BIO 325

Taxonomy and Phylogeny of

Gymnosperms and Angiosperms
Jess H. Jumawan, PHD

1
What is Taxonomy / Systematics ? Animal group No. of species
Amphibians 6,199
Birds 9,956
Fish 30,000
Mammals 5,416
Tundra
Reptiles 8,240
Subtotal 59,811
Grassland Forest Insects 950,000
Molluscs 81,000
Q: Why we keep the stuffs of our home Crustaceans 40,000
at the fixed place or arrange into some Corals 2,175
kinds of system? Desert Others 130,200
Rain forest Total 1,203,375
• Every Human being is a Taxonomist
Plants No. of species
Mosses 15,000
Ferns and allies 13,025
Gymnosperms 980
Dicotyledons 199,350
Monocotyledons 59,300
Green Algae 3,715
Red Algae 5,956
Lichens 10,000
Mushrooms 16,000
Brown Algae 2,849
Subtotal 28,849
Total 1,589,361

• We have millions of different kind of plants, animals and microorganism. We need to scientifically identify, name and classify all the living
organism.

• Taxonomy / Systematics is the branch of science deals with classification of organism.

2
• Q. What is Plant Taxonomy / Plant systematics
 We study plants because:

❑ Plants convert Carbon dioxide gas into ❑ Every things we eat comes
❑ Plants produce oxygen. We breathe directly or indirectly from
sugars through the process of
oxygen. We cannot live without plants.
photosynthesis.
oxygen.

❑ Many chemicals
produced by the ❑ Study of plants science helps to
❑ Study of plants science helps learn more about the natural
plants used as
❑ Plants provide fibres for paper or fabric. to conserve endangered world
medicine.
plants.

❖ We have millions of different kind of plants, animals and

microorganism. We need to scientifically identify, name and
❑ Plants can be a source of biofuels.
Sugars, starches and cellulose can be
classify all the living organism
fermented into ethanol. Ethanol is 3
used as fuel.
 Taxonomic Hierarchy
Carrolus Linnaeus first adopted the hierarchic system of taxonomy classification in 1753. The succession groups are as follow:
Species:
• Organisms sharing a set of biological traits and reproducing only their exact kind.
• The lowest major group, representing plants and animals referred to as Species.
• Species is the fundamental unit in taxonomy

Genus: Genus are the closely related species

Family : Family is the closely related genera Division
Order : Order is the closely related families
Class : Class are the closely related order
Division / Phylum: Division or Phylum is the related classes
Kingdom: Kingdom is the related Division / Phylum

4
Objective / Goals / Aims of Plant Taxonomy
❑ To provide an inventory of plant taxa for local, regional or continental needs.

❑ To establish suitable method for identification, nomenclature and description of plant taxa.

❑ Classification of organism into classes, Order, Families, Genera, and species

❑ To provide significantly valuable information concerning wild and medicinal species,

endangered species, unique plants, genetic and ecological diversity

Scope of Taxonomy
❖ Taxonomy is one of the oldest sciences.

❖ It provides thorough knowledge of living species and their variousforms.

❖ All the branches of biology are dependent on taxonomy for proper identificationthe
species.

❖ It has been proceeded further incorporating data from phytochemistry, cyto-genetics

5
supported by proper computation.
Basic components (Principles) of Plant
Taxonomy / Plant Systematics
1) Plant collection, Preservation and Documentation

2) Plant Structure (Taxonomic Terminology, Taxonomic description of external

and internal morphology )

3) Taxonomic Identification

4) Scientific Nomenclature / Botanical nomenclate : Nomenclature deals with the

application of a correct name to a plant or a taxonomic group. Scientific
names are necessary because the same common name is used for different
plants in different areas of the world.

5) Taxonomic Classification (History and Systems of Plant Classification)

6) Taxonomic evidences / Source of data (Morphology, Anatomy, Embryology,

palynology, Micromorphology, Chemistry, DNA etc.) in plant taxonomy
6
 Basic components of Plant Taxonomy
Phoenix dactylifera L Taxonomic Identification

Taxonomic
description
(Plant
Morphology)

Plant Classification
Kingdom: Plantae
Class: Angiosperms
Order: Arecales
Family: Arecaceae
Genus: Phoenix
Species: Phoenix dactylifera
Scientific name / Botanical 7
Nomenclature
 Types of Taxonomy / Taxonomic Studies / Plant Taxonomic Classification

From the various stages of classification, the types of taxonomy are defined: -

❖ Alpha (α) Taxonomy / classical taxonomy:-

It involves description and naming of organisms. It is the parent of other types of
taxonomy.

❖ Beta (β) Taxonomy: -

In addition to morphological description, it also involves consideration of affinities
and their inter-relationship between separate group of species.

❖ Gama (ɣ) Taxonomy: -

It is concerned with description, inter-relationship and evolution of one species from
the other.

❖ Omega(Ω) Taxonomy: -
It is the modern experimental taxonomy in which the taxonomic activities have been
enriched with data from ecology, phyto-chemistry, phyto-geography, cyto-genetics
and physiology coupled with adequate computation.
8
Alpha (α) Taxonomy /
classical taxonomy:

Plant collection,
Preservation and
Documentation
9
 Herbarium: Plant collecting, Preservation and Documentation
• A HERBARIUM is a collection of dried plants systematically named and arranged for ready reference and study.

• To make a herbarium specimen, the plant is collected, and notes are made about it. The plant is then pressed
until dry between blotters that absorb moisture and mounted onto a herbarium sheet with a suitable label, and
stored in steel cabinet arranged into some system ofclassification.

• Herbarium techniques involve : (i) Collection, (ii) Drying, (iii) Poisoning, (iv) Mounting, (v) Stitching, (vi) Labelling,
and (vii) Deposition.

10
The FLORA is the main Resources of Taxonomic Information

Description of
plant need
taxonomic
terminology
Flora = it is the documentation of
plants occurring in a particular
Phoenix dactylifera Linnaeus, Sp. Pl. 2: 1188. 1753.
region. Stems solitary or clustered and then with few shoots, to 30 m tall, to 50 cm in diam.,
rough with persistent, diamond-shaped leaf bases. Leaves 3-5 m; sheath and petiole
to 1 m; rachis 1-2 m; acanthophylls many per side of rachis; pinnae to 200 per side of
rachis, linear, irregularly arranged and spreading in different planes; middle pinnae to
40 × 2 cm. Male inflorescences erect, to 1 m, with many rachillae, these ca. 30 cm;
female inflorescences erect, becoming pendulous, to 2 m, with to 150 rachillae, these
to 40 cm. Fruits variable in shape, usually oblong, to 7 × 3 cm, brown or black;
endosperm homogeneous. 11
PLANT STRUCTURE
(MORPHOLOGY AND ANATOMY)
▪ Plant Morphology: Study of external structure of
a plant

▪ Plant Anatomy: Study of Internal structure of a

plant

▪ Flowering plants possess three kinds of vegetative

(non-reproductive) organs: Roots, Stems, and
Leaves

▪ The flower is the reproductive organ of the

Angiosperms / Flowering plants. 12
Vegetative and Reproductive Parts of Plants
❑ Root:
In vascular plants, the root is the organ of a plant that typically lies below
the surface of the soil. Root is meant for absorption of water and minerals
from soil, and provide anchorage to plants.

❑ Nodes :
The nodes hold one or more leaves, as well as buds which can grow into
branches (with leaves or inflorescences (flowers). Adventitious roots may
also be produced from the nodes.

❑ Internodes :
The internodes distance one node fromanother.

❑ Stem:
The main body or stalk of a plant or shrub, typically rising above ground.

❑ Leaf:
A leaf is an organ of a vascular plant ,and is the principal lateral appendage
of the stem,

❑ Flower:
The seed-bearing part of a plant consisting of reproductive organs
(stamens and carpels) that are typically surrounded by a brightly coloured
corolla (petals) and a green calyx (sepals).

