0% found this document useful (0 votes)
41 views480 pages

Enzymology

Uploaded by

isalinastm11
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
41 views480 pages

Enzymology

Uploaded by

isalinastm11
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 480

METHODS IN ENZYMOLOGY

Editors-in-Chief

JOHN N. ABELSON AND MELVIN I. SIMON


Division of Biology
California Institute of Technology
Pasadena, California, USA

Founding Editors

SIDNEY P. COLOWICK AND NATHAN O. KAPLAN


Academic Press is an imprint of Elsevier
525 B Street, Suite 1900, San Diego, CA 92101-4495, USA
30 Corporate Drive, Suite 400, Burlington, MA 01803, USA
32 Jamestown Road, London NW1 7BY, UK

First edition 2009

Copyright # 2009, Elsevier Inc. All rights reserved

No part of this publication may be reproduced, stored in a retrieval system or transmitted in any
form or by any means electronic, mechanical, photocopying, recording or otherwise without the
prior written permission of the publisher

Permissions may be sought directly from Elsevier’s Science & Technology Rights Department
in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@
elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at
http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material

Notice
No responsibility is assumed by the publisher for any injury and/or damage to persons or
property as a matter of products liability, negligence or otherwise, or from any use or operation
of any methods, products, instructions or ideas contained in the material herein. Because of rapid
advances in the medical sciences, in particular, independent verification of diagnoses and drug
dosages should be made

For information on all Academic Press publications


visit our website at elsevierdirect.com

ISBN: 978-0-12-374908-6
ISSN: 0076-6879

Printed and bound in United States of America


09 10 11 12 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS

Sarah Able
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Antonio Alcami
Centro de Biologı́a Molecular Severo Ochoa (Consejo Superior de Investigaciones
Cientı́ficas-Universidad Autónoma de Madrid), Cantoblanco, Madrid, Spain, and
Department of Medicine, University of Cambridge, Cambridge, United Kingdom
Paola Allavena
Department of Immunology and Inflammation, IRCCS Istituto Clinico Humani-
tas, Rozzano (Milan), Italy
Mee Y. Bartee
Division of Cardiovascular Medicine, Department of Medicine and Department of
Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida,
USA
Adit Ben-Baruch
Department of Cell Research and Immunology, George S. Wise Faculty of Life
Sciences, Tel Aviv University, Tel Aviv, Israel
Paolo Bianchi
Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas,
Rozzano (Milan), Italy
Emma Blair
Department of Chemistry, and Division of Immunology, Infection and Inflamma-
tion, Glasgow Biomedical Research Center, Glasgow University, Glasgow,
United Kingdom
Raffaella Bonecchi
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
Elena M. Borroni
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
James R. Broach
Department of Molecular Biology, Princeton University, Princeton, New Jersey,
USA

xiii
xiv Contributors

Chiara Buracchi
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
Erbin Dai
Department of Medicine, University of Florida, Gainesville, Florida, USA
John F. DiPersio
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Patrick Dorr
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Pieter C. Dorrestein
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Marco Erreni
Department of Immunology and Inflammation, IRCCS Istituto Clinico Humani-
tas, Rozzano (Milan), Italy
Barry J. Evans
Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson
University, Philadelphia, Pennsylvania, USA
Marco Fabbri
Department of Immunology and Inflammation, IRCCS Istituto Clinico
Humanitas, Rozzano (Milan), Italy
Nobutaka Fujii
Department of Chemogenomics, Graduate School of Pharmaceutical Sciences,
Kyoto University, Sakyo-ku, Kyoto, Japan
Kerry B. Goralski
Department of Pharmacology, Faculty of Medicine, and College of Pharmacy,
Faculty of Health Professions Dalhousie University, Halifax, Nova Scotia, Canada
Gerard J. Graham
Division of Immunology, Infection and Inflammation, Glasgow Biomedical
Research Center, Glasgow University, Glasgow, United Kingdom
Paul Griffin
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
J. Silvio Gutkind
Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial
Research, National Institutes of Health, Bethesda, Maryland, USA
Contributors xv

Amy-Joan L. Ham
Department of Biochemistry, Vanderbilt University School of Medicine,
Nashville, Tennessee, USA
Tracy M. Handel
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Karen E. Hedin
Department of Immunology, College of Medicine, Mayo Clinic, Rochester,
Minnesota, USA
Richard Horuk
Department of Pharmacology, UC Davis, Davis, California, USA
Becky Irvine
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Neil Isaacs
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow
University, Glasgow, United Kingdom
Ian James
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Tom Kershaw
Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department
of Cell and Developmental Biology, University College London, London,
United Kingdom
Kimberly N. Kremer
Department of Immunology, College of Medicine, Mayo Clinic, Rochester,
Minnesota, USA
Ashok Kumar
Endocrine Research Unit, Mayo Clinic, Rochester, Minnesota, USA
Luigi Laghi
Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas,
Rozzano (Milan), Italy
Meizhang Li
Neuroinflammation Research Center, Department of Neurosciences, Lerner
Research Institute, Cleveland Clinic, Cleveland, Ohio, USA
Sergio A. Lira
Immunology Institute, Mount Sinai School of Medicine, New York, New York,
USA
xvi Contributors

Liying Liu
Department of Medicine, University of Florida, Gainesville, Florida, USA
Massimo Locati
Department of Translational Medicine, University of Milan, IRCCS Istituto
Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia
Alexandra R. Lucas
Division of Cardiovascular Medicine, Department of Medicine and Department of
Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida,
USA
Malcolm Macartney
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Colin Macaulay
Division of Cardiovascular Medicine, University of Florida, Gainesville, Florida, USA
Roy Mansfield
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Alberto Mantovani
Department of Translational Medicine, University of Milan, IRCCS Istituto
Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia
Adriano Marchese
Department of Pharmacology, Stritch School of Medicine, Loyola University
Chicago, Maywood, Illinois, USA
Mark Marsh
Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department
of Cell and Developmental Biology, University College London, London,
United Kingdom
Andrea P. Martin
Immunology Institute, Mount Sinai School of Medicine, New York, New York,
USA
Daniel Martin
Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial
Research, National Institutes of Health, Bethesda, Maryland, USA
David Maussang
Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry,
Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Clare McCulloch
Department of Chemistry, and Division of Immunology, Infection and Inflamma-
tion, Glasgow Biomedical Research Center, Glasgow University, Glasgow,
United Kingdom
Contributors xvii

Grant McFadden
Department of Molecular Genetics and Microbiology, University of
Florida, Gainesville, Florida, USA
Pauline McLean
Department of Chemistry, and Division of Immunology, Infection and Inflamma-
tion, Glasgow Biomedical Research Center, Glasgow University, Glasgow,
United Kingdom
Dana McIvor
Division of Cardiovascular Medicine, University of Florida, Gainesville,
Florida, USA
Raymond L. Mernaugh
Department of Biochemistry, Vanderbilt University School of Medicine,
Nashville, Tennessee, USA
Tsipi Meshel
Department of Cell Research and Immunology, George S. Wise Faculty of Life
Sciences, Tel Aviv University, Tel Aviv, Israel
Detlef Michel
Institute of Virology, Ulm University Clinic, Ulm, Germany
Ken Miller
Pfizer GRD-Groton Laboratories, Groton, Connecticut, USA
James Mills
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Massimilliano Mirolo
Laboratory of Leukocyte Biology, Department of Translational Medicine, University
of Milan, IRCCS Istituto Clinico Humanitas, Italy
Ganesh Munuswamy-Ramanujam
Division of Cardiovascular Medicine, Department of Medicine and Department of
Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida,
USA
Carolyn Napier
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Iva Navratilova
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Manuela Nebuloni
Pathology Unit, L. Sacco Institute of Medical Sciences, University of Milan, Milan,
Italy
xviii Contributors

Nicole F. Neel
Department of Cancer Biology, Vanderbilt University School of Medicine,
Nashville, Tennessee, USA
Bruno Nervi
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Robert J. B. Nibbs
Division of Immunology, Infection and Inflammation, Glasgow Biomedical
Research Center, Glasgow University, Glasgow, United Kingdom
Morgan O’Hayre
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Shinya Oishi
Department of Chemogenomics, Graduate School of Pharmaceutical Sciences,
Kyoto University, Sakyo-ku, Kyoto, Japan
Fabio Pasqualini
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
James E. Pease
Leukocyte Biology Section, National Heart and Lung Institute, Imperial College
London, London, United Kingdom
Stephen C. Peiper
Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson
University, Philadelphia, Pennsylvania, USA
Manos Perros
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Dayanidhi Raman
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Pablo Ramirez
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Richard M. Ransohoff
Neuroinflammation Research Center, Department of Neurosciences, Lerner
Research Institute, Cleveland Clinic, Cleveland, Ohio, USA
Michael P. Rettig
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Contributors xix

Alan Riboldi-Tunniclife
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow
University, Glasgow, United Kingdom
Ann J. Richmond
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Graham Rickett
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Harriet Root
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Remo C. Russo
Department of Biochemistry and Immunology, Instituto de Ciencias Biologicas,
Universidade Federal de Minas Gerais, Belo Horizonte, Brazil, and Laboratory of
Leukocyte Biology, Department of Translational Medicine, University of Milan,
IRCCS Istituto Clinico Humanitas, Italy
Elna van der Ryst
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Jiqing Sai
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Catherina L. Salanga
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Benedetta Savino
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
Andreas Schreiber
Institute of Virology, Ulm University Clinic, Ulm, Germany
Limin Shang
Immunology Institute, Mount Sinai School of Medicine, New York, New York,
USA
Nathalie Signoret
Centre for Immunology and Infection, Department of Biology and Hull York
Medical School, University of York, York, United Kingdom
Olivia L. Sims
Department of Immunology, College of Medicine, Mayo Clinic, Rochester,
Minnesota, USA
xx Contributors

Christopher J. Sinal
Department of Pharmacology, Faculty of Medicine, Dalhousie University, Halifax,
Nova Scotia, Canada
Martine J. Smit
Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry,
Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Gali Soria
Department of Cell Research and Immunology, George S. Wise Faculty of Life
Sciences, Tel Aviv University, Tel Aviv, Israel
Nagarajan Vaidehi
Division of Immunology, Beckman Research Institute of the City of Hope,
Duarte, California, USA
Abel Viejo-Borbolla
Centro de Biologı́a Molecular Severo Ochoa, (Consejo Superior de Investiga-
ciones Cientı́ficas-Universidad Autónoma de Madrid), Cantoblanco, Madrid,
Spain, and Immunology Institute, Mount Sinai School of Medicine, New York,
New York, USA
Henry F. Vischer
Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry,
Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Zixuan Wang
Department of Pathology, Anatomy and Cell Biology, and Department of Surgery,
Thomas Jefferson University, Philadelphia, Pennsylvania, USA
Silène T. Wavre-Shapton
Molecular Medicine NHL1, Imperial College, South Kennigton, London, United
Kingdom
Mike Westby
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Jinming Yang
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Yanshi Zhu
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow
University, Glasgow, United Kingdom
PREFACE

Chemokines and chemokine receptors are the eyes and ears of the immune
system, and under normal healthy conditions they guide the migration of
leukocytes within the body to areas of assault or injury. Of course, this
system can be broken, corrupted, compromised, and led astray in a variety
of ways. Immune cells can attack their own tissues leading to autoimmune
diseases such as rheumatoid arthritis and multiple sclerosis. Many pathogens
have evolved ways to ‘‘blind’’ the immune system, thus allowing them to go
undetected and propagate freely. Viruses such as HIV-1 have been shown to
use specific transmembrane chemokine receptors as one path to cellular
entry and infection. The progression of cancer can even be aided by the
good intentions of immune system–mediated vascularization.
The list goes on, and hence the scientific community has long realized
the importance of understanding and eventually being able to manipulate
this complex system. As a result, the number of papers addressing chemo-
kines and chemokine receptors has grown exponentially over the last
decade. In 1997, Richard Horuk edited volumes 287 and 288 of the
Methods in Enzymology series on chemokines and chemokine receptors,
putting together the first comprehensive practical guide to studying these
molecules.
Since then many new technologies and methodologies have been
designed and implemented in the study of these proteins. Volumes 460
and 461 of Methods in Enzymology seek to compile and highlight these recent
methods, explain their importance, and clearly describe in detail the proto-
cols necessary for successful experimental reproduction. Volume 460
focuses on studying the roles of chemokines and chemokine receptors in
disease states, atypical chemokine receptors, and chemokine signaling, as
well as chemokine related proteins from pathogens. Volume 461 deals with
the assays and methods used to study structure and function of these proteins
and to characterize their ultimate goal of cell migration. These methods
span a wide spectrum of multidisciplinary techniques, from new spectro-
scopic advances to in situ cell-selective protein expression to devices
designed to mimic the conditions of flow present in blood vessels where
in situ leukocyte migration occurs.
Many of the authors from the first volumes have returned in the present
work to build upon the foundation they laid over a decade ago. In addition,

xxi
xxii Preface

many newer researchers have pitched in and lent their expansive expertise to
the cause. Compilations like this are assembled by the immense efforts of many
individual researchers and we emphatically offer our thanks and gratitude to all
of the authors who contributed to making these volumes a reality.

TRACY M. HANDEL AND DAMON J. HAMEL


METHODS IN ENZYMOLOGY

VOLUME I. Preparation and Assay of Enzymes


Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME II. Preparation and Assay of Enzymes
Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME III. Preparation and Assay of Substrates
Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME IV. Special Techniques for the Enzymologist
Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME V. Preparation and Assay of Enzymes
Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME VI. Preparation and Assay of Enzymes (Continued)
Preparation and Assay of Substrates
Special Techniques
Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME VII. Cumulative Subject Index
Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
VOLUME VIII. Complex Carbohydrates
Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG
VOLUME IX. Carbohydrate Metabolism
Edited by WILLIS A. WOOD
VOLUME X. Oxidation and Phosphorylation
Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN
VOLUME XI. Enzyme Structure
Edited by C. H. W. HIRS
VOLUME XII. Nucleic Acids (Parts A and B)
Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE
VOLUME XIII. Citric Acid Cycle
Edited by J. M. LOWENSTEIN
VOLUME XIV. Lipids
Edited by J. M. LOWENSTEIN
VOLUME XV. Steroids and Terpenoids
Edited by RAYMOND B. CLAYTON

xxiii
xxiv Methods in Enzymology

VOLUME XVI. Fast Reactions


Edited by KENNETH KUSTIN
VOLUME XVII. Metabolism of Amino Acids and Amines (Parts A and B)
Edited by HERBERT TABOR AND CELIA WHITE TABOR
VOLUME XVIII. Vitamins and Coenzymes (Parts A, B, and C)
Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT
VOLUME XIX. Proteolytic Enzymes
Edited by GERTRUDE E. PERLMANN AND LASZLO LORAND
VOLUME XX. Nucleic Acids and Protein Synthesis (Part C)
Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN
VOLUME XXI. Nucleic Acids (Part D)
Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE
VOLUME XXII. Enzyme Purification and Related Techniques
Edited by WILLIAM B. JAKOBY
VOLUME XXIII. Photosynthesis (Part A)
Edited by ANTHONY SAN PIETRO
VOLUME XXIV. Photosynthesis and Nitrogen Fixation (Part B)
Edited by ANTHONY SAN PIETRO
VOLUME XXV. Enzyme Structure (Part B)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME XXVI. Enzyme Structure (Part C)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME XXVII. Enzyme Structure (Part D)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME XXVIII. Complex Carbohydrates (Part B)
Edited by VICTOR GINSBURG
VOLUME XXIX. Nucleic Acids and Protein Synthesis (Part E)
Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE
VOLUME XXX. Nucleic Acids and Protein Synthesis (Part F)
Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN
VOLUME XXXI. Biomembranes (Part A)
Edited by SIDNEY FLEISCHER AND LESTER PACKER
VOLUME XXXII. Biomembranes (Part B)
Edited by SIDNEY FLEISCHER AND LESTER PACKER
VOLUME XXXIII. Cumulative Subject Index Volumes I-XXX
Edited by MARTHA G. DENNIS AND EDWARD A. DENNIS
VOLUME XXXIV. Affinity Techniques (Enzyme Purification: Part B)
Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK
Methods in Enzymology xxv

VOLUME XXXV. Lipids (Part B)


Edited by JOHN M. LOWENSTEIN
VOLUME XXXVI. Hormone Action (Part A: Steroid Hormones)
Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN
VOLUME XXXVII. Hormone Action (Part B: Peptide Hormones)
Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN
VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides)
Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY
VOLUME XXXIX. Hormone Action (Part D: Isolated Cells, Tissues,
and Organ Systems)
Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY
VOLUME XL. Hormone Action (Part E: Nuclear Structure and Function)
Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN
VOLUME XLI. Carbohydrate Metabolism (Part B)
Edited by W. A. WOOD
VOLUME XLII. Carbohydrate Metabolism (Part C)
Edited by W. A. WOOD
VOLUME XLIII. Antibiotics
Edited by JOHN H. HASH
VOLUME XLIV. Immobilized Enzymes
Edited by KLAUS MOSBACH
VOLUME XLV. Proteolytic Enzymes (Part B)
Edited by LASZLO LORAND
VOLUME XLVI. Affinity Labeling
Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK
VOLUME XLVII. Enzyme Structure (Part E)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME XLVIII. Enzyme Structure (Part F)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME XLIX. Enzyme Structure (Part G)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME L. Complex Carbohydrates (Part C)
Edited by VICTOR GINSBURG
VOLUME LI. Purine and Pyrimidine Nucleotide Metabolism
Edited by PATRICIA A. HOFFEE AND MARY ELLEN JONES
VOLUME LII. Biomembranes (Part C: Biological Oxidations)
Edited by SIDNEY FLEISCHER AND LESTER PACKER
xxvi Methods in Enzymology

VOLUME LIII. Biomembranes (Part D: Biological Oxidations)


Edited by SIDNEY FLEISCHER AND LESTER PACKER
VOLUME LIV. Biomembranes (Part E: Biological Oxidations)
Edited by SIDNEY FLEISCHER AND LESTER PACKER
VOLUME LV. Biomembranes (Part F: Bioenergetics)
Edited by SIDNEY FLEISCHER AND LESTER PACKER
VOLUME LVI. Biomembranes (Part G: Bioenergetics)
Edited by SIDNEY FLEISCHER AND LESTER PACKER
VOLUME LVII. Bioluminescence and Chemiluminescence
Edited by MARLENE A. DELUCA
VOLUME LVIII. Cell Culture
Edited by WILLIAM B. JAKOBY AND IRA PASTAN
VOLUME LIX. Nucleic Acids and Protein Synthesis (Part G)
Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN
VOLUME LX. Nucleic Acids and Protein Synthesis (Part H)
Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN
VOLUME 61. Enzyme Structure (Part H)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME 62. Vitamins and Coenzymes (Part D)
Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT
VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and
Inhibitor Methods)
Edited by DANIEL L. PURICH
VOLUME 64. Enzyme Kinetics and Mechanism
(Part B: Isotopic Probes and Complex Enzyme Systems)
Edited by DANIEL L. PURICH
VOLUME 65. Nucleic Acids (Part I)
Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE
VOLUME 66. Vitamins and Coenzymes (Part E)
Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT
VOLUME 67. Vitamins and Coenzymes (Part F)
Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT
VOLUME 68. Recombinant DNA
Edited by RAY WU
VOLUME 69. Photosynthesis and Nitrogen Fixation (Part C)
Edited by ANTHONY SAN PIETRO
VOLUME 70. Immunochemical Techniques (Part A)
Edited by HELEN VAN VUNAKIS AND JOHN J. LANGONE
Methods in Enzymology xxvii

VOLUME 71. Lipids (Part C)


Edited by JOHN M. LOWENSTEIN
VOLUME 72. Lipids (Part D)
Edited by JOHN M. LOWENSTEIN
VOLUME 73. Immunochemical Techniques (Part B)
Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS
VOLUME 74. Immunochemical Techniques (Part C)
Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS
VOLUME 75. Cumulative Subject Index Volumes XXXI, XXXII, XXXIV–LX
Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS
VOLUME 76. Hemoglobins
Edited by ERALDO ANTONINI, LUIGI ROSSI-BERNARDI, AND EMILIA CHIANCONE
VOLUME 77. Detoxication and Drug Metabolism
Edited by WILLIAM B. JAKOBY
VOLUME 78. Interferons (Part A)
Edited by SIDNEY PESTKA
VOLUME 79. Interferons (Part B)
Edited by SIDNEY PESTKA
VOLUME 80. Proteolytic Enzymes (Part C)
Edited by LASZLO LORAND
VOLUME 81. Biomembranes (Part H: Visual Pigments and Purple Membranes, I)
Edited by LESTER PACKER
VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix)
Edited by LEON W. CUNNINGHAM AND DIXIE W. FREDERIKSEN
VOLUME 83. Complex Carbohydrates (Part D)
Edited by VICTOR GINSBURG
VOLUME 84. Immunochemical Techniques (Part D: Selected Immunoassays)
Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS
VOLUME 85. Structural and Contractile Proteins (Part B: The Contractile Apparatus
and the Cytoskeleton)
Edited by DIXIE W. FREDERIKSEN AND LEON W. CUNNINGHAM
VOLUME 86. Prostaglandins and Arachidonate Metabolites
Edited by WILLIAM E. M. LANDS AND WILLIAM L. SMITH
VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates,
Stereo-chemistry, and Rate Studies)
Edited by DANIEL L. PURICH
VOLUME 88. Biomembranes (Part I: Visual Pigments and Purple Membranes, II)
Edited by LESTER PACKER
xxviii Methods in Enzymology

VOLUME 89. Carbohydrate Metabolism (Part D)


Edited by WILLIS A. WOOD
VOLUME 90. Carbohydrate Metabolism (Part E)
Edited by WILLIS A. WOOD
VOLUME 91. Enzyme Structure (Part I)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME 92. Immunochemical Techniques (Part E: Monoclonal Antibodies and
General Immunoassay Methods)
Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS
VOLUME 93. Immunochemical Techniques (Part F: Conventional Antibodies, Fc
Receptors, and Cytotoxicity)
Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS
VOLUME 94. Polyamines
Edited by HERBERT TABOR AND CELIA WHITE TABOR
VOLUME 95. Cumulative Subject Index Volumes 61–74, 76–80
Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS
VOLUME 96. Biomembranes [Part J: Membrane Biogenesis: Assembly and
Targeting (General Methods; Eukaryotes)]
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 97. Biomembranes [Part K: Membrane Biogenesis: Assembly and
Targeting (Prokaryotes, Mitochondria, and Chloroplasts)]
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 98. Biomembranes (Part L: Membrane Biogenesis: Processing
and Recycling)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 99. Hormone Action (Part F: Protein Kinases)
Edited by JACKIE D. CORBIN AND JOEL G. HARDMAN
VOLUME 100. Recombinant DNA (Part B)
Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE
VOLUME 101. Recombinant DNA (Part C)
Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE
VOLUME 102. Hormone Action (Part G: Calmodulin and
Calcium-Binding Proteins)
Edited by ANTHONY R. MEANS AND BERT W. O’MALLEY
VOLUME 103. Hormone Action (Part H: Neuroendocrine Peptides)
Edited by P. MICHAEL CONN
VOLUME 104. Enzyme Purification and Related Techniques (Part C)
Edited by WILLIAM B. JAKOBY
Methods in Enzymology xxix

VOLUME 105. Oxygen Radicals in Biological Systems


Edited by LESTER PACKER
VOLUME 106. Posttranslational Modifications (Part A)
Edited by FINN WOLD AND KIVIE MOLDAVE
VOLUME 107. Posttranslational Modifications (Part B)
Edited by FINN WOLD AND KIVIE MOLDAVE
VOLUME 108. Immunochemical Techniques (Part G: Separation and
Characterization of Lymphoid Cells)
Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS
VOLUME 109. Hormone Action (Part I: Peptide Hormones)
Edited by LUTZ BIRNBAUMER AND BERT W. O’MALLEY
VOLUME 110. Steroids and Isoprenoids (Part A)
Edited by JOHN H. LAW AND HANS C. RILLING
VOLUME 111. Steroids and Isoprenoids (Part B)
Edited by JOHN H. LAW AND HANS C. RILLING
VOLUME 112. Drug and Enzyme Targeting (Part A)
Edited by KENNETH J. WIDDER AND RALPH GREEN
VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Compounds
Edited by ALTON MEISTER
VOLUME 114. Diffraction Methods for Biological Macromolecules (Part A)
Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF
VOLUME 115. Diffraction Methods for Biological Macromolecules (Part B)
Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF
VOLUME 116. Immunochemical Techniques
(Part H: Effectors and Mediators of Lymphoid Cell Functions)
Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS
VOLUME 117. Enzyme Structure (Part J)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME 118. Plant Molecular Biology
Edited by ARTHUR WEISSBACH AND HERBERT WEISSBACH
VOLUME 119. Interferons (Part C)
Edited by SIDNEY PESTKA
VOLUME 120. Cumulative Subject Index Volumes 81–94, 96–101
VOLUME 121. Immunochemical Techniques (Part I: Hybridoma Technology and
Monoclonal Antibodies)
Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS
VOLUME 122. Vitamins and Coenzymes (Part G)
Edited by FRANK CHYTIL AND DONALD B. MCCORMICK
xxx Methods in Enzymology

VOLUME 123. Vitamins and Coenzymes (Part H)


Edited by FRANK CHYTIL AND DONALD B. MCCORMICK
VOLUME 124. Hormone Action (Part J: Neuroendocrine Peptides)
Edited by P. MICHAEL CONN
VOLUME 125. Biomembranes (Part M: Transport in Bacteria, Mitochondria, and
Chloroplasts: General Approaches and Transport Systems)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 126. Biomembranes (Part N: Transport in Bacteria, Mitochondria, and
Chloroplasts: Protonmotive Force)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 127. Biomembranes (Part O: Protons and Water: Structure
and Translocation)
Edited by LESTER PACKER
VOLUME 128. Plasma Lipoproteins (Part A: Preparation, Structure, and
Molecular Biology)
Edited by JERE P. SEGREST AND JOHN J. ALBERS
VOLUME 129. Plasma Lipoproteins (Part B: Characterization, Cell Biology,
and Metabolism)
Edited by JOHN J. ALBERS AND JERE P. SEGREST
VOLUME 130. Enzyme Structure (Part K)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME 131. Enzyme Structure (Part L)
Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF
VOLUME 132. Immunochemical Techniques (Part J: Phagocytosis and
Cell-Mediated Cytotoxicity)
Edited by GIOVANNI DI SABATO AND JOHANNES EVERSE
VOLUME 133. Bioluminescence and Chemiluminescence (Part B)
Edited by MARLENE DELUCA AND WILLIAM D. MCELROY
VOLUME 134. Structural and Contractile Proteins (Part C: The Contractile
Apparatus and the Cytoskeleton)
Edited by RICHARD B. VALLEE
VOLUME 135. Immobilized Enzymes and Cells (Part B)
Edited by KLAUS MOSBACH
VOLUME 136. Immobilized Enzymes and Cells (Part C)
Edited by KLAUS MOSBACH
VOLUME 137. Immobilized Enzymes and Cells (Part D)
Edited by KLAUS MOSBACH
VOLUME 138. Complex Carbohydrates (Part E)
Edited by VICTOR GINSBURG
Methods in Enzymology xxxi

VOLUME 139. Cellular Regulators (Part A: Calcium- and


Calmodulin-Binding Proteins)
Edited by ANTHONY R. MEANS AND P. MICHAEL CONN
VOLUME 140. Cumulative Subject Index Volumes 102–119, 121–134
VOLUME 141. Cellular Regulators (Part B: Calcium and Lipids)
Edited by P. MICHAEL CONN AND ANTHONY R. MEANS
VOLUME 142. Metabolism of Aromatic Amino Acids and Amines
Edited by SEYMOUR KAUFMAN
VOLUME 143. Sulfur and Sulfur Amino Acids
Edited by WILLIAM B. JAKOBY AND OWEN GRIFFITH
VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular Matrix)
Edited by LEON W. CUNNINGHAM
VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular Matrix)
Edited by LEON W. CUNNINGHAM
VOLUME 146. Peptide Growth Factors (Part A)
Edited by DAVID BARNES AND DAVID A. SIRBASKU
VOLUME 147. Peptide Growth Factors (Part B)
Edited by DAVID BARNES AND DAVID A. SIRBASKU
VOLUME 148. Plant Cell Membranes
Edited by LESTER PACKER AND ROLAND DOUCE
VOLUME 149. Drug and Enzyme Targeting (Part B)
Edited by RALPH GREEN AND KENNETH J. WIDDER
VOLUME 150. Immunochemical Techniques (Part K: In Vitro Models of B and
T Cell Functions and Lymphoid Cell Receptors)
Edited by GIOVANNI DI SABATO
VOLUME 151. Molecular Genetics of Mammalian Cells
Edited by MICHAEL M. GOTTESMAN
VOLUME 152. Guide to Molecular Cloning Techniques
Edited by SHELBY L. BERGER AND ALAN R. KIMMEL
VOLUME 153. Recombinant DNA (Part D)
Edited by RAY WU AND LAWRENCE GROSSMAN
VOLUME 154. Recombinant DNA (Part E)
Edited by RAY WU AND LAWRENCE GROSSMAN
VOLUME 155. Recombinant DNA (Part F)
Edited by RAY WU
VOLUME 156. Biomembranes (Part P: ATP-Driven Pumps and Related Transport:
The Na, K-Pump)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
xxxii Methods in Enzymology

VOLUME 157. Biomembranes (Part Q: ATP-Driven Pumps and Related Transport:


Calcium, Proton, and Potassium Pumps)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 158. Metalloproteins (Part A)
Edited by JAMES F. RIORDAN AND BERT L. VALLEE
VOLUME 159. Initiation and Termination of Cyclic Nucleotide Action
Edited by JACKIE D. CORBIN AND ROGER A. JOHNSON
VOLUME 160. Biomass (Part A: Cellulose and Hemicellulose)
Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG
VOLUME 161. Biomass (Part B: Lignin, Pectin, and Chitin)
Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG
VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis
and Inflammation)
Edited by GIOVANNI DI SABATO
VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis
and Inflammation)
Edited by GIOVANNI DI SABATO
VOLUME 164. Ribosomes
Edited by HARRY F. NOLLER, JR., AND KIVIE MOLDAVE
VOLUME 165. Microbial Toxins: Tools for Enzymology
Edited by SIDNEY HARSHMAN
VOLUME 166. Branched-Chain Amino Acids
Edited by ROBERT HARRIS AND JOHN R. SOKATCH
VOLUME 167. Cyanobacteria
Edited by LESTER PACKER AND ALEXANDER N. GLAZER
VOLUME 168. Hormone Action (Part K: Neuroendocrine Peptides)
Edited by P. MICHAEL CONN
VOLUME 169. Platelets: Receptors, Adhesion, Secretion (Part A)
Edited by JACEK HAWIGER
VOLUME 170. Nucleosomes
Edited by PAUL M. WASSARMAN AND ROGER D. KORNBERG
VOLUME 171. Biomembranes (Part R: Transport Theory: Cells and Model
Membranes)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 172. Biomembranes (Part S: Transport: Membrane Isolation
and Characterization)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
Methods in Enzymology xxxiii

VOLUME 173. Biomembranes [Part T: Cellular and Subcellular Transport:


Eukaryotic (Nonepithelial) Cells]
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 174. Biomembranes [Part U: Cellular and Subcellular Transport:
Eukaryotic (Nonepithelial) Cells]
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 175. Cumulative Subject Index Volumes 135–139, 141–167
VOLUME 176. Nuclear Magnetic Resonance (Part A: Spectral Techniques and
Dynamics)
Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES
VOLUME 177. Nuclear Magnetic Resonance (Part B: Structure and Mechanism)
Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES
VOLUME 178. Antibodies, Antigens, and Molecular Mimicry
Edited by JOHN J. LANGONE
VOLUME 179. Complex Carbohydrates (Part F)
Edited by VICTOR GINSBURG
VOLUME 180. RNA Processing (Part A: General Methods)
Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON
VOLUME 181. RNA Processing (Part B: Specific Methods)
Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON
VOLUME 182. Guide to Protein Purification
Edited by MURRAY P. DEUTSCHER
VOLUME 183. Molecular Evolution: Computer Analysis of Protein and
Nucleic Acid Sequences
Edited by RUSSELL F. DOOLITTLE
VOLUME 184. Avidin-Biotin Technology
Edited by MEIR WILCHEK AND EDWARD A. BAYER
VOLUME 185. Gene Expression Technology
Edited by DAVID V. GOEDDEL
VOLUME 186. Oxygen Radicals in Biological Systems (Part B: Oxygen Radicals and
Antioxidants)
Edited by LESTER PACKER AND ALEXANDER N. GLAZER
VOLUME 187. Arachidonate Related Lipid Mediators
Edited by ROBERT C. MURPHY AND FRANK A. FITZPATRICK
VOLUME 188. Hydrocarbons and Methylotrophy
Edited by MARY E. LIDSTROM
VOLUME 189. Retinoids (Part A: Molecular and Metabolic Aspects)
Edited by LESTER PACKER
xxxiv Methods in Enzymology

VOLUME 190. Retinoids (Part B: Cell Differentiation and Clinical Applications)


Edited by LESTER PACKER
VOLUME 191. Biomembranes (Part V: Cellular and Subcellular Transport:
Epithelial Cells)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 192. Biomembranes (Part W: Cellular and Subcellular Transport:
Epithelial Cells)
Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
VOLUME 193. Mass Spectrometry
Edited by JAMES A. MCCLOSKEY
VOLUME 194. Guide to Yeast Genetics and Molecular Biology
Edited by CHRISTINE GUTHRIE AND GERALD R. FINK
VOLUME 195. Adenylyl Cyclase, G Proteins, and Guanylyl Cyclase
Edited by ROGER A. JOHNSON AND JACKIE D. CORBIN
VOLUME 196. Molecular Motors and the Cytoskeleton
Edited by RICHARD B. VALLEE
VOLUME 197. Phospholipases
Edited by EDWARD A. DENNIS
VOLUME 198. Peptide Growth Factors (Part C)
Edited by DAVID BARNES, J. P. MATHER, AND GORDON H. SATO
VOLUME 199. Cumulative Subject Index Volumes 168–174, 176–194
VOLUME 200. Protein Phosphorylation (Part A: Protein Kinases: Assays,
Purification, Antibodies, Functional Analysis, Cloning, and Expression)
Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON
VOLUME 201. Protein Phosphorylation (Part B: Analysis of Protein
Phosphorylation, Protein Kinase Inhibitors, and Protein Phosphatases)
Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON
VOLUME 202. Molecular Design and Modeling: Concepts and Applications
(Part A: Proteins, Peptides, and Enzymes)
Edited by JOHN J. LANGONE
VOLUME 203. Molecular Design and Modeling: Concepts and Applications
(Part B: Antibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs)
Edited by JOHN J. LANGONE
VOLUME 204. Bacterial Genetic Systems
Edited by JEFFREY H. MILLER
VOLUME 205. Metallobiochemistry (Part B: Metallothionein and
Related Molecules)
Edited by JAMES F. RIORDAN AND BERT L. VALLEE
Methods in Enzymology xxxv

VOLUME 206. Cytochrome P450


Edited by MICHAEL R. WATERMAN AND ERIC F. JOHNSON
VOLUME 207. Ion Channels
Edited by BERNARDO RUDY AND LINDA E. IVERSON
VOLUME 208. Protein–DNA Interactions
Edited by ROBERT T. SAUER
VOLUME 209. Phospholipid Biosynthesis
Edited by EDWARD A. DENNIS AND DENNIS E. VANCE
VOLUME 210. Numerical Computer Methods
Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON
VOLUME 211. DNA Structures (Part A: Synthesis and Physical Analysis of DNA)
Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG
VOLUME 212. DNA Structures (Part B: Chemical and Electrophoretic
Analysis of DNA)
Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG
VOLUME 213. Carotenoids (Part A: Chemistry, Separation, Quantitation,
and Antioxidation)
Edited by LESTER PACKER
VOLUME 214. Carotenoids (Part B: Metabolism, Genetics, and Biosynthesis)
Edited by LESTER PACKER
VOLUME 215. Platelets: Receptors, Adhesion, Secretion (Part B)
Edited by JACEK J. HAWIGER
VOLUME 216. Recombinant DNA (Part G)
Edited by RAY WU
VOLUME 217. Recombinant DNA (Part H)
Edited by RAY WU
VOLUME 218. Recombinant DNA (Part I)
Edited by RAY WU
VOLUME 219. Reconstitution of Intracellular Transport
Edited by JAMES E. ROTHMAN
VOLUME 220. Membrane Fusion Techniques (Part A)
Edited by NEJAT DÜZGÜNES,
VOLUME 221. Membrane Fusion Techniques (Part B)
Edited by NEJAT DÜZGÜNES,
VOLUME 222. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement
Activation (Part A: Mammalian Blood Coagulation Factors and Inhibitors)
Edited by LASZLO LORAND AND KENNETH G. MANN
xxxvi Methods in Enzymology

VOLUME 223. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement


Activation (Part B: Complement Activation, Fibrinolysis, and Nonmammalian
Blood Coagulation Factors)
Edited by LASZLO LORAND AND KENNETH G. MANN
VOLUME 224. Molecular Evolution: Producing the Biochemical Data
Edited by ELIZABETH ANNE ZIMMER, THOMAS J. WHITE, REBECCA L. CANN,
AND ALLAN C. WILSON

VOLUME 225. Guide to Techniques in Mouse Development


Edited by PAUL M. WASSARMAN AND MELVIN L. DEPAMPHILIS
VOLUME 226. Metallobiochemistry (Part C: Spectroscopic and Physical Methods
for Probing Metal Ion Environments in Metalloenzymes and Metalloproteins)
Edited by JAMES F. RIORDAN AND BERT L. VALLEE
VOLUME 227. Metallobiochemistry (Part D: Physical and Spectroscopic Methods
for Probing Metal Ion Environments in Metalloproteins)
Edited by JAMES F. RIORDAN AND BERT L. VALLEE
VOLUME 228. Aqueous Two-Phase Systems
Edited by HARRY WALTER AND GÖTE JOHANSSON
VOLUME 229. Cumulative Subject Index Volumes 195–198, 200–227
VOLUME 230. Guide to Techniques in Glycobiology
Edited by WILLIAM J. LENNARZ AND GERALD W. HART
VOLUME 231. Hemoglobins (Part B: Biochemical and Analytical Methods)
Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW
VOLUME 232. Hemoglobins (Part C: Biophysical Methods)
Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW
VOLUME 233. Oxygen Radicals in Biological Systems (Part C)
Edited by LESTER PACKER
VOLUME 234. Oxygen Radicals in Biological Systems (Part D)
Edited by LESTER PACKER
VOLUME 235. Bacterial Pathogenesis (Part A: Identification and Regulation of
Virulence Factors)
Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL
VOLUME 236. Bacterial Pathogenesis (Part B: Integration of Pathogenic Bacteria
with Host Cells)
Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL
VOLUME 237. Heterotrimeric G Proteins
Edited by RAVI IYENGAR
VOLUME 238. Heterotrimeric G-Protein Effectors
Edited by RAVI IYENGAR
Methods in Enzymology xxxvii

VOLUME 239. Nuclear Magnetic Resonance (Part C)


Edited by THOMAS L. JAMES AND NORMAN J. OPPENHEIMER
VOLUME 240. Numerical Computer Methods (Part B)
Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND
VOLUME 241. Retroviral Proteases
Edited by LAWRENCE C. KUO AND JULES A. SHAFER
VOLUME 242. Neoglycoconjugates (Part A)
Edited by Y. C. LEE AND REIKO T. LEE
VOLUME 243. Inorganic Microbial Sulfur Metabolism
Edited by HARRY D. PECK, JR., AND JEAN LEGALL
VOLUME 244. Proteolytic Enzymes: Serine and Cysteine Peptidases
Edited by ALAN J. BARRETT
VOLUME 245. Extracellular Matrix Components
Edited by E. RUOSLAHTI AND E. ENGVALL
VOLUME 246. Biochemical Spectroscopy
Edited by KENNETH SAUER
VOLUME 247. Neoglycoconjugates (Part B: Biomedical Applications)
Edited by Y. C. LEE AND REIKO T. LEE
VOLUME 248. Proteolytic Enzymes: Aspartic and Metallo Peptidases
Edited by ALAN J. BARRETT
VOLUME 249. Enzyme Kinetics and Mechanism (Part D: Developments in
Enzyme Dynamics)
Edited by DANIEL L. PURICH
VOLUME 250. Lipid Modifications of Proteins
Edited by PATRICK J. CASEY AND JANICE E. BUSS
VOLUME 251. Biothiols (Part A: Monothiols and Dithiols, Protein Thiols, and
Thiyl Radicals)
Edited by LESTER PACKER
VOLUME 252. Biothiols (Part B: Glutathione and Thioredoxin; Thiols in Signal
Transduction and Gene Regulation)
Edited by LESTER PACKER
VOLUME 253. Adhesion of Microbial Pathogens
Edited by RON J. DOYLE AND ITZHAK OFEK
VOLUME 254. Oncogene Techniques
Edited by PETER K. VOGT AND INDER M. VERMA
VOLUME 255. Small GTPases and Their Regulators (Part A: Ras Family)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 256. Small GTPases and Their Regulators (Part B: Rho Family)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
xxxviii Methods in Enzymology

VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved
in Transport)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 258. Redox-Active Amino Acids in Biology
Edited by JUDITH P. KLINMAN
VOLUME 259. Energetics of Biological Macromolecules
Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS
VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A)
Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN
VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids
Edited by THOMAS L. JAMES
VOLUME 262. DNA Replication
Edited by JUDITH L. CAMPBELL
VOLUME 263. Plasma Lipoproteins (Part C: Quantitation)
Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST
VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B)
Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN
VOLUME 265. Cumulative Subject Index Volumes 228, 230–262
VOLUME 266. Computer Methods for Macromolecular Sequence Analysis
Edited by RUSSELL F. DOOLITTLE
VOLUME 267. Combinatorial Chemistry
Edited by JOHN N. ABELSON
VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase)
Edited by LESTER PACKER
VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes)
Edited by LESTER PACKER
VOLUME 270. High Resolution Separation and Analysis of Biological
Macromolecules (Part A: Fundamentals)
Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK
VOLUME 271. High Resolution Separation and Analysis of Biological
Macromolecules (Part B: Applications)
Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK
VOLUME 272. Cytochrome P450 (Part B)
Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN
VOLUME 273. RNA Polymerase and Associated Factors (Part A)
Edited by SANKAR ADHYA
VOLUME 274. RNA Polymerase and Associated Factors (Part B)
Edited by SANKAR ADHYA
Methods in Enzymology xxxix

VOLUME 275. Viral Polymerases and Related Proteins


Edited by LAWRENCE C. KUO, DAVID B. OLSEN, AND STEVEN S. CARROLL
VOLUME 276. Macromolecular Crystallography (Part A)
Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET
VOLUME 277. Macromolecular Crystallography (Part B)
Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET
VOLUME 278. Fluorescence Spectroscopy
Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON
VOLUME 279. Vitamins and Coenzymes (Part I)
Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER
VOLUME 280. Vitamins and Coenzymes (Part J)
Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER
VOLUME 281. Vitamins and Coenzymes (Part K)
Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER
VOLUME 282. Vitamins and Coenzymes (Part L)
Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER
VOLUME 283. Cell Cycle Control
Edited by WILLIAM G. DUNPHY
VOLUME 284. Lipases (Part A: Biotechnology)
Edited by BYRON RUBIN AND EDWARD A. DENNIS
VOLUME 285. Cumulative Subject Index Volumes 263, 264, 266–284, 286–289
VOLUME 286. Lipases (Part B: Enzyme Characterization and Utilization)
Edited by BYRON RUBIN AND EDWARD A. DENNIS
VOLUME 287. Chemokines
Edited by RICHARD HORUK
VOLUME 288. Chemokine Receptors
Edited by RICHARD HORUK
VOLUME 289. Solid Phase Peptide Synthesis
Edited by GREGG B. FIELDS
VOLUME 290. Molecular Chaperones
Edited by GEORGE H. LORIMER AND THOMAS BALDWIN
VOLUME 291. Caged Compounds
Edited by GERARD MARRIOTT
VOLUME 292. ABC Transporters: Biochemical, Cellular, and Molecular Aspects
Edited by SURESH V. AMBUDKAR AND MICHAEL M. GOTTESMAN
VOLUME 293. Ion Channels (Part B)
Edited by P. MICHAEL CONN
xl Methods in Enzymology

VOLUME 294. Ion Channels (Part C)


Edited by P. MICHAEL CONN
VOLUME 295. Energetics of Biological Macromolecules (Part B)
Edited by GARY K. ACKERS AND MICHAEL L. JOHNSON
VOLUME 296. Neurotransmitter Transporters
Edited by SUSAN G. AMARA
VOLUME 297. Photosynthesis: Molecular Biology of Energy Capture
Edited by LEE MCINTOSH
VOLUME 298. Molecular Motors and the Cytoskeleton (Part B)
Edited by RICHARD B. VALLEE
VOLUME 299. Oxidants and Antioxidants (Part A)
Edited by LESTER PACKER
VOLUME 300. Oxidants and Antioxidants (Part B)
Edited by LESTER PACKER
VOLUME 301. Nitric Oxide: Biological and Antioxidant Activities (Part C)
Edited by LESTER PACKER
VOLUME 302. Green Fluorescent Protein
Edited by P. MICHAEL CONN
VOLUME 303. cDNA Preparation and Display
Edited by SHERMAN M. WEISSMAN
VOLUME 304. Chromatin
Edited by PAUL M. WASSARMAN AND ALAN P. WOLFFE
VOLUME 305. Bioluminescence and Chemiluminescence (Part C)
Edited by THOMAS O. BALDWIN AND MIRIAM M. ZIEGLER
VOLUME 306. Expression of Recombinant Genes in Eukaryotic Systems
Edited by JOSEPH C. GLORIOSO AND MARTIN C. SCHMIDT
VOLUME 307. Confocal Microscopy
Edited by P. MICHAEL CONN
VOLUME 308. Enzyme Kinetics and Mechanism (Part E: Energetics of
Enzyme Catalysis)
Edited by DANIEL L. PURICH AND VERN L. SCHRAMM
VOLUME 309. Amyloid, Prions, and Other Protein Aggregates
Edited by RONALD WETZEL
VOLUME 310. Biofilms
Edited by RON J. DOYLE
VOLUME 311. Sphingolipid Metabolism and Cell Signaling (Part A)
Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN
Methods in Enzymology xli

VOLUME 312. Sphingolipid Metabolism and Cell Signaling (Part B)


Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN
VOLUME 313. Antisense Technology (Part A: General Methods, Methods of
Delivery, and RNA Studies)
Edited by M. IAN PHILLIPS
VOLUME 314. Antisense Technology (Part B: Applications)
Edited by M. IAN PHILLIPS
VOLUME 315. Vertebrate Phototransduction and the Visual Cycle (Part A)
Edited by KRZYSZTOF PALCZEWSKI
VOLUME 316. Vertebrate Phototransduction and the Visual Cycle (Part B)
Edited by KRZYSZTOF PALCZEWSKI
VOLUME 317. RNA–Ligand Interactions (Part A: Structural Biology Methods)
Edited by DANIEL W. CELANDER AND JOHN N. ABELSON
VOLUME 318. RNA–Ligand Interactions (Part B: Molecular Biology Methods)
Edited by DANIEL W. CELANDER AND JOHN N. ABELSON
VOLUME 319. Singlet Oxygen, UV-A, and Ozone
Edited by LESTER PACKER AND HELMUT SIES
VOLUME 320. Cumulative Subject Index Volumes 290–319
VOLUME 321. Numerical Computer Methods (Part C)
Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND
VOLUME 322. Apoptosis
Edited by JOHN C. REED
VOLUME 323. Energetics of Biological Macromolecules (Part C)
Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS
VOLUME 324. Branched-Chain Amino Acids (Part B)
Edited by ROBERT A. HARRIS AND JOHN R. SOKATCH
VOLUME 325. Regulators and Effectors of Small GTPases (Part D: Rho Family)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 326. Applications of Chimeric Genes and Hybrid Proteins (Part A: Gene
Expression and Protein Purification)
Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
VOLUME 327. Applications of Chimeric Genes and Hybrid Proteins (Part B: Cell
Biology and Physiology)
Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
VOLUME 328. Applications of Chimeric Genes and Hybrid Proteins (Part C:
Protein–Protein Interactions and Genomics)
Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
xlii Methods in Enzymology

VOLUME 329. Regulators and Effectors of Small GTPases (Part E: GTPases


Involved in Vesicular Traffic)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 330. Hyperthermophilic Enzymes (Part A)
Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY
VOLUME 331. Hyperthermophilic Enzymes (Part B)
Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY
VOLUME 332. Regulators and Effectors of Small GTPases (Part F: Ras Family I)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 333. Regulators and Effectors of Small GTPases (Part G: Ras Family II)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 334. Hyperthermophilic Enzymes (Part C)
Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY
VOLUME 335. Flavonoids and Other Polyphenols
Edited by LESTER PACKER
VOLUME 336. Microbial Growth in Biofilms (Part A: Developmental and
Molecular Biological Aspects)
Edited by RON J. DOYLE
VOLUME 337. Microbial Growth in Biofilms (Part B: Special Environments and
Physicochemical Aspects)
Edited by RON J. DOYLE
VOLUME 338. Nuclear Magnetic Resonance of Biological Macromolecules (Part A)
Edited by THOMAS L. JAMES, VOLKER DÖTSCH, AND ULI SCHMITZ
VOLUME 339. Nuclear Magnetic Resonance of Biological Macromolecules (Part B)
Edited by THOMAS L. JAMES, VOLKER DÖTSCH, AND ULI SCHMITZ
VOLUME 340. Drug–Nucleic Acid Interactions
Edited by JONATHAN B. CHAIRES AND MICHAEL J. WARING
VOLUME 341. Ribonucleases (Part A)
Edited by ALLEN W. NICHOLSON
VOLUME 342. Ribonucleases (Part B)
Edited by ALLEN W. NICHOLSON
VOLUME 343. G Protein Pathways (Part A: Receptors)
Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
VOLUME 344. G Protein Pathways (Part B: G Proteins and Their Regulators)
Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
VOLUME 345. G Protein Pathways (Part C: Effector Mechanisms)
Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
Methods in Enzymology xliii

VOLUME 346. Gene Therapy Methods


Edited by M. IAN PHILLIPS
VOLUME 347. Protein Sensors and Reactive Oxygen Species (Part A:
Selenoproteins and Thioredoxin)
Edited by HELMUT SIES AND LESTER PACKER
VOLUME 348. Protein Sensors and Reactive Oxygen Species (Part B: Thiol
Enzymes and Proteins)
Edited by HELMUT SIES AND LESTER PACKER
VOLUME 349. Superoxide Dismutase
Edited by LESTER PACKER
VOLUME 350. Guide to Yeast Genetics and Molecular and Cell Biology (Part B)
Edited by CHRISTINE GUTHRIE AND GERALD R. FINK
VOLUME 351. Guide to Yeast Genetics and Molecular and Cell Biology (Part C)
Edited by CHRISTINE GUTHRIE AND GERALD R. FINK
VOLUME 352. Redox Cell Biology and Genetics (Part A)
Edited by CHANDAN K. SEN AND LESTER PACKER
VOLUME 353. Redox Cell Biology and Genetics (Part B)
Edited by CHANDAN K. SEN AND LESTER PACKER
VOLUME 354. Enzyme Kinetics and Mechanisms (Part F: Detection and
Characterization of Enzyme Reaction Intermediates)
Edited by DANIEL L. PURICH
VOLUME 355. Cumulative Subject Index Volumes 321–354
VOLUME 356. Laser Capture Microscopy and Microdissection
Edited by P. MICHAEL CONN
VOLUME 357. Cytochrome P450, Part C
Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN
VOLUME 358. Bacterial Pathogenesis (Part C: Identification, Regulation, and
Function of Virulence Factors)
Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL
VOLUME 359. Nitric Oxide (Part D)
Edited by ENRIQUE CADENAS AND LESTER PACKER
VOLUME 360. Biophotonics (Part A)
Edited by GERARD MARRIOTT AND IAN PARKER
VOLUME 361. Biophotonics (Part B)
Edited by GERARD MARRIOTT AND IAN PARKER
VOLUME 362. Recognition of Carbohydrates in Biological Systems (Part A)
Edited by YUAN C. LEE AND REIKO T. LEE
xliv Methods in Enzymology

VOLUME 363. Recognition of Carbohydrates in Biological Systems (Part B)


Edited by YUAN C. LEE AND REIKO T. LEE
VOLUME 364. Nuclear Receptors
Edited by DAVID W. RUSSELL AND DAVID J. MANGELSDORF
VOLUME 365. Differentiation of Embryonic Stem Cells
Edited by PAUL M. WASSAUMAN AND GORDON M. KELLER
VOLUME 366. Protein Phosphatases
Edited by SUSANNE KLUMPP AND JOSEF KRIEGLSTEIN
VOLUME 367. Liposomes (Part A)
Edited by NEJAT DÜZGÜNES,
VOLUME 368. Macromolecular Crystallography (Part C)
Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET
VOLUME 369. Combinational Chemistry (Part B)
Edited by GUILLERMO A. MORALES AND BARRY A. BUNIN
VOLUME 370. RNA Polymerases and Associated Factors (Part C)
Edited by SANKAR L. ADHYA AND SUSAN GARGES
VOLUME 371. RNA Polymerases and Associated Factors (Part D)
Edited by SANKAR L. ADHYA AND SUSAN GARGES
VOLUME 372. Liposomes (Part B)
Edited by NEJAT DÜZGÜNES,
VOLUME 373. Liposomes (Part C)
Edited by NEJAT DÜZGÜNES,
VOLUME 374. Macromolecular Crystallography (Part D)
Edited by CHARLES W. CARTER, JR., AND ROBERT W. SWEET
VOLUME 375. Chromatin and Chromatin Remodeling Enzymes (Part A)
Edited by C. DAVID ALLIS AND CARL WU
VOLUME 376. Chromatin and Chromatin Remodeling Enzymes (Part B)
Edited by C. DAVID ALLIS AND CARL WU
VOLUME 377. Chromatin and Chromatin Remodeling Enzymes (Part C)
Edited by C. DAVID ALLIS AND CARL WU
VOLUME 378. Quinones and Quinone Enzymes (Part A)
Edited by HELMUT SIES AND LESTER PACKER
VOLUME 379. Energetics of Biological Macromolecules (Part D)
Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS
VOLUME 380. Energetics of Biological Macromolecules (Part E)
Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS
VOLUME 381. Oxygen Sensing
Edited by CHANDAN K. SEN AND GREGG L. SEMENZA
Methods in Enzymology xlv

VOLUME 382. Quinones and Quinone Enzymes (Part B)


Edited by HELMUT SIES AND LESTER PACKER
VOLUME 383. Numerical Computer Methods (Part D)
Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON
VOLUME 384. Numerical Computer Methods (Part E)
Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON
VOLUME 385. Imaging in Biological Research (Part A)
Edited by P. MICHAEL CONN
VOLUME 386. Imaging in Biological Research (Part B)
Edited by P. MICHAEL CONN
VOLUME 387. Liposomes (Part D)
Edited by NEJAT DÜZGÜNES,
VOLUME 388. Protein Engineering
Edited by DAN E. ROBERTSON AND JOSEPH P. NOEL
VOLUME 389. Regulators of G-Protein Signaling (Part A)
Edited by DAVID P. SIDEROVSKI
VOLUME 390. Regulators of G-Protein Signaling (Part B)
Edited by DAVID P. SIDEROVSKI
VOLUME 391. Liposomes (Part E)
Edited by NEJAT DÜZGÜNES,
VOLUME 392. RNA Interference
Edited by ENGELKE ROSSI
VOLUME 393. Circadian Rhythms
Edited by MICHAEL W. YOUNG
VOLUME 394. Nuclear Magnetic Resonance of Biological Macromolecules (Part C)
Edited by THOMAS L. JAMES
VOLUME 395. Producing the Biochemical Data (Part B)
Edited by ELIZABETH A. ZIMMER AND ERIC H. ROALSON
VOLUME 396. Nitric Oxide (Part E)
Edited by LESTER PACKER AND ENRIQUE CADENAS
VOLUME 397. Environmental Microbiology
Edited by JARED R. LEADBETTER
VOLUME 398. Ubiquitin and Protein Degradation (Part A)
Edited by RAYMOND J. DESHAIES
VOLUME 399. Ubiquitin and Protein Degradation (Part B)
Edited by RAYMOND J. DESHAIES
VOLUME 400. Phase II Conjugation Enzymes and Transport Systems
Edited by HELMUT SIES AND LESTER PACKER
xlvi Methods in Enzymology

VOLUME 401. Glutathione Transferases and Gamma Glutamyl Transpeptidases


Edited by HELMUT SIES AND LESTER PACKER
VOLUME 402. Biological Mass Spectrometry
Edited by A. L. BURLINGAME
VOLUME 403. GTPases Regulating Membrane Targeting and Fusion
Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 404. GTPases Regulating Membrane Dynamics
Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 405. Mass Spectrometry: Modified Proteins and Glycoconjugates
Edited by A. L. BURLINGAME
VOLUME 406. Regulators and Effectors of Small GTPases: Rho Family
Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 407. Regulators and Effectors of Small GTPases: Ras Family
Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 408. DNA Repair (Part A)
Edited by JUDITH L. CAMPBELL AND PAUL MODRICH
VOLUME 409. DNA Repair (Part B)
Edited by JUDITH L. CAMPBELL AND PAUL MODRICH
VOLUME 410. DNA Microarrays (Part A: Array Platforms and Web-Bench
Protocols)
Edited by ALAN KIMMEL AND BRIAN OLIVER
VOLUME 411. DNA Microarrays (Part B: Databases and Statistics)
Edited by ALAN KIMMEL AND BRIAN OLIVER
VOLUME 412. Amyloid, Prions, and Other Protein Aggregates (Part B)
Edited by INDU KHETERPAL AND RONALD WETZEL
VOLUME 413. Amyloid, Prions, and Other Protein Aggregates (Part C)
Edited by INDU KHETERPAL AND RONALD WETZEL
VOLUME 414. Measuring Biological Responses with Automated Microscopy
Edited by JAMES INGLESE
VOLUME 415. Glycobiology
Edited by MINORU FUKUDA
VOLUME 416. Glycomics
Edited by MINORU FUKUDA
VOLUME 417. Functional Glycomics
Edited by MINORU FUKUDA
VOLUME 418. Embryonic Stem Cells
Edited by IRINA KLIMANSKAYA AND ROBERT LANZA
Methods in Enzymology xlvii

VOLUME 419. Adult Stem Cells


Edited by IRINA KLIMANSKAYA AND ROBERT LANZA
VOLUME 420. Stem Cell Tools and Other Experimental Protocols
Edited by IRINA KLIMANSKAYA AND ROBERT LANZA
VOLUME 421. Advanced Bacterial Genetics: Use of Transposons and Phage for
Genomic Engineering
Edited by KELLY T. HUGHES
VOLUME 422. Two-Component Signaling Systems, Part A
Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE
VOLUME 423. Two-Component Signaling Systems, Part B
Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE
VOLUME 424. RNA Editing
Edited by JONATHA M. GOTT
VOLUME 425. RNA Modification
Edited by JONATHA M. GOTT
VOLUME 426. Integrins
Edited by DAVID CHERESH
VOLUME 427. MicroRNA Methods
Edited by JOHN J. ROSSI
VOLUME 428. Osmosensing and Osmosignaling
Edited by HELMUT SIES AND DIETER HAUSSINGER
VOLUME 429. Translation Initiation: Extract Systems and Molecular Genetics
Edited by JON LORSCH
VOLUME 430. Translation Initiation: Reconstituted Systems and Biophysical
Methods
Edited by JON LORSCH
VOLUME 431. Translation Initiation: Cell Biology, High-Throughput and
Chemical-Based Approaches
Edited by JON LORSCH
VOLUME 432. Lipidomics and Bioactive Lipids: Mass-Spectrometry–Based Lipid
Analysis
Edited by H. ALEX BROWN
VOLUME 433. Lipidomics and Bioactive Lipids: Specialized Analytical Methods and
Lipids in Disease
Edited by H. ALEX BROWN
VOLUME 434. Lipidomics and Bioactive Lipids: Lipids and Cell Signaling
Edited by H. ALEX BROWN
VOLUME 435. Oxygen Biology and Hypoxia
Edited by HELMUT SIES AND BERNHARD BRÜNE
xlviii Methods in Enzymology

VOLUME 436. Globins and Other Nitric Oxide-Reactive Protiens (Part A)


Edited by ROBERT K. POOLE
VOLUME 437. Globins and Other Nitric Oxide-Reactive Protiens (Part B)
Edited by ROBERT K. POOLE
VOLUME 438. Small GTPases in Disease (Part A)
Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 439. Small GTPases in Disease (Part B)
Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 440. Nitric Oxide, Part F Oxidative and Nitrosative Stress in Redox
Regulation of Cell Signaling
Edited by ENRIQUE CADENAS AND LESTER PACKER
VOLUME 441. Nitric Oxide, Part G Oxidative and Nitrosative Stress in Redox
Regulation of Cell Signaling
Edited by ENRIQUE CADENAS AND LESTER PACKER
VOLUME 442. Programmed Cell Death, General Principles for Studying Cell
Death (Part A)
Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN,
AND MAURO PIACENTINI

VOLUME 443. Angiogenesis: In Vitro Systems


Edited by DAVID A. CHERESH
VOLUME 444. Angiogenesis: In Vivo Systems (Part A)
Edited by DAVID A. CHERESH
VOLUME 445. Angiogenesis: In Vivo Systems (Part B)
Edited by DAVID A. CHERESH
VOLUME 446. Programmed Cell Death, The Biology and Therapeutic
Implications of Cell Death (Part B)
Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN,
AND MAURO PIACENTINI

VOLUME 447. RNA Turnover in Bacteria, Archaea and Organelles


Edited by LYNNE E. MAQUAT AND CECILIA M. ARRAIANO
VOLUME 448. RNA Turnover in Eukaryotes: Nucleases, Pathways
and Analysis of mRNA Decay
Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN
VOLUME 449. RNA Turnover in Eukaryotes: Analysis of Specialized and Quality
Control RNA Decay Pathways
Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN
VOLUME 450. Fluorescence Spectroscopy
Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON
Methods in Enzymology xlix

VOLUME 451. Autophagy: Lower Eukaryotes and Non-Mammalian Systems (Part A)


Edited by DANIEL J. KLIONSKY
VOLUME 452. Autophagy in Mammalian Systems (Part B)
Edited by DANIEL J. KLIONSKY
VOLUME 453. Autophagy in Disease and Clinical Applications (Part C)
Edited by DANIEL J. KLIONSKY
VOLUME 454. Computer Methods (Part A)
Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND
VOLUME 455. Biothermodynamics (Part A)
Edited by MICHAEL L. JOHNSON, JO M. HOLT, AND GARY K. ACKERS (RETIRED)
VOLUME 456. Mitochondrial Function, Part A: Mitochondrial Electron Transport
Complexes and Reactive Oxygen Species
Edited by WILLIAM S. ALLISON AND IMMO E. SCHEFFLER
VOLUME 457. Mitochondrial Function, Part B: Mitochondrial Protein Kinases,
Protein Phosphatases and Mitochondrial Diseases
Edited by WILLIAM S. ALLISON AND ANNE N. MURPHY
VOLUME 458. Complex Enzymes in Microbial Natural Product Biosynthesis,
Part A: Overview Articles and Peptides
Edited by DAVID A. HOPWOOD
VOLUME 459. Complex Enzymes in Microbial Natural Product Biosynthesis,
Part B: Polyketides, Aminocoumarins and Carbohydrates
Edited by DAVID A. HOPWOOD
VOLUME 460. Chemokines, Part A
Edited by TRACY M. HANDEL AND DAMON J. HAMEL
C H A P T E R O N E

Chemokines in Human Breast Tumor


Cells: Modifying Their Expression
Levels and Determining Their Effects
on the Malignancy Phenotype
Gali Soria, Tsipi Meshel, and Adit Ben-Baruch

Contents
1. Introduction 4
2. Modifying Chemokine Expression in Breast Tumor Cells 5
2.1. Transfection (microporation) procedures: MCF-7,
T47D, and MDA-MB-231 cells 5
2.2. Tumor cell handling after microporation 8
2.3. Determination of transfection outcome 9
3. Establishment of Primary Local Breast
Tumors and Pulmonary Metastases 9
3.1. Formation of primary tumors by T47D cells 10
3.2. Formation of pulmonary metastases by MDA-MB-231 cells 12
Acknowledgments 15
References 15

Abstract
Chemokines have been recently recognized as important regulators of breast
malignancy; however, much remains unknown regarding their roles in this dis-
ease. Improved understanding of chemokine contribution to breast cancer often
requires studies in which the expression levels of chemokines by the tumor cells
are modified (increased or decreased). In addition, it is essential to determine the
roles of various chemokines in experimental in vivo model systems of breast
cancer, using hormone-dependent or -independent human breast tumor cells
(such as MCF-7, T47D and MDA-MB-231 cells). Since investigators often encoun-
ter difficulties in implementing these techniques in their studies of breast cancer,
we hereby provide a detailed description of microporation approaches for modify-
ing chemokine expression levels in human breast tumor cells, and of the measures

Department of Cell Research and Immunology, George S. Wise Faculty of Life Sciences,
Tel Aviv University, Tel Aviv, Israel

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05201-X All rights reserved.

3
4 Gali Soria et al.

required for establishment of xenograft models of primary tumors and of metas-


tasis by such cells. In the breast malignancy context, the guidelines presented
herein should enable researchers in the field to establish essential means for
determination of chemokine roles in this disease.

1. Introduction
A large body of evidence indicates that chemokines are major regula-
tors of malignancy, acting at many different levels to reduce or to promote
tumor development and/or progression (Ben-Baruch, 2006a). Chemokine
activities in malignancy are mediated primarily by their ability to induce
chemotaxis of leukocytes, endothelial cells, and/or the tumor cells. Indeed,
it is known that specific chemokines chemoattract to tumor sites leukocyte
subpopulations that may promote antitumor activities (such as Th1 cells or
natural killer cells), while other chemokines are responsible for large quan-
tities of deleterious tumor-associated macrophages (TAM) at tumor sites
(Allavena et al., 2007; Ben-Baruch, 2006a; Soria and Ben-Baruch, 2008;
Vandercappellen et al., 2008). In parallel, specific chemokines upregulate
endothelial cell migration and proliferation, therefore promoting angiogen-
esis, whereas other chemokines have powerful angiostatic properties (Ben-
Baruch, 2006a; Salcedo and Oppenheim, 2003; Strieter et al., 2006).
Another very important activity of chemokines is induction of tumor cell
invasion and migration, thereby playing key roles in dictating site-directed
metastasis formation (Ben-Baruch, 2006a, 2007; Zlotnik et al., 2006).
Chemokines can execute such multifaceted roles in malignancy because
they are expressed by cells of the tumor microenvironment, and in many
cases also by the tumor cells themselves. As such, they can affect through
autocrine pathways the ability of the cancer cells to express tumor-
promoting functions, and can also act in paracrine manners on host cells,
thereby influencing their roles in malignancy.
Of the various malignant diseases, breast cancer has attracted the atten-
tion of many researchers, whose joint efforts have provided improved
insights into the roles of chemokines in disease development and progression
(Ben-Baruch, 2006a,b, 2007; Soria and Ben-Baruch, 2008; Zlotnik et al.,
2006). However, our understanding of chemokine roles in breast cancer is
only at its beginning, and extensive research is required in order to enable
improved use of chemokines for diagnostic, prognostic, or therapeutic
purposes in this disease.
To enable better elucidation of the roles played by specific chemokines
in breast malignancy, it is necessary to define the autocrine and paracrine
effects of tumor-cell–derived chemokines. Such analyses are enabled by
studies modulating chemokine expression levels in the tumor cells, either
Chemokine Expression and Effects in Breast Cancer 5

increasing them by overexpression or reducing them by different measures,


such as siRNA. In parallel, it is important to determine the effects of
chemokine expression levels on tumor growth and metastasis in animal
model systems. This can be done by using breast tumor cells that express
chemokines endogenously, or alternatively with cells whose chemokine
expression levels were modified by appropriate measures.
Many researchers find it difficult to reach high transfection yields in
breast cancer cells, including the routinely used MCF-7, T47D, and MDA-
MB-231 cells. In addition, investigators often encounter difficulties in
establishing tumors of hormone-dependent human breast tumor cells, or
pulmonary metastases. To comply with the needs of investigators in the
field, we hereby provide detailed methods for successful modification of
chemokine expression levels in human breast tumor cells, by micropora-
tion. Thereafter, we describe the procedures of forming primary xenograft
tumors by human breast tumor cells in the mammary fat pad of mice, and
producing ‘‘experimental’’ pulmonary metastases in female mice.

2. Modifying Chemokine Expression


in Breast Tumor Cells
In this part, we provide the optimal conditions and procedures for
modifying chemokine expression in human breast tumor cells, by micro-
poration. Microporation is a unique electroporation technology using a
pipette tip as an electroporation space (http://www.microporator.com).
The protocols include microporations of the MCF-7 and T47D
hormone-dependent human breast carcinoma cell lines, and of the MDA-
MB-231 cells that are hormone independent (for details on the cells, please
consult the guidelines of the American Type Culture Collection [ATCC]).
Using microporation, a high success rate of over 60 to 80% transient
transfection can be achieved in the above mentioned breast tumor cells with a
variety of vectors, including HA or GFP-tagged vectors coding for chemo-
kines. If selection-carrying vectors are used, one can proceed to establishment
of cell populations stably overexpressing the chemokines. Alternatively, the
same transfection conditions could be used with the pSUPER vector for
expression of short interfering RNA; however, in this case it is essential to
have a selective marker that would enable formation of stable transfectants.

2.1. Transfection (microporation) procedures: MCF-7,


T47D, and MDA-MB-231 cells
Based on our experience, we recommend using the microporation tech-
nology in order to transfect the above mentioned breast tumor cells. The
MicroPorator (MP-100 MicroPorator) and its accompanying devices and
6 Gali Soria et al.

materials are manufactured by Digital Bio (Seoul, Korea) (http://www.


microporator.com). The manufacturer’s instructions include recommended
conditions for microporation of a variety of cell types, including MCF-7,
T47D, and MDA-MB-231 cells. Nevertheless, we have performed careful
calibrations for microporation of MCF-7 and T47D cells, leading to
improved transfection yields and cell survival rates (please see below).
Accordingly, we provide detailed microporation conditions for these two
cell lines. For MDA-MB-231 cells, we describe one of the three conditions
that were recommended by the manufacturer, which we found highly
suitable in terms of transfection yields and cell viability.

2.1.1. Required materials


Devices and materials of the microporation apparatus Digital Bio (http://
www.microporator.com) provides the main device (MP-100 MicroPorator),
Pipette Station, MicroPorator pipettes, gold-tips, microporation tubes, and
buffers (Buffer R, resuspension buffer; Buffer E, electrolytic buffer).

Additional materials
 Cells of interest: MCF-7, T47D, and MDA-MB-231 cells can all be
obtained from the American Type Culture Collection (ATCC).
 DNA of interest: DNA of high quality (endotoxin-free plasmid DNA) is
recommended, although lower-grade DNA would also allow reasonable
yields of transfection.
 Growth medium: The growth medium for the cells contains DMEM
supplemented with 10% FCS and 2% glutamine. Antibiotics (e.g., peni-
cillin, streptomycin, nystatin) could be used during cell growth, but
should be avoided in the microporation stage (see Section 2.1.2).
Although MCF-7 and T47D cells are hormone dependent, in most
laboratories they are routinely grown in culture without estrogen
(17b-estradiol, E2) or progesterone. Under these conditions, the cells
are highly proliferative, and respond well to a variety of stimuli without
hormone supplementation. However, the growth of these cells in in vivo
xenograft models depends exclusively on estrogen (see Section 3).
Please note that in specific studies there may be a need, or interest, to
perform experiments in cells that were stimulated by the relevant hor-
mones, estrogen or estrogen þ progesterone. In such case, the cells are
routinely grown without the hormones, and are then exposed to a cycle
of stimulation by the hormones. Cells undergoing hormonal treatment
should be grown in phenol-red free medium, supplemented by charcoal-
stripped serum. For cell growth with estrogen only, the hormone
(E8875, Sigma Aldrich, St. Louis, MO) is added at 10–8 or 10–9 M, for
3 to 7 consecutive days (conditions used vary by laboratory). The culture
medium (phenol-red free, including charcoal-stripped serum) should be
Chemokine Expression and Effects in Breast Cancer 7

replaced daily. For estrogen þ progesterone stimulation, the cells are


cultured first with estrogen for 1 day (as above), and for additional 2 days
in the presence of estrogen þ progesterone (progesterone: P6149,
Sigma), both at 108 M. As before, the medium (phenol-red free,
including charcoal-stripped serum) should be replaced daily.

Other reagents
 Trypsin-EDTA solution (trypsin 0.25%, EDTA 0.05%)
 Caþþ and Mgþþ-free PBS1

Disposables
 1.5-ml (Eppendorf) and 10-ml tubes
 6 and 10-cm tissue culture plates

2.1.2. Tumor cell preparation for microporation


One day prior to microporation Culture the cells in a 10 cm tissue culture
plate with fresh growth medium. The cells should reach 60 to 80% con-
fluency on the microporation day.

On the day of microporation You will need warm trypsin solution for cell
removal from growth plates. You also need warm growth medium for
trypsin neutralization, and for the microporation procedure (See note at
the end of the paragraph). Therefore, prewarm an aliquot of the trypsin
solution and of the growth medium at 37 . Following microporation, you
will need to transfer the cells from each microporation tube to a tissue
culture plate with growth medium containing serum and supplements. For
T47D cells, use a 6 cm tissue culture plate with 3 ml medium for each
microporation; for MCF-7 and MDA-MB-231 cells, use a 10 cm tissue
culture plate with 8 ml of medium for each microporation. Prepare such
plate/s in advance, in a humidified 37 , 5% CO2 incubator. Note: Do not
add antibiotics (e.g., penicillin, streptomycin, nystatin) to the growth
medium, which is added to the cells prior to microporation. The antibiotics
can be added afterward to the collecting tissue culture plates, used at the end
of the microporation stage.
Prior to the microporation step itself, prepare the cells together
with the DNA. To this end, trypsinize the cells with trypsin-EDTA
solution, neutralize the trypsin by antibiotic free, serum-containing growth
medium. The procedure described below is suitable for one transfection of
1.2  106 cells:
Pellet your pool of tumor cells at 1200 rpm (140g) for 7 min at room
temperature (RT). Count the cells and pellet 1.2  106 cells in 1.5 ml
(Eppendorf ) tube at 2000 rpm (400g) for 3 min at RT. Following cell washing
8 Gali Soria et al.

in 1 ml of Caþþ and Mgþþ-free PBSx1, resuspend the cell pellet in 120 ml


buffer R (107 cells/ml). Add 5 mg of plasmid DNA into the 1.5 ml tube and
gently pipette the cells up and down. Avoid storing the tube longer than 15 to
30 min at RT, as this would reduce transfection efficiency and cell viability.

2.1.3. Microporation
The microporations are done in 10-ml or 100-ml gold-tips, which are
inserted into the microporation tube. The size of the tip, whether 10 ml
or 100 ml, depends on the amount of cells undergoing microporation,
according to the manufacturer’s instructions. For example, for micropora-
tion of 1.2  106 cells, use a 100-ml gold-tip. Please note that you first need
to prepare the microporation apparatus and set up the pulse conditions.
Only then can you proceed to perform the microporation step itself.
 Preparation of the microporation apparatus: To prepare the apparatus,
add 3 ml of Buffer E into the microporation tube. Then set up the pulse
conditions of the pipette station, as follows:
For MCF-7 cells: pulse voltage, 1100; pulse width, 20; pulse number, 2.
For T47D cells: pulse voltage, 1100; pulse width, 20; pulse number, 2.
For MDA-MB-231 cells: pulse voltage, 1350; pulse width, 20; pulse
number, 2.
 Performing the microporation: The following details are suitable for each
microporation of 1.2  106 cells by a 100-ml gold-tip: Mix the cell-DNA
mixture gently with a standard pipette, and then aspirate the cell-DNA
mixture using the MicroPorator pipette carrying the gold-tip. Avoid air
bubbles during pipetting (the smallest air bubble would induce a spark that
will ruin the transfection). Afterward, insert the MicroPorator pipette
into the Pipette Station and press the Start button on the LCD panel.
When the high-voltage button turns red, press it to transfect by the
MicroPorator. After the pulse, immediately transfer the cell sample into
the 6-cm plate (for T47D cells) or 10-cm plate (for MCF-7 and MDA-
MB-231 cells) that was prepared in advance with warm growth medium
(can include antibiotics).

2.2. Tumor cell handling after microporation


Immediately after the microporation, rock the plates gently to ensure even
distribution of the cells. Next, incubate the plate at 37 in a humidified CO2
incubator. In transient transfections, checking the chemokine expression
2 days after microporation is advised. For establishment of cell populations
that express the vector in a stable fashion, add the appropriate antibiotic 1 or
2 days after the microporation, as applicable.
Chemokine Expression and Effects in Breast Cancer 9

1.4

1.2 *
expression (OD–450 nm)
1
CCL5 extracellular

0.8

0.6

0.4

0.2

0
pE-GFP pE-GFP-CCL5

Figure 1.1 Overexpression of CCL5 in MCF-7 human breast carcinoma cells. MCF-7
cells were transfected with pE-GFP or pE-GFP-CCL5 vectors, following the procedures
detailed above. Stable transfectants of both cell types were cultured under similar condi-
tions for 24 h in serum-free medium.The expression of secreted CCL5 was determined
in cell supernatants of stable transfectants by ELISA assays, using coating and detecting
antibodies to GFP.The high expression levels of CCL5 in pE-GFP-CCL5 transfectants,
as compared to the pE-GFP control transfected cells, were confirmed by ELISA assays
with coating and detecting antibodies to CCL5 (data not shown). The analyses were
done at the linear range of absorbance (*p ¼ 0.03).

2.3. Determination of transfection outcome


According to the vectors used for transfection, and whether overexpression
or downregulation of chemokine expression was performed, chemokine
expression in the transfected cells can be determined in several ways.
Although this chapter does not discuss in detail the methods for determina-
tion of transfection outcome, we would like to note that chemokine
expression could be evaluated by ELISA assays, Western blots, FACS
analyses, and/or confocal analyses (e.g., if a GFP-carrying vector was
used). Accordingly, Fig. 1.1 shows the overexpression of CCL5 in stable
MCF-7 transfectants, determined by ELISA.

3. Establishment of Primary Local Breast


Tumors and Pulmonary Metastases
In this section, we provide detailed description of the methods for
establishment of primary tumors and pulmonary metastases in xenograft model
systems using human breast cancer cells. Procedures are given for two cell
types, T47D and MDA-MB-231. (See note concerning MCF-7 cells.
10 Gali Soria et al.

For details on the cells, consult the guidelines of the American Type Culture
Collection [ATCC].)
 T47D cells: When the appropriate conditions are used, these hormone-
dependent human breast cancer cells give a high yield of primary local
tumors in the mammary fat pad of female mice. However, due to their
relatively mild aggressiveness, these cells do not form metastases.
Note: Similar to T47D cells, tumor formation by MCF-7 cells is highly
dependent on estrogen supplementation. In essence, it is expected that the
procedure for in vivo tumor formation by MCF-7 cells would follow the
guidelines of T47D cells. Nevertheless, laboratories use different variants of
these cells, such as the MCF-7-ras cells (expressing activated ras oncogene),
which form tumors in the absence of exogenous estrogen and form pulmo-
nary metastases as well (Karnoub et al., 2007; Orimo et al., 2005).
 MDA-MB-231 cells: These are highly metastatic, hormone-independent
human breast carcinoma cells. In procedures of intravenous injection of
the tumor cells, these cells form ‘‘experimental’’ pulmonary metastasis (in
contrast to ‘‘spontaneous’’ pulmonary metastases, which are derived from
the primary tumor) with very high yield.
To elucidate the roles of chemokines in tumor growth and metastasis
formation, many different measures could be taken. Between others,
they include overexpression of chemokines or of chemokine knock-down
in the tumor cells, as described above. In these cases, one should consider
the use of vectors in which the transcription of the chemokine can be
controlled in vivo.

3.1. Formation of primary tumors by T47D cells


As indicated above (Section 2.1.1), although T47D cells are hormone-
dependent, they are usually kept in culture without estrogen/progesterone
supplementation. Under these conditions, the cells proliferate and respond
well to a variety of stimuli. In case of need or interest, estrogen (with
or without progesterone) can be added to the cells (as described in
Section 2.1.1).
In contrast, the in vivo growth of T47D cells is strictly dependent on
estrogen supplementation. Therefore, 9 to 10 days prior to tumor cell
injection, the mice have to be implanted with estrogen pellets (details
follow). In addition, the cells are injected together with matrigel, shown
to be extremely useful in establishing xenografts by many human cancer cell
lines (Mullen et al., 1996). The matrigel is a solubilized tissue basement
membrane matrix rich in extracellular matrix proteins, which was originally
isolated from the Engelbreth-Holm-Swarm (EHS) mouse tumor.
Chemokine Expression and Effects in Breast Cancer 11

3.1.1. Required materials


Mice and supplementary material for tumor cell injection
 Mice: Female SCID mice, 6 to 8 weeks of age (e.g., CB-17-SCID-BG
mice, Harlan, Indianapolis, IN, catalog no. 2CB17BG25).
 Estrogen pellets: 17b-estradiol, 60-day–release pellets of 1.7 mg/pellet
(Innovative Research of America, Sarasota, FL)
 Trochar: 10-gauge (MP-182, Innovative Research of America)
 Matrigel (FAL356234, BD Biosciences)
 Growth medium and trypsin-EDTA solution (as above)
 PBS1

Disposables
 1.5-ml (Eppendorf ) tubes, 10-ml round-bottom tubes, 1 ml-syringes,
needles (25 gauge)

3.1.2. Mice handling prior to tumor cell inoculation


Maintain a colony of female SCID mice under specific pathogen-free (SPF)
conditions. This includes autoclaved water and food, and filtered cages. Let
mice acclimatize for 3 to 5 days prior to implantation of estrogen pellets.
The implantation of the pellets is performed 9 to 10 days prior to
injection of the tumor cells. The pellets are implanted with trochar to the
lateral side of the neck of the mouse. To this end, put the estrogen pellet in a
standing position on the needle of the trochar away from sharp edge. Press
the trochar gently, so that the estrogen pellet would be stable in this position
(if the trochar is pointed downward, the pellet should not fall). Hold the
trochar with your stronger hand. With the other hand, lift skin on the lateral
side of the neck of the mouse and insert the trochar. When the pellet
contacts the skin, twist the trochar sideways and insert pellet.

3.1.3. Tumor cell preparation


One day prior to tumor cell injection A day before tumor cell injection,
you need to pre-prepare both the matrigel and the cells. The matrigel forms
a highly viscous gel above 10 . To avoid this gel formation, the matrigel
should be kept cold throughout the experimental stages. To this end, put the
matrigel 1 day prior to the injection at 4 . Also, cool to 4 all the necessary
equipments (syringes, needles, pipettes, etc.).
T47D cells should be cultured 1 day before their injection in 10-cm
tissue-culture plates with fresh growth medium, so that they will reach 60 to
80% confluency on the injection day.
12 Gali Soria et al.

On the day of tumor cell injection T47D cells are injected at concentration
of 5  105 cells/100 ml, 100 ml/mouse in a suspension that contains matrigel.
The procedure provided below is suitable for injection to 20 mice. Note that
the amounts of cells and matrigel that are given below are suitable for 40 mice:
They were calculated in a large excess due to a considerable loss of material
at the time of cell injection. On the whole, you would need 2  107 cells.
On the day of cell injection, prewarm an aliquot of the culture medium
and the trypsin-EDTA solution. Trypsinize the cells, neutralize the trypsin
with serum-containing growth medium, and centrifuge the cells at
1200 rpm (140g) for 7 min at 4 . Next, resuspend the pelleted cells in
growth medium and after counting them, transfer 2  107 cells to a 10-ml
round bottom tube. Pellet the cells by centrifugation as above, wash them
with 10 ml PBS 1, aspirate the PBS, and transfer the resuspended cells to
4 . Adjust the volume to 2 ml with fresh and ice-cold PBS 1, and mix the
cell suspension with 2 ml of ice-cold matrigel. The resulting cell-matrigel
mixture would be at a final concentration of 5  106 cells/ml.
To avoid warming of the cell-matrigel mixture, and due to its high
viscosity, aliquoting the cell-matrigel mixture into several aliquots
is advised. In the specific example given previously, the cells can be
aliquoted to eight 1.5-ml (Eppendorf) tubes, each containing 500 ml of the
cell-matrigel mixture. Keep the tubes on wet ice until injection.

3.1.4. Tumor cell inoculation to mice


Tumor cell injection is done subcutaneously at the mammary fat pad. Mix
gently one aliquot of cell-matrigel mixture. Draw 100 ml of the mixture into
1-ml syringe without a needle. Then, add a 25-gauge needle, and inject cells
slowly (5 to 6 s) to the lower-right mammary fat pad of the mouse.

3.1.5. Determining tumor growth and survival


Tumors start developing within several days following tumor cell injection
(Fig. 1.2A), at times in proximity to the abdomen surface, and in others
internally. Follow tumor establishment daily, feeling the developing tumors
with your fingertips. Determine the lag period until tumor appearance and
survival of the mice. The size of the tumors in three dimensions can be
determined by calibrated caliper in excised tumors, after sacrificing the mice.

3.2. Formation of pulmonary metastases


by MDA-MB-231 cells
3.2.1. Required materials
Mice and supplementary material for tumor cell injection
 Mice: Female SCID mice, 6 to 8 weeks of age (e.g., CB-17-SCID-BG
mice, Harlan, Indianapolis, IN, catalog no. 2CB17BG25)
Chemokine Expression and Effects in Breast Cancer 13

A
120
100

% Mice with tumors


80
60
40
20
0
0 5 10 15 20
Days

B C
Number of
Mouse no.
metastases *

1 >300
2 >300
3 240
4 211
5 138
6 134
7 +++

Figure 1.2 Formation of primary tumors and pulmonary metastases by human breast
carcinoma cells in female SCID mice. (A) Formation of primary tumors in the mam-
mary fat pad of female SCID mice byT47D cells. T47D cells were injected subcutane-
ously to the mammary fat pads of five female SCID mice, in concentrations of 5  105
cells/100 ml, 100 ml per mouse. Tumor formation was followed daily. (B) Formation of
pulmonary metastases in female SCID mice by MDA-MB-231 cells. MDA-MB-231 cells
were injected intravenously to the tail vein of seven female SCID mice, in concentrations
of 7.5  105 cells/100 ml, 100 ml per mouse. The mice were sacrificed 21 days after tumor
cell inoculation. Metastases were counted following injection of india ink solution. *In
all cases, micrometastases were present, but they were not counted. þþþA mouse in
which only micrometastases were detected. (C) White pulmonary metastases detected
against the black background of india ink^stained lung.

 Growth medium and trypsin-EDTA solution (as above)


 PBS 1
Other materials
 India ink solution (15% india ink, 85% water, 3 drops NH4OH/100 ml)
 Feket’s solution (300 ml 70% ethanol, 30 ml 37% formaldehyde, 5 ml
glacial acetic acid)
 Lamp (to warm the mice) and restraining tube (for holding the mice)

Disposables:
 10 ml round bottom tubes, 1-ml syringes, needles (25 gauge)
14 Gali Soria et al.

3.2.2. Mice handling prior to tumor cell inoculation


Maintain a colony of female SCID mice under specific pathogen-free (SPF)
conditions. This includes autoclaved water and food, and filtered cages. Let
mice acclimatize for 3 to 5 days prior to tumor cell injection.

3.2.3. Tumor cell preparation


One day prior to tumor cell injection One day prior to tumor cell
injection, transfer the MDA-MB-231 tumor cells into a 10-cm tissue
culture plate with fresh growth medium, to reach 60 to 80% confluency
on the day of injection.

On the day of tumor cell injection The MDA-MB-231 cells are injected
at a concentration of 7.5  105 cells/100 ml, 100 ml/mouse. The procedure
provided in the following is suitable for injection of 20 mice. On the whole,
you would need a total of 1.5  107 cells; however, preparing extra cells,
such as a total of 2  107 cells, is advisable.
On the day of tumor cell injection, prewarm an aliquot of culture
medium and the trypsin-EDTA solution. Following cell trypsinization,
neutralize the trypsin with serum-containing growth medium, and centri-
fuge the cells at 1200 rpm (140g) for 7 min at 4 . Next, resuspend the cell
pellet with 5 ml of growth medium and count the cells. Transfer 2  107
cells to a 10-ml round-bottom tube and pellet the cells by centrifugation at
1200 rpm for 7 min at 4 . Wash the cells with 10 ml PBS 1 and aspirate
the PBS, and then add fresh PBS 1 to a final volume of 2.7 ml, leading to
final cell concentration of 7.5  106 cells/ml. Keep the cells on ice until
injection of the tumor cells.

3.2.4. Tumor cell inoculation to mice


The MDA-MB-231 cells are routinely injected intravenously. To this end,
warm mice with a lamp until they rub their faces and veins are visible.
Following gentle cell mixing, load a syringe with the cells, and tap the bubbles
out. Place mouse in restraining tube, pulling gently on the tail until taut, rub
the tail with 70% alcohol, and inject the tumor cells into the tail vein. Wipe
with tissue.

3.2.5. Determining formation of pulmonary metastases


Upon intravenous injection, MDA-MB-231 cells give rise to a large num-
ber of pulmonary metastases. One cannot detect metastases without sacrifi-
cing the mice; therefore, you need to follow the mice daily and sacrifice
them when they weaken, that is, when their fur is not shiny and their
appearance seems abnormal. A heavy load of metastases usually develops
within 3 weeks after tumor cell injection (Fig. 1.2B).
Chemokine Expression and Effects in Breast Cancer 15

For determination of pulmonary metastases, sacrifice the mice according to


local procedures; avoid neck dislocation. Pulmonary metastases are detected
by intratracheal injection of india ink solution, which stains the lungs black,
leaving the white metastases visible (Fig. 1.2C). To this end, the trachea of the
dead animal should be dissected free from the surrounding structures (e.g., by
putting tweezers under the trachea). The india ink solution (2 to 4 ml) should
be injected via the trachea into the lungs until each of the lobes is inflated and
stains black. Dislocate the lungs and wash the india ink in double-distilled
water. Next, place the lungs in fresh Feket’s solution for 24 h at RT. In parallel
to weighing the lungs, count white metastases against the black color of the
lung background. Please note that when a heavy metastatic load is obtained,
some of the metastases may merge together, and counting may be difficult.
In such a case, a binocular may be of assistance, enabling a certain degree of
discrimination between the merging metastases.

