clustering and outlier detection, become less meaningful
Many clustering and classification algorithms have trouble with high-
dimensional data leading to reduced classification accuracy and poor
quality clusters.
01/27/2021 Introduction to Data Mining, 2nd Edition 49
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction
Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise
Techniques
– Principal Components Analysis (PCA)
– Singular Value Decomposition
– Others: supervised and non-linear techniques
01/27/2021 Introduction to Data Mining, 2nd Edition 50
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA
A data reduction technique that transforms a large
number of correlated variables into a smaller set of
correlated variables called principal components
a method of extracting important variables from a large
number of variables available in a dataset
it extracts a set of low-dimensional features from a high-
dimensional dataset with the goal of capturing as much
information as possible(variance) in the data.
01/27/2021 Introduction to Data Mining, 2nd Edition 51
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA
Steps Involved in the Principal Component
Analysis:
Standardize the dataset
Compute the covariance matrix for the features in
the dataset
Compute the eigenvalues and eigenvectors for the
covariance matrix
Sort the eigenvalues and their corresponding
eigenvectors
Choose k eigenvalues to form an eigenvector matrix
Transform the original matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 52
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA
Goal is to find a projection that captures the
largest amount of variation in data
x2
x1
01/27/2021 Introduction to Data Mining, 2nd Edition 53
Tan, Steinbach, Karpatne, Kumar
Feature Subset Selection
Another way to reduce dimensionality of data
✔ Use only a subset of the features
Redundant features
– Duplicate much or all of the information contained in one or more
other attributes
– Example: purchase price of a product and the amount of sales tax
paid
Irrelevant features
– Contain no information that is useful for the data mining task at hand
– Example: students' ID is often irrelevant to the task of predicting
students' GPA
Redundant and irrelevant features can reduce classification
accuracy and the quality of the clusters that are found.
01/27/2021 Introduction to Data Mining, 2nd Edition 55
Tan, Steinbach, Karpatne, Kumar
Feature Subset Selection
Techniques
✔ Brute-Force approach:
Try all possible feature subsets as input to data mining
algorithm, and then take the subset that produces the
best results
✔ Embedded approaches:
Feature selection occurs naturally as part of the data
mining algorithm
the data mining algorithm itself decides which attributes to
use and which to ignore.
For example: Algorithms for building decision tree
classifiers
01/27/2021 Introduction to Data Mining, 2nd Edition 56
Tan, Steinbach, Karpatne, Kumar
Feature Subset Selection
Techniques
✔ Filter approaches:
Feature are selected before data mining algorithm is run
Using some approach that is independent of the data mining
task.
For example: select sets of attributes whose pairwise
correlation is as low as possible.
✔ Wrapper approaches:
Use the data mining algorithm as a black box to find best
subset of attributes
01/27/2021 Introduction to Data Mining, 2nd Edition 57
Tan, Steinbach, Karpatne, Kumar
An Architecture for Feature Subset Selection
It is possible to encompass both the filter and
wrapper approaches within a common architecture
The feature selection process view as consisting of
four parts:
✔ A measure for evaluating a subset
Filter methods and Wrapper methods differ only in the way in
which they evaluate a subset of features
✔ A search strategy that controls the generation of a new subset of
features
✔ A stopping criterion
✔ A validation procedure
01/27/2021 Introduction to Data Mining, 2nd Edition 58
Tan, Steinbach, Karpatne, Kumar
An Architecture for Feature Subset Selection
01/27/2021 Introduction to Data Mining, 2nd Edition 59
Tan, Steinbach, Karpatne, Kumar
Feature Creation
Create new attributes that can capture the
important information in a data set much more
efficiently than the original attributes
Three general methodologies:
– Feature extraction
Example: extracting edges from images
– Feature construction
Example: dividing mass by volume to get density
– Mapping data to new space
Example: Fourier and wavelet analysis
01/27/2021 Introduction to Data Mining, 2nd Edition 60
Tan, Steinbach, Karpatne, Kumar
Mapping Data to a New Space
Fourier and wavelet transform
Frequency
Two Sine Waves + Noise Frequency
01/27/2021 Introduction to Data Mining, 2nd Edition 61
Tan, Steinbach, Karpatne, Kumar
Discretization
Discretization is the process of converting a
continuous attribute into a categorical attribute
– A potentially infinite number of values are mapped into
a small number of categories
– Discretization is used in both unsupervised and
supervised settings
Discretization is typically applied to attributes that
are used in classification or association analysis
01/27/2021 Introduction to Data Mining, 2nd Edition 62
Tan, Steinbach, Karpatne, Kumar
Discretization of continuous attributes
Transformation of a continuous attribute to a
categorical attribute involves two subtasks:
– deciding how many categories, n, to have
– determining how to map the values of the continuous
attribute to these categories.