❑ Fruit:
A fruit is the seed-bearing structure in flowering plants formed from the
ovary after flowering
13
 Habit of Plants

Vines
Tree
14
shrubs
 Different Types of Roots
Tap Root: Adventitious Roots
A straight tapering root growing ❖ Some roots,
vertically downwards and forming called adventitious roots,
the centre from which subsidiary arise from an organ other
rootlets spring. than the root—usually a
stem, sometimes a leaf.

Fibrous Root ❖ Prop roots

❖ A fibrous root system is The adventitious root when modified
the opposite of a taproot for aerial support, are called prop
system. roots
❖ The fibrous root is usually
formed by thin, moderately
branching roots growing
from the stem.
❖ A fibrous root system is
universal in
monocotyledonous plants
and ferns
Parasitic Root:
Respiratory Roots: A parasitic plant is a plant that derives some
❖ An erect root that protrudes some or all of its nutritional requirements from
distance above soil level. another living plant.
❖ Pneumatophores are formed in large All parasitic plants have modified roots,
numbers by certain plants, e.g.
Sonneratia and some mangrove species,
named haustoria, which penetrate the host
growing in areas with waterlogged badly plants, connecting them to the conductive
aerated soils. system – either the xylem, the phloem1,5or
both
 Stem Habit = Relative position of stem (+ growth, structure)

Prostrate
❖ Trailing or lying flat, not rooting at
the nodes

Acaulescent Caulescent Cespitose

❖ Apparently a stemless ❖ With a distinct
❖ Short, much- Repent
plant having very stem branched, plant
❖ Creeping or lying flat and
inconspicuous reduced forming a cushion
rooting at the nodes
stem

arborescent suffrutescent decumbent

Arborescent Suffrutescent Decumbent

❖ Tree-like in appearance and ❖ Lying on the ground
❖ Woody basally, with the tips ascending 16
size
herbaceous apically
 Stem Branching

• Monopodial: • Dichotomous: • Sympodial:

Branching with a Branching into two Branching without a
main axis and equal parts main axis but with
reduced or missing many, more or less,
equal laterals

17
 LEAVES There are large number of
▪ The leaf is the main photosynthetic
terminology leaf based on:
organ of most vascular plants.
• Margin
▪ Leaves generally consist of a flattened • Apex
blade and a petiole, which joins the • Base
leaf to a node of the stem. • Venation
• Arrangement
▪ Some plant species have evolved • Petiole
• Modifications
modified leaves that serve various
functions. For example: climbing,
pollinator attraction, storage,
digestion, prevention of water loss,
etc.

18
Leaves
External Parts of the Leaf:

• Petiole
o Leaf stalk or part that
connects the leaf to
the stem.

• Blade
o The large, flat part of a
leaf.

• Midrib
o The large center vein.
19
 Leaf Types

(b) Compound leaf (c) Doubly compound

(a) Simple leaf. A (Pinnate). In a leaf
simple leaf is a compound leaf, (Bipinnate)In a
single, the blade doubly compound
undivided blade. consists of leaf, each leaflet is
multiple leaflets. divided into smaller
Note that a leaflet 20 leaflets.
has no axillarybud
at its base.
 Compound Leaves

❖ With two orders of

❖ With leaflets ❖ With leaflets leaflets, each pinnately
from one arranged compound
point at end oppositely or
of petiole alternately
along a
common axis
21
Leaf Venation

❖ Parallel- veins extend the entire

length of the leaf with little or no
cross-linking

❖ Pinnate- ‫ يشير‬leaves have one major

vein from which others branch

❖ Palmate- leaves have several

veins which branch

Reticulate Parallel

22
 Leaf Adaptations/ Modifications
Some plant species have evolved modified leaves to serve various functions.
Tendrils: Usually a coiled rachis or twining
leaflet modification. Tentacular Leaf
A leaf bearing numerous, sticky, glandular
Thorns, Spines, and Prickles : The thorns, hairs or bristles that function in capturing
spines and prickles, and in general spinose and digesting small animals, e.g. Drosera
structures are hard, rigid extensions or
modifications of leaves, roots, stems or Carnivorus plants
buds with sharp, stiff ends ▪ Insect-Trapping Leaves in areas with
low soil Nitrogen.
▪ Insect digested by enzymes to release
Storage leaves: Most succulents, such as Nitrogen from proteins.
ice plant, have leaves modified for storing ▪ Example: Trap Leaf of Dionaea
water. muscipula capturing fly

Bracts: a modified leaf or scale, typically

small, with a flower or flower cluster in it s Pitcher plant:
axil. Bracts are sometimes larger and Pitcher plants are several different
more brightly colored than the true carnivorous plants which have modified
flower, as in Poinsettia leaves known as pitfall traps—a prey-
trapping mechanism featuring a deep
cavity filled with digestive fluid liquid
Reproductive leaves: The leaves of some
succulents, such as Kalanchoe
daigremontiana produce adventitious
plantlets, which fall off the leaf and take
root in the soil.
23
 PLANT ANATOMY
(Study of internal structure of plant)

24
 Plant Tissue
(Group of cells having similar structure and function is called as tissue)

Tissue Systems
There are four plant tissue systems:

1. Ground tissue system :

-Parenchyma tissue
-Collenchyma tissue
-Sclerenchyma tissue

2. Vascular tissue includes:

-Xylem tissue
-Phloem tissue

3. Dermal tissue:
-Epidermis

4. Meristematic tissue: (dividing tissue)

25
 Dermal Tissue - Stomata

• Openings in the epidermis

on the underside of a leaf
where gases are exchanged
are called stomata.

26
Angiospermae
(Anthophyta – Flowering Plants)
Peduncle: The stalk of a flower.
• All Angiosperms produce flowers
Receptacle: The part of a flower stalk where theparts
containing the sexual reproduction of the flower are attached.
structures.
Sepal: The outer parts of the flower (often greenand
• The angiosperms ( angios =covered, leaf-like) that enclose a developingbud.
sperm = seed) produce fruits and
seeds. Petal: The parts of a flower that areoften
conspicuously colored.
• There are presently 235,000 known
living flowering plants species. Stamen: The pollen producing part of a flower,usually
with a slender filament supporting the anther.

Anther: The part of the stamen where pollenis

produced.

Pistil: The ovule producing part of a flower. Theovary

often supports a long style, topped by a stigma. The
mature ovary is a fruit, and the mature ovule is a
seed.

Stigma: The part of the pistil wherepollen

germinates.

Ovary: The enlarged basal portion of the pistil where

27
ovules are produced.
Parts of Angiospermic flowers
 Unisexual and Bisexual Flower
Bisexual or Hermaphrodite flower:

▪ A bisexual flower is that, which contains both the

male and female reproductive whorls, i.e.,
androecium and gynoecium.

▪ Examples: Hibiscus (Chinarose), Brassica (Mustard).

Unisexual flower:

• A flower is unisexual, when either of the maleor

the female reproductive organ is absent.

• Examples of these types of flowers are staminate

and pistillate flower of Cucurbita (gourd).
28
 Floral Symmetry
Regular or Actinomorphic flower:

A flower is said to be regular types of flowers,

when all the floral members of the respective
whorls (viz., sepals, petals, stamens, carpels)
are having equal size and shape and are more
or less equidistant from each other, hence the
flower can be dissected into two equal halves
at any plane, e.g., Hibiscus (Chinarose);
Datura.

Irregular or Zygomorphic flower:

A flower is said to be irregular, when the floral members vary in their size and shape,
and hence the flower can be cut into two equal halves through one plane only ;
example Pisum sativum (Pea).

29
 Cyclic and Acyclic Flower
Cyclic Flower:

Types of flowers are said to be cyclic, when all

the four whorls (viz., sepals, petals, stamens
and pistils) are arranged in whorled or
verticellate manner.

Example, Hibiscus (Chinarose).

Acyclic Flowers:

Types of flowers are said to be acyclic, when the

floral members are arranged spirally on the
thalamus.

Example: Paoenia.
30
Spirocyclic, Nude and Neuter Flower
❖ Spirocyclic flower:

The floral members of a spirocyclic flower are both arranged

spiral as well as in whorled manner example, Nymphaea,
Magnolia.

❖ Nude flower:

The types of flowers are said to be naked, because neither calyx nor
corolla is present, example Male flower within the cyathium of
Pedilanthus.