ACKNOWLEDGMENTS
The research relevant to this paper was supported by The Israel Science Foundation; The
Israel Cancer Association; The Ela Kodesz Institute for Research on Cancer Development
and Prevention; The Federico Foundation.

REFERENCES
Allavena, P., Sica, A., Solinas, G., Porta, C., and Mantovani, A. (2007). The inflammatory
micro-environment in tumor progression: The role of tumor-associated macrophages.
Crit. Rev. Oncol. Hematol. 67, 11438–11446.
Ben-Baruch, A. (2006a). The multifaceted roles of chemokines in malignancy. Cancer
Metastasis Rev. 25, 357–371.
Ben-Baruch, A. (2006b). ‘‘Pro-malignancy and putative anti-malignancy chemokines in the
regulation of breast cancer progression.’’ In Veskler, Barbara A., ed., Focus on Immunology
Research, pp. 1–46. Nova Science Publisher, New York.
Ben-Baruch, A. (2007). Organ selectivity in metastasis: Regulation by chemokines and their
receptors. Clin. Exp. Metastasis 25, 345–356.
Karnoub, A. E., Dash, A. B., Vo, A. P., Sullivan, A., Brooks, M. W., Bell, G. W.,
Richardson, A. L., Polyak, K., Tubo, R., and Weinberg, R. A. (2007). Mesenchymal
stem cells within tumour stroma promote breast cancer metastasis. Nature 449, 557–563.
Mullen, P., Ritchie, A., Langdon, S. P., and Miller, W. R. (1996). Effect of Matrigel on the
tumorigenicity of human breast and ovarian carcinoma cell lines. Int. J. Cancer 67,
816–820.
Orimo, A., Gupta, P. B., Sgroi, D. C., Arenzana-Seisdedos, F., Delaunay, T., Naeem, R.,
Carey, V. J., Richardson, A. L., and Weinberg, R. A. (2005). Stromal fibroblasts present
in invasive human breast carcinomas promote tumor growth and angiogenesis through
elevated SDF-1/CXCL12 secretion. Cell 121, 335–348.
Salcedo, R., and Oppenheim, J. J. (2003). Role of chemokines in angiogenesis: CXCL12/
SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses. Microcircu-
lation 10, 359–370.
16 Gali Soria et al.

Soria, G., and Ben-Baruch, A. (2008). The inflammatory chemokines CCL2 and CCL5 in
breast cancer. Cancer Lett. 267, 281–285.
Strieter, R. M., Burdick, M. D., Mestas, J., Gomperts, B., Keane, M. P., and Belperio, J. A.
(2006). Cancer CXC chemokine networks and tumour angiogenesis. Eur. J. Cancer 42,
768–778.
Vandercappellen, J., Van Damme, J., and Struyf, S. (2008). The role of CXC chemokines
and their receptors in cancer. Cancer Lett. 267, 226–244.
Zlotnik, A., Yoshie, O., and Nomiyama, H. (2006). The chemokine and chemokine
receptor superfamilies and their molecular evolution. Genome Biol. 7, 243.
C H A P T E R T W O

CCR5 Pharmacology Methodologies


and Associated Applications
Roy Mansfield,* Sarah Able,* Paul Griffin,* Becky Irvine,*
Ian James,* Malcolm Macartney,* Ken Miller,† James Mills,*
Carolyn Napier,* Iva Navratilova,* Manos Perros,*
Graham Rickett,* Harriet Root,* Elna van der Ryst,*
Mike Westby,* and Patrick Dorr*

Contents
1. Introduction 18
2. CCR5 Signaling Assays and Application to Quantify and
Characterize Ligand-Dependent Agonism,
Antagonism, and Inverse Agonism 19
2.1. CCR5-mediated Ca2þ signaling 19
2.2. CCR5 cellular internalization assay 24
2.3. Application of CCR5 receptor internalization assay to
investigate antagonist-dependent functional receptor
occupancy in vivo (clinical trials) 25
2.4. GTP-associated CCR5 inverse agonism assay 28
2.5. cAMP-response-element-luciferase reporter gene assay 30
3. CCR5-Associated Ligand-Binding Assays 33
3.1. Radiolabeled CCR5 chemokine-binding assays 33
3.2. Radiolabeled antagonist-binding and -dissociation assays 34
3.3. Real-time ligand binding using Biacore technology 34
3.4. Real time HIV-1 gp120-CCR5 binding assay 35
3.5. Application of gp120 binding to characterize functional
occupancy in vitro 37
4. Surrogate In Vitro Antiviral Assays 38
4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay 38
4.2. Antiviral assays 40
5. CCR5 Site-Directed Mutagenesis and Ligand Docking Studies 43
5.1. Structural model generation 44
5.2. CCR5 site-directed mutagenesis 45

* Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom


{
Pfizer GRD-Groton Laboratories, Groton, Connecticut, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05202-1 All rights reserved.

17
18 Roy Mansfield et al.

5.3. Transfection of HEK Ga15 cells with pIRESneo-CCR5 (various


isoforms) and pCRE-luc 45
5.4. CRE-Luc reporter assay 46
5.5. Example results/data 46
6. Non-HIV Indications–Associated Studies, Human CCR5
Knock-In Mice 48
6.1. Vector construction for hCCR5 knock-in 48
6.2. Transfection and human CCR5 knock-in mouse generation 49
6.3. Materials 50
References 52

Abstract
The G protein–coupled chemokine (C-C motif ) receptor, CCR5, was originally
characterized as a protein responding functionally to a number of CC chemo-
kines. As with chemokine receptors in general, studies indicate that CCR5 plays
a role in inflammatory responses to infection, although its exact role in normal
immune function is not completely defined. The vast majority of research into
CCR5 has been focused on its role as an essential and predominant coreceptor
for HIV-1 entry into host immune cells. Discovery of this role was prompted by
the elucidation that individuals homozygous for a 32 bp deletion in the CCR5
gene do not express the receptor at the cell surface, and as a consequence, are
remarkably resistant to HIV-1 infection, and apparently possess no other clear
phenotype. Multiple studies followed with the ultimate aim of identifying drugs
that functionally and physically blocked CCR5 to prevent HIV-1 entry, and thus
provide a completely new approach to treating infection and AIDS, the world’s
biggest infectious disease killer. To this end, functional antagonists with potent
anti–HIV-1 activity have been discovered, as best exemplified by maraviroc, the
first new oral drug for the treatment of HIV-1 infection in 10 years. In this
chapter, the specific methods used to characterize CCR5 primary pharmacology
and apply the data generated to enable drug discovery, notably maraviroc, for
the treatment of HIV infection and potentially inflammatory-based indications,
are described.

1. Introduction
The CCR5-associated methods included in this chapter are described
in fine detail to enable their various subtleties to be captured as far as possible
for the reader, especially where the method in question is subject to failure
due to minor changes in assay conditions. As the predominant application of
CCR5 research is toward the discovery of agents to treat HIV infection,
CCR5-associated virology methodologies are included. Where helpful for
the reader, specific reagent volumes and working conditions are also
described as ‘‘typical’’ in order to help their transfer to practical laboratory
CCR5 Primary Pharmacology Methods and Applications 19

situations. Where such fine details are captured elsewhere, an outline is


given with the associated citation for the sake of brevity. Where methods
and applications are described, but not available for transfer to third-party
laboratories due to their proprietary nature, a citation and overview of the
method are described. Example data, results, and application for specific
methods are also described or cited both for purposes of providing informa-
tion per se as well as to enable assay setup in independent laboratories where
applicable or desired. The antagonists and agonists either discovered or used
to exemplify the methods and associated applications or results are described
in Table 2.1 with specific citation for each provided in the text.

2. CCR5 Signaling Assays and Application to


Quantify and Characterize Ligand-Dependent
Agonism, Antagonism, and Inverse Agonism
Chemokine interaction with CCR5 initiates several events.
The receptor associates with G proteins, leading to activation of signaling
processes, that is, changes in receptor conformation, G-protein interaction
and GTP binding, and intracellular Ca2þ redistribution and receptor inter-
nalization. A number of cognate/endogenous CC chemokines (see
Table 2.2) bind to CCR5 with different affinities and abilities to activate
the receptor (Blanpain et al., 2003). Discovery and characterization of novel,
noncognate ligands, including quantification of their inhibitory (i.e., antag-
onistic) potencies can be determined using the various assays developed to
measure chemokine-induced CCR5 signaling. The methods can be applied
to show the qualitative functional binding of a ligand (i.e., agonism, inverse
agonism, and functional antagonism), and the quantification in potency
(i.e., EC50 [agonists]) or IC50 [antagonists]).

2.1. CCR5-mediated Ca2þ signaling


This method was adapted from a previous reported methodology
(Combadiere et al., 1996), and a summary with application for drug discov-
ery has been reported (Dorr et al., 2005b; Napier et al., 2005). A CCR5
agonist would be expected to trigger a cascade of intracellular signaling
events that may lead to activation of the target cell. Conversely, a functional
antagonist or inverse agonist of the receptor would bind without triggering
an intracellular signal to prevent attachment of the cognate chemokines and
subsequent signaling events. Agonists bind to the CCR5 receptor to induce
a signal transduction cascade provoking, among other events, redistribution
of intracellular Ca2þ from the endoplasmic reticulum (i.e., Ca2þ flux). Ca2þ
flux can be measured by the increase in fluorescence of an intracellular dye
Table 2.1 CCR5 antagonists described in this chapter

CCR5 antagonist:
status/application Structure and general chemotype
Maraviroc (UK-427857): N
Approved drug for the F N
treatment of HIV-1 N
infection (Dorr et al., F H
N N
2005b; Dorr and Perros,
2008; Fatkenheuer et al., O
2008)

Tropane azole

N
PF-232798: Phase 2
(Dorr et al., 2008) N O
N
H
N N

F
Tropane imidazipiperidine

N
UK-484900:
Eexperimental N O
CCR5 antagonist H N
and inflammatory N N
O
indications tool
O

F
Tropane imidazipiperidine

N
PF-501606: Experimental O O
N N
antagonist and docking
standard. N O
N

Tropane imidazopiperidine
x
Table 2.1 (continued)

CCR5 antagonist:
status/application Structure and general chemotype

UK-396794: Experimental N
CCR5 antagonist N
(Dorr et al., 2005a; O
H
Haworth et al., 2007) N N

Tropane benzimidazole
Me
N
UK-433370: Experimental
F N
CCR5 antagonist N
(Dorr et al., 2005a) H
F
N N

Tropane azole

N
O
UK-438235: Experimental
CCR5 antagonist N
N
(Haworth et al., 2007) H
N N

Tropane benzimidazole

O
O−
SCH-C Former clinical N N+
candidate (Tsamis et al.,
O N
2003a)
N

Br
Bis-piperidine

(continued)
22 Roy Mansfield et al.

Table 2.1 (continued)

CCR5 antagonist:
status/application Structure and general chemotype
N

UK-107543: CCR5 HTS


hit (agonist) (Dorr et al.,
2005b) N N
N

Imidazopyridine

Table 2.2 Cognate ligands for CCR5

Systematic ligand name Original ligand name


CCL3 MIP-1a (macrophage inflammatory protein 1a)
CCL4 MIP-1b (macrophage inflammatory protein 1a)
CCL5 RANTES (regulated on activation, normally
T -cell expressed and secreted)
CCL7
CCL8 MCP-2 (monocyte chemoattractant protein 1)
CCL14 HCC-1 (Haemofiltrate CC chemokine 1)
CCL3L1 LD78b

resulting from its combination with intracellular Ca2þ released from the
ER. This can be monitored in real time using a fluorescent laser imaging
plate reader (FLIPR) or an equivalent workstation technology. This allows a
real-time assay of agonist and antagonist effects on CCR5-mediated Ca2þ
flux in HEK-293 cells expressing the human chemokine receptor.

2.1.1. CCR5 stable transfected cell culture and preparation for


calcium signaling assays
CCR5 stably transfected cells, such as CHO or HEK-293 cells, are prepared
in an appropriate cell culture medium to a density of 1  106 cells/ml.
Suitable aliquots of this cell suspension (e.g., 100 ml for a 96-well,
plate-based assay) are transferred into every well of poly-D-lysine plates
CCR5 Primary Pharmacology Methods and Applications 23

FLIPR-compatible plates and incubated overnight in a growth incubator


(humidified 5% (v/v) CO2 incubator at 37 ) to ensure cell adhesion.

2.1.2. Calcium dye preparation and cell dye loading for calcium
signaling assays
A Calcium Plus KitTM dye is dissolved in 10 ml Ca2þ flux buffer (see
Section 6.3) before adding 90 ml of the same buffer to create the final
working solution. The media from the plated cells is removed and the
adherent cells washed twice by removal of culture medium and replacement
with 2  100 ml PBS into each well. The PBS is removed and the adherent
cells are incubated with dye preparation (100 ml/well) and left gently rock-
ing for 3 h. The dye is then aspirated and the plates washed three times with
Ca2þ flux buffer, prior to addition of additional buffer (160 ml) immediately
before the Ca2þ flux assay is undertaken.

2.1.3. Ca2þ flux assay


Antagonist dilutions (20 ml, at appropriate concentrations) are added to
designated wells of the dye-loaded cell plate after 30 s into a prewritten
fluorescence program, to examine agonist activity. Chemokines (20 ml to
enable testing at the predetermined EC50 at final assay concentration [FAC])
are added to each well after 4 min. Buffer–buffer and MIP-1b–buffer
controls are performed to establish contribution of the artifact signal.

2.1.4. Example data and results


The profile of maraviroc in this assay is shown in Fig. 2.1 as an example of a
functional CCR5 antagonist.
1000 nM maraviroc
13,000
16 nM maraviroc
12,000
4 nM maraviroc
11,000 Vehicle control
Fluorescent counts

10,000

9000
8000
7000
Maraviroc RANTES
6000
0 50 100 150 200 250 300 350 400 450
5000
Time (s)

Figure 2.1 Effect of RANTES (CCR5 agonist) and maraviroc (CCR5 functional
antagonist) on recombinant CCR5-mediated Ca2þ signaling in HEK cells. The
dynamic change in fluorescence after the addition of maraviroc (marked) is shown,
as well as subsequent addition of agonist RANTES as marked 4 min later.
24 Roy Mansfield et al.

2.2. CCR5 cellular internalization assay


To enable characterization of ligand binding with association to agonism or
antagonism, it is necessary to see if test compounds induce CCR5 internali-
zation or not. A method for this has been summarized with application in
reported drug discoveries (Dorr et al., 2003b, 2005b). Antiviral activity by
CCR5 cognate chemokines is mediated by internalization of receptor,
whereas antagonists block the receptor and stabilize a conformation that
is not recognizable by CCR5-tropic (R5) HIV-CD4 complex. CCR5-
internalization–mediated antiviral activity has been reported to lead to
HIV-1 resistance through tropism shift (Mosier et al., 1999), although the
viruses used in such studies are associated with random tropism shift per se
(i.e., shift to CXCR4 without CCR5 antagonist selection pressure)
(Westby et al., 2004, 2007). A tropism shift to escape antagonist antiviral
activity has not been observed to date in clinical or preclinical studies (Dorr
and Perros, 2008). In light of the low and variable levels of CCR5 expres-
sion on primary cells, 300.19/R5 cells (an internalization-competent
recombinant human CCR5 expressing mouse pre–B-cell line) can be
used for quantitative preclinical pharmacology studies. Cell surface CCR5
levels are measured using a human CCR5-specific monoclonal antibody,
with an associated labeled secondary antibody to enable fluorescence-
activated cell sorting (FACS) technology (alternatively, the primary anti-
body can be custom labeled). Endogenous CCR5 agonists and the CXCR4
agonist stromal derived factor 1a (SDF-1a) can be used as positive and
negative CCR5 internalization controls, respectively.

2.2.1. Cell culture and reagent preparation


300.19/R5 cells (mouse pre–B-cell line, recombinantly expressing human
CCR5) are cultured in a DMEM medium and adjusted to a cell density of
5  106/ml by dilution in the same medium. Anti-CCR5 antibody (2D7-
see Section 6.3) is diluted 1:10 in 0.5% (w/v) BSA/PBS. Antibody IgG2a
(isotype control for the assay, see Section 6.3) is similarly diluted. The anti-
2D7 phycoerythrin (PE)–labeled, goat anti-mouse secondary antibody (see
Section 6.3) is used at a 1:20 dilution in 0.5% (w/v) BSA/PBS. RANTES
and SDF-1a (or any other cognate chemokine, see Section 6.3) is dissolved
in PBS (100 mM), and then further diluted from a 1-mM final assay
concentration (FAC) in cell culture medium.

2.2.2. FACS Assay


300.19/R5 cells (100 ml) at 5  106 cells/ml are added to each assay tube.
Antagonists or chemokine controls (10 ml) are added to appropriate assay
tubes to enable profiling (usually at 100 nM or below in situ). The tubes are
incubated 37 for 45 min to enable CCR5 internalization. The samples are
centrifuged (1500 rpm in a benchtop centrifuge) and washed twice in 0.5%
CCR5 Primary Pharmacology Methods and Applications 25

(w/v) BSA/PBS (100 ml). Washed samples are resuspended in 40 ml of the


same buffer. Anti-CCR5 antibodies or isotype controls are then added to
the samples followed by incubation for 45 min at 4 to enable antibody
binding to CCR5. The samples are washed once in 0.5% (w/v) BSA/PBS,
followed by the addition of 75 ml phycoerythrin (PE)–goat, anti-mouse
secondary antibody with incubation at 4 for 45 min in the dark to enable
binding. The samples are subsequently centrifuged (1500 rpm in a benchtop
centrifuge for 5 min), washed twice in 0.5% (w/v) BSA/PBS (100 ml) and
resuspended in 1% (v/v) formaldehyde/PBS (1 ml) for fixing. The fixed
cells are processed using suitable instrumentation (e.g., Becton Dickinson
FACScalibur), using excitation/emission wavelengths of 488 nm/530 nm,
respectively.

2.2.3. Example results/data


Figure 2.2 highlights the data generated from this method as plotted by
fluorescence overlays showing chemokine induction of CCR5 cellular
internalization. The plots highlight that agonism results in receptor inter-
nalisation and that antagonists do not induce this event. This method can
also be modified by the addition of a ‘‘wash-and-chase’’ phase where cells
are washed following a period of incubation with antagonists (for a set
period) and then progressed to chemokine-induced internalization studies
with FACS analysis. This enables the functional offset of the antagonist to be
characterized and used to compare various antagonists. Figure 2.3 highlights
this application with the experimental antagonist UK-484900 (Table 2.1),
highlighting prolonged blockade of chemokine-induced CCR5 internali-
zation, following removal (by cell washing) of exogenous antagonist and a
2-h incubation prior to chemokine addition.

2.3. Application of CCR5 receptor internalization assay to


investigate antagonist-dependent functional receptor
occupancy in vivo (clinical trials)
As part of drug clinical development, it is becoming increasingly important
to ensure that compounds under evaluation induce the desired mechanism-
associated pharmacology in humans. The FACS-based CCR5 internaliza-
tion assay has been adapted to enable functional CCR5 occupancy studies in
humans. Placebo versus maraviroc (i.e., CCR5 antagonist)-dependent inhi-
bition of MIP-1b–mediated CCR5 internalization (i.e., functional occu-
pancy) can be assessed in CD4 T lymphocytes prepared from whole-blood
citrate CPT (cell preparation tubes) samples taken from healthy volunteers
participating in a clinical study designed to investigate CCR5 occupancy
in vivo. The difference in CCR5 expression on the cell surface in the
presence of high concentration exogenously supplied maraviroc treated
(total CCR5) versus untreated (maximum internalization) peripheral
26 Roy Mansfield et al.

A B
80 80 Control
Control
SDF-1a
SDF-1a
37 ⬚C RANTES + 2 hr media
4 ⬚C RANTES

RANTES
Counts

Counts
0 0
100 101 102 103 104 100 101 102 103 104
Fluorescence Fluorescence

C
80 Control
SDF-1a
37 ⬚C 10 nM UK-427857
100 nM UK-427857
Counts

0
100 101 102 103 104
Fluorescence

Figure 2.2 Effect of maraviroc on 300.19 cell surface CCR5 levels (anti-CCR5
antibody^dependent cell population fluorescence). Isotype control fluorescence counts
(y-axis) is depicted in grey. RANTES (100 nM)-induced reduction of CCR5 is shown
by a reduction in fluorescence (green line in 2A) relative to parallel experiments using
the negative control ligand SDF-1a (red line in 2A). Reemergence of CCR5 at the cell
surface is apparent following a 2-h incubation period post addition of RANTES (blue
line, 2A). RANTES-induced reduction in cell population fluorescence is reduced at 4
(2B) highlighting internalization to be an active biological process. Maraviroc did not
affect cell population fluorescence at10 nM or 100 nM (blue and green lines, respectively,
in 2C), as also seen for the negative control SDF-1a (red line). (From Dorr P., and Perros,
M. (2008). CCR5 inhibitors in HIV therapy. Expert Opin. Drug Discov.3, 1^16; Dorr, P.,
et al. (2005). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective small-
molecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human
immunodeficiency virus type1activity. Antimicrob. Agents Chemother.49,4721^4732.)

blood lymphocytes (PBLs) subjected to MIP-1b challenge, gives estimate of


the proportion of free CCR5 present on the cell surface at any given plasma
concentration of maraviroc. These data can then be used to estimate the
degree of receptor occupancy obtained at different doses (and exposures) of
maraviroc, or indeed any other CCR5 antagonist in clinical evaluation.
CCR5 Primary Pharmacology Methods and Applications 27

A
120
100
80
Counts

60
40
20
0
100 101 102 103 104
FL2-H
B
120
100
80
Counts

60
40
20
0
100 101 102 103 104
FL2-H
C
120
100
80
Counts

60
40
20
0
100 101 102 103 104
FL2-H

Figure 2.3 Prolonged inhibition of UK-484900 (antagonist)-dependent inhibition of


chemokine-induced CCR5 internalization in 300.19 cells. Flourescence plot overlays of
a representative FACS experiment with human CCR5 expressed on 300.19/R5 cells.
Fluorescence units are shown on the x-axis, and cell counts on the y-axis. UK-484,900 is
assayed at 1000 nM, 100 nM, and 10 nM (f3A, B, and C, respectively). Cells are treated
with RANTES in the presence of the compound (depicted in black), following com-
pound removal and wash (pink), or a further 1.5-h incubation (orange).Vehicle control
is depicted in green.Total fluorescence (no RANTES) is depicted in red, and the isotype
negative control is depicted in blue.

2.3.1. Dosing and sampling regimen


CCR5 antagonists such as maraviroc versus placebo are dosed to volun-
teers at known levels for the purpose of evaluating dose-occupancy
correlation. Blood samples are then taken (into citrate-CPT tubes, 4 ml)
at intervals after dosing to evaluate occupancy. The residual CCR5-
receptor expression on CD4 positive lymphocyte populations is deter-
mined by FACS analysis of processed sodium citrate CPT anticoagulated
whole-blood samples.
28 Roy Mansfield et al.

2.3.2. Sample preparation and FACS analysis


Peripheral blood lymphocyte–rich plasma samples are isolated by centrifu-
gation of CPT tubes at 1550g for 25 min at room temperature (RT) in a
swing-out–rotor bench centrifuge. The buffy coat layer of cells is resus-
pended in the plasma. Each cell-enriched plasma sample (250 ml) is
pipetted into three separately labeled 12  75–mm polystyrene round-
bottomed tubes (Tube 1 [isotype control], Tube 2 [maraviroc-stabilized
CCR5], and Tube 3 [test sample]). An aliquot (50 ml) of CCR5 stabilizing
solution (see Section 6.3) is added to Tube 2, while PBS (1% (w/v) BSA)
(50 ml) is added to Tubes 1 and 3, before briefly vortexing on a medium
setting for 2 s and incubating at 37 for 30 min. All tubes are centrifuged
at 400g for 5 min to isolate cells. Aliquots (15 ml) of MIP-1b (100 nM)
are added to all tubes, and then gently vortexed on a medium setting for
2 s to resuspend pellet in fluid. The tubes are then incubated uncapped for
45 min in a growth incubator to enable CCR5 internalization. Aliquots
(1 ml) of 0.5% (v/v) paraformaldehyde in PBS are added to each tube,
followed by vortex (2 s) and incubation (10 min) in the dark at RT to fix
the cells. Cells are washed with PBS/centrifugation (400g for 5 min)
prior to antibody addition (50 ml—MsIgG R-phycoerythrin [PE], isotype
control [Tube 1]; anti-CCR5 2D7, PE labeled, maraviroc stabilized and
test samples [Tubes 2 and 3]). All tubes are then vortexed (2 s) and
incubated for 20 min in the dark at RT, washed with PBS/BSA as before,
with resuspension in 0.5 ml of 1%(v/v) paraformaldehyde by vortexing
(2 s). Samples can be stored at 2 to 8 until FACS analysis as described
above.

2.3.3. Example results/data


The PBL population CCR5-mediated fluorescence profile and MIP-1b–
induced effect to reduce this signal through receptor internalization on the
cells taken from human volunteers are highlighted in Fig. 2.4. The effect of
blockade of this agonist-induced internalization is used to measure the
functional occupation of maraviroc in clinical studies, and example data
highlighting the dynamic dose-occupancy relationship is highlighted in
Fig. 2.5.

2.4. GTP-associated CCR5 inverse agonism assay


CCR5 interacts with multiple G-protein species in recombinant cells,
following binding of the various endogenous agonist ligands (Mueller
et al., 2002, 2006; Mueller and Strange, 2004a, 2004b; Peltonen et al.,
1998). MIP-1b–dependent stimulation of GTP can be examined using a
radiolabeled nonhydrolyzable form of GTP (gS-GTP) exactly as described
by (Haworth et al., 2007) to characterize the inverse agonism mechanism
CCR5 Primary Pharmacology Methods and Applications 29

Maraviroc plus chemokine Vehicle plus chemokine


60
50 50
Cell counts

Cell counts
40 40
CCR5 CCR5
30 30
20 20
:
10 10

101 102 103 104 101 102 103 104


PE-dependent fluorescence PE-dependent fluorescence

Figure 2.4 CCR5 occupancy assay in/ex vivo. FACS analysis of PBLs blockade of che-
mokine (MIP-1b)-induced CCR5 internalization by maraviroc in ex vivo PBMCs, as
measured by PE-conjugated anti-CCR5-Mab (2D7) fluorescence measurements on a
FACS technology platform.The presence of maraviroc inhibits MIP-1b^induced CCR5
internalization compared tovehicle. Analysis of placebo versus maraviroc dosed samples
using this methodology enabled the dynamic functional occupancy of CCR5 to be pro-
filed (Fig. 2.5).

120
% CCR5 functional occupancy

100
100 mg
80
25 mg
60 3 mg
10 mg
40
Placebo
20

0
0 10 20 30 40 50 60
Time (h)

Figure 2.5 Dynamic functional occupancy of CCR5 in humans by maraviroc blood


sample for assay of CCR5-internalization on isolated PBMCs taken at times indicated
following single dose to healthy volunteers. Data are mean  SD for each cohort. Note
that 20% of 2D7-anti-CCR5^recognized CCR5 is not internalized by MIP-1b, lead-
ing to an apparent occupancy level of 20% for placebo-dosed human volunteers.

that is measurable in recombinant systems which underpins the functional


antagonism of antiviral CCR5 inhibitors (Dorr et al., 2005b; Strizki et al.,
2001). GTP binding to CCR5 is measured based on previously described
methods ( Jansson et al., 1999; Labrecque et al., 2005). These can also be
adapted to a time-resolved fluorometric assay, using a Europium (Eu3þ)
labeled gS-GTP to avoid use of radioactivity.
30 Roy Mansfield et al.

2.4.1. Membrane preparation and GTP-binding assay


CCR5 stable transfected HEK-293 cells are cultured to a confluency
between 50 and 70% in standard culture medium (e.g., DMEM), typically
in a 225-cm2 flask. Cells are washed once with PBS. The PBS is removed
and the cells dislodged by rapping the side of the culture flask in the presence
of 10 ml culture medium, harvested by centrifugation (350g for 10 min).
Pelleted cells are resuspended in 15 ml lysis buffer (see Section 6.3), and
homogenized with a handheld homogenizer (5 to 10 s on ice, three to four
times). The homogenate is centrifuged at 40,000g for 30 min at 4 . The
membranous pellet is resuspended in a minimal volume of lysis buffer (see
Section 6.3) prior to estimation of protein concentration (e.g., Bradford
microassay). Membrane aliquots (50 ml at 500 mg/ml) are added to desig-
nated wells of a 96-well assay plate. GTP binding is measured using a Delfia
GTP-binding assay kit (see Section 6.3), according to the manufacturer’s
protocol, with a ‘‘preoptimized’’ GTP assay buffer (see Section 6.3). Assay
buffer (50 ml) is added to the plate wells prior to incubation at RT for
30 min with gentle rotary shaking. MIP-1b and test compounds are diluted
in 50 mM HEPES buffer, pH 7.4, over a desired concentration range. The
test compound is added and incubated at RT for 30 min prior to the
addition of 10 ml GTP-Eu3þ (100 nM FAC). The reaction is incubated
for a further 30 min at 37 before washing with 300 ml/well of ice-cold
wash buffer (supplied with assay kit) and reading immediately at 615 nm
using an appropriate plate reader. Basal GTP binding is calculated from the
mean values obtained for vehicle control-designated wells (50 mM HEPES,
pH 7.4). The effect of MIP-1b and the test compound on GTP incorpora-
tion is measured for each well (and meaned), with percent stimulation
relative to vehicle control calculated. Nonspecific binding (NSB) is sub-
tracted (NSB is determined as the background binding of GTP to the assay
plate in the absence of membranes).

2.4.2. Example data and results


Vicriviroc, maraviroc, and its analogues UK-396794 and UK-438235 show
the classic inverse agonist profile of small concentration-dependent reduc-
tions in GTP-binding assays, compared to relatively large agonist-stimulated
increase in binding as previously reported (Dorr et al., 2005b; Haworth
et al., 2007; Strizki et al., 2001). This is depicted in the case of maraviroc in
Fig. 2.6.

2.5. cAMP-response-element-luciferase reporter gene assay


The cAMP-response-element-luciferase (CRE-luc) plasmid codes for a
cAMP response element upstream of a luciferase reporter gene.
HEKGa15 cells can be transiently cotransfected with the CRE-luc
CCR5 Primary Pharmacology Methods and Applications 31

1600

1400

MIP-1b
MIP-1
Stimulated/basal GTP binding (%)

1200

1000

800

600

400

200
Maraviroc
0
3 6 10 30 60 100 300 600 1000
Ligand concentration (nM)

Figure 2.6 Inverse agonism of CCR percent by maraviroc. Stimulation of GTP bind-
ing to membrane preparations from CCR5-expressing HEK-293 cells by MIP-1b-
(pink line and data points), and UK-427,857 (blue line and data points). Data points
represent the ratio of GTP binding in the presence of ligand over basal levels of GTP
binding in vehicle control assays.

construct and a plasmid encoding the human CCR5 receptor. The trans-
fected cells are stimulated with forskolin to activate adenylate cyclase, and
increase intracellular cAMP to enable an assay window. The cAMP binds to
its response element, which activates transcription of the luciferase reporter
gene, leading to an increase in measured luminescence. The CCR5 recep-
tor is a Gi-linked GPCR when expressed in an appropriate background, and
agonism inhibits adenylate cyclase, reducing the intracellular cAMP con-
centration and thus decreasing the luminescence signal. The effect of pre-
incubation with antagonists on the dose–response curve to MIP-1b, and
therefore its functional activity at the CCR5 receptor can thereby be
investigated.

2.5.1. Transient transfections and assay plate preparation


Bulk preparations of human CCR5 receptor DNA (in the expression vector
pIRESneo) and CRE-luc plasmid DNA (see Section 6.3) are used for
transfections. HEKGa15 cells are cultured in standard medium (see
Section 6.3), and passaged at 90% confluency using cell dissociation
solution. Cells are transfected at 50 to 80% confluency in T75 flasks, using
32 Roy Mansfield et al.

lipofectamine (Plus) reagent. OptiMEM reduced serum medium is used in


all transfection procedures. Two solutions are prepared for each transfection:
Solution 1 ¼ 4 mg human CCR5 receptor DNA, 2.5 mg CRE-luc DNA,
45 ml Plus reagent, 0.75 ml OptiMEM; and Solution 2 ¼ 22.5 ml lipofecta-
mine, 0.75 ml OptiMEM. Solution 1 is incubated at RT for 15 min.
Solutions 1 and 2 are then mixed and incubated at RT for 15 min, before
the addition of 7 ml OptiMEM. The flasks containing the cells for transfec-
tion are removed from the incubator and the media removed. The cells are
washed in 10 ml OptiMEM, and the DNA/lipofectamine/OptiMEM mix
(Solutions 1 and 2) added. The flasks are incubated in a growth incubator
overnight. For cell plate preparation, DMEM medium without phenol red,
supplemented with 10% (w/v) dialysed FCS, is used in the cell plate
preparation. Media is removed from the transfected cells and each flask is
washed once in 10 ml PBS. Cell dissociation solution is added (2 ml) and the
flasks incubated at RT for up to 5 min. The flasks are tapped to dislodge the
cells, and approximately 8 ml media (as above) added. The cells are pelleted
by centrifugation at 1000g for 5 min. The cells are resuspended in fresh
media and plated out (90 ml) into 96-well plates (2.5  104 cells/well), and
are left to adhere overnight in a growth incubator.

2.5.2. CRE-luc assay


To inhibit phophodiestrase activity and enable cAMP detection accord-
ingly, isobutylmethylxanthine (500 mM in DMSO) is diluted to 1 mM in
0.1% (w/v) BSA/PBS to make the antagonist diluent. Test compounds e.g.,
maraviroc are diluted in antagonist diluent to 10x final assay concentration.
MIP-1b is prepared at 36 mM in 0.1% (w/v) BSA/PBS, and aliquoted for
freezing/use. MIP-1b is then diluted in 0.1% (w/v) BSA/PBS to 12 final
assay concentration. Forskolin (1 mM in DMSO) is diluted to 3.6 mM in
0.1% (w/v) BSA/PBS to give a FAC of 300 nM. Test compounds (10 ml)
are added to the cell and incubated at 37 for 30 min, prior to addiction of
MIP-1b and forskolin (10 ml each). The plates are mixed gently, and
incubated at 37 for 5 h. After equilibration to RT for 10 min. Steady-
Glo luciferase (see Section 6.3) is prepared according to manufacturer’s
instructions, added (100 ml/well), and incubated at RT for 10 to 15 min
before reading luminescence on an appropriate plate reader with data
transfer system to determine percent of cAMP inhibition values.

2.5.3. Example results/data


Maraviroc at 1, 3, and 10 nM, caused a dose-dependent rightward shift of
the dose–response curve to MIP-1b, together with a marked suppression of
the maximum response, indicative of insurmountable antagonism (Fig. 2.7).
The maraviroc pKb is determined following an assumption of hemi-
equilibrium conditions, and a double reciprocal regression is then con-
structed, and the slope of the line is used to calculate the Kb. The pKb
CCR5 Primary Pharmacology Methods and Applications 33

150
Control
% Fitted max of control curve
1 nM UK-427, 857
100
3 nM UK-427, 857
10 nM UK-427, 857
50

0
−12 −11 −10 −9 −8 −7 −6

−50 Log10 [MIP-1b]M

Figure 2.7 Effect of maraviroc on MIP-1b dose^response curveDose^response in the


absence and presence of 1, 3, and 10 nM of former. Each data point represents the mean
of n ¼ 4 experiments. In each experiment, the mean of duplicate wells is calculated.

value of maraviroc is determined as 9.4 (95% confidence interval 9.01–


9.75). A more detailed description of analysis of this type has been compre-
hensively reported for CCR5 (Kenakin et al., 2006; Watson et al., 2005b).

3. CCR5-Associated Ligand-Binding Assays


The affinity of CCR5 ligands including antagonists with therapeutic
potential can be characterized in terms of their potency in a range of binding
assays, and also to examine relevant kinetic properties such as physical and
functional receptor dissociation rates. This can be used for compound
characterisation, or comparison in order to guide a synthetic program.

3.1. Radiolabeled CCR5 chemokine-binding assays


Radiolabeled cognate chemokine-binding assays to recombinant CCR5
(membranes and whole cells) has been extensively reported to a level of
detail that would enable straightforward setup in an independent laboratory.
Classic membrane-filter binding assays were originally developed and
reported by Combadiere et al. (1996), and described in detail to enable
the characterization of specific CCR5 antagonist such as maraviroc by Dorr
et al. (2005b) and Napier et al. (2005), and the bicyclics SCH-C and SCH-D
(vicriviroc) by Strizki et al. (2001, 2005) and Tagat et al. (2004). Modifica-
tion to enable homogenous assays using scintillation proximity assay tech-
nology for greater screening amenity has also been reported for the
characterization of aplaviroc (Watson et al., 2005b). These and signaling
assays have been applied across CCR5 isoforms in order to select
34 Roy Mansfield et al.

appropriate species to examine the mechanistic toxicology of CCR5


antagonists (Mosley et al., 2006; Napier et al., 2005).

3.2. Radiolabeled antagonist-binding


and -dissociation assays
Physical association and dissociation studies for maraviroc have been reported
in fine detail by Napier et al. (2005). These include competition studies where
excess unlabeled maraviroc is used to prevent reassociation of 3H-maraviroc
in ligand-binding experiments (either isolated membrane preparations or
intact recombinant CCR5-expressing cell lines). Data from such experi-
ments highlighted the slow physical dissociation of maraviroc (T1/2 ¼ 16 h;
see Napier et al., 2005)). This is a phenomenon that appears to be consistent
for CCR5 antagonists and no freely reversible antagonists have been reported
to date. Intriguingly, experiments that assess functional offset by gp120 offset
or chemokine on-set assays (Dorr et al., 2005a; Watson et al., 2005a) imply
even longer antagonist dissociation, or more strictly, receptor recovery. For
gp120 binding, this may be a consequence of this glycoprotein linking to
CCR5 clusters rather than single receptors for infection, and so antagonist
dissociation may be required from each CCR5 molecule prior to a gp120-
accepting formation can be adopted, or that antagonist dissociation is fol-
lowed by a period of CCR5 being in a nonfunctional conformation, or both.

3.3. Real-time ligand binding using Biacore technology


Biacore offers a technology platform that can monitor the binding of ligands
to receptors and monitor interactions based on induced changes in the
refractive index. This enables interactions to be monitored in real time,
rather than by sampling at time points, and avoid the use of radiolabeled
ligands.

3.3.1. Immobilization of 1D4 monoclonal antibody


on a CM4 surface
The monoclonal antibody 1D4 (see Section 6.3) is immobilized on a CM4
sensor chip using standard amine-coupling chemistry. HBS-N (10 mM
Hepes, 0.15 M NaCl, pH 7.4) is used as the running buffer. The carbox-
ymethyl dextran surface requires activation with a 12-min duration injection
of a 1:1 ratio of 0.4 M 1-ethyl-3-(3-dimethylaminopropyl) carbodimide
hydrochloride (EDC):0.1 M N-hydroxy succinimide (NHS). The antibody
is coupled to the surface with a 15-min injection of 1D4 diluted in 10 mM
sodium acetate (pH 5.0). Remaining activated groups are blocked with a
7-min injection of 1 M ethanolamine (pH 8.5). To obtain a 1D4 surface
density of approximately 12,000 RU, immobilization is performed at 30
using Biacore S51.
CCR5 Primary Pharmacology Methods and Applications 35

3.3.2. Ligand binding to receptors


CCR5 is solubilized as described previously (Navratilova et al., 2006) and
captured by 1D4 immobilized on surfaces within a CM4 chip at densities
equating to approximately 4000 RU (the running buffer consists of 50 mM
Hepes, pH 7.0, 150 mM NaCl, 0.02% (w/v) CHS, 0.1% (w/v) DOM, 0.1%
(w/v) CHAPS, and 50 nM DOPC/DOPS [7:3]). Small-molecule CCR5
compounds are dissolved in dimethyl sulfoxide (DMSO) and diluted into
50 mM HEPES (pH 7.0), 150 mM NaCl, 0.02% (w/v) CHS, 0.1% DOM,
0.1% CHAPS, and 50 nM DOPC/DOPS (7:3) to concentrations of 1 to
20 mM. These solutions are then serially diluted threefold in running buffer
to produce the concentration series for each inhibitor. The receptor surfaces
are stabilized by at least eight start-up buffer blanks before injecting a
compound. To reference for drift, two blank injections are performed
between analyte injections. Compounds are injected at a flow rate of
30 ml/min, and the association and dissociation phases are monitored for
1 and 10 min, respectively. The receptor surfaces are not regenerated
between analyte injections. Instead, the injections are performed from
lowest to highest concentrations and the data are normalized for the maxi-
mum binding capacity as described previously (Navratilova et al., 2006).

3.3.3. Example data and results


Antagonist binding to solubilized CCR5 is highlighted in Fig. 2.8. The
compounds are injected over freshly prepared CCR5 surfaces in increasing
concentrations. All binding responses are globally fitted with a 1:1 interac-
tion model that used a different maximum binding capacity (Rmax) for
each analyte injection and data are normalized for Rmax. The compounds
highlighted in Fig. 2.8 show their relative CCR5 affinities and physical
association and dissociation rates.

3.4. Real time HIV-1 gp120-CCR5 binding assay


CCR5 antagonists bind the receptor and stabilize a conformation that is
unable to bind the HIV-1 gp120-CD4 complex. The method detailed in
the following requires preparation of a crude gp120-containing extract to
enable an empiric assay for IC50 determination, although commercially
available sources of purified or semipurified gp120 also generate signals in
this assay albeit to a lesser extent (Rickett et al., 2003). The requirement for
gp120 preparations to enable a sufficiently high signal to noise in this assay
reduces the ability of the assay to resolve/differentiate compounds of IC50
potencies less than 20 nM. Other limitations are the empiric nature of the
screen and limited scope for kinetic validation. However, this assay is
amendable to high throughput screening, and has utility for scrutinizing
the molecular interaction for inhibitors of HIV-1 gp160-CCR5–mediated
36 Roy Mansfield et al.

120
100
Maraviroc
80 ka = 1.1 (±0.1) ⫻ 105 M−1s−1
60 kd = 6.0 (±0.2) ⫻ 10−4 s−1
40
KD = 25.0 (±4.0) ⫻ 10−9 M
20
0 t1/2 = 1165 s
Normalised response (% Rmax)

0 50 100 150 200 250 300


120
UK-438235−40
100
80 ka = 3.5 (±0.1) ⫻ 104 M−1s−1
60 kd = 7.1 (±0.1) ⫻ 10−4 s−1
40 KD = 2.0 (±0.1) ⫻ 10−8 M
20 t1/2 = 976 s
0
0 50 100 150 200 250 300
10
UK-107543 (agonist)
8
ka = 1.14(7)E + 06
6
kd = 0.27(2)
4
KD = 2.40(20)E − 07
2
t1/2 = 2.56721178
0
0 50 100 150 200 250
Time(s)

Figure 2.8 Profile of small molecule antagonist and agonist binding in Biacore.
Graphs highlighting association and dissociation of various CCR5 ligands as measured
by dynamic change in refractive index on Biacore.

cell–cell fusion (Fig. 2.9), which better resemble the HIV-1 entry process in
infection, and is now the favored screen for HTS (Dorr et al., 2003a), but
does not define the specific interaction blocked by inhibitory compounds.

3.4.1. Preparation and assay of soluble recombinant gp120


CHO cells stably transfected with the HIV-1 gp120 expression vector
pEE14.1 (see Section 6.3) are cultured in 200-ml roller bottles for 4 days,
which is replaced by 200 ml DMEM-S medium with 1% (w/v) FCS for
3 days prior to supernatant harvest for gp120 preparation. The cell super-
natant is concentrated by ultrafiltration and empirically quantified in the
assay described in the following using a Europium-labeled, anti–HIV-1
gp120 IgG antibody (see Section 6.3) in the time-resolved fluorescence
immunoassay (TRFIA).

3.4.2. Inhibition of soluble recombinant HIV-1 gp120 (Ba-L strain)


binding to CCR5 by TRFIA
This assay is performed as essentially as described by (Dobbs et al., 2001), and
is depicted in Fig. 2.9. HEK-293 cell aliquots (100 ml at 1  106 cells/ml)
are plated into poly-D-lysine–coated plates and incubated in a growth
incubator overnight. A 1:1 mix of soluble recombinant human CD4
(sCD4, diluted to 4.5 nM in culture medium; see Section 6.3) and HIV-1
CCR5 Primary Pharmacology Methods and Applications 37

gp120-sCD4-CCR5 binding gp160-CCR5 cell-cell fusion

Eu-cryptate gp160

CHO TAT
anti-gp120 TAT
CD4 CCR5
gp120 +
sCD4 Hela P4 b-Gal
b-Gal
CCR5

Figure 2.9 Cartoon depictions of gp120-sCD4-CCR5 binding and gp160-CCR5 cell^


cell fusion assays.

gp120 (e.g., Ba-L strain) are incubated at RT for 15 min before its addition
to PBS-washed cells, in the presence of dilutions of maraviroc to enable
IC50 determination. The assay plates are incubated at 37 for 1 h and washed.
Eu3þ labeled anti-gp120 antibody (1/500 dilution in assay buffer; see Section
6.3) is added to each well (50 ml) and incubated 1 h. The plate is washed three
times with assay buffer, prior to the addition of enhancement solution
(200 ml/well; see Section 6.3) and measurement of Eu3þ fluorescence. Non-
specific binding is taken as the fluorescence measured for gp120 incubated
with cells in the absence of preincubation with sCD4. The data can be used
to examine dose–response for compound-dependent inhibition of HIV
gp120-sCD4 complex binding to CCR5 as shown for maraviroc in Fig. 2.10.

3.5. Application of gp120 binding to characterize functional


occupancy in vitro
CCR5 antagonists have slow physical dissociation from the receptor, as
measured using radiolabeled antagonist competition assay. To investigate
the more clinically relevant endpoint of dynamic compound stabilization of
HIV-1 ‘‘unrecognizable’’ conformation (i.e., time required for receptor to
become amenable for HIV-gp120 binding following antagonist onset),
a wash-and-chase modification of the gp120 assay can be undertaken.
This also offers the advantage of cross-compound comparisons, without
the need for custom radiolabeling of each antagonist. The methodology
is essentially the same, except that the following a 30min period of antago-
nist association (period in excess of the tritiated antagonist binding to a
steady-state signal (various compounds, data not shown), the assay plates
38 Roy Mansfield et al.

100
90
80
70
60
% Inhibition

50 Fusion
gp120
40
30
20
10
0
0.001 0.01 0.1 1 10 100 1000
[Maraviroc] (nM)

Figure 2.10 Dose^response curves for maraviroc-dependent inhibition of gp120-


sCD4 binding to CCR5, and gp160-CCR5 cell^cell fusion maraviroc-dependent
inhibition of gp120 binding to CCR5 (red) and gp160-CCR5^mediated cell^cell fusion
(black).

containing confluent, nonexpanding cell populations are washed three


times in PBS to remove all exogenous antagonist, incubated for a set period
(e.g., overnight), prior to completion of the assay for IC50 determination.
The assay is run without the wash step, where exogenous antagonist is
present throughout the assay in parallel. Control studies (unpublished) have
shown that the wash-and-chase steps do not alter compound potency per se.
The IC50 ratio for gp120-binding inhibition for assays run under non-wash
versus wash-and-chase gives an indication of the functional occupancy of a
given antagonist (as exemplified for PF-232798 in Fig. 2.11), and enable
comparisons of different antagonists as previously reported (Dorr et al.,
2005a, 2008).

4. Surrogate In Vitro Antiviral Assays


The role of CCR5 as a coreceptor important in antiviral drug discov-
ery has led to de novo assay developments that are of a bespoke nature. The
novelty of CCR5 as an antiviral target has also led to the development of
new surrogate antiviral assays, and modifications of infectious virus-based
antiviral assays. These are described in the following in no particular order.

4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay


A high-throughput fully automated HIV-1 envelope or gp160-CCR5–
dependent cell–cell fusion assay (fusion assay) has been previously reported
in detail, and shown to be highly predictive of antiviral activity, with a
CCR5 Primary Pharmacology Methods and Applications 39

120

% Inhibition gp120-sCD4 binding


100

80

60

40
No wash
20 Wash and chase

0
0.1 1 10 100 1000 10000
[PF-232798] (nM)

Figure 2.11 Functional offset of PF-232798 from CCR5 as measured by a wash-and-


chase gp120-sCD4^binding assay. Dose^response curves for PF-232798^dependent inhi-
bition of gp120-sCD4 binding to CCR5 in the presence of exogenous dosed antagonist
(no wash) and when removed and incubated for 24 h (wash and chase).

greater correlation to antagonist potency in primary cell-based antiviral


assays (deemed the most reliable predictor of efficacy in humans from a
pharmacology perspective), than either the chemokine or gp120-binding
assays (Bradley et al., 2004; Dorr et al., 2003a). This has enabled extensive
screening for CCR5 ligands (and inhibitors against other cell-entry–asso-
ciated targets), without the need to use hazardous systems such as infectious
HIV preparations or radioligands. The fusion assay is depicted in Fig. 2.9,
and requires functional complete viral envelope protein gp160, which is
naturally processed into two linked subunits, gp120 and gp41. To enable
quantitative evaluation of the process, the HeLaP4 cells express a b-galac-
tosidase reporter gene under the control of HIV-1-LTR, while the gp160-
expressing CHO cells also expressed the HIV-1 transcriptional activator
Tat. Fusion between the two cell lines allows soluble Tat from the CHO-
gp160 cells to transactivate the HIV-1 LTR present in the HeLaP4, leading
to the expression of b-galactosidase. The level of b-galactosidase is deter-
mined using the fluorogenic substrate 4-methylumbelliferyl-galactopyrano-
side (MUG). b-galactosidase cleaves MUG to generate fluorescent
4-methylumbelliferone. Inhibition of cell–cell fusion reduces fluorescent
signal levels in this assay relative to mock-treated controls, to enable dose–
response evaluation (see Fig. 2.10). The methods and application of this
method have been described in fine detail (Bradley et al., 2004) and are not
included here for the sake of brevity. This assay can also be modified to
become a direct antiviral assay by supplanting the CHO cell line with
CCR5-tropic whole HIV virus (predetermined titer). However, correla-
tion studies with antiviral activity of CCR5 antagonists in primary
40 Roy Mansfield et al.

cell–based assays with infectious virus show no advantage in the use of virus
versus CHO cells in this reporter assay (unpublished data, Pfizer GRD),
highlighting the advantage of the cell–cell fusion system in terms of safety
and assay amenability.

4.2. Antiviral assays


A range of antiviral assays have been used to profile CCR5 antagonists
ranging from systems using ex vivo native cells, through to proprietary high
throughput recombinant systems as described in detail by Petropoulos et al.
(2000), which are commercially available for compound screening (Pheno-
SenseTM assay) or for determination of HIV coreceptor usage (i.e., tropism)
of patient HIV samples (TrofileTM assay). The details of these assays are not
described here in light of their proprietary nature. The principles of their use
and general methodologies in the field of CCR5 research are outlined in
Dorr et al. (2005b) and Westby et al. (2007). In light of the notorious
difficulty yet high importance in establishing cross-laboratory consistency
with native cell–based antiviral assays, and their general utility in establishing
target exposure levels in patients for dose setting in clinical trials, fine details
in these methods are described.

4.2.1. CCR5-associated primary cell–based antiviral assays:


Peripheral blood lymphocytes and monocyte-derived
macrophages HIV-1 replicative systems
Cell preparation: Peripheral blood lymphocytes Peripheral blood lym-
phocytes (PBLs) are typically prepared in convenient batch sizes using buffy
coats from individual donors or combined from two to four HIV- and
HBV-seronegative donors. Each buffy coat is diluted in an equal volume of
PBS and mixed. From this, 30 ml is layered onto 20 ml of Ficoll-Paque in
50 ml centrifuge tubes, followed by centrifugation for 30 min at 1000g at
RT. The PBLs are harvested at the Ficoll–plasma interface. The PBLs are
washed twice in PBS by centrifugation for 10 min at 500g at 4 . Con-
taminating erythrocytes are lysed by adding 9 ml sterile water, stored at 4 ,
to the resuspended PBL pellet, followed immediately by 1 ml of RT 10 
Hanks Buffered Saline. PBS is added to a final volume of 45 ml and the
PBLs are pelleted by centrifugation for 10 min at 100g at 4 . The pellet
is washed twice more in PBS at 4 prior to resuspension and pooling of
pellets from other tubes in 30 ml RPMI cell culture medium at RT. Cells
can be pooled, and if required, frozen (liquid nitrogen storage) from
individual donors at this stage. Cell viability is determined, such as by trypan
blue exclusion. Only cell suspensions showing greater than 95% viability
are typically used in antiviral assays. The cell suspensions are adjusted to
1  106 cells/ml by the addition of fresh RT RPMI cell culture medium
containing 1.5 mg/ml phytohemaglutinin (PHA) to enable enhanced
CCR5 Primary Pharmacology Methods and Applications 41

CCR5 expression to facilitate viral entry, aliquoted into 50 ml cultures and


incubated for 3 days in a growth incubator, prior to counting for viral
expansion or antiviral assays.

Cell preparation: Monocyte-derived macrophages Harvested buffy coats


(single donors) are diluted with an equal volume of DPBS and layered in
30-ml aliquots onto an Accuspin tube prior to centrifugation for 30 min at
RT (1000g). Harvested monocyte-derived macrophages (MDMs) are
washed three times in approximately 50 ml PBS and centrifuged for 10 min
at 750g prior to resuspension in RPMI growth medium. Monocytes are
adjusted to 1.0  105/well (200 ml) in a 96-well plate and incubated in a
growth incubator for 1 h (to enable MDM-selective adhesion). The super-
natant is discarded from the cells, and plates are washed twice with 200 ml RT
PBS, prior to addition of fresh cell culture medium (200 ml) and incubated for
7 days prior to antiviral assay in a growth incubator.

Antiviral assay: PBL cultures PBLs are infected for 1 h at 37 with a
predetermined volume of virus calculated to give an equal amount of
HIV-1 reverse transcriptase (RT) activity per virus stock. Infected cells
are washed and added to assay plates (e.g., 7.2  104 cells/well [200 ml]
for a 96-well plate) containing serial dilutions of test compounds (in RPMI
culture medium and DMSO 0.1% (v/v) FAC). After 5 to 7 days of
incubation, the cultures are examined visually with a microscope for evi-
dence of cytotoxicity and viral replication and compound-dependent inhi-
bition is quantified by measuring RT activity (see the following).

Antiviral assay: MDM cultures MDMs are used after 7 days in culture (to
enable full differentiation). The supernatant is replaced with 50 ml of either
compound preparation or vehicle (RPMI medium containing DMSO at
0.1% (v/v) FAC). Cells are transferred to a growth incubator for 1 h, and
then 50 ml of pretiter virus stock (see the following) is added prior to return
to the incubator for 3 h. Following removal of medium, plates are washed
five times using 200 ml of RT PBS per well prior to readdition of test
compounds and vehicle at 2  FAC equivalent. A further 50 ml of cell
culture medium are added to all wells and plates transferred to a growth
incubator for 7 days. After this period, culture supernatant is harvested from
the assay plates and tested directly in the HIV-1 RT detection assay as a
surrogate of HIV-1 replication for compound susceptibility profiling and
quantification (i.e., IC50 and IC90).

Reverse transcriptase assay RT activity is quantified in culture super-


natants using and appropriate assay kit such as the Quan-T-RT assay (see
Section 6.3) (Amersham Pharmacia Biotech). Assay reagent sufficient for
the whole assay is prepared based on the following reagent volumes
42 Roy Mansfield et al.

per well: 50ml H2O; 19 ml assay buffer; 10 ml primer/template bead/scintil-


lant complex, and 1 ml [3H]TTP. The mixture is vortexed to ensure full
suspension of the beads, and 80 ml are transferred to each well of a 96-well
Isoplate, to which 20 ml culture supernatant or standard is added and mixed
by pipetting. The plate is sealed and incubated at 37 for 1 h in a growth
incubator to allow incorporation of the tritiated thymidine triphosphate
into the primer/template by the virus RT enzyme. The reaction is termi-
nated with the addition of the supplied stop solution (EDTA) containing 1%
(w/v) SDS) to inactivate HIV-1. Light emission (SPA bead-driven from kit)
is measured in a scintillation counter (results recorded as cpm). Samples are
considered positive for virus if the cpm value is fourfold greater than that of
the uninfected cell control. An RT standard curve (Quant-T kit; see
Section 6.3) ranging from 0 to 10 mU/ml is prepared in culture medium
and treated in the same manner as the test material.

Expansion and storage of HIV-1 stocks HIV-1 isolates (laboratory and


primary origin; see Section 6.3) can progress through a typical methodology
as follows to supply virus of sufficient titer for antiviral assay: Typically, an
aliquot (0.5 ml) of isolate sample is added to a 15-ml conical centrifuge tube,
prior to the addition of 1.0  107 PBLs, in RT RPMI growth medium.
Following incubation for 1 h in a growth incubator, the infected cells are
pelleted by centrifugation at 225g for 10 min, and resuspended in a small
volume of RPMI medium at RT. The resuspended cells are transferred to a
T75 tissue culture flask and diluted up to a final volume up to 50 ml with
RPMI growth medium containing IL-2 (enhances proliferation and CCR5
expression) at 10 ng/ml. The cells are reincubated for 3 to 4 days. After this,
25 ml of the spent medium is removed and replaced with 30 ml fresh
growth medium containing IL-2 (10 ng/ml). Following, 3 4 days incuba-
tion as before, 20 ml of the supernatant is assayed for reverse transcriptase
(RT) activity for evidence of replication as described above. Counts above
2000 cpm are deemed sufficiently high to enable CCR5 antagonist antiviral
testing. Supernatants with counts less than 2000 cpm/20 ml supernatant in
the RT assay are typically further expanded by replacement of half the
culture medium with fresh, and addition of a further 1  107 PBL cells, with
a further 3- to 4-day incubation and RT assay until counts of more than
2000 cpm are achieved.

HIV-1 resistance to CCR5 antagonists This has become a rapidly growing


research field that cannot be detailed to the level as for more direct CCR5
pharmacology- and virology-associated methodologies. However, this
important preclinical and clinical field has been included in a recent review
with citations of key methodologies and applications included (Dorr
and Perros, 2008). The methodology for viral passage for generating
CCR5 Primary Pharmacology Methods and Applications 43

120

100

80 MVC plus MVC Res


CC185
% Inhibition

60 MVC plus start CC185

40 PF-232798 plus start


CC185
20 PF-232798 plus MVC
Res CC185
0

−20
1.0E-11 1.0E-10 1.0E-09 1.0E-08 1.0E-07
[Antagonist] (M)

Figure 2.12 Antiviral dose^response curves highlighting activity of PF-232798 against


laboratory-generated MVCRES HIV-1 isolate CC1/85. All data points are from parallel
PBL cultures using RT activity as measurement of HIV-1 replication. Inhibition is
measured versus vehicle-dosed control cultures. MVC retained expected activity against
passaged control start cultures of HIV-1 isolate CC1/85 (blue line and data points), and is
inactive against MVC-passaged isolate (red line and data points). PF-232798 shows reten-
tion of activity against both passaged isolates (green and pink lines and data points).
Graphs highlighting association and dissociation of various CCR5 ligands as measured
by dynamic change in refractive index on Biacore.

laboratory-resistant CCR5 antagonist HIV strains and examining cross-


resistance has been extensively detailed and exemplified (Westby et al., 2007).

Example results and data Figure 2.12 shows the dose–response curves for
CCR5 antagonist profiling in PBL-based antiviral assays, using a laboratory-
generated maraviroc-resistant (MVCRES) isolate generated by long-term
serial passage in gradually increasing maraviroc concentrations (Dorr et al.,
2008; Westby et al., 2007). This has been used to show the potential of
second-generation CCR5 antagonists to retain activity against laboratory
generated MVCRES isolates (see Fig. 2.12).

5. CCR5 Site-Directed Mutagenesis and Ligand


Docking Studies
The techniques for visualizing ligand-GPCR interactions are signifi-
cantly hampered by the insolubility of the receptors, and the associated
difficulties involved in crystal formation for x-ray diffraction. To investigate
the molecular interactions between CCR5 antagonists and specific amino
44 Roy Mansfield et al.

acids of the CCR5 receptor, and to support a computer-assisted docking


model of maraviroc and other CCR5 antagonists into the presumed binding
pocket, a CCR5 site-directed mutagenesis–based approach can be used.
By homology modeling with bovine rhodospin, a structurally characterized
GPCR (Palczewski et al., 2000), amino acid residues that are presumed to
form the CCR5 equivalent of the retinol-binding pocket of bovine rho-
dopsin can be identified. This region of the CCR5 receptor has been widely
identified as the binding site for CCR5 antagonists and numerous models
reported, including an excellent cross-template study (Kondru et al., 2008).
Although all such studies have been retrospective (i.e., visual models gen-
erated following antagonist design and established SARs), the structural
information has highlighted receptor–ligand interactions that might be the
driving various SARs observed. The example cited here shows the use of
structural information on the CCR5 program and various antagonists, and
specifically its application to rationalize the SAR associated with crossand
nonoverlapping activity against laboratory generated MVCRES virus (strain
CC1/85). This strain, in common with all HIV-1 isolates that eventually
acquire resistance to maraviroc following in vitro passage or prolonged
clinical exposure, gains cell entry through maraviroc-occupied CCR5
rather than via CXCR4 (Dorr and Perros, 2008; Westby et al., 2004, 2007).

5.1. Structural model generation


Following site-directed mutagenesis of selected residues in CCR5 the inter-
action of antagonists with a selected residue can be determined in terms of
change in functional affinity. For this, the EC50 of chemokine (e.g.,
MIP-1b)-induced signaling is determined, and compared to that measured
for wildtype receptor. For this, expression plasmids encoding the CCR5
isoforms can be individually cotransfected into HEK cells in combination
with a plasmid encoding a CRE-dependent luciferase reporter gene.
Following elevation of intracellular cAMP levels by exposure to forskolin
(a nonspecific activator of adenylate cyclase), CCR5 signaling is subsequently
measured by MIP-1b–induced agonism of the receptor, which reduces of
intracellular cAMP levels due to CCR5 Gi protein coupling. Intracellular
levels of cAMP can be assessed following luciferase expression as a result of
cAMP-dependent induction of the cre-luc reporter plasmid. Antagonist-
dependent inhibition of MIP-1b–induced signaling of each CCR5 isoform is
thus enabled through IC50 measurement. The change in IC50 values for each
mutant can be compared to wildtype to gain insight into which residues in the
putative binding pocket formed an interaction with a given antagonist. The
very general rule is that interaction is proportional to the loss in IC50 against
the mutated residue as compared to wildtype. The MIP-1b–dependent
reduction of cAMP levels is deemed to be a consequence of CCR5 signaling,
in light of this chemokine being a highly specific cognate ligand for this
CCR5 Primary Pharmacology Methods and Applications 45

receptor, and the absence of such signaling being seen in the absence of
recombinant receptor, and complete inhibition seen at high doses of applied
CCR5 antagonist. Computer-assisted docking using this ‘‘IC50-shift’’
parameter of antagonists requires an initial dock of a test compound of
known crystal structure and rigidity, with following docks of test compounds
thereafter. Site directed mutagenesis studies as reported here run against this
compound resulted in a loss in potency for the Y108A and E283A mutants.
This enabled an overlay and subsequent docking of other CCR5 antagonists
such as maraviroc, vicriviroc, and PF-232798 into the modeled putative
binding pocket of CCR5 using a Pfizer software package (FLOPS, Flexes
Ligands Optimizing Property Similarity). Similar packages are reported with
this type of utility (Kondru et al., 2008; Tsamis et al., 2003b).

5.2. CCR5 site-directed mutagenesis


Mutant CCR5 isoforms made de novo or sourced directly are cloned into an
appropriate expression plasmid, such as pIRESneo (see Section 6.3 section).
For de novo mutations and the desired mutation (e.g., glutamic acid 283,
alanine (E283A)) is constructed using polymerase chain reaction (PCR)–
based site directed mutagenesis methodology with the wildtype CCR5en-
coding pIRESneo plasmid as the substrate DNA source, and mutant-specific
primer pairs for E283A. The PCR is run according to a manufacturer’s
instructions (e.g., Quikchange mutagenesis kit; see Section 6.3). Parent
template wildtype CCR5 DNA is removed by digestion using methylase-
dependent Dpn-1 endonuclease (part of Quikchange kit), leaving amplified
mutant CCR5. The retained DNA preparations containing the CCR5 point
mutations are transformed into XL-1 blue supercompetent E. coli (according
to associated kit instructions) and incubated overnight on plates containing
LB agar supplemented with 100 mg/ml ampicillin at 37 . Resulting colonies
are expanded (e.g., 5 ml cultures of LB broth containing 100 mg/ml ampicil-
lin at 37 overnight). Plasmid DNA is purified from the E. coli cultures using a
Miniprep kit (see Section 6.3) according to the manufacturer’s protocol and
the insert verified using restriction digest with EcoRV. Cultures associated
with the expected restriction pattern are replated. Confirmed sequence-
validated clones are bulked up (e.g., 200 ml culture), DNA extracted, and
quantified by UV spectroscopy (using maxi prep kit; see Section 6.3) for
large-scale plasmid purification and HEK cell transfection.

5.3. Transfection of HEK Ga15 cells with pIRESneo-CCR5


(various isoforms) and pCRE-luc
This method is a modification of the CRE-luc assay described above, with
the following modifications: Solution 1 contains 7.5 mg CCR5 construct,
2.5 mg pCRE-luc reporter plasmid (see Section 6.3), 45 ml lipofectamine
46 Roy Mansfield et al.

plus reagent, and 800 ml optimem (see Section 6.3). Solution 2 contains
22.5 ml lipofectamine and 800 ml optimem. Transfected cells are washed
with prewarmed (37 ) optimem (10 ml) and growth media (20 ml) prior to
incubation overnight in a growth incubator and trypsin-EDTA treatment
(1 ml supplied reagent; see Section 6.3) incubation for 2 min at RT, media
resuspension, to 3  105 viable cells/ml. Cells are plated at 90 ml/well in
96-well, white opaque plates, incubated overnight prior to functional
(CRE-luc) assay.

5.4. CRE-Luc reporter assay


The CCR5-associated CRE-luc assay was described above. This can be
undertaken for mutants versus wildtype to measure the effect of the muta-
tion on the IC50 value. Loss in potency is implicated with a loss in binding at
the mutation site. The docking pattern is computed accordingly.

5.5. Example results/data


The data from such studies enable overlays of various antagonists based on
an initial dock into CCR5, and can be validated using functional inhibition
studies comparing compound potency for mutated versus wildtype recep-
tor. This is exemplified in Fig. 2.13A where maraviroc and analogues in the
monocyclic tropane series show an inhibitory potency loss against CCR5
signaling following Y108A and E283A mutation. The resultant docks
respectably show the hydrophobic and ionic interactions at these residues
by the phenyl and amine moieties of maraviroc. Similar interactions are seen
with the tropane antagonist PF-232798 (Fig. 2.13B). A dock of the bis-
piperidine (i.e., bicyclic) CCR5 antagonist SCH-C is shows no equivalent
interaction with Y108 (Fig. 2.13c), consistent with previous reports, high-
lighting this residue to be relatively unimportant in enabling interaction
with CCR5 (Tsamis et al., 2003a). Comparative docks with other templates
within the tropane series of CCR5 antagonists can be made to highlight
differential occupation potentially underpinning the SAR required to
enable activity against the laboratory generated MVCRES HIV-1 CC1/85,
which has evolved resistance through multiple envelope mutation to enable
entry via maraviroc-occupied CCR5 (Westby et al., 2004, 2007). The
overlays highlight the additional spatial occupation by the imidazopiper-
idine group of PF-232798 (and UK-484900; see Table 2.1) around the
ECL2 region, which is believed to stabilize CCR5 in a conformation that
MVCRES HIV-1 CC1/85 cannot bind. This represents highly specific
SAR, as close-in analogue benzimidazole tropanes such as UK-396794
and UK-438235 (see Table 2.1 and Fig. 2.13D) are inactive against
MVCRES HIV-1 CC1/85 (Dorr et al., 2005a; Dorr and Perros, 2008;
Westby et al., 2005).
CCR5 Primary Pharmacology Methods and Applications 47

ECL2

E283

Y108

B C
E283 E283

Y108
Y108

E283

Y108

UK-433370 UK-396794 PF-232798


(cyclopropyl-triazole): (benzimidazole): (imidazopiperidine)
inactive against inactive against active against
MVCRES HIV-1 CC185 MVCRES HIV-1 CC185 MVCRES HIV-1 CC185

Figure 2.13 Computer-assisted docks of CCR5 antagonists and HIV resistance SAR.
Computer-modeled docking of maraviroc (green) into the transmembrane pocket of
CCR5, highlighting hydrophobic interaction between the maraviroc phenyl moiety
with the tyrosine (Y) 108, and the ionic interaction between the tropane basic amine
and the glutamic acid (E) 283 (A). Overlaps between maraviroc and PF-232798 (purple)
and the bicyclic CCR5 antagonist SCH-C (yellow) are highlighted in (B) and (C),
respectively. The extracellular loop 2 (ECL2) hinge region of CCR5 is highlighted.
SAR associated with antiviral activity of CCR5 antagonists in the tropane series against
laboratory-generated MVCRES HIV-1 CC185, with the requirement of differential occu-
pancy at the ECL2 hinge region (specifically achieved by the imidazopiperidine substit-
uent) highlighted, is shown in (D). Maraviroc is depicted in green and test compounds
are depicted in purple. Full structures of compounds are shown inTable 2.1.
48 Roy Mansfield et al.

6. Non-HIV Indications–Associated Studies,


Human CCR5 Knock-In Mice
CCR5 is a chemokine receptor, and has subsequently been investi-
gated as a potential target against a wide range of predominantly inflamma-
tory disorders. Such studies have been driven by expression studies in
disease states and pharmacogenomic data highlighting positive, negative,
or neutral correlation with diseases. Animal models using CCR5 ligands
have also inferred association of CCR5 antagonism with efficacy against
various disorders. Reviews on the potential of CCR5 antagonist for treat-
ment of non-HIV diseases include Turner et al. (2007) and Wells et al.
(2006). Preclinical evaluation of the utility of CCR5 antagonists against
non-HIV diseases would be greatly facilitated by a highly potent and
selective murine CCR5 antagonist. Unfortunately, no such tool has been
reported, and compounds in current clinical HIV programs are highly
selective for primate isoforms, and are devoid of activity against rodent
species CCR5. To this end, a human CCR5 knock-in mouse has been
constructed, where the human ORF supplants the murine ORF to ensure
expression, and physiological role is as analogous to wildtype as possible.
This, together with the identification of UK-484900 as a highly potent and
selective human CCR5 antagonist with equivalent primary and selectivity
pharmacology to maraviroc, coupled a PK profile (and dosing regime) in
mice that ensures free compound exposure to be equivalent to maraviroc as
seen in HIV-1 associated clinical practice (i.e., 100% functional CCR5
blockade), and has enabled a model for studying antagonist efficacy in
various murine disease models (Dorr, 2008). Further validation has shown
that hCCR5 is activated by murine chemokines (same EC50 as for human
chemokines), and this is inhibited by hCCR5 antagonists. This validation of
the model and utility in non-HIV diseases has recently been reported by
(Dorr, 2008).

6.1. Vector construction for hCCR5 knock-in


To generate a knock-in CCR5 mouse model, homologous recombination
is used to replace the murine CCR5 gene with its human orthologue. Only
the coding sequence of the human gene is inserted; thus the recombinant
locus retains all mouse CCR5 cis-regulatory sequences and is expected to
express the human CCR5 gene with the same cell specificity. The
neomycin-resistance cassette used for targeting into ES cells is flanked by
loxP sites and placed immediately after the stop codon (see Fig. 2.14).
Therefore, the only permanent alteration of the locus is a 34 bp loxP site
left after subsequent CRE-mediated recombination (Sauer and Henderson,
CCR5 Primary Pharmacology Methods and Applications 49

Stop
ATG

BamH1

Spe
Sca

Xbol

Not1
Kpn

3 kb Murine genomic DNA 3.5 kb Murine genomic DNA


Human CCR5 loxP Neomycin resistance loxP

Figure 2.14 CCR5 knock-in miceçtarget vector. Neomycin resistance cassette used
for targeting into ES cells by homologous recombination with murine orthologue^
flanking regions (in situ) for human CCR5 (ORF-only) knock-in mice generation.The
selection, excision, and marker restriction sites are shown.

1988). To achieve the seamless insertion of the human coding sequence into
the mouse locus, the 50 arm of the targeting vector is constructed by
overlapping PCR. The reverse oligo used to amplify the 3 kb of the murine
genomic sequence upstream of the ATG includes 10 bp of the human
coding sequence (Table 2.3). Likewise, the forward oligo used to amplify
the human cDNA incorporated 30 bp of mouse genomic sequence at its 50
end, while the reverse primer contains a BamH1 cloning site, the loxP
sequence, and stop codons. To complete the seamless junction at the ATG,
another PCR is performed, which uses these two products as template to
make a shorter product that bridges the mouse and human sequences. The
full-length 50 homology arm is then assembled using naturally occurring
restriction sites. The 30 homology arm is also made by PCR, using oligos
that included a second loxP site in the forward primer. The completed
homology arms are cloned into the pJNS2 vector containing PGK-
neomycin phosphotransferase for positive selection and the HSV thymidine
kinase gene for negative selection. All products should be sequenced to
ensure accuracy of the PCR.

6.2. Transfection and human CCR5 knock-in


mouse generation
The linearized targeting vector is electroporated into E14 129 ES cells
(Hooper et al., 1987). Targeted clones can be identified by Southern blot
using a 50 probe generated by PCR using oligos 585F/1521R and a 30 probe
is made using oligos 9570F/10524. Targeting the 50 is determined by
Sca1digestion (wt ¼ 6.5 kb, targeted ¼ 5.8 kb) and 30 targeting by Spe1
digestion (wt ¼ 11, targeted ¼ 7.5). Heterozygous animals carrying the
targeted human allele are bred to mice expressing Cre recombinase under
control of the E2A promoter (Lakso et al., 1996) to remove the neomycin-
resistance cassette, and then bred to homozygosity for the human CCR5,
with cell surface expression checked in target cells (e.g., splenocytes, PBLs,
etc.) using FACS technology as described above. These mice are available
from Pfizer-GRD and are used in various academic laboratories as tools to
investigate the potential of CCR5 antagonists to treat diverse inflammatory
diseases.
50 Roy Mansfield et al.

Table 2.3 Oligos used to build CCR5 KI vector

CCR5-10254R CATGATCTTCTTCATTCTCC
CCR5-9570F TCCTTGCATTTCACTCTAGC
CCR5-585F GGAACTTGAGAATATCATCC
CCR5-1521R GATTTGAAGGTAACAGAGCG
CCR5-Kpn1755F ATGGTACCATTGGTGTCTGGGATAAAGC
CCR5-Not9496R ATAAGAATGCGGCCGCTCCAGCATTCTGCAGATCCACC
CCR5-50 arm-R GATAATCCATCCTGCAAGAG CCTATGAATAAATAAAAGAC
hCCR5-50 F GTCTTTTATTTATTCATAGGCTCTTGCAGGATGGATTA
TCAAGTGTCAAGTCCAATCTATGAC
hCCR5-50 R TTGGATCCATAACTTCGTATAATGTATGCTATACGAA
GTTATTCATCATCACAAGCCCACAG
ATATTTCCTGCTCCCCAGTG
hCCR5 30 arm-F ATACTCGAGATAACTTCGTATAGCATACATTATACGAAGT
TATCCTGGTTGACTTTTGTGTATCACGTAG
hCCR5-690R CCTCTTCTTCTCATTTCG
muCCR5-4697-F CACTACTCATTCTTTCTGGC

6.3. Materials
Most materials described as reagents can be sourced from various commer-
cial suppliers. Bespoke materials (and their final preparation) used in the
methods are listed in the following against each method section number,
with associated supplier.
2.1. CCR5-associated Ca2þ signaling—Ca2þ flux buffer and assay
reagents: One bottle HANKS balanced salts powder (Sigma), 1.6 ml
of 1 M CaCl2 (Sigma), 10 ml of 1 M HEPES, pH 8 (Sigma, cat no.
H-0763), made up to 1 l with sterile water and adjusted to pH 7.4 with
hydrochloric acid (HCl). Calcium Plus Kit (Molecular Devices).
2.2. Receptor internalization signaling assay—Assay buffer: RPMI
(10% FBS) (RPMI, Gibco Invitrogen Corporation), RANTES and
SDF-1a (R&D Systems, Becton Dickinson), FACScalibur (Cell Quest
Software). Mouse antihuman CCR5 monoclonal antibodies: 2D7
(Pharmingen). Isotype control antibodies: mouse IgG2a, (Pharmingen).
Secondary PE-labeled antibody: PE-labeled goat anti-mouse antibody
(Sigma). Sodium citrate CPT (4-ml draw) blood tubes (Becton Dick-
inson). Sample processing tubes (12  75-mm polystyrene round bot-
tomed) and caps (push fit) (Sarstedt Ltd). Reagents: MIP-1b working
solution (R & D systems, 100 nM MIP-1b) aliquots stored frozen at –
70 . CCR5 stabilizing solution (600 nM maraviroc in PBS), stabilizing
control solution (PBS), CCR5 MsIgG R-phycoerythrin 2D7 anti-
CCR5 antibody (Pharmingen) (PE-labeling by custom order).
CCR5 Primary Pharmacology Methods and Applications 51

2.4. GTP-associated CCR5 inverse agonism assay—Delfia GTP-


binding kit (Perkin Elmer). Assay buffer: 50 mM HEPES, pH 7.4,
containing 1 mM GDP, 10 mM MgCl2, 100 mM NaCl, and 100 mg/
ml saponin. MIP-1b (R & D Systems). Lysis buffer: 20 mM HEPES in
purified water, containing 1 mM CaCl2, one tablet COMPLETETM
protease inhibitors per 50-ml lysis buffer (BoehringerMannheim)
adjusted to pH 7.4 (2 M HCl).
2.5. CRE-luciferase (CRE-Luc) reporter gene assay—Steady Glo
Luciferase reagent (Promega). pCRE-luc, Pathdetect CRE cis report-
ing system (Stratagene). IBMX (Sigma). Human recombinant
MIP-1b (R&D Systems). Forskolin (Sigma).
3.3. Real-time ligand binding using Biacore technology—Biacore
2000 and S51 optical biosensors, CM4 sensor chips, and the amine-
coupling kit (Biacore AB). 1D4 antibody (University of British
Columbia). The human chemokine receptor CCR5 is overexpressed
in Cf2Th canine thymocyte cells as described previously (Mirzabekov
et al., 1999); the cells are propagated by the National Cell Culture
Center and contain a C-terminal linear C9 peptide tag (TETSQ-
VAPA) that is recognized by the 1D4 monoclonal antibody (Oprian
et al., 1987). Lipids (synthetic phospholipid blend [Dioleoyl] DOPC:
DOPS [7:3, w/w]), Mini-Extruder kit, and polycarbonate filters
(100 nm) (Avanti Polar Lipids).
3.4. HIV gp120 binding assay—pEE14.1 (Ba-L strain, Lonza Biolo-
gics). Human-soluble CD4 (Immunodiagnostics). Europium-labeled
anti–HIV-1 gp120 IgG antibody (AALTO). Enhancement solution
(EG&G Wallac). Wash buffer, Dulbecco’s PBS (Gibco).
4.2.1. CCR5-associated primary cell–based antiviral assays, periph-
eral blood lymphocytes (PBLs) and monocyte-derived
macrophages (MDMs) HIV-1 replicative systems—HIV-1 iso-
lates and strains and MT-2 cells: AIDS Reagent Project (NIBSC,
Potters Bar, Herts, UK). All antiviral drug susceptibility assays are
performed in RPMI 1640 medium, containing 10% v/v heat inacti-
vated FCS, 2 mM L-glutamine, and antibiotics (1 U/ml penicillin and
0.1 mg/ml streptomycin). Phytohaemagglutinin (PHA), 1.5 mg/ml
(Murex, Abbott Laboratories). Human recombinant interleukin-
2 (IL-2), 10 ng/ml (R&D Systems). QuanT RT kits (Amersham
Pharmacia Biotech).
5. CCR5 site-directed mutagenesis and ligand docking studies—
Plasmid pIRES neo (Clontech) pCRE-luc (Stratagene). Quikchange
Site-Directed Mutagenesis kit (Stratagene). EcoRV (R&D Systems).
QIAprep 8 Miniprep KitCat and QIAfilter Plasmid Maxi Kit (Qiagen).
One ShotÒ TOP10 chemically competent cells E. coli (Invitrogen).
HEK Ga15 cells (Aurora). HEK cell media: Dulbecco’s Modified Eagles
Medium (DMEM) supplemented with 10% fetal calf serum, 2 mM
52 Roy Mansfield et al.

L-glutamine, sodium pyruvate, HEPES, nonessential amino acids, and


blasticidin. DMEM (Dulbecco’s), with/without phenol red (Invitro-
gen). Blasticidin (Invitrogen R21001). OptiMEM 1 (Invitrogen). Lipo-
fectamine reagent (Invitrogen). Plus reagent (Invitrogen). Steady Glo
Luciferase reagent (Promega). pCRE-luc, Pathdetect CRE cis report-
ing system (Stratagene). IBMX (Sigma).
6. Non-HIV indications–associated studies, human CCR5
knock-in mice—Animals are housed in an AAALAC-accredited
facility and handled according to Pfizer global research guidelines
complying with the U.S. Public Health Service policy for the care
and use of laboratory animals. PCR is carried out using Expand High-
Fidelity polymerase (Roche, Laval, QC, Canada).

REFERENCES
Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G.,
Doms, R. W., Proudfoot, A., and Parmentier, M. (2003). The core domain of chemo-
kines binds CCR5 extracellular domains while their amino terminus interacts with the
transmembrane helix bundle. J. Biol. Chem. 278, 5179–5187. Epub 2002 Dec 3.
Bradley, J., Gill, J., Bertelli, F., Letafat, S., Corbau, R., Hayter, P., Harrison, P., Tee, A.,
Keighley, W., Perros, M., Ciaramella, G., Sewing, A., et al. (2004). Development and
automation of a 384-well cell fusion assay to identify inhibitors of CCR5/CD4-mediated
HIV virus entry. J. Biomol. Screen 9, 516–524.
Combadiere, C., Ahuja, S. K., Tiffany, H. L., and Murphy, P. M. (1996). Cloning and
functional expression of CC CKR5, a human monocyte CC chemokine receptor
selective for MIP-1(alpha), MIP-1(beta), and RANTES. J. Leukoc. Biol. 60, 147–152.
Dobbs, S., Perros, M., and Rickett, G. A. (2001). An assay method for determining whether
an agent is capable of mudlating the interaction of CCR5 with gp120.
Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug
Discovery 3, 1–16.
Dorr, P., Corbau, R., Pickford, C., Rickett, G., Macartney, M., Griffin, P., Dobbs, S.,
Irvine, R., Westby, M., and Perros, M. (2003). Evaluation of the mechanism underlying
the anti-HI activity of a series of experimental CCR5 antagonists. on. 43rd Annual
Interscience Conference Antimicrobial Agents and Chemotherapy. Sept 14-17 2003,
Poster, Chicago, F1466.
Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug
Discovery 3, 1345–1361.
Dorr, P., Rickett, G., and Perros, M. (2003). A method for identifying CCR5 receptor
antagonists by measuring residency time. Patent Ref. US20040023845 A1.
Dorr, P., Todd, K., Irvine, B., Robas, N., Thomas, A., Fidock, M., Sultan, H., Mills, J.,
Perrucio, F., Burt, C., Rickett, G., Perkins, H., et al. (2005a). Site-Directed Mutagenesis
Studies of CCR5 Reveal Differences in the Interactions between the Receptor and
Various CCR5 Antagonists. In ‘‘45th Interscience Conference on Antimicrobial Agents
and Chemotherapy,’’ Washington DC, USA.
Dorr, P., Westby, M., Dobbs, S., Griffin, P., Irvine, B., Macartney, M., Mori, J.,
Rickett, G., Smith-Burchnell, C., Napier, C., Webster, R., Armour, D., et al.
CCR5 Primary Pharmacology Methods and Applications 53

(2005b). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective small-


molecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human
immunodeficiency virus type 1 activity. Antimicrob. Agents Chemother. 49, 4721–4732.
Dorr, P., Westby, M., McFadyen, L., Mori, J., Davis, J., Perruccio, F., Jones, R.,
Stupple, P., Middleton, D., and Perros, M. (2008). PF-232798, a Second Generation
Oral CCR5 Antagonist. 15th Conference on Retroviruses and Opportunistic Infections,
pp. 3–6. Boston. (Boston). February, 2008. Abstract 737.
Dorr, P. (2008). Maraviroc outlook in HIV and non-HIV diseases. HIV-Infection
and Organ Transplantation Symposium University Medical Center Hamburg-Eppendorf
Hamburg, Germany.
Haworth, B., Lin, H., Fidock, M., Dorr, P., and Strange, P. G. (2007). Allosteric effects of
antagonists on signalling by the chemokine receptor CCR5. Biochem. Pharmacol. 74,
891–897. Epub 2007 Jun 26.
Hooper, M., Hardy, K., Handyside, A., Hunter, S., and Monk, M. (1987). HPRT-deficient
(Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells.
Nature 326, 292–295.
Jansson, C. C., Pohjanoksa, K., Lang, J., Wurster, S., Savola, J. M., and Scheinin, M. (1999).
Alpha2-adrenoceptor agonists stimulate high-affinity GTPase activity in a receptor
subtype-selective manner. Eur. J. Pharmacol. 374, 137–146.
Kenakin, T., Jenkinson, S., and Watson, C. (2006). Determining the potency and molecular
mechanism of action of insurmountable antagonists. J. Pharmacol. Exp. Ther. 319,
710–723. Epub 2006 Jul 20.
Kondru, R., Zhang, J., Ji, C., Mirzadegan, T., Rotstein, D., Sankuratri, S., and Dioszegi, M.
(2008). Molecular interactions of CCR5 with major classes of small-molecule anti-HIV
CCR5 antagonists. Mol. Pharmacol. 73, 789–800. Epub 2007 Dec 20.
Labrecque, J., Anastassov, V., Lau, G., Darkes, M., Mosi, R., and Fricker, S. P. (2005). The
development of an europium-GTP assay to quantitate chemokine antagonist interactions
for CXCR4 and CCR5. Assay Drug Dev. Technol. 3, 637–648.
Lakso, M., Pichel, J. G., Gorman, J. R., Sauer, B., Okamoto, Y., Lee, E., Alt, F. W., and
Westphal, H. (1996). Efficient in vivo manipulation of mouse genomic sequences at the
zygote stage. Proc. Natl. Acad. Sci. USA 93, 5860–5865.
Mirzabekov, T., Bannert, N., Farzan, M., Hofmann, W., Kolchinsky, P., Wu, L., Wyatt, R.,
and Sodroski, J. (1999). Enhanced expression, native purification, and characterization of
CCR5, a principal HIV-1 coreceptor. J. Biol. Chem. 274, 28745–28750.
Mosier, D. E., Picchio, G. R., Gulizia, R. J., Sabbe, R., Poignard, P., Picard, L.,
Offord, R. E., Thompson, D. A., and Wilken, J. (1999). Highly potent RANTES
analogues either prevent CCR5-using human immunodeficiency virus type 1 infection
in vivo or rapidly select for CXCR4-using variants. J. Virol. 73, 3544–3550.
Mosley, M., Pullen, S., Botham, A., Gray, A., Napier, C., Mansfield, R., and Holbrook, M.
(2006). The molecular cloning and functional expression of the dog CCR5. Vet Immunol.
Immunopathol. 113, 415–420. Epub 2006 Jun 27.
Mueller, A., Mahmoud, N. G., Goedecke, M. C., McKeating, J. A., and Strange, P. G.
(2002). Pharmacological characterization of the chemokine receptor, CCR5. Br. J.
Pharmacol. 135, 1033–1043.
Mueller, A., Mahmoud, N. G., and Strange, P. G. (2006). Diverse signalling by different
chemokines through the chemokine receptor CCR5. Biochem. Pharmacol. 72, 739–748.
Epub 2006 Jul 17.
Mueller, A., and Strange, P. G. (2004a). CCL3, acting via the chemokine receptor CCR5,
leads to independent activation of Janus kinase 2 ( JAK2) and Gi proteins. FEBS Lett.
570, 126–132.
Mueller, A., and Strange, P. G. (2004b). The chemokine receptor, CCR5. Int. J. Biochem.
Cell. Biol. 36, 35–38.
54 Roy Mansfield et al.