In the first step, after the values of the continuous
attribute are sorted, they are then divided into n
intervals by specifying n − 1 split points.
In the second step, all the values in one interval are
mapped to the same categorical value.
01/27/2021 Introduction to Data Mining, 2nd Edition 63
Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization
Data consists of four groups of points and two outliers. Data is one-
dimensional, but a random y component is added to reduce overlap.
01/27/2021 Introduction to Data Mining, 2nd Edition 64
Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization
Equal interval width approach used to obtain 4 values.
01/27/2021 Introduction to Data Mining, 2nd Edition 65
Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization
Equal frequency(equal depth) approach used to obtain 4 values.
01/27/2021 Introduction to Data Mining, 2nd Edition 66
Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization
K-means approach to obtain 4 values.
01/27/2021 Introduction to Data Mining, 2nd Edition 67
Tan, Steinbach, Karpatne, Kumar
Binarization
Binarization maps a continuous or categorical
attribute into one or more binary variables
01/27/2021 Introduction to Data Mining, 2nd Edition 69
Tan, Steinbach, Karpatne, Kumar
Attribute Transformation
An attribute transform is a function that maps the
entire set of values of a given attribute to a new
set of replacement values such that each old
value can be identified with one of the new
values
– Simple functions: xk, log(x), ex, |x|
– Standardization and Normalization
01/27/2021 Introduction to Data Mining, 2nd Edition 70
Tan, Steinbach, Karpatne, Kumar
Data Preprocessing – In a Nutshell
Aggregation
✔ Normally bunch of data is used, and cumulative data from all is used.
Sampling
✔ Only few representative data is kept, rest is thrown away
Dimensionality Reduction
✔ Picking up only the attributes that are important
Feature Subset Selection
Feature Creation/Extraction
Discretization and Binarization
✔ Discretize the value, the continuous value may not be useful, for example age range
Variable Transformation
✔ Scale it by some factor
01/27/2021 Introduction to Data Mining, 2nd Edition 73
Tan, Steinbach, Karpatne, Kumar
Similarity and Dissimilarity Measures
Similarity measure
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
Dissimilarity measure
– Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
01/27/2021 Introduction to Data Mining, 2nd Edition 74
Tan, Steinbach, Karpatne, Kumar
Similarity/Dissimilarity for Simple Attributes
The following table shows the similarity and dissimilarity
between two objects, x and y, with respect to a single, simple
attribute.
01/27/2021 Introduction to Data Mining, 2nd Edition 75
Tan, Steinbach, Karpatne, Kumar
Euclidean Distance
Euclidean Distance
where n is the number of dimensions (attributes) and xk
and yk are, respectively, the kth attributes (components)
or data objects x and y.
Standardization is necessary, if scales differ.
01/27/2021 Introduction to Data Mining, 2nd Edition 76
Tan, Steinbach, Karpatne, Kumar
Euclidean Distance
3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 77
Tan, Steinbach, Karpatne, Kumar
Minkowski Distance
Minkowski Distance is a generalization of Euclidean
Distance
Where r is a parameter, n is the number of dimensions
(attributes) and xk and yk are, respectively, the kth
attributes (components) or data objects x and y.
01/27/2021 Introduction to Data Mining, 2nd Edition 78
Tan, Steinbach, Karpatne, Kumar
Minkowski Distance: Examples
r = 1. City block (Manhattan, taxicab, L1 norm) distance.
– A common example of this for binary vectors is the Hamming
distance, which is just the number of bits that are different
between two binary vectors
r = 2. Euclidean distance
r = ∞. “supremum” (Lmax norm, Lnorm) distance.
– This is the maximum difference between any component of
the vectors
Do not confuse r with n, i.e., all these distances are
defined for all numbers of dimensions.
01/27/2021 Introduction to Data Mining, 2nd Edition 79
Tan, Steinbach, Karpatne, Kumar
Minkowski Distance
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 80
Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance
-0.5
is the covariance matrix
For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.
01/27/2021 Introduction to Data Mining, 2nd Edition 81
Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance
Covariance
Matrix:
0.3 0.2
C
0 . 2 0 . 3
B A: (0.5, 0.5)
B: (0, 1)
A
C: (1.5, 1.5)
Mahal(A,B) = 5
Mahal(A,C) = 4
01/27/2021 Introduction to Data Mining, 2nd Edition 82
Tan, Steinbach, Karpatne, Kumar