❖ Neuter flower:

A flower is said to be neuter, when it is devoid of both male androecium

and female gynoecium, as an example the Ray florets of sunflower.
31
 Monochlamydous and Dichlamydous Flower
Monochlamydous flower:

The types of flowers are said to be

monochlamydous, when either calyx or corolla is
present, e.g., Polyanthes (tuberose).

Dichlamydous flower:

A normal flower with both the accessory whorls,

i.e., calyx and corolla is called dichlamydous.
Example, Hibiscus (chinarose).

32
 Polypetalous and Gamopetalous
Flower

Polypetalous is having a corolla Gamopetalous having petals wholly

composed of distinct, separable petals. or partially fused such that the
33
corolla takes the form of a tube
Relative Positions of Floral Appendages

34
 Inflorescence
(An inflorescence is an arrangement of one or more flowers on a floral axis)

• Inflorescence type determined by:

– Number of flowers
– Positional relationships
– Degree of the development of their
pedicels
– Nature of their branching pattern

35
 Simple Inflorescences

• Terminal: flower at
the tip of a stem.
• Example: Hibiscus
coccineus

Scarlet rose-mallow (Hibiscus coccineus)

36
 Compound Inflorescences

• Two or more flowers

in every
inflorescence

• Example: Sunflower

37
 Compound Inflorescences

• Spike: elongate
inflorescence;
flowers are sessile,
dense, or remote
from one another

Spiked blazing star (Liatris spicata)

38
 Compound Inflorescences

• Catkin: A spike like

inflorescence of
unisexual flowers;
found only in woody
plants.

39
 Compound Inflorescences

• Raceme: an elongate
inflorescence of
pedicellate flowers
on an unbranched
rachis

40
 Compound Inflorescences

• Umbel: a flat-topped
or somewhat
rounded
inflorescence in
which all of the
pedicels arise from
a common point at
the tip of the
peduncle

Butterfly weed (Asclepias sp.)

41
 Compound Inflorescences

• Corymb: a flat-topped
or somewhat rounded
inflorescence in which
the pedicels of
varying length are
inserted along the
rachis

42
 Compound Inflorescences

• Panicle: a much-
branched inflorescence
with a central rachis
which bears branches
which are themselves
branched

43
 Compound Inflorescences
• Head, (Capitulum) : isa
short dense spike in
which the flowers are
borne directly on a
broad, flat peduncle,
giving the
inflorescence the
appearance of a single
flower.

44
 Complete and incomplete flower
Complete flower:
▪ A flower is said to be complete, when it has allthe
four whorls (calyx, corolla, androecium and
gynoecium).
▪ Example: Hibiscus (Chinarose), Brassica (mustard)
and Datura.

Incomplete flower:
• A flower is incomplete, when any one of
the four whorl (calyx, corolla, androecium
and gynoecium) is absent.
• Examples of these types of flowers are
Polyanthes (calyx absent), Beta (corolla
absent), Cucurbita male flower
(gynoecium absent), female flower
(androecium absent). 45
 PLANT
CLASSIFICATION

46
 History and Systems of Classification of Plants
Preliterate Mankind / Folk taxonomies: Medieval Botany:

▪ Classification of plants by preliterate early mankind to o During the Middle Ages (5 to 15 century AD), little or no
know: progress was made in botanical investigation.
o what he should eat o
o what he should avoid During this period in the history, Europe and Asia
o what he should use as cures for disease witnessed wars etc.
o what he should utilize for his shelter

▪ The information was accumulated and stored in the Islamic Botany:

human brain and passed on one generations to the other
generation through words of mouth ▪ 610-1100 AD saw the revival of literacy.
▪ Greek manuscripts were translated.

Theophrastus (372 BC to 287 BC): Ibual- Awwan described nearly 600 plants
❑ Father of Botany ❖ Described sexuality as well as the role of insects in fig
❑ The Greek philosopher pollination
❑ Wrote more than 200 manuscripts
❑ Theophrastus work translated in to English : ❖ But not develop any significant scheme of classification
Enquiry into plants (1916)
The Causes of plants (1927)

❑ Theophrastus described about 500 kinds of plants

❑Theophrastus classified into four major groups: the trees,
shrubs, subshrubs and herbs Page from 15th century
❑Theophrastus recognized the differences between flowering Arabic edition of
plants and non-flowering plants Dioscorides herbal
❑Theophrastus recognized superior ovary and inferior ovary,
free and fused petals and also fruit types
Andrea Cesalpino (1519-1603)

❖ Andrea Cesalpino Italian botanist

❖Director of the Botanical Garden, and later Professor of Botany and Medicine at
Bologna
❖De Plantis libri in 16 volumes appeared in 1583 and contained descriptions of 1520
species of plants grouped as herbs and trees and further differentiated on fruit and seed
characters

John Ray (1627-1705)

❖ John Ray was an British Botanist

❖ Published
•Methodus plantarum nova (1682)
•Historia plantarum (1686-1704)
•Methodus (1703) included 18000 species

J. P. de Tournefort (1656-1708)

❖ J. P. de Tournefort (1656-1708)—Father of genus concept

❖ A French botanist published Elements de botanique in 1694
❖ Published 698 genera and 10,146 species
❖ First to give names and description of genera
❖ Recognized petaliferous and apetalous flowers, free and fused petals, and regular and
irregular flowers
 Binomial Nomenclature and Carolus Linneaus System of Plant Classification

❖ Taxonomic Systems of Classification: Ideally our systems of

classification should allow us to place similar species of plants
together in the same category.

❖ There are two types of Classification Schemes:

❑ Artificial taxonomy was a system of grouping unrelated plant species

by a common criteria (i.e. a flowers sexual organs)
❑ Natural classification reflects relationships among taxon

➢ Carolus Linneaus was a Swedish botanist.

➢ Carolus Linneaus traveled to Lapland (Blue Lake, CA) and collected

large number of plants.

➢ Carolus Linneaus introduced Binomial Nomenclature.

Binomial nomenclature = Uses two Latin words to indicate the genus and
the species. The first word is the genus and the second word is the species.
Example- the botanical name of dates is Phoenix dactylifera

➢ Carolus Linneaus published the book ‘Species Plantarum’ in 1753.

➢ Carolus Linneaus classified the plants based on the plant’s method of

reproduction and structure of reproductive parts.

➢ Produced his sexual system of classification (Artificial classification)

➢ Carolus Linneaus divided plants into 24 classes. The Classes in the

Linneaus is based largely on the amount, union and length of stamens
Michel Adanson (1727-1806)

❖ A French botanist
❖ Published Familles des plantes (1763)
❖ Recognized 58 natural orders

Jean B.P. Lamarck (1744-1829)

❖ A French naturalist
❖ Published Flore Francaise (1778)
❖ Proposed key for identification of plants
❖ Proposed principles concerning the natural grouping of species, orders and families

Antoine Laurent de Jussieu (1748-1836)

❖ 15 classes and 100 orders

❖ The author of Genera plantarum (1789)

de Candolle(1778−1841)

❖ de Candolle was Professor of Botany at Montpellier

❖ de Candolle Published Theorie elementaire de la botanique, Prodromus systematis naturalis and regni
vegetabilis
❖ de Candolle for the first time introduced the term ‘taxonomy’ in his Theorie elementaire de la botanique (1813)
❖ de Candolle considered 161-213 natural orders
❖ de Candolle grouped the plants primarily on the basis of the presence or absence of vascular structures
❖ Ferns were with monocots and Gymnosperms with among dicots in the de Candolle system of classification.
❖ de Candolle highlighted importance of anatomical data
 Bentham and Hooker System of Plant Classification

❖ Bentham and Hooker, two English botanists, represented the most well
developed natural system of plant classification. The classification was
published in a three-volume work Genera plantarum (1862-83).

❖ Hooker supervised the publication of Index Kewensis (2 volumes, 1893),

listing the names of all known species and their synonyms.

❖ Many important herbaria of the world have specimens arranged

according to Bentham and Hooker system of plant classification.