Napier, C., Sale, H., Mosley, M., Rickett, G., Dorr, P., Mansfield, R., and Holbrook, M.
(2005). Molecular cloning and radioligand binding characterization of the chemokine
receptor CCR5 from rhesus macaque and human. Biochem. Pharmacol. 71, 163–172.
Epub 2005 Nov. 18.
Navratilova, I., Dioszegi, M., and Myszka, D. G. (2006). Analyzing ligand and small
molecule binding activity of solubilized GPCRs using biosensor technology. Anal.
Biochem. 355, 132–139. Epub 2006 May 15.
Oprian, D. D., Molday, R. S., Kaufman, R. J., and Khorana, H. G. (1987). Expression of a
synthetic bovine rhodopsin gene in monkey kidney cells. Proc. Natl. Acad. Sci. USA 84,
8874–8878.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and
Miyano, M. (2000). Crystal structure of rhodopsin: A G. protein-coupled receptor.
Science 289, 739–745.
Peltonen, J. M., Pihlavisto, M., and Scheinin, M. (1998). Subtype-Specific Stimulation
of [S-35]Gtp-Gamma-S Binding by Recombinant Alpha(2)-Adrenoceptors. European
Journal of Pharmacology 355, 275–279.
Petropoulos, C. J., Parkin, N. T., Limoli, K. L., Lie, Y. S., Wrin, T., Huang, W., Tian, H.,
Smith, D., Winslow, G. A., Capon, D. J., and Whitcomb, J. M. (2000). A novel
phenotypic drug susceptibility assay for human immunodeficiency virus type 1.
Antimicrob. Agents Chemother. 44, 920–928.
Rickett, G., Dobbs, S., Griffin, P., Dorr, P., Hitchcock, C., and Perros, M. (2003).
Development of a high throughput time resolved immunoassay to support discovery of
HIV-1 entry inhibitors. 43rd Annual Interscience Conference on Antimicrobial Agents
and Chemotherapy, Abstract F-1461.
Sauer, B., and Henderson, N. (1988). Site-specific DNA recombination in mammalian cells
by the Cre recombinase of bacteriophage P1. Proc. Natl. Acad. Sci. USA 85, 5166–5170.
Strizki, J. M., Tremblay, C., Xu, S., Wojcik, L., Wagner, N., Gonsiorek, W.,
Hipkin, R. W., Chou, C. C., Pugliese-Sivo, C., Xiao, Y., Tagat, J. R., Cox, K., et al.
(2005). Discovery and characterization of vicriviroc (SCH 417690), a CCR5 antagonist
with potent activity against human immunodeficiency virus type 1. Antimicrob. Agents
Chemother. 49, 4911–4919.
Strizki, J. M., Xu, S., Wagner, N. E., Wojcik, L., Liu, J., Hou, Y., Endres, M., Palani, A.,
Shapiro, S., Clader, J. W., Greenlee, W. J., Tagat, J. R., et al. (2001). SCH-C (SCH
351125), an orally bioavailable, small molecule antagonist of the chemokine receptor
CCR5, is a potent inhibitor of HIV-1 infection in vitro and in vivo. Proc. Natl. Acad. Sci.
USA 98(22), pp. 12718–12723.
Tagat, J. R., McCombie, S. W., Nazareno, D., Labroli, M. A., Xiao, Y., Steensma, R. W.,
Strizki, J. M., Baroudy, B. M., Cox, K., Lachowicz, J., Varty, G., and Watkins, R.
(2004). Piperazine-based CCR5 antagonists as HIV-1 inhibitors. IV. Discovery of
1-[(4,6-dimethyl-5-pyrimidinyl)carbonyl]-4-[4-[2-methoxy-1(R)-4-(trifluoromethyl)
phenyl]ethyl-3(S)-methyl-1-piperaz inyl]-4-methylpiperidine (Sch-417690/Sch-D),
a potent, highly selective, and orally bioavailable CCR5 antagonist. J. Med. Chem. 47,
2405–2408.
Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A.,
Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003a).
Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-
351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry.
J. Virol. 77, 5201–5208.
Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A.,
Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003b).
Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-
CCR5 Primary Pharmacology Methods and Applications 55

351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry. J. Virol.
77, 5201–5208.
Turner, J. E., Steinmetz, O. M., Stahl, R. A., and Panzer, U. (2007). Targeting of
Th1-associated chemokine receptors CXCR3 and CCR5 as therapeutic strategy for
inflammatory diseases. Mini Rev. Med. Chem. 7, 1089–1096.
Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005a). The CCR5 receptor-
based mechanism of action of 873140, a potent allosteric noncompetitive HIV entry
inhibitor. Mol. Pharmacol. 67, 1268–1282.
Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005b). The CCR5 receptor-
based mechanism of action of 873140, a potent allosteric noncompetitive HIV entry
inhibitor. Mol. Pharmacol. 67, 1268–1282. Epub 2005 Jan. 11.
Wells, T. N., Power, C. A., Shaw, J. P., and Proudfoot, A. E. (2006). Chemokine blockers--
therapeutics in the making? Trends Pharmacol. Sci. 27, 41–47. Epub 2005 Nov. 28.
Westby, M., Smith-Burchnell, C., Hamilton, D., Robas, N., Irvine, B., Fidock, M., Mills, J.,
Perruccio, F., Mori, J., Macartney, M., Barber, C., Dorr, P., et al. (2005). UK-427,857-
resistant Primary Isolates are Susceptible to Structurally-related CCR5 Antagonists.
In ‘‘12th Conference on Retroviruses and Opportunistic Infections,’’ Boston, MA.
Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Mosley, M., Stockdale, M., Dorr, P.,
Ciaramella, G., and Perros, M. (2007). Reduced maximal inhibition in phenotypic
susceptibility assays indicates that viral strains resistant to the CCR5 antagonist maraviroc
utilize inhibitor-bound receptor for entry. J. Virol. 81, 2359–2371.
Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Whitcomb, J., Petropoulos, C., and
Perros, M. (2004). In vitro Escape of R5 Primary Isolates from the CCR5 Antagonist,
UK-427,857, is Difficult to Achieve and Involves Continued Use of the CCR5 Receptor.
In ‘‘XIII International HIV Drug Resistance Workshop,’’ Tenerife.
C H A P T E R T H R E E

CXCR4 and Mobilization of


Hematopoietic Precursors
Michael P. Rettig, Pablo Ramirez, Bruno Nervi, and
John F. DiPersio

Contents
1. Introduction 58
2. HSPC Mobilizing Agents that Target the CXCL12/CXCR4 Axis 59
3. Donor Selection for HSPC Mobilization 64
3.1. Selection of mice for HSPC mobilization 64
3.2. Selection of humans for HSPC mobilization 64
4. Flow Cytometric Enumeration of Mobilized HSPCs 65
4.1. Flow cytometric enumeration of murine HSPCs 65
4.2. Flow cytometric enumeration of human HSPCs 65
5. Dosing and Kinetics of HSPC Mobilization by G-CSF and Plerixafor 66
5.1. G-CSF 66
5.2. Plerixafor 67
6. Flow Cytometric Analysis of CXCR4 Expression on Human CD34þ
Subsets 69
6.1. Evaluation of cell surface CXCR4 on human CD34þ cell subsets 70
7. Functional Characterization of Mobilized HSPCs 73
7.1. In vitro assays of differentiation 73
7.2. Transmigration assays 73
7.3. Transplantation assays for mouse and human HSPCs 74
8. Concluding Remarks 80
Acknowledgment 80
References 80

Abstract
The binding of the chemokine [C-X-C motif ] ligand 12 (CXCL12 or stromal cell–
derived factor 1a [SDF-1a]) constitutively produced by bone marrow stromal
cells and osteoblasts, to the CXC receptor (CXCR) 4, a transmembrane chemo-
kine receptor expressed on hematopoietic stem and progenitor cells (HSPCs),

Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis,
Missouri, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05203-3 All rights reserved.

57
58 Michael P. Rettig et al.

has emerged as a key signal for HSPC trafficking to and from the bone marrow.
Disruption of CXCL12/CXCR4 signaling causes leukocytosis, with the release of
HSPCs, neutrophils, and lymphocytes into the peripheral blood. Although
mobilized peripheral blood has become the preferred source of stem cells for
both autologous and allogeneic transplantation, the optimum strategy for
obtaining mobilized products from donors is the subject of ongoing study.
Granulocyte colony–stimulating factor (G-CSF) and plerixafor (AMD3100) are
two agents used clinically to induce HSPC mobilization by disruption of the
CXCL12/CXCR4 interaction. This chapter describes current procedures used
to phenotypically and functionally characterize murine and human HSPCs
mobilized by G-CSF or plerixafor.

1. Introduction
The majority of hematopoietic stem and progenitor cells (HSPCs)
reside in the bone marrow in a highly organized microenvironment con-
sisting of marrow stromal cells, osteoblasts, osteoclasts, and other extracel-
lular matrix proteins (e.g., collagens, fibronectins, proteoglycans) (Adams
and Scadden, 2006; Kiger et al., 2000; Kollet et al., 2007; Wilson and
Trumpp, 2006; Xie and Spradling, 2000). HSPCs express a number of
cell surface molecules such as lymphocyte function–associated antigen-1
(LFA-1), very late antigen 4 (VLA-4), CXCR4, CXCR2, CD44, CD62L,
and CD117 (c-kit) that mediate their adherence in the bone marrow (BM)
microenvironment (Adams and Scadden, 2006; Lapidot et al., 2005; Wilson
and Trumpp, 2006). These interactions play important roles in regulating
HSPC trafficking, as well as self-renewal, proliferation, and differentiation
processes (Kiel and Morrison, 2008; Wilson and Trumpp, 2006).
Under normal conditions, a small number of HSPCs circulate in the
peripheral blood. However, the number of circulating HSPCs can be
increased 10- to 100-fold with administration of chemotherapy and/or
cytokines in a process termed ‘‘stem cell mobilization’’ (Bensinger et al.,
2009; Papayannopoulou and Scadden, 2008; Winkler and Levesque, 2006).
Mobilized HSPCs can be collected by large-volume apheresis techniques in
numbers sufficient for use in hematopoietic stem cell transplants, and upon
reinfusion, are capable of homing to the BM cavity and regenerating the full
array of hematopoietic lineages. Compared to BM, use of peripheral blood
stem cells in hematopoietic stem cell transplantation results in more rapid
hematologic reconstitution, reduced hospitalization costs, and avoids the
risks of general anesthesia and discomfort with a BM harvest (Group, 2005).
Because of these advantages, the use of mobilized HSPCs over marrow as a
stem cell source continues to increase such that greater than 95% of
CXCR4 and Mobilization 59

autologous transplants and 75% of allogeneic hematopoietic stem cell trans-


plants in adults are currently being performed with mobilized HSPCs
(Bensinger et al., 2009).
The optimal method for mobilization of HSPCs remains a subject of
investigation. Although various agents have been used to mobilize HSPCs,
only granulocyte colony-stimulating factor (G-CSF) (filgrastim,
NeupogenÒ , Amgen, Thousand Oaks, CA), granulocyte-macrophage
colony-stimulating factor (GM-CSF) (sargramostim, LeukineÒ , Bayer
Healthcare Pharmaceuticals, Seattle, WA), stem cell factor (ancestim,
StemgenÒ , Amgen, Thousand Oaks, CA, available in Canada and
New Zealand only), and plerixafor (Mozobil, AMD3100, Genzyme Cor-
poration, Cambridge, MA) are approved clinically for use in stem cell
mobilization (Bensinger et al., 2009). Currently, G-CSF is the most com-
monly used agent to induce HSPC mobilization. However, because opti-
mal mobilization requires from 4 to 6 days of G-CSF administration, donors
may experience significant inconvenience, including bone pain, fatigue,
headache, and nausea. Furthermore, while no long-term sequelae have
been confirmed with short-term G-CSF, there are reports of serious acute
toxicities related to its use as well as concerns that it can induce genetic and
epigenetic modifications in HSPCs (Hernandez et al., 2005; Nagler et al.,
2004; Shapira et al., 2003; Tigue et al., 2007). Accordingly, a less toxic,
more rapid, and yet efficient method for collection of HSPCs from donors is
still required and would represent a clear advance.

2. HSPC Mobilizing Agents that Target


the CXCL12/CXCR4 Axis
Targeted disruption of the interaction between CXCR4 and
CXCL12 has received considerable attention since it may provide a method
to efficiently and rapidly mobilize HSPCs from the BM into the periphery
as well as inhibiting the metastatic process and HIV-1 infection (Burger and
Peled, 2009; Grande et al., 2008; Khan et al., 2007; Uy et al., 2008).
CXCL12 is a chemokine constitutively produced at high levels in the BM
by stromal cells such as osteoblasts, endothelial cells, and a subset of reticular
cells (Calvi et al., 2003; Dar et al., 2005; Imai et al., 1999; Jung et al., 2006;
Ponomaryov et al., 2000). It is a potent chemoattractant for HSPCs and has
been shown to regulate cell adhesion, survival, and cell-cycle status (Peled
et al., 1999; Sugiyama et al., 2006; Watt and Forde, 2008). Interestingly,
CXCL12 gene polymorphism has been proposed as a conditional factor for
human CD34þ stem cell mobilization, with the presence of the SDF1-30 A
allele as a predictive factor of good CD34þ cell mobilization (Benboubker
60 Michael P. Rettig et al.

et al., 2001). More recently, a second receptor, CXCR7, was identified that
binds CXCL12 with an affinity that is approximately 10-fold higher than
the affinity for CXCR4 (Balabanian et al., 2005a; Burns et al., 2006).
Although the role of CXCR7 in CXCL12-dependent chemotaxis is not
fully understood, there is evidence that CXCR7 lacks intrinsic chemotactic
activity toward CXCL12, and functions instead by sequestering CXCL12
and modifying CXCR4 signaling (Boldajipour et al., 2008; Hartmann et al.,
2008; Sierro et al., 2007).
CXCR4 is a member of the large family of seven transmembrane
domain receptors coupled to heterotrimeric Gi proteins and functions as
a coreceptor for HIV-1 cell entry (Bleul et al., 1996; Feng et al., 1996;
Fredriksson et al., 2003; Loetscher et al., 1994; Oberlin et al., 1996). Both
CXCL12 (Bleul et al., 1996; Oberlin et al., 1996) and macrophage migrat-
ing inhibiting factor (MIF) (Bernhagen et al., 2007) are ligands for
CXCR4. The binding of CXCR4 to CXCL12 results in activation of
multiple signal transduction pathways ultimately triggering chemotaxis
(Busillo and Benovic, 2007; Kucia et al., 2004). Targeted disruption of
either CXCL12 or CXCR4 is lethal in mice, resulting in very similar
developmental defects, including the failure of HSPC migration from the
fetal liver to the BM, defects in lymphoid and myeloid hematopoiesis, and
cerebellar dysgenesis (Ma et al., 1998; Nagasawa et al., 1996; Tachibana
et al., 1998; Zou et al., 1998). Furthermore, wildtype mice transplanted
with CXCR4-deficient progenitor cells have high circulating levels of
HSPCs, indicating poor retention in the BM (Christopher et al., 2009;
Ma et al., 1999). Finally, multiple preclinical and clinical studies have
shown that pharmacologic interference in the axis between marrow-
derived CXCL12 and CXCR4 expressed on HSPCs using various
CXCR4 modulators, including antagonist, peptide agonist, and modified
CXCL12 analogues stimulate HSPC mobilization in a target-dependent
manner (Nervi et al., 2006; Pelus, 2008).
There are three potential mechanisms to explain how CXCR4 could
regulate HSPC mobilization: (1) downregulation of cell surface CXCR4 by
internalization or proteolysis, (2) disruption of the CXCL12 chemokine
gradient between the BM and plasma, and (3) receptor antagonism via
direct blocking of the CXCR4/CXCL12 interaction (Table 3.1).
Decreased expression of CXCR4 on mobilized HSPCs has been reported
following administration of G-CSF (Christopher et al., 2009; Dlubek
et al., 2006; Levesque et al., 2003; Oelschlaegel et al., 2007; Semerad et al.,
2005), a CXCL12 analogue (met-SDF-1b) (Shen et al., 2001; Yang et al.,
1999), and CXCL12-derived peptide agonists (CTCE-0021, CTCE-0214)
(Faber et al., 2007; Pelus et al., 2005; Zhong et al., 2004). Since native
CXCL12 itself downregulates CXCR4 expression but does not result
in significant mobilization (Haribabu et al., 1997; Orsini et al., 1999;
Table 3.1 CXCR4-mediated mobilization of murine HSPC

HSPC peak
Compound Class Mechanism Dose Route mobilization Reference
G-CSF Growth factor Granulocyte expansion/ 250 mg/kg/ SC Day 5 Molineux
activation, protease day x 5 days et al., 1990
release, and cleavage of
adhesion molecules,
downregulation of
CXCL12 in osteoblasts
Pegylated Growth factor Granulocyte expansion/ 25 mg SC Day 3 de Haan et al.,
G-CSF activation, protease 2000
release and cleavage
of adhesion molecules,
downregulation of
CXCL12 in osteoblasts
Plerixafor Bicyclam CXCR4 antagonist 5 mg/kg SC 3–6 h Broxmeyer
et al., 2005
3 mg/kg IV 1–3 h Ramirez
et al., 2008
T140 Peptide CXCR4 antagonist 5 mg/kg SC 1–2 h Abraham
et al., 2007
T134 Peptide CXCR4 antagonist 10 mg/kg SC 1h Iyer et al.,
2008
Met-SDF- CXCL12 analog CXCR4 agonist 300 mg IV 48 h Shen et al.,
1b 2001
(continued)
Table 3.1 (continued)

HSPC peak
Compound Class Mechanism Dose Route mobilization Reference
CTCE- CXCL12 peptide CXCR4 agonist 25 mg/kg SC 1h Pelus, et al.,
0021 analog 2005
CTCE- CXCL12 peptide CXCR4 agonist 75 mg IV 4h Zhong et al.,
0214 analog 2004
FucS Sulfated Disruption of CXCL12 100 mg/kg IV 1.5 h Sweeney
polysaccharide chemotactic gradient et al., 2002
G-CSF, granulocyte colony-stimulating factor; Met-SDF, N-terminal methionine stromal cell---derived factor; FucS, sulfated polysaccharide fucoidan; IV, intravenous;
SC, subcutaneous; n.d., not determined.
CXCR4 and Mobilization 63

Signoret et al., 1997, 1998), it is generally believed that a threshold level of


CXCR4 downregulation may be required for these agents to induce HSPC
mobilization (Busillo and Benovic, 2007; Kucia et al., 2004). Concerning
the second mechanism whereby CXCR4 could modulate HSPC mobiliza-
tion, studies have shown that disruption of the CXCL12 gradient between
the BM and the peripheral blood by the administration of sulfated poly-
saccharides (Sweeney et al., 2002) or adenovirus expressing CXCL12
(Hattori et al., 2001) results in an increase in circulating CXCL12 and
HSPC mobilization. More relevant physiologically, recent studies have
shown that a key step in G-CSF–induced HSPC mobilization is loss of
CXCL12 expression by osteoblasts in the BM (Christopher et al., 2009;
Katayama et al., 2006; Semerad et al., 2005). Since similar results were
observed following mobilization of mice with Flt3L or stem cell factor
(Christopher et al., 2009), this loss of osteoblast-produced CXCL12 may
represent a common pathway in cytokine-induced mobilization. Finally,
several CXCR4 antagonists have been described, of which plerixafor
(Broxmeyer et al., 2005; Liles et al., 2003; Uy et al., 2008), T140
(Abraham et al., 2007), and T134 (Iyer et al., 2008) have been shown to
rapidly mobilize HSPCs.
Additional evidence for the critical role that CXCR4 plays in leukocyte
trafficking has been obtained from patients with the genetic immunodefi-
ciency syndrome WHIM (warts, hypogammaglobulinemia, infections,
myelokathexis). WHIM syndrome is a rare congenital immunodeficiency
disorder characterized by susceptibility to human papilloma virus infection-
induced warts, B-cell lymphopenia and hypogammaglobulinemia, chronic
noncyclic neutropenia, and BM myeloid hyperplasia with apoptosis (Gorlin
et al., 2000; Gulino, 2003). Most cases of WHIM syndrome have been
linked to autosomal dominant mutations in CXCR4, all of which truncate
the C-terminal tail of CXCR4 (Balabanian et al., 2005b; Gulino et al., 2004;
Hernandez et al., 2003). Multiple studies have demonstrated that loss of the
intracellular tail of CXCR4 prevents its internalization and desensitization in
response to CXCL12 (Balabanian et al., 2005b; Gulino et al., 2004; Kawai
et al., 2005). This loss of homologous desensitization leads to long-lasting
activation of G-proteins and sustained functional activity of the chemokine
receptor as evidenced by increased chemotaxis to CXCL12, F-actin polymer-
ization, intracellular calcium release, and endothelial adhesion (Balabanian
et al., 2005b, 2008; Gulino et al., 2004). Since CXCL12 is expressed constitu-
tively at high levels in the BM, it is not surprising that WHIM leukocytes
preferentially traffic to the marrow. In fact, expression of the WHIM-type
mutated CXCR4 in healthy human CD34þ cells enhances their chemotactic
response to CXCL12 and BM engraftment in immunodeficient mice
(Kawai et al., 2007).
64 Michael P. Rettig et al.

3. Donor Selection for HSPC Mobilization


3.1. Selection of mice for HSPC mobilization
Mice aged 8 weeks or older are used for mobilization experiments. When
purchased from commercial vendors or obtained from outside sources, we
allow the mice to acclimate to our facility for at least 1 week before use. All
animal use should be in accordance with the guidelines of each individual’s
Institutional Animal Care and Use Committee, the Federal Animal Welfare
Act, and conform to recommendations in the Guide for the Care and Use of
Laboratory Animals (Institute of Laboratory Animal Resources, National
Research Council, National Academy of Sciences, 1996).
Similar to humans, there is a wide variation in the magnitude of HSPC
mobilization by different inbred strains of mice in response to G-CSF.
Following treatment of mice with 200 mg/kg/d G-CSF for 5 days,
Roberts et al. (1997) observed a 10-fold range in the number of circulating
progenitor cells between different inbred strains of mice, with the mobili-
zation efficacy roughly aligning in the following order: DBA > 129Sv >
BALB/c ¼ SJL > C57Bl/6 ¼ C3H/He. Similarly, Broxmeyer and
colleagues (2005) reported that the combination of G-CSF and plerixafor
induced significantly greater mobilization of HSPCs in DBA mice com-
pared with either C57Bl/6 or C3H/He. Although the exact mechanism/s
for this large interstrain variation remains unresolved, both genetic deter-
minants and the size of the stem cell pool play a role in the efficiency of
mobilization by G-CSF (reviewed in Herbert et al., 2008). Because of the
broad variability in mobilization efficiency by different strains of mice, it is
preferable to test at least two strains of mice that differ in responsiveness to
G-CSF when setting up mobilization experiments (Herbert et al., 2008).

3.2. Selection of humans for HSPC mobilization


At our institution, eligible donors are between the ages of 18 and 70 years
inclusive with evidence of adequate organ function (left ventricular ejection
fraction more than 40%, formal pulmonary function testing showing a
forced expiratory volume in 1 s [FEV1], more than 50% of predicted and
a diffusing lung capacity for carbon dioxide [DLCO], more than 40% of
predicted [corrected for hemoglobin]), a serum creatinine clearance of more
than 40% of normal, a total bilirubin less than two times normal or absence
of hepatic fibrosis/cirrhosis, no evidence of a severe central or peripheral
neurologic abnormality, no evidence of active infection, be HIV negative,
and have an Eastern Cooperative Oncology Group (ECOG) performance
status of 0 or 1. Donors must give written consent in accordance with the
Declaration of Helsinki on a study approved by the Human Studies
CXCR4 and Mobilization 65

Committee at Washington University. In the case of studies involving


plerixafor, the Food and Drug Administration (FDA) approved the study
under an investigator-held investigational new drug application.

4. Flow Cytometric Enumeration of


Mobilized HSPCs
Previous chapters in this journal (Hawley et al., 2006; Lin and
Goodell, 2006) and elsewhere (Ema et al., 2006; Fukuda and Pelus, 2008;
Herbert et al., 2008; Robinson and van Os, 2008) provide current proce-
dures used to phenotypically characterize and isolate candidate human
and murine HSPCs. The reader is referred to these publications for detailed
methodology. In the following, we first briefly summarize the most common
phenotypes used to characterize murine and human HSPCs.

4.1. Flow cytometric enumeration of murine HSPCs


Among the subsets that define hematopoietic stem cells, CD34 c-kitþ
Sca-1þ lineage marker (CD34KSL) cells are regarded as one of the
populations that have the highest enrichment of HSPCs in adult mouse
BM (Giebel and Punzel, 2008; Weissman and Shizuru, 2008). More
recently, Morrison and colleagues (Kiel et al., 2005) have used markers
from the SLAM family—CD150, CD244, and CD48—to differentiate
stem cells from more committed progenitor cells. The most primitive
murine stem cells were found to reside within the CD150þCD244–CD48–
subpopulation.

4.2. Flow cytometric enumeration of human HSPCs


The enumeration of cells that express the cell surface marker CD34 present
on human HSPCs is used to assess the adequacy of stem cell numbers for
hematopoietic stem cell transplantation. In humans, the CD34þ cell popu-
lation contains progenitors committed to the myeloid, erythroid, megakar-
yoid, and lymphoid lineages, as well as primitive progenitors and stem cells
capable of long-term reconstitution (Giebel and Punzel, 2008; Weissman
and Shizuru, 2008). Although no adequate threshold exists, a minimum of
2.0  106 CD34þ cells/kg body weight is used by many centers to ensure
adequate neutrophil recovery after transplant (Gandhi et al., 1999;
Montgomery and Cottler-Fox, 2007; Tricot et al., 1995). Additionally,
5  106 CD34þ cells/kg has been considered by some to be the optimal
target as it results in faster platelet recovery post transplant (Bensinger et al.,
1995; Brown et al., 1997; Weaver et al., 1995).
66 Michael P. Rettig et al.

5. Dosing and Kinetics of HSPC Mobilization by


G-CSF and Plerixafor
5.1. G-CSF
5.1.1. Mobilization of murine HSPCs by G-CSF
Mice are typically mobilized with recombinant human G-CSF (Amgen,
Thousand Oaks, CA) diluted in phosphate buffered saline (PBS) with 0.1%
low endotoxin bovine serum albumin (BSA, Sigma) and administered by
daily subcutaneous injection for 5 days at a dose of 250 mg/kg (Molineux
et al., 1990). Although the mechanism by which G-CSF induces HSPC
mobilization remains controversial, the absence of a mobilization response
in CXCR4–/– BM chimeras indicates the absolute dependence of this
chemokine receptor in G-CSF–induced HSPC mobilization (Christopher
et al., 2009).
Pegylated-G-CSF (pegfilgrastim, Neulasta, Amgen, Inc) is a longer-
lasting variant of G-CSF and was approved by the FDA in the USA to
prevent prolonged neutropenia following chemotherapy for nonhematolo-
gical malignancies (Kroschinsky et al., 2008). The 33-h plasma half-life of
pegfilgrastim is substantially longer than the 4- to 6-h half-life of G-CSF due
to decreased serum clearance (Zamboni, 2003). Peak mobilization of
murine CFU-GM and CAFC by pegfilgrastim is observed 3 days after a
single subcutaneous injection of 25 mg (de Haan et al., 2000).

5.1.2. Mobilization of human HSPCs by G-CSF


When G-CSF is used alone for human HSPC mobilization, the recom-
mended dose is 10 mg/kg subcutaneous daily (either as a bolus or continu-
ous infusion) beginning at least 4 days before the first apheresis session and
continued until the last apheresis session (Gazitt et al., 1999) (Neupogen
[filgrastim]). Circulating CD34þ stem cell levels usually peak on the 5th day
of G-CSF (Lane et al., 1995). Administration of G-CSF at a dose of at least
10 mg/kg/day for 5 days is usually required to achieve the mobilization goal
of 5  106 CD34þ cells/kg of recipient body weight, a dose considered
suitable for reproducible, rapid, and consistent engraftment of both neu-
trophils and platelets (Henon et al., 1992; Schmitz et al., 1996). Although
the Food and Drug Administration (FDA) approved pegfilgrastim for the
prevention of prolonged neutropenia after chemotherapy for nonhemato-
logical malignancies, its potential as a mobilizing agent is still being
explored. In healthy donors, a single dose of 12 mg pegfilgrastim has been
shown to mobilize CD34þ stem cells with a similar magnitude and kinetics
as standard G-CSF (Hill et al., 2006; Kroschinsky et al., 2005).
CXCR4 and Mobilization 67

High-dose GCSF was investigated as a primary mobilization regimen


throughout the 1990s (Kobbe et al., 1999; Sheridan et al., 1994; Zeller et al.,
1996). Although seldom used today for primary mobilization, high-dose
GCSF regimens are occasionally employed for remobilization (Boeve et al.,
2004; Wang et al., 2007). Doses ranging from 16 to 32 mg/kg subcutaneous
daily to 12 to 16 mg/kg subcutaneous twice daily have been considered as
high-dose regimes (Bensinger et al., 2009).

5.2. Plerixafor
5.2.1. Mobilization of murine HSPCs by plerixafor
Plerixafor (Genzyme, Cambridge, MA) is supplied as a sterile isotonic
aqueous solution at 10 mg/ml. Broxmeyer and colleagues (2005) showed
that a single-dose administration of 5 mg/kg subcutaneous plerixafor
induces rapid mobilization of hematopoietic progenitor cells (HPCs) and
long term repopulating cells to the blood of mice, with maximal mobili-
zation of the HSPCs occurring 1 h postinjection. In agreement with these
published results, we found that treatment of 129  B6 F1 mice with
subcutaneous plerixafor results in rapid mobilization of white blood cells
(WBC) and HPCs, with peak CFU-GM levels achieved 3 h after a single
injection of 5 mg/kg plerixafor (Ramirez et al., 2008). Furthermore, we
reported that repetitive subcutaneous injection of 5 mg/kg plerixafor to
mice every 24 h results in a similar mobilization of progenitors (CFU-GM)
after each injection (Nervi et al., 2009). Similar data were generated by
Hubel et al. (2004) using normal human volunteers. These data demon-
strate that subcutaneous plerixafor can be given daily resulting in similar
kinetics and magnitude of progenitor mobilization with no obvious
tachyphylaxis.
In a separate series of experiments, we tested the efficacy of murine
HSPC mobilization following intravenous administration of 1, 3, or
5 mg/kg plerixafor (Ramirez et al., 2008). Analysis of the dose–response
relationship indicated that intravenous plerixafor resulted in more rapid
mobilization (peak 1 h) than subcutaneous administration. Doses higher
than 3 mg/kg intravenous plerixafor were lethal to the mice.

5.2.2. Mobilization of human HSPCs by plerixafor


The FDA approved plerixafor for use in combination with G-CSF to
mobilize HSPCs in patients with non-Hodgkin’s lymphoma and multiple
myeloma undergoing autologous transplantation in December 2008.
Subcutaneous injection of 240 mg/kg plerixafor is initiated after the patient
has received 10 mg/kg/day G-CSF for 4 days, followed by leukapheresis
beginning 11 h after drug treatment (MOZOBIL [plerixafor injection]).
68 Michael P. Rettig et al.

We recently published results from a Phase II study evaluating the safety


and efficacy of plerixafor for CD34þ stem cell mobilization in allogeneic
transplantation (Devine et al., 2008). Twenty-five donors were treated with
a single subcutaneous dose of 240 mg/kg plerixafor and underwent apheresis
4 h later, with collection of enough stem cells for transplant (defined
as >2  106 CD34þ cells/kg) in two-thirds of the donors. Twenty patients
with hematologic malignancies received plerixafor-mobilized stem cell
products with no adverse events. Although the CD34þ doses obtained
were lower than that observed with a standard G-CSF mobilization
regimen, the plerixafor-mobilized allografts functioned well and promoted
rapid and durable multilineage hematopoiesis in the recipients.
In our Phase II study discussed above, only 16 of the first 24 donors
mobilized with subcutaneous plerixafor (240 mg/kg) collected the minimal
required target of 2  106 CD34þ cells/kg in a single apheresis (Devine
et al., 2008). Based on preliminary data suggesting higher (twofold) and
earlier (1 h vs. 3 h) progenitor mobilization in mice after intravenous
versus subcutaneous dosing of plerixafor (Ramirez et al., 2008), we
amended our trial and began testing the safety and efficacy of increasing
doses of intravenous plerixafor (80, 160, 240, 320, 400, and 480 mg/kg
over 30 min) on the kinetics and magnitude of allogeneic HSPC mobili-
zation. In an ongoing Phase I safety evaluation of intravenous plerixafor,
allogeneic related donors are initially mobilized with increasing doses of
intravenous plerixafor. After 4 days of drug clearance, the same donors are
then mobilized with a single subcutaneous dose of 240 mg/kg plerixafor,
and collected cells are used as a source of stem cells for transplantation.
Consistent with our hypothesis, patients treated intravenously with
240 mg/kg plerixafor had higher peak levels of CD34þ cells/ml blood at
every time point evaluated compared to the same plerixafor dose adminis-
tered subcutaneously (Rettig et al., 2008). Furthermore, we have noted a
clear dose–response effect of increasing doses of intravenous plerixafor.
Of the seven donors who received 320 mg/kg intravenous plerixafor, all
achieved peak levels of CD34/kg greater than 20 CD34/ml (range 22 to
38/ml), a level that we as well as others have shown is highly correlated
with achieving more than 2  106 CD34/kg after a single apheresis
(Bensinger et al., 2009; Pusic et al., 2008). Since no related dose-limiting
toxicity has yet been determined, we plan to complete the final two
intravenous dose cohorts (400 mg/kg and 480 mg/kg). These encouraging
studies suggest that intravenous plerixafor may be a more effective mobi-
lizing agent with a low side effect profile. We predict, based on this
preliminary data, that the optimal dose of intravenous plerixafor will result
in similar rates of achieving 2  106 CD34/kg after a single apheresis
procedure compared to G-CSF in less time (4 h vs. 5 days).
CXCR4 and Mobilization 69

6. Flow Cytometric Analysis of CXCR4


Expression on Human CD34þ Subsets
A variety of cell types express the CXCR4 receptor, including periph-
eral blood lymphocytes (B cells and T cells), monocytes, neutrophils, pre–B
cells, mast cells, CD34þ HPCs, endothelial cells, intestinal and alveolar
epithelial cells, astrocytes, microglia, and neurons (Khan et al., 2007).
CXCR4 receptors cycle continuously to and from the cell surface in a
ligand-independent manner, with the majority of CXCR4 being stored in
an intracellular pool (Busillo and Benovic, 2007; Marchese et al., 2008;
Zhang et al., 2004). The function of these large stores of intracellular
CXCR4 remains unclear.
In our recently published Phase II study evaluating the safety and efficacy
of plerixafor for CD34þ stem cell mobilization in allogeneic transplantation
(Devine et al., 2008), eight normal donors were mobilized sequentially with
plerixafor and G-CSF. These donors initially received one subcutaneous
injection of 240 mg/kg plerixafor, followed by leukapheresis beginning 4 h
after drug treatment. After 10 days of drug clearance, the same donors were
mobilized with 5 days subcutaneous injection of 10 mg/kg/day G-CSF, and
leukapheresed on day 5. Interestingly, we found via flow cytometry that
plerixafor mobilized a unique population of CD34dim cells which were
present in 3- to 10-fold higher numbers compared to G-CSF mobilized
CD34þ cells (Rettig et al., 2008). We further characterized CD34 immu-
noselected cells obtained after plerixafor or G-CSF mobilization of normal
human donors by staining for CD34-APC and CD45RA-FITC. This
staining and gating approach has allowed us to separate CD34þ cells in
plerixafor mobilized products into three separate subsets (only two in
G-CSF mobilized grafts), with the CD34dimCD45RAþ subset relatively
specific to plerixafor compared to G-CSF mobilized products (Fig. 3.1).
Of interest, two of the key molecules responsible for stem cell homing,
retention, and trafficking, CXCR4 and VLA-4, were significantly
overexpressed in the CD34dimCD45RAþ subset compared to the
CD34þCD45RA– and CD34þCD45RAþ cells (Fig. 3.1). Others have
shown that CD34þCD45RAþ cells represent more committed progenitors
(reviewed in Blom and Spits, 2006; Weissman and Shizuru, 2008), with two
different CD34dimCD45RAþ progenitor cell subsets having been described
in the literature (Blom et al., 2000; Freud et al., 2005). Ongoing studies in
the lab are further characterizing the CD34dimCD45RAþ progenitor cell
subset preferentially mobilized by plerixafor. Below we describe in detail
our method to purify and phenotype these different CD34þ stem cell
subsets.
70 Michael P. Rettig et al.

Plerixafor G-CSF
A
15.7 16.7

CD34

CD34
62.9 21 80.8 2.34

CD45RA CD45RA
B
% of max

% of max
CXCR4 CXCR4
C
% of max

% of max

VLA-4 VLA-4

CD45RA−CD34+
CD45RA+CD34+
CD45RA+CD34dim

Figure 3.1 Coexpression of CD45RA on human CD34þ cells identifies the CD34dim
subset. (A) Healthy donors were treated with a single injection of 240 mg/kg AMD3100
or given 10 mg/kg/day G-CSF for 5 days. CD34þ cells from leukapheresis products
were purified by CD34 immunoselection using an autoMACS device and the expression
of CD34 and CD45RA was evaluated by flow cytometry. CD45RAþCD34dim cells
are enriched in AMD3100-mobilized products. (B-C) CD45RAþCD34dim
cells from AMD3100-mobilized products express high levels of surface CXCR4 (B)
and VLA-4 (C).

6.1. Evaluation of cell surface CXCR4 on human CD34þ


cell subsets
Aliquots of leukapheresis products are obtained in evacuated tubes coated
with ethylene-diaminetetra-acetic acid (EDTA) or sodium heparin after
informed consent in conformity with a human subjects protocol approved
by an institutional review board. Rapid processing of samples is particularly
important, since surface expression of CXCR4 may increase with time due
to release from intracellular stores (Forster et al., 1998; Shalekoff and
Tiemessen, 2001). Cold (4 ) storage stabilizes human CD34þ cells.
CXCR4 and Mobilization 71

1. Pass leukapheresis product through 30 mm nylon mesh (Miltenyi Pre-


Separation Filters, #130-041-407) into a sterile 50 ml conical tube to
remove cell clumps. Dilute cells by adding 20 to 30 ml of cold running
buffer ( phosphate-buffered saline supplemented with 0.5% bovine
serum albumin and 2 mM EDTA, stored at 4 ).
2. Perform a viable cell count on a hemacytometer.
3. Pellet cells at 300g for 5 min at 4 .
4. To prepare the cells for magnetic selection, decant supernatant and
resuspend the cell pellet in a final volume of 300 ml of running buffer
per 108 cells.
5. Isolate CD34þ cells by positive selection using a CD34 Microbead Kit
(cat. no. 130-046-702, Miltenyi Biotec, Auburn, CA) and autoMACS
Separator (Miltenyi Biotec) according to the manufacturer’s instructions.
Set aside an aliquot of 106 cells immediately before application to the
autoMACS separator to use a pre-sort control for flow cytometry. Run
sample through the autoMACS separator using the ‘‘posseld’’ (double-
positive selection) program and collect both the positive (enriched
CD34þ cells) and negative (CD34– cells) fractions.
6. Perform a viable cell count on both the positive and negative fractions
using a hemacytometer. After CD34 positive selection of 6 ml of
leukapheresis material, we typically obtain 5  106 and 2  106
CD34þ cells from G-CSF (10 mg/kg/day  5 days) and plerixafor
(240 mg/kg subcutaneous) mobilized donors, respectively.
7. Label tubes and aliquot cells for flow cytometry as described in Table 3.2.
Approximately 10  105 CD34– cells (negative sort) are used per tube to
setup the instrument (compensation controls). In contrast, because of the
limited number of CD34þ cells obtained, we usually only aliquot 0.5
to 1  105 CD34þ cells (positive sort) per tube for the gating controls
(fluorescence minus one controls) and experimental sample. All samples
are placed in a final volume of 100 ml of running buffer for flow
cytometry analysis. Negative gating controls are analyzed to establish
the level of background fluorescence resulting from autofluorescence
and nonspecific antibody binding. Furthermore, fluorescence minus one
gating controls are preferred over isotype controls because isotype con-
trols are not always matched to the concentration of the test monoclonal
antibody (mAb).
Extracellular staining of cells is performed as described in Table 3.2 by
the addition of the following antihuman monoclonal antibodies (all
obtained from BD Biosciences): CD4-FITC (clone RPA-T4, cat. no
555346), CD4-PE (clone RPA-T4, cat. no. 555347), CD4-APC (clone
RPA-T4, cat. no. 555349), CD45RA-FITC (clone HI100, cat. no.
555488), CXCR4-PE (clone 1D9, cat. no. 551510), and CD34-APC
(clone 581, cat. no. 555824). The amount of antibody added to each sample
72 Michael P. Rettig et al.

Table 3.2 Staining setup for evaluation of CXCR4 on CD34þ cell subsets

Tube No. cells


no. Sample (105) FITC PE Viability APC
Compensation controls
1 CD34– 10 — — 7-AAD —
2 CD34– 10 CD4 — 7-AAD —
3 CD34– 10 — CD4 7-AAD —
4 CD34– 10 — — 7-AAD CD4
Gating controls
5 CD34þ 0.5 — CXCR4 7-AAD CD34
6 CD34þ 0.5 CD45RA — 7-AAD CD34
7 CD34þ 0.5 CD45RA CXCR4 7-AAD —
Experimental samples
8 pre 10 CD45RA CXCR4 7-AAD CD34
9 CD34– 0.5 CD45RA CXCR4 7-AAD CD34
10 CD34þ 10 CD45RA CXCR4 7-AAD CD34
7-AAD, 7-amino-actinomycin D; APC, allophycocyanin; FITC, fluorescein isothiocyanate; PE,
phycoerythrin.

is adjusted according to the number of cells used per the manufacturer’s


instructions. Since CD34þ cells are immunoselected using the antihuman
CD34 clone QBEND/10, post-sort analyses of CD34 expression must be
performed using a separate mAb clone. The APC-conjugated anti-CD34
clone 581 provides a very bright signal that can be easily distinguished from
the negative gating control. Additionally, the mAb most commonly used to
study cell surface CXCR4 expression, clone 12G5, does not bind in the
presence of plerixafor (Khan et al., 2007). Clone 12G5 binds to an epitope
on the second extracellular loop of CXCR4 that overlaps the plerixafor
binding site on the extracellular loop 2 and the adjacent transmembrane
segment TM4. Therefore, we use a separate clone, 1D9, which is not
inhibited by plerixafor. The epitope recognized by antibody 1D9 is
contained within the N-terminus of CXCR4 (Forster et al., 1998).
1. Incubate samples for 30 min at 4 in the dark.
2. Remove unreacted antibodies by washing the cells twice in 3 ml of
running buffer. After the final wash, decant the supernatant and resuspend
the cells in 300 ml of running buffer. Keep samples on ice until analysis.
3. We assess cell viability concomitantly with flow cytometry evaluation of
stained cells by the addition of 7-amino-actinomycin D (cat. no. 559925,
BD Biosciences).
4. Analyze the samples on a flow cytometer equipped for excitation wave-
lengths of 488 and 633 nm.
CXCR4 and Mobilization 73

7. Functional Characterization
of Mobilized HSPCs
7.1. In vitro assays of differentiation
In vitro assays of differentiation have been developed to quantify murine and
human HSPC content (Sutherland et al., 1989). In short-term colony-
forming cell (CFC) assays, test samples are cultured in a semisolid matrix
supplemented with nutrients and cytokines for 2 weeks at 37 . During this
culture period, CFCs proliferate and produce discrete cell clusters or colo-
nies of morphologically recognizable daughter cells that can be quantified
by light microscopy. Based on the selection of the appropriate media and
culture conditions, CFC assays can be used to quantify myeloid multipo-
tential progenitors (CFU-GEMM and CFU-GM) and lineage-restricted
progenitors of the erythrocyte (CFU-E and BFU-E), granulocyte
(CFU-G), monocyte-macrophage (CFU-M), megakayocyte (CFU-Mk),
and B-cell (CFU–pre-B) lineages.
The standardized short-term colony assays discussed above easily quan-
tify lineage-committed progenitors, but are not adequate for the detection
of more primitive HSPCs. Two assays, the cobblestone-area–forming-cell
(CAFC) assay (de Haan et al., 2002) and the long-term culture-initiating cell
(LTC-IC) assay (Lemieux et al., 1995; Sutherland et al., 1991), have been
developed to measure more primitive stem cell frequencies. Both the
CAFC and LTC-IC assays rely on adherent stromal cells for hematopoietic
support and are quantified in vitro based on their capacity to generate
myeloid cells for at least 5 weeks of culture. Additionally, the LTC-IC
assay can be used in a quantitative manner by limiting dilution analysis to
provide an estimate of the primitive cell pool within a product (Coulombel,
2004). The reader is referred to previous chapters in this series (Broxmeyer
et al., 2006) and elsewhere (Miller et al., 2008; van Os et al., 2008) for
detailed descriptions of the CFC, CAFC, and LTC-IC procedures (see also
www.stemcell.com/technical/manuals.asp).

7.2. Transmigration assays


Trafficking of HSPCs to the BM following transplantation is believed to be
a critical step for hematopoietic reconstitution. Studies by Voermans et al.
(2001) showed that enhanced in vitro migration of human CD34þ cells to
CXCL12 was associated with improved in vivo hematopoietic recovery.
Since CXCL12-induced migration is not dependent on CXCR4 expres-
sion levels alone (Voermans et al., 2001), and treatment with plerixafor,
G-CSF or other mobilizing agents that target the CXCL12/CXCR4 inter-
action alter CXCL12 signaling, others and we often test the ability of
74 Michael P. Rettig et al.

mobilized HSPCs to migrate to CXCL12 using transwell migration assays.


We perform these assays according to the protocol described elsewhere by
Fukuda and Pelus (2008).

7.3. Transplantation assays for mouse and human HSPCs


Long-term repopulating stem cells are defined by their ability to self-renew
and to differentiate into mature cells of all hematopoietic lineages. The
definitive assay for stem cell activity in a test sample is the complete and
sustained (>6 months) reconstitution of all hematopoietic lineages in irra-
diated recipients by transplanted HSPCs (Herbert et al., 2008; Purton and
Scadden, 2007). The most common type of transplantation assay used to
measure murine primitive stem cell activity is the competitive repopulation
assay (Harrison, 1980). This assay measures the functional potential of an
unknown ‘‘test’’ source of HSPCs (e.g., mobilized grafts) against a set
known number of whole BM cells. The competing cells ensure the survival
of lethally irradiated recipients transplanted with a low number of test
HSPCs and allow quantification of the reconstitution activity. For donor
versus host identification in transplantation assays, investigators commonly
use C57BL/6 (B6) mice congenic for the CD45 (Ly5, common leukocyte
antigen) locus to discriminate among the three potential sources of stem
cells (test cells, competitor BM cells, and the host). We routinely use
C57BL/6 (CD45.2þ) as recipients, congenic C57BL/6 (CD45.1þ) mice
for mobilization, and hybrid C57BL/6 (CD45.1þCD45.2þ) mice as BM
donors. The number of repopulating units (RU) in the test sample is then
determined by measuring the contribution of the test sample to donor
chimerism at various time points after transplantation (Harrison et al.,
1993; Purton and Scadden, 2007; Yuan et al., 2005). The value of the
repopulating unit is indicative of the amount of repopulating activity within
the test sample.
Although determination of the repopulating unit provides important
information about the overall function of a test sample, it does not provide
information on the quantity of primitive stem cells within the graft. The
frequency of stem cells in an unknown test sample can be determined by
performing limiting dilution competitive repopulation assays. In these stud-
ies, a series of dilutions of the test source are again competed against a set
number of competing BM cells. The number of mice negative for reconsti-
tution in each test cell dose is determined, and the frequency of HSPCs
(competitive repopulating units, CRU) is estimated using Poisson statistics
(Purton and Scadden, 2007; Szilvassy et al., 1989, 1990; Taswell, 1981).
The most definitive test of long-term hematopoietic stem cells potential
is the serial transplantation assay (Purton and Scadden, 2007). In this assay,
the test sample is transplanted into sequential serial transplant recipients, and
CXCR4 and Mobilization 75

the ability of the transplanted population to sustain hematopoiesis is


determined.
Since the limiting dilution competitive repopulation assay can be used to
incorporate all three types of the long-term repopulating stem cell assays
discussed above (RU, CRU, and serial transplantation), we will describe the
assay in greater detail in the following.

7.3.1. Limiting dilution competitive repopulation assay


Wildtype C57BL/6J (CD45.2þ) and a congenic strain of C567BL/6 that
have the CD45.1 gene (B6.SJL-PtPrc*Pep3BoyJ) are obtained from The
Jackson Laboratory (Bar Harbor, ME). Hybrid C57BL/6J  B6.SJL-
PtPrc*Pep3BoyJ F1 (CD45.1þ/CD45.2þ heterozygous) are bred at our
animal facility. The Ly5/CD45 antigen is expressed on all hematopoietic
cells except erythrocytes, and polymorphism between CD45.1 and CD45.2
provides a quick and convenient method for detecting donor cells within
leukocytes of recipients using flow cytometric techniques. All mice are 8 to
10 weeks old and sex-matched.
Wildtype C57BL/6J (CD45.2þ) recipients are exposed to a lethal dose
of total body irradiation from 12 to 24 h before transplantation. Since
irradiation toxicity levels can be variable between institutions, it is prefera-
ble that all investigators assess the level of radiation that their mice can
tolerate without any morbidity and mortality. Typical irradiation doses
range for C57BL/6 mice range from 1000 cGy to 1100 cGy TBI. At least
16 to 20 mice are irradiated per experiment.
Low-density mononuclear cells (LDMNCs) are isolated from mobilized
B6.SJL-PtPrc*Pep3BoyJ (CD45.1þ) mice using murine lympholyte
(Cedarlane Laboratories, Burlington, Ontario, Canada). Approximately
2  107 total LDMNCs are needed to inject at least four mice at a minimum
of three different cell doses. For plerixafor, we typically treat 20 to 25
CD45.1þ B6 donor mice with 5 mg/kg subcutaneous plerixafor and har-
vest peripheral blood 3 h later. For GCSF, we treat 10 to 15 CD45.1þ B6
donor mice with G-CSF (250 mg/kg/day) for 5 days and harvest peripheral
blood 4 h after the last injection of G-CSF.
Isolate BM cells aseptically from C57BL/6J  B6.SJL-PtPrc*Pep3BoyJ
F1 (CD45.1þ/CD45.2þ) mice. We sacrifice 1 CD45.1þ/CD45.2þ B6 BM
donor mouse for every 15 to 20 lethally irradiated CD45.2þ B6 mice
undergoing transplantation.
LDMNCs from mobilized CD45.1þ B6 mice are mixed with unfrac-
tionated CD45.1þ/CD45.2þ B6 competitor BM cells. At least four mice at
a minimum of three different cell doses should be evaluated to allow
statistical comparison of test (CD45.1þ) cell engraftment between treatment
groups at limiting dilution (Purton and Scadden, 2007). Most investigators
inject between 2 to 5  105 competing BM cells per mouse. However, the
number of LDMNCs injected per mouse is variable between institutions
76 Michael P. Rettig et al.

and each mobilizing agent. For plerixafor and G-CSF mobilized grafts, we
and others (Broxmeyer et al., 2005) have set the ratio of donor (CD45.1þ)
blood cells to competitor (CD45.1þ/CD45.2þ) BM cells as the number
or LDMNCs in three, two, or one donor mice to a constant number of
5  105 competitor BM cells (CD45.1þ/CD45.2þ). For example, at a 3:1
ratio, we mix the number of LDMNCs obtained from the peripheral blood
of three donor mice (CD45.1þ) with 5  105 competitor BM cells
(CD45.1þ/CD45.2þ). Others mix 5  105 competitor BM cells with
2  106, 1.5  106, or 1  106 LDMNCs to yield LDMNC to BM ratios
of 4:1, 3:1, or 2:1, respectively (Fukuda et al., 2007). Pilot experiments are
recommended to obtain the range of LDMNCs required to achieve durable
test sample engraftment. Four B6 (CD45.2þ) mice that received 1000 cGy
TBI and 5  105 competitor BM cells (CD45.1þ/CD45.2þ) without donor
test cells were used as controls.
Hematopoietic repopulation is evaluated monthly for at least 6 months
to demonstrate long-term multilineage reconstitution in the CD45.1þ and
CD45.1þ/CD45.2þ donor cell subsets. Multilineage analysis is performed
on the blood by flow cytometry using antimouse monoclonal antibodies
against CD45.1, CD45.2, and the lineage markers B220 (B lymphoid),
CD3 (T lymphoid), Mac1 (monocyte/macrophage), and Gr1 (granulo-
cyte). At least 20,000 events are acquired on a flow cytometer. Since
myeloid progenitors and their progeny have short half-lives compared to
lymphoid progeny, it is important to demonstrate myeloid reconstitution in
the test-cell subset following transplantation. Furthermore, Bryder et al.
(2004) demonstrated that the RB6-8C5 mAb detecting Gr-1 also binds to
a subpopulation of CD3þCD8þ T cells present in the peripheral blood.
Therefore, granulocyte reconstitution should be defined as Gr-1þ cells
negative for expression of T-cell markers like CD3.
The percentage of chimerism is calculated based on flow cytometry data
as follows: % chimerism ¼ (% test donor cells)  100 / (% test donor cells þ
% competitor cells). Most investigators consider that primitive stem cells are
present in the test donor cells when the percent chimerism is greater than
1% for all myeloid (granulocytes and macrophages), B-lymphoid, and
T-lymphoid lineages at 6 months after transplantation.
The number of repopulating units (RU) in test donor cells is calculated
according to the method of Harrison et al. (1993) as follows: % chimerism ¼
(% chimerism)  (no. of competitor cells/105) /(100 – % chimerism). One
RU is defined as the amount of repopulating activity in 105 BM cells from
wildtype mice (Ema et al., 2006; Purton and Scadden, 2007).
In limiting dilution assays, the frequency of competitive repopulating
units (CRU) among test donor cells is estimated on the basis of Poisson
statistics; the ranges of CRUs are given as 95% confidence intervals. Stem-
Cell Technologies has developed a program, L-Calc, to aid in the data
analysis of limiting dilution assays. This software is free to download from
CXCR4 and Mobilization 77

the company website. Of note, CRU and RU are different (Ema et al.,
2006; Purton and Scadden, 2007). CRU measures the quantity of HSPCs,
whereas RU measures the functional quality of HSPCs. Furthermore, since
short-term repopulating cells can reconstitute multiple lineages for at least
16 weeks, most researchers determine RU and CRU values from data
collected at least 6 months post-transplantation.
It should be noted, that noncompetitive primary transplantation assays
can be performed to mimic how transplants are performed clinically. In a
noncompetitive transplant, test cells (typically 1 to 2  106) are injected into
lethally irradiated congenic recipients in the absence of competing BM cells.
Although the primary endpoint in noncompetitive transplants is the time to
recovery of peripheral blood neutrophils, platelets, and hemoglobin, donor
chimerism can also be determined as described.

7.3.2. Secondary transplantation


Wildtype C57BL/6J (CD45.2þ) recipients are exposed to a single dose of
lethal (1000 cGy) total body irradiation from a 37Cesium source at a rate of
95 cGy/minute 12 to 24 h before transplantation.
Primary recipient mice are sacrificed at 6 months post-transplant and the
contents of their femurs are pooled within the respective treatment groups.
Pooled BM cells (1  106) are injected via the tail vein using a 27-gauge
needle in 0.2 ml of PBS within 12 h after irradiation of C57BL/6J
(CD45.2þ) recipients. If possible, at least 10 secondary recipients should
be injected with BM cells harvested from the primary recipients.
The proportions of CD45.2 donor and CD45.1 competitor cell engraft-
ment in the secondary recipients were measured at 2, 6, 14, and 27 weeks
using the same methods.
Tertiary transplantations were carried out in the same manner.

7.3.3. Immune-deficient mouse models to study human


stem cell–repopulation capacity
Several xenotransplantation models have been developed as surrogate assays
of human HSPC activity, with the majority relying on the use of different
strains of immunodeficient mice with various degrees of residual innate
immunity. Nonobese diabetic (NOD) mice crossed with severe combined
immunodeficient (SCID) mice represent the most accepted and widely
used immune-deficient animal for quantitative comparison of human
HSPC activity (Cashman et al., 1997; Larochelle et al., 1996; Pflumio et al.,
1996). NOD/SCID mice stringently engraft only primitive human hema-
topoietic stem cells (scid-reconstituting cells [SRC]) that repopulate the BM
with predominantly CD34þCD19þ pro-B cells exhibiting a poor capacity
to terminally differentiate, and to a lesser degree, myeloid cells. In contrast to
the SRC, more committed human progenitor populations are able to
engraft NOD/SCID mice back-crossed with the b2-microglobulin–null
78 Michael P. Rettig et al.

(b2mnull) allele (Kollet et al., 2000, 2001). These NOD/SCIDbmnull mice


exhibit a more absolute immunodeficiency than NOD/SCID mice and have
virtually no NK cell function. In fact, compared to NOD/SCID controls,
NOD/SCIDb2mnull mice support a greater than 10-fold higher level of SRC
frequency upon transplantation of small numbers (8  104 cells) of human
cord–blood mononuclear cells and become reconstituted with lymphoid
CD45þCD19þ cells (no T cells) and myeloid CD45þCD33þ cells. This
enhanced SRC frequency in NOD/SCIDbmnull mice is caused by the
increased engraftment of human myeloid and lymphoid short term repopu-
lating hematopoietic cells (Eaves et al., 2001; Glimm et al., 2001).
Two major limitations of the NOD/SCIDbmnull xenograft model are
their poor reproduction rate and short life span (approximately 6 months
due to accelerated thymic lymphomagenesis). One alternative to using
NOD/SCIDbmnull mice for measuring human HSPC activity is to treat
NOD/SCID mice with a monoclonal antibody (mAb) against the interleu-
kin-2 receptor bchain (IL-2Rb, CD122). The anti-CD122 mAb eradicates
CD122-expressing cell populations, including NK cells and macrophages
that mediate a negative effect on human engraftment. Compared to NOD/
SCIDb2mnull mice, anti-CD122 treated NOD/SCID mice exhibit a nearly
threefold greater human cell engraftment upon transplantation of human
cord–blood mononuclear cells (McKenzie et al., 2005). A second alternative
to using NOD/SCIDb2mnull mice in SRC assays is to use NOD/SCID
mice harboring a complete null mutation of the interleukin 2 receptor
common g chain (NOD/SCID/gcnull) (Ito et al., 2002; Shultz et al.,
2005). Similar to NOD/SCID-b2mnull mice, NOD/SCID/gcnull mice
have reduced activities and numbers of NK cells. However, unlike
NOD/SCID-b2mnull mice, NOD/SCID/gcnull mice can survive long
term (15 months) because they do not develop thymic lymphomas, have a
reproduction rate similar to normal wildtype mice, and exhibit multilineage
engraftment of mature and functional CD3þCD4þ and CDþCD8þ T cells,
Igþ B cells, NK cells, monocytes/macrophages, and plasmacytoid dendritic
cells following transplantation of human CD34þ HSCs. Furthermore, since
NOD/SCID/gcnull mice require no anti-CD122/IL-2Rb monoclonal anti-
body treatment for human cell engraftment, they provide a significant cost
advantage over NOD/SCID mice.
NOD/LtSz-Prkdcscid/Prkdcscid (NOD/SCID), NOD/LtSz-Prkdcscid/
Prkdcscidbmnull (NOD/SCID-b2mnull), and NOD.Cg-Prkdcscid Il2rgtm1Wjl/
SzJ (NOD/SCID/gcnull) mice are obtained from Jackson Laboratories (Bar
Harbor, ME), and bred at our animal facility. NOD/SCID mice are known
to be ‘‘leaky,’’ and sometimes develop mouse CD3þ T cells that can impede
human cell engraftment. Therefore, we screen the peripheral blood of all
NOD/SCID mice by flow cytometry with antimouse monoclonal antibo-
dies (CD45, CD3, and DX5) and eliminate any mice exhibiting more than
1% CD3þ T cells.
CXCR4 and Mobilization 79

All immunodeficient mice are housed in a specific pathogen-free facility


in sterile microisolator cages, and given autoclaved food and water ad libitum.
All manipulations are performed aseptically on a laminar flow bench.
We condition 8- to 10-week-old NOD/SCID, NOD/SCIDb2mnull,
and NOD/SCID/gcnull mice with 300 cGy, 300 cGy, and 250 cGy of
single-dose total body g irradiation (TBI), respectively, using a Shepard
Mark IV Cesium137 irradiator. However, since irradiation toxicity levels
can be variable between institutions, it is preferable that each investigator
assesses the level of radiation that their mice can tolerate without any
morbidity and mortality. Typical irradiation doses range from 250 cGy to
300 cGy TBI.
NOD/SCID mice treated with anti-CD122 antibody are given injec-
tions of 200 mg purified antibody into the intraperitoneal cavity immedi-
ately after irradiation. The anti-CD122 monoclonal antibody generated
from the hybridoma cell line TM-b1 can be purchased from Bio Express
Inc. (West Lebanon, NH).
Human mobilized peripheral blood mononuclear cells and purified
CD34þ cells are injected via the tail vein using a 27-gauge needle in
0.2 ml of PBS within 12 h after irradiation. A range of human MNC
(106 to 40  106 cells) or purified CD34þ cells (2  104 to 1  106 cells)
are injected into quadruplicate mice at a minimum of three different doses
per donor to allow direct statistical comparison of human cell engraftment
between treatment groups at limiting dilution. Control mice are irradiated
but do not receive human cells.
Ten to 12 weeks after transplantation, BM (femurs and tibias), spleen,
and peripheral blood are recovered, single cell suspensions prepared, and
numbers of total nucleated cells are determined using a hemacytometer.
The appropriate dilution of antibodies, as titered against human or mouse
peripheral blood mononuclear cells, are incubated with 1 to 5  105 cells
for 30 min at 4 and then washed two times in phosphate-buffered saline
(PBS) plus 0.5% bovine serum albumin. At least 10,000 events are acquired
on a flow cytometer. Antimouse CD45 and antihuman CD45 mAb are used
to determine the number of mouse and human hematopoietic cells, respec-
tively. Engrafted mouse BM is further analyzed for the frequency of
human B-lymphoid cells (CD20-FITC, CD19-PE), myeloid cells (CD14-
FITC, CD33-PE), T-lymphoid cells (CD4-FITC, CD8-PE), and primitive
HSPCs (CD34-FITC, CD38-PE). All antibodies are purchased from
Becton Dickinson (San Diego, CA). To accurately set up the cytometer,
we mix equal numbers of BM cells from a control, untransplanted immu-
nodeficient mouse with human PBMCs. These control samples are then
stained individually with antihuman CD45 and antimurine CD45 or simul-
taneously with the antihuman CD45/antimurine CD45-lineage cocktails
described.
80 Michael P. Rettig et al.

The proportion of human cells in each mouse is calculated as follows:


% huCD45þ ¼ [no. huCD45þ/(no. huCD45þ þ no. muCD45þ)]. Mice
are considered engrafted when at least 1% of human CD45þ cells are
detected in the mouse BM. Short-term human reconstitution potential is
measured by sacrificing and analyzing mice 6 weeks after transplantation.
Levels of human engraftment are reported as the mean  SD for mice
grouped according to transplanted cell numbers and compared using a
Student’s t-test. SCID repopulating cell (SRC) analysis is performed using
the single-hit model and Poisson statistics at limiting dilution with 95%
confidence intervals. Typically, data from three limiting dilution experi-
ments are pooled and analyzed using L-Calc software (Stem Cell Technol-
ogies; free software download).

8. Concluding Remarks
Disruption of CXCL12/CXCR4 signaling is a critical step in HSPC
mobilization by G-CSF, plerixafor, and additional agents in development.
We (Devine et al., 2008; Hess et al., 2007; Rettig et al., 2008) and
others (Fruehauf et al., 2006; Jin et al., 2008; Pelus and Fukuda, 2008)
have found intrinsic differences between HSPCs mobilized with plerixafor
and G-CSF, including differences in cell surface markers, cell cycle, gene
expression profiles, and NOD/SCID repopulating capacity. The optimum
strategy for obtaining mobilized peripheral blood from donors is the subject
of ongoing study.

ACKNOWLEDGMENT
This work was supported by Genzyme Corporation.

REFERENCES
Abraham, M., Biyder, K., Begin, M., Wald, H., Weiss, I. D., Galun, E., Nagler, A., and
Peled, A. (2007). Enhanced unique pattern of hematopoietic cell mobilization induced
by the CXCR4 antagonist 4F-benzoyl-TN14003. Stem Cells 25, 2158–2166.
Adams, G. B., and Scadden, D. T. (2006). The hematopoietic stem cell in its place. Nat.
Immunol. 7, 333–337.
Balabanian, K., Lagane, B., Infantino, S., Chow, K. Y., Harriague, J., Moepps, B.,
Arenzana-Seisdedos, F., Thelen, M., and Bachelerie, F. (2005a). The chemokine
SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in
T lymphocytes. J. Biol. Chem. 280, 35760–35766.
Balabanian, K., Lagane, B., Pablos, J. L., Laurent, L., Planchenault, T., Verola, O.,
Lebbe, C., Kerob, D., Dupuy, A., Hermine, O., Nicolas, J. F., Latger-Cannard, V.,
CXCR4 and Mobilization 81

et al. (2005b). WHIM syndromes with different genetic anomalies are accounted for by
impaired CXCR4 desensitization to CXCL12. Blood 105, 2449–2457.
Balabanian, K., Levoye, A., Klemm, L., Lagane, B., Hermine, O., Harriague, J., Baleux, F.,
Arenzana-Seisdedos, F., and Bachelerie, F. (2008). Leukocyte analysis from WHIM
syndrome patients reveals a pivotal role for GRK3 in CXCR4 signaling. J. Clin. Invest.
118, 1074–1084.
Benboubker, L., Watier, H., Carion, A., Georget, M. T., Desbois, I., Colombat, P.,
Bardos, P., Binet, C., and Domenech, J. (2001). Association between the SDF1-30 A
allele and high levels of CD34(þ) progenitor cells mobilized into peripheral blood in
humans. Br. J. Haematol. 113, 247–250.
Bensinger, W., Appelbaum, F., Rowley, S., Storb, R., Sanders, J., Lilleby, K., Gooley, T.,
Demirer, T., Schiffman, K., and Weaver, C. (1995). Factors that influence collection and
engraftment of autologous peripheral-blood stem cells. J. Clin. Oncol. 13, 2547–2555.
Bensinger, W., Dipersio, J. F., and McCarty, J. M. (2009). Improving stem cell mobilization
strategies: Future directions. Bone Marrow Transplant. 43, 181–195.
Bernhagen, J., Krohn, R., Lue, H., Gregory, J. L., Zernecke, A., Koenen, R. R.,
Dewor, M., Georgiev, I., Schober, A., Leng, L., Kooistra, T., Fingerle-Rowson, G.,
et al. (2007). MIF is a noncognate ligand of CXC chemokine receptors in inflammatory
and atherogenic cell recruitment. Nat. Med. 13, 587–596.
Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., and
Springer, T. A. (1996). The lymphocyte chemoattractant SDF-1 is a ligand for
LESTR/fusin and blocks HIV-1 entry. Nature 382, 829–833.
Blom, B., Ho, S., Antonenko, S., and Liu, Y. J. (2000). Generation of interferon alpha-
producing predendritic cell (Pre-DC)2 from human CD34(þ) hematopoietic stem cells.
J. Exp. Med. 192, 1785–1796.
Blom, B., and Spits, H. (2006). Development of human lymphoid cells. Annu. Rev. Immunol.
24, 287–320.
Boeve, S., Strupeck, J., Creech, S., and Stiff, P. J. (2004). Analysis of remobilization success
in patients undergoing autologous stem cell transplants who fail an initial mobilization:
Risk factors, cytokine use and cost. Bone Marrow Transplant. 33, 997–1003.
Boldajipour, B., Mahabaleshwar, H., Kardash, E., Reichman-Fried, M., Blaser, H.,
Minina, S., Wilson, D., Xu, Q., and Raz, E. (2008). Control of chemokine-guided
cell migration by ligand sequestration. Cell 132, 463–473.
Brown, R. A., Adkins, D., Goodnough, L. T., Haug, J. S., Todd, G., Wehde, M.,
Hendricks, D., Ehlenbeck, C., Laub, L., and DiPersio, J. (1997). Factors that influence
the collection and engraftment of allogeneic peripheral-blood stem cells in patients with
hematologic malignancies. J. Clin. Oncol. 15, 3067–3074.
Broxmeyer, H. E., Orschell, C. M., Clapp, D. W., Hangoc, G., Cooper, S., Plett, P. A.,
Liles, W. C., Li, X., Graham-Evans, B., Campbell, T. B., Calandra, G., Bridger, G., et al.
(2005). Rapid mobilization of murine and human hematopoietic stem and progenitor
cells with AMD3100, a CXCR4 antagonist. J. Exp. Med. 201, 1307–1318.
Broxmeyer, H. E., Srour, E., Orschell, C., Ingram, D. A., Cooper, S., Plett, P. A.,
Mead, L. E., and Yoder, M. C. (2006). Cord blood stem and progenitor cells. Methods
Enzymol. 419, 439–473.
Bryder, D., Sasaki, Y., Borge, O. J., and Jacobsen, S. E. (2004). Deceptive multilineage
reconstitution analysis of mice transplanted with hemopoietic stem cells, and implications
for assessment of stem cell numbers and lineage potentials. J. Immunol. 172, 1548–1552.
Burger, J. A., and Peled, A. (2009). CXCR4 antagonists: Targeting the microenvironment
in leukemia and other cancers. Leukemia 23, 43–52.
Burns, J. M., Summers, B. C., Wang, Y., Melikian, A., Berahovich, R., Miao, Z.,
Penfold, M. E., Sunshine, M. J., Littman, D. R., Kuo, C. J., Wei, K.,
McMaster, B. E., et al. (2006). A novel chemokine receptor for SDF-1 and I-TAC
82 Michael P. Rettig et al.

involved in cell survival, cell adhesion, and tumor development. J. Exp. Med. 203,
2201–2213.
Busillo, J. M., and Benovic, J. L. (2007). Regulation of CXCR4 signaling. Biochim. Biophys.
Acta 1768, 952–963.
Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D. P., Knight, M. C.,
Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F. R., Milner, L. A.,
Kronenberg, H. M., et al. (2003). Osteoblastic cells regulate the haematopoietic stem
cell niche. Nature 425, 841–846.
Cashman, J., Bockhold, K., Hogge, D. E., Eaves, A. C., and Eaves, C. J. (1997). Sustained
proliferation, multi-lineage differentiation and maintenance of primitive human haemo-
poietic cells in NOD/SCID mice transplanted with human cord blood. Br. J. Haematol.
98, 1026–1036.
Christopher, M. J., Liu, F., Hilton, M. J., Long, F., and Link, D. C. (2009). Suppression of
CXCL12 production by bone marrow osteoblasts is a common and critical pathway for
cytokine-induced mobilization. Blood doi: 10.1182/blood-2008-10-184754.
Coulombel, L. (2004). Identification of hematopoietic stem/progenitor cells: strength and
drawbacks of functional assays. Oncogene 23, 7210–7222.
Dar, A., Goichberg, P., Shinder, V., Kalinkovich, A., Kollet, O., Netzer, N., Margalit, R.,
Zsak, M., Nagler, A., Hardan, I., Resnick, I., Rot, A., et al. (2005). Chemokine receptor
CXCR4-dependent internalization and resecretion of functional chemokine SDF-1 by
bone marrow endothelial and stromal cells. Nat. Immunol. 6, 1038–1046.
de Haan, G., Ausema, A., Wilkens, M., Molineux, G., and Dontje, B. (2000). Efficient
mobilization of haematopoietic progenitors after a single injection of pegylated recombi-
nant human granulocyte colony-stimulating factor in mouse strains with distinct
marrow-cell pool sizes. Br. J. Haematol. 110, 638–646.
de Haan, G., Bystrykh, L. V., Weersing, E., Dontje, B., Geiger, H., Ivanova, N.,
Lemischka, I. R., Vellenga, E., and Van Zant, G. (2002). A genetic and genomic analysis
identifies a cluster of genes associated with hematopoietic cell turnover. Blood 100,
2056–2062.
Devine, S. M., Vij, R., Rettig, M., Todt, L., McGlauchlen, K., Fisher, N., Devine, H.,
Link, D. C., Calandra, G., Bridger, G., Westervelt, P., and Dipersio, J. F. (2008). Rapid
mobilization of functional donor hematopoietic cells without G-CSF using AMD3100,
an antagonist of the CXCR4/SDF-1 interaction. Blood 112, 990–998.
Dlubek, D., Drabczak-Skrzypek, D., and Lange, A. (2006). Low CXCR4 membrane
expression on CD34(þ) cells characterizes cells mobilized to blood. Bone Marrow Trans-
plant. 37, 19–23.
Eaves, C., Glimm, H., Eisterer, W., Audet, J., Maguer-Satta, V., and Piret, J. (2001).
Characterization of human hematopoietic cells with short-lived in vivo repopulating
activity. Ann. N. Y. Acad. Sci. 938, 63–70; discussion 70–71.
Ema, H., Morita, Y., Yamazaki, S., Matsubara, A., Seita, J., Tadokoro, Y., Kondo, H.,
Takano, H., and Nakauchi, H. (2006). Adult mouse hematopoietic stem cells: Purifica-
tion and single-cell assays. Nat. Protoc. 1, 2979–2987.
Faber, A., Roderburg, C., Wein, F., Saffrich, R., Seckinger, A., Horsch, K., Diehlmann, A.,
Wong, D., Bridger, G., Eckstein, V., Ho, A. D., and Wagner, W. (2007). The many
facets of SDF-1alpha, CXCR4 agonists and antagonists on hematopoietic progenitor
cells. J. Biomed. Biotechnol. 2007, 260–265.
Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A. (1996). HIV-1 entry cofactor:
Functional cDNA cloning of a seven-transmembrane, G protein–coupled receptor.
Science 272, 872–877.
Forster, R., Kremmer, E., Schubel, A., Breitfeld, D., Kleinschmidt, A., Nerl, C.,
Bernhardt, G., and Lipp, M. (1998). Intracellular and surface expression of the HIV-1
CXCR4 and Mobilization 83

coreceptor CXCR4/fusin on various leukocyte subsets: Rapid internalization and recy-


cling upon activation. J. Immunol. 160, 1522–1531.
Fredriksson, R., Lagerstrom, M. C., Lundin, L. G., and Schioth, H. B. (2003). The
G-protein-coupled receptors in the human genome form five main families. Phyloge-
netic analysis, paralogon groups, and fingerprints. Mol. Pharmacol. 63, 1256–1272.
Freud, A. G., Becknell, B., Roychowdhury, S., Mao, H. C., Ferketich, A. K., Nuovo, G. J.,
Hughes, T. L., Marburger, T. B., Sung, J., Baiocchi, R. A., Guimond, M., and
Caligiuri, M. A. (2005). A human CD34(þ) subset resides in lymph nodes and differ-
entiates into CD56bright natural killer cells. Immunity 22, 295–304.
Fruehauf, S., Seeger, T., Maier, P., Li, L., Weinhardt, S., Laufs, S., Wagner, W.,
Eckstein, V., Bridger, G., Calandra, G., Wenz, F., Zeller, W. J., et al. (2006). The
CXCR4 antagonist AMD3100 releases a subset of G-CSF–primed peripheral blood
progenitor cells with specific gene expression characteristics. Exp. Hematol. 34,
1052–1059.
Fukuda, S., Bian, H., King, A. G., and Pelus, L. M. (2007). The chemokine GRObeta
mobilizes early hematopoietic stem cells characterized by enhanced homing and engraft-
ment. Blood 110, 860–869.
Fukuda, S., and Pelus, L. M. (2008). Transmigration of human CD34þ cells. Methods Mol.
Biol. 430, 55–75.
Gandhi, M. K., Jestice, K., Scott, M. A., Bloxham, D., Bass, G., and Marcus, R. E. (1999).
The minimum CD34 threshold depends on prior chemotherapy in autologous peripheral
blood stem cell recipients. Bone Marrow Transplant. 23, 9–13.
Gazitt, Y., Freytes, C. O., Callander, N., Tsai, T. W., Alsina, M., Anderson, J., Holle, L.,
Cruz, J., Devore, P., McGrath, M., West, G., Alvarez, R., et al. (1999). Successful PBSC
mobilization with high-dose G-CSF for patients failing a first round of mobilization.
J. Hematother. 8, 173–183.
Giebel, B., and Punzel, M. (2008). Lineage development of hematopoietic stem and
progenitor cells. Biol. Chem. 389, 813–824.
Glimm, H., Eisterer, W., Lee, K., Cashman, J., Holyoake, T. L., Nicolini, F., Shultz, L. D.,
von Kalle, C., and Eaves, C. J. (2001). Previously undetected human hematopoietic cell
populations with short-term repopulating activity selectively engraft NOD/SCID-beta2
microglobulin-null mice. J. Clin. Invest. 107, 199–206.
Gorlin, R. J., Gelb, B., Diaz, G. A., Lofsness, K. G., Pittelkow, M. R., and Fenyk, J. R. Jr.
(2000). WHIM syndrome, an autosomal dominant disorder: Clinical, hematological, and
molecular studies. Am. J. Med. Genet. 91, 368–376.
Grande, F., Garofalo, A., and Neamati, N. (2008). Small molecules anti-HIV therapeutics
targeting CXCR4. Curr. Pharm. Des. 14, 385–404.
Group, S. C. T. C. (2005). Allogeneic peripheral blood stem-cell compared with bone
marrow transplantation in the management of hematologic malignancies: An individual
patient data meta-analysis of nine randomized trials. J. Clin Oncol. 23, 5074–5087.
Gulino, A. V. (2003). WHIM syndrome: A genetic disorder of leukocyte trafficking. Curr.
Opin. Allergy Clin. Immunol. 3, 443–450.
Gulino, A. V., Moratto, D., Sozzani, S., Cavadini, P., Otero, K., Tassone, L., Imberti, L.,
Pirovano, S., Notarangelo, L. D., Soresina, R., Mazzolari, E., Nelson, D. L., et al. (2004).
Altered leukocyte response to CXCL12 in patients with warts hypogammaglobulinemia,
infections, myelokathexis (WHIM) syndrome. Blood 104, 444–452.
Haribabu, B., Richardson, R. M., Fisher, I., Sozzani, S., Peiper, S. C., Horuk, R., Ali, H.,
and Snyderman, R. (1997). Regulation of human chemokine receptors CXCR4. Role
of phosphorylation in desensitization and internalization. J. Biol. Chem. 272,
28726–28731.
Harrison, D. E. (1980). Competitive repopulation: A new assay for long-term stem cell
functional capacity. Blood 55, 77–81.
84 Michael P. Rettig et al.

Harrison, D. E., Jordan, C. T., Zhong, R. K., and Astle, C. M. (1993). Primitive hemopoi-
etic stem cells: Direct assay of most productive populations by competitive repopulation
with simple binomial, correlation and covariance calculations. Exp. Hematol. 21,
206–219.
Hartmann, T. N., Grabovsky, V., Pasvolsky, R., Shulman, Z., Buss, E. C., Spiegel, A.,
Nagler, A., Lapidot, T., Thelen, M., and Alon, R. (2008). A crosstalk between intracel-
lular CXCR7 and CXCR4 involved in rapid CXCL12-triggered integrin activation but
not in chemokine-triggered motility of human T lymphocytes and CD34þ cells.
J. Leukoc. Biol. 84, 1130–1140.
Hattori, K., Heissig, B., Tashiro, K., Honjo, T., Tateno, M., Shieh, J. H., Hackett, N. R.,
Quitoriano, M. S., Crystal, R. G., Rafii, S., and Moore, M. A. (2001). Plasma elevation
of stromal cell-derived factor-1 induces mobilization of mature and immature hemato-
poietic progenitor and stem cells. Blood 97, 3354–3360.
Hawley, R. G., Ramezani, A., and Hawley, T. S. (2006). Hematopoietic stem cells. Methods
Enzymol. 419, 149–179.
Henon, P. R., Liang, H., Beck-Wirth, G., Eisenmann, J. C., Lepers, M., Wunder, E., and
Kandel, G. (1992). Comparison of hematopoietic and immune recovery after autologous
bone marrow or blood stem cell transplants. Bone Marrow Transplant. 9, 285–291.
Herbert, K. E., Levesque, J. P., Haylock, D. N., and Prince, H. M. (2008). The use of
experimental murine models to assess novel agents of hematopoietic stem and progenitor
cell mobilization. Biol. Blood Marrow Transplant. 14, 603–621.
Hernandez, J. M., Castilla, C., Gutierrez, N. C., Isidro, I. M., Delgado, M., de las Rivas, J.,
Ferminan, E., Garcia, J. L., Ocio, E. M., del Canizo, M. C., and San Miguel, J. F. (2005).
Mobilisation with G-CSF in healthy donors promotes a high but temporal deregulation
of genes. Leukemia 19, 1088–1091.
Hernandez, P. A., Gorlin, R. J., Lukens, J. N., Taniuchi, S., Bohinjec, J., Francois, F.,
Klotman, M. E., and Diaz, G. A. (2003). Mutations in the chemokine receptor gene
CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease.
Nat. Genet. 34, 70–74.
Hess, D. A., Bonde, J., Craft, T. P., Wirthlin, L., Hohm, S., Lahey, R., Todt, L. M.,
Dipersio, J. F., Devine, S. M., and Nolta, J. A. (2007). Human progenitor cells rapidly
mobilized by AMD3100 repopulate NOD/SCID mice with increased frequency in
comparison to cells from the same donor mobilized by granulocyte colony stimulating
factor. Biol. Blood Marrow Transplant. 13, 398–411.
Hill, G. R., Morris, E. S., Fuery, M., Hutchins, C., Butler, J., Grigg, A., Roberts, A.,
Bradstock, K., Szer, J., Kennedy, G., Morton, J., and Durrant, S. (2006). Allogeneic stem
cell transplantation with peripheral blood stem cells mobilized by pegylated G-CSF. Biol.
Blood Marrow Transplant. 12, 603–607.
Hubel, K., Liles, W. C., Broxmeyer, H. E., Rodger, E., Wood, B., Cooper, S., Hangoc, G.,
Macfarland, R., Bridger, G. J., Henson, G. W., Calandra, G., and Dale, D. C. (2004).
Leukocytosis and mobilization of CD34þ hematopoietic progenitor cells by AMD3100,
a CXCR4 antagonist. Support Cancer Ther. 1, 165–172.
Imai, K., Kobayashi, M., Wang, J., Shinobu, N., Yoshida, H., Hamada, J., Shindo, M.,
Higashino, F., Tanaka, J., Asaka, M., and Hosokawa, M. (1999). Selective secretion of
chemoattractants for haemopoietic progenitor cells by bone marrow endothelial cells:
A possible role in homing of haemopoietic progenitor cells to bone marrow. Br. J.
Haematol. 106, 905–911.
Ito, M., Hiramatsu, H., Kobayashi, K., Suzue, K., Kawahata, M., Hioki, K., Ueyama, Y.,
Koyanagi, Y., Sugamura, K., Tsuji, K., Heike, T., and Nakahata, T. (2002). NOD/
SCID/gamma(c)(null) mouse: An excellent recipient mouse model for engraftment of
human cells. Blood 100, 3175–3182.
CXCR4 and Mobilization 85

Iyer, C. V., Evans, R. J., Lou, Q., Lin, D., Wang, J., Kohn, W., Yan, L. Z., Pulley, S., and
Peng, S. B. (2008). Rapid and recurrent neutrophil mobilization regulated by T134,
a CXCR4 peptide antagonist. Exp. Hematol. 36, 1098–1109.
Jin, P., Wang, E., Ren, J., Childs, R., Shin, J. W., Khuu, H., Marincola, F. M., and
Stroncek, D. F. (2008). Differentiation of two types of mobilized peripheral blood
stem cells by microRNA and cDNA expression analysis. J. Translational Med. 6, 39.
Jung, Y., Wang, J., Schneider, A., Sun, Y. X., Koh-Paige, A. J., Osman, N. I.,
McCauley, L. K., and Taichman, R. S. (2006). Regulation of SDF-1 (CXCL12)
production by osteoblasts; a possible mechanism for stem cell homing. Bone 38, 497–508.
Katayama, Y., Battista, M., Kao, W. M., Hidalgo, A., Peired, A. J., Thomas, S. A., and
Frenette, P. S. (2006). Signals from the sympathetic nervous system regulate hemato-
poietic stem cell egress from bone marrow. Cell 124, 407–421.
Kawai, T., Choi, U., Cardwell, L., DeRavin, S. S., Naumann, N., Whiting-
Theobald, N. L., Linton, G. F., Moon, J., Murphy, P. M., and Malech, H. L. (2007).
WHIM syndrome myelokathexis reproduced in the NOD/SCID mouse xenotransplant
model engrafted with healthy human stem cells transduced with C-terminus–truncated
CXCR4. Blood 109, 78–84.
Kawai, T., Choi, U., Whiting-Theobald, N. L., Linton, G. F., Brenner, S., Sechler, J. M.,
Murphy, P. M., and Malech, H. L. (2005). Enhanced function with decreased internali-
zation of carboxy-terminus truncated CXCR4 responsible for WHIM syndrome. Exp.
Hematol. 33, 460–468.
Khan, A., Greenman, J., and Archibald, S. J. (2007). Small molecule CXCR4 chemokine
receptor antagonists: Developing drug candidates. Curr. Med. Chem. 14, 2257–2277.
Kiel, M. J., and Morrison, S. J. (2008). Uncertainty in the niches that maintain haemato-
poietic stem cells. Nat. Rev. Immunol. 8, 290–301.
Kiel, M. J., Yilmaz, O. H., Iwashita, T., Terhorst, C., and Morrison, S. J. (2005). SLAM
family receptors distinguish hematopoietic stem and progenitor cells and reveal endothe-
lial niches for stem cells. Cell 121, 1109–1121.
Kiger, A. A., White-Cooper, H., and Fuller, M. T. (2000). Somatic support cells restrict
germline stem cell self-renewal and promote differentiation. Nature 407, 750–754.
Kobbe, G., Sohngen, D., Bauser, U., Schneider, P., Germing, U., Thiele, K. P., Rieth, C.,
Hunerliturkoglu, A., Fischer, J., Frick, M., Wernet, P., Aul, C., et al. (1999). Factors
influencing G-CSF–mediated mobilization of hematopoietic progenitor cells during
steady-state hematopoiesis in patients with malignant lymphoma and multiple myeloma.
Ann. Hematol. 78, 456–462.
Kollet, O., Dar, A., and Lapidot, T. (2007). The multiple roles of osteoclasts in host defense:
Bone remodeling and hematopoietic stem cell mobilization. Annu. Rev. Immunol. 25,
51–69.
Kollet, O., Peled, A., Byk, T., Ben-Hur, H., Greiner, D., Shultz, L., and Lapidot, T. (2000).
beta2 microglobulin-deficient (B2m(null)) NOD/SCID mice are excellent recipients for
studying human stem cell function. Blood 95, 3102–3105.
Kollet, O., Spiegel, A., Peled, A., Petit, I., Byk, T., Hershkoviz, R., Guetta, E., Barkai, G.,
Nagler, A., and Lapidot, T. (2001). Rapid and efficient homing of human CD34(þ)
CD38(-/low)CXCR4(þ) stem and progenitor cells to the bone marrow and spleen of
NOD/SCID and NOD/SCID/B2m(null) mice. Blood 97, 3283–3291.
Kroschinsky, F., Holig, K., and Ehninger, G. (2008). The role of pegfilgrastim in mobiliza-
tion of hematopoietic stem cells. Transfus. Apheresis Sci. 38, 237–244.
Kroschinsky, F., Holig, K., Poppe-Thiede, K., Zimmer, K., Ordemann, R.,
Blechschmidt, M., Oelschlaegel, U., Bornhauser, M., Rall, G., Rutt, C., and
Ehninger, G. (2005). Single-dose pegfilgrastim for the mobilization of allogeneic
CD34þ peripheral blood progenitor cells in healthy family and unrelated donors.
Haematologica 90, 1665–1671.
86 Michael P. Rettig et al.

Kucia, M., Jankowski, K., Reca, R., Wysoczynski, M., Bandura, L., Allendorf, D. J.,
Zhang, J., Ratajczak, J., and Ratajczak, M. Z. (2004). CXCR4-SDF-1 signalling,
locomotion, chemotaxis and adhesion. J. Mol. Histol. 35, 233–245.
Lane, T. A., Law, P., Maruyama, M., Young, D., Burgess, J., Mullen, M., Mealiffe, M.,
Terstappen, L. W., Hardwick, A., and Moubayed, M. (1995). Harvesting and enrich-
ment of hematopoietic progenitor cells mobilized into the peripheral blood of normal
donors by granulocyte-macrophage colony-stimulating factor (GM-CSF) or G-CSF:
Potential role in allogeneic marrow transplantation. Blood 85, 275–282.
Lapidot, T., Dar, A., and Kollet, O. (2005). How do stem cells find their way home? Blood
106, 1901–1910.
Larochelle, A., Vormoor, J., Hanenberg, H., Wang, J. C., Bhatia, M., Lapidot, T.,
Moritz, T., Murdoch, B., Xiao, X. L., Kato, I., Williams, D. A., and Dick, J. E.
(1996). Identification of primitive human hematopoietic cells capable of repopulating
NOD/SCID mouse bone marrow: Implications for gene therapy. Nat. Med. 2,
1329–1337.
Lemieux, M. E., Rebel, V. I., Lansdorp, P. M., and Eaves, C. J. (1995). Characterization
and purification of a primitive hematopoietic cell type in adult mouse marrow capable of
lymphomyeloid differentiation in long-term marrow ‘‘switch’’ cultures. Blood 86,
1339–1347.
Levesque, J. P., Hendy, J., Takamatsu, Y., Simmons, P. J., and Bendall, L. J. (2003).
Disruption of the CXCR4/CXCL12 chemotactic interaction during hematopoietic
stem cell mobilization induced by GCSF or cyclophosphamide. J. Clin. Invest. 111,
187–196.
Liles, W. C., Broxmeyer, H. E., Rodger, E., Wood, B., Hubel, K., Cooper, S., Hangoc, G.,
Bridger, G. J., Henson, G. W., Calandra, G., and Dale, D. C. (2003). Mobilization of
hematopoietic progenitor cells in healthy volunteers by AMD3100, a CXCR4 antago-
nist. Blood 102, 2728–2730.
Lin, K. K., and Goodell, M. A. (2006). Purification of hematopoietic stem cells using the side
population. Methods Enzymol. 420, 255–264.
Loetscher, M., Geiser, T., O’Reilly, T., Zwahlen, R., Baggiolini, M., and Moser, B. (1994).
Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly
expressed in leukocytes. J. Biol. Chem. 269, 232–237.
Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa, T., Kishimoto, T.,
Bronson, R. T., and Springer, T. A. (1998). Impaired B-lymphopoiesis, myelopoiesis,
and derailed cerebellar neuron migration in CXCR4- and SDF-1–deficient mice. Proc.
Natl. Acad. Sci. USA 95, 9448–9453.
Ma, Q., Jones, D., and Springer, T. A. (1999). The chemokine receptor CXCR4 is required
for the retention of B lineage and granulocytic precursors within the bone marrow
microenvironment. Immunity 10, 463–471.
Marchese, A., Paing, M. M., Temple, B. R., and Trejo, J. (2008). G protein–coupled
receptor sorting to endosomes and lysosomes. Annu. Rev. Pharmacol. Toxicol. 48,
601–629.
McKenzie, J. L., Gan, O. I., Doedens, M., and Dick, J. E. (2005). Human short-term
repopulating stem cells are efficiently detected following intrafemoral transplantation into
NOD/SCID recipients depleted of CD122þ cells. Blood 106, 1259–1261.
Miller, C. L., Dykstra, B., and Eaves, C. J. (2008). Characterization of mouse hematopoietic
stem and progenitor cells. Curr. Protoc. Immunol. 22, Unit 22B 2.
Molineux, G., Pojda, Z., and Dexter, T. M. (1990). A comparison of hematopoiesis in
normal and splenectomized mice treated with granulocyte colony-stimulating factor.
Blood 75, 563–569.
Montgomery, M., and Cottler-Fox, M. (2007). Mobilization and collection of autologous
hematopoietic progenitor/stem cells. Clin. Adv. Hematol. Oncol. 5, 127–136.
CXCR4 and Mobilization 87

MOZOBIL (2008). Plerixafor Injection. (Package insert) Genzyme Corporation.


Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y.,
Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis
and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1.
Nature 382, 635–638.
Nagler, A., Korenstein-Ilan, A., Amiel, A., and Avivi, L. (2004). Granulocyte colony-
stimulating factor generates epigenetic and genetic alterations in lymphocytes of normal
volunteer donors of stem cells. Exp. Hematol. 32, 122–130.
Nervi, B., Link, D. C., and DiPersio, J. F. (2006). Cytokines and hematopoietic stem cell
mobilization. J. Cell Biochem. 99, 690–705.
Nervi, B., Ramirez, P., Rettig, M. P., Uy, G. L., Holt, M. S., Ritchey, J. K., Prior, J. L.,
Piwnica-Worms, D., Bridger, G., Ley, T. J., and Dipersio, J. F. (2009). Chemosensitiza-
tion of AML following mobilization by the CXCR4 antagonist AMD3100. Blood doi:
10.1182/blood-2008-06-162123.
Neupogen (1991–2006). Filgrastim. (Package insert) Amgen Inc., Thousand Oaks, CA.
Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F.,
Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M.,
et al. (1996). The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents
infection by T-cell-line–adapted HIV-1. Nature 382, 833–835.
Oelschlaegel, U., Bornhauser, M., Boxberger, S., Kroschinsky, F., Illmer, T., Hoelig, K.,
Calandra, G., Ehninger, G., and Platzbecker, U. (2007). Kinetics of CXCR-4 and
adhesion molecule expression during autologous stem cell mobilisation with G-CSF
plus AMD3100 in patients with multiple myeloma. Ann. Hematol. 86, 569–573.
Orsini, M. J., Parent, J. L., Mundell, S. J., Marchese, A., and Benovic, J. L. (1999).
Trafficking of the HIV coreceptor CXCR4. Role of arrestins and identification of
residues in the C-terminal tail that mediate receptor internalization. J. Biol. Chem. 274,
31076–31086.
Papayannopoulou, T., and Scadden, D. T. (2008). Stem-cell ecology and stem cells in
motion. Blood 111, 3923–3930.
Peled, A., Petit, I., Kollet, O., Magid, M., Ponomaryov, T., Byk, T., Nagler, A.,
Ben-Hur, H., Many, A., Shultz, L., Lider, O., Alon, R., et al. (1999). Dependence of
human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science
283, 845–848.
Pelus, L. M. (2008). Peripheral blood stem cell mobilization: New regimens, new cells,
where do we stand. Curr. Opin. Hematol. 15, 285–292.
Pelus, L. M., Bian, H., Fukuda, S., Wong, D., Merzouk, A., and Salari, H. (2005). The
CXCR4 agonist peptide, CTCE-0021, rapidly mobilizes polymorphonuclear neutro-
phils and hematopoietic progenitor cells into peripheral blood and synergizes with
granulocyte colony-stimulating factor. Exp. Hematol. 33, 295–307.
Pelus, L. M., and Fukuda, S. (2008). Chemokine-mobilized adult stem cells: Defining a
better hematopoietic graft. Leukemia 22, 466–473.
Pflumio, F., Izac, B., Katz, A., Shultz, L. D., Vainchenker, W., and Coulombel, L. (1996).
Phenotype and function of human hematopoietic cells engrafting immune-deficient
CB17-severe combined immunodeficiency mice and nonobese diabetic–severe com-
bined immunodeficiency mice after transplantation of human cord blood mononuclear
cells. Blood 88, 3731–3740.
Ponomaryov, T., Peled, A., Petit, I., Taichman, R. S., Habler, L., Sandbank, J., Arenzana-
Seisdedos, F., Magerus, A., Caruz, A., Fujii, N., Nagler, A., Lahav, M., et al. (2000).
Induction of the chemokine stromal-derived factor-1 following DNA damage improves
human stem cell function. J. Clin. Invest. 106, 1331–1339.
Purton, L. E., and Scadden, D. T. (2007). Limiting factors in murine hematopoietic stem cell
assays. Cell Stem Cell 1, 263–270.
88 Michael P. Rettig et al.

Pusic, I., Jiang, S. Y., Landua, S., Uy, G. L., Rettig, M. P., Cashen, A. F., Westervelt, P.,
Vij, R., Abboud, C. N., Stockerl-Goldstein, K. E., Sempek, D. S., Smith, A. L., et al.
(2008). Impact of mobilization and remobilization strategies on achieving sufficient stem
cell yields for autologous transplantation. Biol. Blood Marrow Transplant. 14, 1045–1056.
Ramirez, P. A., Rettig, M., Holt, M., Ritchey, J. K., and DiPersio, J. F. (2008). Rapid
mobilization of long term repopulating hematopoietic stem cells (HSC) with
AMD15057, a small molecule inhibitor of VLA4; synergism with AMD3100 and
G-CSF. Blood 112, 229:615a.
Rettig, M. P., Shannon, W. D., Ritchey, J., Holt, M., McFarland, K., Lopez, S., Gabriel, J.,
and DiPersio, J. F. (2008). Characterization of human CD34þ hematopoietic stem cells
following administration of G-CSF or plerixafor. Blood 112, 1192:3476a.
Roberts, A. W., Foote, S., Alexander, W. S., Scott, C., Robb, L., and Metcalf, D. (1997).
Genetic influences determining progenitor cell mobilization and leukocytosis induced by
granulocyte colony-stimulating factor. Blood 89, 2736–2744.
Robinson, S. N., and van Os, R. P. (2008). Mobilization of hematopoietic stem and
progenitor cells in mice. Methods Mol. Biol. 430, 31–53.
Schmitz, N., Linch, D. C., Dreger, P., Goldstone, A. H., Boogaerts, M. A., Ferrant, A.,
Demuynck, H. M., Link, H., Zander, A., and Barge, A. (1996). Randomised trial of
filgrastim-mobilised peripheral blood progenitor cell transplantation versus autologous
bone-marrow transplantation in lymphoma patients. Lancet 347, 353–357.
Semerad, C. L., Christopher, M. J., Liu, F., Short, B., Simmons, P. J., Winkler, I.,
Levesque, J. P., Chappel, J., Ross, F. P., and Link, D. C. (2005). G-CSF potently inhibits
osteoblast activity and CXCL12 mRNA expression in the bone marrow. Blood 106,
3020–3027.
Shalekoff, S., and Tiemessen, C. T. (2001). Duration of sample storage dramatically alters
expression of the human immunodeficiency virus coreceptors CXCR4 and CCR5. Clin.
Diagn. Lab. Immunol. 8, 432–436.
Shapira, M. Y., Kaspler, P., Samuel, S., Shoshan, S., and Or, R. (2003). Granulocyte colony
stimulating factor does not induce long-term DNA instability in healthy peripheral blood
stem cell donors. Am. J. Hematol. 73, 33–36.
Shen, H., Cheng, T., Olszak, I., Garcia-Zepeda, E., Lu, Z., Herrmann, S., Fallon, R.,
Luster, A. D., and Scadden, D. T. (2001). CXCR-4 desensitization is associated with
tissue localization of hemopoietic progenitor cells. J. Immunol. 166, 5027–5033.
Sheridan, W. P., Begley, C. G., To, L. B., Grigg, A., Szer, J., Maher, D., Green, M. D.,
Rowlings, P. A., McGrath, K. M., and Cebon, J. (1994). Phase II study of autologous
filgrastim (G-CSF)-mobilized peripheral blood progenitor cells to restore hemopoiesis
after high-dose chemotherapy for lymphoid malignancies. Bone Marrow Transplant. 14,
105–111.
Shultz, L. D., Lyons, B. L., Burzenski, L. M., Gott, B., Chen, X., Chaleff, S., Kotb, M.,
Gillies, S. D., King, M., Mangada, J., Greiner, D. L., and Handgretinger, R. (2005).
Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R gamma null
mice engrafted with mobilized human hemopoietic stem cells. J. Immunol. 174,
6477–6489.
Sierro, F., Biben, C., Martinez-Munoz, L., Mellado, M., Ransohoff, R. M., Li, M.,
Woehl, B., Leung, H., Groom, J., Batten, M., Harvey, R. P., Martinez, A. C., et al.
(2007). Disrupted cardiac development but normal hematopoiesis in mice deficient in the
second CXCL12/SDF-1 receptor, CXCR7. Proc. Natl. Acad. Sci. USA 104,
14759–14764.
Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F.,
Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., Luther, M. A.,
Wells, T. N., et al. (1997). Phorbol esters and SDF-1 induce rapid endocytosis and
down modulation of the chemokine receptor CXCR4. J. Cell Biol. 139, 651–664.
CXCR4 and Mobilization 89

Signoret, N., Rosenkilde, M. M., Klasse, P. J., Schwartz, T. W., Malim, M. H., Hoxie, J. A.,
and Marsh, M. (1998). Differential regulation of CXCR4 and CCR5 endocytosis. J. Cell
Sci. 111(Pt 18), 2819–2830.
Sugiyama, T., Kohara, H., Noda, M., and Nagasawa, T. (2006). Maintenance of the
hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone
marrow stromal cell niches. Immunity 25, 977–988.
Sutherland, H. J., Eaves, C. J., Eaves, A. C., Dragowska, W., and Lansdorp, P. M. (1989).
Characterization and partial purification of human marrow cells capable of initiating
long-term hematopoiesis in vitro. Blood 74, 1563–1570.
Sutherland, H. J., Eaves, C. J., Lansdorp, P. M., Thacker, J. D., and Hogge, D. E. (1991).
Differential regulation of primitive human hematopoietic cells in long-term cultures
maintained on genetically engineered murine stromal cells. Blood 78, 666–672.
Sweeney, E. A., Lortat-Jacob, H., Priestley, G. V., Nakamoto, B., and Papayannopoulou, T.
(2002). Sulfated polysaccharides increase plasma levels of SDF-1 in monkeys and mice:
Involvement in mobilization of stem/progenitor cells. Blood 99, 44–51.
Szilvassy, S. J., Humphries, R. K., Lansdorp, P. M., Eaves, A. C., and Eaves, C. J. (1990).
Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive
repopulation strategy. Proc. Natl. Acad. Sci. USA 87, 8736–8740.
Szilvassy, S. J., Lansdorp, P. M., Humphries, R. K., Eaves, A. C., and Eaves, C. J. (1989).
Isolation in a single step of a highly enriched murine hematopoietic stem cell population
with competitive long-term repopulating ability. Blood 74, 930–939.
Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y.,
Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998).
The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal
tract. Nature 393, 591–594.
Taswell, C. (1981). Limiting dilution assays for the determination of immunocompetent cell
frequencies. I. Data analysis. J. Immunol. 126, 1614–1619.
Tigue, C. C., McKoy, J. M., Evens, A. M., Trifilio, S. M., Tallman, M. S., and
Bennett, C. L. (2007). Granulocyte-colony stimulating factor administration to healthy
individuals and persons with chronic neutropenia or cancer: An overview of safety
considerations from the Research on Adverse Drug Events and Reports project. Bone
Marrow Transplant. 40, 185–192.
Tricot, G., Jagannath, S., Vesole, D., Nelson, J., Tindle, S., Miller, L., Cheson, B.,
Crowley, J., and Barlogie, B. (1995). Peripheral blood stem cell transplants for multiple
myeloma: Identification of favorable variables for rapid engraftment in 225 patients. Blood
85, 588–96.
Uy, G. L., Rettig, M. P., and Cashen, A. F. (2008). Plerixafor, a CXCR4 antagonist for the
mobilization of hematopoietic stem cells. Expert Opin. Biol. Ther. 8, 1797–804.
van Os, R. P., Dethmers-Ausema, B., and de Haan, G. (2008). In vitro assays for cobblestone
area-forming cells, LTC-IC, and CFU-C. Methods Mol. Biol. 430, 143–57.
Voermans, C., Kooi, M. L., Rodenhuis, S., van der Lelie, H., van der Schoot, C. E., and
Gerritsen, W. R. (2001). In vitro migratory capacity of CD34þ cells is related to
hematopoietic recovery after autologous stem cell transplantation. Blood 97, 799–804.
Wang, S., Nademanee, A., Qian, D., Dagis, A., Park, H. S., Fridey, J., Smith, E., Snyder, D.,
Somlo, G., Stein, A., Rosenthal, J., Falk, P., et al. (2007). Peripheral blood hematopoietic
stem cell mobilization and collection efficacy is not an independent prognostic factor for
autologous stem cell transplantation. Transfusion 47, 2207–2216.
Watt, S. M., and Forde, S. P. (2008). The central role of the chemokine receptor, CXCR4,
in haemopoietic stem cell transplantation: Will CXCR4 antagonists contribute to the
treatment of blood disorders? Vox Sang 94, 18–32.
Weaver, C. H., Hazelton, B., Birch, R., Palmer, P., Allen, C., Schwartzberg, L., and
West, W. (1995). An analysis of engraftment kinetics as a function of the CD34 content
90 Michael P. Rettig et al.

of peripheral blood progenitor cell collections in 692 patients after the administration of
myeloablative chemotherapy. Blood 86, 3961–3969.
Weissman, I. L., and Shizuru, J. A. (2008). The origins of the identification and isolation of
hematopoietic stem cells, and their capability to induce donor-specific transplantation
tolerance and treat autoimmune diseases. Blood 112, 3543–3553.
Wilson, A., and Trumpp, A. (2006). Bone-marrow haematopoietic-stem-cell niches. Nat.
Rev. Immunol. 6, 93–106.
Winkler, I. G., and Levesque, J. P. (2006). Mechanisms of hematopoietic stem cell mobili-
zation: When innate immunity assails the cells that make blood and bone. Exp. Hematol.
34, 996–1009.
Xie, T., and Spradling, A. C. (2000). A niche maintaining germ line stem cells in the
Drosophila ovary. Science 290, 328–330.
Yang, O. O., Swanberg, S. L., Lu, Z., Dziejman, M., McCoy, J., Luster, A. D.,
Walker, B. D., and Herrmann, S. H. (1999). Enhanced inhibition of human immunode-
ficiency virus type 1 by Met-stromal-derived factor 1beta correlates with down-
modulation of CXCR4. J. Virol. 73, 4582–4589.
Yuan, R., Astle, C. M., Chen, J., and Harrison, D. E. (2005). Genetic regulation of
hematopoietic stem cell exhaustion during development and growth. Exp. Hematol.
33, 243–250.
Zamboni, W. C. (2003). Pharmacokinetics of pegfilgrastim. Pharmacotherapy 23, 9S–14S.
Zeller, W., Gutensohn, K., Stockschlader, M., Dierlamm, J., Kroger, N., Koehne, G.,
Hummel, K., Kabisch, H., Weh, H. J., Kuhnl, P., Hossfeld, D. K., and Zander, A. R.
(1996). Increase of mobilized CD34-positive peripheral blood progenitor cells in patients
with Hodgkin’s disease, non-Hodgkin’s lymphoma, and cancer of the testis. Bone Marrow
Transplant. 17, 709–713.
Zhang, Y., Foudi, A., Geay, J. F., Berthebaud, M., Buet, D., Jarrier, P., Jalil, A.,
Vainchenker, W., and Louache, F. (2004). Intracellular localization and constitutive
endocytosis of CXCR4 in human CD34þ hematopoietic progenitor cells. Stem Cells
22, 1015–1029.
Zhong, R., Law, P., Wong, D., Merzouk, A., Salari, H., and Ball, E. D. (2004). Small
peptide analogs to stromal derived factor-1 enhance chemotactic migration of human and
mouse hematopoietic cells. Exp. Hematol. 32, 470–475.
Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998).
Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar
development. Nature 393, 595–599.
C H A P T E R F O U R

Double-Label Nonradioactive In Situ


Hybridization for the Analysis of
Chemokine Receptor Expression in the
Central Nervous System
Meizhang Li and Richard M. Ransohoff

Contents
1. Introduction 92
2. Basic Protocol for ISH (Using Digoxygenin-Labeled Probe) 93
2.1. Equipment and reagent 93
2.2. Tissue preparation 94
2.3. Total RNA purification 94
2.4. First-strand cDNA synthesis 95
2.5. cDNA clones of chemokine receptors 95
2.6. Generation of ISH probe by in vitro transcription 96
2.7. Hybridization 97
2.8. Posthybridization washing 98
2.9. Development of ISH signals 98
2.10. Controls 99
3. Comments 101
References 102

Abstract
Chemokines are a family of mainly-secreted proteins, traditionally associated
with regulation of leukocyte trafficking during host defense and pathological
immune/inflammatory reactions. All chemokines signal to G protein-coupled
receptors. Recent studies show that chemokines and their receptors are also
expressed by neuroepithelial cells, and govern developmental, physiological
and pathological processes through actions towards these cells, as well
as infiltrating and resident hematopoietic cells. Understanding chemokine
action at the tissue level therefore requires defining which cells express
chemokine receptors. At a first level of approximation (and lacking appropriate

Neuroinflammation Research Center, Department of Neurosciences, Lerner Research Institute, Cleveland


Clinic, Cleveland, Ohio, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05204-5 All rights reserved.

91
92 Meizhang Li and Richard M. Ransohoff

immunohistochemical reagents) this determination can be made by in situ


hybridization (ISH), which localizes mRNA expression for chemokines and
their receptors at the cellular level. Here we provide a protocol for ISH and
demonstrate its application for localizing mRNA encoding two chemokine recep-
tors, CXCR4 and CXCR7 in murine CNS tissues.

1. Introduction
In the central nervous system (CNS), chemokines and chemokine
receptors are constitutively or inducibly expressed in neurons (Belmadani
et al., 2005; Hermann et al., 2008; Khan et al., 2008; Lu et al., 2002), astrocytes
(Carter et al., 2007; van Heteren et al., 2008; Zheng et al., 2008), microglia
(Biber et al., 2002; Cardona et al., 2006; Huang et al., 2005), and oligoden-
drocyte lineage cells (Dziembowska et al., 2005; Kadi et al., 2006; Padovani-
Claudio et al., 2006). In this regard, chemokines represent an inherent system
that helps establish and maintain CNS homeostasis (Li and Ransohoff, 2008).
The healthy CNS is an immune activity–free site, which peripheral leuko-
cytes do not enter freely due to the unique structure of the blood–brain
barrier (BBB) (Ransohoff et al., 2003). Furthermore, dendritic cells (DCs) as
the key antigen-presenting cells in both adaptive immunity and autoimmu-
nity, are absent from the healthy CNS (Pashenkov and Teleshova, 2003).
Thus, aberrant invasion of peripheral leukocytes into the CNS is a cardinal
feature of neuroinflammation-mediated human brain disorders.
Multiple sclerosis (MS) is a neuroinflammation-mediated demyelinating
disease. Previous studies demonstrated expression of chemokines and chemo-
kine receptors in CNS lesions in MS tissue sections (Srensen et al., 2002;
Trebst et al., 2003; Mahad et al., 2004; Kivisäkk, et al., 2004). In a mouse model
of inflammation-mediated demyelination, experimental autoimmune enceph-
alomyelitis (EAE), expression of chemokines was reproducibly and specifically
increased (Ransohoff et al., 1997). Detailed analyses further supported the
hypothesis that chemokines regulated the recruitment of peripheral leukocytes
into the CNS (Huang et al., 2000; Lu et al., 2002; Mahad et al., 2003) during
neuroinflammation. In addition, chemokines potentially mediate local cellular
pathogenesis in the lesion sites of EAE (Carlson et al., 2008; Sunnemark et al.,
2005). Unfortunately, very few chemokine receptor antibodies are suitable for
application in immunohistochemical evaluation of murine CNS tissues. False-
positive results are more the rule than the exception. To further explore the
roles of chemokine receptors in mouse models of CNS diseases, we applied
double-label nonradioactive in situ hybridization (double ISH) to evaluate the
expression of chemokine receptors in various cell types (Fig. 4.1). ISH also
provides a useful method to establish the cellular sources of chemokine recep-
tor expression (Ransohoff et al., 1997).
Double-Label Nonradioactive In Situ Hybridization 93

A B

C D

E F

F⬘

Figure 4.1 Detection of CXCR4 and CXCR7 mRNA expression in healthy ventral
spinal cord by double-fluorescent ISH. Double-fluorescent ISH was performed with
digoxygenin-labeled antisense CXCR4 probe (red, developed with Texas red) and
CXCR7 (green, developed with tyramide-fluorescein). Colocalization of CXCR4 and
CXCR7 in a neuron was indicated by arrows. (A) CXCR7; (B) CXCR4; (C) DAPI;
(D) CXCR7 and CXCR4; (E) CXCR7, CXCR4, and DAPI. An area was shown by
both low power (F) and high power (F0 ). Scale bars: 0.4 cm ¼ 25 mm.

2. Basic Protocol for ISH (Using Digoxygenin-


Labeled Probe)
2.1. Equipment and reagent
1. Moist chamber
2. Hybridization oven
3. TRIzol Reagent (Invitrogen, Carlsbad, CA)
4. Hybri-Well Press-Seal hybridization chamber (Sigma, St.Louis, MO)
94 Meizhang Li and Richard M. Ransohoff

5. SuperScript III First-strand synthesis system for reverse transcription


polymerase chain reaction (Invitrogen, Carlsbad, CA)
6. TOPO TA cloning kit (Invitrogen, Carlsbad, CA)
7. TSA Fluorescein system (PerkinElmer, Massachusetts, MA)
8. DIG RNA labeling mix (Roche, Indianapolis, IN)
9. Biotin RNA labeling mix (Roche, Indianapolis, IN)
10. Fluorescein RNA labeling mix (Roche, Indianapolis, IN)
11. Superfrost Plus microscope slides (Fisher, Pittsburgh, PA)
Solutions are prepared with autoclaved 1% (v/v) diethyl pyrocarbonate
water (DEPC-water). All glassware is washed in DEPC water and baked at
125 to 150 overnight.

2.2. Tissue preparation


1. All tissue preparation is done with gloves to avoid RNase contamination.
To purify high-quality total RNA, fresh tissues are needed.
2. Paraffin-embedded tissues: Tissues are dissected from experimental animals
and fixed in 10% (w/v) formalin (Fisher, Pittsburgh, PA) for at least 5 days
at room temperature (RT). Paraffin-embedded tissues are prepared by a
histology service (housed either in a clinical pathology department or
research department core facility). Sections are collected on Superfrost
Plus microscope slides at a thickness between 5 to 30 mm. One slide
from each block is stained with hematoxylin and eosin (H&E) for histology
correlation. Slides can be kept in histology box at RT for quite a long time.
Sections need to be deparaffinization before hybridization. Briefly, slides
are baked at 65 for 15 min until the paraffin is melted and immediately
immersed in staining trays through two changes of fresh xylene (10 min for
each) with gentle mixing. For rehydration, slides are passed twice through
100, 95, and 75% ethanol, respectively, and rinsed once in 1 PBS.
3. Paraformaldehyde (PFA) fixed tissues: Animals are sacrificed and perfused
with 4% (w/v) PFA. Brains and spinal cords are removed from animals and
fixed in 4% PFA at 4 overnight, following treatment with 15 to 30%
(w/v) sucrose for 1 to 3 days at 4 . Tissues are embedded in Tissue-Tek
O.C.T. Compound (Sakura). Next, 15 to 30 mm tissue sections are col-
lected on the Superfrost Plus microscope slides by cryosectioning. Slides
are dried at RT and baked at 50 for 30 min before hybridization.
4. Frozen tissues: Fresh tissues are directly frozen on dry ice and sectioned
by cryosectioning.

2.3. Total RNA purification


Homogenize 50 mg of tissue in 1 ml of TRIzol Reagent by using a 1-ml tip
and leave at RT for 5 to 10 min. Add 0.2 ml of chloroform and vortex.
Centrifuge the sample at 12,000 rpm for 15 min. Transfer the supernatant
Double-Label Nonradioactive In Situ Hybridization 95

carefully in a clean 1.5 ml-Eppendorf tube. Precipitate the total RNA by


adding 0.5 ml of isopropanol and centrifuge the sample at 12,000 rpm for
15 min. Wash the total RNA pellet once with 75% ethanol. Spin the sample
at 12,000 rpm for 15 min and completely remove the residual ethanol.
Use 100 ml RNase-free water to dissolve the total RNA. Remove 2 ml
sample for OD260/280 measurement. The OD260/280 for purity RNA should
be between 1.99 and 2.1. Alternatively, check the total RNA quality on a
1.2% (w/v) agarose gel, using ethidium bromide staining and UV light to
visualize ribosomal RNA bands.

2.4. First-strand cDNA synthesis


Use SuperScript III first-strand synthesis system (Invitrogen) and follow the
protocol provided by the manufacturer to synthesize the first-strand cDNA.
Briefly, prepare 10 ml of mix (including 1 ml 50 mM oligo (dT)20, 1 ml
10 mM dNTP, and 1 mg total RNA in 8 ml RNase-free water). Incubate
10 ml mix at 65 for 5 min and place on ice for at least 1 min. Prepare
another 10 ml of reaction buffer according the following recipe:
10  RT buffer, 2 ml
25 mM MgCl2, 4 ml
0.1 M DTT, 2 ml
RNase inhibitor (40 U/ml), 1 ml
SuperScript III RT (200 U/ml), 1 ml
Add this reaction buffer to the 10-ml mix and incubate at 50 for 50 min.
Stop the reaction at 85 for 5 min and chill on ice. Finally, add 1 ml of
RNaseH and incubate the reaction at 37 for 20 min.

2.5. cDNA clones of chemokine receptors


1. Design specific PCR primers for chemokines or chemokine receptors.
2. Use 0.5 ml first-strand DNA as PCR template to amplify the expression
fragments of chemokines or chemokine receptors in a 25-ml PCR
reaction described in the following:
 Water, 18.85 ml
 10  PCR buffer, 2.5 ml
 10 nM dNTP, 0.4 ml
 20 nM forward primer, 0.50 ml
 20 nM reverse primer, 0.50 ml
 50 mM MgCl2, 0.75 ml
 DNA polymerase (1 U/ml), 0.5 ml
Run the PCR reactions in a thermal cycler by denaturing at 95 for
1 min; anneal at 58 , 1 min; and extend at 72 , 1.5 min, for a total 30
cycles.
96 Meizhang Li and Richard M. Ransohoff

3. After PCR, remove 5 ml PCR product to run a 1.2% agarose gel and
check the PCR amplification.
4. Set up a TOPO cloning reaction by following the standard protocol
provided by the manufacturer. Briefly, prepare 6 ml of reaction mix
(1.0 ml fresh PCR product, 3 ml salt solution, 3 ml water, 1 ml TOPO
vector), and incubate the reaction at RT for 5 min.
5. Mix 2 ml TOPO cloning reaction with competent Escherichia coli cells
and mix gently.
6. Incubate the competent cells on ice for 30 min and heat-shock for 30 s at
42 .
7. Add 250 ml S.O.C. medium (recipe for 1000 ml of S.O.C. medium is
described in the following) and shake the competent cells at 37 for 1 h.
Bacto-tryptone (Becton, Dickinson and Company, USA), 20 g
Bacto-yeast extract (Becton, Dickinson and Company, USA), 5 g
NaCl, 0.5 g
1 M KCl, 2.5 ml
Add water, 1000 ml
Note: Adjust pH to 7.0 with 10 M NaOH, autoclave to sterilize, and add
20 ml of sterile 1 M glucose immediately before use.
8. Spread 10 to 100 ml cells on 100 mg/ml ampicillin agar plates, and
incubate plates at 37 overnight.
9. Randomly pick 10 colonies to culture the bacteria and prepare plasmid
DNAs. Verify the cDNA plasmid clones by restriction enzyme (RE)
analysis or sequencing.

2.6. Generation of ISH probe by in vitro transcription


1. Digest 10 mg plasmid DNA with an appropriate RE at 37 for 1 h.
Check the plasmid DNA digestion in 1.2% agarose gel.
Note: Set up two digestion reactions in 1.5-ml Eppendorf tubes. One is
for antisense labeling and another for sense-control labeling.
2. Precipitate linearized DNA by adding one-ninth volume of 3 M
NaOAc, pH 4.8, and two volumes of 100% ethanol.
3. Spin down at 4 for 15 min. Wash the pellet once with 70% ethanol.
4. Resuspend the pellet in 50 ml RNase-free water.
5. Prepare a 50 ml IVT reaction described as follows:
10  reaction buffer, 5 ml
0.1 M DTT, 5 ml
Digoxygenin-UTP mix, 2.5 ml
RNAsin, 10 units
RNA polymerase (T3, T7, or Sp6), 90units
Linearized plasmid DNAs, 1 to 2.5 mg
RNase-free water, up to 50 ml
Double-Label Nonradioactive In Situ Hybridization 97

Incubate the IVT reaction at 37 for 1 to 2 h. After that, remove 5 ml


IVT reaction to check the labeling in a 1.2% agarose gel.
Note: Fluorescein-12-UTP or Biotin-16-UTP mix can be used for
double labeling.
6. Stop the IVT reaction by adding 50 ml of stop buffer.
7. Precipitate probe rRNA with one-ninth volume of 3 M NaOAc, pH
4.8, and two volumes of 100% ethanol at –80 for at least 30 min.
8. Centrifuge at 12,000 rpm at 4 for 15 min and discard the supernatant.
9. Wash the pellet with 80% ethanol, centrifuge at 4 for 10 min, and
discard the supernatant.
10. Dry the pellet at RT for 5 min and suspend the pellet in 50 to 100 ml of
RNase-free water.

2.7. Hybridization
1. Fix the slides in 4% PFA at RT for 30 min.
2. Wash the slides twice (5 min each time) with DEPC-1 PBS at RT.
3. Treat the slides with 50 mg/ml proteinase K (Sigma) in PK buffer
(see following recipe for 50 ml) at RT for 10 to 15 min.

Stock solution Volume added Final concentration


1 M Tris-HCl, pH 7.5 2.5 ml 50 mM Tris-HCl, pH7.5
0.5 M EDTA 0.5 ml 5 mM EDTA
DEPC water 47 ml –

4. Rinse the slides once with DEPC-1 PBS at RT.


5. Fix the slides in 4% PFA at RT for 30 min.
6. Wash the slides twice (5 min each time) with DEPC-1 PBS at RT.
7. Prepare 50 ml of prehybridization buffer as indicated in the following,
and prehybridize the slides at 60 for 3 4 h.

Stock concentration Volume added Final concentration


Formamide 25 ml 50%
20 SSC 12.5 ml 5 SSC
50 mg/ml yeast tRNA (Sigma) 0.3 ml 0.3 mg/ml
100 mg/ml heparin 50 ml 100 mg/ml
100 Denhardt’s solution 0.5 ml 1 Denhardt’s solution
10% Tween 20 (Sigma) 0.5 ml 0.1%
10% CHAPS (Sigma) 0.5 ml 0.1%
0.5 M EDTA 0.5 ml 5 mM
DEPC water 10.2 ml –
98 Meizhang Li and Richard M. Ransohoff

8. Cover the slides by hybridization chambers and add 100 ml prehybridiza-


tion buffer with 1 to 2 mg/ml probe rRNA into the chambers. Slides are
kept in a moist chamber and further hybridized at 60 for overnight.

2.8. Posthybridization washing


Note: After hybridization, using RNase-free buffers is not necessary.
1. Discard the hybridization chambers and wash the slides in 1 SSC at 60
for 10 min.
2. Wash the slides twice in 2 SSC at 37 for 30 min each, followed by a
wash with 1.5 SSC at 60 for 10 min.
3. Treat tissue sections with 0.1 mg/ml RNase A (Sigma) in 2 SSC at 37
for 30 min.
4. Wash the slides in 2 SSC at RT for 10 min.
5. Wash the slides twice in 0.2 SSC at 60 for 30 min each.
6. Wash the slides once in 0.2 SSC at RT for 15 min.
7. Wash the slides three times in PBT buffer, 0.1% (v/v) Triton X-100
(Sigma) in 1 PBS, at RT for 15 min each.
8. Block the tissue sections in 20% (v/v) heat-inactivated sheep serum in
PBT buffer for 4 h at RT.

2.9. Development of ISH signals


1. Incubate the slides with goat antidigoxygenin antibody conjugated with
AP (alkaline phosphatase) diluted 1:2000 in 20% heat-inactivated sheep
serum in PBT buffer at 4 overnight.
2. Wash the slides three times in PBT at RT for 30 min each.
3. Wash the slides twice with alkaline phosphatase buffer (AP) (recipe for
500 ml follows) at RT for 5 min each.

Stock concentration Volume added Final concentration


1 M Tris, pH 9.5 50 ml 100 mM Tris, pH 9.5
1 M MgCl2 25 ml 50 mM MgCl2
5 M NaCl 10 ml 100 mM NaCl
20% Tween-20 2.5 ml 0.1% Tween-20
5 mM Levamisole
Water 412.5 ml –

4. Prepare 50 ml of AP buffer with 50 ml NBT (BioRad) and 175 ml BCIP


(BioRad).
Double-Label Nonradioactive In Situ Hybridization 99

Note: 80 mg/ml stock NBT (nitro blue tetrazolium chloride) is prepared


in 70% (v/v) dimethyl formamide (Sigma); 60 mg/ml stock BCIP
(5-bromo-4-chloro-3-indolyl phosphate, toluidine salt) is prepared in
100% dimethyl formamide.
5. Develop the ISH signals for 2 to 10 h at RT in the dark.
6. Wash the slides twice with 1 PBS at RT for 10 min each.
7. Fix the slides at RT for 15 min and mount the slides in 50% glycerol with
1 PBS.

2.10. Controls
It is essential to generate control hybridizations for each ISH experiment to
enable data interpretation. Such controls must address both technical and
biological variability. Positive controls using housekeeping genes such as
beta-actin or GAPDH are employed to verify the presence of hybridizable
mRNA that is detectable by ISH. Sense probes or sections from gene
knockout mice or control mice (in disease model experiments) are useful
to exclude unspecific signals. Initial screening of all slides is performed by an
observer blinded to genetics, treatment, or illness status of the animal from
which the specimen was derived; probe identity; and probe polarity.

2.10.1. Special ISH protocols


Double ISH
1. Follow the basic protocol (described above) to label two different ISH
probes. For example, one is labeled with digoxygenin and another is
labeled with fluorescein.
2. Prepare the hybridization buffer with both probes (1 to 2 mg/ml) and
hybridize at 60 overnight.
3. Follow the basic protocol (described above) to wash the slides and block
with 20% heat-inactivated sheep serum in PBT buffer at 4 overnight.
4. Incubate the slides with sheep anti–digoxygenin-AP at 4 for overnight.
5. Wash the slides three times in PBT buffer at RT for 30 min each.
6. Wash the slides twice in AP buffer at RT for 5 min each.
7. Develop the slides with NBT/BCIP until the desired signal is observed.
Note: A sense control probe is helpful to confirm the right hybridization
signals. For most chemokine receptors, a cell type–dependent signal pattern
is desired.
8. Wash the slides three times in 1 PBS at RT for 5 min each.
9. Inactivate the AP in TE (100 mM Tris-HCl, pH 7.5, 50 mM EDTA) at
85 for 10 min.
10. Wash the slides three times in 1 PBS at RT for 5 min each.
11. Wash the slides once in PBT at RT for 10 min each.
100 Meizhang Li and Richard M. Ransohoff

12. Block the slides with 20% heat-inactivated sheep serum in PBT at RT
for 1 h.
13. Incubate the slides with goat anti–fluorescein-AP antibody diluted
1:3000 in 20% heat-inactivated sheep serum in PBT at 4 overnight.
14. Wash the slides three times in PBT at RT for 30 min each.
15. Wash the slides twice in AP buffer at RT for 5 min each.
16. Develop the second ISH signal with 50 ml INT (BioRad) and 175 ml
BCIP at RT for 3 to 4 h.
Note: 40 mg/ml INT (2-[4-iodophenyl]-3-[4-nitrophenyl]-5-phenylte-
trazolium chloride) is prepared in 70% (v/v) dimethyl formamide. To
obtain good double ISH signals, the weaker probe should be developed
first.
17. Fix the slides at RT for 15 min and mount in 50% glycerol with 1
PBS.

Fluorescent double ISH


1. Follow the double ISH protocol (described above) to hybridize the
slides with two different probes that are labeled by either digoxygenin
or fluorescein.
2. After hybridization, wash the slides by following the basic ISH protocol
(described above).
3. Incubate the slides with sheep anti-digoxygenin-AP at 4 overnight.
4. Wash the slides three times in PBT buffer at RT for 30 min each.
5. Wash the slides three times in AP buffer (pH 7.6) at RT for 5 min each.
6. Dissolve one Fast Red tablet (Roche) in 2 ml of AP buffer (pH7.6) and
filter the solution through a 0.45-mm filter (Millipore, Cork, Ireland).
7. Incubate the slides with Fast Red solution in dark for 3 to 4 h until the
desired signal is obtained.
Note: The single antisense ISH developed by NBT/BCIP (positive
control) and sense ISH (negative control) developed by Fast Red are helpful
in evaluating the specific signal.
8. Wash the slides three times in PBT buffer at RT for 30 min each.
9. Block the slides with 20% heat-inactivated sheep serum in PBT at RT
for 1 h.
10. Incubate the slides with sheep anti-fluorescein-POD (peroxidase)
(Roche) 1:5000 in PBT at 4 overnight.
11. Wash the slides three times in PBT buffer at RT for 30 min each.
12. Dilute tyramide-fluorescein (1:50) in the amplification buffer supplied
in the TSA Fluorescein system.
13. Incubate the slides with diluted tyramide-fluorescein at RT for 10 to
15 min.
Double-Label Nonradioactive In Situ Hybridization 101

14. Wash the slides three times in PBT buffer at RT for 5 min each.
15. Wash the slides three times in 1 PBS at RT for 5 min each.
16. Mount the slides in VECTASHIELD mount medium with or without
DAPI (Vector Laboratory, Burlingame, CA).

ISH and immunohistochemistry (IHC)


1. Follow the basic protocol (described above) to complete the nonfluo-
rescent ISH first.
2. Fix the slides in 4% PFA at RT for 30 min.
3. Wash the slides three times in PBT at RT for 5 min each.
4. Incubate the slides in 3% H2O2 (hydrogen peroxide) at RT for 30 min
to inactivate the AP.
5. Wash the slides three times in PBT at RT for 5 min each.
6. Block the slides with 10% heat-inactivated goat serum at RT for
30 min.
7. Incubate the primary antibody at 4 for overnight.
8. Wash the slides three times in PBT at RT for 5 min each.
9. Incubate the secondary antibody conjugated with biotin at RT for 1 h.
10. Wash the slides three times in PBT at RT for 5 min each.
11. Wash the slides three times in 1 PBS at RT for 5 min each.
12. Incubate the slides in ABC complex solution at RT for 1 h. ABC
complex is made using the ABC Elite Kit (Vector Laboratory). Make
the solution at least 30 min before use.
13. Wash the slides three times in 1 PBS at RT for 5 min each.
14. Incubate the slides in DAB (Sigma) solution with 0.01% H2O2 for 5 to
10 min. To make DAB (3, 30 -diaminobenzidine) solution, two DAB
tablets are dissolved into 30 ml of 1 PBS supplemented with 10 ml
H2O2.
15. Wash the slides three times in 1 PBS at RT for 5 min each.
16. Fix the slides for 15 min at RT and mount slides in 50% glycerol in
1 PBS.

3. Comments
Given their wide-ranging biology in the CNS, chemokine receptors
have been extensively investigated. The critical issue of the cellular source(s)
of chemokine receptors in the CNS cannot, in most cases, be addressed by
the direct IHC approach. The remaining options are ISH, use of transgenic
mice with reporter genes expressed from chemokine receptor promoters, or
flow cytometry using CNS tissue lysates.
102 Meizhang Li and Richard M. Ransohoff

REFERENCES
Belmadani, A., Tran, P. B., Ren, D., Assimacopoulos, S., Grove, E. A., and Miller, R. J.
(2005). The chemokine stromal cell-derived factor-1 regulates the migration of sensory
neuron progenitors. J. Neurosci. 25, 3995–4003.
Biber, K., Dijkstra, I., Trebst, D., De Groot, C. J., Ransohoff, R. M., and Boddeke, H. W.
(2002). Functional expression of CXCR3 in cultured mouse and human astrocytes and
microglia. Neuroscience 112, 487–497.
Cardona, A. E., Pioro, E. P., Sasse, M. E., Kostenko, V., Cardona, S. M., Dijkstra, I. M.,
Huang, D., Kidd, G., Dombrowski, S., Dutta, R., Lee, J. C., Cook, D. N., et al. (2006).
Control of microglial neurotoxicity by the fractalkine receptor. Nat. Neurosci. 9,
917–924.
Carlson, T., Kroenke, M., Rao, P., Lane, T. E., and Segal, B. (2008). The Th17-ELRþ
CXC chemokine pathway is essential for the development of central nervous system
autoimmune disease. J. Exp. Med. 205, 811–823.
Carter, S. L., Müller, M., Manders, P. M., and Campbell, I. L. (2007). Induction of the genes
for Cxcl9 and Cxcl10 is dependent on IFN-gamma but shows differential cellular
expression in experimental autoimmune encephalomyelitis and by astrocytes and micro-
glia in vitro. Glia 55, 1728–1739.
Dziembowska, M., Tham, T. N., Lau, P., Vitry, S., Lazarini, F., and Dubois-Dalcq, M.
(2005). A role for CXCR4 signaling in survival and migration of neural and oligoden-
drocyte precursors. Glia 50, 258–269.
Hermann, G. E., Van Meter, M. J., and Rogers, R. C. (2008). CXCR4 receptors in the
dorsal medulla: Implications for autonomic dysfunction. Eur. J. Neurosci. 27, 855–864.
Huang, D., Han, Y., Rani, R. M., Glabinski, A., Trebst, C., Srensen, T., Tani, M.,
Wang, J., Chien, P., O’Bryan, S., Bielecki, B., Zhou, Z. L., et al. (2000). Chemokines
and chemokine receptors in inflammation of the nervous system: Manifold roles and
exquisite regulation. Immunol. Rev. 177, 52–67.
Huang, D., Wujek, J., Kidd, G., He, T. T., Cardona, A., Sasse, M. E., Stein, E. J., Kish, J.,
Tani, M., Charo, I. F., Proudfoot, A. E., Rollins, B. J., et al. (2005). Chronic expression
of monocyte chemoattractant protein-1 in the central nervous system causes delayed
encephalopathy and impaired microglial function in mice. FASEB J. 19, 761–772.
Kadi, L., Selvaraju, R., de Lys, P., Proudfoot, A. E., Wells, T. N., and Boschert, U. (2006).
Differential effects of chemokines on oligodendrocyte precursor proliferation and myelin
formation in vitro. J. Neuroimmunol. 174, 133–146.
Khan, M. Z., Brandimarti, R., Shimizu, S., Nicolai, J., Crowe, E., and Meucci, O. (2008).
The chemokine CXCL12 promotes survival of postmitotic neurons by regulating Rb
protein. Cell Death Differ. 15, 1663–1672.
Kivisäkk, P., Mahad, D. J., Callahan, M. K., Sikora, K., Trebst, C., Tucky, B., Wujek, J.,
Ravid, R., Staugaitis, S. M., Lassmann, H., and Ransohoff, R. M. (2004). Expression of
CCR7 in multiple sclerosis: Implications for CNS immunity. Ann. Neurol. 55, 627–638.
Li, M., and Ransohoff, R. M. (2008). Multiple roles of chemokine CXCL12 in the central
nervous system: A migration from immunology to neurobiology. Prog. Neurobiol. 84,
116–131.
Lu, M., Grove, E. A., and Miller, R. J. (2002). Abnormal development of the hippocampal
dentate gyrus in mice lacking the CXCR4 chemokine receptor. Proc. Natl. Acad. Sci.
USA 99, 7090–7095.
Mahad, D. J., and Ransohoff, R. M. (2003). The role of MCP-1 (CCL2) and CCR2 in
multiple sclerosis and experimental autoimmune encephalomyelitis (EAE). Semin. Immunol.
15, 23–32.
Double-Label Nonradioactive In Situ Hybridization 103

Mahad, D. J., Trebst, C., Kivisäkk, P., Staugaitis, S. M., Tucky, B., Wei, T.,
Lucchinetti, C. F., Lassmann, H., and Ransohoff, R. M. (2004). Expression of chemo-
kine receptors CCR1 and CCR5 reflects differential activation of mononuclear phago-
cytes in pattern II and pattern III multiple sclerosis lesions. J. Neuropathol. Exp. Neurol. 63,
262–273.
Padovani-Claudio, D. A., Liu, L., Ransohoff, R. M., and Miller, R. H. (2006). Alterations
in the oligodendrocyte lineage, myelin, and white matter in adult mice lacking the
chemokine receptor CXCR2. Glia 54, 471–483.
Pashenkov, M., and Teleshova, N. (2003). Inflammation in the central nervous system:
The role for dendritic cells. Brain Pathol. 13, 23–33.
Ransohoff, R. M., Kivisäkk, P., and Kidd, G. (2003). Three or more routes for leukocyte
migration into the central nervous system. Nat. Rev. Immunol. 3, 569–581.
Ransohoff, R. M., Tani, M., Glabinski, A. R., Chernosky, A., Krivacic, K., Peterson, J. W.,
Chien, H. F., and Trapp, B. D. (1997). Chemokines and chemokine receptors in model
neurological pathologies: Molecular and immunocytochemical approaches. Methods
Enzymol. 287, 319–348.
Srensen, T. L., Trebst, C., Kivisäkk, P., Klaege, K. L., Majmudar, A., Ravid, R.,
Lassmann, H., Olsen, D. B., Strieter, R. M., Ransohoff, R. M., and Sellebjerg, F.
(2002). Multiple sclerosis: A study of CXCL10 and CXCR3 co-localization in the
inflamed central nervous system. J. Neuroimmunol. 127, 59–68.
Sunnemark, D., Eltayeb, S., Nilsson, M., Wallström, E., Lassmann, H., Olsson, T.,
Berg, A. L., and Ericsson-Dahlstrand, A. (2005). CX3CL1 (fractalkine) and CX3CR1
expression in myelin oligodendrocyte glycoprotein-induced experimental autoimmune
encephalomyelitis: kinetics and cellular origin. J. Neuroinflammation 2, 17.
Trebst, C., Staugaitis, S. M., Kivisäkk, P., Mahad, D., Cathcart, M. E., Tucky, B., Wei, T.,
Rani, M. R., Horuk, R., Aldape, K. D., Pardo, C. A., Lucchinetti, C. F., et al. (2003).
CC chemokine receptor 8 in the central nervous system is associated with phagocytic
macrophages. Am. J. Pathol. 162, 427–438.
van Heteren, J. T., Rozenberg, F., Aronica, E., Troost, D., Lebon, P., and Kuijpers, T. W.
(2008). Astrocytes produce interferon-alpha and CXCL10, but not IL-6 or CXCL8, in
Aicardi-Goutières syndrome. Glia 56, 568–578.
Zheng, J. C., Huang, Y., Tang, K., Cui, M., Niemann, D., Lopez, A., Morgello, S., and
Chen, S. (2008). HIV-1-infected and/or immune-activated macrophages regulate
astrocyte CXCL8 production through IL-1beta and TNF-alpha: Involvement of
mitogen-activated protein kinases and protein kinase R. J. Neuroimmunol. 200, 100–110.
C H A P T E R F I V E

Expression of Chemokines and


Chemokine Receptors in Human
Colon Cancer
Marco Erreni,* Paolo Bianchi,† Luigi Laghi,† Massimiliano Mirolo,§
Marco Fabbri,* Massimo Locati,‡ Alberto Mantovani,‡
and Paola Allavena*

Contents
1. Introduction 106
2. Materials and Methods 108
2.1. Cell culture and tissue collection and processing 108
2.2. TaqMan Low Density Array 108
2.3. Quantitative real-time RT-PCR (Q-PCR) 109
2.4. Enzyme-linked immunosorbent assay 110
2.5. Statistical analysis 110
3. Results 110
3.1. TaqMan Low Density Array analysis of eight colon cancer
samples 110
3.2. CCL3, CCL4, and CXCL8 expression in colon cancer 112
3.3. Regulation of CXCL8 expression in colon cancer cell lines 115
3.4. CXCL8 correlation with OPN and SPARC 116
4. Discussion 117
Acknowledgments 119
References 119

Abstract
Human colorectal cancer (CRC), the second largest cause of tumor-related death
in Western countries, represents a paradigm for the now well-established
connections between inflammation and cancer. In this study, we investigated

* Department of Immunology and Inflammation, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy
{
Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy
{
Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas,
Via Manzoni, Rozzano (Milano), Italia
}
Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan,
IRCCS Istituto Clinico Humanitas, Italy

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05205-7 All rights reserved.

105
106 Marco Erreni et al.

which inflammatory mediators are mostly expressed in the microenvironment of


human CRC. The RNA profile of a large panel of inflammatory genes, in particu-
lar chemokines and chemokine receptors, was analyzed in eight surgical tumor
samples and in paired normal tissues from CRC patients. We employed an
‘‘inflammatory gene card’’ (TaqMan Low Density Array by Applied Biosystem),
designed by our group, containing probes for 24 chemokines and 17 chemokine
receptors. Several chemokines were strongly upregulated in the tumor micro-
environment, most frequently CCL4 and CCL5, chemotactic for monocytes/
macrophages and T cells, and the corresponding receptors CCR1 and CCR5;
the angiogenic chemokines CXCL1 and CXCL8, and the receptor CXCR2. The
antiangiogenic chemokines CXCL9 and CXCL10 were also expressed, but in the
absence of the receptor CXCR3. Selected results have been confirmed in a larger
number of samples. The levels of mRNA CXCL8 were significantly associated
with the levels of osteopontin, a matrix-associated protein that shares with
chemokines important functions such as induction of cell migration and sur-
vival, and modulation of the neoangiogenesis. Overall these results could be
helpful to identify the most relevant inflammatory pathways present in CRC
tumors and to build a solid rationale for future therapeutic interventions based
on anti-inflammatory strategies.

1. Introduction
Links between cancer and inflammation were first suggested in the
19th century on the basis of observations that tumors often arise at sites of
chronic inflammation and that inflammatory cells are present in the biopsied
samples from tumors (Mantovani et al., 2001). Epidemiological studies have
shown that chronic inflammation predisposes individuals to various types of
cancer, including microbial infections, autoimmune diseases, and inflam-
matory conditions of unknown origin. The hallmarks of cancer-related
inflammation include the presence in tumor tissues of inflammatory cells
and soluble mediators such as chemokines, cytokines and prostaglandins,
tissue remodeling, and angiogenesis (Coussens and Werb, 2002; Karin,
2006; Mantovani, 2005; Mantovani et al., 2008).
Chemokines are chemotactic cytokines that cause the direct migration of
leukocytes and are induced by inflammatory cytokines, growth factors, and
pathogenic stimuli. Many human cancers have a complex chemokine net-
work that regulates the extent and phenotype of the infiltrating leukocytes, as
well as have an effect on tumor growth, survival, migration, and angiogenesis
(Balkwill, 2004). The pattern of chemokine-receptor and ligand expression
in a tissue is generally correlated with the numbers and types of infiltrating
cells that are present in the tumor microenvironment (Balkwill, 2004; Karin
and Greten, 2005; Rossi and Zlotnik, 2000).
The influence of the immune response in the behavior of neoplasia has
been extensively investigated. There is little doubt that adaptive immune
Chemokines and Receptors in Human Colon Cancer 107

cells, especially cytotoxic CD8þ T-cell effectors, have the potential to limit
tumor progression (Dunn et al., 2004). The protective function of CD8þ T
cells has been demonstrated in patients with melanoma, ovarian, and
colorectal cancer (CRC) (Coukos et al., 2005; Taylor et al., 2007). Recently,
Galon and colleagues (Galon et al., 2006; Pages et al., 2005) demonstrated
that the presence of a strong immune-cell infiltrate is associated with the
absence of early metastatic processes, which include vascular emboli, lym-
phatic invasion, and perineural invasion, demonstrating a beneficial effect of
the host’s immune response.
On the other hand, the persistence of active innate immune responses (i.e.,
chronic inflammation) at tumor sites has been more frequently associated with
poor clinical outcome (Balkwill, 2004; Coussens and Werb, 2002; Dunn et al.,
2004; Karin, 2006; Mantovani, 2005; Mantovani et al., 2001, 2008).
The links between inflammation and cancer promotion are especially
strong in human colorectal carcinoma (CRC), the second largest cause of
cancer-related death in Western countries. Patients with inflammatory
bowel disease, both ulcerative colitis and Crohn’s disease, are at increased
risk of developing colorectal cancer. Even precancerous tissues show signs of
inflammation. Accordingly, treatment with nonsteroidal anti-inflammatory
agents decreases the incidence of colon cancer, and the mortality that results
from it (Bertagnolli, 2003).
The contribution of macrophages to CRC development is quite contro-
versial. Bailey et al. (2007) demonstrated that the increase of macrophages
number in all areas within the tumor correlated with advanced tumor stage.
In contrast, Forssell et al. (2007) showed that in CRC, macrophages are
localized principally at the tumor front and positively influenced prognosis.
These contrasting results may be explained by the ‘‘macrophages balance
hypothesis,’’ proposed by our group, to convey the idea that macrophages
may inhibit or stimulate tumor growth according to their functional polariza-
tion and state of activation (Mantovani et al., 2002, 2004; Pollard, 2004).
While M1-polarized macrophages, activated by IFNg and bacterial products
such as LPS, usually have tumoricidal activity, M2 macrophages, differentiated
in the presence of Th2 cytokines (IL-4, IL-13) or IL-10, most frequently are
not cytotoxic, favor tumor cell proliferation and the angiogenic switch, and
lead to tumor progression and invasion (Mantovani et al., 2008). In this
context, it is clear that inflammatory mediators, such as chemokines, cyto-
kines, and growth factors play a pivotal role in the recruitment of the
inflammatory infiltrate and in the buildup of the tumor microenvironment.
In this study, we investigated the expression of chemokines and
chemokine-receptors in surgical samples of human CRC. We analyzed
the mRNA profile using a customized TaqMan Low Density Array
(Lu et al., 2008). The results show a strong upregulation of chemokines
and chemokine-receptors, indicating the pivotal role of these inflammatory
mediators in the growth and progression of CRC.
108 Marco Erreni et al.

2. Materials and Methods


2.1. Cell culture and tissue collection and processing
Thirty colon cancer samples and corresponding normal tissues were
obtained via surgical resection from the Department of Gastroenterology,
Istituto Clinico Humanitas IRCCS, Rozzano, Milan. The samples were
immediately treated with RNAlater (Ambion) for 24 h at 4 , and subse-
quently dried and stored at –80 . All patients consented to the study. CRC
cell lines HCT116, HT29, and SW620 were cultured in RPMI 1640
medium supplemented with 10% fetal bovine serum (Lonza, BioWhit-
taker), 2 mM Ultraglutamine1 (Lonza, BioWhittaker), and 100 U/ml peni-
cillin/streptavidin (Lonza, BioWhittaker) at 37 in 5% CO2. Total RNA
was isolated both from tissue specimens and cell lines using TRI Reagent
(Ambion). Total RNA was quantified by Nanodrop Spectrophotometer
ND-1000 and its quality was examined by 1.5% agarose gel electrophoresis.
2mg of total RNA were reverse-transcribed using the High-Capacity
cDNA Archive kit (Applied Biosystems) according to the manufacturer’s
instructions.

2.2. TaqMan Low Density Array


Eight colon cancer samples and their corresponding normal tissues were
used for low-density array (LDA) analysis. The LDA contains eight sample-
loading lines, each connected by microchannel to 48 miniature reaction
chambers for a total of 384 wells per card. Gene-specific exon-spanning
primers and TaqMan probes were factory-designed and embedded in each
well. We chose 96 genes from Applied Biosystems Assays-on-DemandTM
Gene Expression Products: five housekeeping genes (HPRT, 18S, GAPDH,
B2M, ACTB) and 91 inflammation-related genes. The LDA in this study was
configured into four identical 96-gene sets (two samples in duplicate). A total
of 100 ml of reaction mixture with 100 ng of cDNA template and 50 ml 2  of
TaqMan Universal PCR Master Mix (Applied Biosystems) was added to
each line of LDA after vortex and brief centrifugation. Each reaction cell
contained 1 ml of reaction mixture with 1 ng of mRNA. LDA were sealed
with a TaqMan LDA sealer (Applied Biosystems) before centrifugation.
The PCR amplification was performed in the microfluidic card sample
block of an ABI PrismÒ 7900HT Fast Real-Time PCR System (Applied
Biosystems). The amplification protocol was used as follows: 2 min at 50
to activate uracil-DNA glycosylase (Forssell et al. 2007), 10 min at 94.5
(activation), 40 cycles of denaturation at 97 for 30 s, and annealing and
extension at 59.7 for 1 min. The relative amount of each target gene
Chemokines and Receptors in Human Colon Cancer 109

mRNA to the mean of the five housekeeping genes (HPRT, 18S,


GAPDH, B2M, and ACTB) was calculated as 2–DCt, where DCt ¼ Ct –
Ctmean of housekeeping genes. The fold-change of each target gene mRNA to
the corresponding normal tissue was calculated as 2–DDCt, where DDCt ¼
DCttarget gene in tumor tissue – DCttarget gene in normal tissue. The threshold cycle
Ct was automatically given by the SDS2.2 software package (Applied
Biosystems).

2.3. Quantitative real-time RT-PCR (Q-PCR)


Several genes were further analyzed via the SYBR Green-based Q-PCR
assay in an additional 30 colon cancer samples and corresponding normal
tissue. 18S was used as an internal control to normalize samples. All gene-
specific exon-spanning primers were domestically designed. The sequences
are indicated in the following:
18S:
Forward: 50 CGC CGC TAG AGG TGA AAT TC 30
Reverse: 50 CTT TCG CTC TGG TCC GTC TT 30
CCL3:
Forward: 50 TGC AAC CAG TTC TCT GCA TC 30
Reverse: 50 AAT CTG CCG GGA GGT GTA 30
CCL4:
Forward: 50 TTA CTA TGA GAC CAG CAG CCT CT 30
Reverse: 50 CAG CAC AGA CTT GCT TGC TT 30
OPN:
Forward: 50 CGC AGA CCT GAC ATC CAG T 30
Reverse: 50 GGC TGT CCC AAT CAG AAG G 30
SPARC:
Forward: 50 GTG CAG AGG AAA CCG AAG AG 30
Reverse: 50 TGT TTG CAG TGG TGG TTC TG 30
CXCL8:
Forward: 50 CTG CGC CAA CAC AGA AAT TA 30
Reverse: 50 TTG AAG AGG GCT GAG AAT TCA 30
Each PCR reaction of 25 ml consisted of a 4-ml aliquot of each cDNA
(40 ng mRNA for target genes and 1 ng mRNA for 18S gene), 0.2 mM
forward and reverse primers and 12.5 ml of Power SYBR Green PCR
Master Mix (Applied Biosystem). The Q-PCR program follows: 2 min at
50 , 10 min at 95 , 40 cycles of 15 s at 95 , and 1 min for 60 . The melting
curve analysis was carried out at 95 for 15 s, 60 for 15 s, and 95 for 15 s.
Each sample was amplified in triplicate in 96-well PCR microplates on an
ABI PrismÒ 7900HT Fast Real-Time PCR System (Applied Biosystems).
Data analysis followed the same protocol as that in LDA.
110 Marco Erreni et al.

2.4. Enzyme-linked immunosorbent assay


CXCL8 levels in cell-line supernatants were measured using human IL-8
DuoSet ELISA Development System (R&D Systems). Cells were cultured
in six-well plates at a concentration of 500,000 cells/well and treated with
TNFa (10 ng/ml) alone or in combination with TGFb (2 ng/ml) at 37 in
5% CO2. After 24 h, supernatants were collected, filtered using 0.2 mm
cellulose-acetate syringe filters (Albet-Jacs), and stored at –20 . The IL-8
DuoSet ELISA Development System (R&D Systems) was used for CXCL8
detection. Briefly, a 96-well flat bottom microplate (Costar) was coated with
4 mg/ml of captured antibody, diluted in Reagent Diluent (R&D Systems)
(0.1% BSA, 0.05% Tween 20 in PBS, pH 7.2–7.4) at 4 O/N. Each well was
washed in Washing Buffer (0.05% Tween 20, PBS, pH 7.2–7.4) and blocked
with 1% BSA in Washing Buffer for 2 h at RT. Wells were washed three
times and then 50 ml of sample were added to each wells and incubated for
2 h at RT. Each sample was analyzed in duplicate and threefold serial
dilutions in Reagent Diluent were performed. A standard curve was per-
formed using recombinant CXCL8, using twofold serial dilution in Reagent
Diluent and a high standard point of 2 ng/ml. Each well was then washed in
washing buffer and incubated with 50 ml of detection antibody for 2 h RT.
Next, 50 ml of streptavidin-HRP were added to each well for 20 min at RT.
Development was performed using the 3,30 ,5,50 tetramethyl-benzidine
(TMB) Liquid Substrate System (SIGMA), and reaction was blocked by
H2SO4 2N. The amount of CXCL8 was evaluated by optical density using
the VersaMax microplate reader (Molecular Devices) set to 450 nm.

2.5. Statistical analysis


The StatsDirect software was applied for the statistical analysis. The signifi-
cance of differential gene expression among normal and tumor tissues were
determined using the nonparametric Mann-Whitney U-test. A p-value of
less than 0.05 was considered statistically significant. Simple linear regression
analysis was used to determine mRNA correlation among the target genes.

3. Results
3.1. TaqMan Low Density Array analysis of eight colon cancer
samples
To investigate the role of chemokines and their receptors in colon cancer
tissues, we performed a large screening of inflammation-related genes in
eight human colon cancer samples and corresponding normal tissues, using
the TaqMan Low Density Array (Applied Biosystem), customized with
Chemokines and Receptors in Human Colon Cancer 111

91 inflammation-related genes, selected by us, and 5 housekeeping genes.


Among the 91 inflammation-related genes, 24 were chemokines and 17 were
chemokine-receptors. Table 5.1 shows an overview of the results from eight
samples of CRC tumors. The data are expressed as relative to each utologous
normal tissue (adjacent colonic mucosa). Considering a fold-change greater
than two, several ligands were upregulated. Among CC chemokines, CCL1,
CCL3, CCL4, CCL7, CCL20, CCL25, and CCL26 were more frequently
transcribed compared to normal tissues. The corresponding receptors, CCR8

Table 5.1 Overview: Expression of chemokine system in microenvironment of human


CRC samples

Stage1 Stage2 Stage2 Stage3 Stage3 Stage3 Stage4 Stage4


CCL1 4 3 1 0 3 2 6 28
CCL11 0 1 2 0 0 0 0 0
CCL14/15 1 0 1 0 0 0 6 1
CCL17 1 0 0 1 30 0 0 1
CCL18 1 0 1 4 2 1 12 1
CCL2 0 1 0 0 2 0 3 0
CCL20 0 6 0 0 3 0 2 42
CCL21 1 0 1 0 0 0 0 0
CCL25 20 0 582 3 0 0 28 694
CCL26 4 0 2 3 761 134 3 143
CCL3 5 0 1 1 8 1 26 0
CCL4 4 1 0 1 3 0 22 1
CCL7 1 3 2 1 4 0 7 0
CCL8 0 0 0 0 0 0 6 0
CCR1 1 0 0 1 1 0 1 1
CCR3 0 3 1 0 0 0 0 0
CCR5 1 0 1 0 0 1 1 0
CCR6 1 3 2 0 0 0 0 2
CCR8 4 5 6 2 8 3 2 3
CMKLR1 0 0 0 1 0 0 3 1
CXCL1 2 3 2 1 10 1 28 9
CXCL10 7 2 0 1 1 1 410 9
CXCL9 6 1 0 1 0 1 10 6
CXCR3 1 4 0 1 1 0 0 1
CXCR4 1 0 1 1 1 0 3 3
CXCL8 4 24 13 11 447 4 1492 1
CXCR2 0 4 3 3 10 3 34 0
CXCL12 0 0 0 0 0 0 0 0

mRNA of chemokines and receptors from CRC tumors were analyzed via a customized TaqMan Low
Density Array. Data are expressed relative to autologous normal tissues. Grey box depicts a fold equal or
greater than two. Eight tumor samples representative of various clinical stages are shown.
112 Marco Erreni et al.

and CCR6, were also upregulated, but others, CCR1 and CCR5, were less
than 2. Among CXC chemokines, high levels of CXCL1 and CXCL8 and
the corresponding receptor CXCR2 were found. High levels of CXCL9 and
CXCL10 were also found, but not their receptor CXCR3. Surprisingly, the
chemokine CCL2, frequently produced by several tumor types including
CRC, or the constitutive chemokine CXCL12, were not upregulated.
To better appreciate the configuration of the chemokine system in the
normal colonic mucosa, the data were analyzed relative to the mean of the
five housekeeping genes customized in the LDA. Two representative cases
are presented in Fig. 5.1. Panels A and B show the mRNA levels of chemo-
kines and receptors in one early-stage tumor, while Panels C and D show
levels in an advanced stage tumor, respectively. The normal colonic mucosa
(white bars) expresses several chemokines; CCL2, CCL5, CCL14/CCL15,
CCL20, CCL21, and CXCL12 are expressed most frequently. Some of these
chemokines were further upregulated in tumor samples (black bars), but not
always reach the cut-off of twofold. Other chemokines such as CCL3,
CCL4, and CXCL9, CXCL10, and especially CXCL8 were more selectively
overexpressed in the tumor tissue. Among chemokine receptors, CXCR4
and CXCR7—both binding CXCL12—were found in the normal mucosa,
while in the tumor tissue several receptors were upregulated, including
CCR1 and CCR5, both binding CCL3 and CCL4, and CXCR2, recogniz-
ing CXCL8. We further decided to investigate the expression of these
specific ligands in a larger series of CRC samples.

3.2. CCL3, CCL4, and CXCL8 expression in colon cancer


To confirm the data obtained by the TaqMan Low Density Array, we
further investigated mRNA expression of CCL3 and CCL4 in another 20
colon cancer tissues and their corresponding normal tissue. As shown in
Fig. 5.2A, there is a significant increase in CCL3 expression in tumor
samples compared with the normal colonic mucosa (p ¼ 0.05). CCL4
median expression is higher in tumor tissues, but this difference is at the
limit of significance ( p ¼ 0.07). Moreover, there is higher amount of CCL4
than CCL3, both in normal and tumor tissue. Subsequently, we focused our
attention on CXCL8, since it has been extensively demonstrated that this
ligand is strongly overexpressed in various tumor types. We then investi-
gated CXCL8 mRNA expression in 30 colon cancer tissues and correspond-
ing normal mucosa: as shown in Fig. 5.2C, there is a strong significant
increase in CXCL8 expression in tumor tissues (p < 0.0001).When com-
pared to CCL3 and CCL4, CXCL8 shows the same mRNA expression in
normal mucosa, but its expression is markedly higher in tumor samples.
Both for CCL3, CCL4 and CXCL8 there is no significant correlation with
tumor stage (data not shown).
A Early stage tumor C Advanced stage tumor Normal
0.4 Tumor
0.3
0.2 0.52
0.150

0.125 0.12

0.100 0.10

0.08
0.075

Arbitrary units
Arbitrary units
0.06
0.050
0.04
0.025
0.02

0 0
L1 L2 L3 L4 L5 L7 L8 L11 L13 L15 L16 L17 L18 L19 L20 L21 L22 L25 L26 L1 L8 L9 L10 L12 L1 L2 L3 L4 L5 L7
C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C
L8 L11 L13 L15 L16 L17 L18 L19 L20 L21 L22 L25 L26 L1 L8 L9 L10 L12
C
C C C C C C C C C ;C C C C C C C C C C CX CX CX X X C C C C C C C C C C C C C C C C C C C C C C C
4 C C C C ; C C C C C C C C C C CX CX CX X X
C C
L1 4
C L1
C C
Chemokines C Chemokines
B D
0.0200
0.025
0.0175

0.020 0.0150

0.0125
0.015
0.0100

0.010 0.0075

Arbitrary units

Arbitrary units
0.0050
0.005
0.0025

0 0
1 2 3 4 5 6 7 8 1 2 3 4 6 7 1 1 2 3 4 5 6 7 8 L1 L2 1 2 3 4 6 7 1
R R R R R R R R L1 L2 R R R R R R R R R R R R R R R R R R R R R R LR
C C C C C C C C R R C C C C C C LR C C C C C C C C C C C C C C C C
C C C C C C C C C C X X X X X X K C C C C C C C C C C X X X X X X K
C C C C C C C C M C C C C C C M
C C

Chemokine receptors Chemokine receptors

Figure 5.1 ExpressionofmRNAforchemokinesandchemokine receptorsintwotumorsamples from CRCpatients,analyzedbyacustomized


TaqMan Low DensityArray. Results in left panels refer to an early-stage tumor (Stage 2); right panel refers to an advanced-stage tumor (Stage 4).
Chemokine ligands are depicted in panels A and C, and receptors in panels B and D. Shown are the mRNA levels relative to the mean of the
five housekeeping genes customized in the LDA in the normal autologous colonic mucosa (white bar) and in the tumor tissue (black bar).
114 Marco Erreni et al.

A p = 0.05 CCL3

0.0016
0.0014
0.0012
Arbitrary units

0.0010
0.0008
0.0006
0.0004
0.0002
0.0000
Normal Tumor

p = 0.07
B CCL4
0.0018
0.0016
0.0014
Arbitrary units

0.0012
0.0010
0.0008
0.0006
0.0004
0.0002
0.0000
Normal Tumor

C p < 0.0001 CXCL8

0.206
0.106
0.006
Arbitrary units

0.005
0.004
0.003
0.002
0.001
0.000
Normal Tumor

Figure 5.2 Expression of mRNA of CCL3 (panel A), CCL4 (panel B), and CXCL8
(panel C), in CRC tumor samples and in adjacent normal colonic mucosa analyzed by
RT-PCR. Statistical significance is shown. CCL3 and CXCL8 expression in tumors is
significantly different from normal tissues.
Chemokines and Receptors in Human Colon Cancer 115

3.3. Regulation of CXCL8 expression in colon cancer cell lines


Three CRC tumor cell lines were studied for the expression of CXCL8
mRNA and protein secretion. The cell lines SW620 and HT29 secreted
low but detectable levels of CXCL8 constitutively, while HCT116 cells did
not. An increased production was obtained upon stimulation with TNFa
and TGFb, two mediators frequently found at the tumor site. Accordingly,
mRNA levels were increased in TNFa/TGFb-stimulated cells. Surprisingly,
TNFa stimulation alone increased mRNA levels in SW620 and HT29
cells, but not protein production (Fig. 5.3).

A CXCL8
NT
TNFa
7 TNFa + TGFb
6
5
4
ng/ml

2.0
1.5
1.0
0.5
0
HCT116 SW620 HT29

B CXCL8
10
9
8
7
Fold change

6
5
4
3
2
1
0
HCT116 SW620 HT29

Figure 5.3 Regulation of CXCL8 in tumor cells lines derived from human CRC.
Protein levels (panel A) were measured by a commercial ELISA in cell supernatants;
mRNA levels (panel B) were analyzed by RT-PCR. Cells were either untreated
(medium), or stimulated with TNFa (20 ng/ml) and TGFb (20/ ng/ml) for 24 h for pro-
tein expression or 6 h for mRNA.
116 Marco Erreni et al.

3.4. CXCL8 correlation with OPN and SPARC


Among the most expressed genes in the LDA, we found osteopontin
(OPN) and Secreted Protein Acidic and Rich in Cysteine (SPARC). It
has been demonstrated that osteopontin is not only a matrix protein, but has
also chemotactic activity for leukocytes, and is involved, together with
CXCL8, in prostate cancer recurrence. Both OPN and SPARC contribute
to the deposition and remodeling of the extracellular matrix (ECM) and to
the development of angiogenesis, a function shared by CXCL8 as well. We
therefore investigated the expression of OPN and SPARC in CRC sam-
ples, and their relationship with CXCL8. As shown in Fig. 5.4, there is a
significant increase in both mRNA OPN (Fig. 5.4A) and SPARC (Fig. 5.4B)
in tumor tissues compared to normal mucosa ( p < 0.0001). Interestingly, we
found a significant linear correlation between mRNA OPN and CXCL8

A OPN C
P < 0.0001 0.020

0.015
0.010 0.015
0.005
Arbitrary units

0.0025
OPN

0.0020 0.010

0.0015

0.0010 0.005
P = 0.001
0.0005

0 0
Normal Tumor 0 0.1 0.2 0.3
CXCL8
B SPARC D
P < 0.0001
0.08
0.07

0.02
0.0100 0.06
Arbitrary units

SPARC

0.0075
0.04

0.0050

0.02 P = 0.9
0.0025

0 0
Normal Tumor 0 0.1 0.2 0.3
CXCL8

Figure 5.4 Expression of mRNA of osteopontin (OPN) (panel A) and SPARC (panel
B) in CRC tumor samples, and in adjacent normal colonic mucosa analyzed by RT-
PCR. Statistical significance is shown. Both OPN and SPARC are significantly more
expressed in tumor samples. Panels C and D show the linear regression analysis of
CXCL8 and OPN (C) or SPARC (D). mRNA CXCL8 significantly correlates with
mRNAOPN in the tumor tissues.
Chemokines and Receptors in Human Colon Cancer 117

expression in tumor tissues ( p ¼ 0.001) (Fig. 5.4C), while there was no


correlation between CXCL8 and SPARC ( p ¼ 0.9) (Fig. 5.4D).

4. Discussion
In this study, we have investigated the chemokine system in samples of
human colorectal tumors. To obtain a global view of which chemokines
and receptors are overexpressed in the tumor microenvironment, we
have used a customized TaqMan Low Density Array containing probes
for 24 ligands and 17 receptors. Several CC and CXC chemokines were
strongly upregulated in tumor samples compared to the paired normal
colonic mucosa. Interestingly, a number of chemokines were constitutively
expressed also in the normal tissue, such as CCL2, CCL20, and CXCL12.
The significance of their expression in normal colonic mucosa is likely
explained by the abundant presence, at this site, of immune effectors of
both innate and adaptive immunity, to maintain the local homeostasis.
These chemokines were not or only slightly elevated in tumor samples. In
contrast, other ligands, such as the inflammatory cytokines CCL3, CCL4,
CXCL8, and a few others, were significantly increased compared to the
normal counterpart tissue.
CCL3 and CCL4 are chemotactic for monocytes/macrophages and T
cells, the major components of tumor-infiltrating leucocytes in colorectal
tumors, as well as in other tumor histotypes. Of note, while the subset of
CD8þ T cells has been defined as protective antitumor effectors in CRC
and their number associated with better prognosis (Galon et al., 2006), the
role of macrophages is more ambiguous. Some studies on different tumor
types, have described divergent result reporting a correlation with a favorable
clinical outcome (Bailey et al., 2007; Forssell et al., 2007) or, in marked
contrast, an association with tumor progression—in the majority of tumors
(Allavena et al., 2008; Deconto et al., 2008). These contrasting results may be
interpreted in view of the macrophage balance hypothesis and the distinct
function of polarized macrophage populations (Mantovani et al., 2002).
In our study, we found an increased expression of CCL3 and CCL4 in
tumor samples, but no association with the stage of disease, in that early-
stage tumors also had high levels of these chemokines compared to normal
tissues (data not shown). The chemokine CXCL8 attracts mainly neutro-
phils; these leukocytes are short-living and are not usually present in tumors.
Recently, it has been reported that myeloid derived suppressor cells
(MDSC) express the CXCR2 receptor and may respond to CXCL8
(Sica and Bronte, 2007). The contribution of CXCL8 in the recruitment
of MDSC warrants further investigation.
CXCL8 and other members of the same family have been extensively
studied for their role in stimulating neoplastic growth, such as in melanoma
118 Marco Erreni et al.

(Richmond, 2002). In addition, these chemokines may promote tumor


progression and invasion by stimulating the process of neoangiogenesis
and the activation of matrix proteases (Murphy, 2001; Strieter et al.,
2006). In this study, mRNA CXCL8 was strongly expressed in CRC
samples, in line with previous reports (Schottelius and Dinter, 2006). The
receptor CXCR2 was also found upregulated in selected tumor samples
(not shown). To gain some information on the regulation of CXCL8, we
performed in vitro experiments with cytokine-activated tumor-cell lines
derived from CRC. Two cell lines were able to constitutively produce
CXCL8 and its secretion was increased upon stimulation with TNFa and
TGFb, two major cytokines present at the tumor site. It is well established
that other members of the CXC family possess antiangiogenic activity
(Strieter et al., 2006). In the tumor microenvironment, the balance between
proangiogenic and antiangiogenic chemokines may determine the degree
of angiogenesis and the consequent tumor progression. In our study,
we also found high levels of two antiangiogenic chemokines, CXCL9 and
CXCL10, but no significant expression of their specific receptor CXCR3
was detected. Hence, it is likely that the proangiogenic effect of CXCL8
prevails.
The TaqMan array we used contained several other probes coding for
inflammation-related genes. Two genes remarkably upregulated in cancer
samples were OPN and SPARC. These glycoproteins belong to the large
family of ECM proteins and have generated great interest in cancer biology.
Evidence in vivo and in vitro indicates that SPARC is a key modulator
of the tumor microenvironment, as this protein influences tumor cell
survival, migration, angiogenesis, and ECM remodeling (Chlenski et al.,
2006; Clark and Sage, 2008; Podhajcer et al., 2008). Nevertheless, its
underlying mechanisms and true impact on tumor progression are yet to
be determined. Recently it has been reported that macrophage-derived
SPARC induces cancer cell migration, acting at the step of integrin aVb5
(Sangaletti et al., 2008).
The other matricellular protein, OPN, is also important to bridge cancer
cells with the ECM. The relevance of OPN expression to human cancer has
been investigated in several studies (Koh et al., 2007; Wai and Kuo, 2008).
OPN levels are usually elevated in aggressive tumors when compared with
low-grade tumors or with the normal tissue and correlate with the presence
of metastatic disease. Moreover, OPN is included in lists of genes that
predict poor prognosis in patients with various types of cancer (Graudens
et al., 2006; Wai and Kuo, 2008). Yet, the mechanism by which OPN
supports metastasis is not clear. Tumor cell interaction with OPN is
mediated via the adhesion receptor CD44 and its variants expressed by
tumor cells (e.g., CD44v6) and by beta-integrins (Bellahcene et al., 2008).
Recently McAllister et al. (2008) proposed that soluble OPN released by
cancer cells can activate bone marrow cells to be recruited at the tumor site,
Chemokines and Receptors in Human Colon Cancer 119

fostering tumor progression. In our study, and in line with previous reports,
mRNA of OPN and SPARC were strongly upregulated in tumor samples.
Of interest, a linear correlation was found between the expression of OPN
and CXCL8. As mentioned above, these two mediators share some impor-
tant functions such as cell mobility and cell survival via integrin activation
(Caruso et al., 2008). In contrast, no significant correlation was found
between the levels of SPARC and CXCL8. Collectively, this study inves-
tigated the complex network of chemokines and receptors in the tumor
microenvironment of human CRCs. The approach we used was to employ
a TaqMan Low Density Array to screen a large number of ligands and
receptors that would have been very laborious to perform with the conven-
tional RT-PCR. This initial screening led to identification of the most
expressed genes in tumor samples, and was therefore very informative for
selection of a more restricted panel of candidate molecules for further
investigation. The results of this study may be helpful to build a solid ratio-
nale for novel therapeutic interventions targeted to specific inflammatory
molecules, and to identify novel prognostic CRC markers.

ACKNOWLEDGMENTS
This work was supported by the Italian Association for Cancer Research (AIRC), MIUR
target project Oncologia 2006, and Alleanza Contro il Cancro.

REFERENCES
Allavena, P., Sica, A., Garlanda, C., and Mantovani, A. (2008). The yin-yang of tumor-
associated macrophages in neoplastic progression and immune surveillance. Immunol.
Rev. 222, 155–161.
Bailey, C., Negus, R., Morris, A., Ziprin, P., Goldin, R., Allavena, P., Peck, D., and
Darzi, A. (2007). Chemokine expression is associated with the accumulation of tumour
associated macrophages (TAMs) and progression in human colorectal cancer. Clin. Exp.
Metastasis 24, 121–130.
Balkwill, F. (2004). Cancer and the chemokine network. Nat. Rev. Cancer 4, 540–550.
Bellahcene, A., Castronovo, V., Ogbureke, K. U., Fisher, L. W., and Fedarko, N. S. (2008).
Small integrin-binding ligand N-linked glycoproteins (SIBLINGs): Multifunctional
proteins in cancer. Nat. Rev. Cancer 8, 212–226.
Bertagnolli, M. M. (2003). The potential of non-steroidal anti-inflammatory drugs
(NSAIDs) for colorectal cancer prevention. J. Surg. Oncol. 84, 113–119.
Caruso, D. J., Carmack, A. J., Lokeshwar, V. B., Duncan, R. C., Soloway, M. S., and
Lokeshwar, B. L. (2008). Osteopontin and interleukin-8 expression is independently
associated with prostate cancer recurrence. Clin. Cancer Res. 14, 4111–4118.
Chlenski, A., Liu, S., Guerrero, L. J., Yang, Q., Tian, Y., Salwen, H. R., Zage, P., and
Cohn, S. L. (2006). SPARC expression is associated with impaired tumor growth,
inhibited angiogenesis and changes in the extracellular matrix. Int. J. Cancer 118, 310–316.
Clark, C. J., and Sage, E. H. (2008). A prototypic matricellular protein in the tumor
microenvironment—where there’s SPARC, there’s fire. J. Cell Biochem. 104, 721–732.
120 Marco Erreni et al.

Coukos, G., Conejo-Garcia, J. R., Roden, R. B., and Wu, T. C. (2005). Immunotherapy
for gynaecological malignancies. Expert Opin. Biol. Ther. 5, 1193–1210.
Coussens, L. M., and Werb, Z. (2002). Inflammation and cancer. Nature 420, 860–867.
Deconto, R. M., Pollard, D., Wilson, P. A., Palike, H., Lear, C. H., and Pagani, M. (2008).
Thresholds for Cenozoic bipolar glaciation. Nature 455, 652–656.
Dunn, G. P., Old, L. J., and Schreiber, R. D. (2004). The three Es of cancer immunoediting.
Annu. Rev. Immunol. 22, 329–360.
Forssell, J., Oberg, A., Henriksson, M. L., Stenling, R., Jung, A., and Palmqvist, R. (2007).
High macrophage infiltration along the tumor front correlates with improved survival in
colon cancer. Clin. Cancer Res. 13, 1472–1479.
Galon, J., Costes, A., Sanchez-Cabo, F., Kirilovsky, A., Mlecnik, B., Lagorce-Pages, C.,
Tosolini, M., Camus, M., Berger, A., Wind, P., Zinzindohoue, F., Bruneval, P., et al.
(2006). Type, density, and location of immune cells within human colorectal tumors
predict clinical outcome. Science 313, 1960–1964.
Graudens, E., Boulanger, V., Mollard, C., Mariage-Samson, R., Barlet, X., Gremy, G.,
Couillault, C., Lajemi, M., Piatier-Tonneau, D., Zaborski, P., Eveno, E., Auffray, C.,
et al. (2006). Deciphering cellular states of innate tumor drug responses. Genome Biol. 7, R19.
Karin, M. (2006). Nuclear factor-kappaB in cancer development and progression. Nature
441, 431–436.
Karin, M., and Greten, F. R. (2005). NF-kappaB: linking inflammation and immunity to
cancer development and progression. Nat. Rev. Immunol. 5, 749–759.
Koh, A., da Silva, A. P., Bansal, A. K., Bansal, M., Sun, C., Lee, H., Glogauer, M., Sodek, J.,
and Zohar, R. (2007). Role of osteopontin in neutrophil function. Immunology 122,
466–475.
Lu, B., Xu, J., Chen, J., Yu, J., Xu, E., and Lai, M. (2008). TaqMan low density array is
roughly right for gene expression quantification in colorectal cancer. Clin. Chim. Acta
389, 146–151.
Mantovani, A. (2005). Cancer: Inflammation by remote control. Nature 435, 752–753.
Mantovani, A., Allavena, P., Sica, A., and Balkwill, F. (2008). Cancer-related inflammation.
Nature 454, 436–444.
Mantovani, A., Muzio, M., Garlanda, C., Sozzani, S., and Allavena, P. (2001). Macrophage
control of inflammation: Negative pathways of regulation of inflammatory cytokines.
Novartis Found. Symp. 234, 120–131; discussion 131–135.
Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., and Locati, M. (2004).
The chemokine system in diverse forms of macrophage activation and polarization.
Trends Immunol. 25, 677–686.
Mantovani, A., Sozzani, S., Locati, M., Allavena, P., and Sica, A. (2002). Macrophage
polarization: Tumor-associated macrophages as a paradigm for polarized M2 mononu-
clear phagocytes. Trends Immunol. 23, 549–555.
McAllister, S. S., Gifford, A. M., Greiner, A. L., Kelleher, S. P., Saelzler, M. P., Ince, T. A.,
Reinhardt, F., Harris, L. N., Hylander, B. L., Repasky, E. A., and Weinberg, R. A.
(2008). Systemic endocrine instigation of indolent tumor growth requires osteopontin.
Cell 133, 994–1005.
Murphy, P. M. (2001). Chemokines and the molecular basis of cancer metastasis. N. Engl. J.
Med. 345, 833–835.
Pages, F., Berger, A., Camus, M., Sanchez-Cabo, F., Costes, A., Molidor, R., Mlecnik, B.,
Kirilovsky, A., Nilsson, M., Damotte, D., Meatchi, T., Bruneval, P., et al. (2005).
Effector memory T cells, early metastasis, and survival in colorectal cancer. N. Engl. J.
Med. 353, 2654–2666.
Podhajcer, O. L., Benedetti, L., Girotti, M. R., Prada, F., Salvatierra, E., and Llera, A. S.
(2008). The role of the matricellular protein SPARC in the dynamic interaction between
the tumor and the host. Cancer Metastasis Rev. 27, 523–537.
Chemokines and Receptors in Human Colon Cancer 121

Pollard, J. W. (2004). Tumour-educated macrophages promote tumour progression and


metastasis. Nat. Rev. Cancer 4, 71–78.
Richmond, A. (2002). Nf-kappa B, chemokine gene transcription and tumour growth. Nat.
Rev. Immunol. 2, 664–674.
Rossi, D., and Zlotnik, A. (2000). The biology of chemokines and their receptors. Annu.
Rev. Immunol. 18, 217–242.
Sangaletti, S., Di Carlo, E., Gariboldi, S., Miotti, S., Cappetti, B., Parenza, M., Rumio, C.,
Brekken, R. A., Chiodoni, C., and Colombo, M. P. (2008). Macrophage-derived
SPARC bridges tumor cell-extracellular matrix interactions toward metastasis. Cancer
Res. 68, 9050–9059.
Schottelius, A. J., and Dinter, H. (2006). Cytokines, NF-kappaB, microenvironment,
intestinal inflammation and cancer. Cancer Treat. Res. 130, 67–87.
Sica, A., and Bronte, V. (2007). Altered macrophage differentiation and immune dysfunc-
tion in tumor development. J. Clin. Invest. 117, 1155–1166.
Strieter, R. M., Burdick, M. D., Mestas, J., Gomperts, B., Keane, M. P., and Belperio, J. A.
(2006). Cancer CXC chemokine networks and tumour angiogenesis. Eur. J. Cancer 42,
768–778.
Taylor, R. C., Patel, A., Panageas, K. S., Busam, K. J., and Brady, M. S. (2007). Tumor-
infiltrating lymphocytes predict sentinel lymph node positivity in patients with cutaneous
melanoma. J. Clin. Oncol. 25, 869–875.
Wai, P. Y., and Kuo, P. C. (2008). Osteopontin: Regulation in tumor metastasis. Cancer
Metastasis Rev. 27, 103–118.
C H A P T E R S I X

Kaposi’s Sarcoma Virally


Encoded, G-Protein–Coupled
Receptor: A Paradigm for
Paracrine Transformation
Daniel Martin and J. Silvio Gutkind

Contents
1. Introduction 127
2. Cloning of vGPCR 128
2.1. Outline 128
2.2. Procedure 129
3. Assaying vGPCR Transforming Activity In Vitro 130
3.1. Overview 130
3.2. Procedure 130
4. vGPCR Transforming Activity In Vivo Using Xenograft Systems 130
4.1. Overview 130
4.2. Procedure 131
5. In Vivo Targeted Infection Using the TVA-RCAS System 131
5.1. Overview 131
5.2. Procedure 132
5.3. Viral production 132
6. vGPCR-Induced Paracrine Transformation 134
6.1. Overview 134
6.2. Procedure 135
7. Characterization of vGPCR-Induced Molecular Signaling 135
7.1. Outline 135
8. Evaluation of Activation of Second-Messenger–
Generating Systems 136
8.1. Overview 136
8.2. Procedure 136

Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research,
National Institutes of Health, Bethesda, Maryland, USA

Methods in Enzymology, Volume 460


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05206-9

125
126 Daniel Martin and J. Silvio Gutkind

9. Activation of Signal-Transducing Protein


Kinases and Small GTPases 137
10. Akt Kinase Assay 137
10.1. Overview 137
10.2. Procedure 137
11. vGPCR Stimulated Activation of Rac1-Pulldown Assays 138
11.1. Overview 138
11.2. Procedure 139
12. Western Blotting Using Phospho-Specific Antibodies 140
12.1. Overview 140
12.2. Procedure 140
13. Activation of Transcription Factors 141
14. Global Changes in Gene Expression: Microarray Analysis 141
14.1. Overview 141
14.2. Procedure 142
15. NFkB Luciferase Assays 143
15.1. Overview 143
15.2. Procedure 144
16. NFkB Binding Assays 144
16.1. Overview 144
16.2. Procedure 145
17. Nuclear Translocation of NFkB 146
17.1. Overview 146
17.2. Procedure 146
Acknowledgments 147
References 147

Abstract
Kaposi’s sarcoma (KS) is an angioproliferative disease caused by infection with
human herpesvirus 8 (HHV-8), also known as Kaposi’s sarcoma-associated
herpesvirus (KSHV). This virus encodes 84 open-reading frames (ORFs), many
of which represent pirated versions of human genes. One of them, ORF74,
encodes a predicted seven-span transmembrane receptor termed vGPCR that
is similar to the human IL8 receptor CXCR2, which displays strong oncogenic
activity in vitro and in vivo by a complex interplay of direct and autocrine/
paracrine mechanisms. vGPCR has been shown to be both necessary and
sufficient for the formation and progression of KS-like lesions in experimental
model systems. Due to the fundamental role of vGPCR in the pathogenesis of
KS, understanding the molecular mechanisms elicited by this unique chemo-
kine receptor can be exploited to devise new strategies for KS management, as
well as to gain novel insights into how KSHV subverts key physiological pro-
cesses such as cell proliferation, chemotaxis, angiogenesis, and immunomodu-
lation for its replicative advantage. Here we describe multiple techniques and
strategies that have been used to study the unique properties and functions of
vGPCR and its role in oncogenesis.
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 127

1. Introduction
The human herpesvirus 8 (HHV8) (also termed Kaposi’s sarcoma-
associated herpesvirus [KSHV]) is the etiologic agent of Kaposi’s sarcoma
(KS) and two lymphoproliferative diseases, multicentric Castleman’s disease
and primary effusion lymphoma (Cesarman and Mesri, 2007; Chang et al.,
1994). KS is an angioproliferative disease manifested in four different variants
that vary in the onset, progression, and clinical implication (Schwartz et al.,
2008). Classical KS, the first described, affects elderly population of the
Mediterranean area, appearing in extremities, normally as an indolent disease.
The endemic variant is a more aggressive form, occurring mostly in young
males in some sub-Saharan African countries (Morris, 2003). A third variant,
the iatrogenic KS, is developed by transplant recipients undergoing immu-
nosuppression regimes, and finally, the AIDS-associated KS is the most
aggressive variant and is frequently fatal being still the most common cancer
arising in AIDS patients (Laney et al., 2007). The introduction of highly
active antiretroviral therapy (HAART) has caused a dramatic decrease in the
proportion of new AIDS-defining KS cases and a regression in the size of
existing KS lesions (Bower et al., 2006). However, there is still a risk of
recurrence of AIDS-associated KS that we cannot afford to ignore (Rezza
et al., 1999). Indeed, in parts of the developing world, KS has tragically
emerged as one of the most frequent cancers among children and adult
men (Schwartz et al., 2008), and KS remains a significant cause of morbidity
and mortality among the world AIDS population (Cheung et al., 2005).
Initial characterization of KS lesions identified the presence of multiple
cytokines and growth factors. Unlike many other tumor-derived cell cul-
tures, isolates from KS lesions strictly require supplementation with growth
factor and chemokines such as VEGF and oncostatin M, providing an early
insight into the central role secreted factors play in KS development and
maintenance (reviewed in Cesarman and Mesri, 2007; Ganem, 2006). In
this regard, upon sequencing of the KSHV genome, several virally encoded
genes and cytokines have been identified and shown to play roles in cell
proliferation, immune surveillance evasion, and host cell recruitment.
These include multiple virally encoded secreted factors such as vIL6,
vCCL-1, vCCL-2, and vCCL-3, and a number of viral proteins that
promote the production of host cytokines, chemokines, and growth factors
(Ganem, 2006). Among these molecules, the open reading frame 74
(ORF74) encodes a constitutively active G-protein–coupled receptor
termed vGPCR that is highly related to the IL8 chemokine receptor
CXCR2 (Arvanitakis, 1997). vGPCR promotes the release of proangio-
genic growth factors and exhibits potent transforming activity in cells in
culture (Bais et al., 1998; Sodhi et al., 2000). Furthermore, when expressed
as a transgene or when virally transduced into endothelial cells, vGPCR
readily leads to the development of KS-like lesions in animal models
128 Daniel Martin and J. Silvio Gutkind

(Guo et al., 2004; Jensen et al., 2005; Montaner et al., 2003; Yang et al.,
2000). This strong growth-promoting and tumorigenic activity of vGPCR
involves the robust stimulation of the expression and release of multiple
chemokines and endothelial growth factors, which promote the prolifera-
tion of KSHV infected cells in a an autocrine and paracrine fashion (Martin
et al., 2008; Montaner et al., 2003; Sodhi et al., 2004a).
While recent studies have highlighted the critical role of vGPCR in KS
development (Mutlu et al., 2007), the emerging information on how
vGPCR exerts its potent sarcomagenic activity in animal models has now
provided an opportunity for the development of molecularly targeted
therapies aimed at interfering with vGPCR-initiated pathways in human
KS (Montaner et al., 2006; Sodhi et al., 2006). In this regard, early studies
showed that vGPCR stimulates several mitogenic pathways, including the
MAPK and p38 pathways and the small G-protein Rac1, which play a role
in vGPCR-induced pathogenesis (Bais et al., 1998; Dadke et al., 2003;
Montaner et al., 2004; Sodhi et al., 2000). Subsequently, it was observed
that vGPCR promotes the survival and subsequent transformation of endo-
thelial cells by the activation of the phosphatidylinositol-3-kinase (PI3K)–
Akt pathway (Sodhi et al., 2004b). Systematic analysis of the molecular
mechanism by which the activation of Akt contributes to vGPCR-induced
sarcomagenesis revealed that mTOR, a protein kinase that acts as a down-
stream target of Akt, is strictly required for the tumorigenic activity of
vGPCR (Sodhi et al., 2006), thereby providing a molecular target for
therapeutic intervention in this angioproliferative disease. Indeed, drugs
that inhibit the PI3K-Akt-mTOR pathway can halt the progression of KS
and even induce its regression both in animal models and in the clinical
setting (Chaisuparat et al., 2008; Sodhi et al., 2004b; Stallone et al., 2005).
The identification of suitable molecular targets for KS treatment has
ignited renewed interest in understanding the molecular mechanisms
involved in vGPCR-mediated angioproliferation, immunomodulation and
transformation. Here we describe a number of techniques and strategies to
study several molecular aspects of vGPCR with particular focus in its direct
and paracrine transforming ability in vitro and in vivo. We will not assume
previous experience from the reader and we will emphasize practical simpli-
fications that we have developed in some of the protocols that we expect can
be useful also for the characterization of other chemokine receptors.