❖ Bentham and Hooker recognized three class:

Class DICOTYLEDONES:
Subclass POLYPETALE with three series Series 1. THALAMIFLORÆ, Series 2. DISCIFLORÆ, Series 3. CALYCIFLORÆ;
Subclass DICOTYLEDONES (GAMOPETALÆ) with three series that is Series 1. INFERÆ, Series 2. HETEROMERÆ, Series 3. BICARPELLATÆ, and
Subclass DICOTYLEDONES MONOCHLAMIDEÆ.

Class GYMNOSPERMEÆ (Gymnosperms are placed between Dicotyledons and Monocotyledons)

Class MONOCOTYLEDONES
 PLANT CLASSIFICATION
Beta (β), Gama (ɣ)and
Omega (Ω) Taxonomy:

Beta (β) Taxonomy:-

In addition to morphological description, it also involves consideration of affinities and their inter-
relationship between separate group of species.

Gama (ɣ) Taxonomy: -

It is concerned with description, inter-relationship and evolution of one species from the other.

Omega (Ω) Taxonomy: -

It is the modern experimental taxonomy in which the taxonomic activities have been enriched with
data from ecology, phyto-chemistry, phyto-geography, cyto-genetics and physiology coupled with
adequate computation.
52
 Engler and Prantl System of Classification
❖ Engler and Prantl were German botanists published naturlichen
Pflanzenfamilien (= The Natural Plant Families)

❖ The classification covered the entire plant kingdom from Algae to Angiosperms
which has been divided into 13 divisions.
❖ The first 11 divisions in the Engler and Prantl
System of Classification are Thallophytes

❖ The 12th division in the Engler and Prantl System

of Classification is Embryophyta
Asiphonogama (plants with embryos but no
pollen tubes; Bryophytes and Pteridophytes).

❖ The 13th division in the Engler and Prantl System

of Classification is Embryophyta
Siphonogama (plants with embryos and pollen
tubes) which includes seed plants. This is divided
into 2 subdivisions:

1. Gymnospermae,
2. Angiospermae

❖ The subdivision Angiospermae is further divided

into 2 classes:

Class 1. Monocotyledoneae
Class 2. Dicotyledoneae
 Bessey System of Plant Classification

❖ Charles E. Bessey (1845-1915) proposed a modified

system of classification of Bentham and Hooker.

❖ Bessey separated the gymnosperms from

angiosperms.

❖ Bessey reorganized the orders of angiosperms.

❖ Bessey system of plant classification is popularly

known as Besseyan system.

❖ Bessey published the system of classification in the

book “The phylogenetic Taxonomy of Flowering
plants”.

❖ Bessey’ssystem was based on primitiveness and

evolutionary advancement of plant groups.
Modified Bessian Classification Schemes: Modern phylogenetic Systems of Plant Classification
Cronquist System of Plant classification:
❖ Auther Cronquist 1968 was from NY Botanuical Gardens.
❖ Cronquist published book:
-The Evolution and Classification of Flowering Plants
- An Integrated System of Classification of FloweringPlants
-The Evolution and Classification of Flowering Plants

Classification-

Division. Magnoliophyta- 2 classes, 11 subclasses, 83 orders and 386 families; 219,300 species
Class 1. Magnoliopsida (Dicotyledons)- 6 subclasses, 64 orders, 320 families; 169,400species
Class 2. Liliopsida (Monocotyledons)- 5 subclasses, 19 orders, 66 families; 49,900species

Takhtajan system of plant classification:

❖ Armen Takhtajan 1969 was a Russian plant taxonomist
❖ Takhtajan published the books
-Origin of Angiospermous Plants
-Die Evolution der Angiospermen
-Systema et Phylogenia Magnoliophytorum
-Flowering Plants—Origin and dispersal
-Diversity and Classification of Flowering Plants 1997

Class 1. Magnoliopsida (Dicotyledons)- 11 subclasses, 55 superorders, 175 orders, 458 families (8 subclasses, 37 superorders, 128 orders, 429 families,
estimated genera- 10,000, species- 1,90,000
Class 2. Liliopsida (Monocotyledons)-6 subclasses, 16 superorders, 57 orders and 131 families (4 subclasses, 16 superorders, 38 orders, 104 families,
estimated genera-3,000, species- 60,000

John Hutchinson (1884-1972) Rolf Dahlgren (1932-87)

❖ John Hutchinson was a British botanist
associated with the Royal Botanic Gardens, Kew, Rolf Dahlgren (1932-87) Danish botanist
England. working in Botanical Museum of the
❖ Published classification of plants in the book The University of Kopenhagen
Families of Flowering Plants
 Angiosperm Phylogeny Group
(APG)
❖ The APG system of flowering plant
classification is the modern, mostly
molecular-based, system of plant taxonomy
for flowering plants (angiosperms) being
developed by the Angiosperm Phylogeny
Group (APG).

❖ The APG was first published in 2008.

❖ Currently the APG IV system recognizes a

total of 64 angiosperm orders and 416
families.

❖ The families in APG classification have been

grouped into 40 putative monophyletic
orders under a small number of informal
monophyletic higher groups: monocots,
commelinoids, eudicots, core eudicots,
rosids, eurosids I, eurosids II, asterids,
euasterids I and euasterids II
Botanical Nomenclature
 Species Concept
❖ Species is the basic unit of classification
❖ Plants in the same species consistently produce plants
of the same types

The name of the plants must should be written in italics. For example Phoenix dactylifera 58
SCIENTIFIC NOMENCLATURE / BOTANICAL NOMENCLATE :

Nomenclature deals with the application of a correct name to a plant or a

taxonomic group.

❖ We have millions of species distributed in different geographical regions

of the world.

❖ The Scientific names (Botanical name and Zoological name)of the living
organism (Plants and Animals) are necessary because the same common
name is used for different plants / Animals in different areas of the
world.

• Swedish Botanist Carolus Linnaeus introduced Binomial Nomenclature.

• The Binomial nomenclature uses two Latin words to indicate the genus
and the species. The first word is the genus and the second word is the
species. Example- the botanical name of Dates is Phoenix dactylifera
 International Code of Botanical Nomenclature (ICBN)

The current activity of botanical nomenclature is governed by the International Code of Botanical
Nomenclature (ICBN) published by the International Association of Plant Taxonomy (IAPT).

The Code is divided into 3 divisions:

I. Principles
II. Rules and recommendations
III. Provisions for the governance of the Code

Principles of ICBN

1. Botanical Nomenclature is independent of Zoological Nomenclature. The Code applies equally to the names
of taxonomic groups treated as plants whether or not these groups were originally so treated.

2. The application of names of taxonomic groups is determined by means of nomenclatural types / TYPIFICATION.

3. Nomenclature of a taxonomic group is based upon Priority Of Publication.

4. Each taxonomic group with a particular circumscription, position and rank can bear Only One Correct Name,
the earliest that is in accordance with the rules.

5. Scientific names of taxonomic groups are treated as LATIN, regardless of derivation.

6. The rules of nomenclature are Retroactive, unless expressly limited.

Names of Taxa
❖ Generic Name:

The Generic name is

usually a noun and
singular, which is spelled
or written with a capital
letter.

❖ Specific Epithet:

The specific epithet is

often an adjective and it
is written with a small
initial letter.

❖ In the hand written

manner, both the
generic names and
specific epithet
should be
underlined, while
if printed it should
be in italics.
61
 TYPIFICATION

Type Specimen is the one representative of the taxon.

❖ Holotype:

A specimen designated by the author in the original publication

(nomenclatural type).

❖ Isotype:

A duplicate specimen of the holotype collected at the same timeand

place (may be in other herbarium).

❖ Lectotype:

A specimen chosen from the author’s original material when no holotype has been
designated.

❖ Neotype:

A specimen selected when all original specimens have been destroyed

Author Citation, Effective Publication and Principle of Priority
Author Citation
▪ For a name to be complete, it should be accompanied by the name of the author or authors who first
published the name validly. The names of the authors are commonly abbreviated, Example L. for
Carolus Linnaeus
▪ Aizoon canariense L.
▪ Tribulus macropterus var. arabicus (Hosni) Al-Hemaid & J. Thomas

Basic structure of a taxonomic Research papers / Recent publication of a new species in taxonomic journal

63
Effective publication
in the journal,
available to Botanist

Abstract / Summary /
Synopsis.
Date of valid publication Previously it was
(principles of priority): If required to write in
the same species will be Latin.
published by some one
else after this date then
the publication will be
not valid. (/Principles of
Priority).

Specimens
examined

Botanical name in Latin

Taxonomic
Description
Rank indicated

Type Specimen indicated 64

 Line
drawing

Taxonomic Key
for Identification

65
 Synonyms and Related Terminology
Synonyms:

❑ A name rejected due to misuse or difference in taxonomic judgement.

Basionym:

➢ The basionym is the first name ever given to a taxon. Further studies and revisions may reject the
basionym as the most correct one, but it still is useful as a nomenclatural reference for that species.

➢ Also, according to the priority rules of the ICBN, after a taxonomic revision that results in a species
being reclassified in another genus, the specific epithet must remain the same as the one in the
Basionym.

➢ A short example: Linnaeus classified the Tea Plant as Thea sinensis. Some decades later, Sweet noticed
that the genus Thea was not really different from the genus Camellia, and renamed all the Theas as
Camellias. Thea sinensis became Camellia sinensis, because he had to keep the specific epithet the
same as the original name (Basionym) for that species, given by Linnaeus.

Homonym:
A case in which two or more identical names are baed on different type , of which only one can be a
legitimate name , is called as homonym.

Tautonym
66
A case in which name of genus and the name of the species is the same.
Plant Biodiversity
 Plant Biodiversity of Saudi Arabia
❖ The flora of Saudi Arabia is somewhat a complex
one, having affinities with the floras of East Africa,
North Africa, the Mediterranean countries and the Major Families of Saudi flora
Irano-Turanian countries. 300 269
246
250 217

❖ Total number of species recorded: about 2300 200

150
species 100
87 74 72 71 67 64 62
50
❖ Gymnosperms: 9 species (Juniperus phoenicea) 0

❖ Pteridophytes : 27 species (Example: Marsilea

aegyptiaca)

❖ Total number of families: 131

Percentage of Herbs, shrubs and Trees
❖ Families represented by single species : 33

❖ 418 species belonging to 27 families are monocots 4%

25%
❖ 67 species are endangered (Huernia saudi-Arabica)
71%
❖ 56 are endemic to the region (Example: Aloe
sheilae Lavr.)

Trees (97) shrubs (564) Herbs (1620)6 8

 Aromatic and Medicinal Plants of Saudi Arabia

Artemisia sieberi
(Family Compositae):
❑ Leaves are used as an
anthelmintic.
❑ Anthelmintic is an antiparasitic
drugs that expel parasitic
worms Ruta chalepensis
(Family Rutaceae)
❑ Leaves are used to cure
rheumatism
❑ Rheumatism is the disease
marked by inflammation and
pain in the joints, muscles, or
fibrous tissue

Withania somnifera
(Family Solanaceae) Citrullus colocynthis
❑ Leaves and roots are used asa (Family Cucurbitaceae )
poultice ❑ Leaves, seeds and roots are used in
❑ Poultice is the term used for insect bits
“applied to the body to relieve
soreness and inflammation” 69
 PLANT BIODIVERSITY AND CONSERVATION
❖ Biodiversity is the biological diversity which includes the
variety of the whole species present on earth. It includes
different animals, plants, micro-organisms)

❖ Biodiversity conservation:
❑ Plant diversity is disappearing at an unprecedented rate as a
direct impact of the way humankind uses the world's natural
resources.
❑ Our flora is fundamentally important to human life as a source
of food, shelter and medicine amongst many other things.
❑ The threats to plant diversity vary worldwide. These include
habitat loss and degradation, invasive aliens, over-
exploitation of resources, and even climate change. Ex-Situ conservation:
❑ Species extinctions are on the rise. ❖ Ex-situ conservation involves the conservation of
❑ More than 80,000 seed-bearing plant species (20% of the biological diversity outside of their naturalhabitats.
total) are currently under threat.
❖ Ex-situ Biodiversity conservation can be done by
❖ The biodiversity must should be conserve because of its
benefit for example services and biological resources forming Gene banks, seed banks, botanical garden,
(medicine, food, wood products, fibers etc.) which are collections of In vitro plant tissue culture.
essential to live our life on earth.
❖ Ex-situ biodiversity conservation strategy plays an
❖ In-situ conservation: In-situ conservation means the important role in recovery programmes for
conservation of species within their natural habitats. By In- endangered species.
situ biodiversity conservation method the biodiversity area
may be covered in the form of natural park/ ❖ Frerea indica (Family
sanctuary/biosphere reserve etc. Apocynaceae) is one of the
❖ At present, Saudi Arabia has 15 protected areas. For example: world’s 12 endangered
Area Name Area Km2 Declared Year medicinal species listed by
Harrat al Harrah 13,775 1987 IUCN (International Union for
Al Khunfah 20,450 1987
Conservation of Nature), and
is endemic to western part of 70
At Tubayq 12,200 1989
India
 Botanical Garden
❑ The botanic gardens are institutions holding
List of some important botanic garden of world:
documented collections of living plants for
the purposes of studied botany, taxonomy 1. New York Botanical Gardens, New York,America
and systematics, multidisciplinary scientific
research, conservation, display and 2. Royal Botanical Gardens Sydney,Sydney,
education. Australia
❑ Botanical gardens are often run by
universities or scientific research 3.Kirstenbosch National Botanical Garden,Cape
organizations. Town, South Africa
❑ Recently botanic gardens have seen a revival
4. Botanischer Garten München, Munich,Germany
as scientific institutions due to the emergence
of the conservation movement. 5.Orto botanico di Padova, Padua,Italy

6.Hawaii Tropical Botanical Garden,Pāpa’ikou,

Hawaii

7. Jardin Botanique de Montreal, Montreal, Canada

8. Longwood Gardens, Philadelphia,USA

9. Kew Royal Botanical Gardens, London,England

10.Oman Botanic garden, Oman (BotanicalGarden

for the Future)

71
 Identifying Plant Families
Caryophyllaceae
▪ Herbs
▪ Leaves in opposite pairs, unlobed, untoothed
▪ Flowers usually have 5 petals
▪ Flowers usually have 5 sepals
▪ Flowers in cymes (group of flowers, terminal flower opens first )
▪ Single capsule fruit

Brassicaceae
▪ Herbs
▪ Alternate leaves
▪ No stipules
▪ Flowers have 4 petals in a cross
▪ Flowers have 4 sepals
▪ Many cultivated vegetables

72
 Identifying Plant Families
Apiaceae
▪ Herbs
▪ Leaves usually alternate with sheathing,
inflated leaf-stalk bases
▪ Flowers have 5 separate petals
▪ Flowers small
▪ Umbels type of inflorescence

Lamiaceae / Labiatae
Herbs
Square stems
Leaves opposite
Leaves often toothed
No stipules
Tubular flowers
Flowers usually have hood and prominent lower lip

73
 Identifying Plant Families
Asteraceae / Compositae
▪ Largest family of flowering plants worldwide
▪ Herbs
▪ Leaves without stipules
▪ Flowers small in dense heads
▪ Petals always joined into a corolla-tube
(petals fused together below forming a tube)

Cucurbitaceae
▪ Herbaceous vines
▪ Tendrils present
▪ Plants usually monecious
▪ Flowers 5-merous
▪ Ovary inferior
▪ Fruit usually a pepo
74
 Identifying Plant Families
Asclepiadaceae
▪ Perennial herbs, vines, and shrubs with milky sap, some
cactus-like
▪ Leaves opposite or whorled, simple, entire
▪ Flowers bisexual, actinomorphic, with elaborate corona
containing hoods and horns
▪ Highly specialized pollination mechanism
▪ Pollen contained in waxy pollinia connected in pairs to
glands
▪ Stamens and carpels united into gynostegium
▪ Fruit a follicle
▪ seeds with tuft of silky hairs

Euphorbiaceae
▪ Habit: herbs, shrubs, stem succulents, trees; often with milky sap
▪ Leaves: alternate, opposite, whorled; simple (rarely palmately compound);
stipulate
▪ Plants: monoecious or dioecious
▪ Inflorescence: cymose, racemes, cyathium
▪ Perianth: 0 (4-6); distinct or basally connate, free or adnate at base to
stamens
▪ Stamens: 1-many, distinct or variously connate
▪ Ovary: 3 carpels; connate; superior; 3 (1-4) locules with 1 or 2 apical-axile
ovules per locule; styles 3 (1-4), often forked 75
▪ Fruit: schizocarpic capsule (drupe, berry, pod, samara)
 Identifying Plant Families
Poaceae
▪ Habit: Mainly herbs (annuals or perennials) or shrubs. Some are trees like

▪ Root: Adventitious, fibrous, branched or stilt (as in maize).