2. Cloning of vGPCR
2.1. Outline
KSHV RNA can be obtained form several sources including KS biopsies,
pleural effusions, body cavity B-cell lymphomas (BCBL), cell lines, and
KS-derived spindle-cell cultures (Browning et al., 1994) and the KSHV
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 129

phage library (National Institutes of Health, AIDS Research and Reference


Reagent Program, Rockville, MD). Because of the limited availability of
commercial antibodies for vGPCR, it is advised to epitope-tag the protein.
As GPCRs interact with Ga subunits and with the internalization and
intracellular targeting machinery by their c-terminal tails, it is recom-
mended to add small tags N-terminally. Addition of bulkier N-terminal
tags, such as GFP or derivatives, normally results in reduced vGPCR
activity (unpublished results).

2.2. Procedure
RNA should be extracted using standard methods such as the TriZOL
(Invitrogen, Carlsbad, CA) method. Following manufacturer’s recommen-
dations regarding the specific volume of TriZOL reagent to use depending
on the origin of the source (tissue or cell line) and mass, homogenization
will be accomplished by finely mincing, grinding in LN2, or scrapping of
the sample in TriZOL. Incubate the samples for 5 min at room temperature,
centrifuge, and add 1:5 of the volume of chloroform and vortex vigorously.
Incubate the samples for an additional 15 min. Centrifuge the samples at
12,000g for 15 min, and collect the upper phase containing the RNA.
Precipitate the RNA by adding 1:2 of the original TriZol volume of
isopropyl alcohol. Incubate for 15 min at room temperature and centrifuge
at 12,000g for 10 min at 4 . Wash the RNA pellet once with 75% EtOH, air
dry, and resuspend the pellet in RNAse-free water.
Use 100 ng of RNA as template for cDNA synthesis using Superscript II
(Invitrogen). Assemble the reaction following the manufacturer’s recom-
mendations but extend the synthesis at 42 for up to 2 h. Remove RNA by
treatment with RNAse H. This cDNA can be used as template for PCR, or
alternatively, Lambda Phage KSHV Library DNA that can be obtained from
the National Institutes of Health, AIDS Research and Reference Reagent
Program, Rockville, MD, can be used as well.
Amplify vGPCR using the following oligos containing BglII and EcoRI
sites (underlined) used for the subsequent cloning (or modify accordingly);
the vGPCR start codon is boldfaced.
Fwd: 50 -ATAAGATCTATGGCGGCCGAGGATTTCCTAAC-30
Rev: 50 -ATAGAATTCCTACGTGGTGGCGCCGGACATGAA-30
Use 100 ng of cDNA or lambda DNA as template using a high-fidelity
polymerase. Conditions for PCR are as follows: 95 , 2 min initial denatur-
ation; 30 cycles of 95 30 s, 60 30 s, and 68 1.5 min; and a final 7min
extension at 68 . PCR amplification of vGPCR yields a 1.1-Kb fragment.
Gel-purify the PCR product and clone in an expression vector.
130 Daniel Martin and J. Silvio Gutkind

3. Assaying vGPCR Transforming


Activity In Vitro
3.1. Overview
One of the most remarkable cellular effects of vGPCR is the acquisition
of a transformed phenotype that can be experimentally induced by trans-
fecting mouse fibroblasts with vGPCR (Bais et al., 1998). A very conve-
nient way to detect and characterize molecules involved in vGPCR’s
transforming ability is to cotransfect the cells with shRNA-encoding
vectors targeted to molecules of interest or expression vectors for their
interfering mutants, and thus study cooperation or inhibition in cell
transformation.

3.2. Procedure
Transfect NIH 3T3 cells by the calcium phosphate precipitation technique
(Wigler et al., 1977) with a vGPCR expression vector and optionally other
expression or shRNA-encoding plasmids together with 1 mg of pcDNAIII-
b-gal, a plasmid expressing the enzyme b-galactosidase, adjusting the total
amount of plasmid DNA with empty vector, and maintaining the cells
in DMEM supplemented with 10% calf bovine serum. The day after
transfection, wash the cells in medium supplemented with 5% calf serum,
and maintain them, changing the same medium twice a week until foci
are scored 3 to 4 weeks later. Fix the plates with PBS containing 2%
(v/v) formaldehyde and 0.2% (v/v) glutaraldehyde and stain at 37 for
b-galactosidase activity with a PBS solution containing 2 mM MgCl2, 5 mM
K3Fe(CN)6, 5 mM K4Fe(CN)6, and 0.1% 5-bromo-4-chloro-3-indolyl-b-D-
galactopyranoside (X-gal) to evaluate the transfection efficiency.

4. vGPCR Transforming Activity In Vivo


Using Xenograft Systems
4.1. Overview
The initial studies that led to the realization of vGPCR as a putative
oncogene were performed using mouse xenograft models (Bais et al.,
1998). This method still remains the gold standard to evaluate transforming
potential in vivo, while also provides a simple model, albeit with limitations,
to screen for potential therapeutic targets.
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 131

4.2. Procedure
SVEC cells lines were used to induce endothelial tumor xenografts in
athymic mice as described previously (Montaner et al., 2003). Female
athymic (nu/nu) nude mice (Harlan Sprague-Dawley, Frederick, MD),
5 to 6 weeks of age and weighing 18 to 20 g, are routinely used in these
studies, and are housed in appropriate sterile filter-capped cages and fed and
watered ad libitum. Briefly, exponentially growing stable cultures of vGPCR
expressing cells are harvested, washed, and resuspended in DMEM. One
million viable cells are transplanted subcutaneously into both flanks of the
athymic mice. Normally, SVEC-vGPCR induced tumors progress slowly,
within 1 to 2 months. For tumor growth analysis, tumor weight is deter-
mined as described previously (Montaner et al., 2003), whereby tumor
volume (LW 2/2, where L and W represent the length and the width of
the tumor) is converted to weight (milligrams) assuming unit density.
Alternatively, we have begun to use cell lines expressing the red-shifted
GFP derivative mCherry and firefly luciferase. These cell lines allow for
careful quantitative analysis of the tumor volume and ‘‘metabolic status’’
using bioluminescence detectors such as the Xenogen IVIS Lumina II.
Because steady production of mCherry and luciferase is associated with
normal metabolism of these cells, the analysis of these two markers allows
for early visualization of changes in tumor status before apparent changes in
tumor volume occurs, for example when evaluating small molecule inhibi-
tors of tumor growth. Regardless of the method used for evaluation, the
animals are monitored twice weekly for tumor volume. Results of animal
experiments are normally expressed as mean  standard error, and the
unpaired Student’s t test is used to determine the difference between
experimental and control groups for each of the cell lines.

5. In Vivo Targeted Infection Using


the TVA-RCAS System
5.1. Overview
The limitations in the tumorigenicity studies using xenograft models can be
overcome with the use of the RCAS system (Hughes, 2004). This system
allows the expression of genes in mammalian cells in vivo through specific
somatic infection and requires two components. It involves the use of an
avian retrovirus derived from the Rous sarcoma virus (RSV), a member of
the family of avian sarcoma-leukosis viruses (ASLVs) and a cell surface
glycoprotein, TVA, which serves as receptor for this virus, thereby enabling
viral infection (reviewed in Fisher et al., 1999). Because TVA is only
expressed in avian cells, the virus is unable to infect mammalian cells.
132 Daniel Martin and J. Silvio Gutkind

However, it is possible to express this molecule as a transgene, thus enabling


specific infection, which will be restricted to the cell types or tissues
expressing Tva. To study the role of vGPCR in KS pathogenesis in vivo,
we developed a RCAS-based retroviral gene transfer system to specifically
express this KSHV oncogene in mouse endothelial cells (Fig. 6.1). We
engineered transgenic mice to express the avian retroviral receptor, Tva,
under the control of the vascular endothelial cell-specific TIE2 promoter
(Montaner et al., 2003). Indeed, expression of this receptor is exclusively
detectable in endothelial cells (Montaner et al., 2003). RCAS retroviral
vector encoding vGPCR are generated using standard cloning techniques,
and viral production is performed on the chicken fibroblast cell line DF-1.

5.2. Procedure
For the generation of an endothelial-specific TVA-expressing transgenic
line, the TIE2-Tva transgene was created by insertion of the pg800 tva
cDNA as a NotI fragment into a bluescript SK (þ) vector containing the
murine 2.1-kb HindIII TIE2 promoter fragment and SV40 poly (A) signal
sequence (Montaner et al., 2003). The plasmid also included, downstream
of the tva cassette, a 10-kb autonomous endothelial-specific enhancer
located in the first intron of the mouse TIE2 gene, which allows specific
and uniform gene expression to all vascular endothelial cells in vivo. Trans-
genic mice are generated in FVB/N mice using standard techniques and
identified by Southern blot using the Tva cDNA as a probe. Genotypes are
determined by Southern blotting and by PCR with tail DNA.

5.3. Viral production


RCAS vectors are replication-incompetent in mammalian cells; however,
they are competent for replication in avian cells. This property enables very
efficient viral production upon transfection of the RCAS vector or by viral
infection of available stocks in avian cells. Eventually all cells become
infected and start producing viruses, reaching titers as high as 1011 infective
units (i.u.) per milliliter in concentrated stocks. A simple protocol for viral
production follows. DF-1 chicken fibroblasts are maintained in DMEM
with high glucose and sodium pyruvate, supplemented with 10% FBS and
1% penicillin/streptomycin. DF-1 cells are transfected using ExGen 500
reagent (Fermentas) with RCAS vectors to produce recombinant viruses.
It is always advisable to produce RCAS GFP viruses in parallel, as they can
be easily monitored by fluorescence microscopy, and thus serve as positive
controls for viral production and titration. Initially transfection efficiency
is normally low, at less than 20%; however, due to the replication of the
virus in the transfected cells most cells are actively producing virus in 3 to
4 days. Cell cultures have to be actively expanded and split as necessary,
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 133

RCAS viral production


RCAS
RCAS (avian retrovirus)
vector

Transfection
Retroviral stocks
2 weeks

DF-1 cells
TIE2-TVA mouse

Endothelial cell-
specific
gene transfer
vGPCR

MAPK IL8
Akt
TVA p38 VEGF
NFκB SDF-1

Multiple signaling events


paracrine transformation
spindle cell growth
Endothelial cell angiogenesis
Kaposi’s sarcomagenesis

Figure 6.1 Overview of the RCAS system. The two components of the RCAS system
are depicted in the figure. A recombinant avian retrovirus (RCAS) is produced in DF-1
chicken fibroblast. Somatic expression of genes of interest, such as vGPCR, in mice is
achieved by the tissue-restricted transgenic expression of the glycoproteinTVA, which
acts as a receptor for avian leukosis^derived retroviruses. In particular, the expression of
TVA in endothelial cells using the Tie2-TVA transgenic animal system enables the
endothelial-specific expression of vGPCR and other genes of interest in vivo in a high-
throughput fashion.

as retroviruses can only infect cells undergoing division. Once all the cells
are producing virus (as judged by GFP fluorescence), let the cells reach
confluence, wait an additional 48 h, and collect cell-free viral supernatants.
Supernatants can be immediately used, frozen, or combined for concen-
tration. For concentration, 30 ml of virus-containing supernatant are
ultracentrifuged in an SW28 Beckman (Fullerton, CA) rotor at 22,000
rpm at 4 for 2 h. Pellets are resuspended in 1/100 of the original volume
in PBS and viral titers are determined by limiting dilution. Briefly,
134 Daniel Martin and J. Silvio Gutkind

mammalian TVA-expressing cells, such as SVEC-TVA cells, are seeded into


six-well culture dishes at 30% confluence and infected with serial 10-fold
dilutions of concentrated viral supernatants in growth medium. Cell num-
bers expressing the retroviral-transduced proteins are determined by immu-
nofluorescence, and viral titers expressed as the number of infective units
(i.u.) per milliliter. Viral stocks are injected intraperitoneally into 5-day-old
FVB/TIE2-Tva littermates (100 ml/mouse) at the indicated viral load. Mice
are genotyped at 21 days of age. Depending on the viral titer, animals could
die within the first 2 months after infection, displaying multiple hemorrhages
and small angioproliferative lesions. If titer is low enough for the animals to
survive (approximately 105 i.u.), KS-like lesions will develop within the first
year, normally appearing after 6 months.

6. vGPCR-Induced Paracrine Transformation


6.1. Overview
KS lesions are characterized histologically by predominant proliferating
spindle cells, angiogenesis, erythrocyte-replete vascular slits, profuse
edema, and a variable inflammatory cell infiltrate (Schwartz et al., 2008).
The presence of KSHV-infected cells increases as the lesion progresses, but
many cells including some of the dominant spindle cells present in KS
lesions remain uninfected even in advanced lesions (Chiou et al., 2002),
while displaying a transformed phenotype. vGPCR is considered a lytic
gene, but its powerful KS-driving properties are evident in spite of the fact
that the expression of this receptor is restricted to a small percentage—
between 1 and 5%—of the cells in human lesions. The origin of these few
vGPCR-expressing cells could be due to a basal level of viral replication, an
aborted lytic cycle, or dysregulated expression of vGPCR (Nador et al.,
2001; Sodhi et al., 2004a). In an effort to mimic the cellular composition of
human KS lesions in our animal xenograft model, we generate mixed
populations using a small percentage of the cells expressing vGPCR while
the majority express three of the major latent transcripts, namely, LANA,
vFLIP, and vCyclin (Fakhari and Dittmer, 2002). While the oncogenic
potential of these genes is the focus of intense debate, when coexpressed in
SVEC cells, they do not induce cellular transformation and do not form
tumors in xenograft models (Montaner et al., 2003). However, in the
presence of 10% SVEC-vGPCR cells and their induced secreted factors,
these cells initiate an exuberant proliferation becoming tumorigenic
through a process known as paracrine transformation.
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 135

6.2. Procedure
For the generation of the SVEC line expressing the three latent transcripts,
we first generated a line expressing vFLIP and vCyclin, as both are expressed
as a naturally occurring bicistronic mRNA. Once a stable pool of clones was
selected and characterized, cells were submitted to a second round of
transfection with a LANA expression vector cotransfected with 1:10 of
the total DNA of a vector encoding a different resistance gene than the
one used in the first place. To reconstitute the cellular composition of human
KS in mice, 1  105 SVEC-vGPCR cells are combined with 9  105 SVEC
LANA/vFLIP/vCyclin cells prior to injection into female (nu/nu) athymic
mice. As a negative control, SVEC-vGPCR cells can be substituted by
inactive mutant vGPCR (vGPCRD5) or the parental cell line (Montaner
et al., 2003). The animals are monitored twice weekly for tumor formation
for 3 months. For analysis, tumor weight is determined by converting tumor
volume (LW2/2) (where L and W represent longest length and shortest width
of the tumor) to weight.

7. Characterization of vGPCR-Induced
Molecular Signaling
7.1. Outline
Characterization of the molecular responses elicited by vGPCR is essential
to understand its role in KS initiation and progression. A number of
methods have been used to study the cellular signaling triggered by the
expression of this receptor. Initial studies showed that unlike its closest
homolog, CXCR2, this receptor requires no ligand binding to activate a
number of signaling events (Arvanitakis et al., 1997). However, vGPCR still
retains the ability to bind a number of molecules, further modulating its
intrinsic activity and include IL8, Groa and several other CXC and CC type
chemokines (Rosenkilde et al., 1999). A simple method to evaluate the
activity of the receptor is the analysis of second messengers and activated
signaling molecules after transient transfection of the receptor. However,
large overexpression of vGPCR can be toxic to cells, including those
of endothelial and fibroblastic origin. To perform transient transfection
experiments, it is therefore advisable to initially evaluate a range of con-
centrations of vGPCR expression vectors (dose–response) for every cell
line. Most classical vGPCR activity experiments have been performed using
COS-1 and COS-7 cells in addition to NIH 3T3 fibroblasts, but other
cell lines such as the murine immortalized endothelial cell line SVEC 4-10
can be also used.
136 Daniel Martin and J. Silvio Gutkind

8. Evaluation of Activation of
Second-Messenger–Generating Systems
8.1. Overview
The accumulation of second messengers is an early event in the signal
transduction induced by GPCRs. In particular, vGPCR strongly stimulates
phosphatidylinositol bisphosphate (PIP2) hydrolysis upon expression. Gaq
proteins, when triggered by receptors, activate the plasma-membrane–
bound enzyme phospholipase C-b (PLC) (Sternweis and Smrcka, 1992).
This enzyme hydrolyzes PIP2 in the plasma membrane to release inositol
1,4,5-trisphosphate (IP3). This molecule is labile, being quickly hydrolyzed
to two inositol phosphate subproducts, IP2 and IP1. Part of the IP3 gener-
ated binds to specific receptors on the endoplasmic reticulum, which induce
opening of calcium-release channels (Berridge, 2005). This quickly raises
the concentration of Ca2þ ions in the cytosol, causing a burst of ionic
calcium that will lead to the activation of important effectors such as PKC
or the NFAT transcription factor (Berridge, 2005; Crabtree and Olson,
2002). The following procedure is based in the purification and measure-
ment of inositol produced in response to vGPCR expression from a radi-
olabeled precursor.

8.2. Procedure
To measure inositol phosphate levels in transiently transfected cells, perform
transfections in 12-well plates using increasing amounts of a vGPCR
expression vector and a GFP or other fluorescent protein–encoding plasmid
to assess for efficiency of transfection and vGPCR-induced toxicity. DNA
amounts should be maintained constant by the addition of empty expression
vector. The transfection method should be optimized beforehand for every
particular cell type. We have successfully transfected a number of cell lines,
including COS-7, NIH 3T3, and SVEC using the ExGen500 reagent
(Fermentas, Burlington, Ontario). Briefly, dissolve 2 mg of the DNA mix-
ture in 100 ml of 150 mM NaCl, and add 6.6 ml of ExGen500 reagent, mix
by vortexing and incubate for 10 min at room temperature. Add complexes
drop-wise to the wells and swirl to ensure appropriate distribution. Incubate
the cells for 12 to 16 h before removing complexes, and label the cells by
adding fresh complete medium containing 1 mCi/ml myo-[3H]-inositol
(DuPont/NEN, Boston, MA), incubating for an additional 24 h. Remove
and safely discard the media, rinse once with warm PBS, and replace with
prewarmed serum-free medium containing 10 mM HEPES, pH 7.4, and
10 mM LiCl, an inhibitor of inositol phosphatases. Cells are collected at
different time points (usually 10 min to 1 h), rinsed once with ice-cold
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 137

PBS, and then the reaction is halted by addition of 1 ml ice-cold trichlor-


oacetic acid (TCA) in each well. Water-soluble [3H]-inositol phosphates
are separated from unincorporated [3H]-inositol using anion-exchange
chromatography on Dowex-Cl columns (Mallinckrodt Baker, Phillipsburg,
NJ) and measured using scintillation counting as described (Gutkind
et al., 1991).

9. Activation of Signal-Transducing Protein


Kinases and Small GTPases
vGPCR activates a number of mitogenic and stress pathways includ-
ing the PI3K/Akt, MAPK, and p38 pathways leading to increased survival,
proliferation, and production of secreted factors (Bais et al., 1998; Dadke
et al., 2003; Montaner et al., 2001; Sodhi et al., 2000, 2004a). In addition,
vGPCR also activates the small G protein Rac1, which has been shown to
play a role in vGPCR-induced sarcomagenesis (Montaner et al., 2004).

10. Akt Kinase Assay


10.1. Overview
While there are a number of techniques that have been traditionally used to
study the activation of kinases, the widespread availability of phospho-
specific antibodies has relegated most of them to a second option. None-
theless, in vitro kinase assays are still considered the gold standard to assess
kinase activity, and we have used them successfully to analyze the activation
of Akt and MAPK in response to vGPCR expression (Bais et al., 1998;
Montaner et al., 2001).

10.2. Procedure
To assay for Akt activation induced by vGPCR, split COS-7 1:5 in 10%
fetal bovine serum containing DMEM the day previous to transfection.
Transfect cells using ExGen500 reagent (see above) with a cocktail contain-
ing 0.5 mg pCEFL-HA-Akt1 (or other epitope-tagged Akt expression
vector) plus increasing concentrations of a vGPCR-encoding vector, nor-
malizing DNA amounts to 10 mg per plate using empty vector. It is
recommended to also add 1 to 2 mg of a GFP encoding vector to monitor
efficiency of transfection and toxicity. Incubate the cells with transfection
complexes for 24 h, and then starve cells in serum free medium for 16 h, or
alternatively, 4 h, if cells are too sensitive to starvation. Discard medium and
138 Daniel Martin and J. Silvio Gutkind

wash with cold PBS twice, making sure to aspirate as much PBS as possible.
Add 1 ml (for a 10 cm plate) or 600 ml (for a 6-cm plate) of cold lysis buffer
(1% triton X-100, 10% glycerol, 137 mM NaCl, 20 mM Tris-HCl, pH 7.5,
1 mg/ml aprotinin and leupeptin, 1 mM PMSF, 20 mM NaF, 1 mM NaPPi,
and 1 mM of freshly prepared Na3VO4). Scrape cells and transfer to
Eppendorf tubes. Shake 10 min at 4 (vortexing 30 s also works). Clear
the samples by centrifugation at 12,000g, for 10 min at 4 . This will
sediment unbroken cells, membranes, mitochondria, and nuclei. Transfer
cleared supernatant to new tubes containing 1 ml of anti-HA antibody
(12CA5 clone, Covance, Princeton, NJ). Transfer the samples to an orbital
rocker and leave rocking at 4 for 2 h. Add 20 ml of a 50% slurry of
Gammabind Protein-G sepharose beads (GE Healthcare, Piscataway, NJ).
Rock the samples for an additional 1 h at 4 . Centrifuge at 12,000g for 15 s.
As the beads loosely pack at the bottom of the tube, use a micropipette
instead of suction to carefully remove the supernatant and discard. Resus-
pend in 1 ml of cold lysis buffer and centrifuge again. Wash the beads twice
with 1 ml cold lysis buffer. Wash once with 1 ml cold water and finally wash
once with 1 ml ‘‘cold’’ kinase buffer (1 kinase buffer: 20 mM HEPES,
pH 7.4, 10 mM MgCl2, 10 mM MnCl2, prepared as a 10 stock) and
carefully remove all supernatant. For the kinase reaction, resuspend beads in
25 ml of 1 complete ‘‘hot’’ kinase buffer (supplement 1 kinase buffer
with 0.05 mg/ml histone H2B substrate, 5 mM ATP, 1 mM DTT, and
10 mCi of [g32P]-ATP). Shake 30 min at room temperature (30 min at 30
also works). Terminate the reaction by adding 5 ml of 5 protein loading
buffer, boil, and load into a 15% SDS-PAGE acrylamide gel including the
beads. Transfer gel to Immobilon-P membranes (Millipore, Billerica, MA)
and expose the area containing the substrate H2B, around 15 kDa. Confirm
by Western blot the presence of immunoprecipitated HA-Akt (around
60 kDa, but note that it runs very close to the IgG heavy chain).

11. vGPCR Stimulated Activation


of Rac1-Pulldown Assays
11.1. Overview
The principle of the assay depends on the ability of active, GTP-bound
form of Rac1, to interact with the Rac1 binding domain on the N-terminal
portion of PAK1 (PAK-N) expressed as a glutathione-S-transferase fusion
protein (Montaner et al., 2004; Tan et al., 2006). The PAK-N-GST protein
is first expressed in bacteria and the recombinant protein is isolated with
glutathione-sepharose beads. These beads are then used to capture the active
form of Rac1 from lysates of vGPCR expressing COS-7 cells, and the
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 139

fraction of active Rac1 is detected by Western blotting having as a reference


the amount of Rac1 detected in parallel in total cell lysates.

11.2. Procedure
Preparation of PAK-N beads
The expression vector pGEX encodes the glutathione S-transferase (GST)
fusion protein with the isolated GTP-dependent binding domain of the
Rac1 effector PAK1 (Teramoto et al., 1996). Transform BL21 Escherichia coli
with GST-PAK-N and plate the bacteria on LB-agar containing 50 mg/ml
ampicillin. Pick a colony of GST-PAK-N–transformed BL21 cells and start
a liquid culture in 5 ml of LB-ampicillin, leave overnight at 37 with
constant shaking. On the following day, transfer the culture into a 1-1
bottle containing 250 ml of LB-ampicillin, and leave 2 to 3 h at 37 with
constant shaking. Add 0.2 mM IPTG (isopropyl b-D-thiogalactopyranoside,
Sigma, cat. no. I-5502, prepare a 200-mM stock in water and keep it frozen
in small aliquots), transfer the culture to room temperature and leave it
overnight with constant shaking. Harvest the bacteria by centrifugation and
resuspend in 10 ml of ice-cold PBS-Triton-EDTA including protease
inhibitors (1% Triton X-100, 1 mM EDTA, 1 mM PMSF, 10 mg/ml each
aprotinin and leupeptin). Transfer the lysates to a 50-ml polypropylene
centrifuge tube and freeze-thaw three times by immersing in an ethanol
dry-ice bath followed by thawing in cold water. Keep the lysates on ice and
sonicate three times for 10 s each to disrupt genomic DNA. Centrifuge at
14,000 rpm (Beckman JA-17 Rotor or equivalent). In the meantime
prepare 250 ml of glutathione-sepharose beads (GE Healthcare cat. no.
17-0756-01 or similar) by washing them with PBS-Triton-EDTA. Transfer
the supernatant of the lysates to a 15-ml tube and incubate with the beads
for 30 min at 4 with constant shaking. Centrifuge at 4 for 1 min at 3000
rpm. Resuspend the beads in PBS-Triton-EDTA containing protease
inhibitors, transfer to a microcentrifuge tube, and wash three times; resus-
pend the beads each time by vortexing, and spin down briefly. Wash three
times with PBS containing protease inhibitors and resuspend in 500 ml of
this buffer. For the experiment, use 50 ml of resuspended beads per sample.
We prefer to keep the beads at 4 and use them within a week.

Experiment
Transfect COS-7 cells with wildtype vGPCR or a mutant inactive form
such as vGPCR R143A to be used as a negative control. The day after
transfection leave the cells in serum free media and process the experiment
the following day. Wash once with ice cold PBS and keep the plates on ice
from that point on, and use ice-cold buffers. Lyse the cells at 4 with 1 ml
of a buffer containing 50 mM Tris, pH 7.5, 0.15 M NaCl, 1% Triton X-100,
5 mM EDTA, 10 mM MgCl2, 10 mg/ml aprotinin, 10 mg/ml leupeptin, and
140 Daniel Martin and J. Silvio Gutkind

1 mM phenylmethylsulfonyl fluoride. Transfer the lysates to micro-


centrifuge tubes, centrifuge at 14,000 rpm for 5 min at 4 , and transfer the
supernatants to new tubes for the isolation of GTP-Rac1 and 75 ml to a
second set of tubes for total cell lysates. Incubate the cell lysates with 50 ml of
GST-PAK-N beads (vortex briefly before taking the indicated volume),
leave at 4 for 30 to 45 min in an orbital rocker, wash three times with lysis
buffer, vortex, and spin down briefly for each wash. Detect the active
GTP-bound form of Rac1 associated with GST-PAK-N and the total
Rac1 in cell lysates by Western blot analysis using a monoclonal antibody
against Rac1 (Santa Cruz Biotechnology).

12. Western Blotting Using


Phospho-Specific Antibodies
12.1. Overview
In most cases the activity of signal-transducing kinases is regulated by
phosphorylation on specific residues. In addition, when a specific substrate
has been defined for a particular kinase, its activity can be determined
by analyzing the status of phosphorylation of its cellular substrates or
direct targets. Western blotting with phospho-specific antibodies for the
most relevant kinases and their substrates provides a very fast and convenient
alternative to the classical kinase assays and is routinely used in most
laboratories. We have used Western blot analysis of most mitogenic path-
ways to assess for the activity of vGPCR, with particular emphasis on the
MAPK and PI3K/Akt/mTOR pathways (Montaner et al., 2001; Sodhi
et al., 2000).

12.2. Procedure
Cell and tissue lysates are prepared by incubation on an appropriate volume
of SDS-lysis buffer (50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM
EDTA, 1% SDS, 2% Triton X-100, 1% b-mercaptoethanol). This buffer
will extract and denature all the proteins in the cell but disrupts the nuclear
membrane, provoking the release of genomic DNA that will increase the
viscosity of the solution. Scrape the cells or grind the tissue in this buffer and
transfer to Eppendorf tubes. Cutting the pipette tips to increase the diameter
will ease pipetting into the tubes. Keep samples at 4 . Sonicate samples for
10 sec on ice with a tip sonicator (5 watts) to shear the DNA; avoid
overheating the samples. The viscosity will be reduced after this procedure.
Add 5 SDS-loading buffer and boil the samples. Resolve the samples by
SDS-PAGE, transfer into Immobilon-P membranes (Millipore), and pro-
ceed with Western blotting. We normally block for 1 h in 5% non-fat dry
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 141

milk in T-TBS (50 mM, Tris-HCl, pH 7.5, 150 mM NaCl, 0.05%


Tween-20), followed by a 2-h to overnight incubation with primary
antibody diluted in 0.5 to 5% BSA. Wash the membranes three times
with T-TBS and incubate for 1 h with the appropriate HRP-conjugated
secondary antibody (Southern Biotech, Birmingham, AL) diluted 1:30,000
in 5% milk in T-TBS. Wash three times for 10 min with T-TBS, and
perform an enhanced chemiluminiscence reaction (Immobilon Western,
Chemiluminiscent HRP substrate, Millipore, or related kits) for development
following the manufacturer’s instructions. Primary antibodies are normally
diluted at 1:1000 to 1:5000, but require individual optimization. Antibodies
frequently used in our laboratory include phospho-specific rabbit monoclonal
antibodies from Cell Signaling (Danvers, MA) including phospho-S6
S32, phospho-Akt S473, phospho-Akt T308, phospho-p70S6K T389,
phospho-mTOR S2448, and phospho-p44/42 (Erk1/2). Many excellent
antibodies for similar targets are also available from other companies, and
should be evaluated.

13. Activation of Transcription Factors


Changes in gene expression due to the activation or repression of
transcription factors in the nucleus represent the ultimate target of molecular
signaling events initiated by vGPCR expression. In particular, a number of
transcription factors have been identified that are activated or repressed by
vGPCR-stimulated pathways. They include AP-1, HIF-1, NFAT, FOXO,
and NFkB, among others (Cannon et al., 2003; Martin et al., 2008; Sodhi
et al., 2000). Our recent studies have been focused in the contribution and
mechanism of activation of the NFkB transcription factor by vGPCR, as it
plays a fundamental role in the production and secretion of numerous
chemokines and growth factors implicated in the development of KS
(Martin et al., 2008). Here, we provide methods that we use routinely to
evaluate global changes in gene expression at the coarse level, as well as the
fine detailed analysis of particular transcription factors.

14. Global Changes in Gene Expression:


Microarray Analysis
14.1. Overview
Generally speaking, gene expression profiling consists on the isolation of
mRNA from test samples and controls, synthesis of fluorescently labeled
cDNA and then hybridization onto a DNA or oligonucleotide microarray
142 Daniel Martin and J. Silvio Gutkind

representing all or part of the genomic transcripts of a given organism.


In recent years, a number of complementary platforms for gene expres-
sion analysis have rapidly evolved. Our first studies on vGPCR-induced
transcriptional changes were conducted on custom-designed spotted long
oligonucleotide arrays containing around 40,000 features. These platforms
have been clearly surpassed by much more dense microarrays leveraging
sophisticated on spot oligonucleotide synthesis with advanced quality con-
trol measures and highly optimized workflows. Several vendors offer very
integrated platforms for genomics and gene expression profiling, with
individual strengths and weaknesses. We provide here a method based on
the gene expression platform from Agilent (Santa Clara, CA), but similar
platforms from alternative vendors as Affimetrix, Illumina, or Nimblegen
have been extensively used and provide perfectly valid alternatives. Due to
the massive data generation capabilities of microarrays analysis, careful
experimental design is a prerequisite for gene expression profiling. Sample
replication is of paramount importance to determine the robustness of the
subsequent analysis. We have learned that biological replicates (i.e., taking
several independent replicates or repetitions of the same experimental point)
are much more important than experimental replicates (i.e., repeating the
microarray procedure for the same sample) and that three to four good-
quality biological replicates provide sufficient statistical power to identify
hundreds of genes with altered expression.

14.2. Procedure
We provide here a brief summary of the steps that we follow routinely
when performing microarrays in our murine endothelial cells. We system-
atically use Agilent’s supplied materials and reagents and follow the manu-
facturer’s protocols, as they have been extensively optimized for this
particular application. Briefly, total RNA is extracted from exponentially
growing SVEC lines serum starved for 16 h using GenEluteTM Mammalian
Total RNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO). Total RNAs are
quality evaluated with Agilent 2100 Bioanalyzer normally discarding sam-
ples with RNA integrity number, RIN less than 7 (Schroeder et al., 2006).
Labeled cDNA used as targets for hybridizations are synthesized by Quick
Amp kit (Agilent Technologies, Palo Alto, CA) from total RNA samples
and universal mouse reference (Stratagene, La Jolla, CA) in the presence of
CyTM3 and CyTM5 reactive dye, respectively. The labeled probes are
hybridized with oligonucleotide microarrays for 17 h at 65 . Slides are
immediately scanned in an Agilent DNA Microarray Scanner. Spot quanti-
fication and data normalization are performed using Agilent’s Feature
Extraction software and data analysis is performed on the TIGR Multi
Experiment Viewer (TMEV) v4.1 platform (Institute for Genome
Research, TIGR, Rockville, MD, http://www.tm4.org/).
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 143

Our normal repertoire of analyses includes the significance analysis


of microarrays (SAM) algorithm, cluster analysis, and Pavlidis template
matching (PMT) analysis (see Martin et al., 2008), and are performed as
implemented in TMEV v4.1 with settings left to default. For SAM analysis,
the d-value is similar to the Student’s t. Briefly, SAM computes the mean
value of each gene for each group and the values are submitted to a t-test
(observed d-value). Gene values are then randomly iterated between sam-
ples and groups, and the test is repeated until all possible combinations are
reached, typically more than 100, and the results are averaged (expected d-
value). If there is no significant difference between groups, the expected and
observed d-values are similar. One of the advantages of this analysis is that it
is possible to interactively adjust the statistical parameter ‘‘delta-value,’’
which defines the threshold of false-positives or ‘‘false discovery rate’’
(FDR) present in the gene list. In this statistical test, the q-value is defined
as the FDR analogue of the p-value. The q-value of an individual hypoth-
esis test is the minimum FDR at which the test may be called significant. To
confirm the expression profiles of significant genes, quantitative RT-PCR
is carried out in respective independent samples.
In addition, we also routinely use Gene Set Enrichment Analysis (GSEA
v2.0, Broad Institute, MIT) to tease out biologically meaningful informa-
tion. GSEA is an algorithm that executes a weighted comparison of experi-
mentally generated significant gene lists against a collection of metabolic and
signaling pathways (Subramanian et al., 2005). These gene lists were gleaned
from publicly available manually curated databases plus sets representing
gene expression signatures of genetic and chemical perturbations that have
been culled from experimental results in the literature. In this bioinformatic
tool, each occurrence of a significant gene in any of the signature gene sets is
counted as a hit toward that gene set. For example, the NFkB list includes
genes that are involved in the activation of NFkB or are transcriptional
targets of this transcription factor.

15. NFkB Luciferase Assays


15.1. Overview
vGPCR promotes the activation of the NFkB transcription factor (Dadke
et al., 2003; Martin et al., 2008; Montaner et al., 2004; Shepard et al., 2001).
NFkB exists in an inactive form bound to the inhibitory IkB proteins in the
cytoplasm. Activation of the regulatory IKB kinases (IKKa and IKKb)
results in the degradation of the IkB proteins releasing the NFkB homo-
and hetero-dimers, which subsequently translocate to the nucleus where
they activate appropriate target genes (Hayden and Ghosh, 2008). The assay
to monitor this activity assesses the expression and function of reporter
144 Daniel Martin and J. Silvio Gutkind

genes such as luciferase or chloramphenicol acetyl transferase (CAT), which


are cloned in a plasmid downstream of the NFkB response element. The
synthesis and activity of these enzymes reflects the activity of NFkB. In this
section, we will describe the NFkB-luciferase assay as it is performed in
SVEC 4-10 cells.

15.2. Procedure
SVEC cells are split the day before so that they are 60 to 70% confluent at
the time of transfection. Cells are transfected at least in triplicate, in 24-well
plates using the ExGen500 reagent (Fermentas) with various quantities of
empty vector or a vGPCR expression plasmid in combination with 100 ng
of the NFkB luciferase reporter (Stratagene, La Jolla, CA) and 50 ng of
pCEFLmyc hRL-EGFP, an EF-1a–driven humanized Renilla reniformis
luciferase for normalization. Sixteen h after transfection, complexes are
removed, and cells washed once with PBS and incubated for 24 h in
serum-free DMEM. Extending the time after transfection before the lucif-
erase assay is performed is not recommended, as this normally leads to
increased background luciferase expression while not improving the induc-
tion of luciferase by vGPCR. Luciferase activity is detected using a Dual-
Glo Luciferase Assay Kit (Promega, Madison, WI) and a microtiter plate
luminometer (Dynex Tech, Chantilly, VA). Briefly, media is removed from
the wells and the cells are washed once with PBS. Cells are lysed by
incubation in 100 ml of 1 Dual-Glo luciferase reagent (diluted in
DMEM) for 15 min at room temperature. Lysates are then transferred to a
96-well opaque microtiter plate, including blanks, and firefly luciferase
activity is measured using a glow-type protocol. Once finished, 50 ml of
Stop’n’Glo reagent are added to each well, and incubated for an additional
15 min. After that incubation, Renilla luciferase activity can be measured,
again using a glow protocol. The normalized relative luciferase activity for
each data point is obtained by dividing the firefly counts by the
corresponding Renilla counts.

16. NFkB Binding Assays


16.1. Overview
An alternative method for determination of transcription factor activation is
the analysis of the binding of activated transcription factors to their cognate
binding sequences. Homo- and hetero-dimers of members of the Rel/
NFkB family specifically recognize the 50 -GGGACTTTCC-30 nucleotide
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 145

sequence (reviewed in Hayden and Ghosh, 2008; Karin, 2006). The p50/p65
heterodimers and the p50 homodimers are the most common dimers found
in the NFkB signaling pathway (Karin, 2006). A traditional method for
assaying these events are the electrophoretic mobility shift assays (EMSA),
where cell lysates or nuclear extracts are incubated with radiolabeled oligo-
nucleotides containing the binding sequence of the transcription factor of
interest. After incubation, the samples are resolved by nondenaturing elec-
trophoresis and autoradiography and analyzed for the presence of retarded,
transcription factor–bound oligonucleotide bands. The identity of the tran-
scription factor bound to the sequence is determined by super-shift assays,
where the samples are incubated with the oligonucleotides in the presence
of antibodies specific to the transcription factor of interest. This results in
even higher retardation due to the increased molecular weight of the
antibody-transcription factor complexes. Alternatively, a new type of tran-
scription factor–binding assays are being developed based on an ELISA-like
format, that do not require the use the radioactivity and inherently identify
the bound transcription factor. In this case, samples are incubated in a
96-well plate coated with immobilized oligonucleotides containing the
binding sequence and then the bound factors are detected with appropriate
antibodies followed by ECL or chromogenic assays, thus providing quanti-
tative results. We have successfully used these assays to quantify the activa-
tion of NFkB in response to vGPCR.

16.2. Procedure
This procedure is based on the TransAM NF-kB p65 kit from Activemotif
(Carlsbad, CA). The assay requires the preparation of nuclear extracts from
transiently or stably vGPCR-transfected cells, serum-starved for 16 h prior
to the experiment. As a positive control, cells treated for 1 h with 20 ng/ml
of either TNFa or IL-1b could be used. For consistency, nuclear extracts
are prepared using Nuclear Extract Kit (Active Motif ), and the assay is
performed following the manufacturer’s recommendations. Briefly, pro-
teins in nuclear extracts are quantified and 1 mg of total protein is incubated
for 1 h in the presence of binding buffer to allow the binding of activated
NFkB to the immobilized oligonucleotides in the well. Bound factors are
washed three times and incubated in the presence of p65 antibodies for 1 h.
Wells are washed again three times and incubated for an additional hour
with a horseradish peroxidase (HRP)–conjugated secondary antibody.
After washing the wells four times, a chemiluminescent reaction is used.
Light emission is evaluated using a Dynex MLX system (Dynex Tech)
luminometer.
146 Daniel Martin and J. Silvio Gutkind

17. Nuclear Translocation of NFkB


17.1. Overview
NFkB shuttles in and out of the nucleus depending on its association with
the IkB proteins, thus regulating its activity. Free, active NFkB homo- and
hetero-dimers quickly translocate to the nucleus. Immunohistochemistry
for the presence of nuclear NFkB components provides an additional
method to assess the early activation of this transcription factor in response
to several stimuli, including vGPCR. Moreover, as opposed to the methods
mentioned above this assay has the advantage that it can be used in paraffin-
embedded archived material, for example using normal and pathological
tissues of diverse origin, without further manipulation and is easily quantifi-
able. We routinely assay for NFkB activation using antibodies against p65.

17.2. Procedure
This procedure is meant to be used for formalin-fixed paraffin-embedded
tissues of mouse and human origin, for tissue culture samples, see the
following. Briefly, tissue slides are dewaxed in xylene, hydrated through
graded alcohols and distilled water, and washed thoroughly with PBS.
Antigen retrieval is done using 10 mM citrate buffer (pH 6) in a microwave
oven for 20 min (2 min at 100% power and 18 min at 10% power). The
slides are allowed to cool down for 30 min at room temperature, rinsed
twice with PBS, and incubated in 3% hydrogen peroxide in PBS for 30 min
to quench the endogenous peroxidase. The sections are then washed in
distilled water and PBS and incubated in the blocking solution (5% bovine
serum albumin in PBS) for 1 h at room temperature. Excess solution is
discarded and the sections incubated overnight with primary antibody
(rabbit polyclonal anti-p65, purchased from Neomarkers, Fremont, CA)
diluted in 1:100 blocking solution at 4 . After washing with PBS, the slides
are sequentially incubated with the biotinylated secondary antibody (Vector
Laboratories, Burlingame, CA; 1:300) for 1 h, followed by the ABC
complex (Vector Stain Elite, ABC kit, Vector Laboratories) for 30 min at
room temperature. The slides are washed and developed in 3,3-diamino-
benzidine (Sigma FASTDAB tablet, Sigma Chemical, St. Louis, MO)
under microscopic control. The reactions are stopped by immersing the
slides in tap water; the tissues are then counterstained with Mayer’s hema-
toxylin, dehydrated, cleared in xylene, and mounted.
For immunofluorescence experiments using cell lines, cells are trans-
fected in 35-mm dishes with the appropriate expression plasmids. After 8 h,
cells are split and seeded onto collagen IV–coated glass slides and cultured
for an additional 48 h. Cells are serum-starved for 16 h, washed once with
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 147

cold PBS, and fixed in 4% paraformaldehyde in PBS for 10 min at room


temperature. Cells are washed three times with PBS and permeabilized for
5 min with PBS containing 0.5% NP-40. Cells are washed again twice and
incubated in blocking solution (3% BSA in PBS) for 20 min. Slides are
incubated with primary antibody (rabbit polyclonal anti-p65, 1:100 in
blocking solution) for 1 h at room temperature, washed three times, and
incubated with appropriate secondary antibodies for an additional hour.
Slides are washed once with PBS, nuclei stained with 1 mg/ml Hoechst
33258 in PBS for 5 min at room temperature, washed three times with PBS
and once with distilled water, and mounted using Vectashield mounting
medium (Vector Labs, Burlingame, CA). In both cases, activated NFkB can
be visually scored and represented as a percentage of transfected cells
showing nuclear staining with respect to the total cell number.

ACKNOWLEDGMENTS
This research was supported by the National Institutes of Health Intramural AIDS Targeted
Antiviral Program and the National Institute of Dental and Craniofacial Research.

REFERENCES
Arvanitakis, L., Geras-Raaka, E., Varma, A., Gershengorn, M. C., and Cesarman, E. (1997).
Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor
linked to cell proliferation. Nature 385, 347–350.
Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S.,
Cesarman, E., Gershengorn, M. C., and Mesri, E. A. (1998). G-protein-coupled receptor
of Kaposi’s sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator.
Nature 391, 86–89.
Berridge, M. J. (2005). Unlocking the secrets of cell signaling. Annu. Rev. Physiol. 67, 1–21.
Bower, M., Palmieri, C., and Dhillon, T. (2006). AIDS-related malignancies: Changing
epidemiology and the impact of highly active antiretroviral therapy. Curr. Opin. Infect
Dis. 19, 14–19.
Browning, P. J., Sechler, J. M., Kaplan, M., Washington, R. H., Gendelman, R.,
Yarchoan, R., Ensoli, B., and Gallo, R. C. (1994). Identification and culture of Kaposi’s
sarcoma-like spindle cells from the peripheral blood of human immunodeficiency virus-
1-infected individuals and normal controls. Blood 84, 2711–2720.
Cannon, M., Philpott, N. J., and Cesarman, E. (2003). The Kaposi’s sarcoma-associated
herpesvirus G protein-coupled receptor has broad signaling effects in primary effusion
lymphoma cells. J. Virol. 77, 57–67.
Cesarman, E., and Mesri, E. A. (2007). Kaposi sarcoma-associated herpesvirus and other
viruses in human lymphomagenesis. Curr. Top. Microbiol. Immunol. 312, 263–287.
Chaisuparat, R., Hu, J., Jham, B. C., Knight, Z. A., Shokat, K. M., and Montaner, S. (2008).
Dual inhibition of PI3Kalpha and mTOR as an alternative treatment for Kaposi’s
sarcoma. Cancer Res. 68, 8361–8368.
148 Daniel Martin and J. Silvio Gutkind

Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M., and
Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-asso-
ciated Kaposi’s sarcoma. Science 266, 1865–1869.
Cheung, M. C., Pantanowitz, L., and Dezube, B. J. (2005). AIDS-related malignancies:
Emerging challenges in the era of highly active antiretroviral therapy. Oncologist 10, 412–426.
Chiou, C. J., Poole, L. J., Kim, P. S., Ciufo, D. M., Cannon, J. S., ap Rhys, C. M.,
Alcendor, D. J., Zong, J. C., Ambinder, R. F., and Hayward, G. S. (2002). Patterns of
gene expression and a transactivation function exhibited by the vGCR (ORF74) chemo-
kine receptor protein of Kaposi’s sarcoma-associated herpesvirus. J. Virol. 76, 3421–3439.
Crabtree, G. R., and Olson, E. N. (2002). NFAT signaling: Choreographing the social lives
of cells. Cell 109(Suppl), S67–S79.
Dadke, D., Fryer, B. H., Golemis, E. A., and Field, J. (2003). Activation of p21-activated
kinase 1-nuclear factor kappaB signaling by Kaposi’s sarcoma-associated herpes virus G
protein-coupled receptor during cellular transformation. Cancer Res. 63, 8837–8847.
Fakhari, F. D., and Dittmer, D. P. (2002). Charting latency transcripts in Kaposi’s sarcoma-
associated herpesvirus by whole-genome real-time quantitative PCR. J. Virol. 76,
6213–6223.
Fisher, G. H., Orsulic, S., Holland, E., Hively, W. P., Li, Y., Lewis, B. C., Williams, B. O.,
and Varmus, H. E. (1999). Development of a flexible and specific gene delivery system
for production of murine tumor models. Oncogene 18, 5253–5260.
Ganem, D. (2006). KSHV infection and the pathogenesis of Kaposi’s sarcoma. Annu. Rev.
Pathol. 1, 273–296.
Guo, H. G., Pati, S., Sadowska, M., Charurat, M., and Reitz, M. (2004). Tumorigenesis by
human herpesvirus 8 vGPCR is accelerated by human immunodeficiency virus type 1
Tat. J. Virol. 78, 9336–9342.
Gutkind, J. S., Novotny, E. A., Brann, M. R., and Robbins, K. C. (1991). Muscarinic
acetylcholine receptor subtypes as agonist-dependent oncogenes. Proc. Natl. Acad. Sci. USA
88, 4703–4707.
Hayden, M. S., and Ghosh, S. (2008). Shared principles in NF-kappaB signaling. Cell 132,
344–362.
Hughes, S. H. (2004). The RCAS vector system. Folia Biol. (Praha) 50, 107–119.
Jensen, K. K., Manfra, D. J., Grisotto, M. G., Martin, A. P., Vassileva, G., Kelley, K.,
Schwartz, T. W., and Lira, S. A. (2005). The human herpes virus 8-encoded chemokine
receptor is required for angioproliferation in a murine model of Kaposi’s sarcoma.
J. Immunol. 174, 3686–3694.
Karin, M. (2006). Nuclear factor-kappaB in cancer development and progression. Nature
441, 431–436.
Laney, A. S., Cannon, M. J., Jaffe, H. W., Offermann, M. K., Ou, C. Y., Radford, K. W.,
Patel, M. M., Spira, T. J., Gunthel, C. J., Pellett, P. E., and Dollard, S. C. (2007). Human
herpesvirus 8 presence and viral load are associated with the progression of AIDS-
associated Kaposi’s sarcoma. Aids 21, 1541–1545.
Martin, D., Galisteo, R., Ji, Y., Montaner, S., and Gutkind, J. S. (2008). An NF-kappaB
gene expression signature contributes to Kaposi’s sarcoma virus vGPCR-induced direct
and paracrine neoplasia. Oncogene 27, 1844–1852.
Montaner, S., Sodhi, A., Molinolo, A., Bugge, T. H., Sawai, E. T., He, Y., Li, Y.,
Ray, P. E., and Gutkind, J. S. (2003). Endothelial infection with KSHV genes in vivo
reveals that vGPCR initiates Kaposi’s sarcomagenesis and can promote the tumorigenic
potential of viral latent genes. Cancer Cell 3, 23–36.
Montaner, S., Sodhi, A., Pece, S., Mesri, E. A., and Gutkind, J. S. (2001). The Kaposi’s
sarcoma-associated herpesvirus G protein-coupled receptor promotes endothelial cell
survival through the activation of Akt/protein kinase B. Cancer Res. 61, 2641–2648.
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 149

Montaner, S., Sodhi, A., Ramsdell, A. K., Martin, D., Hu, J., Sawai, E. T., and
Gutkind, J. S. (2006). The Kaposi’s sarcoma-associated herpesvirus G protein-coupled
receptor as a therapeutic target for the treatment of Kaposi’s sarcoma. Cancer Res. 66,
168–174.
Montaner, S., Sodhi, A., Servitja, J. M., Ramsdell, A. K., Barac, A., Sawai, E. T., and
Gutkind, J. S. (2004). The small GTPase Rac1 links the Kaposi sarcoma-associated
herpesvirus vGPCR to cytokine secretion and paracrine neoplasia. Blood 104, 2903–2911.
Morris, K. (2003). Cancer? In Africa? Lancet Oncol. 4, 5.
Mutlu, A. D., Cavallin, L. E., Vincent, L., Chiozzini, C., Eroles, P., Duran, E. M.,
Asgari, Z., Hooper, A. T., La Perle, K. M., Hilsher, C., Gao, S. J., Dittmer, D. P.,
et al. (2007). In vivo-restricted and reversible malignancy induced by human herpesvirus-
8 KSHV: A cell and animal model of virally induced Kaposi’s sarcoma. Cancer Cell 11,
245–258.
Nador, R. G., Milligan, L. L., Flore, O., Wang, X., Arvanitakis, L., Knowles, D. M., and
Cesarman, E. (2001). Expression of Kaposi’s sarcoma-associated herpesvirus G protein-
coupled receptor monocistronic and bicistronic transcripts in primary effusion lympho-
mas. Virology 287, 62–70.
Rezza, G., Andreoni, M., Dorrucci, M., Pezzotti, P., Monini, P., Zerboni, R., Salassa, B.,
Colangeli, V., Sarmati, L., Nicastri, E., Barbanera, M., Pristera, R., et al. (1999).
Human herpesvirus 8 seropositivity and risk of Kaposi’s sarcoma and other acquired
immunodeficiency syndrome-related diseases. J. Natl. Cancer Inst. 91, 1468–1474.
Rosenkilde, M. M., Kledal, T. N., Brauner-Osborne, H., and Schwartz, T. W. (1999).
Agonists and inverse agonists for the herpesvirus 8-encoded constitutively active seven-
transmembrane oncogene product, ORF-74. J. Biol. Chem. 274, 956–961.
Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S.,
Menzel, W., Granzow, M., and Ragg, T. (2006). The RIN: An RNA integrity number
for assigning integrity values to RNA measurements. BMC Mol. Biol. 7, 3.
Schwartz, R. A., Micali, G., Nasca, M. R., and Scuderi, L. (2008). Kaposi sarcoma:
A continuing conundrum. J. Am. Acad. Dermatol. 59, 179–206; quiz 207-208.
Shepard, L. W., Yang, M., Xie, P., Browning, D. D., Voyno-Yasenetskaya, T., Kozasa, T.,
and Ye, R. D. (2001). Constitutive activation of NF-kappa B and secretion of
interleukin-8 induced by the G protein-coupled receptor of Kaposi’s sarcoma-associated
herpesvirus involve G alpha(13) and RhoA. J. Biol. Chem. 276, 45979–45987.
Sodhi, A., Chaisuparat, R., Hu, J., Ramsdell, A. K., Manning, B. D., Sausville, E. A.,
Sawai, E. T., Molinolo, A., Gutkind, J. S., and Montaner, S. (2006). The TSC2/mTOR
pathway drives endothelial cell transformation induced by the Kaposi’s sarcoma-asso-
ciated herpesvirus G protein-coupled receptor. Cancer Cell 10, 133–143.
Sodhi, A., Montaner, S., and Gutkind, J. S. (2004a). Viral hijacking of G-protein-coupled-
receptor signalling networks. Nat. Rev. Mol. Cell Biol. 5, 998–1012.
Sodhi, A., Montaner, S., Patel, V., Gomez-Roman, J. J., Li, Y., Sausville, E. A.,
Sawai, E. T., and Gutkind, J. S. (2004b). Akt plays a central role in sarcomagenesis
induced by Kaposi’s sarcoma herpesvirus-encoded G protein-coupled receptor. Proc.
Natl. Acad. Sci. USA 101, 4821–4826.
Sodhi, A., Montaner, S., Patel, V., Zohar, M., Bais, C., Mesri, E. A., and Gutkind, J. S.
(2000). The Kaposi’s sarcoma-associated herpes virus G protein-coupled receptor up-
regulates vascular endothelial growth factor expression and secretion through mitogen-
activated protein kinase and p38 pathways acting on hypoxia-inducible factor 1alpha.
Cancer Res. 60, 4873–4880.
Stallone, G., Schena, A., Infante, B., Di Paolo, S., Loverre, A., Maggio, G., Ranieri, E.,
Gesualdo, L., Schena, F. P., and Grandaliano, G. (2005). Sirolimus for Kaposi’s sarcoma
in renal-transplant recipients. N. Engl. J. Med. 352, 1317–1323.
150 Daniel Martin and J. Silvio Gutkind

Sternweis, P. C., and Smrcka, A. V. (1992). Regulation of phospholipase C by G proteins.


Trends Biochem. Sci. 17, 502–506.
Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M. A.,
Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., and Mesirov, J. P. (2005).
Gene set enrichment analysis: A knowledge-based approach for interpreting genome-
wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545–15550.
Tan, W., Martin, D., and Gutkind, J. S. (2006). The Galpha13-Rho signaling axis is required
for SDF-1-induced migration through CXCR4. J. Biol. Chem. 281, 39542–39549.
Teramoto, H., Coso, O. A., Miyata, H., Igishi, T., Miki, T., and Gutkind, J. S. (1996).
Signaling from the small GTP-binding proteins Rac1 and Cdc42 to the c-Jun N-terminal
kinase/stress-activated protein kinase pathway. A role for mixed lineage kinase 3/pro-
tein-tyrosine kinase 1, a novel member of the mixed lineage kinase family. J. Biol. Chem.
271, 27225–27228.
Wigler, M., Silverstein, S., Lee, L. S., Pellicer, A., Cheng, Y., and Axel, R. (1977). Transfer
of purified herpes virus thymidine kinase gene to cultured mouse cells. Cell 11, 223–232.
Yang, T. Y., Chen, S. C., Leach, M. W., Manfra, D., Homey, B., Wiekowski, M.,
Sullivan, L., Jenh, C. H., Narula, S. K., Chensue, S. W., and Lira, S. A. (2000). Transgenic
expression of the chemokine receptor encoded by human herpesvirus 8 induces an
angioproliferative disease resembling Kaposi’s sarcoma. J. Exp. Med. 191, 445–454.
C H A P T E R S E V E N

Pharmacological and Biochemical


Characterization of Human
Cytomegalovirus-Encoded
G Protein–Coupled Receptors
David Maussang,*,1 Henry F. Vischer,*,1 Andreas Schreiber,†
Detlef Michel,† and Martine J. Smit*

Contents
1. Introduction 152
2. Virally Encoded GPCR Engineering 154
3. vGPCR Expression, Trafficking, and Radioligand Binding 156
3.1. Microscopic visualization of the cellular localization of vGPCRs 156
3.2. Enzyme-linked immunosorbent assay 156
3.3. Radioligand binding assays 157
3.4. Internalization assays 159
4. vGPCR-Induced Signal Transduction 159
4.1. Inositol phosphate production 159
4.2. Intracellular [Ca2þ] measurements 160
4.3. Reporter gene assays 160
5. vGPCR-Induced Oncogenesis 162
5.1. Cellular transformation: Foci formation assay 162
5.2. Cell proliferation assay: Cyclin D1 expression 163
5.3. In vivo xenograft models 164
6. Generation of Recombinant HCMV Strains by Markerless Bacterial
Artificial Chromosome Mutagenesis 165
7. Conclusions 167
Acknowledgments 167
References 167

* Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry, Faculty of Sciences,
Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
{
Institute of Virology, Ulm University Clinic, Ulm, Germany
1
Both authors contributed equally to this work

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05207-0 All rights reserved.

151
152 David Maussang et al.

Abstract
Human cytomegalovirus (HCMV) is a widely spread herpesvirus that can have
serious consequences in immunocompromised hosts. Interestingly, HCMV
genome encodes for four viral G protein–coupled receptors (vGPCRs), namely,
US27, US28, UL33, and UL78. Thus far, US28 and UL33 have been shown to
activate signaling pathways in a ligand-independent manner. US28 is the best
characterized vGPCR and has been shown to be potentially involved in the
development of HCMV-related diseases. As such, detailed investigation of
these viral GPCR is of importance in order to understand molecular events
occurring during viral pathogenesis and the potential identification of novel
therapeutic targets. Herewith, we describe several approaches to study these
HCMV-encoded vGPCRs. Using molecular biology, tags can be introduced in the
vGPCRs, which may facilitate the study of their protein expression with various
techniques, such as microscopy, Western blotting, enzyme-linked immunosor-
bent assay (ELISA), and flow cytometry. Furthermore, radioligand binding stud-
ies can be performed to screen for ligands for vGPCRs, but also to study kinetics
of internalization. We also describe several signal transduction assays that can
evaluate the signaling activity of these vGPCRs. In addition, we discuss different
proliferation assays and an in vivo xenograft model that were used to identify
the oncogenic potential of US28. The study of these vGPCRs in their viral
context can be examined using recombinant HCMV strains generated by bacte-
rial artificial chromosome mutagenesis. Finally, we show how these mutants can
be used in several pharmacological and biochemical assays.

1. Introduction
Human cytomegalovirus (HCMV), a member of the human b-herpes-
virus family, also referred to as human herpesvirus-5 (HHV-5), is widely
spread among the population. Although its presence is mostly asymptomatic
in immunocompetent hosts, HCMV-positive immunosuppressed patients are
at risk for the development of serious inflammatory diseases (Soderberg-
Naucler, 2006). Furthermore, HCMV has been linked to the development
of proliferative diseases, such as colon cancer and glioblastoma (Cobbs et al.,
2002; Harkins et al., 2002). While the Kaposi’s sarcoma–associated herpesvirus
(KSHV) and the Epstein-Barr virus (EBV) are considered oncogenic viruses,
HCMV appears to preferentially infect cancer cells to further increase their
malignant phenotype (Cinatl et al., 2004).
Interestingly, like other herpesviruses, the HCMV genome encodes viral
G protein–coupled receptors (vGPCRs), referred to as US27, US28, UL33,
and UL78, that appear on the surface of human cells upon viral infection
(Fig. 7.1A) (Rosenkilde et al., 2008). Thus far, UL33 and US28 have
been shown to constitutively activate various signaling pathways in a
Characterization of HCMV-Encoded Viral GPCRs 153

A B Wild type US28

g g
HCMV a a
b b

Signaling

C Δ2–22
UL33 UL78 US27 US28 US28 mutants

g g
a a
R129A b b Δ300
signaling
Human cell

Figure 7.1 Expression and signaling of vGPCRs. (A) HCMV infection of human cells
leads to the expression of the four viral GPCRUS27, US28, UL33, and UL78. (B) US28
signals both in a ligand-independent and -dependent manner and undergoes rapid con-
stitutive internalization. (C) US28 mutants show different signaling and internalization
properties than the wildtype receptor. US28-R129A does not couple to G proteins and
presents no constitutive activity. D2-22-US28 still shows constitutive activity but can
no longer bind chemokines. US28-D300 still binds chemokines and exhibits a higher
constitutive activity due to a reduced internalization rate compared to the wildtype
receptor.

ligand-independent manner (Casarosa et al., 2001, 2003a). The significance


of vGPCR in viral pathogenesis is exemplified by the work on the KSHV-
encoded GPCR ORF74. This receptor possesses constitutive activity as
well as ligand-induced signaling properties. In vitro assays first demonstrated
the transforming properties of ORF74 (Bais et al., 1998), and development
of transgenic animal models confirmed the ability of ORF74 to induce
Kaposi’s sarcoma–like diseases (Yang et al., 2000). As such, the KSHV-
encoded vGPCR was revealed to be a key player in viral diseases and
highlights the importance of vGPCRs in the pathologies of herpesviruses.
Among the four vGPCRs encoded by HCMV, US28 is the most
extensively studied. US28 binds several chemokines from the CC and
CX3C families and was suggested to act as a chemokine sink (Bodaghi
et al., 1998; Kledal et al., 1998). In addition, US28 constitutively activates
the phospholipase C and the NF-kB transcription factor (Fig. 7.1B) (Casarosa
et al., 2001). Based on these findings, a potential involvement of US28 in
HCMV-related diseases has been suggested. For instance, ligand stimulation
of US28 showed that it can induce migration of smooth muscle cells,
providing a rationale for the implication of US28 in the pathogenesis of
cardiovascular diseases (Streblow et al., 1999). We also demonstrated that the
constitutive activity of US28 is responsible for the formation of tumors in a
xenograft model, implying that US28 may be an oncomodulatory viral
protein (Maussang et al., 2006). Studies of the other HCMV-encoded
154 David Maussang et al.

GPCRs are still required to elucidate their role during viral infection and
their importance in the development of viral diseases.
In this chapter, we describe several techniques that can be applied to
study virally encoded GPCRs in more detail. Various research questions can
be addressed using molecular, cellular, as well as viral techniques.

2. Virally Encoded GPCR Engineering


The HCMV-encoded GPCR US28 displays ligand-dependent and
-independent signaling properties, possesses a broad spectrum of chemokine
binding capacity and shows constitutive internalization (Vischer et al.,
2006). UL33 signals and internalizes in a constitutive manner, while US27
and UL78 appear silent. All three vGPCRs are thus far orphans since no
ligands have been found to bind these receptors. In order to dissect the
contribution of chemokine binding, various US28 mutants were generated
(Fig. 7.1C). Truncation of the N-terminus of US28 by deleting amino acid
residues 2-22 (i.e., D(2-22)-US28) results in a mutant incapable of binding
chemokines but that still presents constitutive activity (Casarosa et al.,
2003b; Stropes and Miller, 2008). Ala-substitution of the Arg3.50/129 of
the conserved DRY motif at the bottom of transmembrane helix 3 (i.e.,
US28-R129A) impairs G protein–mediated signaling without affecting che-
mokine binding and constitutive internalization (Stropes and Miller, 2008;
Waldhoer et al., 2003). Constitutive receptor phosphorylation and internal-
ization is attenuated by Ala substitution of all Ser and Thr residues in the
intracellular C-terminal tail or truncation of this domain by deleting the last
54 amino acid residues (i.e., US28-D300) (Miller et al., 2003; Mokros et al.,
2002; Waldhoer et al., 2003).
Since high-quality antibodies against the majority of GPCRs, including
the HCMV-encoded receptors, are not available, N-terminal epitope-
tagged receptors, among others, are generated. Tags such as hemaglutinin,
FLAG, or c-myc, are used to allow detection of expression of vGPCRs with
commercially available high-affinity antibodies in different assays such as
microscopy, Western blotting, fluorescent-activated cell sorting (FACS)
analysis, or enzyme-linked immunosorbent assay (ELISA) (McIlhinney,
2004). Various epitope tags have been successfully fused to the
N-terminus of US28 (Casarosa et al., 2003b; Fraile-Ramos et al., 2002;
Miller et al., 2003; Waldhoer et al., 2003), US27 (Fraile-Ramos et al., 2002),
and UL33 (Margulies et al., 1996). Alternatively, engineered variants of
green fluorescent protein (GFP) from the jellyfish Aequorea victoria have
been genetically fused, in frame, by replacing the stop codon to the
C-terminus of HCMV-encoded GPCRs, allowing localization studies by
means of fluorescent (confocal) microscopy (Fraile-Ramos et al., 2001, 2002;
Characterization of HCMV-Encoded Viral GPCRs 155

Stropes and Miller, 2008; Waldhoer et al., 2002, 2003). The most optimal
tag needs to be empirically determined for each receptor and should
not interfere significantly with ligand binding, receptor signaling, and
expression.
Various methodologies can be used to introduce site-directed mutations
or epitope tags, or to generate fusion proteins (Blomenröhr et al., 2004;
McIlhinney, 2004). Nonetheless, PCR-based approaches using high-
fidelity DNA polymerase (e.g., Pfu) can be used universally to generate all
these different constructs. Short N-terminal tags are introduced after the
initial methionine of a vGPCR by using chimeric forward primer (Tf ),
consisting of the tag-encoding sequence at the 50 end and a fully comple-
mentary GPCR-specific sequence at the 30 end, in combination with a
reverse open-reading frame (ORF) primer (Or) in a single PCR (Fig. 7.2A).
Site-directed mutations are introduced using a three-step PCR strategy
(Fig. 7.2B). In the first PCR, the 50 - and 30 -end cDNA fragments are
generated in parallel by using overlapping reverse (Mr) and forward (Mf )
mutation primers in combination with forward (Of ) and reverse (Or) ORF
primers, respectively. The two PCR fragments are then fused in a self-
primed PCR, taking advantage of the introduced overlapping sequences.
Next, the fusion products are amplified in a third PCR using the primers Of
and Or (Blomenröhr et al., 2004). In principle, this three-step PCR
approach can also be used to generate GPCR–GFP fusion proteins. How-
ever, such fusion proteins are more easily generated by substituting the stop

A B
Tf Of Mf
5⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘
3⬘ 5⬘ 3⬘ 5⬘ 3⬘ 5⬘
Or Mr Or

PCR (1) PCR (1a) PCR (1b)

5⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘
3⬘ 5⬘ 3⬘ 5⬘ Gel purify 3⬘ 5⬘

Mix equimolar quantities

5⬘ 3⬘
3⬘ 5⬘ Self-primed fusion PCR (2)

PCR (3)
Of
5⬘ 3⬘
3⬘ 5⬘
Or

Figure 7.2 Generation of mutated vGPCR using polymerase chain reactions.


(A) N-terminal tagged GPCR are created by PCR using a forward primer (Tf )
containing the tag-encoding sequence at the 50 -end and a fully complementary GPCR-
specific sequence at the 30 -end, in combination with a reverse open-reading frame
(ORF) primer (Or). (B) Three-step PCR strategy for the creation of a point mutation.
In the first PCR, the 50 - and 30 -end cDNA fragments are generated in parallel using
overlapping reverse (Mr) and forward (Mf ) mutation primers in combination with
forward (Of ) and reverse (Or) ORF primers, respectively.The two PCR fragments are
then fused in a self-primed PCR, taking advantage of the introduced overlapping
sequences. Next, the fusion products are amplified using the primers Of and Or.
156 David Maussang et al.

codon of the GPCR with a restriction-endonuclease (RE) site, which is also


introduced at the 50 end of the GFP-encoding cDNA. The GPCR–GFP
fusion protein is then generated by ligation of both cDNAs.

3. vGPCR Expression, Trafficking,


and Radioligand Binding
3.1. Microscopic visualization of the cellular
localization of vGPCRs
HEK 293T or COS-7 cells that are transiently transfected with vGPCR-
GFP fusion protein constructs using 25-kDa linear polyethylenimine (PEI)
or DEAE-dextran, respectively (Casarosa et al., 2005; Verzijl et al., 2008),
are grown on poly-L-lysine–coated coverslips. Cells are washed with
phosphate-buffered saline (PBS) and subsequently fixed with 4% parafor-
maldehyde in PBS for 10 min at room temperature. Next, the cells are
mounted in Vectashield mounting medium (Vector Laboratories) and ana-
lyzed using a confocal laser scanning microscope (e.g., Zeiss LSM 510) with
excitation at 505 nm and emission at 530 nm.

3.2. Enzyme-linked immunosorbent assay


An ELISA can be used to monitor membrane and intracellular expression of
vGPCRs. HEK 293T or COS-7 cells transfected with epitope-tagged
GPCRs are seeded in poly-L-lysine–coated 24-well plates (2.5  105 and
1.5  105 cells/well, respectively). The next day, cells are fixed using 4%
paraformaldehyde in PBS. Samples are then washed with Tris-buffered
saline (TBS). Half of the wells can be permeabilized with 0.5% Nonidet
P-40 in TBS to detect intracellularly localized GPCRs. After blocking
nonspecific sites with 1% nonfat-dried milk in 0.1 M NaHCO3, pH 8.6,
for 1 h, cells are incubated with the anti-epitope tag antibody in TBS
containing 0.1% BSA for 1.5 h at room temperature or overnight at 4  C.
Next, the cells are washed three times with TBS, and incubated with the
appropriate horseradish peroxidase–conjugated secondary antibody in 1%
nonfat-dried milk in 0.1 M NaHCO3, pH 8.6, for 1.5 h at room tempera-
ture. Unbound antibodies are washed away with TBS and peroxidase
activity is visualized using 3,30 ,5,50 -tetramethylbenzidine liquid substrate
system (Sigma-Aldrich). Reactions are terminated by adding 0.5 M H2SO4,
and absorption is measured at 450 nm using a Victor2 1420 multilabel plate
reader (Fig. 7.3A).
Characterization of HCMV-Encoded Viral GPCRs 157

A B
0.6 1250
Total
(absorbance at 450 nm)

[125I]-CX3CL1 (dpm)
0.5 Surface 1000
HA detection

0.4
750
0.3
500
0.2
0.1 250

0 0

Control US28 −12 −11 −10 −9 −8 −7 Control


Log [CX3CL1]

C
100
% internalization

75

50

25

0 10 20 30 40 50 60
Time (s)

Figure 7.3 US28 protein expression and internalization in transfected cells. (A) Hem-
agglutinin-tagged US28 (HA-US28) encoding plasmid is transfected into HEK 293T
cells. Twenty-four hours later, the epitope-tagged protein is detected using an ELISA
assay against the HA tag. (B) Radiolabeled [125I]-CX3CL1 binds to US28-expressing
membranes. Cold CX3CL1 displaces the radioligand in a dose-dependent manner
down to the level observed in membranes prepared from mock-transfected control
cells. (C) Internalization studies indicate that US28 rapidly internalizes radiolabeled
chemokines as soon as 5 min after their addition at 37  C.

3.3. Radioligand binding assays


Direct interactions between chemokine ligands and US28 can be quantified
using radioligand binding studies. Radiolabeled human chemokines (125I)
are commercially available from PerkinElmer or can be iodinated in-house
using Pierce iodination reagent or Bolton-Hunter reagents (Daugherty
et al., 2000). Three distinct types of radioligand binding experiments can
be performed: kinetic, saturation, and competition binding (Bylund et al.,
2004). Kinetic binding experiments measure the rate of ligand-receptor
complex formation and/or dissociation in time. Saturation binding
158 David Maussang et al.

experiments measure the equilibrium binding of increasing concentrations


of radioligand and are used to determine the affinity (Kd) of the radioligand
for a receptor and the number of receptors (Bmax) in a sample. In competi-
tion binding experiments, the equilibrium binding of a single concentration
radioligand is measured in the presence of increasing concentrations of an
unlabeled ligand, allowing determination of the affinity (Ki) of numerous
unlabeled ligands for a receptor. Radioligand binding assays can be per-
formed on intact cells or membrane preparations. Membrane preparations
are commonly used in high-throughput drug screens, whereas the more
cumbersome intact cell binding assays allows quantification of receptor cell
surface levels and internalization kinetics. Membranes are prepared from,
for example, US28-transfected HEK 293T or COS-7 cells. Two days after
transfection, the cells are harvested in ice-cold PBS supplemented with
1 mM EDTA, and centrifuged at 1500g for 10 min at 4  C. Pellets are
washed once in the same buffer and subsequently resuspended and homo-
genized in ice-cold membrane buffer (15 mM Tris, pH 7.5, 1 mM EGTA,
0.3 mM EDTA, and 2 mM MgCl2) using a motorized Teflon-glass homog-
enizer (10 strokes at 1200 rpm). Membranes are then subjected to two
freeze–thaw cycles using liquid nitrogen and subsequently centrifuged at
40,000g for 25 min at 4  C. Pellets are washed once with ice-cold Tris-su-
crose buffer (20 mM Tris, pH 7.4, and 250 mM sucrose), before being
resuspended in the same buffer and frozen in liquid nitrogen. For competi-
tion binding experiments in 96-well microplates, 25 ml 125I-chemokine
(0.25 nM/well) in binding buffer (50 mM Hepes, pH 7.4, 1 mM CaCl2,
5 mM MgCl2, 100 mM NaCl, and 0.5% BSA) are dispensed together with
25 ml of increasing concentrations unlabeled ligand in each well. Next,
binding reactions are initiated by adding 50 ml of purified membrane (0.5–
10 mg membrane protein/well) and incubated for 2 h at room temperature
with gentle agitation. The optimal amount of membrane protein and
concentration of 125I-chemokine (0.3–0.7  Kd) need to be empirically
determined in order to obtain a maximal detection window without bind-
ing more than 10% of the radioligand. Incubations are terminated by
filtration through a UniFilter-96 GF/C (Perkin-Elmer) presoaked in 0.3%
PEI, and subsequently washed with ice-cold binding buffer supplemented
with 0.5 M NaCl using a Filtermate Harvester (Perkin-Elmer). Radio-
activity is quantified by liquid scintillation using a Wallac MicroBeta TriLux
(Perkin-Elmer). Next, radioligand binding is plotted as function of the
logarithm of the unlabeled ligand concentration (Fig. 7.3B), and IC50
values are determined by nonlinear curve fitting using GraphPad Prism.
The affinity of the unlabeled ligand (Ki) is calculated using the Cheng-
Prusoff equation: Ki ¼ IC50/(1 þ [125I-chemokine]/Kd) (Cheng and
Prusoff, 1973).
Characterization of HCMV-Encoded Viral GPCRs 159

3.4. Internalization assays


US28 acts as a decoy receptor for many inflammatory chemokines by
removing them from the microenvironment of HCMV-infected cells
through rapid and constitutive internalization. As such, US28 may attenuate
the inflammatory response by reducing the recruitment of chemokine-
responding inflammatory cells (Billstrom et al., 1999; Bodaghi et al., 1998;
Fraile-Ramos et al., 2001; Randolph-Habecker et al., 2002). Internalization
kinetics can be monitored by quantification of 125I-chemokine uptake by
US28-expressing cells. To this end, transiently US28-expressing HEK
293T (1.6  105 cells/well) are seeded in poly-L-lysine–coated 48-well
plates. The next day, medium is aspirated and cells are incubated at 37  C
with 0.25 nM 125I-chemokine in prewarmed binding buffer using time
intervals ranging from 5 min to 1 h. Incubations are terminated by placing
the plates on ice and immediately washing the cells three times with ice-
cold binding buffer supplemented with 0.5 M NaCl. For each time point,
total radioactivity was determined by collecting one set of cells in lysis buffer
(0.5% Nonidet P-40, 0.1% sodium dodecyl sulfate, 0.5% deoxycholic acid),
whereas a second set of cells was first incubated for 10 min in ice-cold acidified
DMEM (pH 2.0) to remove surface-bound chemokine before being collected
in lysis buffer. Control experiments revealed that the acidic incubation
removed all surface-bound chemokine while leaving the receptor surface
intact. Next, radioactivity in collected cell lysates is quantified using a Wallac
Compugamma counter (PerkinElmer). The percentage of 125I-chemokine
internalization is calculated for each time point using: internalization (%) ¼
(acid-resistant radioactivity/total radioactivity)  100 (Fig. 7.3C).

4. vGPCR-Induced Signal Transduction


4.1. Inositol phosphate production
Both UL33 and US28 constitutively activate the enzyme phospholipase Cb to
produce inositol triphosphate (InsP3) and diacylglycerol by hydrolyzing
plasma membrane phosphatidylinositol 4,5-bisphosphates (PIP2). Prelabeling
the cells overnight with myo-[2-3H]-inositol allows metabolic incorporation
into PIP2. PLCb-catalyzed production of 3H-InsP3 is measured in the pres-
ence of lithium, which inhibits the rapid dephosphorylation of InsP to
inositol, resulting in the accumulation of 3H-InsP (Huckle and Conn,
1987). HEK 293T (5  104 cells/well) or COS-7 cells (3  104 cells/
well) that are transiently transfected with US28 or UL33, or SVEC4-10 cells
(5  104 cells/well) stably expressing US28 are seeded in poly-L-lysine–
coated 96-well plates and incubated overnight in 100 ml/well, Earle’s inositol-
free minimal essential medium (Invitrogen) supplemented with 10 mCi/ml
160 David Maussang et al.

myo-[2-3H]-inositol (17 Ci/mmol; GE Healthcare). Importantly, overnight


labeling of HEK 293T cells requires the supplementation of medium with
10% fetal bovine serum. The next day, cells are washed with DMEM
supplemented with 25 mM Hepes (pH 7.4) and 20 mM LiCl, and subse-
quently incubated in the same medium in the absence or presence of ligands at
37  C for 2 h. Incubations are terminated by aspiration of the medium, and
cellular lipids are extracted from the cells using 10 mM formic acid. [3H]-InsP
accumulation is then quantified using 0.5 mg/well YSi-RNA–binding SPA
beads (GE Healthcare) in white clear-bottomed, 96-well isoplates using a
Wallac MicroBeta Trilux counter (PerkinElmer) (Fig. 7.4A) (Brandish et al.,
2003). This assay can be used for US28 to screen for inverse agonist properties
of chemokine ligands, such as CX3CL1 or small compounds (Hulshof
et al., 2006).

4.2. Intracellular [Ca2þ] measurements


US28 induces a rapid transient increase in intracellular Ca2þ levels in
response to CC and CX3C chemokines (Billstrom et al., 1998; Casarosa
et al., 2005; Gao and Murphy, 1994). SVEC4-10 cells stably expressing
US28 are seeded in clear-bottomed black 96-well plates (4  104 cells/well)
(Casarosa et al., 2005). The next day, cells are loaded with 4 mM cell-
permeant Fluo-4 acetoxymethyl ester (Invitrogen) in loading buffer
(Hanks’ balanced salt solution supplemented with 20 mM Hepes, pH 7.4,
2.5 mM probenecid) supplemented with 0.04% pluronic acid and 1% BSA,
for 30 min at 37 in the dark. Cells are washed twice and preincubated for
1 h at 37 in the dark in loading buffer supplemented with 0.1% BSA.
Intracellular Ca2þ levels are monitored at 37 by measuring fluorescence
(excitation at 485 nm and emission at 520 nm) with a Novostar microplate
reader (BMG Labtechnologies GmBH, Offenburg) for 10 s to determine
mean basal level. Next, the chemokine is injected and fluorescence is
recorded for another 50 s, after which cells are lysed by adding 5% Triton
X-100 to determine maximum fluorescence. Results are expressed as
percentage of maximum fluorescence (Fig. 7.4B).

4.3. Reporter gene assays


Reporter gene assays are commonly used to determine the signaling proper-
ties and functional effects of GPCRs. Whether their viral counterparts are
constitutively active or can be stimulated with ligands (when known), the
transcriptional activity or direct transcription of various cellular factors can
be analyzed. Initial characterization of US28 and UL33 constitutive signal-
ing properties was performed using NF-kB reporter gene assays (Casarosa
et al., 2001, 2003a). This reporter gene plasmid encodes the luciferase gene
controlled by five successive NF-kB–binding sites (Fig. 7.4C). As such,
Characterization of HCMV-Encoded Viral GPCRs 161

A B
[3H]-InsP (% US28) 125 25

100 20

[Ca2+]i (% max)
75 15

50 10

25 5

0 0

Basal Basal CX3CL1 0 10 20 30 40 50 60


Time (s)
Control US28

C D
4
Control
NF-kB
NF-kB
NF-kB
NF-kB
NF-kB

Luciferase reporter gene


activation (RLU ⫻ 105)

US28
3
Luciferase
2
NF-kB binding sites
STAT3

1
HRE

AP-2
Sp1

Sp1
Luciferase 0
VEGF promoter
NF-kB VEGF

Figure 7.4 US28 signals in both a ligand-dependent and -independent manner.


(A) US28-expressing SVEC 4-10 cells present a ligand-independent formation of inosi-
tol phosphate (InsP) compared to mock-transfected cells. Incubation of US28-expres-
sing cells with CX3CL1 can partially inhibit this constitutive signaling. (B) Stimulation
of SVEC 4-10 cells stably expressing US28 with CCL5 induces a transient increase in
intracellular calcium signaling ([Ca2þ]i). (C) Schematic representation of the various
transcription factor^binding sites controlling the luciferase gene in the NF-kB and the
human vascular endothelial growth factor (VEGF) promoter reporter gene plasmids.
(D) HEK 293T cells are transfected with the polyethylenimine (PEI) method with
pcDEF3 plasmid either empty (control) or containing the sequence of US28 together
with the reporter gene plasmid.The total amount of DNAwas kept constant at 2 mg per
106 cells. Plasmid DNA (1 mg reporter gene with 900 ng pcDEF3 and 100 ng pcDEF3
either with or without US28 sequence) is diluted in 75 ml of 150 mM NaCl solution and
mixed with 75 ml 150 mM NaCl containing 6 mg PEI. HEK 293Tcells are harvested and
resuspended in culture medium to a concentration of 0.5  106 cells per milliliter. Two
milliliters of cell suspension are added to the DNA:PEI mixture, and100 ml of transfected
cells are seeded per well of a white 96-well plate. Luminescence is measured 24 h later
after transfection.
162 David Maussang et al.

upon activation of the NF-kB transcription factor, the luciferase gene is


transcribed and expressed at the protein level. Alternatively, the activation
of downstream target genes such as the vascular endothelial growth factor
(VEGF) can also be quantified. In that case, the luciferase gene is controlled
by the endogenous promoter of the VEGF gene that contains binding sites
of various transcription factors (Fig. 7.4C). This method was used to assess
the proangiogenic properties of US28 (Maussang et al., 2006).
HEK 293T cells are transfected with control or US28 plasmids and with
either the NF-kB reporter gene or the human VEGF promoter reporter
gene using the PEI method. Twenty-four hours after transfection, cells are
lysed and stimulated with Luciferin (0.83 mM ATP, 0.83 mM D-Luciferin,
18.7 mM MgCl2, 0.78 mM Na2H2P2O7, 38.9 mM Tris (pH 7.8), 0.39%
(v/v) glycerol, 0.03% (v/v) Triton X-100 and 2.6 mM DTT), and light
emission is quantified with a Victor2 (Fig. 7.4D). This method can be
extended to other transcription factors such as cyclic AMP responsive-
element–binding protein (CREB), and nuclear factor of activated T cells
(NFAT) (McLean et al., 2004), and alternatively, the luciferase gene can be
replaced by the b-galactosidase reporter gene (Lim et al., 2006).

5. vGPCR-Induced Oncogenesis
5.1. Cellular transformation: Foci formation assay
Cellular transformation induced by human or viral oncogenes is typically
assessed using stably transfected NIH-3T3 cells. These mouse fibroblasts are
on the verge of transformation and allow sensitive detection of oncogenic
signals, resulting in cellular transformation. However, in order to ascertain
the oncogenic properties of the studied proteins, mock-transfected cells
always have to be taken as a negative control in the experiment to estimate
the background activity. NIH-3T3 cells are transfected with a US28-
encoding plasmid using the calcium phosphate method (Chen and
Okayama, 1988). This plasmid also contains the antibiotic-resistant gene
neomycin, allowing the selection of geneticin-resistant US28-expressing
cells. NIH-3T3 cells possess cell contact–inhibition properties that disable
them to proliferate when entering in contact with adjacent cells within a cell
monolayer. Upon transformation, cells lose this ability and uncontrolled
growth of cells leads to formation of cell foci (Maussang et al., 2006). The
transforming ability of US28-expressing NIH-3T3 cells is measured when
cells are cultured together with native NIH-3T3 cells that still possess
cell contact inhibition. The latter grow in a monolayer, while US28-
transformed cells grow on top of one another, leading to the formation of
foci. To this end, 2  105 naive NIH-3T3 cells are cultured together with
2  103 mock or US28 stably transfected NIH-3T3 cells for 14 days in the
Characterization of HCMV-Encoded Viral GPCRs 163

absence of antibiotic selection. Medium is refreshed biweekly. To detect the


formed foci, wash cells twice with PBS and twice with ice-cold methanol,
and fix them with ice-cold methanol for 5 min. After washing the dish with
distilled water, stain the cells with 0.4% methylene blue for a few minutes.
Wash the dishes extensively with distilled water until the rinsing water does
not appear blue. Foci are then counted in each sector (Fig. 7.5A).