▪ Stem: Underground rhizome in all perennial grasses, cylindrical, distinct nodes

and internodes, herbaceous or woody.

▪ Leaves: Alternate, simple, extipulate, sessile, leaf base forming tubular sheath,
sheath open, surrounding the internodes completely, hairy or rough, linear,
parallel venation.

▪ Inflorescence: Compound spike, sessile or stalked. Each unit is called spikelet,

may be a spike of spikelets (Triticum) or panicle of spikelets (Avena).

▪ Perianth: Represented by membranous scales called lodicules, many (Ochlandra)

or three or two or absent.

▪ Androecium: Stamens usually three, some times six (Bambusa) rarely one
(species of Fistuca). Filaments long, anthers dithecous, versatile and linear.

▪ Gynoecium: Monocarpellary (presumed to be three of which two are aborted),

unilocular, single ovule on basal placentation, style short or absent, stigma bifid,
ovary superior.

▪ Fruit: A caryopsis with pericarp completely united with the seed coat, rarely a
nut (Dendrocalamus) or a berry (Bambusa).

▪ Seed: Endospermic, with a single cotyledon called scutellum, pressed against the
endosperm

76
 Identifying Plant Families
Fabaceae / Leguminosae
▪ Five-petalled flowers
▪ Leaves usually trifoliate or pinnate
▪ Wide standard petal at top
▪ 5 sepals forming calyx-tube (lower
parts of sepals fused)
▪ Fruit an elongated pod

77
 Identifying Plant Families
Characteristic of the family Malvaceae:
Presence of epicalyx
Petals with twisted aestivation
Stamens indefinite and monoadelphous
Anthers reniform and monothecous
Ovary two- many carpels with axile placentation.

Floral characteristics of family Malvaceae by dissection

of Hibiscus rosa-sinensis
▪ Inflorescence: Solitary axillary

▪ Floral characteristics: Pedicellate, complete, cyclic, bracteolate in the form

of epicalyx, hermaphrodite, actinomorphic, hypogynous, regular and
pentamerous.

▪ Epicalyx: Number- 5-7, Colour – Green, An additional whorl below calyx

▪ Calyx: Number- 5, Fusion- Gamosepalous, Aestivation- Valvate, Shape –bell

shaped, Colour- Green

▪ Corolla: Number- 5, Fusion- Polypetalous, Aestivation- Twisted, Shape –Bell

shaped, slightly fused due to fusion with staminal tube, Colour- red

▪ Androecium: Stamen, Number.-Indefinite, Cohesion- Monoadelphous. i.e

forming a staminal tube around the style., Adhesion -Epipetalous i.e.
filaments adnate to the basal part of the petal. Anthers- Reniform, i.e.
kidney shaped, Free and monothecous. Basifixed, extrorse.

▪ Gynoecium: Carpel- Number of carpels-5, (Pentacarpellary), Fusion –

Syncarpous, Ovary- Superior, pentalocular with 1 or 2 ovules in each locale,
Style- Long, united below, free above, passes through staminal tube,
Stigma-Five in number, capitate, Placentation-Axile. 78
Taxonomic Key
An identification device, consisting of contrasting statements used to narrow down the
identity of a taxon

A Magnolia Elm
Walnut

Spruce

Pine

White Oak

Chestnut
Holly 79
 Taxonomic Evidences
Taxonomic evidence for the establishment of classifications and phylogenies
is gathered from a variety of sources

Morphology to Molecules

Chemistry 80
Morphology Anatomy Pollen Chromosomes DNA / Molecular taxonomy
Source of Taxonomic Evidences: Vegetative and Floral Morphology

❖ Since there is huge diversity in the vegetative (external plant characteristics) and floral
morphology among flowering plants, the vegetative and floral morphological
characters is the first step in the plant identification and classification of angiospermic
plants.

81
Source of Taxonomic Evidences: Plant Anatomy - (Internal
Characteristics) and Physiology in Relation to Plant Taxonomy
▪ The Anatomical features is the most useful taxonomiccharacters
in classification of the higher taxonomic categories .
• Physiological Evidence - C3 vs. C4 vs.
▪ Anatomical features (plant cell & tissue types) (vs. morphological CAM plants (in terms of their
features) are somewhat more conservative characters thatare strategies for photosynthesizing.
not easily modified by growing conditions.
• C4 photosynthesis occurs in about 10
▪ Anatomical features of vegetative structures (roots, stems, unrelated families of monocots and
leaves) are used to distinguish gymnosperms from angiosperms dicots .... and is associated with plants
and monocots from dicots. that are adapted to arid environments.

• Cyperaceae
• Hydrocharitaceae
• Poaceae / Gramineae
• Acanthaceae
• Aizoaceae
• Amaranthaceae
• Asteraceae
• Boraginaceae
• Capparidaceae
• Caryophyllaceae
• Euphorbiaceae
• Molluginaceae
Figure: Transverse Sections of stem Artocarpus atilis (a) • Nyctaginaceae
and Artocarpus communis (b). • Polygonaceae
▪ PM: Pore multiple • Portulacaceae
▪ T=Tylose (Tyloses are outgrowths on parenchyma cells • Scrophulariaceae
• Zygophyllaceae
of xylem vessels of secondary heartwood 82
▪ SV: Solitary vessel
Source of Taxonomic Evidences: Systematic significance of Stomata
Stomata types produced by characteristic arrangements of guard cells and
subsidiary cells can be of taxonomic use at the family or higherlevel.

Different stomatal apparatus in Angiosperms

❖ Anomocytic type: with epidermal cells around stomata not differentiated
❖ Paracytic type: with two or more cells parallel to the guard cells
differentiated as subsidiary cells
❖ Diacytic type: with two subsidiary cells at right angles to the guards cells
❖ Anisocytic type: with three subsidiary cells of unequal size
❖ Actinocytic type: with stomata surrounded by a circle of radiatingcells
❖ Tetracytic type: with four subsidiary cells
❖ Cyclocytic type: with concentric rings of subsidiary cells
❖ Graminaceous type: with dumb-bell shaped guard cells with two small
subsidiary cells parallel to the guard cells.

❖ FARROKH et al., studies 32

Salix speices of Salix
Species (Salicaceae) in
order to find the
systematic significance of
trichomes in Angiosperms
Source of Taxonomic Evidences: Systematic Significance of
Micromorphological Character of Leaf Surface / Trichomes /
Electron Microscopy in Relation to Taxonomy
▪ Trichomes meaning "hair", are fine outgrowths or appendages on
plants.

▪ Ali and Al-Hemaid (2011) studies trichomes of 23 species of the

member of the family Cucurbitaceae using Electron Microscope in
order to find the systematic significance of micromorphological
characters of trichomes

Trichomes morphology in Cucurbitaceae: (A) Melothria

Trichomes morphology in Cucurbitaceae: (A) Gynostemma maderspatana ·300, (B) Sechium edulae, (C) Thladiantha cordifolia
Trichomes morphology in Cucurbitaceae: (A) Benincasa hispida x300,
pubescens x300, (B) Hemsleya diptrygia x300, (C) Lageneria ·300, (D) Trichosanthes cucumerina ·300, (E) T. cucumerina var.
(B) Citrullus lanatus x300, (C) Cucumis melo var. agrestis
siceraria x300, (D) Luffa acutangula x300, (E) L. cylindrica anguina ·300, (F) T. dioica ·300, (G) T. lepiniana ·300, and (H) T.
x300, (D) C. sativus x300, (E) Diplocyclos palmatus x50, (F) Edgaria
x300, (F) L. echinata x300, (G) Melothria heterophylla x300, tricuspidata ·300.
dargeelingensis x300, (G) Gynostemma burmanicum x300, and (H)G.
and (H) M. leucocarpa x300.
Source of Taxonomic Evidences: Systematic Significance of Seed Micromorphological
Character / Electron Microscopy in Relation to Taxonomy
❖ Spermoderm refers to the pattern present
on the seed coat of mature seeds.

❖ Seed characteristic, particularly

exomorphic features as revealed by
scanning electron microscopy, have been
used by many workers in resolving
taxonomic problems (Koul et al., 2000;
Pandey and Ali, 2006) and evolutionary
relationships (Kumar et al., 1999; Segarra
and Mateu, 2001).

❖ Ali et al. (2003) studied the sppermoderm

pattern of the members of the family
cucurbitaceae using Electron Microscope
in order to find the systematic significance
of micromorphological characters seed
surface

Scanning electron micrograph of the seed surface in Cucurbitaceae: 1. Benincasa hispida ×400 (rugulate); 2. Citrullus colocynthis ×400
(reticulate); 3. Cucumis melo var. agrestis ×400 (reticulate); 4. Diplocyclos palmatus ×1000 (reticulate); 5. Gynostemma laxiflorum ×600
(colliculate); 6. Hemsleya longivillosa ×400 (reticulate); 7. Luffa echinata ×1000 (reticulate); 8. Momordica charantia ×700 (reticulate); 9.
Momordica cymbalaria ×1000 (reticulate); 10. Schizopepon bryoniifolius ×400 (reticulate); 11. Sicyos angulatus ×300 (rugulate); 12.
Trichosanthes cucumerina ×320 (reticulate).
Source of Taxonomic Evidences: Systematic Significance of Palynology / Pollen
Micromorphological Character / Electron Microscopy in Relation to Taxonomy
• Palynology is the study of plant pollen and spores.

• There are two pollen types: monosulcate andtricolpate

• Monosulcate pollen are boat shaped with one long furrow andone
germinal aperture (associated with primitive docots and the
majority of monocots, the cycads and ferns).

• Triculpate pollen are found and typically have 3 apertures andis

characteristic of the more advanceddicots.

Erdtman (1963) used the pollen

charactersin solving the
SEM of pollen grains. A: Nonaperturate pollen grain of Persea americana; B: taxonomic problem of 105
Monosulcate pollen grain of Magnolia grandiflora; C: Monoporate pollen grain of family
Siphonoglossa; D: Tricolporate pollen grain of Scaevola glabra; E: Polyporate spinose
pollen grain of Ipomoaea wolcottiana; F: Tricolpate pollen grain of Disanthus
cercidifolius.
Source of Taxonomic Evidences: Systematic Significance of Embryology
/ Embryology in Relation to Taxonomy
▪ Embryology is the branch of biology that studies the
prenatal development of gametes (sex cells), fertilization,
and development of embryos and seed coats.

▪ The major embryological character that separates the

monocots from the dicots is the number of embryonic
cotyledon leaves.

▪ Embryological features are normally constant at the family

level and below.

▪ The genus Paeonia was earlier included under the family

Ranunculaceae. But Paeonia differs from Ranunculaceae in
chromosome number, vascular anatomy, floral anatomy.

▪ Worsdell (1908) suggested its removal to a distinct family,

Paeoniaceae.

▪ The separation is supported by the embryological features:

(i)centrifugal stamens (not centripetal); (ii) pollen with
reticulately-pitted exine with a large generative cell (not
granular, papillate and smooth, small generative cell); (iii)
unique embryogeny in which early divisions are free nuclear
forming a coenocytic stage, later only the peripheral part
becomes cellular (not onagrad or solanad type); and (iv) 87
seed arillate.
Source of Taxonomic Evidences: / Cytology in Relation to Taxonomy
▪ Cytology is the study of the cell.

▪ Chromosome is a thread-like structure of nucleic acids and protein found in the nucleus of
the living cells, carrying genetic information in the form of gene.

▪ Number of chromosome are fixed for a species.

Chromosome Set:
• Number of chromosome can be counted in the metaphase stage of cell division.

• One copy of each of the different chromosomes in the nucleus containing one copy of each
different gene.

• Haploid Number (n): The number of chromosomes comprising one set.

• Diploid Number (2n): The number of chromosomes in a cell containing two sets.

• Human Haploid (n)= 23, Diploid (2n)=46

• Dates Haploid (n)= 14, Diploid (2n)=28

▪ In plants, only information about chromosome number, shape or pairing at meiosis is used
for classification purposes.

▪ The term karyotype is used for the phenotypic appearance for the somatic chromosomes.

▪ The diagrammatic representation of the karyotype is termed as idiogram.

▪ The characteristic of chromosome having taxonomic values are: chromosome number,

chromosome size, chromosome morphology, and chromosome behavior during meiosis.

▪ The genus Yucca had long been treated as a member if Liliaceae because of the superior
ovary. Hutchinson shifted Yucca to the family Agavaceae because the genus Yucca possess 25 ▪ 88
small and 5 large chromosome which is similar to the member of family Agavaceae
Source of Taxonomic Evidences: / Chemotaxonomy / Chemical Information in
Relation to Taxonomy
❖ Application of chemistry to taxonomy is called chemical taxonomy / chemotaxonomy.

❖ Some of the major classes of the chemical evidence include Anthocyanin, Flavonoids,
Alkaloids, Glycosides, Terpenes, Amino acid, Fatty acids, Aromatic compounds,
Polysaccharides, Carotenoids

❖ Caryophyllales produces Betalin and not anthocyanin

❖ Polygonales produce anthocyanin and not Betalin

❖ Highly aromatic compound are found in Lamiaceae

Source of Taxonomic Evidences: / Ecology in Relation to Taxonomy
• The ecological criteria are of comparatively little direct
importance in taxonomy.

• Ecological Evidence provides information about variation

within plant taxa associated with plant adaptations and the
distribution of plants.

• Plant ecologists frequently examine edaphic (soil)

specializations, pollinating mechanisms (co-evolution),
effect of habitat on hybridization, plant-herbivore Erect form of Euphorbia hira
interactions (co-evolution), seed-dispersal mechanisms,
reproductive isolating mechanisms.

• Information from plant ecology has implicationsfor

classification below the level of genus.

• Ecotypes:
• Ecotypes is a distinct form or race of a plant species
occupying a particular habitat.
• Example; prostrate and erect form of Euphorbia hira Prostrate form of Euphorbia hira
(Euphorbiaeae)
90
Source of Taxonomic Evidences: Molecular Data / DNA / Molecular
Taxonomy

▪ The Cell is the basic structural, functional and biological unit of all known living organisms. The Nucleus is enclosed in an
envelope which is a double membrane structure. The Nucleus contains DNA in the form of loose threads called chromatin /
Chromosomes

▪ The chromosomes are the thread-like structure of nucleic acids and protein found in the nucleus of the living cells, carrying
genetic information in the form of gene.

▪ Genes passes genetic information from one generation to another generation. Genes lies on Chromosomes. Genes are made up
of DNA. There are large number of genes occurs in each cell on each chromosomes.

▪ DNA (Deoxyribo Nucleic Acid) the genetic materials of living organism. The model of DNA was given by James Watson and
Francis Crick in 1962.

▪ Protein synthesis is the main function of the gene. DNA transcribed in to RNA (called as Transcription), and then RNA translated
into Amino Acids (called as Translation). There are 20 different types of amino acids. Several amino acids in a fixed sequenced
forms protein.
91
▪ Gene expression is the process of converting information from gene to cellular product.
Molecular systematics
▪ Molecular systematics deals
the utilization of nucleic acid Gel electrophoresis
data. As DNA sequence of a
Collection of plant samples
gene is constant in a species,
hence advantage over
morphological data for A view of molecular biology
taxonomic studies. laboratory
Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12:13–15
▪ Taxonomist use molecular
data from three different
locations within a plant cell:
chloroplast, mitochondrion
and the nucleus.