5.2. Cell proliferation assay: Cyclin D1 expression


US28-mediated signaling pathways upregulate the expression of cyclin D1
(Fig. 7.5B) that is involved in cell cycle progression and proliferation
(Maussang et al., 2006). Control or US28 stably transfected NIH-3T3
cells are seeded in a six-well plate (3  105 cells per well) and cultured
overnight in DMEM supplemented with 10% calf serum. The following
day, cells are synchronized in the G0 phase by serum starvation (DMEM þ
0.5% calf serum) overnight. The next day, samples are washed twice with
cold PBS and lysed for 10 min on ice with 75 ml RIPA lysis buffer
supplemented with protease inhibitors. Cell lysates are collected in 1.5-ml
tubes, sonicated for 3 s, and subsequently centrifuged at 15,000g for 10 min
at 4  C. Next, collect supernatant and use an aliquot to determine protein
concentration using commercially available kits and store the remaining
protein sample at –80  C. Load equal amounts of proteins onto a 10% SDS-
PAGE electrophoresis gel and run at constant voltage (100 V) for approxi-
mately 1.5 h. Transfer the proteins from the electrophoresis gel onto a
PVDF membrane for 1 h at constant intensity (200 mA), and block the
membrane in blocking buffer containing 5% dry milk for at least 1 h.
Determine the cyclin-D1 protein levels using a mouse anti-cyclin D1
(Upstate Millipor, cat. no. 05-815) as primary antibody (at 4  C overnight),

A B

Control US28

Cyclin D1

b-actin

Control US28

Figure 7.5 US28 induces a transformed phenotype and increased proliferation in


NIH-3T3 cells. (A) 2  103 NIH-3T3 cells stably transfected with either mock (empty
plasmid) or US28 are grown for 2 weeks together with 2  105 naive NIH-3T3 cells.The
formed foci are stained with methylene blue. (B) Total lysates from mock and US28
stably transfected NIH-3T3 cells present higher expression levels of cyclin D1.
Protein levels are normalized against b-actin expression.
164 David Maussang et al.

and an HRP-conjugated goat antimouse antibody (BioRad, cat. no. 170-


6516) as secondary antibody (at room temperature for 1 h). HRP-derived
chemiluminescence is measured using standard commercially available
kits (e.g., ECL kit, Amersham) and Imaging films (e.g., Kodak BioMax
Light films). To verify that the levels of proteins are equal in all lanes, the
blot is stripped using 0.2 N NaOH solution, blocked with 5% dry milk in
blocking buffer, and probed for b-actin levels (Sigma, cat. no. A5440)
(Smit et al., 2002).

5.3. In vivo xenograft models


The tumorigenic character of vGPCRs can be confirmed using tumor
xenograft models in nude mice. These mice are deprived in T cells and
are consequently not able to mount T cell-mediated immune responses,
such as graft rejection. To this end, 2  106 NIH-3T3 cells stably trans-
fected with either mock or US28 are injected subcutaneously in each flank
of the animal, and tumor formation is checked every other day. Each
injected side is considered as an independent tumor. The length, width,
and depth of growing malignancies are measured with a caliper, and the
volume of the tumors is determined by calculating the half-product of the
three dimensions of the tumor. Malignancies can be considered as tumors
when their sizes are greater than or equal to 50 mm3. Tumor growth can be
depicted as the tumor size by time post-injection (Fig. 7.6A), or by means of
Kaplan-Meier curves to illustrate the percentage of mice presenting tumors
over time (Fig. 7.6B).

A B
400 100 Control
US28
presenting tumors (%)
Tumor size (mm3)

300 75
Inoculated sites

200 50

100 25

0 0

0 10 20 30 0 10 20 30
Time (days) Time (days)

Figure 7.6 Representation of US28-induced tumor formation in xenograft models.


(A) Tumors formed in the flanks of nude mice injected with 2  106 US28 stably trans-
fected NIH-3T3 cells are measured with a caliper, and the tumor volume is calculated as
the half-product of the length, width, and depth. Tumor formation is followed over
time after the injection of stably transfected cells. (B) Kaplan-Meier curves are used to
determine the percentage of animals presenting tumors larger than 50 mm3, and show
that US28-induced tumors have a 100% incidence within 21days post-injection.
Characterization of HCMV-Encoded Viral GPCRs 165

6. Generation of Recombinant HCMV Strains


by Markerless Bacterial Artificial
Chromosome Mutagenesis
Bacterial artificial chromosome (BAC) mutagenesis has become an
excellent tool to manipulate the CMV genome and to investigate the
function of vGPCRs in the context of viral infection in biologically relevant
cells (specifically endothelial cells, and macrophages). The generation of
recombinant CMVs by BAC mutagenesis has been achieved by several
research groups investigating vGPCRs (e.g., MCMV M33 (Davis-Poynter
et al., 1997), RCMV R33 (Beisser et al., 1998), HCMV US28 (Minisini
et al., 2003), HCMV UL33 (Casarosa et al., 2003a), RCMV R78 (Kaptein
et al., 2003), and HCMV UL78 (Michel et al., 2005)). In particular, the
publication of Streblow et al. in 1999 highlighted the importance for vGPCR
research by demonstrating that US28 is responsible for the migration of
HCMV-infected smooth muscle cells (Streblow et al., 1999).
The ground for recombinant CMVs was prepared by cloning CMV
genomes from various species into BACs (Brune et al., 2000; Messerle et al.,
1997). Initially, BAC mutagenesis was achieved by means of shuttle plas-
mids using RecA-mediated recombination with homologous flanks of 500
to 3000 bp (Casarosa et al., 2003a; Michel et al., 2005), but this method was
very time consuming. Later, the establishment of the Red-mediated or
RecE/T-recombination to manipulate BACs provided a reliable faster
technique (Borst et al., 2001; Wagner et al., 2002). However, since this
method led to the persistence of undesired genetic sequences, it was not an
ideal tool to generate point mutations or introduce molecular tags to the
target gene. This technique has been further optimized (Tischer et al., 2006;
Warming et al., 2005) and the so-called ‘‘en passant’’ mutagenesis described
by Tischer et al. in 2006 is a powerful tool for the traceless introduction of
potentially any mutation into the CMV genome. Markerless BAC muta-
genesis is based on two recombination steps: (1) the insertion of the
mutation at the target site, and (2) the excision of the positive (kanamycin
resistance) and the negative (I-SceI) selection marker. Briefly, a linear DNA
fragment containing the sequences needed for the two recombination
steps (the directed integration and precise excision of the unwanted
sequences) is generated by PCR (Tischer et al., 2006). It is then electro-
porated into recombination competent Escherichia coli, harboring (1) a CMV
BAC genome, (2) the Red recombination system under control of a
temperature-sensitive promoter, and (3) the coding sequence for the homing
endonuclease I-SceI under control of an arabinose-inducible promoter.
Successful integrates, controlled by PCR and restriction fragment length
polymorphism (RFLP) analysis, undergo the second round of recombination
166 David Maussang et al.

removing the negative and positive selection marker. This step is performed
by induction of the red recombination system at 42  C for 20 min and the
parallel induction of I-SceI endonuclease by 1% arabinose, resulting in a
mutated BAC carrying only the CMV genome with the desired mutation.
The mutated BAC is checked again by PCR, RFLP with at least three
restriction enzymes and sequencing of the mutated region. Recombinant
virus is reconstituted by electroporation of the mutated BAC DNA
into CMV permissive cells (Chevillotte et al., 2009; Sinzger et al., 2008).
A B
25 25
[125I]-CCL5 (103 sites/cell)

20 20
[3H]-InsP (⫻103)

15 15

10 10

5 5

0 0

WT ΔUS28 Control WT ΔUS28 Quattro


AD169 AD169

C
10.0
VEGF promoter activation

7.5
(fold control)

5.0

2.5

Control WT ΔUS28
Titan

Figure 7.7 Cell surface expression and signaling properties of vGPCRs in HCMV-
infected cells. (A) Human foreskin fibroblasts (HFF) are infected with the AD169 WT
and DUS28 (lacking the US28 gene) strains. Eight hours post-infection, [125I]-CCL5
specific binding is detected in cells infected with the WT virus, but it is almost
completely abrogated in cells infected with the DUS28 mutant. (B) Infection of HFF
cells with HCMV strain AD169 leads to a constitutive formation of inositol phosphate
(InsP) 48 h postinfection. Deletion of either US28 only (DUS28) or the four vGPCRsç
US27, US28, UL33, and UL78 (Quattro)çcompletely impairs InsP accumulation ( Jens
Holl, Andreas Schreiber and Detlef Michel, unpublished data). (C) Human glioblas-
toma U373 cells infected with the HCMV strainTitan present an increased activation of
the humanVEGF promoter, which is impaired after deletion of US28 gene.
Characterization of HCMV-Encoded Viral GPCRs 167

‘‘En passant’’ mutagenesis offers two major advantages: (1) recombinant


BACs can be generated within less than 14 days, and (2) the method can be
applied sequentially for the generation of mutations in any order.
Using BAC mutagenesis, we generated different mutants derived from
AD169 and TB40 HCMV strains. AD169 strains lacking US28 or also all four
vGPCRs (US27, US28, UL33, and UL78) demonstrate that US28 is respon-
sible for the observed CCL5 binding (Fig. 7.7A) and constitutive inositol
phosphate formation in infected human foreskin fibroblasts (HFF) (Fig. 7.7B).
Furthermore, infection of human glioblastoma U373 cells with the Titan
strain induces the activation of the human VEGF promoter. After deletion of
US28, the observed proangiogenic phenotype is impaired, highlighting the
potential involvement of US28 in HCMV-related pathogenic conditions
(Fig. 7.7C).

7. Conclusions
The study of HCMV-encoded vGPCRs can be performed at several
levels. For the quest of nonpeptidergic drug–like compounds that can
inhibit US28-mediated activities, high-throughput screening methods for
InsP formation and radioligand binding have been successfully used. Similar
approaches can be used to identify cognate ligands for US27, UL33, and
UL78. Signaling assays determine whether these vGPCRs are constitutively
active and whether they present ligand-induced signaling properties once
these receptors are deorphanized. The BAC mutagenesis method is also a
very useful tool to determine the importance of vGPCRs in the context of
HCMV-infected cells. In vitro and xenograft in vivo models have enabled us
to delineate the oncogenic properties of US28 and highlight its potential
importance in viral proliferative diseases.

ACKNOWLEDGMENTS
D.M., H.F.V., and M.J.S. are supported by the Dutch Organization for Scientific Research
(NWO).

REFERENCES
Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S.,
Cesarman, E., Gershengorn, M. C., and Mesri, E. A. (1998). G-protein-coupled receptor
of Kaposi’s sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator.
Nature 391, 86–89.
Beisser, P. S., Vink, C., Van Dam, J. G., Grauls, G., Vanherle, S. J., and Bruggeman, C. A.
(1998). The R33 G protein-coupled receptor gene of rat cytomegalovirus plays an
essential role in the pathogenesis of viral infection. J. Virol. 72, 2352–2363.
168 David Maussang et al.

Billstrom, M. A., Johnson, G. L., Avdi, N. J., and Worthen, G. S. (1998). Intracellular
signaling by the chemokine receptor US28 during human cytomegalovirus infection.
J. Virol. 72, 5535–5544.
Billstrom, M. A., Lehman, L. A., and Scott Worthen, G. (1999). Depletion of extracellular
RANTES during human cytomegalovirus infection of endothelial cells. Am. J. Respir.
Cell Mol. Biol. 21, 163–167.
Blomenrohr, M., Vischer, H. F., and Bogerd, J. (2004). Receptor mutagenesis strategies for
examination of structure-function relationships. Methods Mol. Biol. 259, 307–322.
Bodaghi, B., Jones, T. R., Zipeto, D., Vita, C., Sun, L., Laurent, L., Arenzana-Seisdedos, F.,
Virelizier, J. L., and Michelson, S. (1998). Chemokine sequestration by viral chemor-
eceptors as a novel viral escape strategy: Withdrawal of chemokines from the environ-
ment of cytomegalovirus-infected cells. J. Exp. Med. 188, 855–866.
Borst, E. M., Mathys, S., Wagner, M., Muranyi, W., and Messerle, M. (2001). Genetic
evidence of an essential role for cytomegalovirus small capsid protein in viral growth.
J. Virol. 75, 1450–1458.
Brandish, P. E., Hill, L. A., Zheng, W., and Scolnick, E. M. (2003). Scintillation proximity
assay of inositol phosphates in cell extracts: High-throughput measurement of G-protein-
coupled receptor activation. Anal. Biochem. 313, 311–318.
Brune, W., Messerle, M., and Koszinowski, U. H. (2000). Forward with BACs: New tools
for herpesvirus genomics. Trends Genet. 16, 254–259.
Bylund, D. B., Deupree, J. D., and Toews, M. L. (2004). Radioligand-binding methods for
membrane preparations and intact cells. Methods Mol. Biol. 259, 1–28.
Casarosa, P., Bakker, R. A., Verzijl, D., Navis, M., Timmerman, H., Leurs, R., and
Smit, M. J. (2001). Constitutive signaling of the human cytomegalovirus-encoded
chemokine receptor US28. J. Biol. Chem. 276, 1133–1137.
Casarosa, P., Gruijthuijsen, Y. K., Michel, D., Beisser, P. S., Holl, J., Fitzsimons, C. P.,
Verzijl, D., Bruggeman, C. A., Mertens, T., Leurs, R., Vink, C., and Smit, M. J. (2003a).
Constitutive signaling of the human cytomegalovirus-encoded receptor UL33 differs
from that of its rat cytomegalovirus homolog R33 by promiscuous activation of
G proteins of the Gq, Gi, and Gs classes. J. Biol. Chem. 278, 50010–50023.
Casarosa, P., Menge, W. M., Minisini, R., Otto, C., van Heteren, J., Jongejan, A.,
Timmerman, H., Moepps, B., Kirchhoff, F., Mertens, T., Smit, M. J., and Leurs, R.
(2003b). Identification of the first nonpeptidergic inverse agonist for a constitutively
active viral-encoded G protein-coupled receptor. J. Biol. Chem. 278, 5172–5178.
Casarosa, P., Waldhoer, M., LiWang, P. J., Vischer, H. F., Kledal, T., Timmerman, H.,
Schwartz, T. W., Smit, M. J., and Leurs, R. (2005). CC and CX3C chemokines
differentially interact with the N terminus of the human cytomegalovirus-encoded
US28 receptor. J. Biol. Chem. 280, 3275–3285.
Chen, C. A., and Okayama, H. (1988). Calcium phosphate-mediated gene transfer: A highly
efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques
6, 632–638.
Cheng, Y., and Prusoff, W. (1973). Relationship between the inhibition constant (Ki) and
the concentration of inhibitor which causes 50 per cent inhibition (IC50) of the
enzymatic reaction. Biochem. Pharmacol. 22, 3099–3108.
Chevillotte, M., Landwehr, S., Linta, L., Frascaroli, G., Luske, A., Buser, C., Mertens, T.,
and von Einem, J. (2009). Major tegument protein pp65 of human cytomegalovirus is
required for the incorporation of pUL69 and pUL97 into the virus particle and for viral
growth in macrophages. J. Virol. 83, 2480–2490.
Cinatl, J. Jr., Vogel, J. U., Kotchetkov, R., and Wilhelm Doerr, H. (2004). Oncomodula-
tory signals by regulatory proteins encoded by human cytomegalovirus: A novel role for
viral infection in tumor progression. FEMS Microbiol. Rev. 28, 59–77.
Characterization of HCMV-Encoded Viral GPCRs 169

Cobbs, C. S., Harkins, L., Samanta, M., Gillespie, G. Y., Bharara, S., King, P. H.,
Nabors, L. B., Cobbs, C. G., and Britt, W. J. (2002). Human cytomegalovirus infection
and expression in human malignant glioma. Cancer Res. 62, 3347–3350.
Daugherty, B. L., Siciliano, S. J., and Springer, M. S. (2000). Radiolabeled chemokine
binding assays. Methods Mol. Biol. 138, 129–134.
Davis-Poynter, N. J., Lynch, D. M., Vally, H., Shellam, G. R., Rawlinson, W. D.,
Barrell, B. G., and Farrell, H. E. (1997). Identification and characterization of a
G protein-coupled receptor homolog encoded by murine cytomegalovirus. J. Virol.
71, 1521–1529.
Fraile-Ramos, A., Kledal, T. N., Pelchen-Matthews, A., Bowers, K., Schwartz, T. W., and
Marsh, M. (2001). The human cytomegalovirus US28 protein is located in endocytic
vesicles and undergoes constitutive endocytosis and recycling. Mol. Biol. Cell 12,
1737–1749.
Fraile-Ramos, A., Pelchen-Matthews, A., Kledal, T. N., Browne, H., Schwartz, T. W., and
Marsh, M. (2002). Localization of HCMV UL33 and US27 in endocytic compartments
and viral membranes. Traffic 3, 218–232.
Gao, J. L., and Murphy, P. M. (1994). Human cytomegalovirus open reading frame US28
encodes a functional beta chemokine receptor. J. Biol. Chem. 269, 28539–28542.
Harkins, L., Volk, A. L., Samanta, M., Mikolaenko, I., Britt, W. J., Bland, K. I., and
Cobbs, C. S. (2002). Specific localisation of human cytomegalovirus nucleic acids and
proteins in human colorectal cancer. Lancet 360, 1557–1563.
Huckle, W. R., and Conn, P. M. (1987). Use of lithium ion in measurement of stimulated
pituitary inositol phospholipid turnover. Methods Enzymol. 141, 149–155.
Hulshof, J. W., Vischer, H. F., Verheij, M. H., Fratantoni, S. A., Smit, M. J., de Esch, I. J.,
and Leurs, R. (2006). Synthesis and pharmacological characterization of novel inverse
agonists acting on the viral-encoded chemokine receptor US28. Bioorg. Med. Chem. 14,
7213–7230.
Kaptein, S. J., Beisser, P. S., Gruijthuijsen, Y. K., Savelkouls, K. G., van Cleef, K. W.,
Beuken, E., Grauls, G. E., Bruggeman, C. A., and Vink, C. (2003). The rat cytomega-
lovirus R78 G protein-coupled receptor gene is required for production of infectious
virus in the spleen. J. Gen. Virol. 84, 2517–2530.
Kledal, T. N., Rosenkilde, M. M., and Schwartz, T. W. (1998). Selective recognition of the
membrane-bound CX3C chemokine, fractalkine, by the human cytomegalovirus-
encoded broad-spectrum receptor US28. FEBS Lett. 441, 209–214.
Lim, H. D., Smits, R. A., Bakker, R. A., van Dam, C. M., de Esch, I. J., and Leurs, R.
(2006). Discovery of S-(2-guanidylethyl)-isothiourea (VUF 8430) as a potent nonimi-
dazole histamine H4 receptor agonist. J. Med. Chem. 49, 6650–6651.
Margulies, B. J., Browne, H., and Gibson, W. (1996). Identification of the human cyto-
megalovirus G protein-coupled receptor homologue encoded by UL33 in infected cells
and enveloped virus particles. Virology 225, 111–125.
Maussang, D., Verzijl, D., van Walsum, M., Leurs, R., Holl, J., Pleskoff, O., Michel, D., van
Dongen, G. A., and Smit, M. J. (2006). Human cytomegalovirus-encoded chemokine
receptor US28 promotes tumorigenesis. Proc. Natl. Acad. Sci. USA 103, 13068–13073.
McIlhinney, R. A. (2004). Generation and use of epitope-tagged receptors. Methods Mol.
Biol. 259, 81–98.
McLean, K. A., Holst, P. J., Martini, L., Schwartz, T. W., and Rosenkilde, M. M. (2004).
Similar activation of signal transduction pathways by the herpesvirus-encoded chemo-
kine receptors US28 and ORF74. Virology 325, 241–251.
Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H., and Koszinowski, U. H.
(1997). Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial
artificial chromosome. Proc. Natl. Acad. Sci. USA 94, 14759–14763.
170 David Maussang et al.

Michel, D., Milotic, I., Wagner, M., Vaida, B., Holl, J., Ansorge, R., and Mertens, T.
(2005). The human cytomegalovirus UL78 gene is highly conserved among clinical
isolates, but is dispensable for replication in fibroblasts and a renal artery organ-culture
system. J. Gen. Virol. 86, 297–306.
Miller, W. E., Houtz, D. A., Nelson, C. D., Kolattukudy, P. E., and Lefkowitz, R. J. (2003).
G-protein-coupled receptor (GPCR) kinase phosphorylation and beta-arrestin recruit-
ment regulate the constitutive signaling activity of the human cytomegalovirus US28
GPCR. J. Biol. Chem. 278, 21663–21671.
Minisini, R., Tulone, C., Luske, A., Michel, D., Mertens, T., Gierschik, P., and Moepps, B.
(2003). Constitutive inositol phosphate formation in cytomegalovirus-infected human
fibroblasts is due to expression of the chemokine receptor homologue pUS28. J. Virol.
77, 4489–4501.
Mokros, T., Rehm, A., Droese, J., Oppermann, M., Lipp, M., and Hopken, U. E. (2002).
Surface expression and endocytosis of the human cytomegalovirus-encoded chemokine
receptor US28 is regulated by agonist-independent phosphorylation. J. Biol. Chem. 277,
45122–45128.
Randolph-Habecker, J. R., Rahill, B., Torok-Storb, B., Vieira, J., Kolattukudy, P. E.,
Rovin, B. H., and Sedmak, D. D. (2002). The expression of the cytomegalovirus
chemokine receptor homolog US28 sequesters biologically active CC chemokines and
alters IL-8 production. Cytokine 19, 37–46.
Rosenkilde, M. M., Smit, M. J., and Waldhoer, M. (2008). Structure, function and
physiological consequences of virally encoded chemokine seven transmembrane recep-
tors. Br. J. Pharmacol. 153, S154–S166.
Sinzger, C., Hahn, G., Digel, M., Katona, R., Sampaio, K. L., Messerle, M., Hengel, H.,
Koszinowski, U., Brune, W., and Adler, B. (2008). Cloning and sequencing of a highly
productive, endotheliotropic virus strain derived from human cytomegalovirus TB40/E.
J. Gen. Virol. 89, 359–368.
Smit, M. J., Bakker, R. A., and Burstein, E. S. (2002). G protein-coupled receptors and
proliferative signaling. Methods Enzymol. 343, 430–447.
Soderberg-Naucler, C. (2006). Does cytomegalovirus play a causative role in the develop-
ment of various inflammatory diseases and cancer? J. Intern. Med. 259, 219–246.
Streblow, D. N., Soderberg-Naucler, C., Vieira, J., Smith, P., Wakabayashi, E., Ruchti, F.,
Mattison, K., Altschuler, Y., and Nelson, J. A. (1999). The human cytomegalovirus
chemokine receptor US28 mediates vascular smooth muscle cell migration. Cell 99,
511–520.
Stropes, M. P., and Miller, W. E. (2008). Functional analysis of human cytomegalovirus
pUS28 mutants in infected cells. J. Gen. Virol. 89, 97–105.
Tischer, B. K., von Einem, J., Kaufer, B., and Osterrieder, N. (2006). Two-step red-
mediated recombination for versatile high-efficiency markerless DNA manipulation in
Escherichia coli. Biotechniques 40, 191–197.
Verzijl, D., Storelli, S., Scholten, D. J., Bosch, L., Reinhart, T. A., Streblow, D. N.,
Tensen, C. P., Fitzsimons, C. P., Zaman, G. J., Pease, J. E., de Esch, I. J., Smit, M. J.,
et al. (2008). Noncompetitive antagonism and inverse agonism as mechanism of action of
nonpeptidergic antagonists at primate and rodent CXCR3 chemokine receptors.
J. Pharmacol. Exp. Ther. 325, 544–555.
Vischer, H. F., Leurs, R., and Smit, M. J. (2006). HCMV-encoded G-protein-coupled
receptors as constitutively active modulators of cellular signaling networks. Trends
Pharmacol. Sci. 27, 56–63.
Wagner, M., Ruzsics, Z., and Koszinowski, U. H. (2002). Herpesvirus genetics has come of
age. Trends Microbiol. 10, 318–324.
Characterization of HCMV-Encoded Viral GPCRs 171

Waldhoer, M., Casarosa, P., Rosenkilde, M. M., Smit, M. J., Leurs, R., Whistler, J. L., and
Schwartz, T. W. (2003). The carboxyl terminus of human cytomegalovirus-encoded 7
transmembrane receptor US28 camouflages agonism by mediating constitutive endocy-
tosis. J. Biol. Chem. 278, 19473–19482.
Waldhoer, M., Kledal, T. N., Farrell, H., and Schwartz, T. W. (2002). Murine cytomega-
lovirus (CMV) M33 and human CMV US28 receptors exhibit similar constitutive
signaling activities. J. Virol. 76, 8161–8168.
Warming, S., Costantino, N., Court, D. L., Jenkins, N. A., and Copeland, N. G. (2005).
Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res.
33, e36.
Yang, T. Y., Chen, S. C., Leach, M. W., Manfra, D., Homey, B., Wiekowski, M.,
Sullivan, L., Jenh, C. H., Narula, S. K., Chensue, S. W., and Lira, S. A. (2000).
Transgenic expression of the chemokine receptor encoded by human herpesvirus 8
induces an angioproliferative disease resembling Kaposi’s sarcoma. J. Exp. Med. 191,
445–454.
C H A P T E R E I G H T

Identification and Characterization


of Virus-Encoded Chemokine
Binding Proteins
Antonio Alcami*,† and Abel Viejo-Borbolla*,‡

Contents
1. Introduction 174
2. Methods for Studying Chemokine-Binding Proteins 175
2.1. Preparation of media from virus-infected cell cultures 175
2.2. Cross-linking of chemokines to soluble vCKBPs 176
2.3. Ligand blot assay 178
2.4. Chemokine binding to cells 179
2.5. Scintillation-proximity assay 180
2.6. FlashPlateâ assay 182
2.7. Surface plasmon resonance to characterize vCKBP–chemokine
interactions 184
2.8. The use of SPR in GAG competition assays 187
2.9. SPR technology to investigate the interaction between vCKBPs
and GAGs 188
Acknowledgments 189
References 189

Abstract
Poxviruses and herpesviruses encode a unique family of proteins that are
secreted from infected cells and bind chemokines, in spite of their lack of
amino acid sequence similarity to cellular chemokine receptors. Many of the
methods used with host chemokines and chemokine receptors may be used to
characterize these virus-encoded chemokine inhibitors. Here we focus on meth-
odologies that have been adapted to identify secreted chemokine binding
proteins from viruses, to determine their binding specificity for chemokines
and to characterize their interaction with the chemokine domains involved in
the recognition of chemokine receptors or glycosaminoglycans.

* Centro de Biologı́a Molecular Severo Ochoa, Consejo Superior de Investigaciones Cientı́ficas-Universidad


Autónoma de Madrid, Cantoblanco Madrid, Spain
{
Department of Medicine, University of Cambridge, Cambridge, United Kingdom
{
Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05208-2 All rights reserved.

173
174 Antonio Alcami and Abel Viejo-Borbolla

1. Introduction
Viruses modulate the chemokine network by encoding homologues
of chemokines and chemokine receptors, and secreted proteins that bind
chemokines (Alcami, 2003; Seet et al., 2003). These mechanisms have been
mainly identified in large DNA viruses such as herpesviruses and poxviruses.
Virus-encoded chemokine homologues function as agonists, binding the
cellular receptors and transducing signals, or antagonists, preventing the
activity of chemokines by occupying chemokine receptors. Viral homolo-
gues of G protein–coupled receptors (GPCRs), the seven-transmembrane–
domain chemokine receptors, are expressed at the surface of infected cells
and may transduce signals in the absence of ligand.
Several viral chemokine-binding proteins (vCKBPs) have been identi-
fied to date (Alcami and Saraiva, 2009). These vCKBPs are secreted in large
amounts from infected cells and, despite the lack of sequence similarity to
GPCRs, bind chemokines with high affinity. The myxoma virus M-T7
protein has been propose to inhibit chemokine activity by preventing the
interaction of chemokines with glycolaminoglycans (GAGs) and disrupting
the chemokine gradient ( Lalani et al., 1997). The interaction of chemokines
with GAGs is believed to be required for proper presentation of the
chemokine to the GPCRs present in the target cell in vivo (Handel et al.,
2005; Johnson et al., 2005). The vaccinia virus 35-kDa protein and myxoma
virus M-T1 bind CC chemokines with high affinity and neutralize their
activity by preventing interaction with cellular chemokine receptors
(Alcami et al., 1998; Graham et al., 1997; Smith et al., 1997). A secreted
protein related to the 35-kDa vCKBP, known as A41 in vaccinia virus and
E163 in ectromelia virus, has been recently shown to bind chemokines, but
does not block chemokine-induced migration and it has been proposed to
block chemokine–GAG interactions ( Bahar et al., 2008; Ruiz-Arguello
et al., 2008). The CrmB and CrmD secreted tumor-necrosis-factor receptor
homologues from poxviruses have a C-terminal domain, designated small-
pox virus–encoded chemokine receptor (SECRET) domain, that binds a
reduced set of chemokines. The SECRET domain is also present in three
poxvirus secreted proteins and inhibits the biological activity of chemokines
(Alejo et al., 2006). Three vCKBPs have been identified in herpesviruses.
The M3 protein encoded by murine gammaherpesvirus 68 binds a broad
range of chemokines, including CC, CXC, C, and CX3C chemokines, and
neutralizes their activity ( Parry et al., 2000; van Berkel et al., 2000). The
glycoprotein G from several alphaherpesviruses infecting animals binds a
broad range of chemokines ( Bryant et al., 2003; Costes et al., 2005). Both
M3 and glycoprotein G inhibit the interaction of chemokines with
both cellular receptors and GAGs (Alexander-Brett and Fremont, 2007;
Viral Chemokine Binding Proteins 175

Bryant et al., 2003; Webb et al., 2004). Finally, the pUL21.5 protein encoded
by human cytomegalovirus binds CCL5 and blocks its interaction with
cellular receptors (Wang et al., 2004).
The methods used to study the binding properties and biological activity
of viral chemokines and chemokine receptors are similar to those used to
characterize the cellular homologues. This chapter will focus on methods that
have been specifically used to identify vCKBPs and to characterize their
binding properties. A chemokine-binding assay for cells that can also be
used to characterize the binding properties of the viral chemokine and
chemokine receptor homologues is described. The ability of vCKBPs to
neutralize the biological activity of chemokines can be determined in standard
chemokine-induced cell migration and calcium mobilization assays.

2. Methods for Studying


Chemokine-Binding Proteins
2.1. Preparation of media from virus-infected cell cultures
Initial screenings for the presence of vCKBPs are carried out with crude
supernatants from cell cultures infected with relevant viruses (Alcami et al.,
1998; Bryant et al., 2003; Graham et al., 1997; Parry et al., 2000; van Berkel
et al., 2000). While removal of virus particles by centrifugation may reduce
virus titers, additional methods should be used to ensure inactivation of
infectious virus, such as treatment with UV light and trioxsalen, a photo-
chemical DNA cross-linker (Tsung et al., 1996).
1. Infect cell monolayers with virus at high multiplicity of infection (5 to 10
plaque-forming units per cell) in a small volume of serum-containing
tissue culture medium (i.e., 10 ml in a 175-cm2 flask). Prepare super-
natants from mock-infected cells as a control.
2. After an adsorption period of 1 to 2 h at 37  C, wash monolayers three
times with serum-free tissue culture medium or phosphate buffer saline
(PBS) to remove any remaining virus or serum.
3. Follow the infection in a small volume of serum-free medium (i.e., 15
to 20 ml for a 175-cm2 flask) during the desired time. Normally, 24 to
48 h of infection will ensure maximal expression of viral proteins.
4. Collect the supernatants and centrifuge at 4 for 15 min at 3000 rpm to
remove cellular debris. Add Hepes, pH 7.4, to a final concentration of
20 mM to stabilize the pH of the supernatants.
5. Virus particles may be removed by ultracentrifugation (i.e., 33,000g for
1 h at 4 ).
6. Inactivate infectious virus by treatment with trioxsalen and UV light.
A concentrated 100 stock of trioxsalen (4,50 ,8-trimethylpsoralen, Sigma)
176 Antonio Alcami and Abel Viejo-Borbolla

is freshly prepared by dissolving 1 mg in 1 ml of dimethylsulfoxide (DMSO)


at 37 for 3 h and diluted to a final concentration of 200 mg/ml in DMSO.
Add 10 ml trioxsalen stock per milliliter of supernatant to a final concen-
tration of 2 mg/ml. Incubate for 10 min at room temperature. Transfer
3-ml aliquots of the supernatant to six-well tissue culture plates. Remove
the lid of the plate and expose to UV in a cross-linker for 5 min. Test the
virus inactivation by titration on cell monolayers.
7. Concentrate supernatant 5- to 10-fold using a Centriprep concentrator
and store at –80 .

2.2. Cross-linking of chemokines to soluble vCKBPs


Most of the vCKBPs described to date were identified in cross-linking experi-
ments to chemokines (Alcami et al., 1998; Bryant et al., 2003; Graham et al.,
1997; Lalani et al., 1997; Parry et al., 2000; van Berkel et al., 2000; Wang et al.,
2004). Samples that potentially contain vCKBPs, such as supernatants from
virus-infected cultures, crude medium from mammalian cell or baculovirus
expression systems, and purified recombinant candidate proteins, are incubated
with 125I-chemokines. The interaction of chemokines with binding proteins is
identified by inducing covalent cross-linking between interacting proteins and
subsequent analysis by SDS-PAGE (Fig. 8.1). Nonradioactive chemokines
may also be cross-linked and the complexes visualized by Western blot
with specific antibodies ( Lalani et al., 1997; van Berkel et al., 2000). There is
a large variety of chemical cross-linkers with different functional group speci-
ficity and length of the spacer, and one must consider that a specific cross-linker
may not work for all protein–protein interactions. The cross-linkers described
in the following have been successfully used to identify vCKBP–chemokine
interactions.
Once a vCKBP has been identified by using radioiodinated chemokines,
the cross-linking may be repeated in the presence of increasing doses of
unlabeled chemokines to determine the ability of other chemokines to bind
the vCKBP. This method is very sensitive and will identify low-affinity
interactions. It is critical that chemokine activity assays are also performed to
confirm whether the vCKBP neutralizes the activity of specific chemokines.
1. Incubate 10–20 ml supernatants with 1–2 ml of 125I-chemokine (0.4–0.8
nM), commercially available at 2200 Ci/mmol, in 25 ml final volume
of binding buffer (RPMI containing 20 mM Hepes, pH 7.5, and
0.1% bovine serum albumin, BSA) for 2 h at room temperature. Add
100 to 1000-fold excess of unlabeled chemokine to demonstrate speci-
ficity of the interaction, or other unlabeled chemokines to determine
chemokine-binding specificity.
2. Add 2.5 ml of 10x concentrated cross-linker and incubate for 15 min at
room temperature. Various cross-linkers may be used: (a) 5 nM Bis
Viral Chemokine Binding Proteins 177

5 k ck
A Δ3 mo 1 1 B 5 k ck
- 68 ster ster K -1 -4 -5 V- V- V-1 Δ3 mo
V li li B H H 68 ter ter -1 -1 1
H V- V- D HV HV HV an ap erH 1 4 5 V V -
M V V M B B B R C C V--lis -lis BKV- V- V- nH pH rHV
H V D a
M VV V M BH BH BH R Ca Ce
175
* 175
83 *
83
62 * 62 *
47 *
* 47 *
32 32

25 25

16 16
CK
CK

5k k
Δ3 ck oc k B4
68 ster ster mo -1 -3 -4
m
1 4 5 V V -
-1 -1 1 oc A
C -
V l li i
H - V- L V V V
D BK - - - H H V
D HV HV HV an ap erH L
m -1
V
M VV V EE EH EH EH M B B B R C C EE EH

175
175
*
83
83
* 62 *
62

47 * 47

32 32

25 25

16 16
CK CK

TM
ll ll + M
E EHV-1
4 4
ce ce + T
4 4
3 k B B B B
18 oc 1 A 1 A 1 A 1 A
H y 83 449 492281 047 644 244 202 013 062 966 529 L m V- V- V- V-
ac rm 4
R A 50 82 10 32 84 82 82 32 10 62 60 82 EE EH EH EH EH

175
83
62
47
*

32
25

16
CK

Figure 8.1 Identification of vCKBPs by chemokine cross-linking assay. Cross-linking


of 125I-CCL3 (A), 125I-CXCL8 (B,C,E), or 125I-CXCL12 (D) with EGS to medium
from cultures uninfected (mock) or infected with the indicated viruses.The field isolates
of EHV-1 are indicated with an identification number (E). Cross-linking with
125
I-CXCL8 was also performed to supernatants and cell extracts (cell) from cultures
infected with EHV-1 strain AB4 in the absence or presence of tunicamycin (Tm) (E).
Samples were analyzed by sodium-dodecyl-sulphate polyacrylamide gel electrophoresis
178 Antonio Alcami and Abel Viejo-Borbolla

(Sulfosuccinimidyl) suberate (BS3) (Pierce Chemical Co.), with a freshly


prepared 10 stock solution at 50 nM dissolved in 5 mM sodium citrate,
pH 5; (b) 40 mM 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide
(EDC, Sigma), with a 10 stock solution at 400 mM (76 mg/ml) in
water and stored at –20 ; or (c) 1 mg/ml ethylene glycol-bis-succinamidyl
succinate (EGS, Sigma), with a freshly prepared 10 stock solution at
10 mg/ml in DMSO.
3. Add 2.5 ml of 1 M Tris-HCl pH 7.5 to quench the reaction.
4. Centrifuge the sample in a microfuge (13,000 rpm) for 15 min. This step
can be avoided, but it will be recommended if high background levels are
observed.
5. Transfer 20 ml of the supernatant to a tube containing 20 ml of
2 Laemmli buffer with mercaptoethanol. Boil for 3 min.
6. Load 10 to 15 ml in a 12% polyacrylamide gel to separate chemokines
from complexes by SDS-PAGE.
7. Fix and dry the gel, and expose to autoradiography film with two
intensifying screens at –80 .

2.3. Ligand blot assay


The ligand blot assay has been successfully used to identify the interaction of a
variety of cytokines with their receptors and with viral proteins (Dower et al.,
1985; Symons et al., 1995). Proteins are resolved by SDS-PAGE in the absence
of reducing agents, transferred to a nitrocellulose membrane and incubated
with radioiodinated chemokines. The major limitation of this method is that
insufficient protein renaturation after immobilization onto the membrane
support may limit the detection of chemokine–vCKBP interactions.
1. Resolve 10 to 20 ml of concentrated serum-free virus-infected and mock-
infected supernatants or purified recombinant proteins under nonreducing
conditions by SDS-PAGE.
2. Transfer the proteins onto a nitrocellulose membrane.
3. Incubate overnight at 4 the nitrocellulose membrane with blocking
solution containing 3% non-fat skimmed milk powder in 10 mM
Tris-HCl pH 7.4, 140 mM NaCl, and 0.02% NaN3.
4. Incubate the nitrocellulose membrane with 2 to 10 nM commercially
available 125I-chemokine (220 Ci/mmol), in blocking solution for 4 h at
room temperature. Binding specificity should be demonstrated in the
presence of a 100- to 1000-fold excess unlabeled chemokine.

(SDS-PAGE) and autoradiography. Molecular masses in kilo-daltons and the position of


125
I-labeled chemokine (CK) and vCKBP-chemokine complexes (*) are indicated.
(From Bryant, N. A., Davis-Poynter, N.,Vanderplasschen, A., Alcami, A. (2003). Glyco-
protein G isoforms from some alphaherpesviruses function as broad-spectrum chemo-
kine binding proteins. EMBO J. 22,833^846, with permission.)
Viral Chemokine Binding Proteins 179

5. Wash the nitrocellulose membrane with blocking solution three times


for 30 min.
6. Air-dry the nitrocellulose membrane on filter paper for 10 min.
7. Place the membrane between plastic wrap and expose to autoradiogra-
phy film with two intensifying screens at –80 .

2.4. Chemokine binding to cells


This method is useful to determine whether vCKBPs prevent the interac-
tion of chemokines with specific cellular receptors expressed at the cell
surface (Fig. 8.2) (Alcami et al., 1998; Bryant et al., 2003; Parry et al., 2000).
It may also be used to test the binding of virus-encoded chemokines to cells
expressing relevant chemokine receptors or to test whether virus-infected
cells or cells transfected with viral homologues of chemokine receptor genes
express chemokine-binding activity. The first step of the method should be
ignored to study viral chemokines and chemokine receptors. Binding assays
described here with cells in suspension may also be performed with cell
monolayers, but higher cell densities and chemokine-binding values are
normally achieved with cells in suspension.
The affinity of cellular chemokine receptors for chemokines can
be determined from saturation curves. Once the affinity is known, the
ability of purified vCKBPs to inhibit binding of 125I-chemokines to cellular
receptors will give us an indirect indication of the binding affinity of the
vCKBP–chemokine interaction.
1. Incubate various doses of supernatant containing vCKBP or purified
vCKBP with commercially available 125I-chemokine (2200 Ci/mmol,
final concentration 100 to 300 pM ) in 100 ml of binding medium (RPMI
containing 20 mM Hepes, pH 7.5, and 0.1% BSA) for 1 h at 4 .
2. Prepare cells expressing chemokine receptors. Cells growing in suspension,
such as U937 and THP-1 cells, are washed twice with binding medium
by centrifugation. Cells growing in monolayer can be detached from the
substrate by incubation with 0.5 mM EDTA in PBS for 10 to 15 min. Cells
must be washed twice with binding medium by centrifugation and resus-
pended in binding medium to a concentration of 2.5  106 cells in 50 ml.
3. Add 2.5  106 cells in suspension in 50 ml and incubate for 2 h at 4 with
occasional shaking.
4. Centrifuge (microfuge 30 s) 125 ml of the cell suspension through 200 ml
of phthalate oil mix (1.5 parts of dibutyl phthalate, Sigma, and 1 part of
dioctyl phathlate [bis(2ethylhexyl) phthalate], Aldrich) in 0.5 ml Eppen-
dorf tubes. Aspirate the supernatant and cut with scissors the tip of the
tube containing the pellet.
5. Transfer the tip of the Eppendorf tube into a suitable tube to count the
radioactivity in a gamma counter.
180 Antonio Alcami and Abel Viejo-Borbolla

A B
20,000 25,000

20,000
Bound MIP - Ia (CPM)

Bound MIP - Ia (CPM)


15,000

15,000
10,000

10,000

5000
5000

0 0
1 10 100 1000 10,000 100,000 1,000,000 1 10 100 1000 10,000 100,000 1,000,000

Dose (cell equivalents) Dose (cell equivalents)

C D
15,000 8000

6000
Bound IL - 8 (CPM)

Bound IL - 8 (CPM)

10,000

4000

5000
2000

0 0
1 10 100 1000 10,000 100,000 1,000,000 1 10 100 1000 10,000 100,0001,000,000
Dose (cell equivalents) Dose (cell equivalents)

Figure 8.2 Inhibition of chemokine binding to cellular receptors by vCKBPs. Secreted


glycoprotein G from equine herpesvirus 1 (EHV-1) and bovine herpesvirus 1 (BHV-1)
expressed in the baculovirus system inhibits chemokine binding to cells in a dose-
dependent manner. Binding assay of 125I-CCL3 and 125I-CXCL8 to U937 cells in the
absence (solid triangles) or presence of increasing amounts of supernatants from Sf 21
cells infected with recombinant baculovirus expressing full-length glycoprotein G
from either EHV-1 (B, D) or BHV-1 (A, C) (solid squares), or with control baculovirus
(AcNPV, open squares).The dose of supernatant is expressed as cell equivalents. Binding
specificity was determined in the presence of 500-fold excess of unlabeled CCL3 or
CXCL8 (open circles). Purified M3 protein was used as a positive control (open trian-
gles). Binding of chemokines is expressed as the mean  standard deviation of triplicate
assays. (From Bryant, N. A., Davis-Poynter, N.,Vanderplasschen, A., Alcami, A. (2003).
Glycoprotein G isoforms from some alphaherpesviruses function as broad-spectrum
chemokine binding proteins. EMBO J. 22, 833^846, with permission.)

2.5. Scintillation-proximity assay


The scintillation-proximity assay (SPA) is a powerful quantitative-binding
method ( Bosworth and Towers, 1989). This technology is available from
GE Healthcare as microspheres embedded with scintillant, and various
formats are available, with antibodies or proteins bound to the surface of
the beads to facilitate the coupling of the protein of interest. We illustrate
Viral Chemokine Binding Proteins 181

this technology while describing a protocol in which protein A–coated


beads are used to characterize the interaction of chemokines with vCKBPs
fused to the Fc portion of IgG1 (Alcami et al., 1998). The vCKBP-Fc
protein binds to the surface of protein A–coated fluomicrospheres and
the radioligand must bind to the receptor to be in close proximity to the
fluomicrospheres to excite the scintillant (Fig. 8.3). One of the best
advantages of this technique is that the unbound radioligand does not
activate the scintillant, and thus eliminates the need to carry out extensive
washings and manipulations to separate bound from free ligand. In this
method, all reagents are mixed, and bound radioactivity is counted at the
indicated time.
It is critical to determine experimentally the amount of purified vCKBP-
Fc to be used in the assay, which will normally be 1 to 100 ng. High
concentrations of vCKBP-Fc will saturate the binding capacity of the
protein A–SPA beads, and the excess vCKBP-Fc in solution will prevent
binding of the radiolabeled chemokine to vCKBP-Fc–coated beads. An
alternative when large amounts of vCKBP-Fc protein are needed is to
precoat the protein A–SPA beads with purified viral protein, and to remove
the excess of protein by washing the beads before addition of the radiola-
beled chemokines. The specificity of the interaction may be demonstrated
in the presence of excess unlabeled chemokine.
An advantage of this method over the cross-linking assay is that it is more
quantitative and allows determination of binding affinities (Fig. 8.3). This
can be achieved by performing saturation curves with increasing doses of
125I-chemokine followed by Scatchard analysis. Alternatively, the affinity

of vCKBP for chemokines can be indirectly calculated by determining the


binding of a 125I-chemokine of known binding affinity to vCKBP in
the presence of increasing doses of unlabeled chemokines. The assay
described in the following is performed in tubes, but the beads and reagents
may also be added to specially designed microplates to facilitate the
manipulation and counting of many samples.
1. Incubate commercially available 125I-chemokines (200 to 400 pM ) with
1 to 100 ng of purified vCKBP-Fc in 100 ml of binding buffer (0.1% BSA
in PBS) for 2 h at room temperature. Unlabeled chemokines can be
added as necessary. Tissue culture medium is not recommended as
binding buffer to avoid possible quenching when counting radioactivity
due to phenol red present in the medium. As an alternative, phenol
red–free tissue culture medium may be used in these assays.
2. Add 50 ml of protein A-SPA beads and incubate for 2 h at room tempera-
ture. If affinity constants will be calculated, the time of incubation necessary
to reach equilibrium should be tested experimentally.
3. Determine the radioactivity bound to vCKBP-Fc by counting in a beta-
scintillation counter.
182 Antonio Alcami and Abel Viejo-Borbolla

A B
vCKBP-Fc
+ 50
125I-chemokine

40

125I-CCL3 bound, pM
30

20
vCKBP-Fc
SPA
Prot.A 125I-chemokine 10
CCL3 KD 103 ± 4 pM
Protein A
0
0 100 200 300 400 500 600 700
Scintillation proximity assay 125I-CCL3 (pM)

C
100
KD (nM)
bound, %

80
CCL11 1.4 ± 0.6
60
CCL5 7.2 ± 0.8
125I-CCL3

CCL3
40 CCL11 CCL2 15.1 ± 0.6
CCL5
20 CCL2

0
0.01 0.1 1 10 100 1000
Cold competitor (nM)

Figure 8.3 SPA to study the interaction of vCKBPs with chemokines. (A) Illustration
of SPA using protein A-fluoromicrospheres containing scintillant (SPA Prot. A) to
detect the interaction of 125I-chemokines with a vCKBP fused to the Fc portion of
human IgG1 (vCKBP-Fc). (B) Saturation curve and Scatchard analysis of 125I-CCL3
binding to vaccinia virus 35K-Fc.The mean ( SEM) specific binding of triplicate sam-
ples and the affinity constant are shown. (C) Competitive inhibition with various doses
of CC chemokines. Purified vaccinia virus 35K-Fc protein was incubated in triplicate
with 50 pM 125I-CCL3 in the presence of increasing doses of unlabeled human CC
chemokines: CCL2, CCL3, CCL5, and CCL11. The percentage of specific binding
(mean  SEM) refers to binding in the absence of competitor. The affinity constant
(KD) values calculated are indicated.

4. The total radioactivity added must be determined in a beta-scintillation


counter after addition of a standard scintillant to a relevant amount of
125I-chemokine.

2.6. FlashPlateâ assay


The principle of the FlashPlate ( PerkinElmer Life Sciences) is the same as
that of SPA, but in this case the assay has been designed in a plate format.
FlashPlate is a microplate designed for binding assays with radiolabeled
Viral Chemokine Binding Proteins 183

ligands (Brown et al., 1997). The interior of each well is coated with a thin
layer of polystyrene-based scintillant. Following the SPA principle, the
radioisotope must be in close proximity to the surface of the well to excite
the scintillant (Fig. 8.4). Unbound radioligand does not activate the scintil-
lant and thus there is no need to carry out extensive washings. FlashPlate
was designed for use with microplate scintillation counters.
Various FlashPlate formats are available that have secondary antibodies
or other proteins precoated in the wells. In the protocol described here, a
nickel-chelate FlashPlate format is used to study the interaction of chemo-
kines with vCKBPs fused to a C-terminal 6xhis tag (vCKBP-his) (Alcami,
2004). Protein A–coated FlashPlate can also be used when the vCKBP or
other receptors are expressed fused to the Fc portion of human IgG1.

125l-chemokine

vCKBP-his
Scintillant
Nickel chelate flashplate
(PerkinElmer life sciences)

B C
10000
18000
bound (cpm)

8000
bound (cpm)

12000
6000
8000
4000
125I-IL-8

125I-IL-8

4000
2000

0 0
1 10 100 1000 0 200 400 600 800
Purified M3 (ng) 125I-IL-8 added (pM)

Figure 8.4 FlashPlate assay to characterize the interaction of vCKBPs with chemo-
kines. (A) Illustration of FlashPlate assay to determine the interaction of radiolabeled
chemokines with purified vCKBP expressed with a C-terminal 6xhis tag (vCKBP-his)
in nickel chelate FlashPlate. (B) Binding of 200 pM 125I-IL-8 (125I-CXCL8) to increasing
doses of purified murine gammaherpesvirus 68 M3 protein fused to a C-terminal 6xhis
tag. The mean ( standard deviation) specific binding of triplicate samples is shown.
(C) Saturation curve of 125I-IL-8 (125I-CXCL8) binding to purified M3 (1 ng).The mean
( standard deviation) specific binding of triplicate samples is shown. (From Alcami,
A. (2004). Interaction of viral chemokine inhibitors with chemokines. Methods Mol. Biol.
239, 167^180, with permission.)
184 Antonio Alcami and Abel Viejo-Borbolla

As for the SPA beads from GE Healthcare, the concentration of


vCKBP-his used in the assay is determined experimentally, which will
normally be 1 to 100 ng per well. Figure 8.4 illustrates a typical experiment
in which addition of an excess of vCKBP-his may reduce the signal. If large
amounts of recombinant protein are needed, the FlashPlate may be pre-
coated with purified viral protein, and the excess of protein removed by
washing the wells before addition of 125I-chemokines.
As indicated for SPA, the FlashPlate platform can be used to determine
chemokine specificity, by either direct binding to 125I-chemokines or by
competitive inhibition with unlabeled chemokines (Bryant et al., 2003;
Webb et al., 2003). The binding affinity of the vCKBP-chemokine inter-
action is calculated from saturation curves or competitive inhibition assays
with increasing doses of unlabeled chemokines.
1. Add commercially available 125I-chemokines (200–400 pM ) and 1 to
100 ng of purified vCKBP-his in 100 ml of binding buffer (0.1% BSA in
PBS) to the wells of a nickel chelate FlashPlate. Unlabeled chemokines
can be added as necessary. As indicated above for SPA, tissue culture
medium is not recommended due to the presence of phenol red, and
phenol red–free tissue culture medium should be used in these assays.
2. Incubate for 4 to 6 h at room temperature or for longer periods at 4 .
If affinity constants will be calculated at equilibrium, the same plate may
be counted several times to determine experimentally the kinetics of
interaction of chemokines with the viral protein.
3. Count the FlashPlate at the desired time of incubation in a microplate
scintillation counter.
4. The total radioactivity added can be determined by addition of Microscint,
a scintillant designed for these counters, to control wells.

2.7. Surface plasmon resonance to characterize


vCKBP–chemokine interactions
Surface plasmon resonance (SPR) technology, such as BIAcore biosensors
( Biacore Life Sciences, GE Healthcare), monitors protein–protein interac-
tions in real time and has been widely used to characterize the binding of
vCKBPs to chemokines (Alejo et al., 2006; Alexander-Brett and Fremont,
2007; Ruiz-Arguello et al., 2008; Seet et al., 2001; Wang et al., 2004). SPR
is a very useful and powerful method to address whether a protein of interest
is able to interact with chemokines (Fig. 8.5). Once a putative vCKBP has
been coupled onto a biosensor chip, all available recombinant chemokines
can be used in an initial screening assay to determine the binding specificity
of the candidate protein. This method offers a quantitative advantage over
the cross-linking where screening of many samples is time consuming and
more expensive due to the cost of the chemokine labeling. More than 40
Viral Chemokine Binding Proteins 185

1600

Resp. diff. (RU)


hCCL28
1200
800 hCCL25
hCXCL14
400 hCCL26
hCXCL10
0 hCXCL12b
0 100 200 300 400
Time (s)

500
Resp. diff. (RU)

380 mCCL25
260 mCCL21
mCCL24
140 mCXCL12b
20 mCXCL10
mCXCL12a
0 100 200 300 400
Time (s)

Figure 8.5 SPR analysis of vCKBP binding to chemokines. Sensorgrams showing


binding of the indicated human (h) and mouse (m) chemokines to purified recombinant
E163 from ectromelia virus analyzed by SPR. Arrows indicate end of injection and the
times are shown in seconds. (From Ruiz-Arguello, M. B., Smith,V. P., Campanella, G. S.,
Baleux, F., Arenzana-Seisdedos, F., Luster, A. D., and Alcami, A. (2008). An ectromelia
virus protein that interacts with chemokines through their glycosaminoglycan binding
domain. J.Virol. 82,917^926, with permission.)

chemokines have been described in both mouse and human systems, and
purified recombinant chemokines are available from a number of companies
such as Peprotech or R&D Systems. Another advantage of SPR is the
monitoring of the vCKBP–chemokine interaction in real time, allowing
the quantification of binding affinities and providing additional information
on the stability of the vCKBP–chemokine complex. This is relevant in
order to understand the biology of these viral proteins. For example, a slow
dissociation of the complex may enhance the ability of a particular vCKBP
to inhibit chemokine activity in vivo. Another application of this technology
is the screening of chemokine and vCKBP mutants to map the amino
acid residues involved in the interaction and to assess the relative contribu-
tion of different binding domains when multiple interactions are occurring
between two proteins.
The vCKBP can be immobilized onto the biosensor chip through various
methods: amine-, thiol-, and streptavidine-coupling. Proteins containing a
histidine-tag can also be immobilized using NTA sensor chips. The choice of
the method depends on the chemical nature of the ligand. The most common
method used for vCKBPs is amine coupling since most of the vCKBPs
contain free amine groups and are not very acidic. When the protein is
186 Antonio Alcami and Abel Viejo-Borbolla

very acidic, does not have free amine groups, or, on the other hand, has too
many amine groups, thiol coupling is a good alternative. Thiol groups are
normally present in the vCKBP, but can also be inserted into the vCKBP if
needed. Reducing conditions for either the binding or regeneration of the
chip should not be employed if thiol coupling is performed. When neither
thiol nor amine coupling are suitable for the immobilization of the vCKBP,
the protein can be biotinylated prior to the immobilization in a streptavidin-
containing chip. In this section, we describe the methodology used to
determine the binding properties of vCKBPs using the amine groups
to immobilize the protein. The use of streptavidine coupling is described
later (Section 2.9). The BIAcore chips contain several cells allowing the
coupling of the vCKBP to one cell while leaving the other empty or occupied
by a protein control unable to interact with chemokines. This reference cell is
required for the analysis of the BIAcore sensorgram (see the following).
The main limitation of the SPR technology over the cross-linking is that
it does not allow the screening of complex protein mixtures such as crude
medium from virus-infected cells to identify the presence of secreted
vCKBPs. Moreover, the cross-linking assay allows the comparison of the
binding profiles of supernatant from cells infected with wildtype virus versus
a virus mutant lacking the vCKBP, to test whether a protein is the sole
vCKBP encoded by a particular virus.
1. Dyalize purified recombinant vCKBP against acetate buffer. The pH of
the buffer depends on the isoelectric point of the vCKBP.
2. Activate all cells of the carboxy methyl dextran 5 (CM5) chip (Biacore
Life Sciences, GE Healthcare) by addition of 35 ml of NHS/EDC. This
results in the modification of the carboxymethyl groups of the chip to
N-hydroxysuccinimide esters.
3. Inject the vCKBP at a flow rate of 5 ml/min only in one of the chip cells.
Covalent interactions will form between the amine groups of the vCKBP
and the N-Hydroxysuccinimide esters of the chip surface. For initial
screening purposes, approximately 5000 response units ( RU) (5000 pg/
mm2) should be coupled to the chip. To determine the kinetics of associ-
ation and dissociation and to calculate the affinity constants, lower
densities of vCKBP are immobilized to the chip (Rmax < 200 RU).
4. Deactivate all cells of the chip by injecting 35 ml of 1 M ethanolamine
hydrochloride, pH 8.5. This will impede that the free esters react with
the analyte later on.
5. Inject recombinant chemokines dissolved in HBS-EP buffer (10 mM
Hepes, 150 mM, NaCl, 3 mM EDTA, 0.005% surfactant P20, pH 7.4).
For initial screening purposes, the chemokines are injected at a concen-
tration of 100 nM at a flow rate of 10 ml/min, and association and
dissociation phases are monitored. The dissociation phase in a screening
experiment is approximately 2 min. For kinetics experiments, the
Viral Chemokine Binding Proteins 187

chemokines are injected at different concentrations (ranging from 1 to


300 nM ) at a flow rate of 30 ml/min over a 2-min period. Following the
association period, the dissociation is analyzed by running sample buffer
for 5 to 10 min.
6. Regenerate the chip surface after each chemokine injection to remove
all bound analyte by injecting 10 to 30 ml of 10-mM glycine-HCl, pH
2.0 to 3.0.
7. Analyze the BIAcore sensorgrams with the software BIAevaluation,
version 3.2, or more recent versions. Bulk refractive index changes are
removed by subtracting the reference flow cell responses, and the average
response of a blank injection is subtracted from all analyte sensorgrams to
remove systematic artifacts. Kinetic data are globally fitted to a 1:1
Langmuir model.

2.8. The use of SPR in GAG competition assays


Some vCKBPs prevent the binding of chemokines to GAGs, thereby
interfering with the presentation of the chemokine to the GPCR (Bryant
et al., 2003; Lalani et al., 1997; Ruiz-Arguello et al., 2008; Webb et al.,
2004). As outlined above, the SPR technology is very useful to determine
the binding specificities and affinities of vCKBPs to chemokines. Similar
experiments may address whether the chemokines previously bound to
GAGs interact with vCKBPs and provide information on the involvement
of the GAG-binding site of chemokines in the interaction to vCKBPs
(Fig. 8.6). To investigate whether a vCKBP is binding to the chemokine
through its GAG-binding domain a simple competition experiment can be
performed.
1. Using a CM5 chip with immobilized vCKBP, inject a constant concen-
tration of chemokine diluted in HBS-EP at a flow rate of 10 ml/min.
During the rest of the experiment, use the same buffer and flow rate.
Monitor association and dissociation phases in all injections. Allow
dissociation to occur for 2 min.
2. Regenerate the chip by injecting 10 ml of 10-mM glycine-HCl, pH 2.0
to 3.0.
3. Preincubate the chemokine for 30 min with increasing concentrations of
GAGs, such as heparin, heparan sulfate, or chondroitin sulfate.
4. Inject the same concentration of chemokine as before, together with
increasing concentrations of GAGs.
5. Inject GAG alone at each of the concentrations used to ensure that GAG
is not binding to the vCKBP-containing CM5 chip.
6. Analyze the BIAcore sensorgrams as described in Section 2.7. Determine
maximum response by measuring RU at the end of the injection.
188 Antonio Alcami and Abel Viejo-Borbolla

hCXCL12b
100
mCCL25
mCXCL10
80

Binding (%)
60

40

20

0
1:0 1:0.1 1:0.5 1:1 1:10 1:100 1:1000
Chemokine:heparin (molar ratio)

Figure 8.6 SPR analysis of the interacion of avCKBP to chemokines in the presence of
GAGs. SPR binding assay of mouse CCL25, mouse CXCL10 or human CXCL12b to pur-
ified E163 from ectromelia virus in the presence of increasing concentrations of heparin.
Chemokine and heparin were incubated for 15 min before injection over a E163-coupled
chip and maximum response was recorded.The percentage of binding refers to the binding
in the absence of heparin. (From Ruiz-Arguello, M. B., Smith,V. P., Campanella, G. S.,
Baleux, F., Arenzana-Seisdedos, F., Luster, A. D., and Alcami, A. (2008). An ectromelia
virus protein that interacts with chemokines through their glycosaminoglycan binding
domain. J.Virol. 82,917^926, with permission.)

2.9. SPR technology to investigate the interaction


between vCKBPs and GAGs
Some vCKBPs, such as the M-T1 protein from myxoma virus and the E163
protein from ectromelia virus, are able to interact directly with GAGs, and it
has been postulated that this may be a mechanism to retain the secreted
vCKBP in the vicinity of the infected tissue (Ruiz-Arguello et al., 2008;
Seet et al., 2001). By occupying GAG-binding sites at the cell surface, these
vCKBPs may also interfere with chemokine–GAG interactions.
SPR technology may be adapted to analyze vCKBP–GAG interactions.
The method involves the immobilization of byotinylated GAG to the
streptavidin (SA) chip ( BIAcore Life Sciences, GE Healthcare). Once
the GAG of interest is coupled to the chip, binding of purified vCKBP
can be easily assessed. Furthermore, the kinetics of the interaction are easily
calculated. The method also permits carrying out competition assays with
other nonbyotinylated GAGs and between vCKBP and chemokines for
GAGs. Due to differences in the chemical nature of GAGs and proteins, the
method requires several modifications described in the following. Immobi-
lization of GAGs instead of vCKBPs is preferable to address this question
because amine coupling of vCKBP may block the accessibility of residues
required for protein–GAG interaction.
Viral Chemokine Binding Proteins 189

1. Inject three times 1 M NaCl in 50 mM to condition the SA biosensor


chip, permitting subsequent GAG immobilization.
2. Inject biotinylated GAG at a flow rate of 5 ml/min to reach approxi-
mately 100 RU.
3. Assess the binding specificity of the vCKBP by injecting it at 100 nM
diluted in HBS-EP buffer at a flow rate of 10 ml/min. Monitor associa-
tion and dissociation as described in Section 2.7. For kinetics analysis,
inject serial dilutions of the vCKBP in HSB-EP at a flow rate of 30 ml/min.
Allow the dissociation to proceed for at least 5 min.
4. Regenerate the SA chip surface after each vCKBP injection by injecting
2 M NaCl.
5. Analyze the BIAcore sensorgrams as described in Section 2.7.
A similar experiment can be performed to determine the different
oligosaccharides bound by a vCKBP. This avoids having to biotinylate
and immobilize each individual GAG in an SA chip.
1. Using a SA chip containing immobilized biotinylated GAG inject a
constant concentration of vCKBP diluted in HBS-EP at a flow rate of
10 ml/min. During the rest of the experiment use the same buffer and
flow rate. Monitor association and dissociation phases in all injections.
2. Preincubate the vCKBP with heparin, heparan sulfate, or chondroitin
sulfate during 30 min.
3. Inject the solution mixture as before.
4. Analyze the BIAcore sensorgrams as described in Section 2.7. Determine
maximum response by measuring RU at the end of the injection.

ACKNOWLEDGMENTS
The work in the A.A.’s laboratory is funded by the Wellcome Trust, European Union,
Spanish Ministry of Science and Innovation, and Comunidad de Madrid. A.V.-B. is
supported by a postdoctoral contract program from the Instituto de Salud Carlos III (Spanish
Ministry of Health).

REFERENCES
Alcami, A. (2003). Viral mimicry of cytokines, chemokines and their receptors. Nat. Rev.
Immunol 3, 36–50.
Alcami, A. (2004). Interaction of viral chemokine inhibitors with chemokines. Methods Mol.
Biol. 239, 167–180.
Alcami, A., and Saraiva, M. (2009). Chemokine binding proteins encoded by pathogens.
In ‘‘Pathogen-Derived Immunomodulatory Molecules.’’ (Fallon, P., ed.), Landes
Bioscience, Austin Tx.
190 Antonio Alcami and Abel Viejo-Borbolla

Alcami, A., Symons, J. A., Collins, P. D., Williams, T. J., and Smith, G. L. (1998). Blockade
of chemokine activity by a soluble chemokine binding protein from vaccinia virus.
J. Immunol. 160, 624–633.
Alejo, A., Ruiz-Arguello, M. B., Ho, Y., Smith, V. P., Saraiva, M., and Alcami, A. (2006).
A chemokine-binding domain in the tumor necrosis factor receptor from variola
(smallpox) virus. Proc. Natl. Acad. Sci. USA 103, 5995–6000.
Alexander-Brett, J. M., and Fremont, D. H. (2007). Dual GPCR and GAG mimicry by the
M3 chemokine decoy receptor. J. Exp. Med. 204, 3157–3172.
Bahar, M. W., Kenyon, J. C., Putz, M. M., Abrescia, N. G., Pease, J. E., Wise, E. L.,
Stuart, D. I., Smith, G. L., and Grimes, J. M. (2008). Structure and function of A41,
a vaccinia virus chemokine binding protein. PLoS Pathog. 4, e5.
Bosworth, N., and Towers, P. (1989). Scintillation proximity assay. Nature 341, 167–168.
Brown, B. A., Cain, M., and Broadbent, J. (1997). FlashPlate technology. In ‘‘High
Throughput Screening.’’ (Devlin, J., ed.), pp. 317–328. CRC Press, Boca Raton, FL.
Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A., and Alcami, A. (2003). Glycopro-
tein G isoforms from some alphaherpesviruses function as broad-spectrum chemokine
binding proteins. EMBO J. 22, 833–846.
Costes, B., Ruiz-Arguello, M. B., Bryant, N. A., Alcami, A., and Vanderplasschen, A. (2005).
Both soluble and membrane-anchored forms of Felid herpesvirus 1 glycoprotein G
function as a broad-spectrum chemokine-binding protein. J. Gen. Virol. 86, 3209–3214.
Dower, S. K., Kronheim, S. R., March, C. J., Conlon, P. J., Hopp, T. P., Gillis, S., and
Urdal, D. L. (1985). Detection and characterization of high affinity plasma membrane
receptors for human interleukin 1. J. Exp. Med 162, 501–515.
Graham, K. A., Lalani, A. S., Macen, J. L., Ness, T. L., Barry, M., Liu, L. Y., Lucas, A.,
Clark-Lewis, I., Moyer, R. W., and McFadden, G. (1997). The T1/35kDa family of
poxvirus-secreted proteins bind chemokines and modulate leukocyte influx into virus-
infected tissues. Virology 229, 12–24.
Handel, T. M., Johnson, Z., Crown, S. E., Lau, E. K., and Proudfoot, A. E. (2005).
Regulation of protein function by glycosaminoglycans—as exemplified by chemokines.
Annu. Rev. Biochem. 74, 385–410.
Johnson, Z., Proudfoot, A. E., and Handel, T. M. (2005). Interaction of chemokines and
glycosaminoglycans: A new twist in the regulation of chemokine function with oppor-
tunities for therapeutic intervention. Cytokine Growth Factor Rev. 16, 625–636.
Lalani, A. S., Graham, K., Mossman, K., Rajarathnam, K., Clark-Lewis, I., Kelvin, D., and
McFadden, G. (1997). The purified myxoma virus gamma interferon receptor homolog
M-T7 interacts with the heparin-binding domains of chemokines. J. Virol. 71,
4356–4363.
Parry, C. M., Simas, J. P., Smith, V. P., Stewart, C. A., Minson, A. C., Efstathiou, S., and
Alcami, A. (2000). A broad spectrum secreted chemokine binding protein encoded by a
herpesvirus. J. Exp. Med. 191, 573–578.
Ruiz-Arguello, M. B., Smith, V. P., Campanella, G. S., Baleux, F., Arenzana-Seisdedos, F.,
Luster, A. D., and Alcami, A. (2008). An ectromelia virus protein that interacts with
chemokines through their glycosaminoglycan binding domain. J. Virol. 82, 917–926.
Seet, B. T., Barrett, J., Robichaud, J., Shilton, B., Singh, R., and McFadden, G. (2001).
Glycosaminoglycan binding properties of the myxoma virus CC-chemokine inhibitor,
M-T1. J. Biol. Chem. 276, 30504–30513.
Seet, B. T., Johnston, J. B., Brunetti, C. R., Barrett, J. W., Everett, H., Cameron, C.,
Sypula, J., Nazarian, S. H., Lucas, A., and McFadden, G. (2003). Poxviruses and immune
evasion. Annu. Rev. Immunol. 21, 377–423.
Smith, C. A., Smith, T. D., Smolak, P. J., Friend, D., Hagen, H., Gerhart, M., Park, L.,
Pickup, D. J., Torrance, D., Mohler, K., Schooley, K., and Goodwin, R. G. (1997).
Poxvirus genomes encode a secreted, soluble protein that preferentially inhibits beta
Viral Chemokine Binding Proteins 191

chemokine activity yet lacks sequence homology to known chemokine receptors.


Virology 236, 316–327.
Symons, J. A., Alcami, A., and Smith, G. L. (1995). Vaccinia virus encodes a soluble type I
interferon receptor of novel structure and broad species specificity. Cell 81, 551–560.
Tsung, K., Yim, J. H., Marti, W., Buller, R. M., and Norton, J. A. (1996). Gene expression
and cytopathic effect of vaccinia virus inactivated by psoralen and long-wave UV light.
J. Virol. 70, 165–171.
van Berkel, V., Barrett, J., Tiffany, H. L., Fremont, D. H., Murphy, P. M., McFadden, G.,
Speck, S. H., and Virgin, H. I. (2000). Identification of a gammaherpesvirus selective
chemokine binding protein that inhibits chemokine action. J. Virol. 74, 6741–6747.
Wang, D., Bresnahan, W., and Shenk, T. (2004). Human cytomegalovirus encodes a highly
specific RANTES decoy receptor. Proc. Natl. Acad. Sci. USA 101, 16642–16647.
Webb, L. M., Clark-Lewis, I., and Alcami, A. (2003). The gammaherpesvirus chemokine
binding protein binds to the N terminus of CXCL8. J. Virol. 77, 8588–8592.
Webb, L. M., Smith, V. P., and Alcami, A. (2004). The gammaherpesvirus chemokine
binding protein can inhibit the interaction of chemokines with glycosaminoglycans.
FASEB J. 18, 571–573.
C H A P T E R N I N E

The Chemokine-Binding Protein


M3 as a Tool to Understand
the Chemokine Network In Vivo
Sergio A. Lira,* Abel Viejo-Borbolla,*,† Limin Shang,*
and Andrea P. Martin*

Contents
1. Introduction 193
2. Generation of Transgenic Mice Expressing
M3 in Insulin-Producing b Cells 195
3. M3 Expression in Islets of Langerhans Blocks CCL2-, CCL21-,
and CXCL13-Induced Migration of Cells to Islets 198
4. M3 Expression in b Cells Blocks Cellular Infiltration and Prevents
Diabetes Development 199
5. Generation of a Conditional Transgenic System
for Expression of M3 202
6. Concluding Remarks 204
References 205

Abstract
Murine herpesvirus 68 (MHV-68) codes for a secreted chemokine-binding
protein, termed M3, which interacts with a broad range of chemokines with
very high affinity, inhibiting chemokine function both in vitro and in vivo. Here
we describe the transgenic methodology used to study the role of M3 as an
immune modulator in vivo.

1. Introduction
Chemokines are chemoattractant cytokines that orchestrate the
migration of leukocytes to tissues during homeostasis and following injury
and infection. They are responsible for the initiation of a series of events that

* Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA
{
Centro de Biologı́a Molecular Severo Ochoa, Consejo Superior de Investigaciones Cientı́ficas-Universidad
Autónoma de Madrid, Madrid, Spain

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05209-4 All rights reserved.

193
194 Sergio A. Lira et al.

lead to leukocyte vascular extravasation and tissue infiltration. Chemokines


are classified into C, CC, CXC, and CX3C subfamilies according to the
relative positioning of the N-terminal cystein residues. Most chemokines
are secreted, with the exception of CXCL16 and CX3CL1, which contain
a transmembrane domain. Chemokines interact with glycosminoglycans
(GAGs), and this interaction seems to be required for a proper presentation
of the chemokine to the specific G-protein–coupled receptors (GPCRs)
present at the plasma membrane of the target cell (Cinamon et al., 2001;
Proudfoot et al., 2003; Rot, 1992). There is a certain degree of redundancy in
the chemokine network, with some chemokines interacting with more than
one chemokine receptor and some receptors interacting with more than one
chemokine. Dysregulation of the chemokine network is observed in many
inflammatory and autoimmune diseases.
Large DNA viruses have developed strategies to interfere with the
chemokine system. One of them, used by members of the Poxviridae
and Herpesviridae families, involves the expression of secreted chemokine-
binding proteins that inhibit chemokine function (vCKBP) (Alcami,
2003a,b).
MHV-68 is a murine gamma-2-herpesvirus closely related to two
important human oncogenic viruses, KSHV and EBV. The left region
of the MHV-68 genome contains 4 genes not found in KSHV or EBV.
These genes are termed M (for MHV-68) followed by a number (M1 to
M4) and have important immunomodulatory functions. M3 encodes for a
secreted protein with the ability to bind to a broad range of chemokines
with high affinity and inhibit chemokine function in vitro (Parry et al., 2000;
van Berkel et al., 2000). The mechanism of action behind this inhibition
involves M3 binding to the chemokine N-loop thereby interfering with
the chemokine-receptor interaction (Parry et al., 2000). The analysis of the
crystal structure of M3 and CCL2 reveals that M3 forms a homodimer
that mimics the CCL2-interacting structure of its receptor CCR2
(Alexander et al., 2002).
The use of genetically manipulated mice has contributed to the under-
standing of chemokine function in vivo. As we enter the new century, most
of the chemokine receptors have been individually deleted by conventional
gene targeting techniques. These studies have convincingly demonstrated a
role for chemokines in homeostasis and disease. However, despite these
advances, our understanding of the role of multiple chemokines in the
context of disease is quite primitive. It has been amply documented that
the pattern of chemokine expression varies dramatically during the course of
diseases; not only many chemokines are expressed simultaneously, but also
their temporal expression pattern varies significantly. No genetic or phar-
macological tools have emerged thus far to probe on the chemokine system.
We have reasoned that M3 could be a very good tool to analyze the role of
chemokines in vivo during homeostasis or inflammation because it binds and
M3 and Transgenic Mice 195

inhibits a broad spectrum of chemokines. Our group was the first one to
explore the use of M3 as a chemokine blocker in vivo using transgenic mice
( Jensen et al., 2003). The use of this technology has improved our under-
standing of the immunomodulatory role of M3 in vivo. Moreover, the
characterization of mice expressing M3 has shed light into the role of
chemokines during homeostasis and inflammation.
Here we review the methods used to understand the role of M3 as an
inhibitor of chemokine function in vivo. Specifically, we review the meth-
odology employed to generate and characterize transgenic mice expressing
M3. The technical approaches utilized to identify M3 as a chemokine
binding protein and the molecular mechanism of chemokine inhibition
are covered in Chapter 8 in this volume.

2. Generation of Transgenic Mice Expressing


M3 in Insulin-Producing b Cells
To study the biological effects of M3 in vivo, we generated transgenic
mice expressing M3 in the pancreas (RIP-M3 mice). To this end, first we
constructed the RIP-poly(A) vector containing a segment of the rat insulin
promoter 2 (RIP) and the rabbit b-globin poly(A) signal ( Jensen et al.,
2003). The vector was generated by replacing the tumor necrosis factor
alpha (TNF-a) fragment in RIP-TNF-pBS (Grewal et al., 1996) with the
rabbit b-globin poly(A) DNA segment. The rabbit b-globin poly(A) signal
was PCR amplified from a plasmid containing the CMV-EGFP transgene
(Okabe et al., 1997) using the oligonucleotides 50 -ACAGAGGATAT
CACTCCTC AGGTGCAGGCTGC-30 , inserting an EcoRV site, and
50 -TGTCTCCTCGAGGTCGAGGGATCTCCATAAGAG-30 , inserting
an XhoI site. TNF-a was released from RIP-TNF-apBS by EcoRV/SalI
digestion and replaced by the rabbit b-globin poly(A) PCR-amplified
fragment. To express M3 in the pancreas, we constructed the pRIPM3
plasmid that placed M3 downstream of rat insulin promoter, which has
previously been shown to target transgene expression predominately to the
pancreatic islets and the kidney (Grewal et al., 1996). M3 was PCR ampli-
fied from a previously described plasmid (Parry et al., 2000) using the
oligonucleotides 50 -ACAGAGGAATTCGCCGCCACCATGGCCTTC
CTATCCACATCTGTG-30 , inserting an EcoRIsite and a consensus
Kozak sequence, and 50 -ACAGAGGATATCTCAATGATCCCCAAA
ATACTCCAG-30 , inserting an EcoRV site. This PCR fragment was
subcloned into the EcoRI/EcoRV site of the RIP-poly(A) vector described
above, creating pRIPM3. The transgene (RIP-M3) was released from
pRIPM3 by SacII/KpnI digestion. Separation of the RIP-M3 transgene
from vector DNA was accomplished by zonal sucrose gradient centrifugation
196 Sergio A. Lira et al.

as described (Yang et al., 2000). Fractions containing the transgene were


pooled; microcentrifuged through Microcon-100 filters (Amicon, Beverly,
MA) and washed five times with microinjection buffer (5 mM Tris-HCl
[pH 7.4], 5 mM NaCl, 0.1 mM EDTA). To generate the mice, the RIP-M3
transgene was resuspended in microinjection buffer (5 mM Tris-HCl [pH
7.4], 5 mM NaCl, 0.1 mM EDTA) to a final concentration of 1 to 5 mg/ml,
microinjected into ([C57BL/6J  DBA/2]F2; Jackson Laboratory, Bar
Harbor, ME) eggs, and transferred into oviducts of ICR foster mothers
(Charles River Laboratories, Wilmington, MA), according to published
procedures (Hogan et al., 1986). At 10 days after birth, a piece of tail from
the resulting animals was clipped for DNA analysis. Identification of the
transgenic mice was accomplished by PCR amplification of mouse tail
DNA using specific primer sets. Specifically, the primers used for detection
of the RIPM3 transgene were 50 -AGTGTGCAGGCTGCCTATCAGA
ATGT-30 and 50 -TCTGATGTTTTAAATGATTTGCCCTCCC-30 ,
which are specific for a region in the rabbit b-globin poly(A) sequence.
The endogenous ZP3 gene, used as an internal control, was amplified
with the following primers: 50 -CAGCTCTACATCACCTGCCA-30 and
50 -CACTGGGAAGAGA CACTCAG-30 . PCR conditions were 94 , 30 s;
60 , 30 s; and 72 , 60 s.
Eleven founders were generated from microinjection of this transgene into
fertilized mouse eggs and 10 transgenic lines were established from these
founders. RIP-M3 transgenic mice were healthy and fertile. To test for
transgene expression, the pancreas was dissected and analyzed by immunohis-
tochemistry, using an anti-M3 polyclonal antibody (rabbit antiserum raised
against M3 expressed in Escherichia coli ). Seven transgenic lines showed expres-
sion of M3 (Fig. 9.1), and one of these lines (line 31) was selected for further
experiments. We also confirmed by Western blot that islets from transgenic
animals secreted M3 in vitro. Islets of Langerhans were isolated as previously

Figure 9.1 M3 expression in islets of Langerhans of transgenic mice. Representative


picture of M3 immunostaining in the pancreata of control (WT, left) and RIP-M3
(right) mice.
M3 and Transgenic Mice 197

described (Gotoh et al., 1985). The common bile duct was clamped distal to the
pancreatic duct junction at its hepatic insertion and the proximal common bile
duct was then cannulated using a 27-gauge needle. Then, the pancreas was
infused by retrograde injection of 2 ml of ice-cold collagenase solution (1.0 mg/
ml; Sigma, St. Louis, MO) in HBSS (Invitrogen, Carlsbad, CA). Pancreatic
tissue was recovered and subjected to a 15-min digestion at 37 . Subsequently,
ice-cold HBSS was added and the suspension was vortexed at full speed for 10 s.
Islets were handpicked under a dissection microscope. To analyze M3 expres-
sion, 200 islets from control and transgenic animals were incubated for 24 h in
glucose-free medium and supernatants were collected. Twenty micrograms of
protein from each sample was processed. Blots were incubated with primary
antibodies against M3 and a peroxidase-conjugated goat anti-rabbit IgG
(Abcam Inc, Cambridge, MA). Chemiluminescence was detected using the
Western Blot Chemiluminescence Reagent Plus (Enhanced Luminol, Perkin
Elmer Life Sciences). We found that transgenic RIP-M3 mice secreted immu-
noreactive 44-kD M3 protein after 24 h of culture, which was not present in
media from control islets.
To examine whether constitutive expression of M3 in the pancreas had
affected the development of lymphoid or nonlymphoid tissue, we examined
H&E-stained sections from RIP-M3 transgenic mice. All major organs of
the RIP-M3 mice, including pancreas, kidney, thymus, spleen, and periph-
eral lymph nodes, appeared normal by light microscopy (data not shown).
To rule out that expression of M3 affected b-cell function we performed
both in vitro (insulin content and insulin release) and in vivo experiments
(glucose tolerance test). To measure the insulin content, 20 fresh islets were
collected in Eppendorf tubes in duplicate. To extract insulin, islets were
sonicated in acid ethanol (75% ethanol, 15% HCl), and insulin content was
measured by ELISA (ALPCO Diagnostic, Windham, NH) following the
manufacturer’s instructions. We did not find significant differences in the
insulin content between islets from control and RIP-M3 mice (n ¼ 15 per
group). Later, we performed the insulin secretion assay as described by
Eizirik et al. (1992) with some modifications. Briefly, 20 islets from each
group were set in quintuplicate in a 24-well plate and incubated in CMRL
medium (Cellgro, Mediatech Inc, Herndon, VA) supplemented with
1.7 mM glucose or with 16.7 mM glucose for 60 min at 37 in an atmosphere
of 95% O2/5% CO2. Insulin released into supernatants was measured by
ELISA (ALPCO Diagnostic, Windham, NH). Although higher levels of
secreted insulin were detected in supernatants of cultured islets from both
control and RIP-M3 transgenic mice after they were exposed to high
concentrations of glucose, there was no difference between the groups.
Finally, we performed a intraperitoneal glucose tolerance test. After a 16-h
fast, glucose (1.5 g/kg body weight in saline [0.9% NaCl]) was administered
intraperitoneally (IP). The blood glucose was monitored at 0, 30, 60, 120,
and 240 min using a one-touch blood Ascensia Elite XL glucometer
198 Sergio A. Lira et al.

(Bayer, Elkhart, IN). We found that the blood glucose curves on 8-week-old
control and RIP-M3 transgenic mice were identical. Altogether these results
indicate that the insulin synthesis and secretion are not altered by expression
of M3.

3. M3 Expression in Islets of Langerhans


Blocks CCL2-, CCL21-, and CXCL13-Induced
Migration of Cells to Islets
To test the hypothesis that M3 blocks chemokine function in vivo we
crossed RIP-M3 mice to mice expressing CCL21 (Chen et al., 2002),
CCL2, or CXCL13 (Martin et al., 2006) in insulin-producing b cells.
Our laboratory and others have shown that transgenic expression of
CCL21 induces specific migration of T cells (Luther et al., 2002; Martin
et al., 2004), expression of CCL2 induces migration of monocytes and DCs
(Fuentes et al., 1995; Martin et al., 2006), and that CXCL13 drives specific
migration of B cells (Luther et al., 2000; Martin et al., 2006). Using mice
coexpressing the chemokines and M3 in b cells, we asked whether M3
would block chemokine function and prevent the migration of leukocytes
to the islets and if these blocking properties would be sustained even in the
presence of increasing concentration of the chemokines.
To determine the degree of islet infiltration we analyzed histological
sections of the pancreas of different animals. Sections were stained with
H&E or with antibodies against CD45 (BD Biosciences Pharmigen, San
Diego, CA) and insulin (DAKO, Carpinteria, CA). Forty to 100 islets were
examined for each mouse. Insulitis was scored as follows: no lesions; small or
periinsular leukocytic aggregates, usually periductal infiltrates; medium or
moderate insulitis with mononuclear cells infiltrating less than 50% of the
islet architecture; and large or severe insulitis with more than 50% of
the islet tissue infiltrated by mononuclear cells. We did not find infiltrates
in islets of control or RIP-M3 transgenic mice regardless of age (n ¼ 8 each,
data not shown). As expected, mononuclear infiltrates of varying sizes were
found in the pancreatic islets of RIPCCL2, RIPCCL21, and RIPCXCL13
transgenic mice (Fig. 9.2 A to C; data not shown). M3 coexpressed with
CCL2 in pancreatic islets (RIP-M3/CCL2 line 251), inhibited CCL2-
induced accumulation of mononuclear cells (Fig. 9.2D). A similar effect
was observed when M3 was coexpressed with CCL21 in transgenic islets
( Jensen et al., 2003). This blockade was less pronounced in the presence of
higher levels of CCL2 (RIPM3/CCL2 line 254, Fig. 9.2E); while the
center of the islets appeared less infiltrated in RIPM3/CCL2 than in RIP-
CCL2 line 254 animals, both the number of islets presenting periislet
infiltrates and the size of these infiltrates were similar between these
M3 and Transgenic Mice 199

A RIP-CCL2 line 251 B RIP-CCL2 line 254 C RIP-CXCL13

D RIP-M3/CCL2 line 251 E RIP-M3/CCL2 line 254 F RIP-M3/CXCL13

Insulin/CD45

Figure 9.2 Expression of M3 in b cells blocks migration of mononuclear cells induced


by CCL2 and CXCL13. (A^F) Representative immunostaining for CD45 (red) and insulin
(green) in pancreata of RIP-CCL2 (line 251 A and line 254 B), RIP-CXCL13 (C), RIP-M3/
CCL2 (line 251 D and line 254 E), and RIP-M3/CXCL13 transgenic mice.

two groups. We presume that the recruitment of cells into the perivascular
space was due to the increased amount of CCL2 produced by the islets of
animals in line 254. When coexpressed with CXCL13 or CCL21 in
pancreatic islets, M3 inhibited CXCL13- and CCL21-induced accumula-
tion of mononuclear cells (Fig. 9.2F, data not shown). The number of islets
infiltrated and the total number of cells per islet were significantly reduced
in each case. Furthermore, M3 expression disturbed the organization of the
infiltrates promoted by CXCL13 and CCL21 expression. The lymphocytes
did not segregate in specific areas, and tended to accumulate in the periph-
ery of the islets or closer to the ducts. Taken together these results indicate
that expression of M3 in pancreatic islets blocks the accumulation of
mononuclear cells induced by the ectopic expression of CCL2, CCL21,
and CXCL13, and that this effect is less pronounced in RIP-M3/CCL2
mice expressing higher levels of CCL2 in the pancreas.

4. M3 Expression in b Cells Blocks


Cellular Infiltration and Prevents
Diabetes Development
Type 1 diabetes is an autoimmune disease characterized by a local
inflammatory reaction in and around islets that is followed by selective
destruction of insulin-secreting b cells (Foulis, 1987). Factors leading to
200 Sergio A. Lira et al.

the destruction of the islets are still not known, but it is well accepted
that immune-based mechanisms involving macrophages and T cells are
responsible for the death of the b cells (Adorini et al., 2002; Yoon et al.,
1998). We tested the hypothesis that M3 could block chemokine function,
infiltration of islets and diabetes development using two different models:
multiple low doses of streptozotocin (MLDS) and the non-obese diabetic
(NOD) mouse. The MLDS model is a widely used model that has clinical
and histoimmunological features similar to those of human disease, with
T cells and macrophages playing a major pathogenic role (Elliott et al.,
1997). When administered in animals at multiple low doses, b-cell toxin
streptozotocin (STZ) alkylates the DNA in islet cells (Like and Rossini,
1976) and promotes release of nitric oxide (Kwon et al., 1994). Subse-
quently, as a result of a novel b-cell antigen expression, mononuclear cells
that infiltrate the islets start a multifactorial process (Kolb-Bachofen and
Kolb, 1989) resulting in the expansion of pathological response from a
‘‘mini-autoimmune response’’ into chronic immune-mediated disease.
We have previously shown that only CCL20 and CCL19 were expressed
at low levels in pancreatic islets of control mice prior to MLDS treatment
(Martin et al., 2007). However, MLDS treatment induced high expression
of several chemokines, including CXCL9, CXCL10, and CCL2, prior to
the onset of diabetes (Martin et al., 2007). To induce diabetes, mice (6 to 10
weeks of age) were injected IP with STZ (40 mg/kg freshly dissolved in
cold 0.1 M citrate buffer, pH 4.5; Calbiochem, EMD Biosciences, San
Diego, CA) for 5 consecutive days as previously described (Flodstrom
et al., 1999). The blood glucose was monitored weekly over the following
35 or 70 days using a one-touch blood Ascensia Elite XL glucometer
(Bayer, Elkhart, IN). Animals were considered diabetic when their blood
glucose levels were greater than 250 mg/dl in two consecutive daily
measurements. Mice in the control group received a corresponding volume
of sodium citrate buffer alone. Four weeks after the beginning of treatment
85% of the control mice treated with MLDS were diabetic, but only 35% of
the RIP-M3 tg/wt mice and, remarkably, none of the homozygous RIP-
M3 mice were diabetic. After 70 days, all control mice were diabetic, but
only 60% of heterozygous mice and none of the homozygous RIP-M3
mice developed disease (n ¼ 5 per group) (Fig. 9.3A).
To study the cellular changes promoted by STZ treatment, we
performed semiquantitative analysis on insulin/CD45-stained sections,
assessing 20 to 80 islets per animal. Three grades of infiltration were based
on the number of CD45-positive cells in or around the islet: grade 1 (10 to
20 cells), grade 2 (20 to 50 cells) and grade 3 (>50 cells). At least 20 sections
were evaluated per mouse and per day in a blinded fashion. Mice (n ¼ 3 per
group) were treated with MLDS and were sacrificed at 7, 14, and 21 days
after the first injection. Infiltration of CD45þ cells into the islets of control
mice was first seen on day 7 and the number of inflammatory cells and
M3 and Transgenic Mice 201

A B 100
100 wt

Infiltrated islets (%)


80 RIP-M3 tg/wt
Diabetes free (%)

80
RIP-M3 tg/tg
60 60

40 WT 40
RIP-M3 tg/wt
20 20
RIP-M3 tg/tg
0 0
0 7 14 21 28 0 7 14 21
Days Days
C D
100 100
Diabetes free (%)

Infiltrated islets (%)


80 75
60
50 *
40 p = 0.004
NOD 25
20
NOD-M3
0 0
0 5 10 15 20 25 NOD NOD-M3
Age (weeks)

Figure 9.3 Expression of M3 in b cells of NOD mice blocks development of diabetes.