▪ Molecular systematics Building Tree

involves following steps: (1)
Sample collection, (2) DNA
extraction, (3) Amplification
using PCR –Polymerase chain
Reaction, (4) DNA / Gene
Sequencing, (5) Analysis of DNA sequence alignment
Sequence data. using ClustalX
▪ DNA barcoding can speed up
identification of species. DNA
barcoding helps in Wild plant
identification / Medicinal
plant authentication

▪ A DNA barcode is a short gene

sequence taken from
standardized portions of the
genome, used to identify
species
Phylogenetic Implication of Molecular Genotyping of Euryops
jaberiana Abedin & Chaudhary (Asteraceae)
❖In Saudi Arabia, the genus Euryops (family Asteraceae) is represented
by two species, viz. E. arabicus Steud. ex Jaub. & Spach, and E.
jaberiana Abedin & Chaudhary.

❖E. arabicus is is endemic to Arabian Peninsula, while E. jaberiana is

endemic to northern Saudi Arabia.

❖Morphologically E. jaberiana very closely resembles with E. arabicus /

very narrow differences in m morphological characters (Abedin and
Chaudhary, 2000).

E. arabicus

❖The taxonomic status of Euryops

jaberiana Abedin & Chaudhary (tribe
Senecioneae, was evaluated (Ali et al.,
2016) based on molecular
phylogenetic analyses of internal
transcribed spacer sequence (ITS) of
nuclear ribosomal DNA (nrDNA) in
order to ascertain its position within
the genus.
93
Phylogenetic Implication of Molecular Genotyping of Euryops jaberiana Abedin & Chaudhary (Asteraceae)
Contd……
Branch ❑ In molecular taxonomic studies, the most convenient way of presenting
taxonomic relationships among a group of organisms is the phylogenetic tree.

❑ Node: a branch point in a tree

Clade
❑ Branch: defines the relationship between the taxon
Node
❑ Topology: the branching patterns of the tree

❑ Branch length: represents the number of changes that have occurred in the
branch

❑ Clade: a group of two or more taxa closed together based on DNA sequences data
analsysis

❑ Maximum parsimony is an optimality criterion under which the phylogenetic tree

that minimizes the total number of character-state changes is to be preferred.

❑ Bootstrap: Bootstrapping is a procedure where DNA sequence data run for the
phylogenetic analysis, and the reported value is the percentageof
bootstrap replicates, for examples 100 means that the node is well-supported, it
showed in all tress.

❖The key morphological features which differentiate E. jaberiana from E.

arabicus are: leaves 3-lobed at the tips, pappus hairs transparent orrarely
dull white, and achenes glabrescent, while in E. arabicus, the leaves are
unlobed, pappus hairs are dull white and achene densely lanate hairy
(Abedin and Chaudhary, 2000).

❖The Maximum Parsimony analyses reveals that E. jaberiana nested within

the clade of the section Angustifoliae.

❖E. jaberiana shows proximity with E. arabicus (66% bootstrapsupport.

94
Phylogenetic Implication of Molecular Genotyping of Euryops jaberiana Abedin & Chaudhary (Asteraceae)
Contd……
10 20 30 40 50 60 70 80 90 100
....|.. ..|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ....|....|....|

Euryops_jabriana TCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAATAACAATCGGGTGTCCATGGTTTCCGACTATTGTTTGATTCTTTGGATACCCTGATAATGTG
Euryops_arabicus ............................................................................................T.......
Clustal Consensus ******************************************************************************************** *******

110 120 130 140 150 160 170 180 190 200
....|.. ..|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ....|....|....|

Euryops_jabriana CGTCTTTGGTCAGCCGCTTGGGTCCTAATGATGTCACATTAACACAATAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATAAAACTTAAGAAAAGCT
Euryops_arabicus ...............C....................................................................................
Clustal Consensus *************** ************************************************************************************

210 220 230 240 250 260 270 280 290 300
....|.. ..|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ....|....|....|

Euryops_jabriana TGTATCATGTTACGTCGTTCGCGGGGTTTGCATGATACGTGGCTTCTTTATAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGA
Euryops_arabicus C...................................................................................................
Clustal Consensus ***************************************************************************************************

310 320 330 340 350 360 370 380 390 400
....|.. ..|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ....|....|....|

Euryops_jabriana AGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCA
Euryops_arabicus ....................................................................................................
Clustal Consensus ****************************************************************************************************

410 420 430 440 450 460 470 480 490 500
....|.. ..|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ....|....|....|

Euryops_jabriana CGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCACAACATCTCTTGATTGGGATGTTGTAATGGGGGCGGATATTGGTCTCCCGTTCCTAAGGTTCGG
Euryops_arabicus ..........................................G.................G.......................................
Clustal Consensus ****************************************** ***************** ***************************************

510 520 530 540 550 560 570 580 590 600
....|.. ..|....|....|....|....|....| ....| ....|....|....|....|....|....|....|....|....| ....|....| ....|

Euryops_jabriana TTGGCTAAAATAGGAGTCCCCTTCGAAGGATGCACGATTAGTGGTGGTTGTCAAGACCTTCTTATCGACTCGCGCGTTACAAGTAGTAGGGAAGATCTCT
Euryops_arabicus ..............................C.........................................T...........................
Clustal Consensus ****************************** ***************************************** ***************************

610 620 630 640

....|....|....|....|....|.... |....|....|....|

Euryops_jabriana TCAAAGACCCTAATGTGTTGTCTTGTGACAATGCTTCGACCGCGA
Euryops_arabicus ..........C..................................
Clustal Consensus ********** **********************************

❖ A total of eight specific nucleotide differences were detected between E. jaberiana

and E. Arabicus i.e. at the alignment position:
❖ 93 (A→T)
❖ 116 (G →C)
❖ 201 (T →C)
❖ 443 (C→G) Thus on the basis of phylogenetic
❖ 461 (T →G) relationships of E. jaberiana within the genus
❖ 531 (T → C) and nucleotide differences, Ali et al. (2016)
❖ 573 (C→T) recognized E. jaberiana as a distinct species
❖ 611 (T →C) and different from E. arabicus.
95
ONLINE RESOURCES OF PLANT TAXONOMY

nomenclatural, bibliographic,
and specimen data
 LITERATURE OF PLANT TAXONOMY
Records: Library and Herbarium

Publications:

Monograph - covers a specific group of plants: family, genera, etc. (Revisions, Synopses)

Flora - Treatment of plants in a defined geographical area

Taxonomic journals
❖ American Journal of Botany (http://www.amjbot.org)
❖ Annals of the Missouri Botanic Garden(http://www.mbgpress.org/)
❖ Australian Journal of Botany (http://www.publish.csiro.au/nid/65.htm)
❖ Botanical Journal of the Linnaean Society (http://www.blackwellpublishing.com/jnl_default.asp)
❖ Botanical Review (http://sciweb.nybg.org/science2/BotanicalReview.asp)
❖ Brittonia (http://www.nybg.org/bsci/brit/)
❖ Canadian Journal of Botany (http://pubs.nrc-cnrc.gc.ca/cgi-bin/rp/rp2_desc_e?cjb)
❖ Fieldiana (Botany) http://www.fortsasbooks.com/publish.htm
❖ Grana (http://www.tandf.co.uk/journals/titles/00173134.asp)
❖ International Journal of Plant Sciences (http://www.journals.uchicago.edu/IJPS/home.html)
❖ Molecular Biology & Evolution (http://mbe.oupjournals.org)
❖ Molecular Phylogenetics & Evolution (http://www.elsevier.com)
❖ Nordic Journal of Botany (http://www.nathimus.ku.dk/bot/b_nordic.htm)
❖ Novon( http://www.mbgpress.org/)
❖ Smithsonian Contributions to Botany (http://www.sipress.si.edu/the_press/press_main.html)
❖ Systematic Biology (http://systbiol.org)
❖ Systematic Botany (http://www.sysbot.org/)
❖ Taxon (http://www.botanik.univie.ac.at/iapt/s_taxon.php)
THANKS

100