(A) Diabetes incidence in animals treated with multiple low doses of STZ. (B)
Semiquantitative analysis of islet infiltrates in pancreas from control and RIP-M3 mice,
before (day 0) and after (days 7,14, and 21) MLDS treatment. (C) Cumulative incidence
of diabetes in NOD nontransgenic littermates (n ¼ 61) and NOD-M3 (n ¼ 66) mice.
(D) Insulitis score of pancreata from NOD and NOD-M3 mice at 10 weeks of age
(n ¼ 5/group).

frequency of infiltrated islets increased thereafter. By day 21, most control


islets were infiltrated by mononuclear cells and had lost normal morpho-
logic integrity. In contrast, a small number of infiltrating cells was found in
RIP-M3 tg/wt mice only after 21 days of treatment, and the morphological
appearance of the islets was normal. None of the homozygous RIP-M3
mice showed infiltrating cells 21 days after STZ treatment (Fig. 9.3B).
NOD mice develop autoimmunity in several organs, in particular
against insulin-producing cells of the pancreas, leading to type 1 diabetes
(Atkinson and Wilson, 2002). Along with others, we have shown that
chemokine expression precedes development of diabetes (Bouma et al.,
2005; Cardozo et al., 2003; Morimoto et al., 2004). Prediabetic NOD islets
expressed inflammatory (CCL1, CCL3, CCL4, CCL22, CCL24, CXCL9,
and CXCL10) as well as homeostatic chemokines (CCL21) (Martin et al.,
2008). To test the hypothesis that M3 can block chemokine function and
202 Sergio A. Lira et al.

prevent diabetes in an autoimmune environment, we backcrossed RIP-M3


mice onto the NOD background. N11 female NOD-M3 and their NOD
littermates were monitored weekly for the development of hyperglycemia
using a one-touch blood Ascensia Elite XL glucometer (Bayer, Elkhart,
IN). Animals were considered diabetic when their blood glucose levels
were greater than 250 mg/dl in two consecutive daily measurements. By
45 weeks of age, more than 80% of the NOD female mice (n ¼ 61) were
diabetic. However, expression of M3 in islets of NOD-M3 (n ¼ 66)
completely abrogated the development of diabetes (Fig. 9.3C).
To investigate the effect of M3 expression by b cells on insulitis, we
examined pancreata from NOD and NOD-M3 female mice at 10 weeks of
age (n ¼ 5 per group). Insulitis was scored as follows: grade 0, no lesions;
grade 1, periinsular leukocytic aggregates, usually periductal infiltrates;
grade 2, less than 25% islet destruction; and grade 3, more than 25% islet
destruction. Semiquantitative analysis of islet infiltrates showed that, as
expected, most (95%) islets from NOD nondiabetic mice had periinsulitis,
and in some cases developed a destructive inflammatory infiltrate, with
marked loss of b-cell mass. In contrast, islets from NOD-M3 mice were
virtually devoid of infiltrating cells and showed a normal complement of
insulin-producing cells (Fig. 9.3D).
Overall, these findings indicate that b-cell expression of M3 prevents
islet mononuclear infiltration and diabetes development in NOD mice and
after STZ treatment. Our results suggest that the use of a chemokine
receptor antagonist that can block multiple receptors like M3 may be a
viable strategy to ameliorate autoimmune diabetes.

5. Generation of a Conditional Transgenic


System for Expression of M3
Conventional transgenic approaches have proven to be useful in
defining the functional role of M3 in blocking chemokine functions.
However, constitutive over expression of M3 does not mimic the potential
therapeutic use of M3 as a chemokine blocker. To examine the usefulness of
M3 as therapeutic agent, we took advantage of a tetracycline-dependent
gene expression system (Gossen and Bujard, 1992).
To generate transgenic mice in which expression of M3 could be
induced conditionally, we used the tetracycline-dependent gene expression
system originally described by Gossen and Bujard (1992). In this bi-genic
system the tet-activator protein (rtTA) is expressed constitutively from the
‘‘activator’’ transgene (Fig. 9.4). In the presence of the tetracycline analogue
doxycycline, the rtTA protein binds to a tetracycline-responsive promoter
element (TRE) present on a ‘‘reporter’’ transgene, and induces expression
M3 and Transgenic Mice 203

CMV promoter rtTA b-globin p(A)

SV40 p(A) M3 TRE LacZ b-globin p(A)

Figure 9.4 Transgenic system for conditional expression of M3.The system consists of
an activator transgene that encodes the transcriptional activator rtTA and a responder
transgene that encodes M3 and LacZ. In the presence of DOX, rtTA present in tissues
tareted by the CMV/b-actin promoter, binds to a tetracycline responsive element
(TRE) and drives expression of both M3 and lacZ. CMV promoter, CMV enhancer/
chicken b-actin promoter; rtTA, reverse tetracycline-controlled transactivator;
b-globin p(A), rabbit b-globin polyadenylation signal; TRE, tetracycline-responsive
element; SV40 p(A), SV40 polyadenylation signal.

of the transgene(s) of choice. The activator transgene used here is driven by


the CMV enhancer/b-actin promoter, which promotes expression of trans-
genes in multiple tissues.
To generate the responder transgenic mice, a bidirectional responder
transgene was constructed containing the M3 gene and the LacZ gene
encoding b-galactosidase (b-gal) (Fig. 9.4). Nine transgenic founder mice
were generated from which four transgenic lines were derived. No b-gal
activity was detected in frozen sections from kidney, liver, muscle, pancreas,
and spleen of transgenic mice carrying the responder transgene only, indi-
cating that responder transgene expression was silent in the absence of rtTA.
The responder mice were crossed to transgenic animals carrying the
rtTA gene driven by the CMV/b-actin promoter (activator transgene).
These transgenic mice express rtTA in multiple tissues (Wiekowski et al.,
2001). b-gal activity was detected by a chemiluminescence-based assay in
the kidneys of transgenic mice derived from all four double-transgenic
lines examined 48 h after a single IP injection of 500 mg DOX. The line
with the highest level of induction was selected for further analysis. Tissues
from mice receiving DOX were analyzed by histochemical staining.
The highest levels of b-gal activity were noted in the liver and kidney,
with an intermediate level in the heart. As expected, analysis of these tissue
extracts by western blot analysis demonstrated the presence of M3 immuno-
reactivity in DOX-treated animals, but not in their nontreated control
littermates, demonstrating that M3 expression was dependent on DOX
(Pyo et al., 2004).
To determine whether the conditional expression of M3 interfered with a
physiological response, we used the bilateral femoral arterial injury model.
Double transgenic mice received DOX 2 days before injury and daily through
postoperative day 10, or received vehicle only. Arterial injury produced a
substantial expansion of the intima at 4 weeks in vehicle-treated mice, result-
ing in an I/M ratio of 0.9 (0.23). In contrast, DOX treatment resulted
in a 67% reduction in intimal area ( p < 0.01) and a 68% reduction in I/M
204 Sergio A. Lira et al.

ratio (p < 0.05). The data demonstrated that the inducible expression of M3
was able to block bilateral femoral arterial injury (Pyo et al., 2004).

6. Concluding Remarks
Previous work using knockout or transgenic mice has demonstrated
the role of particular chemokines in the recruitment of distinct cell popula-
tions, and their relevance to specific disease processes. These studies
provided the rationale for the development of pharmacological reagents
targeting chemokine receptors. The initial failure of some of these reagents
in clinical trials has prompted a reevaluation of the concept of targeting
specific chemokines or their receptors. Attempts to better define the role of
the chemokine system have thus far included a better description of the
pattern of expression of chemokines during particular disease conditions and
experiments with chemokine blockers with multiple specificities. Using
genetic approaches in mice, we showed that M3 is a powerful tool to
understand chemokine function in vivo. First, we showed that M3 can
block chemokine-induced mobilization of leukocytes in vitro and in vivo
( Jensen et al., 2003). Second, we showed that M3 expression could prevent
development of disease in two different settings: autoimmune diabetes and
bilateral femoral arterial injury (Martin et al., 2007, 2008; Pyo et al., 2004).
In the former studies, M3 was constitutively expressed in the pancreas of
mice and was able to inhibit islet mononuclear infiltration and diabetes
development in NOD mice and after STZ treatment (Martin et al., 2007,
2008). The latter study took advantage of an inducible expression system to
show that M3 could have a therapeutic role (Pyo et al., 2004).
While these results suggest that multichemokine blockade may represent
a superior alternative to single chemokine blockade, the usefulness of this
approach remains to be fully tested vis-à-vis safety and therapeutic delivery.
The therapeutic use of virus-encoded chemokine blockers such as M3, may
be effective in acute conditions, but may be problematic in chronic settings
due to their antigenicity. In this regard, the development of multispecific
oral small molecules may be a superior alternative. The existence of
chemokine-binding proteins in different viruses and even in higher organ-
isms, suggests that chemokine-binding proteins are used to evade the
immune system. It is likely that different chemokine-binding proteins
may have evolved to block sets of chemokines that are relevant during
specific stages of infection. The challenge ahead will be to understand which
chemokine sets are important during the various stages of disease and how
to develop safe and effective strategies to interfere with them.
M3 and Transgenic Mice 205

REFERENCES
Adorini, L., Gregori, S., and Harrison, L. C. (2002). Understanding autoimmune diabetes:
Insights from mouse models. Trends Mol. Med. 8, 31–38.
Alcami, A. (2003a). Structural basis of the herpesvirus M3-chemokine interaction. Trends
Microbiol. 11, 191–192.
Alcami, A. (2003b). Viral mimicry of cytokines, chemokines and their receptors. Nat. Rev.
Immunol. 3, 36–50.
Alexander, J. M., Nelson, C. A., van Berkel, V., Lau, E. K., Studts, J. M., Brett, T. J.,
Speck, S. H., Handel, T. M., Virgin, H. W., and Fremont, D. H. (2002). Structural basis
of chemokine sequestration by a herpesvirus decoy receptor. Cell 111, 343–356.
Atkinson, M. A., and Wilson, S. B. (2002). Fatal attraction: Chemokines and type 1 diabetes.
J. Clin. Invest. 110, 1611–1613.
Bouma, G., Coppens, J. M., Mourits, S., Nikolic, T., Sozzani, S., Drexhage, H. A., and
Versnel, M. A. (2005). Evidence for an enhanced adhesion of DC to fibronectin and a
role of CCL19 and CCL21 in the accumulation of DC around the pre-diabetic islets in
NOD mice. Eur J. Immunol. 35, 2386–2396.
Cardozo, A. K., Proost, P., Gysemans, C., Chen, M. C., Mathieu, C., and Eizirik, D. L.
(2003). IL-1beta and IFN-gamma induce the expression of diverse chemokines and
IL-15 in human and rat pancreatic islet cells, and in islets from pre-diabetic NOD
mice. Diabetologia 46, 255–266.
Chen, S. C., Vassileva, G., Kinsley, D., Holzmann, S., Manfra, D., Wiekowski, M. T.,
Romani, N., and Lira, S. A. (2002). Ectopic expression of the murine chemokines
CCL21a and CCL21b induces the formation of lymph node-like structures in pancreas,
but not skin, of transgenic mice. J. Immunol. 168, 1001–1008.
Cinamon, G., Shinder, V., and Alon, R. (2001). Shear forces promote lymphocyte migra-
tion across vascular endothelium bearing apical chemokines. Nat. Immunol. 2, 515–522.
Eizirik, D. L., Korbutt, G. S., and Hellerstrom, C. (1992). Prolonged exposure of human
pancreatic islets to high glucose concentrations in vitro impairs the beta-cell function.
J. Clin. Invest. 90, 1263–1268.
Elliott, J. I., Dewchand, H., and Altmann, D. M. (1997). Streptozotocin-induced diabetes in
mice lacking alphabeta T cells. Clin. Exp. Immunol. 109, 116–120.
Flodstrom, M., Tyrberg, B., Eizirik, D. L., and Sandler, S. (1999). Reduced sensitivity of
inducible nitric oxide synthase-deficient mice to multiple low-dose streptozotocin-
induced diabetes. Diabetes 48, 706–713.
Foulis, A. K., Oakley, C. L. (1987). The pathogenesis of beta cell destruction in type I
(insulin-dependent) diabetes mellitus. J. Pathol. 152, 141–148.
Fuentes, M. E., Durham, S. K., Swerdel, M. R., Lewin, A. C., Barton, D. S., Megill, J. R.,
Bravo, R., and Lira, S. A. (1995). Controlled recruitment of monocytes and macrophages
to specific organs through transgenic expression of monocyte chemoattractant protein-1.
J. Immunol. 155, 5769–5776.
Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547–5551.
Gotoh, M., Maki, T., Kiyoizumi, T., Satomi, S., and Monaco, A. P. (1985). An improved
method for isolation of mouse pancreatic islets. Transplantation 40, 437–438.
Grewal, I. S., Grewal, K. D., Wong, F. S., Picarella, D. E., Janeway, C. A. Jr., and
Flavell, R. A. (1996). Local expression of transgene encoded TNF alpha in islets prevents
autoimmune diabetes in nonobese diabetic (NOD) mice by preventing the development
of auto-reactive islet-specific T cells. J. Exp. Med. 184, 1963–1974.
Hogan, B., Constantini, F., and Lacy, L. (1986). ‘‘Manipulating the mouse embryo.’’ Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
206 Sergio A. Lira et al.

Jensen, K. K., Chen, S. C., Hipkin, R. W., Wiekowski, M. T., Schwarz, M. A.,
Chou, C. C., Simas, J. P., Alcami, A., and Lira, S. A. (2003). Disruption of CCL21-
induced chemotaxis in vitro and in vivo by M3, a chemokine-binding protein encoded by
murine gammaherpesvirus 68. J. Virol. 77, 624–630.
Kolb-Bachofen, V., and Kolb, H. (1989). A role for macrophages in the pathogenesis of type 1
diabetes. Autoimmunity 3, 145–154.
Kwon, N. S., Lee, S. H., Choi, C. S., Kho, T., and Lee, H. S. (1994). Nitric oxide
generation from streptozotocin. FASEB J. 8, 529–533.
Like, A. A., and Rossini, A. A. (1976). Streptozotocin-induced pancreatic insulitis: New
model of diabetes mellitus. Science 193, 415–417.
Luther, S. A., Bidgol, A., Hargreaves, D. C., Schmidt, A., Xu, Y., Paniyadi, J.,
Matloubian, M., and Cyster, J. G. (2002). Differing activities of homeostatic chemokines
CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and
lymphoid neogenesis. J. Immunol. 169, 424–433.
Luther, S. A., Lopez, T., Bai, W., Hanahan, D., and Cyster, J. G. (2000). BLC expression in
pancreatic islets causes B cell recruitment and lymphotoxin-dependent lymphoid
neogenesis. Immunity 12, 471–481.
Martin, A. P., Alexander-Brett, J. M., Canasto-Chibuque, C., Garin, A., Bromberg, J. S.,
Fremont, D. H., and Lira, S. A. (2007). The chemokine binding protein M3 prevents
diabetes induced by multiple low doses of streptozotocin. J. Immunol. 178, 4623–4631.
Martin, A. P., Canasto-Chibuque, C., Shang, L., Rollins, B. J., and Lira, S. A. (2006). The
chemokine decoy receptor M3 blocks CC chemokine ligand 2 and CXC chemokine
ligand 13 function in vivo. J. Immunol. 177, 7296–7302.
Martin, A. P., Coronel, E. C., Sano, G., Chen, S. C., Vassileva, G., Canasto-Chibuque, C.,
Sedgwick, J. D., Frenette, P. S., Lipp, M., Furtado, G. C., and Lira, S. A. (2004). A novel
model for lymphocytic infiltration of the thyroid gland generated by transgenic
expression of the CC chemokine CCL21. J. Immunol. 173, 4791–4798.
Martin, A. P., Grisotto, M. G., Canasto-Chibuque, C., Kunkel, S. L., Bromberg, J. S.,
Furtado, G. C., and Lira, S. A. (2008). Islet expression of M3 uncovers a key role for
chemokines in the development and recruitment of diabetogenic cells in NOD mice.
Diabetes 57, 387–394.
Morimoto, J., Yoneyama, H., Shimada, A., Shigihara, T., Yamada, S., Oikawa, Y.,
Matsushima, K., Saruta, T., and Narumi, S. (2004). CXC chemokine ligand 10 neutrali-
zation suppresses the occurrence of diabetes in nonobese diabetic mice through enhanced
beta cell proliferation without affecting insulitis. J. Immunol. 173, 7017–7024.
Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., and Nishimune, Y. (1997). ‘‘Green
mice’’ as a source of ubiquitous green cells. FEBS Lett. 407, 313–319.
Parry, C. M., Simas, J. P., Smith, V. P., Stewart, C. A., Minson, A. C., Efstathiou, S., and
Alcami, A. (2000). A broad spectrum secreted chemokine binding protein encoded by a
herpesvirus. J. Exp. Med. 191, 573–578.
Proudfoot, A. E., Handel, T. M., Johnson, Z., Lau, E. K., LiWang, P., Clark-Lewis, I.,
Borlat, F., Wells, T. N., and Kosco-Vilbois, M. H. (2003). Glycosaminoglycan binding
and oligomerization are essential for the in vivo activity of certain chemokines. Proc. Natl.
Acad. Sci. USA 100, 1885–1890.
Pyo, R., Jensen, K. K., Wiekowski, M. T., Manfra, D., Alcami, A., Taubman, M. B., and
Lira, S. A. (2004). Inhibition of intimal hyperplasia in transgenic mice conditionally
expressing the chemokine-binding protein M3. Am. J. Pathol. 164, 2289–2297.
Rot, A. (1992). Endothelial cell binding of NAP-1/IL-8: Role in neutrophil emigration.
Immunol. Today 13, 291–294.
van Berkel, V., Barrett, J., Tiffany, H. L., Fremont, D. H., Murphy, P. M., McFadden, G.,
Speck, S. H., and Virgin, H. I. (2000). Identification of a gammaherpesvirus selective
chemokine binding protein that inhibits chemokine action. J. Virol. 74, 6741–6747.
M3 and Transgenic Mice 207

Wiekowski, M. T., Chen, S. C., Zalamea, P., Wilburn, B. P., Kinsley, D. J., Sharif, W. W.,
Jensen, K. K., Hedrick, J. A., Manfra, D., and Lira, S. A. (2001). Disruption of neutrophil
migration in a conditional transgenic model: Evidence for CXCR2 desensitization
in vivo. J. Immunol. 167, 7102–7110.
Yang, T. Y., Chen, S. C., Leach, M. W., Manfra, D., Homey, B., Wiekowski, M.,
Sullivan, L., Jenh, C. H., Narula, S. K., Chensue, S. W., and Lira, S. A. (2000).
Transgenic expression of the chemokine receptor encoded by human herpesvirus
8 induces an angioproliferative disease resembling Kaposi’s sarcoma. J. Exp. Med. 191,
445–454 (see comments).
Yoon, J. W., Jun, H. S., and Santamaria, P. (1998). Cellular and molecular mechanisms for
the initiation and progression of beta cell destruction resulting from the collaboration
between macrophages and T cells. Autoimmunity 27, 109–122.
C H A P T E R T E N

M-T7: Measuring
Chemokine-Modulating Activity
Mee Y. Bartee,*,†,‡ Erbin Dai,† Liying Liu,†
Ganesh Munuswamy-Ramanujam,*,†,‡ Colin Macaulay,*
Dana McIvor,* Grant McFadden,‡ and Alexandra R. Lucas*,†,‡

Contents
1. Introduction 210
1.1. Chemokine–glycosaminoglycan interaction 210
1.2. Discovery and identification of the M-T7 gene 211
1.3. M-T7 inhibits inflammation and vasculopathic
disease in animal models 213
2. Protein Expression 213
2.1. Generation of viral constructs 213
2.2. Purification of M-T7 215
3. Quantifying the Effects of M-T7 In Vitro and Ex Vivo 216
3.1. Cell adhesion 216
3.2. Membrane fluidity 217
3.3. Ascites assay 219
4. Quantifying the Effects of M-T7 on Vascular Inflammatory
Responses in Rodent Vascular Transplant Models 220
4.1. Aortic transplant model 220
4.2. Tissue staining 223
4.3. Morphometric analysis of aortic plaque area 224
4.4. Statistics 225
5. Preclinical Toxicity Testing 225
References 227

Abstract
Chemokines are important for activation of a host of cellular immune and
inflammatory responses including cell signaling, activation, and communication.
M-T7, a myxoma virus protein, inhibits the activity of chemokines by direct
binding to chemokines and/or with glycosaminoglycans (GAGs). To study the
effects of this chemokine-modulating protein (CMP), we use a variety of in vitro
* Division of Cardiovascular Medicine, University of Florida, Gainesville, Florida, USA
{
Department of Medicine, University of Florida, Gainesville, Florida, USA
{
Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05210-0 All rights reserved.

209
210 Mee Y. Bartee et al.

and in vivo techniques to evaluate M-T7 inhibition of inflammatory cells. To


quickly analyze the effects of M-T7, changes in cell adhesion and membrane
fluidity are measured as well as cell migration in mouse ascites. For more
physiological analyses, an aortic transplant model in rodents is used to assess
change in inflammatory cell infiltrates and vascular plaque growth (rejection).
Utilization of the combination of these in vitro and in vivo techniques allows for
a more complete study of the chemokine-modulating activity of M-T7, and can
be used to study other immune and inflammation-modulating proteins.

1. Introduction
1.1. Chemokine–glycosaminoglycan interaction
Chemokines are small 8 to 12 kDa proteins that attract cells of the inflam-
matory and immune response systems into arteries and tissues in reaction to
damage or pathogen invasion ( Weber et al., 2004). These small chemoat-
tractant proteins create a gradient along connective tissue and cell layers by
binding to highly charged, sulfated, polysaccharide chains of glycosamino-
glycans (GAGs). Increasing concentrations of chemokines bound to GAGs
form this gradient, also termed an ‘‘array,’’ which directs cell taxis. Once
bound to GAGs, exposed chemokine domains interact with G-protein–
coupled receptors (GPCRs) to direct trafficking of cells in the innate and
acquired immune response systems (Parish, 2005). While the chemokine–
receptor interaction is reported to have wide overlap between receptor
recognition and chemokine classes, that is, to be a nonspecific and promis-
cuous interaction, the secondary requirement for chemokine binding to
tissue GAGs is now postulated to increase the specificity of cell to chemo-
kine and receptor interactions.
The chemokine–GPCR interaction has long been known to modify
cellular activation responses, but only recently has it been reported that
chemokine–GAG binding also modifies immune cellular responses
( Johnson et al., 2004a,b; Proudfoot et al., 2003). GAGs have the capacity
to alter cellular adhesion through binding to selectins, adhesion molecules,
chemokines, and growth factors (Forsberg and Kjellen, 2001). GAGs are
also reported to alter activation of serine proteases and serpins in the
coagulation cascades. There are extensive layers of both cell surface and
connective tissue-associated GAGs, the dominant GAG being heparan
sulfate (HS). Tissue and arterial GAGs include heparan sulfate, hyaluronan,
chondroitin sulfate, dermatan sulfate, and keratan sulfate.
GAGs can exist as free molecules or bound to proteins to form proteo-
glycans with chain lengths that vary from 1 up to 25,000 disaccharide units.
GAGs are highly varied and are defined by disaccharide sequences, which
are modified by acetylation and/or N and O sulfation as introduced by
M-T7: Measuring Chemokine-Modulating Activity 211

enzyme reactions. Of marked interest, some GAGs and proteoglycans bind


to the cell surface and can interact with membrane proteins with the
potential to alter cell-signaling pathways and activation. The interactions
of GAGs with cells are capable of markedly altering innate and adaptive
immune cell responses.
Upwards of 50 chemokines and 20 receptors are classified into four
classes defined by C-terminal cysteine residues (C, CC, CXC, and
CX3C) with the CC class reported as more selective for monocytes and
lymphocytes and the CXC class for neutrophils. However, there is exten-
sive redundancy in the chemokine interaction with cells and cell surface
receptors (Allen et al., 2007). Chemokines recognize and bind specific GAG
species based on the structure, which is varied even within the same type of
GAG, and charge, which is highly negative. This chemokine–GAG inter-
action is now believed to introduce an additional layer of complexity.
The combination of chemokine–GAG and chemokine–GPCR selec-
tivity is postulated to increase the specificity of chemokine activity (Allen
et al., 2007; Handel et al., 2005; Johnson et al., 2004b) through the required
dual interaction of chemokines with both selected GAGs and selected
receptors. Although current understanding of chemokine–GAG interac-
tions is incomplete, this interaction is proving to play a pivotal role in
cellular mobilization, recognition, and activation.

1.2. Discovery and identification of the M-T7 gene


M-T7 was initially identified as an interferon-gamma receptor (IFN-gR)
homologue that is secreted by the highly lethal rabbit poxvirus, myxoma
virus (Upton et al., 1992). The M-T7 gene is encoded in the terminal
inverted repeat region of the myxoma genome, and is the seventh open-
reading frame (Fig. 10.1A). When M-T7 is expressed in an intact virus,
mortality of European rabbits is very high. When the gene is deleted in
myxoma virus, a more benign infection with much reduced morbidity and
mortality in rabbits results (Upton et al., 1992). Many viral genes have
evolved to express proteins, working at very low concentrations, postulated
to be in the femtomolar range, which effectively support viral growth and
block host immune defense assaults. During this evolution, these immune-
modulating proteins have developed secondary and tertiary functions,
expanding the viral armamentarium (Mossman et al., 1995, 1996).
In an innovative study, Lalani and McFadden (Lalani et al., 1998)
discovered that this M-T7 IFNgR homologue binds to chemokines as a
secondary function. In this study, M-T7 was reported to bind a wide range
of chemokines including mouse, rat, and human C, CC, and CXC
chemokines. Binding to IFNg was conversely species-specific and limited
to rabbits alone (Mossman et al., 1995). Of greater interest, M-T7 interac-
tion with chemokines is postulated to block binding of chemokines to
212 Mee Y. Bartee et al.

A B M-T7
pDONR221

M-T
FP 7-H
eG is6x

pFastBacDual

BV BV

BV

Figure 10.1 M-T7 sequence and cloning: M-T7 is a chemokine-modulating protein


with a sequence homology to rabbit IFN-g. (A) Model of M-T7 generated in SWISS-
MODEL workspace and the amino acid sequence of the protein. (B) Protein was
expressed using a baculovirus-mediated expression system. First, the M-T7 cDNA con-
struct in pDONR221 was used as a template for generating a C-terminal His tag con-
struct by PCR. This PCR product was cloned into pFastBacDual-eGFP, an insect
expression vector.This plasmid construct was shuttled through DH10Bac cells for trans-
position of M-T7 and eGFP into a bacmid. Bacmids were purified and transfected into
Sf 21 cells for generation of baculovirus expressing M-T7-His6x. (Panel A from Arnold,
K., Bordoli, L., Kopp, J., and Schwede, T. (2006). The SWISS-MODEL workspace:
A web-based environment for protein structure homology modelling. Bioinformatics
22, 195^201; Kopp, J., and Schwede,T. (2004). The SWISS-MODEL repository of anno-
tated three-dimensional protein structure homology models. Nucleic Acids Res. 32,
D230^D234; and Schwede, T., Kopp, J., Guex, N., and Peitsch, M. C. (2003). SWISS-
MODEL: An automated protein homology^modeling server. Nucleic Acids Res. 31,
3381^3385.)

GAGs, providing a mechanism that effectively prevents formation of a


chemokine–GAG gradient, and thus reducing inflammatory cell invasion.
This M-T7 function represents a unique inhibitory mechanism targeting
a different domain in chemokines. Rather than interference of chemokine–
GPCR binding, M-T7 is postulated to reduce chemokine–GAG interac-
tion. Other groups have created a series of chemokine mutants that lack
GAG-binding epitopes and which have the capacity to inhibit chemokine-
mediated inflammatory cell migration ( Johnson et al., 2004a). This novel
chemokine-inhibitory action is evolutionarily advantageous for myxoma
virus. Expression of chemokine inhibitors (CMPs) that target both the
GPCR and GAG binding domains, in addition to blocking IFNg activity
in rabbits, allows myxoma virus to efficiently downregulate the immune
response. Of further benefit, these unique viral proteins have potential as
new immunomodulatory therapeutic agents (Seet et al., 2001).
M-T7: Measuring Chemokine-Modulating Activity 213

1.3. M-T7 inhibits inflammation and vasculopathic


disease in animal models
In an initial study of inflammatory vasculopathic disease, the Lucas labora-
tory contrasted the ability of M-T7 to inhibit arterial inflammation and
atherosclerotic plaque growth after balloon angioplasty injury in rabbit and
rat models. Equivalent reductions in inflammatory cell invasion and plaque
growth were detected in rabbit and rat models with M-T7 treatment. While
the rabbit model might reflect M-T7–mediated blockade of IFNg, as well as
inhibition of chemokine gradient formation, the IFNg homologue function
is specific to rabbits. The inhibition of plaque in rats is thus believed to be
due to interruption of chemokine-mediated activation of inflammatory cell
responses (Liu et al., 2000). In subsequent work, M-T7 has also been
demonstrated to reduce inflammation and plaque growth in rat aortic
transplant models 4 weeks after a single intravenous injection of nanogram
doses of M-T7. Inhibition of monocyte and T-cell infiltration into the
vessel wall was reversed in part through simultaneous infusions of selected
chemokines (Liu et al., 2004). A study in the Zhong laboratory (Bedard
et al., 2003) subsequently confirmed reduction of chronic rejection and
vasculopathy in a rat renal allograft transplant model at 5 months follow-up
after an initial 10-day course of M-T7 treatments. In this paper, we present
techniques used for expression and analysis of the chemokine-inhibitory
function of M-T7 in both in vivo and in vitro systems.

2. Protein Expression
2.1. Generation of viral constructs
Expression of some of the myxoma viral gene products has been unsuccessful
in conventional bacterial protein expression systems. Exact mechanistic
reasons are unknown, but protein folding and glycosylation may be
contributing factors. Since the functionality of M-T7 is not easily tested,
we selected an expression system that has been proven successful for expres-
sion of another myxoma virus protein, Serp-1. A baculovirus-mediated
expression system in Sf 21 (Spodoptera frugiperda) (Invitrogen) and High
Five (Trichoplusia ni ) (Invitrogen) cells was used for the expression and
purification of M-T7. M-T7 has also been expressed in a Chinese hamster
ovary (Weber et al., 2004) mammalian cell system, but we will describe the
baculoviral expression here.
To generate the virus, a C-terminal His–tagged construct was cloned
into a pFastBacDual (Invitrogen) expression vector containing an eGFP
(enhanced green fluorescent protein) reporter driven by the p10 promoter.
The reporter gene is important for selection of foci containing the M-T7
214 Mee Y. Bartee et al.

expressing virus. Sf 21 cells were used to generate the M-T7 baculovirus.


The doubling time of Sf 21 cells is 24 h as opposed to 72 h for Sf 9 cells,
another commonly used insect expression cell line, which means that Sf 21
cells have the advantage of being expanded more rapidly.
Bacmids (baculovirus shuttle vector) are generated in DH10Bac (Invi-
trogen) cells by transforming with the pFastBacDual construct (Fig. 10.1B).
Colonies are screened using blue/white colony screening by spreading
100 ml of 100 mM IPTG (isopropyl-beta-D-thiogalactopyranoside) and
40 ml of 20mg/ml X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyra-
noside) onto selection plates (LB plates with 50 mg/ml kanamycin, 10 mg/ml
tetracycline, 7 mg/ml gentamicin). Purification of bacmids can be done
with standard DNA purification kits such as QIAprep Spin Miniprep Kit
(Qiagen). However, due to the size of the bacmid, 150 kb, we use 100 ml
of elution buffer heated to 50  C to facilitate elution off the spin column.
Incorporation of M-T7 is verified by PCR (polymerase chain reaction)
analysis of the bacmid.
Antibiotics may be used in Sf-900 II SFM media (Invitrogen), but for
the transfection reaction, the media should not contain any, just as in
mammalian transfection reactions. Sf 21 cells are seeded onto six-well tissue
culture plates in 1 Grace’s Insect Media (Invitrogen) at 1  106 cells/ml
for a total of 2 ml (1 h before transfection) to allow the cells to adhere. One
to two micrograms of DNA are preincubated in 100 ml of 1 Grace’s Insect
Media in one tube and 6 ml of Cellfectin II (Invitrogen) reagent with 100 ml
of 1 Grace’s Insect Media in another tube. This is incubated in the hood
for 15 min before the DNA and Cellfectin II containing reagents are mixed
together for 30 min at room temperature (RT). The transfection reaction
mixture needs to be brought up to a final volume of 1 ml with 1 Grace’s
Insect Media. Before adding the mixture to cells, cells have to be washed in
1 Grace’s Insect Media and then aspirated. The transfected cells should be
incubated at 27  C for 5 h before replacement of the transfection reagent
with Sf-900 II SFM. Two days after transfection, foci of eGFP expressing
cells should begin to be visible, and at 72 h, baculovirus-expressing M-T7
can be harvested from the media.
The collected viral supernatant can be used to infect Sf 21 cells for
further amplification of the virus stock. To determine the viral titer of the
construct, a viral plaque assay can be performed. Two milliliters of 5  105
Sf 21 cells/ml can be seeded onto six-well plates and allowed to adhere for
1 h on a flat surface for even cell distribution.
A serial dilution of the viral stock in Sf-900 II SFM media is then set up
with a final plating volume of 1 ml per well. The media from the plated cells
is replaced with the diluted virus and incubated for 1 h at RT. In the
meantime, 10 ml of melted sterile, 4% plating agarose should be mixed with
30 ml of 1.3X Sf-900 (Invitrogen) media and placed in a 37  C water bath.
Virus must be removed quickly from the six-well plates (beginning with
M-T7: Measuring Chemokine-Modulating Activity 215

high to low concentrations) and then 2 ml of the agarose mixture should


be added. The agarose should harden in 15 min. Plates are placed in a
container with wet paper towels on the bottom to prevent the plates
from drying out. Care needs to be taken not to disturb the monolayer of
cells. Incubate in a 27  C incubator for 4 to 10 days. Formation of viral foci
should be observed daily on the microscope for the appearance of green
fluorescent foci. When no new foci form on 2 consecutive days, then
viral titer can be calculated based on the number of foci in the well with
the most diluted virus. Virus will need to be amplified by infecting suspen-
sion cultures of Sf 21 cells at MOIs (multiplicity of infection) of 0.001 to
0.005 for 24 h and then harvesting virus by spinning down the cells and
collecting the virus-containing supernatant. Baculovirus can be stored at
4  C for active use of the virus; however, for long-term storage, freezer
stocks should be made.

2.2. Purification of M-T7


M-T7 protein can be expressed in suspension cultures of High Five insect
cells. Cells seeded at 1  106 cells/ml are infected with baculovirus contain-
ing the M-T7 gene construct at an MOI of 1 and grown in culture for 24 to
72 h before collection of secreted protein from the media. We express a
C-terminal His–tagged construct of M-T7. To purify the protein from
the media, M-T7 is concentrated using a 10 kDa cutoff filter, Amicon
Ultra (Millipore), and buffer exchanged in 50 mM NaH2PO4 þ 300 mM
NaCl þ 10 mM imidazole, pH 8.0, with Snakeskin 10 kDa cut-off dialysis
tubing (Pierce).
A two-step method is used to purify M-T7, first on Ni-NTA (nickel-
nitrilo-triacetic acid) (Qiagen). The buffer-exchanged supernatant is first
centrifuged to remove any particulates in the sample. The supernatant is
added to pre-equilibrated Ni-NTA slurry (50 mM NaH2PO4 þ 300 mM
NaCl þ 10 mM imidazole, pH 8.0), and allowed to mix overnight at 4  C.
The slurry is added to a column the next day, and allowed to flow through
by gravity. The samples are then washed in 50 mM NaH2PO4 þ 300 mM
NaCl þ 20 mM imidazole, pH 8.0, and eluted with 50 mM NaH2PO4 þ
300 mM NaCl þ 250 mM imidazole pH 8.0 in three 3 ml elution fractions.
The elution fractions are further concentrated with a 10 kDa molecular-
weight cut-off Amicon Ultra centrifugal filters (Millipore), and buffer
equilibrated with 50 mM Tris þ 150 mM NaCl, pH 8. These samples are
further purified by size exclusion chromatography, which separates the
proteins by molecular mass. Fractions are loaded onto a HiLoad 16/60
Superdex 75 (GE Healthcare) FPLC (fine-pressure liquid chromatography)
column, and fractions are collected. Protein purity is verified by running
the samples on SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel
216 Mee Y. Bartee et al.

electrophoresis) and gels stained with Coomassie stain. Samples used for
in vivo experiments are kept under sterile conditions after filtration through
a 0.22 micron filter.

3. Quantifying the Effects of M-T7


In Vitro and Ex Vivo
M-T7 has been shown to be a chemokine-modulating protein
(CMP). To understand how this CMP affects inflammatory cells, changes
in cellular responses to M-T7 treatment can be measured both in vitro and
in vivo. Cell adhesion and membrane fluidity are established assays that
monitor cellular activation in vitro, whereas in vivo cell migration using a
peritoneal ascites assay performed in mice can be measured. Further analysis
by flow cytometry can be conducted ex vivo from the ascites, but will not
be discussed.

3.1. Cell adhesion


The THP-1 (Tamm-Horsfall Protein 1) cell line is a human monocytic cell
line that also possesses some macrophage characteristics. The THP-1 cell
line is used in models for the study of cell activation and migration. During
inflammation, monocytes migrate to the injury site along a chemokine
gradient as described in Section 1. To study how M-T7 affects this pheno-
type, cell adhesion of activated THP-1 cells can be monitored.
THP-1 cells (1  106 cells/ml) are labeled with calcein acetoxymethyl
ester (calcein AM) (1 mg/ml of media) (Invitrogen) for 1 h in media (37  C/
5% CO2/humidified). Calcein AM is a membrane-permeable fluorescent
probe that is taken up by viable cells that provides a cell-labeling marker.
Once the label is intracellular, endogenous esterases modify the compound,
exposing a calcium-binding site. After binding calcium, the calcein AM can
be excited at 495 nm and the intensity of emitted fluorescence measured at
515 nm. Labeling cells with calcein AM is a simple way to measure the
number of adhered cells. Alternatively, if a filter is used in a stacked, two-
well Boyden chamber, then the same calcein fluorescence label can be used
to monitor cell migration through filters, basement membrane layers, or
other cell layers such as endothelium in vitro.
Cells are treated with activators found in normal circulating blood or in
damaged tissues where the inflammatory system is upregulated. The activa-
tors that have been tested in our lab include the following: 50 ng MCP-1,
3 U/ml urokinase plasminogen activator (u-PA) (American Diagnostica),
M-T7: Measuring Chemokine-Modulating Activity 217

1 mg/ml recombinant human tissue plasminogen activator (t-PA) (Hoffmann-


La Roche), 1 U/ml thrombin (Warner-Lambert Canada) or 1 mg/ml
phorbol myristate acetate (PMA) (Sigma-Aldrich Chemicals) for 1 h
(37  C, 5% CO2, humidified). Excess calcein and activators are removed
by washing with PBS (centrifuge at 1200 rpm for 8 min at RT; discard
supernatant). The cells are subsequently resuspended in media at a concentra-
tion of 1  106 cells/ml and aliquoted into tubes. Saline or M-T7 (50 ng to
1 mg) is then added to the cell suspension. One aliquot of cells is set aside for
generation of a standard curve. Cells at a concentration of 1  105 cells per
100 ml are plated on fibronectin or collagen III–coated, black 96-well plates,
and incubated for 1 h (37  C, 5% CO2, humidified). Fibronectin plates
are prepared by incubating a 96-well black plate with 5 mg of fibronectin
in 100 ml of PBS per well for 24 h at 4  C. Collagen plates are prepared by
similarly incubating plates with 1 mg of collagen in 100 ml of PBS per
well for 4 h at 4  C. Uncoated plastic wells can also be used for these assays,
as activated monocyte/macrophage cells will adhere to plastic surfaces. Cell
adhesion and migration can also be performed using endothelial cell layers
using similar assays to assess endothelial and monocyte cell interactions.
After the 1 h incubation, nonadherent cells are removed with two cold
PBS washes. This is a crucial step: the PBS should be cold so as not to strip
off the adhered cells from the plate and the pipetting should be gentle
enough to only remove nonadhered cells. Adherent cells are quantified by
measuring calcein fluorescence using a spectrofluorometer (Thermo Fisher
Scientific, Waltham, MA). To calculate the number of adherent cells, the
fluorescent intensity is compared to a standard. This standard curve is
generated by performing serial dilutions, using the same numbers of cells
for each well, and measuring the fluorescence intensity of the calcein labeled
cells set aside earlier.
As mentioned previously, M-T7 is a chemokine-modulating protein
(CMP). THP-1 cells activated with chemokines or chemical compounds
result in the increased number of adhered cells. The inhibitory effect of
M-T7 on THP-1 activation from chemokines or other activators can be
seen in the change in the number of adhered cells.

3.2. Membrane fluidity


Change in membrane fluidity is a measure of cellular activation. The change
in core rigidity, or conversely fluidity of a membrane can be measured using
1,3-bis-(1-pyrenyl)propane (BPP) (Invitrogen), a fluorescent probe that
crosses into the core lipid bi-layer (Fig. 10.2B). An activated cell has a
more fluid membrane, whereas an unactivated cell is comparatively rigid. In
a fluid membrane, BPP more readily forms a dimer, also termed an excimer
formation (Fig. 10.2). The monomer emits light at a wavelength of 390 nm
while the dimer (excimer) emits light at 485 nm, thus providing a ready
218 Mee Y. Bartee et al.

A B
300
Fluorescence intensity

200 −Saline (Iexc/Imon = 1.69)

100

Dimer Monomer
0 −P PMA(Iexc/Imon = 0.89)

−100
300 400 500 600 700
Wavelength (nm)

Figure 10.2 Membrane fluidity measurement with BPP. BPP is a fluorescent probe
useful for measuring the activation of cells by chemokines.The linker between the two
pyrene rings affects the ‘‘monomer’’ versus ‘‘dimer’’ state of the probe. In unactivated
cells, the lipid bilayer is more rigid, and therefore BPP is less mobile, resulting in a higher
ratio of dimers. In activated cells, the membrane is more fluid, resulting in more mobility
of BPP, and a lower ratio of dimers. In addition to the fluorescence emission at 390 nm of
the monomer, when BPP is a dimer (also termed an excimer), there is an additional
emission at 485 nm.The ratio of the excimer to monomer state can be used to determine
the activated state of cells.

means to distinguish the presence of pyrene monomers and excimers.


The ratio of excimer to monomer signal can be used to determine the
activated state of a cell (Fig. 10.2A).
THP-1 cells are resuspended at a concentration of 1  106 cells/ml
in growth media (RPMI 1640, 10% fetal bovine serum, Pen/Strep, Sigma).
A final concentration of 1 mg/ml BPP (dissolved in DMSO) is added per
1 ml of cells and incubated at 37  C, 5% CO2, humidified, for 3 h. This
incubation time is important because excessive incubation will result in
intracellular BPP, which would give erroneous results. However, too short
of an incubation will lead to inefficient labeling of cells, resulting in a weak
signal and increased signal-to-noise ratio. In our laboratory, we have found
that 3 h seems to be the appropriate time for the BPP to incorporate into the
lipid bi-layer. At the end of the incubation, cells are pelleted (centrifuge cells
at 1200 rpm for 8 min, RT, discard supernatant). Cells are resuspended
in growth media at 1  106 cells/ml and divided into 1 ml aliquots in 1.5 ml
microcentrifuge tubes. Activation of cells is done with any one of
the following activators: 50 ng MCP-1, 50 ng MIP-1a, 50 ng RANTES,
3 U/ml urokinase plasminogen activator (u-PA) (American Diagnostica),
1 mg/ml recombinant human tissue plasminogen activator (t-PA)
(Hoffmann-La Roche), 1 U/ml thrombin (Warner-Lambert Canada) or
1 mg/ml phorbol myristate acetate (PMA) (Sigma-Aldrich) for 1 h (37  C,
5% CO2, humidified). Subsequently, cells are washed (centrifuge at 1200
rpm, 8 min, RT; discard supernatant), resuspended in growth medium, and
treated with 50 ng of M-T7 in 100 ml in saline or saline only for 1 h
M-T7: Measuring Chemokine-Modulating Activity 219

(37  C, 5% CO2, humidified). To analyze the samples, cells are washed


(centrifuge at 1200 rpm, 8 min, RT; discard supernatant), resuspended in
250 ml PBS. Aliquot 100 ml of cells per well into black plates. PBS is used as a
blank. Samples are analyzed in a spectrophotometer by exciting at 320 nm
and reading the emission at 390 nm (monomer) and 485 nm (excimer)
(Fig. 10.2A). The ratio of excimer to monomer gives a measure of
membrane fluidity (Fig. 10.2).

3.3. Ascites assay


This mouse ascites assay is a simple and readily established animal model
with minimal stress to the animal during the assay. This mouse ascites cell
model is used for the study of cell migration and activation after chemokine
stimulation. Ascites, also known as peritoneal cavity fluid, is fluid within
the smooth, transparent membranes that line the inside of the abdomen
(peritoneum) and surround the bowel and other abdominal organs.
An excess of peritoneal fluid is a common clinical finding with a wide
range of causes. The model used here relies on the injection of chemokines
that are known to be chemoattractants, bringing cells from the blood into
the peritoneal space.
For this peritoneal ascites model, mononuclear cell migration and fluid
accumulation are induced by intraperitoneal (IP) injection of any one of the
following mouse chemokines: MCP-1, MIP-1a, RANTES. Only one
chemokine is injected into each animal at a concentration of 50 ng/100 ml
of saline. A major role of chemokines is to guide the migration of cells.
Local administration of a chemokine, that is, MCP-1, by IP injection results
in inflammatory cell invasion, dominated by early neutrophil infiltration.
A more delayed mononuclear cell infiltration of predominantly monocytes,
but also T lymphocytes, is then detected in response to IP injection of CC
chemokines, MCP-1, RANTES, and MIP-1a. There is a smaller monocyte
response to CXC chemokine injections. In our research, we have found
that M-T7 injection significantly reduced inflammatory cell invasion in
mouse ascites. No adverse effects, specifically no excess stress, bleeding,
infection, or mortality, have been reported with chemokine injection or
with M-T7 treatments. The mice have minimal if any distress and do not
develop large amounts of fluid that cause discomfort by distending the
animal’s belly. The fluid and cells are collected from mice under general
anesthetic at the time of sacrifice. Ascites fluid and cells are only collected at
one time point.
For the mouse ascites model, mice are restrained and held with their
ventrum exposed. A 22 gauge needle is inserted into the abdominal cavity in
the lower right quadrant to avoid the cecum and bladder. The needle is
directed toward the animal’s head at an angle of 15 to 20 degrees and
inserted approximately 5 mm. Initially, fluid is aspirated to ensure that an
220 Mee Y. Bartee et al.

abdominal viscus (such as bladder or colon) has not been penetrated. If clear
yellow ascites fluid is detected, then 50 ng of a chemokine (MCP-1, MIP-1a,
or RANTES) in 100 ml sterile saline is injected into the abdominal cavity.
M-T7 is given either intravenously (IV) via tail vein or via IP injection
depending on whether local or systemic responses are to be assayed. A single
dose of 1.5 mg of M-T7 in 100 ml sterile saline is given by IV or IP injection.
After injection, the animals are observed carefully at least twice daily, and
monitored for signs of distress, hunching, chattering, decreased activity,
dyspnea, anorexia, or local ascites-peritonitis. Animals having any pain or
discomfort (hunching, chattering, etc.) are given 0.05 to 0.1 mg/kg weight of
buprenorphine, an analgesic that is given subcutaneously (SC).
After 18 h following IP injection, animals are sacrificed for collection
of peritoneal fluid and cells. Mice are euthanized with an IP injection of
120 mg/kg weight of pentobarbital. In prior work, during the 18 h monitored,
minimal if any abdominal distention was observed, and the risk of other side
effects or mortality rate has been less than 5%. The abdominal cavity is washed
with 5 ml of saline. Using sterile technique, ascitic fluid is collected with a
syringe by placing an 18 or 19 gauge needle into the abdomen. Cells from
ascites are isolated for further analysis by FACS, cell adhesion, and membrane
fluidity.

4. Quantifying the Effects of M-T7 on


Vascular Inflammatory Responses
in Rodent Vascular Transplant Models
In order to determine the effects of M-T7 as a chemokine-modulating
protein, its role in the control of the inflammatory response was tested in a rat
aortic allograft transplant model. This model is an example of a host-versus-
graft response, resulting in aggressive inflammation of the transplanted vascular
tissue. Significant reduction in aortic plaque formation and inflammatory
cell invasion into the grafted tissue on comparison against saline or protein
controls allows the study of the pro/anti-inflammatory response of M-T7 and
other chemokines in vivo. Mouse aortic transplant models are also used,
providing a mechanism for assaying tissue responses to transplant in specific
mice strains, such as specific gene knock out or knock in models. It is important
to note that the protocol we describe here is specific to rats, and that conditions
for mice, such as analgesics and surgical equipment, differ for mice.

4.1. Aortic transplant model


Rodent aortic transplantation entails complex surgical procedures and
requires expertise in rat anatomy, knowledge of vascular surgery techniques,
and fine manipulation of tissue. Special equipment, such as a Moller-Wedel
M-T7: Measuring Chemokine-Modulating Activity 221

EOS 900 operating microscope and SurgiVet Vaporizer with a rat mask
attachment and a gas scavenging system, are required. We will describe the
rat aortic transplant surgical model in detail, but many of the techniques
here can be transferred to the mouse model with careful attention to the
differences in body size for rats and mice, specifically transplanted aortic
section length, suture sizes, and dosing of anesthetics.

4.1.1. Anesthetic
Rats are anesthetized using a mixture of ketamine and xylazine (23.75 mg/
ml ketamine plus 1.25 mg/ml xylazine) in sterile saline. This mixture is
given by IP injection at 0.1 ml/100 g weight. The rat belly is shaved and
then prepared for surgery by a three-step sterilization: (1) wash with beta-
dine soap, (2) wash with alcohol, and (3) clean with a betadine topical wash.
For pain control, an SC injection of buprenorphine is given (0.05 to 0.1
mg/kg weight of the rat) immediately after the anesthetic. Isoflurane gas, an
anesthetic, is given by mask with 2% oxygen as needed at a titration of 1 to
3% isoflurane until surgery is finished.

4.1.2. Aortic transplant donor


To produce a chronic rejection model, the preferred donor-to-recipient
mismatch pairs used in our laboratory include ACI (inbred, RT1a/RT2b/
RT3a) donor to Lewis (inbred, RT1l/RT2a/RT3a) recipient or Lewis
(inbred, RT1l/RT2a/RT3a) donor to Sprague Dawley (outbred) recipient
rats. The latter uses the non–inbred Sprague Dawley strain, and thus the
more pure ACI donor to Lewis recipient rat strain model is preferred. After
anesthetizing the rat (ACI strain) an incision is made using sterile technique
from the xiphoid process to the symphysis pubis. The aorta below the renal
arteries is exposed and the rat donor aorta is resected from the area below
the renal artery to the iliac bifurcation (Fig. 10.3). The tissue is placed in
sterile PBS. Subsequently, the rat is sacrificed by exsanguination.

4.1.3. Aortic transplant recipient


Two vessel clips are placed in the middle of the aorta below the renal artery,
corresponding to the aortic diameter of the sections removed from the
donor rat. The aorta (3 to 5 mm in length with matched diameter) is
attached by end-to-end anastomosis using interrupted sutures around the
circumferences of the aorta (Fig. 10.3). Vessel clips are then removed and
vessel pulsation checked, at which time the transplanted rat abdomen is also
assessed for bleeding sites. The inner muscle and connective tissue are closed
with an absorbent suture (4-0 coated VICRYL polyglactin 910 absorbable
suture). Dermal layers of the abdominal wall are closed with either inter-
rupted or continuous suture (sterile nylon suture will be used to close the
dermal layer).
222 Mee Y. Bartee et al.

Donor aorta

Donor rat Transplant rat

Figure 10.3 Schematic of rat aortic transplant:The donor rat is illustrated in black and
the recipient rat in purple. After the donor rat is anesthetized, aorta is removed from
the region between the renal artery (where the kidney is attached) and the bifurcation
of the aorta (where the aorta branches). Side branch vessels off of the aorta are first tied
and removed and the aorta is divided in half. One-half of the aorta is used for the saline
control and the other half for the M-T7 treated recipient rat. The donor aorta is
transplanted according to end-to-end anastomosis in the recipient rat.

M-T7 is infused in a total volume of 200 ml through a 30-gauge needle


via IV injection into the tail vein or penile vein (male rodents) when
the clips on the aorta are removed. Protein is infused only as a one-time
dose (dose ranges of 0.03 to 300 mg/g) immediately after transplant. Animals
are monitored until stable and checked initially every 5 to 20 min, and then
every half-hour until stable. The transplanted rat is kept warm with blankets
if the recovery is prolonged. Normally, the animal is monitored in the
surgical area for 2 to 4 h before transport to an animal holding facility. If the
rat appears to have any discomfort (hunching, chattering, etc.), the animal is
given an additional postoperative dose of buprenorphine. The rats are
monitored at least daily for 4 weeks following the surgery. Sutures are
removed at 7 to 10 days post surgery. At 4 weeks following the surgical
procedure, the rats are humanely euthanized by euthanyl injection contain-
ing 240 mg sodium pentobarbital. The mortality rate for the aortic trans-
plant model is 15 to 20%. Rats that show evidence of complications as a
result of the transplant, such as nerve damage, aneurysm formation, hemor-
rhage (usually seen up to 5 days), ischemia, infection, or difficulty with
normal locomotion, are euthanized. In some cases, the rat is lame temporarily
on one side due to poor blood flow, and therefore must be monitored carefully,
given additional pain killer, and food and water provided individually for
24 to 48 h.
M-T7: Measuring Chemokine-Modulating Activity 223

4.2. Tissue staining


After 4 weeks, the transplanted aortas are removed from the recipient rats as
described for the donor rats (see Section 4.1.2) and the harvested aorta is
fixed, embedded, and stained for histological microscopic analysis. Aortic
sections are cut into three equal-length segments from immediately above
and below the suture lines. Aortic cross-sections can be stained with
hematoxylin and eosin or Masson’s trichrome (Fig. 10.4). In our experi-
ence, the structural architecture of the aorta is best preserved with paraffin
embedding, which is described in the following paragraphs, as opposed to
cryopreservation. The aortic tissue sections are fixed in 10% neutral buffered
formalin (Fisher) overnight at RT in a tissue processor. To dehydrate the
tissue, the following incubations are performed for 1 h each at RT: 1:70%
ethanol, 2:95% ethanol, 3:95% ethanol, 4:100% ethanol, 5:100% ethanol,
6:100% ethanol, 7:xylene, 8:xylene, 9:xylene, 10:100% ethanol. The aorta is
then rehydrated in water for 1 h. Next, tissue is embedded in paraffin wax
(Paraplast plus tissue embedding medium) for 1 h at 60  C. To secure the
tissue for slicing, it is embedded in additional paraffin in a mold. The tissue is
then cut into 4 to 5 micron sections using a standard microtome.
To define the specific layers of the aorta, we use both hematoxylin and
eosin (H&E) as well as Masson’s trichrome staining. With trichrome stain-
ing, smooth muscle cells stain red, collagen is green, and elastin and/or
nuclei are black. With H&E staining, the invading monocytes and lympho-
cytes are more readily identified. Although the internal elastic lamina and
collagen are readily identified as serpiginous pink lines, the trichrome stain
more clearly defines these connective layers that divide the intimal, medial,
and adventitial layers of the arterial wall. Immunohistochemical analysis of
selected cell types or individual proteins and antigens is also used to further
define cellular changes in the tissues after transplantation. We will describe

Saline control M-T7 treated

200x 200x

Figure 10.4 Trichrome staining of rat aortic transplant.Transplanted aortas from rats
treated with either saline or M-T7 were trichrome stained. The arrows indicate the
boundary of the plaque. The areas between the arrowheads demarcate the limits of the
intimal plaque area. Compared to saline, M-T7 significantly reduced plaque formation.
224 Mee Y. Bartee et al.

Masson’s trichrome staining in detail in the next section as a basic staining


approach that provides rapid identification of plaque growth and fibrosis
after aortic transplant.
The paraffin has to be removed from the tissue before staining.
The sections are first placed in a 60  C oven for 30 min to melt the paraffin
wax and then placed in a tissue processor with the following settings:
1:xylene for 5 min, 2:xylene for 5 min, 3:100% ethanol for 2 min, 4:100%
ethanol for 2 min, 5:95% ethanol for 2 min, 6:70% ethanol for 2 min, and
7:water for 2 min.
1. Tissue is stained with trichrome stain. Trichrome staining defines the
internal elastic lamina which serves to outline the intimal plaque and
medial layers. Tissue sections are stained with Verhoeff’s hematoxylin
for 5 min (for Verhoeff’s hematoxylin, combine immediately before use
20 ml of 5% hematoxylin in ethanol and dissolve by gentle heat without
boiling), 8 ml of 10% ferric chloride in water, and 8 ml Verhoeff’s
iodine (2% iodine and 4% potassium iodine in water). The section is
then washed for 10 min with water.
2. Dip slides in 1.4% ferric chloride 10 to 12 times until the tissue becomes
dark. This can be verified under the microscope.
3. Incubate with 95% ethanol for 5 min.
4. Incubate with Biebrich-scarlet-acid-fuchsin solution for 10 min. Wash
for 10 min with water.
5. Stain tissue with phosphomolybdic-phosphotungstic-acid for 15 min
(1.25 g phosphomolybdic acid and 1.25 g phosphotungstic acid in 600
ml of water).
6. Incubate in fast green for 10 min (1% fast green in 1% acetic acid). Wash
with water for 5 min. The fast green stain loses color readily, so the
tissue needs to be checked under the microscope. If the stain is too light,
the sample needs to be restained with fast green for another 10 min.
7. Dip sample in 1% acetic acid several times.
8. Dip into 95% ethanol 20 times.
9. Dip into 100% ethanol 20 times.
10. Dip into xylene two times to get rid of the alcohol.
11. Mount the sample.

4.3. Morphometric analysis of aortic plaque area


After staining, the plaque size is examined and measured via microscopy.
The intimal plaque image is captured by an Olympus DP71 camera attached
to an Olympus BX51 microscope. Several microscopic analysis systems
are available for measuring plaque area and lumen narrowing as well as for
assessing changes in invading cells and tissue composition. Intimal plaque
area is quantified in our lab using Image Pro 6.0 (MediaCybernetics).
M-T7: Measuring Chemokine-Modulating Activity 225

This software allows the user to manually outline the plaque area as well as
trace the internal elastic lamina and external elastic lamina. Lumen narrow-
ing can be assessed by measuring the IEL area and subtracting the plaque
area. In a normal artery, the lumen area should be close to the IEL area, as
the intimal layer is in general composed of one or two endothelial cell layers.
Invading inflammatory cells can be counted in three separate high-power
field areas and can be further normalized to the area of tissue where cells
are counted. Cells can be specifically stained using immunohistochemical
staining techniques to identify cell types and are counted in the intimal,
medial, and adventitial layers for each specimen. Visualization of each
sample is adjusted and normalized to the objective lens of the microscope,
to provide accurate measurement of plaque areas. The software then
quantifies the enclosed plaque area, and that number is used to calculate
the significance of plaque reduction compared to the saline controls.

4.4. Statistics
When aorta samples are processed, each aortic transplant sample is cut into
two or three equal-length segments, and then plaque areas are measured on
two to three sections from each sample. This provides a minimum of four to
six stained plaque sections from each aorta for analysis. The mean value for
plaque area, internal elastic lamina, lumen area, as well as percentage
narrowing is calculated for each animal. These mean values are then utilized
for all later statistical analyses. If more than two treatment variables are
present in the study, an analysis of variance (ANOVA) is calculated to assess
significance. Individual treatment groups can then be assessed using
Fischer’s post-hoc least significant difference (PLSD) analysis. If only two
experimental treatment groups are examined, then a Student’s unpaired,
two-tailed t-test is used. For assessing cellular invasion, three areas in three
differing sites using 100 microscopic objective are counted (cells per field)
for each sample section and for each of the three arterial layers, intima,
media, and adventitial layers. Occasionally, linear regression analysis is also
performed for selected studies for correlations. The Stat view statistics
program is used for all statistical analysis.

5. Preclinical Toxicity Testing


Once there is proof of potential therapeutic value in preclinical animal
models, a new drug must then be rigorously tested in preparation for clinic.
The average time for development of a new therapeutic is 15 years from
initial inception to application. For clinical development, a new anti-
inflammatory protein such as M-T7 requires: (1) expression and purification
226 Mee Y. Bartee et al.

to a clinically acceptable grade, (2) an acceptable functional assay, (3) a


therapeutic target, and (4) toxicity testing in preclinical and clinical trials
(Serabian and Pilaro, 1999; Tolner et al., 2007). These steps in drug
development are outlined in brief in the following:
 Expression of a biologic, in this case an anti-inflammatory protein derived
from a virus, is generally performed in a cell-based expression system that
has been previously approved for expression of biologic agents already in
clinic (Serabian and Pilaro, 1999). This expression requires a clean facility
using good manufacturing procedures (GMP procedures) where the
protein can be expressed at high yield (Tolner et al., 2007). Purification
protocols for the protein must also be developed to produce a product
with minimum impurities (Serabian and Pilaro, 1999). Each agent is also
carefully tested for potentially toxic impurities, such as endotoxins. The
expression and purification must also take into account cost of processing
and storing of proteins for clinical use, as a product that is prohibitively
expensive to manufacture will often fail to proceed to development for
clinical use.
 An acceptable assay is necessary to assess drug half-life and tissue distribu-
tion, monitor clinical responsiveness, and identify potential target organs
for side effects (toxic responses). One pitfall in drug development can be a
lack of a functional assay for detection of active drug in the test subjects.
The assay correlates drug activity with clinical responses. Assay develop-
ment relies on an understanding of the mechanism of action of the drug as
well as predicted cellular and molecular responses.
 While preclinical studies may detect broad anti-inflammatory functions,
the reagent must then be targeted for a specific pathogenesis, or disorder,
where there is both a clinical need as well as potential for efficacy
(Serabian and Pilaro, 1999). Efficacy in animal models does not necessar-
ily translate into efficacy in humans. Production of a therapeutic that is
addressing a problem that is already well treated by current medications is
not particularly useful. Centers specializing in testing therapeutic targets
for new drugs have emerged in recent years. Cell samples derived from
patients, such as cells isolated from the circulating blood, lung wash
(alveolar lavage), or even bone marrow and joint fluid aspirates have
become available. These samples are then tested for responsiveness to a
new drug in vitro. Other studies are performed in silico, using software
programs that model molecular targets or potential for therapeutic appli-
cation in selected disease populations. Final analysis will, however,
require in vivo testing, first in preclinical animal models and finally in
clinical trials in humans.
 Preclinical testing includes both the discovery phase as well as toxicity
testing (Serabian and Pilaro, 1999). The preclinical efficacy studies will
not only determine efficacy in a selected animal model but will also assess
M-T7: Measuring Chemokine-Modulating Activity 227

drug delivery routes and dosing to provide a guide for effective dose range
with minimal adverse events (toxicity). While initial efficacy or prelimi-
nary experimental studies are performed in basic research labs, further
testing in general for toxicity or potentially to confirm efficacy are
performed in labs that use good lab practice (GLP) approaches, where
animal testing is carefully monitored and each stage of testing standar-
dized. Toxicity will assess half-life, organ targets at risk for toxic
responses, and immunogenicity of the reagent tested. The preclinical
toxicity testing will encompass generalized effects on mortality, morbid-
ity, and additionally a half-life analysis. These studies are aimed at a
specific clinical application and the studies will vary depending on the
disease to be addressed. Toxicity testing is generally done in a facility
that specializes in preclinical toxicity testing under GLP conditions.
This work must be very meticulously performed with rigorous standards.
The baseline toxicity tests are generally performed in rodent models.
For some selected studies, analyses are performed in primate models, as
for example when testing for cardiac toxicity, wherein the potential
effects on electrocardiogram (ECG), cardiac enzymes, and heart function
can be assessed with minimal invasive approaches using simple blood tests
and transthoracic noninvasive echocardiography (ultrasound of the
heart), reducing potential discomfort and harm to the test subjects.
If proven to have low toxicity, the subsequent analysis is used to approach
the Food and Drug Administration (FDA) in the United States, the
Health Protection Branch (HPB) in Canada, or equivalent governmental
regulatory agencies in Europe and elsewhere in the world for assessment
and approval for Phase I testing in normal volunteers. Phase I testing is
then performed in normal volunteers to assess safety in humans. These
tests are again performed in facilities that specialize in early clinical studies
with prior approval by regulatory boards such as the FDA or HPB.
Development of a new biologic is thus a complex and long-term
endeavor, but with careful planning and a good team, can be successfully
accomplished.

REFERENCES
Allen, S. J., Crown, S. E., and Handel, T. M. (2007). Chemokine: Receptor structure,
interactions, and antagonism. Annu. Rev. Immunol. 25, 787–820.
Arnold, K., Bordoli, L., Kopp, J., and Schwede, T. (2006). The SWISS-MODEL work-
space: A web-based environment for protein structure homology modelling. Bioinformatics
22, 195–201.
Bedard, E. L., Kim, P., Jiang, J., Parry, N., Liu, L., Wang, H., Garcia, B., Li, X.,
McFadden, G., Lucas, A., and Zhong, R. (2003). Chemokine-binding viral protein
M-T7 prevents chronic rejection in rat renal allografts. Transplantation 76, 249–252.
228 Mee Y. Bartee et al.

Forsberg, E., and Kjellen, L. (2001). Heparan sulfate: Lessons from knockout mice. J. Clin.
Invest. 108, 175–180.
Handel, T. M., Johnson, Z., Crown, S. E., Lau, E. K., and Proudfoot, A. E. (2005).
Regulation of protein function by glycosaminoglycans—as exemplified by chemokines.
Annu. Rev. Biochem. 74, 385–410.
Johnson, Z., Kosco-Vilbois, M. H., Herren, S., Cirillo, R., Muzio, V., Zaratin, P.,
Carbonatto, M., Mack, M., Smailbegovic, A., Rose, M., Lever, R., Page, C., et al.
(2004a). Interference with heparin binding and oligomerization creates a novel anti-
inflammatory strategy targeting the chemokine system. J. Immunol. 173, 5776–5785.
Johnson, Z., Power, C. A., Weiss, C., Rintelen, F., Ji, H., Ruckle, T., Camps, M.,
Wells, T. N., Schwarz, M. K., Proudfoot, A. E., and Rommel, C. (2004b). Chemokine
inhibition—Why, when, where, which and how? Biochem. Soc. Trans. 32, 366–377.
Kopp, J., and Schwede, T. (2004). The SWISS-MODEL repository of annotated three-
dimensional protein structure homology models. Nucleic Acids Res. 32, D230–D234.
Lalani, A. S., Ness, T. L., Singh, R., Harrison, J. K., Seet, B. T., Kelvin, D. J.,
McFadden, G., and Moyer, R. W. (1998). Functional comparisons among members
of the poxvirus T1/35kDa family of soluble CC-chemokine inhibitor glycoproteins.
Virology 250, 173–184.
Liu, L., Dai, E., Miller, L., Seet, B., Lalani, A., Macauley, C., Li, X., Virgin, H. W.,
Bunce, C., Turner, P., Moyer, R., McFadden, G., and Lucas, A. (2004). Viral
chemokine-binding proteins inhibit inflammatory responses and aortic allograft
transplant vasculopathy in rat models. Transplantation 77, 1652–1660.
Liu, L., Lalani, A., Dai, E., Seet, B., Macauley, C., Singh, R., Fan, L., McFadden, G., and
Lucas, A. (2000). The viral anti-inflammatory chemokine-binding protein M-T7 reduces
intimal hyperplasia after vascular injury. J. Clin. Invest. 105, 1613–1621.
Mossman, K., Nation, P., Macen, J., Garbutt, M., Lucas, A., and McFadden, G. (1996).
Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical
virulence factor for the development of myxomatosis in European rabbits. Virology 215,
17–30.
Mossman, K., Upton, C., and McFadden, G. (1995). The myxoma virus-soluble interferon-
gamma receptor homolog, M-T7, inhibits interferon-gamma in a species-specific
manner. J. Biol. Chem. 270, 3031–3038.
Parish, C. R. (2005). Heparan sulfate and inflammation. Nat. Immunol. 6, 861–862.
Proudfoot, A. E., Power, C. A., Rommel, C., and Wells, T. N. (2003). Strategies for
chemokine antagonists as therapeutics. Semin. Immunol. 15, 57–65.
Seet, B. T., Singh, R., Paavola, C., Lau, E. K., Handel, T. M., and McFadden, G. (2001).
Molecular determinants for CC-chemokine recognition by a poxvirus CC-chemokine
inhibitor. Proc. Natl. Acad. Sci. USA 98, 9008–9013.
Serabian, M. A., and Pilaro, A. M. (1999). Safety assessment of biotechnology-derived
pharmaceuticals: ICH and beyond. Toxicol. Pathol. 27, 27–31.
Tolner, B., Smith, L., Hillyer, T., Bhatia, J., Beckett, P., Robson, L., Sharma, S. K.,
Griffin, N., Vervecken, W., Contreras, R., Pedley, R. B., Begent, R. H., et al. (2007).
From laboratory to Phase I/II cancer trials with recombinant biotherapeutics. Eur. J.
Cancer 43, 2515–2522.
Upton, C., Mossman, K., and McFadden, G. (1992). Encoding of a homolog of the
IFN-gamma receptor by myxoma virus. Science 258, 1369–1372.
Weber, C., Schober, A., and Zernecke, A. (2004). Chemokines: Key regulators of
mononuclear cell recruitment in atherosclerotic vascular disease. Arterioscler. Thromb.
Vasc. Biol. 24, 1997–2008.
C H A P T E R E L E V E N

Role of the Chemokine Scavenger


Receptor D6 in Balancing
Inflammation and Immune Activation
Elena M. Borroni,* Chiara Buracchi,* Benedetta Savino,*
Fabio Pasqualini,* Remo C. Russo,*,† Manuela Nebuloni,‡
Raffaella Bonecchi,* Alberto Mantovani,§ and Massimo Locati§

Contents
1. Introduction 232
2. Methods 232
2.1. Immunohistochemistry 232
2.2. TB infection model 233
2.3. Chemokine neutralization in vivo 233
2.4. Cell transfection 233
2.5. Immunofluorescence and confocal microscopy analysis 234
2.6. Chemokine scavenging assay 234
3. Results 235
4. Discussion 236
References 241

Abstract
Chemokines play a major role in the induction of inflammatory reactions and
development of an appropriate immune response by coordinating leukocyte
recruitment. The appropriate control of the chemokine system involves several
chemokine decoy receptors, with distinct specificity and tissue distribution,
defined as nonactivating chemokine receptors able to bind the ligands and
target them to degradation. The best-characterized representative of these
receptors is D6, which is located on lymphatic endothelium and controls most
inflammatory CC chemokines. Here we will discuss the expression and

* Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan, IRCCS


Istituto Clinico Humanitas, Italy
{
Department of Biochemistry and Immunology, Instituto de Ciencias Biologicas, Universidade Federal de
Minas Gerais, Belo Horizonte, Brazil
{
Pathology Unit, L. Sacco Institute of Medical Sciences, University of Milan, Milan, Italy
}
Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas, Via
Manzoni, Rozzano (Milano), Italia

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05211-2 All rights reserved.

231
232 Elena M. Borroni et al.

regulation of D6 during challenge with the pathogen, and its role in dampen-
ing inflammation in tissues and draining lymph nodes and in the organization
of a protective immune response.

1. Introduction
Leukocyte trafficking is a key element in the orientation of innate and
adaptive immunity, and it is mainly controlled by chemokines, small
secreted proteins with chemotactic and cytokine-like activities (Mantovani,
1999). These molecules are classified according to structural properties
related to the number and position of conserved cysteine residues in two
major (CXC and CC) and two minor (C and CX3C) subfamilies, and
according to their production in homeostatic (i.e., produced constitutively)
and inflammatory (i.e., produced in response to inflammatory or immuno-
logical stimuli) chemokines (Charo and Ransohoff, 2006). Chemokine
biological activities are mediated by chemokine receptors, a distinct sub-
family of G protein–coupled receptors that mainly transduce intracellular
signals through the activation of heterotrimeric Gai proteins. A distinct
subfamily of chemoattractant receptors unable to sustain signaling activities,
which includes the chemokine receptors D6, Duffy antigen receptor for
chemokines (DARC, also known as the Duffy antigen), and CCX-CKR,
has recently been identified (Mantovani et al., 2006).
The D6 molecule recognizes an unusual broad spectrum of ligands, being
able to interact with most agonists at inflammatory CC chemokine receptors
from CCR1 through CCR5, while homeostatic CC chemokines, agonists at
CCR6 to CCR10, are not recognized, nor are chemokines belonging to other
subfamilies. While the ligand-binding profile is unusually broad, its expression
is fairly restricted, D6 being detectable only in placenta and on endothelial cells
of lymphatic afferent vessels in skin, gut, and lung (Martinez de la Torre et al.,
2007; Nibbs et al., 1997, 2001). In vivo results in several models, including
challenge with complete Freund adjuvant, have clearly demonstrated that D6
and its scavenger function are mandatory for controlling the outcome of
an inflammatory reaction (Liu et al., 2006; Martinez de la Torre et al., 2005).
Here we focus on how D6 is regulated during the development of an immune
response, and on its role in balancing the inflammatory and protective adaptive
immune response after challenge with Mycobacterium tuberculosis (TB).

2. Methods
2.1. Immunohistochemistry
D6 expression was analyzed in human lung lymph nodes obtained from
patients with pulmonary tuberculosis. Tissues were selected on the basis of
the presence of giant cell–associated necrotic granulomas, and the tubercular
D6 Role in Inflammation and Immune Activation 233

etiology was confirmed by histochemical and biomolecular methods.


Consecutive sections of 3 mm width from formalin-fixed, paraffin-
embedded tissues were dewaxed in xylene, rehydrated in a progressive
ethanol scale, and pretreated in a microwave oven (two cycles of 5 min at
780 W, in 0.25 mM EDTA buffer, pH 8.0) for antigen retrieval. Slides were
incubated for 2 h at room temperature (RT) in a humid chamber with a rat
antihuman D6 monoclonal antibody (1:100; R&D Systems) or a mouse anti
human CD68 monoclonal antibody (1:1500; Dako, Denmark) to detect
macrophages. The reactions were revealed by nonbiotin, mouse-on-rat,
HRP-polymer kit (Biocare Medical), and MACH 4TM Universal HRP-
polymer kit (Biocare Medical), respectively, with 3,30 diaminobenzidine
free base as chromogen (brown staining).

2.2. TB infection model


D6-null mice were generated as previously described ( Jamieson et al.,
2005). Homogeneous populations were established by backcrossing hetero-
zygous mice to C57BL/6J (WT) mice for more than eight generations. WT
and D6-null mice were bred in a specific pathogen-free/viral antibody–free
barrier facility and used in accordance with institutional guidelines in
compliance with national and international law and policies. Mice were
infected via the intranasal (IN) route with the TB H37Rv strain (2  103
CFU in 20 ml), resulting in the reproducible delivery of 50 to 100 viable
CFU. Each experimental group consisted of 7 to 10 mice.

2.3. Chemokine neutralization in vivo


To block inflammatory chemokines, mice were treated with a mixture of
goat antibodies to the CC chemokines CCL2/MCP-1, CCL3/MIP-1a,
and CCL4/MIP-1b), and a monoclonal antibody to CCL5/RANTES
purchased lyophilized from R&D Systems, resuspended in sterile phosphate-
buffered saline (PBS), and mixed as previously described (Martinez de la Torre
et al., 2005, 2007). Mice were given intraperitoneal (IP) injections of 200 ml of
the mixture, equivalent to 100 mg of each antibody. Alternatively, mice were
treated with 400 mg of individual antibodies specific to a single CC chemo-
kine. On the same days, control mice received IP injections equivalent to
400 mg of irrelevant antibodies (normal goat IgG, Sigma-Aldrich) in 200 ml PBS.
Mice were injected weekly, starting from the 3rd week after infection
with TB.

2.4. Cell transfection


CHO-K1/D6 cells were transiently transfected (80% confluency) with the
Rab11-S25N/pEGFP plasmid by using Lipofectamine 2000 (Invitrogen)
protocol as follow. Twenty microliters of Lipofectamine were added to
234 Elena M. Borroni et al.

500 ml OptiMEM medium (Gibco) and incubated for 5 min at RT.


Lipofectamine was then combined with (8 mg) DNA, mixed gently, and
incubated at RT for 20 min to allow DNA-Lipofectamine complexes to
form. DNA-Lipofectamine complexes were added to T25 flasks and incu-
bated at 37  C in a CO2 incubator for 24 h.

2.5. Immunofluorescence and confocal microscopy analysis


CHO-K1/D6 (1  105) cells were seeded onto glass dishes in 24-well plates
and grown at 37  C for 18 h. Cells were stimulated with 100 nM CCL2 in
DMEM-F12, supplemented with 1% bovine serum albumin and fixed with
4% paraformaldehyde for 15 min, permeabilized with 0.3% Triton X-100 in
PBS for 5 min, and incubated with 10% normal goat serum (Dako, Glostrup,
Denmark) for 30 min. Fixed cells were incubated with primary antibodies for
2 h at RT. After washing three times with 0.05% Tween 20 in PBS (pH 7.4),
coverslips were incubated with secondary antibodies for 1 h, extensively
washed, and incubated with DAPI for 5 min. Specimens were mounted
in FluoSave (Calbiochem; San Diego, CA) and high-resolution images
(1024  1024 pixels) were acquired sequentially with a 60  1.4 N.A.
Plan-Apochromat oil immersion objective by using a FV1000 laser-scanning
confocal microscope (Olympus, Hamburg, Germany). For z-stack analysis,
high-resolution images (1.024  1.024 pixels) corresponding to n ¼ 50 optical
sections (slice ¼ 100 nm) were sequentially acquired as described above.
Differential interference contrast (DIC) (Nomarski technique) was also used.
Images were assembled and cropped using the Photoshop software (Adobe
Systems, San Jose, CA). Quantitative colocalization and statistical analysis were
performed using ImarisColoc software, version 4.2 (Bitplane AG, Zurich,
Switzerland).

2.6. Chemokine scavenging assay


CHO-K1/D6 cells were plated the day before the experiment in 96-well
dishes at the concentration of 3  104 cells/well. Cells were then incubated
at 37  C for 4 h in 60 ml of DMEM-F12 supplemented with 1% bovine
serum albumin, 0.1 nM of 125I-CCL2 or 125I-CCL4, and indicated
concentrations of unlabeled CCL2/CCL4 or 10 nM CCL2/CCL4 for
indicated time points. Proteins in the supernatants were precipitated with
12.5% trichloroacetic acid (Carlo Erba Reagents, Milan, Italy) at 4  C for
15 min, and the radioactivity present in both soluble and insoluble fractions
was measured with a WIZARD automatic g counter (Perkin Elmer,
Waltham, MA). Degradation rate curves were obtained by data fitting with
nonlinear regression and interpolation with Michaelis-Menten equations
using Prism4 software (GraphPad Software, San Diego, CA).
D6 Role in Inflammation and Immune Activation 235

3. Results
Expression of the D6 receptor during TB infection was investigated by
immunohistochemistry on lung lymph nodes from patients with pulmonary
tuberculosis. As shown in Fig. 11.1A, D6 expression was prominent in
lymphatic endothelial cells, while CD68-positive macrophages did not stain
for D6, both within and around granulomas.
To better define the role of D6 in this pathological setting, D6-null mice
were infected via the IN route with TB. At the dosage used, WT mice resisted
to the infection, while D6-null mice showed significant mortality (Fig. 11.1B).
Interestingly, the exaggerated susceptibility of D6-null mice to TB infection
was not due to impaired control of the infectious agent, as the bacterial loads in
the lung, liver, and spleen were not different in WT and D6-null mice.
Conversely, a prominent inflammation-driven tissue damage was observed
in several tissue districts, including lung, liver, and kidney, in D6-null animals,
as compared to WT mice (data not shown) (Di Liberto et al., 2008).
We therefore investigated the role of individual inflammatory CC chemokines
by treating TB-infected D6-null mice with monoclonal antibodies blocking

A CD68 D6

B
100

80
Survival rate (%)

WT
60 D6−/−
D6−/− + a CCL2
40 D6−/− + a CCL3
D6−/− + a CCL4
20 D6−/− + a CCL5
D6−/− + mix antibodies
0
0 4 8 12 16
Time after infection (weeks)

Figure 11.1 D6 expression and role of CC chemokines during TB infection. Panel A


shows two serial sections of lung lymph nodes stained for D6 (right panel) and CD68 to
detect macrophages (middle panel).Two granulomas with a high number of macrophages
are present (indicated by filled areas in the left panel), while the D6 positivity is restricted
to lymphatic vessels (indicated by dotted lines in the left panel). Panel B shows survival
rate of WTand D6-null mice after IN exposure in the presence of blocking monoclonal
antibodies to inflammatory CC chemokines, administered alone or in combination.
236 Elena M. Borroni et al.

the inflammatory CC chemokines under D6 control CCL2, CCL3, CCL4,


and CCL5. As shown in Fig. 11.1B, none of the monoclonal antibodies
provided individually was able to reverse the exaggerated D6 susceptibility
to TB. On the contrary, a cocktail of monoclonal antibodies blocking all four
inflammatory CC chemokines provided a partial but significant reversion of
this phenotype. These results indicate that the induction of inflammatory
chemokines after TB challenge is required to induce a protective immune
response, and that D6 clearance of CC chemokines is needed to contain
the immune response and prevent excessive tissue damage.
As D6 provides a nonredundant negative regulator of the chemokine
system, it was particularly relevant to investigate its regulation during the
development of the infection. However, consistently with results previously
obtained in in vitro settings, we have been unable to detect any significant change
in D6 transcript levels in the liver, spleen, and lungs (data not shown). After
ligand engagement, chemokine receptors undergo rapid internalization and
recycling, allowing targeting of the ligand to lysosome and its degradation.
Different from signaling chemokine receptors, we observed that D6 expression
of the cell membrane was significantly upregulated in response to receptor
engagement by its ligand CCL2. Receptor upregulation was particularly evi-
dent for elevated concentrations of the ligands (Bonecchi et al., 2008), and this
increased expression correlated with an increased efficacy in ligand degradation
(Fig. 11.2A and B). To better understand the ligand-dependent induction of
receptor upregulation, D6 localization in the cell was investigated by confocal
microscopy. Under resting conditions, most of the receptor was stored in
perinuclear compartments, whereas ligand engagement induced relocation of
a significant fraction of the receptor to the cell membrane. Concomitantly, the
strong colocalization of D6 with the recycling endosome marker Rab11
observed under resting conditions was significantly reduced after ligand
engagement (Fig. 11.3A and B). To investigate the molecular mechanisms
responsible for the ligand-induced increased expression of D6, we
overexpressed a GFP-tagged, Rab11, dominant negative mutant (Rab11-
S25N-EGFP), and evaluated D6 expression and colocalization after CCL2
engagement. As shown in Fig. 11.3C and D, a causative role of Rab11 in this
process was demonstrated by the observation that the Rab11 dominant
negative mutant was able to largely prevent receptor redistribution on the cell
membrane. The colocalization of signals from the endogenous Rab11 and the
transfected Rab11-S25N-EGFP demonstrated the specificity of the analysis
(Fig. 11.3E and F).

4. Discussion
D6 is the best-described chemokine decoy receptor and plays a crucial
role in controlling leukocyte recruitment in inflamed tissues and the levels
of inflammatory chemokines in draining lymph nodes (Borroni et al., 2006).
D6 Role in Inflammation and Immune Activation 237

A 7
6

Degradation rate
5

(nmoli/s ⫻ 10−8)
4
3
2
1
0
0 1 10 100
Chemokine (nM)

B 100

80
125I-CCL2 (% Cpm)

60

40

20

0
0 30 60 90 120 150 180
Time (min)

Figure 11.2 D6 increased its scavenging rate upon ligand stimulation. (A) CHO-K1/
D6 cells were incubated for 4 h at 37  C with 0.1 nM of 125I-CCL4or 125I-CCL2 and 1 to
100 nM of CCL4 (□) or CCL2 (▪); (B) CHO-K1/D6 cells were incubated with 0.1 nM of
125
I-CCL2 and 10 nM CCL2 for the indicated time points. Data are representative of
(A) the degradation rate (nmoli/s) of TCA soluble fraction of supernatants or (B) the
percentage of radioactivity counted (cpm) over CHO-K1 cells in the TCA soluble (○)
and TCA insoluble () fractions of the supernatants. Results (mean  standard error)
are from triplicates of one representative experiment of three performed.

This atypical CC chemokine receptor shares 30 to 35% sequence identity to


conventional (i.e., signaling) chemokine receptors but lacks sequence motifs
that are critical for the activation of Gai. Consistent with this, D6 does not
support G-protein–dependent signaling functions usually activated by
chemokine receptors (Bonecchi et al., 2004; Fra et al., 2003; Nibbs et al.,
1997), but appears to be structurally adapted to perform chemokine scav-
enging being constitutively internalized and recycled back to cell surface
and not downregulated after chemokine engagement (Galliera et al., 2004;
Weber et al., 2004).
The role of D6 as a regulator of inflammatory chemokines in in vivo
settings has been investigated in different models of local inflammation
using D6-null mice. Of relevance, D6-null mice showed an exacerbated
inflammatory response in a model of inflammation induced by phorbol
238 Elena M. Borroni et al.

Medium CCL2

A B

10 mm 10 mm

C D

20 mm 10 mm

E F

20 mm 10 mm

Figure 11.3 D6 constitutive and ligand-induced recycling is supported by a Rab11-


dependent mechanism. Confocal images of immunofluorescence stained CHO-K1/D6
cells. Panels show representative experiments of the double staining of D6 (red) with
endogenous Rab11 (green) (A, B); D6 (red) with exogenous Rab11-S25N/pEGFP (green)
(C, D); colocalization of endogenous Rab11 (blue) with transfected Rab11-S25N/pEGFP
(green) (E, F).

ester skin painting and in a model of skin inflammation induced by


subcutaneous injection of complete Freund adjuvant ( Jamieson et al.,
2005; Martinez de la Torre et al., 2005). In particular, in this second
model a significant percentage of D6-null animals also developed macro-
scopic granuloma-like lesions, which were evident only in a minority of
WT littermates. In both models, increased levels of inflammatory CC
chemokines were detected locally, and pretreatment with chemokine
receptors blocking antibodies was able to prevent development of lesions,
demonstrating that the increased inflammatory response was caused by an
inefficient control of the chemokine system in the absence of D6.
D6 Role in Inflammation and Immune Activation 239

Although the specific roles of individual CC chemokines in the recruit-


ment of various leukocyte populations have not been defined, both reports
described an imbalance restricted to inflammatory CC chemokines, con-
sistent with the D6-binding profile. In summary, the two models high-
lighted a nonredundant role of D6 in the control of local inflammation in
skin, although molecular mechanisms involved are still not defined and
deserve further investigation, as well as the evaluation of a similar role of
D6 in other tissues.
The increased inflammatory response observed in D6-null mice after
injection of complete Freund adjuvant, which contains inactivated TB,
prompted us to evaluate its role after challenge with the living pathogen
(Di Liberto et al., 2008). As compared to WT littermates, D6-null mice
preserved their ability to control the infectious agent, as shown by the
comparable number of TB CFU. On the contrary, D6-null mice showed
an increase in inflammatory infiltrate in lung and lymph nodes, in the
levels of proinflammatory cytokines (TNFa, Il-1b, IFNg) in bronchoal-
veolar lavage and serum, and in the mortality rate. Given the role of D6
to act as chemokine scavenger and the detection of increased concentra-
tions of CC chemokines (CCL2, CCL3, CCL4, and CCL5) in D6-null
mice, a causative role of unbalanced chemokine concentrations was
hypothesized. Blocking individual CC chemokines did not reverse the
increased mortality observed in D6-null animals, indicating a redundant
role of CC chemokines and the need to control the chemokine system
in its entirety to properly resolve the inflammatory response, but the
block of most CC inflammatory chemokines of relevance for this exper-
imental model (CCL2, CCL3, CCL4, CCL5) using a cocktail of anti-
bodies partially reversed the inflammatory phenotype and the increased
lethality observed in D6-null mice. Interestingly, however, this approach
also led to less-controlled growth of TB. Thus, during TB infection the
survival of the host requires the action of inflammatory chemokines to
coordinate an adequate protective immune response and control the
pathogen, but the control of inflammatory CC chemokines by the D6
decoy receptor is mandatory for the resolution of the inflammatory
reaction (Fig. 11.4).
The expression of D6 on afferent lymphatic vessels supports the hypoth-
esis that this receptor could be at least in part responsible for the well-known
role of this compartment as active disposal system for inflammatory
chemokines (Fra et al., 2003; Nibbs et al., 2001; Palframan et al., 2001).
Consistently with this, D6 expression was detected on lymphatic vessels and
not in granuloma-associated macrophages in human tuberculotic lymph
nodes. As for other scavenger receptors, D6 has recently been shown to
be regulated by soluble inflammatory mediators (McKimmie et al., 2008).
Moreover, we recently reported that chemokine stimulation increased D6
membrane expression through its rapid mobilization from a Rab11-positive
240 Elena M. Borroni et al.

TB D6
Anti-CC chemokines D6−/−

+ CK
- -
CK + CK

- +
Adequate balancing of
Inflammation: reduced inflammatory reaction Inflammation: excessive
Antimicrobial activity: reduced and antimicrobial activity Antimicrobial activity: preserved

Death Survival Death

Figure 11.4 Role of D6 in the immune response to TB infection. Survival to TB


challenge requires a balanced inflammatory response supporting a protective antimi-
crobial response without extensive tissue damage. Chemokines are key to this bal-
ance, with D6 playing a crucial role in chemokine removal (middle panel). In the
absence of chemokines the inflammatory response is blunted and as a consequence
an inefficient antimicrobial response lead to host death (left panel). Conversely, the
absence of D6 does not significantly impact on antimicrobial response, but an excess
in chemokine concentrations leads to host death for extensive tissue damage (right
panel).

compartment and improves its efficiency in chemokine scavenging in a


time- and ligand-dependent manner (Bonecchi et al., 2008). This behavior
is not observed with signaling chemokine receptors, and resembles the
activity of enzymes, which catalyze chemical conversion of specific sub-
strates into related products. Indeed, D6 is able to mediate a time-dependent
conversion of intact ligand (substrate) into degraded fragments (product)
and to improve its degradation rate upon increasing the concentration of
ligand. Moreover, similar to what was previously described for D6 (Fra
et al., 2003; Galliera et al., 2004; Weber et al., 2004), certain enzymatic
pathways undergo constitutive cycling, a phenomenon also referred to as a
‘‘futile cycle’’ because it is an energy-expensive process without energy
gain. It has been proposed that this energy cost is necessary for extremely
sensitive systems because small changes in the rate of one of these reactions
causes a rapid change in net flux, avoiding the lengthy process of protein
synthesis and allowing large changes in cells signaling to occur on a rapid
time scale (Royle and Murrell-Lagnado, 2003).
Constitutive cycling has also been demonstrated for several transmem-
brane proteins, such as receptors at mammalian-synapse (Park et al., 2004)
adhesion molecules, ion channels, and transporters (Dugani and Klip, 2005;
Royle and Murrell-Lagnado, 2003). Interestingly, the macrophage scavenger
receptor for modified lipoproteins stabilin-1 (Prevo et al., 2004) and the
macrophage scavenger receptor for hemoglobin CD163 (Schaer et al., 2006)
D6 Role in Inflammation and Immune Activation 241

RAB11 RAB11

Figure 11.5 Regulation of D6 activity under homeostatic and inflammatory condi-


tions. Under homeostatic conditions, inflammatory chemokines are barely detectable,
most D6 is mostly retained in a Rab11-positive intracellular compartment, few receptors
constitutively cycle from the cell membrane, and no ligand scavenging activity is
detectable (figure to the left). After inflammation is triggered, significant levels of
chemokines are induced, D6 engagement induces the redistribution of the stored pool
from the Rab11-positive compartment to the cell membrane, and a significant increase
in ligand-scavenging activity is detected (right panel).

also undergo a constitutive internalization and recycling process that is signifi-


cantly increased in response to ligand binding. Similarly, D6 displays enhanced
scavenging activity after ligand engagement (Bonecchi et al., 2008), providing
further demonstration that its activity is quite similar to the catalytic function
of enzymes. Thus, it is tempting to speculate that constitutive cycling and
ligand-dependent receptor upregulation might represent mechanisms used
by several receptors, including D6, to rapidly modulate ligand uptake and
degradation depending on the immediate needs of the tissue (Fig. 11.5).

REFERENCES
Bonecchi, R., Borroni, E. M., Anselmo, A., Doni, A., Savino, B., Mirolo, M., Fabbri, M.,
Jala, V. R., Haribabu, B., Mantovani, A., and Locati, M. (2008). Regulation of D6
chemokine scavenging activity by ligand- and Rab11-dependent surface up-regulation.
Blood 112, 493–503.
Bonecchi, R., Locati, M., Galliera, E., Vulcano, M., Sironi, M., Fra, A. M., Gobbi, M.,
Vecchi, A., Sozzani, S., Haribabu, B., Van Damme, J., and Mantovani, A. (2004).
Differential recognition and scavenging of native and truncated macrophage-derived
chemokine (macrophage-derived chemokine/CC chemokine ligand 22) by the D6
decoy receptor. J. Immunol. 172, 4972–4976.
Borroni, E. M., Buracchi, C., de la Torre, Y. M., Galliera, E., Vecchi, A., Bonecchi, R.,
Mantovani, A., and Locati, M. (2006). The chemoattractant decoy receptor D6 as a
negative regulator of inflammatory responses. Biochem. Soc. Trans. 34, 1014–1017.
Charo, I. F., and Ransohoff, R. M. (2006). The many roles of chemokines and chemokine
receptors in inflammation. N. Engl. J. Med. 354, 610–621.
242 Elena M. Borroni et al.

Di Liberto, D., Locati, M., Caccamo, N., Vecchi, A., Meraviglia, S., Salerno, A., Sireci, G.,
Nebuloni, M., Caceres, N., Cardona, P. J., Dieli, F., and Mantovani, A. (2008). Role of
the chemokine decoy receptor D6 in balancing inflammation, immune activation, and
antimicrobial resistance in Mycobacterium tuberculosis infection. J. Exp. Med. 205,
2075–2084.
Dugani, C. B., and Klip, A. (2005). Glucose transporter 4: Cycling, compartments and
controversies. EMBO Rep. 6, 1137–1142.
Fra, A. M., Locati, M., Otero, K., Sironi, M., Signorelli, P., Massardi, M. L., Gobbi, M.,
Vecchi, A., Sozzani, S., and Mantovani, A. (2003). Cutting edge: Scavenging of inflam-
matory CC chemokines by the promiscuous putatively silent chemokine receptor D6.
J. Immunol. 170, 2279–2282.
Galliera, E., Jala, V. R., Trent, J. O., Bonecchi, R., Signorelli, P., Lefkowitz, R. J.,
Mantovani, A., Locati, M., and Haribabu, B. (2004). Beta-Arrestin-dependent constitu-
tive internalization of the human chemokine decoy receptor D6. J. Biol. Chem. 279,
25590–25597.
Jamieson, T., Cook, D. N., Nibbs, R. J., Rot, A., Nixon, C., McLean, P., Alcami, A.,
Lira, S. A., Wiekowski, M., and Graham, G. J. (2005). The chemokine receptor D6
limits the inflammatory response in vivo. Nat. Immunol. 6, 403–411.
liu, L., Graham, G. J., Damodaran, A., Hu, T., Lira, S. A., Sasse, M., Canasto-Chibuque, C.,
Cook, D. N., and Ransohoff, R. M. (2006). Cutting edge: The silent chemokine
receptor D6 is required for generating T cell responses that mediate experimental
autoimmune encephalomyelitis. J. Immunol. 177, 17–21.
Mantovani, A. (1999). The chemokine system: Redundancy for robust outputs. Immunol.
Today 20, 254–257.
Montovani, A., Bonecchi, R., and Locati, M. (2006). Tuning inflammation and immunity
by chemokine sequestration: Decoys and more. Nat. Rev. Immunol. 6, 907–918.
Martinez de la Torre, Y., Buracchi, C., Borroni, E. M., Dupor, J., Bonecchi, R.,
Nebuloni, M., Pasqualini, F., Doni, A., Lauri, E., Agostinis, C., Bulla, R.,
Cook, D. N., et al. (2007). Protection against inflammation- and autoantibody-
caused fetal loss by the chemokine decoy receptor D6. Proc. Natl. Acad. Sci. USA 104,
2319–2324.
Martinez de la Torre, Y., Locati, M., Buracchi, C., Dupor, J., Cook, D. N., Bonecchi, R.,
Nebuloni, M., Rukavina, D., Vago, L., Vecchi, A., Lira, S. A., and Mantovani, A.
(2005). Increased inflammation in mice deficient for the chemokine decoy receptor D6.
Eur. J. Immunol. 35, 1342–1346.
McKimmie, C. S., Fraser, A. R., Hansell, C., Gutiérrez, L., Philipsen, S., Connell, L.,
Rot, A., Kurowska-Stolarska, M., Carreno, P., Pruenster, M., Chu, C. C.,
Lombardi, G., et al. (2008). Hemopoietic cell expression of the chemokine decoy
receptor D6 is dynamic and regulated by GATA1. J. Immunol. 181, 3353–3363.
Nibbs, R. J., Kriehuber, E., Ponath, P. D., Parent, D., Qin, S., Campbell, J. D.,
Henderson, A., Kerjaschki, D., Maurer, D., Graham, G. J., and Rot, A. (2001). The
beta-chemokine receptor D6 is expressed by lymphatic endothelium and a subset of
vascular tumors. Am. J. Pathol. 158, 867–877.
Nibbs, R. J., Wylie, S. M., Yang, J., Landau, N. R., and Graham, G. J. (1997). Cloning and
characterization of a novel promiscuous human beta-chemokine receptor D6. J. Biol.
Chem. 272, 32078–32083.
Palframan, R. T., Jung, S., Cheng, G., Weninger, W., Luo, Y., Dorf, M., Littman, D. R.,
Rollins, B. J., Zweerink, H., Rot, A., and von Andrian, U. H. (2001). Inflammatory
chemokine transport and presentation in HEV: A remote control mechanism for mono-
cyte recruitment to lymph nodes in inflamed tissues. J. Exp. Med. 194, 1361–1373.
Park, M., Penick, E. C., Edwards, J. G., Kauer, J. A., and Ehlers, M. D. (2004). Recycling
endosomes supply AMPA receptors for LTP. Science 305, 1972–1975.
D6 Role in Inflammation and Immune Activation 243

Prevo, R., Banerji, S., Ni, J., and Jackson, D. G. (2004). Rapid plasma membrane-endoso-
mal trafficking of the lymph node sinus and high endothelial venule scavenger receptor/
homing receptor stabilin-1 (FEEL-1/CLEVER-1). J. Biol. Chem. 279, 52580–52592.
Royle, S. J., and Murrell-Lagnado, R. D. (2003). Constitutive cycling: A general mechanism
to regulate cell surface proteins. Bioessays 25, 39–46.
Schaer, C. A., Schoedon, G., Imhof, A., Kurrer, M. O., and Schaer, D. J. (2006). Constitu-
tive endocytosis of CD163 mediates hemoglobin-heme uptake and determines the
noninflammatory and protective transcriptional response of macrophages to hemoglobin.
Circ. Res. 99, 943–950.
Weber, M., Blair, E., Simpson, C. V., O’Hara, M., Blackburn, P. E., Rot, A., Graham, G. J.,
and Nibbs, R. J. (2004). The chemokine receptor D6 constitutively traffics to and from
the cell surface to internalize and degrade chemokines. Mol. Biol. Cell. 15, 2492–2508.
C H A P T E R T W E LV E

Structure–Function Dissection of D6,


an Atypical Scavenger Receptor
Robert J. B. Nibbs,* Pauline McLean,*,† Clare McCulloch,*,†
Alan Riboldi-Tunnicliffe,† Emma Blair,*,† Yanshi Zhu,†
Neil Isaacs,† and Gerard J. Graham*

Contents
1. Introduction 246
1.1. Investigating D6 function using in vitro model systems 247
1.2. D6 as a model for determining chemokine receptor structure 255
Ackowledgments 260
References 260

Abstract
Chemokines direct leukocyte migration by activating intracellular signalling
pathways through G-protein coupled chemokine receptors. However, they
also bind to other surface proteins, including a group of molecules which we
refer to as ‘atypical’ chemokine receptors. One such molecule is D6. D6 is
structurally-related to other chemokine receptors, and binds specific pro-
inflammatory chemokines with high affinity, but surprisingly, when expressed
in heterologous cell lines, it is unable to transduce signals after chemokine
engagement. Instead, by using the approaches outlined in this chapter, evi-
dence has emerged that D6 acts as a chemokine scavenger which uses unique
intracellular trafficking properties to continuously sequester extracellular che-
mokines into cells. It is envisaged that this suppresses inflammation in vivo by
limiting pro-inflammatory chemokine bioavailability, and indeed, D6 deficient
mice show exaggerated inflammatory responses to a variety of challenges. In
addition to the in vitro functional studies, we also describe the methods we
have used to express, purify and analyse large quantities of D6 protein. The
unusually high stability of D6 and its broad subcellular distribution enables D6
to be expressed to very high levels in transfected cells, making it possible, at
least in principal, to produce enough D6 to allow for purification of quantities

* Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Center,


Glasgow University, Glasgow, United Kingdom
{
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow University,
Glasgow, United Kingdom

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05212-4 All rights reserved.

245
246 Robert J. B. Nibbs et al.

suitable for crystallisation. This is a key step on the path towards generating a
three-dimensional structure of the molecule. Thus, the protocols we outline
have helped establish chemokine scavenging as a novel paradigm in chemokine
biology, and may also ultimately provide unprecedented insight into the struc-
ture of D6 and other chemokine receptors.

1. Introduction
Chemokines exert their biological activity by binding to heptahelical
G-protein–coupled receptors (GPCRs) on the surface of their target cells
which activate intracellular signaling pathways (Rot and von Andrian, 2004).
Currently, 10 signaling receptors for the CC chemokines (CCRs1–10) have
been identified, along with 6 for the CXC chemokines (CXCRs1–6) and single
receptors for the XC and CX3C families (Rot and von Andrian, 2004). How-
ever, there also exists a small but discrete family of ‘‘atypical receptors,’’ currently
consisting of DARC, D6, CCXCKR, and CXCR7 (reviewed in Graham,
2009; Mantovani et al., 2006; Nibbs et al., 2003). These molecules show
structural similarity to signaling chemokine receptors, and bind specific subsets
of chemokines with high affinity. Thus, DARC and D6 bind many inflamma-
tory chemokines; CCX-CKR binds to CCL19, 21, and 25; and CXCR7
interacts with CXCL11 and 12. Importantly, however, when expressed in
heterologous cell lines, these molecules are unable to couple to signal transduc-
tion pathways used by typical signaling chemokine receptors and cannot
stimulate cell migration. In fact, in these model systems, atypical receptors
appear completely unable to transduce signals on chemokine binding. This is
associated with subtle alterations in the canonical DRYLAIV motif found in
the second intracellular loop of the signaling chemokine receptors, and mod-
ifying the DKYLEIV motif of D6 to DKYLAIV confers weak ligand-induced
signaling activity (Nibbs, unpublished). Inability to signal in vitro led to
hypotheses that atypical receptors act as chemokine scavengers and/or trans-
porters designed to regulate chemokine abundance and/or localization, and
thereby indirectly control leukocyte migration driven through signaling che-
mokine receptors.
Roles for D6 and CCX-CKR as chemokine scavengers have now been
supported by in vitro studies of transfected cell lines that have clearly shown these
molecules to have specific biochemical properties that enable them
to progressively scavenge large quantities of extracellular chemokines
(Bonecchi et al., 2004, 2008; Comerford et al., 2006; Fra et al., 2003;
McCulloch et al., 2008; Weber et al., 2004). D6 achieves this by constitutively
trafficking to and from the cell surface via early and recycling endosomes
(Bonecchi et al., 2008; Galliera et al., 2004; McCulloch et al., 2008; Weber
et al., 2004). Thus, when an extracellular chemokine binds surface D6, it is
Structure–Function Dissection of D6 247

rapidly internalized. Constitutive trafficking removes the need for signaling


(which is required for effective internalization of typical chemokine receptors),
and simultaneously avoids the obvious constraints to scavenging of receptor
desensitization and surface receptor depletion. Interestingly, chemokine binding
to D6 is particularly sensitive to the low pH found in early endosomes (Weber
et al., 2004), such that any internalized chemokine is rapidly dislodged from D6,
retained inside the cell, and targeted for degradation by lysosomes (Weber et al.,
2004). Meanwhile, internalized D6 continues on its constitutive path back to the
cell surface to become available for more chemokine scavenging. This in vitro
work created a new paradigm of chemokine receptor function, and consistent
with a scavenging role, D6-deficient mice develop exaggerated responses to
inflammatory stimuli ( Jamieson et al., 2005; Martinez de la Torre et al., 2005;
Nibbs et al., 2007; Whitehead et al., 2007), display enhanced inflammation-
associated miscarriage (Martinez de la Torre et al., 2007), show increased suscep-
tibility to inflammation-dependent cancer (Nibbs et al., 2007), and develop fatal
inflammatory responses after Mycobacterium tuberculosis lung infection (Di Liberto
et al., 2008). Notably, these aberrant responses are often associated with elevated
chemokine abundance. Thus, it is clear that D6 is fundamentally involved in the
regulation of in vivo inflammatory responses, and existing evidence strongly
suggests that this is due to its ability to scavenge chemokines.
Here we will describe the in vitro methods that have been used to
provide evidence of D6-mediated chemokine scavenging. Data from
these types of experiments have shaped current models of D6 function,
and continue to inform interpretation of phenotypes observed in D6-
deficient mice. In addition, we will detail the approaches that we have
used to overexpress and purify D6 from transfected mammalian cells as part
of our ongoing efforts to generate a three-dimensional (3D) structure of the
molecule (Blackburn et al., 2004). This was inspired by our finding that D6
is a remarkably stable protein that can be expressed at very high levels in
transfected mammalian cells, making its purification in sufficient quantities
for crystallization a very real possibility.

1.1. Investigating D6 function using in vitro model systems


1.1.1. Cell lines, plasmids, and transfection
In vitro studies of D6 have relied on the use of cell lines transfected with D6
expression constructs. HEK293 cells, which are widely used to study the
biochemistry of other GPCRs including chemokine receptors, have been
our cell line of choice because they are readily transfectible, easy to culture,
and contain a large cytoplasm ideal to visualize intracellular receptor traf-
ficking. They have a tendency to dislodge from plastic during some applica-
tions, and adhere poorly to glass (used in preparation for confocal
microscopy), but adherence can be improved by coating surfaces with
248 Robert J. B. Nibbs et al.

fibronectin at 4  C overnight (or 37  C for 1 h), and then washing briefly


with PBS before the cells are seeded. HEK293 cells are grown in 293
medium (i.e., Dulbecco’s minimal essential medium, 10% fetal calf serum,
5 mM glutamine, plus antibiotics) at 37  C in 5% CO2. For experimenta-
tion performed in the absence of a CO2 source, it is advisable to buffer the
medium with 10 mM HEPES and adjust the pH to 7.4.
For robust expression of D6 and other chemokine receptors in HEK293
cells, the pcDNA3 plasmid from Invitrogen has been our workhorse, allowing
ampicillin selection in bacteria during vector construction, and neomycin/
geneticin (G418) selection in mammalian cells for stable receptor expression
driven by the strong CMV promoter of pcDNA3. Sequences encoding epitope
tags can be introduced by PCR onto the 50 end of the open reading frame
(ORF) of GPCRs, and we have had success with hemagglutinin (HA) tags (i.e.,
YPYDVPDYAGPG inserted between the first two amino acids of the recep-
tor). This enables antibody-mediated detection of the expressed receptor, and is
essential if high-quality antibodies specific for the receptor itself are unavailable,
a common problem with several chemokine receptors. We have been fortunate
to have an effective antihuman D6 antibody (Nibbs et al., 2001), but addition of
the HA tag gives additional options for experimentation and allows the same
antibodies to be used on different HA-tagged receptors, thereby controlling for
antibody-specific effects. To help understand the role of specific residues or
motifs in D6, we have generated pcDNA3-based expression constructs in
which specific mutations have been introduced into the D6 ORF. The
PCR-based Site-Directed Mutagenesis kit from Stratagene works very well
for this in our experience (McCulloch et al., 2008). In addition, to aid D6
visualization in living cells, we have generated and used D6-GFP expression
constructs ( Weber et al., 2004). This was done by using PCR to remove the D6
stop codon and add an appropriate restriction enzyme–cutting site, and then
cloning the modified ORF into the pEGFP-N series of vectors from Clontech.
Fortunately, we have found that in a variety of assays, D6-GFP fusion protein
behaves like untagged D6 protein in HEK293 cells. However, other atypical
chemokine receptors, particularly CCX-CKR, have proved very hard to tag
with GFP for reasons that we do not currently understand. When analyzing D6
function, we have used, where possible, CCR5 or CCR5-GFP as a control
(Weber et al., 2004). CCR5 binds chemokines that also bind D6, such as CCL3,
thus allowing us to compare D6 behavior to that of a typical signaling chemo-
kine receptor using the same chemokine ligand.
pcDNA3-based expression vectors can be readily introduced into
HEK293 cells by a variety of techniques, and we routinely use the lipid-
based reagents, Superfect (Qiagen) or FuGene (Roche). Some optimization
of DNA/Superfect ratios is advisable, but in our experience the manufac-
turer’s recommended conditions consistently yield high transfection
efficiency (40–80%) that are sufficient to allow of emergence of large
numbers of stably transfected HEK293 cell clones. Stable transfection,
Structure–Function Dissection of D6 249

which with HEK293 cells can be achieved by selecting after transfection by


including 0.8 mg/ml G418 in the culture medium, is essential for studies on
D6. D6 is a very stable protein (McCulloch et al., 2008; Weber et al., 2004),
and during transient transfection many cells contain large vacuoles full of D6
protein. These cells do not survive in stable cultures, but the analysis of
transient transfections is confused by these aberrant D6 overexpressing cells.
Once stably transfected, single-cell clones can be derived by limiting dilu-
tion, but we typically work with pools of transfected cells to avoid clonal
artifacts. Using standard techniques described in depth in our published
work (McCulloch et al., 2008; Weber et al., 2004), a number of basic
receptor parameters can be measured in these transfected cells, such as
surface receptor expression (by flow cytometry), the affinity of receptor
for chemokine (by radiolabeled ligand binding assays), and the intracellular
distribution and localization of receptor (by immunofluorescent staining or
direct visualization of D6-GFP coupled to confocal microscopy). However,
this review will focus on methodologies that have been particularly impor-
tant in characterizing the scavenging behavior of D6 in vitro, and revealing
the mechanisms responsible for this activity.

1.1.2. Detection of D6 by Western blotting


Although Western blotting is a widely used technique, initial attempts at
detecting D6 on Western blots were hampered by the tendency of D6 to
form large insoluble aggregates barely capable of entering the gel (Blackburn
et al., 2004). This was caused by the 95  C heating step used to denature proteins
prior to electrophoresis; D6 was able to enter the gel and electrophoresis more
effectively if the incubations were carried out at temperatures less than 60  C
(Blackburn et al., 2004). Thus, we now routinely use the following technique
for D6 detection by Western blotting (McCulloch et al., 2008; Weber et al.,
2004). First, cells are lysed in CellLytic M mammalian cell lysis buffer (Sigma).
Then an equal volume of HU buffer (8 M urea, 5% SDS, 200 mM Tris-HCl,
pH 8, 0.1 mM EDTA, 100 mM dithiothreitol, 0.5% bromphenol blue) is added,
the samples incubated at room temperature (RT) for 10 min, and then subjected
to SDS-PAGE in 4 to 12% w/v gradient acrylamide gels. The proteins are then
electrophoretically transferred onto polyvinylidene difluoride membrane, and
blocked overnight in 10% milk/PBS. Blots are incubated at RT in 10% milk/
PBS containing anti-D6 or anti-HA antibody for 1 to 16 h. After washing
multiple times in PBS/0.1% Tween, primary antibodies are detected by cover-
ing the blot in 10% milk/PBS containing horseradish peroxidase (HRP)–
coupled antimouse IgG secondary antibodies (Amersham Biosciences) for
1 h. After further repeated washes in PBS/0.1% Tween, blots are developed
using chemiluminescence substrates (WestPico or WestFemto kits, Pierce
Chemical) and exposed to x-ray film for appropriate periods of time. This
reliable method of detecting D6 protein has, among other things, been
250 Robert J. B. Nibbs et al.

instrumental in defining post-translational modifications present in D6 (e.g.,


sulfation, phosphorylation) (Blackburn et al., 2004; McCulloch et al., 2008), and
has been essential during our attempts to purify D6 for crystallization (see the
following) (Blackburn et al., 2004). Moreover, by examining the impact of the
protein synthesis inhibitor cycloheximide on the abundance of D6 and a variety
of mutated variants, we are beginning to understand the molecular basis for the
unusually high stability of D6 and its relation to the intracellular trafficking
itinerary of the protein (McCulloch et al., 2008).

1.1.3. Chemokine scavenging assays


A key advance in our understanding of D6 function came when attention
moved away from examining the effect of chemokines on D6, and turned
instead to the effect of D6 on chemokines (Fra et al., 2003; Weber et al., 2004).
Chemokine scavenging assays were developed in which chemokine removal
from the medium, and its subsequent intracellular fate, could be tracked over
time. Labeled chemokines were critical for these experiments, and both radio-
iodinated and biotinylated chemokines have been used effectively.

Radiolabeled chemokines Radioiodinated chemokines are commercially


available (e.g., from Amersham), or recombinant chemokines can be labeled
in-house. Many chemokines are very difficult to radiolabel in a form that
retains bioactivity, but, in our experience, CCL3 can be radioiodinated
with minimal impact on bioactivity (Graham et al., 1993, 1994). Briefly, this
is done by first coating the bottom of a 0.5-ml Eppendorf tube with 10 mg of
IODOGEN (Pierce). This is achieved by dissolving the IODOGEN in
chloroform to 0.1mg/ml, aliquoting 100 ml into the 0.5-ml tube, and then
gently passing an air stream over the surface of the chloroform to encourage
its rapid evaporation. A thin coating of IODOGEN should be visible on the
bottom of the inside of the tube. Then 5 mg of CCL3 (in a maximum of
100 ml of PBS) and 1 mCi of Na125I is added to the tube, and incubated on
ice for 15 min with regular gentle flicking of the tube. The reaction is then
passed down a desalting column (e.g., GF5 excellulose column (Pierce)) to
separate labeled protein from free iodide. Labeled chemokines can be stored
at 4  C for several weeks. We have typically used a mutated version of
mouse CCL3, called PM2, which is restricted in its self-aggregation poten-
tial, because previous experience had shown self-aggregation to be prob-
lematic in receptor-binding assays (Graham et al., 1994). However, we have
also successfully radioiodinated wildtype recombinant human CCL3 and
CCL4 using this methodology.

Biotinylated chemokines Chemokines can be produced by total chemical


synthesis and are extremely tolerant of C-terminal additions. We therefore
had a version of the PM2 form of CCL3 synthesized so that it carried a
C-terminal biotinylated lysine residue (called bioCCL3; Almac Sciences)
Structure–Function Dissection of D6 251

(McCulloch et al., 2008; Weber et al., 2004). A similar version of CCL19,


called bioCCL19, has also been prepared (Almac Sciences) (Comerford
et al., 2006). Both of these biotinylated chemokines are fully functional in
bioassays. They are clearly safer to use than radioiodinated chemokines, but,
depending on the application, cannot be detected with the same sensitivity.
By virtue of the single biotin residue per chemokine molecule, biotinylated
chemokines can be mixed with labeled streptavidin to form chemokine
tetramers that can be used in flow-cytometric and cell-sorting protocols.
Chemokines labeled with biotin postsynthesis are not ideal because they
(1) carry multiple biotin residues, possibly at sites that interfere with bioactiv-
ity, (2) are not uniformly labeled with biotin, and (3) cannot be used to form
good fluorescent tetramers because the presence of multiple biotin residues
per chemokine molecule allows the formation of higher-order structures.

Scavenging assays Radioiodinated chemokines have been used to moni-


tor a variety of receptor properties, particularly their affinity for chemokine
and the level of surface receptor expression. However, it has been their use in
chemokine scavenging assays that has been important in the study of D6,
CCX-CKR, and mutated variants of these molecules. These assays in their
simplest form involve the addition of radioligand to medium bathing cultured
or harvested cells, with samples of medium removed over time (up to 48 h)
for analysis using a gamma counter (e.g., Beckman Gamma 5500B counter).
Adding unlabeled chemokine slows down radiolabeled chemokine removal
and is useful when examining the long-term capability of receptors to
progressively deplete chemokine over time. It is important to note that
internalized radiolabeled chemokine is degraded inside cells and 125I released
back into the medium, so gamma counter readings alone will be misleading,
and it is critical to determine the molecular form of the retrieved radioactivity.
To do this, samples of media can either be examined by SDS-PAGE (drying
the gel under vacuum onto filter paper after electrophoresis and exposing it to
x-ray film), or subjected to precipitation with trichloroacetic acid (TCA).
This precipitates proteins from the medium, including intact radioiodinated
chemokine, while leaving degradation products in the supernatant. To do
this, an equal volume of 25% trichloroacetic acid (TCA) is added to test
samples, the mix incubated at 4  C for 15 min, and then centrifuged (13,000
rpm, 4  C, 15 min). The supernatant is taken, and the TCA precipitate
washed in ice-cold acetone; the acetone wash is combined with the non-
TCA precipitable supernatant. The TCA pellet and non-TCA precipitable
material are then counted in a gamma counter, and the percentage of
retrieved 125I counts in TCA pellet and non-TCA precipitable is calculated
as an indicator of the amount of chemokine degraded.
Biotinylated chemokines can be used in a similar way, but are detected by
Western blotting using HRP-coupled streptavidin (Dako). Cells are incubated
in medium containing bioCCL3 or bioCCL19 and aliquots of medium taken
252 Robert J. B. Nibbs et al.

over time. An equal volume of 2  LB (100 mM Tris-HCl, pH 6.5, 4% SDS,


20 mM dithiothreitol, 20% glycerol, 0.2% bromphenol blue) is added to the
aliquots, which are then boiled for 5 min, and subjected to SDS-PAGE. Blots
are prepared as above, and blocked with 10% milk/PBS. After washing
repeatedly in PBS/0.1% Tween, the blots are exposed to HRP-coupled
streptavidin for 1 h—it is essential that this is done in the PBS/0.1% Tween
rather than in milk, as the milk prevents binding of streptavidin to the immo-
bilized biotinylated chemokine on the blot. Blots are developed as above by
chemiluminescence and the depletion of biotinylated chemokine from the
medium quantified by densitometric scanning of the autoradiographs. For all
these scavenging experiments it is advisable to do parallel experiments using
control untransfected cells lacking receptor, and also include wells which
contain no cells (to control for chemokine adherence to plastic).
To explore the kinetics of chemokine degradation inside cells, chemo-
kine uptake can be synchronized by loading cells at 4  C with radioligand
for 1 h. After a brief (10-min maximum) shift to 37  C to drive chemokine
uptake, remaining external chemokine is washed away and the cells allowed
to process the internalized chemokine at 37  C. All this chemokine will
have been internalized during the initial brief shift to 37  C. At time points
after washing (up to 3 h), triplicate samples are spun (2600 rpm, 5 min,
4  C), the medium removed, and the cell pellet washed in medium. The
original and the wash medium are combined, half of it is subjected to TCA
precipitation (as above), and the amount of radioiodine in the TCA precip-
itable and nonprecipitable fractions determined in a gamma counter. Cell
pellets are resuspended in PBS, and half of the suspension counted in a
gamma counter. To the remaining samples of media and cells, an equal
volume of 2  LB (100 mM Tris-HCl, pH 6.5, 4% SDS, 20 mM dithio-
threitol, 20% glycerol, 0.2% bromphenol blue) is added, the samples are
boiled for 5 min, and then used for SDS-PAGE (see above).
These simple approaches have been used to demonstrate the ability of
D6 and CCX-CKR to mediate the progressive, nondesensitized scavenging
of extracellular chemokines, and to follow the fate of the chemokine
internalized by these receptors. By analyzing D6 variants carrying site-
directed mutations alongside wildtype D6 in these assays it has become
clear that the C-terminus of D6 is particularly important for continuous
chemokine scavenging.

1.1.4. Tracking atypical receptors with antibodies


D6 scavenges chemokines by constitutively trafficking to and from the cell
surface. The first indication of this came from experiments showing that
surface levels of D6 remained unchanged despite active chemokine uptake
(Weber et al., 2004) This was true even if D6-expressing cells were loaded
with high concentrations (up to 100 nM ) of chemokine at 4  C (to achieve
high levels of receptor occupancy) prior to shift to 37  C. In these
Structure–Function Dissection of D6 253

experiments, large amounts of chemokine are internalized very quickly after


shift to 37  C. However, even under these conditions, there was still no
change in surface D6 levels. These data were interpreted as indicating that
chemokine-occupied internalized receptors were instantly replaced by other
receptors from intracellular pools. This idea was supported by the fact that
95% of the total cellular complement of D6 was found in highly motile early
and recycling endosomes inside transfected cells (Weber et al., 2004). To
provide further evidence of constitutive trafficking of D6, antibodies have
been used to track the fate of surface receptors (McCulloch et al., 2008;
Weber et al., 2004), and these techniques are described briefly here.

Antibody feeding to examine constitutive receptor internalization D6-


or D6-GFP-expressing HEK293 cells, or untransfected control cells, are
grown on fibronectin-coated glass chamber slides, washed several times
with PBS and then incubated in SFM (serum-free 293 medium containing
10 mM HEPES, pH 7.4, and 0.2% bovine serum albumin) at 4  C for
30 min. To load surface receptors, anti-D6 or anti-HA antibodies or Fab
fragments of these antibodies are added and cells left at 4  C for a further
30 min. Cells are then washed with ice-cold SFM; as a control ice-cold
SFM adjusted to pH3 can be used to strip off surface antibody. Cells are then
either directly fixed (10 min in 3.5% paraformaldehyde (PFA)) or SFM is
added, and the slides shifted to 37  C. Cells washed with SFM (pH3) are
washed twice with SFM to return the pH to 7.4 before the 37  C incuba-
tion. Chemokines can be added at this point to explore their impact on
antibody trafficking. Cells are left at 37  C for up to 3 h to allow the
antibodies that were on the surface to enter the cell. The antibodies are
then detected by conventional immunostaining protocols. Briefly, cells are
washed with PBS, fixed for 10 min in 3.5% PFA, washed twice with PBS,
and then incubated in 50 mM NH4Cl for 20 min. The fixed cells are then
permeabilized in PGS (PBS, 0.2% gelatin, 0.05% saponin) for 30 min, and
then PGS containing fluorophore-coupled anti-IgG antibodies for 1 h.
After two washes with PGS, the cells undergo a final fixation in 3.5%
PFA for 10 min, a final PBS wash, and the slides are then mounted
in Vectashield (with or without 4,6-diamidino-2-phenylindole) (DAPI)
(Vector Laboratories) under a coverslip sealed with nail varnish in prepara-
tion for confocal microscopy. Control experiments can be performed in the
absence of saponin (the cell-permeabilizing agent). Only surface antibodies
are detected; thus, by comparing these cells to those treated with saponin, it
is possible to get a robust picture of the extent of uptake of the antibodies.

Using antibodies to study receptor recycling Adapting the method above


allows receptor recycling to be examined (Weber et al., 2004). Cells are
plated as before, but this time they are loaded with antibody for up to 1 h at
37  C. They are then washed with cold SFM adjusted to pH 3 (to remove
254 Robert J. B. Nibbs et al.

surface-bound antibodies), and then twice with cold SFM to reset pH to


7.4. Next, the cells are incubated in SFM containing fluorophore-coupled,
anti-IgG antibodies for up to 1 h at 37  C. During this period, any inter-
nalized anti-D6 or anti-HA antibodies that recycle back to the cell surface
will be available to internalize fluorescent anti-IgG antibodies. At the end of
the experiment, cells are washed in PBS, fixed in 3.5% PFA for 10 min,
washed again with PBS, and mounted as described above. Flow cytometry
can also be employed to quantify recycling. In this case, cells are harvested
by mechanical disruption or brief trypsinization before loading them with
anti-D6 or anti-HA antibodies at 37  C for up to 1 h in SFM. Cells are then
washed once with cold SFM adjusted to pH3 (to strip off surface antibo-
dies), twice with cold SFM to restore pH7.4, and finally incubated at 37 or
4  C in SFM containing fluorophore-coupled antimouse IgG antibodies for
up to 1.5 h. After a final PBS wash, cells are analyzed by flow cytometry
with the level of fluorescence providing a direct indication of the extent of
anti-D6 or anti-HA antibody recycling, which in turn reflects the extent
of receptor recycling.

1.1.5. FACS-based chemokine uptake assays


To examine molecular mechanisms underpinning scavenging by D6 and
CCX-CKR, we have developed assays in which fluorescent tetramers can be
used to quantify chemokine uptake (Comerford et al., 2006; Fra et al., 2003;
Weber et al., 2004). Tetramers are generated by mixing bioCCL3 or
bioCCL19 (250 ng) in 10 ml of PBS with 3 mg of Streptavidin-PE (S-PE)
(Molecular Probes) at RT for 1 h. Control samples lacking Bio-CCL3
(i.e., S-PE alone) are also prepared. About 4  105 receptor-expressing
transfected cells, or control untransfected cells, are resuspended in 40 ml of
HEPES-buffered medium, the 10 ml of tetramers or S-PE alone is added, and
the cells incubated at 37  C for 30 to 150 min with regular gentle mixing by
flicking the tube. Next, 1.4 ml of ice-cold FACS buffer (i.e., PBS plus 2% fetal
calf serum) are added to stop uptake, the cells retrieved by centrifugation (2600
rpm, 5 min, 4  C), resuspended in 400 ml of FACS buffer, and passed through a
FACScan flow cytometer. Atypical chemokine receptors will internalize their
cognate chemokine tetramers and fluoresce, detectable in the FL2 channel of
the FACS machine (Comerford et al., 2006; Weber et al., 2004).
Before beginning the experiment, cells can be treated with chemical or
genetic inhibitors of various endocytosis or trafficking pathways to examine
their impact on receptor-mediated chemokine uptake (Comerford et al., 2006;
Weber et al., 2004). In particular, transient transfection of GFP-coupled
protein inhibitors (e.g., dominant-negative forms of caveolin or rab proteins),
coupled to two-color FACS analysis, has allowed a direct examination of the
level of inhibitor expression on chemokine uptake by performing (Comerford
et al., 2006; Weber et al., 2004). In these experiments, controls are essential in
which parental HEK293 or D6- or CCX-CKR–expressing HEK293 cells are
Structure–Function Dissection of D6 255

treated with PE-labeled chemokine tetramers or S-PE alone, after (1) not
having been transiently transfected with GFP constructs, or (2) having been
transiently transfected with untagged GFP (i.e., GFP, which has no protein
attached to it). These samples are then used at the beginning of the analysis to set
the detection parameters of the FACS machine and compensate correctly to
avoid fluorescence bleed-through between channels. Thus, for example, when
analyzing the impact of dominant-negative (DN) rab5-GFP on D6 function
(Weber et al., 2004), PE-/GFP-, GFP-/PEþ, GFPþ/PE-, and PEþGFPþ
gates are set using (1) untransfected parental HEK293 cells fed PE-labeled
CCL3 tetramers or S-PE alone (no red, no green), (2) untransfected D6-
expressing cells fed PE-labeled CCL3 tetramers (red only), (3) GFP-transfected
parental or D6-expressing HEK293 cells fed S-PE (green only), and (4) GFP-
transfected, D6-expressing cells fed PE-labeled CCL3 tetramers (red and
green). Then data are collected from test samples, that is, D6-expressing
HEK293 cells transiently transfected with DN rab5-GFP constructs incubated
in PE-labeled CCL3 tetramers or S-PE only. On analysis, gates of high and low
rab5-GFP expressors can be set, and the mean PE fluorescence intensity and
the number of PE-positive cells determined and compared with identical gates
set on D6-expressing cells expressing untagged GFP, that is, with no DN rab5
attached. These approaches have revealed that atypical chemokine receptors
use different routes for entry into HEK293 cells: CCX-CKR requires caveo-
lin-1 and enters via caveolae/lipid rafts, while D6 uses clathrin-coated pits to
enter rab5þ early endosomes (Comerford et al., 2006; Weber et al., 2004).
In summary, the development of new methodologies to explore how
chemokines are controlled by chemokine receptors has allowed new para-
digms of chemokine receptor function to be proposed, and is beginning to
provide insight into the molecular mechanisms responsible for these unique
chemokine receptor properties. Importantly, despite the limitations of
in vitro model systems, data generated by these approaches underpin our
interpretation of phenotypes observed in animals lacking atypical chemo-
kine receptors, and form the foundation of our understanding of their
function in vivo.

1.2. D6 as a model for determining chemokine


receptor structure
Despite displaying atypical biology and biochemistry, D6 is structurally related
to other chemokine receptors. It shares the common 7-transmembrane
spanning structure and appears to bind chemokines in a manner similar to
typical chemokine receptors. Determination of the 3D structure of D6 would
therefore not just represent an important scientific advance, but would enable
structural modeling of other receptors and assist in the rational design of drugs
targeting these molecules. One major advantage of D6 in terms of determining
structure is the ability of D6 to express to very high levels in heterologous
256 Robert J. B. Nibbs et al.

transfectants, a property dependent in no small part to its very high stability


(Blackburn et al., 2004; Weber et al., 2004; McCulloch et al., 2008). In
addition, since much of the cellular complement of D6 is found inside cells
(Blackburn et al., 2004; Weber et al., 2004; McCulloch et al., 2008), there is a
much greater surface area for the receptor to occupy, providing the potential
for greater levels of expression. It is thus possible in principal to generate
enough D6 in transfected mammalian cells to allow for purification of milli-
gram quantities suitable for routine crystal trialing. Moreover, these high
expression levels remove the need to generate yeast, bacterial or baculoviral
expression systems, and allow for the purification and analysis of functional and
appropriately decorated mammalian D6.

1.2.1. Generation of heterologous transfectants expressing D6


With a few exceptions, we have found that human D6 is expressed at very
high levels in all cell lines tested. However, the combination of high D6
expression, rapid doubling time, and growth to high cell density meant the
murine pre–B suspension cell line L1.2 was preferred for D6 production
(Blackburn et al., 2004). This cell line is maintained in RPMI 1640
containing 5 mM glutamine, 10% heat-inactivated fetal calf serum,
50 mM b-mercaptoethanol and antibiotics. The human D6 cDNA to be
transfected was modified by PCR to encode an N-terminal HA epitope
tag and a stretch of 10 histidine residues (His10) at the extreme
C-terminus. The HA tag enables D6 detection (by flow cytometry and
Western blotting), while the His10 tag allows purification of the protein
using nickel- and cobalt-affinity columns. The resulting cDNA was
verified by DNA sequencing and cloned into pcDNA3 (see above). We
have also generated a variant of D6, which carries the HA and His10 tags,
but which also has the glycosylated Asn19 residue removed by mutation
(Blackburn et al., 2004). This mutation has no effect on chemokine
binding or receptor stability, but since 50% of cellular D6 protein is
glycosylated at this site, its removal improves the homogeneity of the
purified D6 protein and may aid its packing in crystals.
Lipid-based transfection reagents, such as Superfect, proved most effec-
tive for introducing plasmids into L1.2 cells, and a ratio of 6 mg plasmid to
8 ml Superfect gave optimal transfection efficiency. Stable transfectants were
selected by culturing in the presence of 1.6 mg/ml G418 (geneticin), after
previously finding that this effectively kills untransfected L1.2 cells. Single
cell clones were then generated by culture in 96-well plates, seeding
the cells at a concentration of 0.5 cells/well. High-expressing clones were
selected by a variety of approaches, such as flow cytometry (using anti-HA
or anti-D6 antibodies) or radioligand-binding assay. However, surface D6
protein may not accurately reflect total D6 protein. Thus, Western blotting
is now used as the principal method to identify high-expressing clones and
monitor D6 expression under different culture conditions.
Structure–Function Dissection of D6 257

1.2.2. Increasing expression of D6 in transfected L1.2 clones


While we are able to augment D6 expression by clonal selection, we also tested
a number of approaches to induce further production. The histone deacetylase
inhibitor sodium butyrate can increase expression of transcripts from plasmid
vectors in stably transfected cells. Thus we examined the impact of sodium
butyrate on D6 expression, attempting to define an optimal exposure time and
concentration to induce further D6 expression (Blackburn et al., 2004). To do
this, cells were seeded at 5  105 per milliliter in 25-cm2 flasks and either left
untreated or exposed to sodium butyrate (up to 10 mM for up to 48 h). Note
that at concentrations of greater than 10 mM, sodium butyrate was toxic and
resulted in a marked reduction in cell viability. Cells were harvested and D6
levels assessed by Western blotting. This revealed that maximal induction was
reproducibly achieved with 10 mM butyrate after 16 to 20 h exposure.
Subsequent butyrate treatments were standardized at 10 mM for 18 h.
We also assessed the impact of cell density on butyrate responsiveness, but
found that this had a minimal effect on induction of D6 expression. It is
important to note, however, that considerable variation in D6 expression
was caused by the use of different batches of fetal calf serum, and it has been
important to test all serum and select those batches that allow highest D6
expression.

1.2.3. Large-scale production of D6-expressing L1.2 cells


One of the advantages of expressing D6 in suspension cells is the oppor-
tunity to grow these cells to very high density in large volumes of medium.
To maximize this, we have routinely grown cells in large bell jars or a 15-l
Applikon bioreactor (Blackburn et al., 2004). Standard operating proce-
dures have been developed and optimized that provide the highest yield of
D6 protein from both of these culture vessels.

Bell jar protocol Under sterile conditions, 2.5 l of growth medium (see
above) and 500 ml of D6-expressing L1.2 cells are poured into the bell jar.
These cells have been previously maintained in 5  175–cm2 flasks in 37  C,
5% CO2 incubators, and are cultured to ensure that they have a density of
106 cells/ml on the day of seeding the bell jar. Fifty milliliters of 10%
Pluronic F-68 (Gibco)—an antifoaming reagent—are also added. The bell jar
in then incubated, with constant stirring, in a 37  C cabinet and is attached to
sterile compressed air and CO2 sources running at pressures of 500 ml/min
(for air) and 25 ml/min (for CO2). This provides a final concentration of 5%
CO2. Five days later, 50 ml of sterile 1-M sodium butyrate and a further 2 l of
medium are added. The next day the cells are harvested.

Bioreactor protocol The Applikon bioreactor allows continuous monitor-


ing of cultures and automated maintenance of favorable growth conditions.
Consequently, D6 yields per milliliter of culture are typically higher from this
258 Robert J. B. Nibbs et al.

piece of equipment than the bell jars. The bioreactor is loaded with 5 l of
medium and 100 ml of 10% Pluronic F-68. This is allowed to reach 37  C and
pH 7.4 by constant stirring and regulation of the CO2 concentration in the
‘‘air mix’’ being bubbled through the culture. Temperature is maintained by
attaching a controlled heating sheet around the glass bioreactor. Temperature
and pH are constantly monitored and automatically regulated throughout the
culture period. The bioreactor is seeded with 1 l of L1.2 cells (previously
cultured in 10  175–cm2 flasks to 106 cells/ml) and left to grow for 3 days.
On day 4, an aliquot of cells is removed for counting using sterile sampling via
an outflow tube attached to the bioreactor. At this stage, the bioreactor is
perfused by circulating media at low flow rate (3.5 ml/min) through the
bioreactor. This can be achieved in the Applikon bioreactor without losing
cells, and allows the gradual, gentle, and continual replenishment of medium.
This markedly improves cell growth. On day 5, a further aliquot of cells is
taken for counting, perfusion is stopped, the volume of media is increased to
10 l, and 100 ml of 1 M sodium butyrate dissolved in serum-free RPMI is
added to the culture and left for 18 to 24 h. On day 6, the cells are collected
via a ‘‘harvest tube’’ attached to the Bioreactor.

1.2.4. Purification of D6
Cells harvested from the bell jars or the bioreactor are centrifuged at 3500
rpm for 10 min in 500-ml bottles in a GS-3 rotor in a Sorval centrifuge. The
cell pellets are washed twice with PBS and then resuspended in 50 ml of
buffer A (20 mM phosphate buffer, 150 mM NaCl, 10% [v/v] glycerol,
pH 8.0, containing dissolved complete EDTA-free protease inhibitor cock-
tail tablets [Roche]) and stored at –20  C. D6 is then purified by one of the
following two methods (Blackburn et al., 2004).

Solubilization using DDM At all stages, samples are kept on ice and
protease inhibitor tablets added as appropriate. Cells from 5 l of culture
are disrupted using a French press (6555 kPa; 950 lbf/in2), and cell debris
removed by centrifugation for 20 min at 20,000g. Membranes are isolated
by centrifugation at 120,000g for 1 h, and the pellet resuspended in 50 ml of
buffer A containing 0.05% (w/v) CHS (cholesteryl hemisuccinate, Sigma)
and 2% (w/v) DDM (n-dodecyl b-D-maltoside, Glycon). This is stirred
gently for 2 h at 4  C, after which any insoluble debris is removed by
a 30-min spin at 120,000g. Solubilized membranes are then applied to a
5-ml nickel Hitrap column (Amersham Biosciences) connected to an
AKTA Purifier 100 (Amersham Biosciences). A step gradient of imidazole
in buffer A (containing 0.2% DDM and 0.005% CHS) is applied, with
D6 eluting at 300 mM imidazole. Western blotting is used to identify
fractions containing D6, which are then combined. For further purification
and concentration of D6, the imidazole is reduced to 15 mM by dilution
in buffer A (containing 0.2% DDM and 0.005% CHS), the sample is added
Structure–Function Dissection of D6 259

to 1 ml of Talon cobalt resin (BD Clontech), packed on a column, and the


D6 eluted with 150 mM imidazole.

Solubilization using digitonin Cell pellets are solubilized at RT for 3 h


with constant stirring in 2% digitonin in the presence of a full protease
inhibitor cocktail and DNAase (to degrade DNA released during cell lysis).
The mix is then spun at 7000 rpm for 30 min, in 50-ml Falcon tubes, in a
benchtop centrifuge to pellet insoluble material. The soluble fraction is then
further cleared by centrifugation at 20,000 rpm for 30 min in a Beckman
ultracentrifuge. An equal volume of glycerol is added to the soluble fraction,
along with 5ml of Talon resin, and the mixture stirred at 4  C for 3 to 16 h.
During this time, the His10 tag on D6 should bind to the cobalt of the Talon
resin. The resin is then packed into an empty column, using a peristaltic
pump, and washed with 50 mM Tris-HCl (pH 7.5)/500 mM NaCl/30 mM
Imidazole. D6 is eluted using a 30- to 500-mM imidazole gradient (in the
same Tris/NaCl buffer). D6 elutes at 100 to 250 mM imidazole and can be
detected by Western blotting aliquots of the eluted fractions.
Finally, with D6 samples prepared using either approach, imidazole is
removed using PD-10 columns (Amersham Biosciences), and further
concentration of the D6 protein is achieved using Centricon columns
(Vivascience). Purified D6 is then quantified using the BCA (bicinchoninic
acid) assay (Pierce), and examined by Western blotting and Coomassie
staining of polyacrylamide gels.

1.2.5. Functional assays


Crystal trials with purified D6 are underway, with a view to generating a 3D
structure of this molecule. We have also examined the ligand binding
properties of purified D6 protein using scintillation proximity assays
(Blackburn et al., 2004) and Biacore surface plasmon resonance–based
technology (unpublished data). Another simpler approach has been to use
D6 immobilized on nickel affinity beads to ‘‘pull down’’ biotinylated
chemokines. His10-tagged purified D6 is first immobilized on the beads
and then fed biotinylated CCL22 (bioCCL22, Almac Sciences), or pre-
mixed with bioCCL22 before the nickel beads are added. Controls are
performed in which D6 or bioCCL22 are omitted from the reaction.
Once all reagents have been added, the mixture is incubated at 37  C for up
to 30 min and the nickel beads then retrieved by centrifugation at 14,000 rpm
for 10 min. The supernatant is removed and beads washed twice in 30 mM
imidazole/500 mM NaCl/50 mM Tris (pH 7.5), centrifuging at 14,000 rpm
for 10 min after each wash to retrieve the beads. After the final wash
solution has been removed, half the bead pellet is mixed with 20 ml of
LDS loading dye (Invitrogen) while the remainder is mixed with 300 mM
imidazole/500 mM NaCl/50 mM Tris (pH 7.5) to disrupt the interaction of
the His10 tag on D6 with the nickel beads. This is then span at 14,000 rpm
260 Robert J. B. Nibbs et al.

for 10 min and the supernatant mixed with an equal volume of LDS loading
dye. Finally, the beads are stripped with EDTA (200 mM ), and the super-
natant mixed with an equal volume of LDS Loading dye. All samples are
then run on SDS-PAGE, Western blots prepared, and probed for D6 (as
described above using anti-D6) and bioCCL22 (as described above using
HRP-coupled streptavidin). In these experiments, we have found, as
expected, that His10-tagged D6 binds very well to nickel beads, and
importantly, that only in the presence of D6 is bioCCL22 also capable of
binding to the beads. Although we do not yet know whether all purified D6
molecules retain chemokine binding activity, this simple ‘‘pull-down’’ assay
has provided reassuring evidence that D6 can retain chemokine-binding
activity after the rigors of its purification from L1.2 cells.
The unique biochemical properties of D6 have made it possible to
consider its purification in sufficient quantities to generate crystals with
which to determine its three-dimensional structure. Clearly, this is not a
trivial task but by optimizing D6 expression in a cell line that can be
grown to high density in large culture vessels, and by developing methods
to purify and analyze this protein, we are making progress toward this
goal. It is hoped that armed with these methodologies, we will soon be
in a position to provide the first structural information on a crystallized
chemokine receptor.

ACKOWLEDGMENTS
The authors are supported by research grants from the Biotechnology and Biological
Sciences Research Council. R.J.B.N. thanks A. Wilson for providing support services.

REFERENCES
Blackburn, P. E. (2004). Purification and biochemical characterization of the D6 chemokine
receptor. Biochem. J. 379, 263–272.
Bonecchi, R. (2004). Differential recognition and scavenging of native and truncated
macrophage-derived chemokine (macrophage-derived chemokine/CC chemokine
ligand 22) by the D6 decoy receptor. J. Immunol. 172, 4972–4976.
Bonecchi, R. (2008). Regulation of D6 chemokine scavenging activity by ligand- and
Rab11–dependent surface up-regulation. Blood 112, 493–503.
Comerford, I., Milasta, S., Morrow, V., Milligan, G., and Nibbs, R. (2006). The chemokine
receptor CCX-CKR mediates effective scavenging of CCL19 in vitro. Eur. J. Immunol.
36, 1904–1916.
Di Liberto, D. (2008). Role of the chemokine decoy receptor D6 in balancing inflammation,
immune activation, and antimicrobial resistance in Mycobacterium tuberculosis
infection. J. Exp. Med. 205, 2075–2084.
Fra, A. M. (2003). Cutting edge: Scavenging of inflammatory CC chemokines by the
promiscuous putatively silent chemokine receptor D6. J. Immunol. 170, 2279–2282.
Structure–Function Dissection of D6 261

Galliera, E. (2004). Beta-arrestin-dependent constitutive internalization of the human


chemokine decoy receptor D6. J. Biol. Chem. 279, 25590–25597.
Graham, G. J. (2009). D6 and the atypical chemokine receptor family: Novel regulators of
immune and inflammatory processes. Eur. J. Immunol. 39, 342–351.
Graham, G. J. (1993). Characterization of a receptor for macrophage inflammatory protein 1
alpha and related proteins on human and murine cells. Cell Growth Differ. 4, 137–146.
Graham, G. J. (1994). Aggregation of the chemokine MIP-1 alpha is a dynamic and
reversible phenomenon. Biochemical and biological analyses. J. Biol. Chem. 269,
4974–4978.
Hansell, C. A., Simpson, C. V., and Nibbs, R. J. (2006). Chemokine sequestration by
atypical chemokine receptors. Biochem. Soc. Trans. 34, 1009–1013.
Jamieson, T. (2005). The chemokine receptor D6 limits the inflammatory response in vivo.
Nat. Immunol. 6, 403–411.
Mantovani, A., Bonecchi, R., and Locati, M. (2006). Tuning inflammation and immunity
by chemokine sequestration: Decoys and more. Nat. Rev. Immunol. 6, 907–918.
Martinez de la Torre, Y. (2005). Increased inflammation in mice deficient for the chemokine
decoy receptor D6. Eur. J. Immunol. 35, 1342–1346.
Martinez de la Torre, Y. (2007). Protection against inflammation- and autoantibody-caused
fetal loss by the chemokine decoy receptor D6. Proc. Natl. Acad. Sci. USA 104,
2319–2324.
McCulloch, C. V. (2008). Multiple roles for the carboxy-terminal tail of the chemokine
scavenger D6. J. Biol. Chem. 283, 7972–7982.
Nibbs, R. J. (2007). The atypical chemokine receptor D6 suppresses the development of
chemically induced skin tumors. J. Clin. Invest. 117, 1884–1892.
Nibbs, R. J. (2001). The beta-chemokine receptor D6 is expressed by lymphatic endothe-
lium and a subset of vascular tumors. Am. J. Pathol. 158, 867–877.
Nibbs, R., Graham, G., and Rot, A. (2003). Chemokines on the move: Control by the
chemokine ‘‘interceptors’’ Duffy blood group antigen and D6. Semin. Immunol. 15,
287–294.
Rot, A., and von Andrian, U. H. (2004). Chemokines in innate and adaptive host defense:
Basic chemokinese grammar for immune cells. Annu. Rev. Immunol. 22, 891–928.
Weber, M. (2004). The chemokine receptor D6 constitutively traffics to and from the cell
surface to internalize and degrade chemokines. Mol. Biol. Cell 15, 2492–2508.
Whitehead, G. S. (2007). The chemokine receptor D6 has opposing effects on allergic
inflammation and airway reactivity. Am. J. Respir. Crit. Care Med. 175, 243–249.
C H A P T E R T H I R T E E N

Modeling Small Molecule–Compound


Binding to G-Protein–Coupled
Receptors
Nagarajan Vaidehi,* James E. Pease,† and Richard Horuk‡

Contents
1. Introduction 264
2. Similarity and Differences in the Crystal Structures of Class-A
GPCRs Solved to Date 265
3. GPCR Modeling Methods 266
3.1. Homology structure modeling methods 266
3.2. Ab Initio modeling methods 267
3.3. Ligand-docking methods 270
4. Computational Methods for Receptor Flexibility and Ligand-
Induced Conformational Changes in GPCRs 271
4.1. Liticon method 273
5. Validation of GPCR–Ligand Models 274
5.1. General strategies for mutagenesis 275
5.2. Receptor binding 278
6. Conclusions 284
References 286

Abstract
G-protein–coupled receptors (GPCRs) form a superfamily of membrane proteins
that play a crucial role in mediating physiological processes as well as patho-
genesis of many critical diseases. They are one of the most successful drug
targets, accounting for more than 30% of prescription drugs on the market
today. Three-dimensional structural information on GPCRs will greatly aid the
drug design process, and great strides are being made in obtaining crystallo-
graphic information on GPCRs. Since this process is both tedious and risky,
a combination of computational methods and biophysical experiments is a
useful approach to rapidly obtain information on a wide variety of GPCRs.

* Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, California, USA
{
Leukocyte Biology Section, National Heart and Lung Institute, Imperial College London, London,
United Kingdom
{
Department of Pharmacology, UC Davis, Davis, California, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05213-6 All rights reserved.

263
264 Nagarajan Vaidehi et al.

In this review, we describe the methods/protocols involved in these computa-


tional techniques, as well as methods for site-directed mutagenesis and ligand-
binding assays that are currently being used for validating structural-model and
small-molecule–ligand binding to GPCRs. We discuss the merits and pitfalls of
the various methods used in obtaining structural and dynamic information for
ligand binding to GPCRs. Another important factor to consider in drug design is
the conformational flexibility of GPCRs since it has been shown that small-
molecule ligands of varied efficacy stabilize different receptor conformations
leading to functional selectivity of ligands. We discuss the computational
methods used to study this specific ligand-induced state.

1. Introduction
The superfamily of membrane-bound proteins known as G-protein–
coupled receptors (GPCRs) play a critical role in many physiological pro-
cesses as well as in the pathogenesis of many diseases (Lefkowitz, 2004).
GPCRs form the largest superfamily of membrane proteins that are targeted
by more than 30% of the blockbuster drugs in the market today (Schlyer and
Horuk, 2006). Drug design for the GPCR family can be challenging for
a number of reasons, not least of which is the fact that GPCRs within a
subfamily can have high sequence identity to each other, making it difficult
to obtain subtype-specific drugs. Another important factor in drug design is
that GPCR conformations are highly dynamic and this conformational
flexibility leads to structural and functional diversity in this highly conserved
topology for this class of receptors. Small-molecule ligands of varied efficacy
stabilize different receptor conformations (Kobilka and Deupi, 2007) lead-
ing to functional selectivity of ligands (Mailman, 2007; Urban et al., 2007).
This ligand-induced specific state is important for drug design as well.
Recently great strides have been made in solving the crystal structures
of squid rhodopsin (Murakami and Kouyama, 2008), ligand-free opsin
(Park et al., 2008) with and without the carboxy terminus peptide of the
G-protein–bound receptor (Scheerer et al., 2008), turkey b1-adrenergic
receptor (Warne et al., 2008), human b2-adrenergic receptor (Cherezov
et al., 2007; Rosenbaum et al., 2007), and human adenosine A2A receptor
( Jaakola et al., 2008). These structures are in addition to the earlier crystal
structures of inactive rhodopsin (Li et al., 2004; Okada et al., 2004; Palczewski
et al., 2000). The structures of turkey b1-adrenergic, and human b2-
adrenergic receptor, human adenosine A2A receptor and squid rhodopsin
are in their inactive conformations. The ligand-free opsin and G-protein-
peptide–bound opsin are in partially active to active state of the receptor.
This surge in crystal structures not only facilitates crystallization of other
class A GPCRs, but also opens new doors for understanding the dynamics of
GPCR conformations and drug discovery research on class A GPCRs.
Small-Molecule Binding to GPCRs 265

Understanding small-molecule binding to GPCRs requires two steps:


(1) deriving a structural model of the receptor, and (2) modeling the
small-molecule–binding site in the receptor structural model. This invol-
ves a combination of biophysical methods and computational methods.
Structural studies that include crystallography, NMR, other spectroscopic
methods such as FRET and spin labeling require sufficient quantities of
solubilized purified protein that is especially tedious for GPCRs due to the
requirement for optimization of detergent for solubilization. Therefore,
cell-based studies such as radiolabeled ligand binding, site-directed muta-
genesis, competition binding experiments, and efficacy assays are more
readily feasible for many GPCRs. Since these studies do not give direct
structural information, the results in combination with a structural model
generated using computational methods have been used widely to study
ligand binding to GPCRs (Kristiansen, 2004). In this review, we will
address the current status of these methods and analyze the merits and
pitfalls of the methods.

2. Similarity and Differences in the Crystal


Structures of Class-A GPCRs Solved to Date
The remarkable similarity of the structures of b-adrenergic receptors,
adenosine A2A receptor, and rhodopsin with less than 20% sequence simi-
larity reveals high structural homology in class A GPCRs. However, there
are subtle but important differences in the structures, especially in the
extracellular (EC) and intracellular (IC) loop regions that are critical to
ligand access to the binding site, ligand binding, and G-protein coupling.
The extracellular loop 2 (ECL2) is more open in the b-adrenergic receptor
structures in comparison to the rhodopsin structures, perhaps facilitating the
entry and exit of diffusible small molecules. Unlike rhodopsin, the overall
shape of the transmembrane (TM) barrel of b-adrenergic receptors is more
open in the EC half than the IC half. The interhelical salt bridge between
helix 3 and helix 6—the so-called ‘‘ionic lock’’—is absent in the inactive
conformation of b-adrenergic, and A2A receptor structures, but is intact in
the inactive rhodopsin structure, and broken in the partially active ligand-
free opsin structure. It is possible that the ionic lock is not necessarily present
in the inactive structure (Vogel et al., 2008). As shown by some elegant spin
labeling and EPR experiments, the ionic lock is broken upon activation of
rhodopsin (Farrens et al., 1996) that is also evident in the opsin structure.
Thus, the ligand-free opsin structure with the G-protein–peptide bound is
an eye-opener to the active state of class A GPCRs and provides a template
to model the active state conformation of class A GPCRs that could show
selectivity to agonists.
266 Nagarajan Vaidehi et al.

3. GPCR Modeling Methods


Computational methods play a key role in modeling small-molecule
binding to class A GPCRs (Schlyer and Horuk, 2006). Here we describe the
methods used for predicting structural models for class A GPCRs, and give
specific examples for modeling chemokine receptors. The computational
methods available to date rely on structural information from biophysical
experiments and crystal structures of GPCRs to different degrees. Two
classes of computational methods are used for modeling GPCRs: (1) com-
parative or homology modeling methods, and (2) ab initio methods that use
minimal or no experimental information.

3.1. Homology structure modeling methods


Homology modeling methods use the similarity of the modeled protein
to protein(s) with known structure(s). Commonly, homology modeling
methods require more than 40% sequence identity to the template structure
to generate a reliable model (Eswar et al., 2008). However, class A GPCRs
exhibit remarkable structural homology as evidenced from the available
crystal structures of GPCRs, even when the sequence identities are less
than 20%. For GPCRs, the template structures would be rhodopsin, opsin,
or beta-adrenergic receptors; or the adenosine A2A receptor; or a combina-
tion of these structures. There are several software packages that perform
homology modeling, including MODELLER (Eswar et al., 2008), Prime
(Schrodinger Inc), DSModeler (Accelrys Software Inc), ICM (Molsoft Inc),
Sybyl (Tripos Inc), MOE (Chemical Computing Group Inc) and Swiss-
Model (available via ExPASy, http://www.expasy.org). In this review,
we will describe the general requirements for materials and methods for
these homology modeling software packages. For specific details on each of
the methods, see individual software package manuals and a review on this
subject by Akbar et al. (2006).

3.1.1. Materials
 Access to any of the software packages listed above. Some of them are free
of cost for academic users.
 A computer running Red Hat Linux/Unix, Microsoft Windows 98/
NT/2000/XP, or Apple Mac OSX operating systems; 512 MB RAM
or higher; minimum of 1 GB of free hard-disk space for the output files
generated, especially after optimization methods used for structure
refinement.
 Knowledge of scripting languages such as Python and/or Perl, depending
on the software used to run the scripts used for each package.
Small-Molecule Binding to GPCRs 267

3.1.2. Methods
Homology modeling methods in general involve three major steps:
 Identification of the template structure to be used for modeling the
GPCR under investigation.
 The sequence alignment of the GPCR to be modeled with the sequences
of the template(s). In the case of class A GPCRs, highly conserved residues
in each TM helix are used for alignment to b-adrenergic receptors,
rhodopsin, and A2A receptors.
 Methods to optimize the main-chain and side-chain conformations to
refine the structure.
The quality of the homology model depends on the similarity in the
sequence alignment and the resolution of the template structure used.
The modeled structures have the same backbone as the template structure,
and this could be misleading for sequences with low similarity to the
template. For GPCRs, the helical kinks, the tilt and rotational orientation
of the TM helices can thus be misplaced; therefore, homology models have
to be optimized to enable docking of ligands of different sizes and shapes.
Refinement of the homology model is usually performed using a combina-
tion of tools such as molecular dynamics (MD), that is, molecular mechanics
combined with experimental information as constraints. In the absence of
direct structural information, optimization of the model is based on the user’s
intuition and indirect experimental results such as effects of point mutation
on ligand binding. Homology modeling techniques have been successful in
obtaining small-molecule hits from virtual screening of ligands for some cases
(Bissantz et al., 2003; Schyler and Horuk, 2006). These models will become
more robust with the availability of more crystal structures. While these
models are useful in explaining experimental observations, the quality
of the model is dependent on the pre-existing experimental information
on the receptor structure. Hence, these methods have limited use for
GPCRs with very little experimental information.

3.2. Ab Initio modeling methods


Ab initio structure prediction methods such as Predict (Becker et al., 2004;
Shacham et al., 2004) and MembStruk (Trabanino et al., 2004; Vaidehi
et al., 2002) use little or no experimental information, resulting in less bias
in the GPCR model. Unlike homology models, these methods generate an
ensemble of low-energy conformations that can be used for small-molecule
docking. Here we describe briefly the various steps involved in these
ab initio methods. Predict is a software package developed and used inter-
nally at Epix pharmaceuticals and hence the details of using this software are
not known.
268 Nagarajan Vaidehi et al.

3.2.1. Materials
 A computer running Red Hat Linux/Unix, 512 MB RAM or higher;
minimum of 5 GB of free hard disk space for the output files generated.
MembStruk has a graphical user interface that can be used to execute the
various steps involved in modeling the GPCR structure.

3.2.2. Method
The MembStruk computational method uses the topological arrangement
information of the seven TM helices from rhodopsin or the b-adrenergic
receptor as a starting template for further optimization.
 The first step of the MembStruk method is identification of the TM
helices in the sequence, using a hydrophobicity profile generated from a
multiple sequence alignment. The accuracy of the TM length predictions
is plus or minus three residues on each terminus of the helix, and this is
achieved by including sequences with low sequence identity (less than
20%) in generating the multiple sequence alignment.
 Canonical a-helices are built and the helices are arranged in an initial
template similar to those of rhodopsin or b-adrenergic receptors. Unlike
homology modeling, this procedure uses only the rough relative orienta-
tions of the helical axes, with no data on atomic positions. This serves as
the starting point for optimization of the helices in the helical bundle.
 The translational orientation of the TM helices is optimized by aligning
the residues that represent the position of maximum hydrophobicity in
each of the TM helix to a plane. The initial rotational orientation
positioning of the helices is based on hydrophobic moment and each
helix is rotated so that the net hydrophobic moment of the middle of the
helix (14 residues about the hydrophobic maximum) is pointing toward
the lipid bilayer.
 The helical kinks are optimized by performing MD simulations on
individual helices with all atom force field (Mayo et al., 1990) in low
dielectric medium representing the lipid.
 Optimization of the rotational orientation of the helices: The optimiza-
tion of the rotational orientation of each helix with respect to the TM
bundle is important in determining which residues are inside the bundle.
The rotational orientation is further optimized by deliberately rotating
each of the seven helices by plus or minus 30 degrees in 5-degree incre-
ments, and reassigning the side-chains conformation using SCWRL
(Canutescu et al., 2003); the potential energy of the rotated helix in the
presence of all other helices is minimized. We start this procedure with
helix3 and then take the best rotation angle for helix3 and further perform
this optimization for helix4, followed by helices 5, 6, 7, 1, and 2. This
allows optimization of the TM bundle based on the sequence of the
Small-Molecule Binding to GPCRs 269

GPCR being modeled, and hence produces models with backbone


structures that are different from rhodopsin or the b-adrenergic receptors.
 A finite layer of lipids (dilauroylphosphatidylcholine) is packed around
the TM bundle from the previous step using rigid body MD (Lim et al.,
1996).
 Generation of an ensemble of low-energy conformations in MembStruk:
GPCR conformations exist in multiple conformations, and therefore this
method generates an ensemble of low-energy receptor conformations.
This is done by systematically varying the rotational orientation of each
helix by 5 degrees and then optimizing the TM barrel and calculating the
total potential energy of the rotated helix. The number of inter-helical
hydrogen bonds and salt bridges formed in each rotated conformation is
calculated as well. Using this information, a set of rotations is chosen
based on the lowest energies for each helix, and the maximum number of
interhelical hydrogen bonds especially hydrogen bonds made by the
residues in the middle of the TM helices.
 Extra- and intra-cellular loops are added using the loop builder modules
in the software What If (Vriend, 1990) or MODELLER (Eswar et al.,
2008).
The accuracy of the predicted models from MembStruk is of low
resolution, typically 2Å to 3Å in backbone conformation of the TM helices.
In addition, the approximations in the placement of side chains due to the
limited number of rotamer structures available for membrane proteins
(Chamberlain and Bowie, 2004) lowers the resolution of these all atom
models even further. However, we demonstrate that the MembStruk
method can be used to generate a model for the human CCR1 chemokine
receptor with no experimental information on the structure of CCR1.
The Predict computational method (1) generates multiple coarse-grain
packing for a GPCR. This coarse-grain optimization allows for different
topological arrangement of the TM helices. B) The coarse-grain models that
score better than the decoys are further optimized with the fine-grain MD
optimization procedure (Becker et al., 2003). There are several class A
GPCR models generated using Predict, as well as some small-molecule
hits obtained for a few GPCRs as a part of a commercial effort, but the
description and accuracy of these models has not been published.
Given the lack of structural information for many class A GPCRs, these
low-resolution models have been shown to be useful in generating hypoth-
eses to be tested by experiments (Becker et al., 2006; Hall et al., 2009;
Vaidehi et al., 2006). We predicted the structural model of human
CCR1 using MembStruk. The resulting structure has the following inter-
helical hydrogen bonds similar to that of bovine rhodopsin and the two
b-adrenergic receptors. Using the GPCR numbering system of Ballesteros
and Weinstein (1995), we find that the residue D802.50 makes a 2.9-Å
270 Nagarajan Vaidehi et al.

hydrogen bond with N2977.49 and a 2.1-Å hydrogen bond with N521.50.
E1203.39 forms a 2.9-Å hydrogen bond with N2977.49 and a longer
hydrogen bond with H2937.45 on helix7. There is a weak or perhaps a
water-mediated hydrogen bond between N752.45 and W1584.50 and also
between S792.49 and S1193.38. The information gleaned from this model is
valuable for understanding the similarities and differences between chemo-
kine receptors and other class A GPCRs with known structures.

3.3. Ligand-docking methods


Docking of small molecules to proteins with high-resolution structures is an
arduous task in drug design and begs the question of how useful these
low-resolution models really are. It has been shown both for soluble
proteins and for membrane proteins that low-resolution models have a
better chance of predicting the binding sites of ligands of various sizes and
shapes (Bissantz et al., 2003; Rockey and Elcock, 2006; Wojciechowski
and Skolnick, 2002).
Docking of small molecules to GPCRs is usually performed using
various ligand-docking methods such as DOCK (Freddolino et al., 2004;
Vaidehi et al., 2002, 2006), AutoDock (Hiramoto et al., 2004), Glide
(Hall et al., 2009), Flex (Bissantz et al., 2003), or GOLD (Ashton et al.,
2004). One explanation for why the small-molecule docking works well
on the low-resolution receptor models for GPCRs is that unlike globular
proteins, GPCRs have a few polar or charged residues in the TM domain.
Many small-molecule GPCR agonists, antagonists, or inverse agonists
that are known to bind in the TM domain are polar in nature. Thus, the
few polar ligand–receptor interactions can be captured more simply, com-
pared to the numerous hydrophobic interactions in GPCR ligand–receptor
interactions. However, straightforward application of the ligand-docking
methods and selection of the best-scoring docked conformation for GPCRs
does not yield the top-scoring ligand-docked conformation in agreement
with point mutation results. Instead, a hierarchical approach that retains
multiple ligand-docked conformations and further incorporates constraints
and/or induced fit docking followed by optimization of the receptor and
ligand is needed to obtain a docked conformation that fits the site-directed
mutagenesis data. Since these methods are well established, we suggest
that the reader consult a review of these methods elsewhere (Sousa et al.,
2006).

3.3.1. Ligand docking to ab initio model of CCR1


The ligand BX471 was docked to the MembStruk model of human CCR1
using a hierarchical procedure based on the DOCK program (Vaidehi et al.,
2006). In brief, the procedure is as follows: Using the DOCK program,
several docked conformations of the ligand were generated and the
Small-Molecule Binding to GPCRs 271

top-scoring 100 conformations were chosen by buried surface of the ligand


and the DOCK scores for further optimization. The 100 docked-ligand con-
formations were minimized in potential energy using the conjugate gradient
method with the receptor fixed, and 10% of the top-scoring conformations
were chosen by binding energy. Binding energy was calculated as the
difference in potential energy of the ligand in the receptor, and the potential
energy of the ligand in water was represented using the generalized Born
continuum solvation model (Ghosh et al., 1998). The resulting top-scoring
10 CCR1/BX471 complex conformations were further optimized by
minimizing the potential energy of the receptor and the ligand and selecting
the top-scoring docked conformation by binding energy.
Analysis of the docked structure of BX471 in hCCR1 (shown in
Fig. 13.1) showed that residues Y1133.32 and Y1143.33 and I2596.55 interact
strongly with BX471 via hydrophobic and pi-stacking interactions. The
role of explicit water in the ligand binding was further examined by
performing MD simulations of the CCR1/BX 471 complex in explicit
lipid bilayer and water using the NAMD program (Phillips et al., 2005). We
found that the urea group is highly flexible and forms hydrogen bonds with
water molecules that enter the binding region rather than with the residues
in CCR1 receptor. The predictions made from this model were verified
subsequently by site-directed mutagenesis and radiolabeled-ligand binding
as discussed in the following sections.
GPCRs have a wide variety of small-molecule ligands with varied
efficacy, such as the full agonists, strong partial agonists, weak partial
agonists, neutral antagonists, and inverse agonists. These various types of
ligands elicit different levels of biological signaling efficacy at saturating
concentrations by inducing conformational changes to different extents,
thus stabilizing a ‘‘ligand-induced specific state’’ (LISS) (Kobilka and
Deupi, 2007; Urban et al., 2007; Yao et al., 2006). Thus, an understanding
of the conformational dynamics of GPCRs, especially for the agonist-
bound active states, is important in achieving functional specificity in drug
design (Mailman, 2007). Therefore, optimizing one model for a given
GPCR is clearly inadequate and it is vital to account for receptor flexibility
when ligands are bound.

4. Computational Methods for Receptor


Flexibility and Ligand-Induced
Conformational Changes in GPCRs
The models that account for ligand-induced conformational changes
are useful in gaining insights into the activation mechanism of GPCRs.
Changes in inter-residue distances upon activation have been measured
272 Nagarajan Vaidehi et al.

Figure 13.1 The predicted binding site of BX471 in the human CCR1 chemokine
receptor. (A) A top view of the predicted structure of BX 471 in the CCR1 binding
pocket. The residues shown in red (Tyr-113, Tyr-114, and Ile-259) are responsible for
anchoring the ligand in this cavity. The binding site shown is located between trans-
membrane helices 3, 4, 5, 6, and 7. (B) The residues within 5Å of the ligand BX471 are
shown in pink sticks. The residues Y1133.32, Y1143.33, and I2596.55 shown in red
contribute the most to the binding of BX471 in human CCR1. (From Vaidehi, N.,
Schlyer, S., Trabanino, R. J., Floriano, W. B., Abrol, R., Sharma, S., Kochanny, M.,
Koovakat, S., Dunning, L., Liang, M., Fox, J. M., de Mendonca, F. L., Pease, J. E.,
Goddard, W. A., 3rd, and Horuk, R. (2006). Predictions of CCR1 chemokine receptor
structure and BX 471 antagonist binding followed by experimental validation. J. Biol.
Chem. 281, 27613–27620.)

using spin labeling and fluorescent measurements (Farrens et al., 1996; Yao
et al., 2006). The active state model of rhodopsin has been modeled using
annealing MD simulations with the available experimental data as
Small-Molecule Binding to GPCRs 273

constraints (Gouldson et al., 2004; Niv et al., 2006). All-atom MD simula-


tions for 2 ms on trans-retinal bound rhodopsin have provided valuable
insight into the counterion switching mechanism for activation (Crozier
et al., 2007; Martinez-Mayorga et al., 2006). Another method of predicting
the active state conformation is by using the elastic network model (ANM/
GNM), where the inter-residue contacts obtained from experiments are
used in computing the principal components of molecular motion by
inverting the Hessian matrix (Isin et al., 2008). These methods have been
successful in uncovering some of the mechanisms associated with ligand-
induced conformational changes, with partial validation of experimental
observations.
Vaidehi and coworkers have recently developed computational methods
that systematically map the conformational changes in GPCRs in response
to ligand binding (Bhattacharya et al., 2008a, 2008b). This method, known
as Liticon, combines the systematic spanning of simultaneous rotational
orientation of all the TM helices that will speed up the conformational
search, followed by all-atom MD simulation on the best energy structure
chosen from the systematic spanning analysis. This method does not use the
experimental information as input for optimization, but the experimental
information is used in validating the predicted active-state model.

4.1. Liticon method


 The first step of the Liticon method is to pack a finite section of a lipid
bilayer (dilauroyl phosphatidyl choline) around the structure of the
GPCR with the docked ligand using rigid body MD simulations.
 The next step is to identify which of the TM helices are in direct contact
with the ligand and would undergo conformational changes due to ligand
binding. To this end, systematic spanning of rotational orientation of each
helix is performed independently, in the presence of ligand. In this step,
individual TM helices are rotated from –180 to þ180 degrees in incre-
ments of 5-degree rotations and the energy of the helix calculated. The
helices whose potential energy shows substantial changes upon rotation
with ligand present will be mapped using this procedure.
 This step involves simultaneous systematic spanning of the rotational
orientation of TM helices identified to affect ligand binding in the pre-
vious step. Such an optimization procedure would allow us to go over
barriers that MD simulations cannot overcome. This process generates
tens of thousands of receptor conformations. For each conformation, the
following optimization steps are performed:
Optimization of all side-chain conformations using SCWRL 3.0.
Conjugate gradient minimization of the potential energy of the ligand
in the field of the rest of protein fixed until convergence of 0.1 kcal/
mol-Å RMS deviation in force per atom is achieved.
274 Nagarajan Vaidehi et al.

Calculation of the ligand-binding energy defined as the difference of the


potential energy of the ligand with protein fixed, and the potential
energy of the free ligand calculated in water using the generalized
Born solvation method (Ghosh et al., 1996).
Interhelical and ligand-receptor hydrogen bonds using HBPLUS 3.0
(McDonald and Thornton, 1994).
 This generates a multidimensional binding-energy landscape that is used to
identify all the local minima in the landscape and cluster them in coordinate
space using the k-means clustering algorithm. The best binding-energy
conformation from each cluster is taken and then sorted by total number
of interhelical HB and ligand-receptor HB, and by binding energy. The
final ligand-stabilized receptor structural model is then selected based on
low binding energy and high number of hydrogen bonds.
 Subsequently, long time-scale MD simulation is performed on the best
minimum chosen from the previous step in explicit lipid and water. This
step will optimize the helical kinks and tilts in response to the ligand
binding.
 Liticon has been recently validated for prediction of active state of
rhodopsin and compared to the experimental results on meta-rhodopsin
and the ligand-free opsin structure (Bhattacharya et al., 2008a). It has also
been used to predict the ligand-stabilized conformational states of the
human b2 adrenergic receptor (b2AR) with bound ligands of various
efficacies (Bhattacharya et al., 2008b). Virtual ligand screening of small-
molecule database shows that agonist-stabilized conformations show
preference to agonists (of varied chemical structure) compared to the
antagonist- or inverse agonist–bound structure.

5. Validation of GPCR–Ligand Models


Once the GPCR of interest has been modeled, and the small com-
pound docked by in silico means, a network of putative interactions between
the receptor and compound can be envisaged. The validity of the model can
then be assessed by laboratory investigation. A substantial part of our
experience in this area is with the validation of antagonist-binding sites of
chemokine receptors and the following methods are described with those
systems in mind. However, as long as suitable systems for measuring GPCR
expression and activation are available, then these may be interchanged.
An approach that we have employed following analysis of a model is to
generate mutations of the amino acids implicated in contacting the antago-
nist. This is achieved by mutation of the relevant receptor cDNA housed in
a plasmid such as pCDNA3 (Invitrogen) allowing high-level expression in
mammalian systems, under the hCMV promoter. Since the model is likely
Small-Molecule Binding to GPCRs 275

to suggest interactions of the compound with several amino acids of the


GPCR, then we recommend the use of a transient transfection system,
allowing data to be generated rapidly without the need to generate a battery
of stable cell lines. In the first instance, we interrogate the model by asking
three questions of each point mutation:
 Does the mutation affect cell surface expression of the GPCR?
 If the mutant GPCR is expressed at the cells surface, is it still functional?
 If the mutant GPCR is still functional, then is it still amenable to
antagonism by the small molecule of interest?

5.1. General strategies for mutagenesis


Several systems are available for mutagenesis and typically rely upon the
process of ‘‘overlap PCR’’ to introduce the desired mutation (Ho et al.,
1989). This involves the design of complementary overlapping oligonu-
cleotide primers that introduce the desired mutation by means of a
mismatch in the DNA sequence. We favor the use of kits such as
Quikchange (Stratagene, CA), which amplify the entire plasmid, circum-
venting the need for a subsequent cloning of the mutant receptor cDNA.
We have also found it advantageous to introduce an HA-epitope tag at the
amino-terminus of the receptor by an in-frame insertion at the 50 region of
the open reading frame between the first and the second codons. This tag
encodes only nine additional amino acids and does not appear to interfere
with ligand binding. Importantly, it allows cell surface expression to be
easily examined following transfection.
Once mutated, the cDNA is sequenced to check that the desired muta-
tions have been introduced, prior to expression in a suitable system. For our
studies of chemokine receptors, we have found that a leukocyte cell line
such as the murine pre–B-cell L1.2 affords good expression and subsequent
functionality of the introduced receptor.

5.1.1. Maintenance of the L1.2 cell line


Reagents
 RPMI 1640 medium with Glutamax-I, 25 mM HEPES (Invitrogen cat.
no. 72400-021)
 Certified fetal calf serum (Invitrogen,, cat. no. 16000-044)
 Penicillin/streptomycin liquid (Invitrogen, cat. no. 15140-122)
 100 nonessential amino acids (Invitrogen, cat. no. 11140-035)
 1 mM b-mercaptoethanol (Invitrogen, cat. no. 31350-010)
 1 mM sodium pyruvate (Invitrogen, cat. no. 11360-039)
Heat inactivate the calf serum by incubating at 55  C for 30 min. Aliquot
into 50-ml volumes, and store at –20  C until needed.
276 Nagarajan Vaidehi et al.

To a 500-ml bottle of RPMI 1640 medium with Glutamax-I, 25 mM


HEPES, add the following:
 50 ml of heat-inactivated calf serum
 5 ml of penicillin/streptomycin
 5 ml of nonessential amino acids
 0.5 ml of mercaptoethanol
 5 ml sodium pyruvate
This buffer referred to as ‘‘complete’’ RPMI medium, can be stored at
4  C until needed. L1.2 cells should be maintained in this medium at a
concentration of 0.5 to 1  106 cells/ml until required for transfection. We
find that transfection of cells over a concentration of 1.5  106 cells/ml leads
to suboptimal expression.

5.1.2. Transient transfection of L1.2 cells


Reagents and Equipment
 Biorad Gene-Pulser II Electroporator (or equivalent)
 Gene Pulser cuvettes, 0.4-cm gap electrode (Biorad Laboratories, Hercules,
CA, cat. no. 165-2088)
 tRNA from baker’s yeast, 10 mg/ml solution (Sigma-Aldrich, cat. no.
R-8508)
 RPMI 1640 medium (1), liquid with GlutaMAXTM I, 25 mM HEPES
(referred to as simple RPMI) (Invitrogen, cat. no.72400-054)
 RPMI complete medium (see section on L1.2 cell maintenance)
 Sodium butyrate (Sigma-Aldrich, cat. no. B-5887)

Method All procedures are to be carried out in a laminar flow hood to


maintain sterility of the cells.
1. Dissolve the sodium butyrate in sufficient tissue culture–grade water to
make a 10-mM solution. Pass this through a 0.4 mm filter into a sterile
container and keep at room temperature (RT), protected from light.
2. For each transfection, set aside a single electroporation cuvette into which a
fixed amount of tRNA is placed to act as a carrier (50 ml of a 10 mg/ml
solution). To the tRNA add the appropriate amount of plasmid DNA
containing the cDNA of interest is added. For each 1  106 of L1.2 cells
to be transfected, use 1 mg of plasmid DNA. We have successfully
transfected between 0.5 and 40  106 L1.2 cells in each cuvette.
3. From a stock of L1.2 cells at log phase, take an aliquot and after counting
with a hemocytometer, centrifuge the desired amount of cells for 5 min at
300g, RT, and decant the media. Resuspend the L1.2 cell pellet in the
appropriate amount of simple RPMI media, namely 800 ml of simple
RPMI for each transfection and mix the cells by gently flicking the cuvette.
Incubate at RT for 20 to 30 min (preferably inside the flow hood).
Small-Molecule Binding to GPCRs 277

4. Electroporate the cells at 330 volts and 975 mF. If the electorporator is
set to view the time constant, this typically reads 16 ms following
transfection.
5. Incubate the cuvette at RT for 20 to 30 min (preferably inside the hood).
6. Break any surface cell clump by gentle pipetting and transfer the contents
of the cuvette into a T-75 tissue-culture flask, containing enough
complete RPMI at a final concentration of 1  106 cells/ml.
7. Incubate the transfected cells for 3 to 5 h at 37  C, 5% CO2 in a tissue-
culture incubator.
8. Add sufficient sodium butyrate solution to a final concentration of
10 mM (1:100 dilution).
9. After 18 to 24 h of culture, examine receptor cell surface expression by
flow cytometry.

5.1.3. Assaying receptor expression


Reagents
 Primary antibody: For instance, HA.11, Mouse anti-HA monoclonal
antibody (Covance Research Products, cat. no. MMS-101R)
 Secondary antibody: For example, goat antimouse FITC labeled F(ab’)
2 (Dako Cytomation, cat. no. F0479)
 Bovine serum albumin (BSA), fraction V powder (Sigma-Aldrich, cat.
no. A2153)
 Dulbecco’s phosphate buffered saline (D-PBS) 1X (Invitrogen, cat. no.
14040-174)
 1 M HEPES solution (Invitrogen, cat. no. 15630-049)
 TO-PRO-3 iodide, 1 mM solution in DMSO (Invitrogen, cat. no.
642/661)

Stock Solutions
 10% sodium azide solution (1000 stock solution): Dissolve 2 g of
sodium azide in 20 ml of milli-Q grade water. Store at RT.
 Flow cytometry staining buffer: To a 500-ml bottle of PBS, add 1.25 g of
BSA and dissolve by gentle stirring to make a 0.25% (w/v) solution.
Readjust the pH to 7.4 if necessary by adding five to eight drops of 1 M
NaOH. Add 500 ml of 10% sodium azide solution.

Method All incubations are to be carried out on ice unless otherwise


stated.
1. From the flask of transfected L1.2 cells, take an aliquot and after counting
with a hemocytometer, place the appropriate volume in a suitable tube
(e.g., Falcon 12  75-mm test tubes, cat. no. 352052) and centrifuge for
278 Nagarajan Vaidehi et al.

5 min at 300g at RT, and then decant the media. Typically, 0.5 to
1  106 transfected cells are adequate for staining.
2. Resuspend the cell pellet by gentle pipetting in 100 ml of staining buffer
containing either the primary antibody or isotype control at 10 mg/ml
and incubate for 15 to 30 min.
3. Wash the cells by adding 1 ml of staining buffer and centrifuge at 300g
for 5 min at RT.
4. Decant the supernatant and resuspend the cells in 100 ml of secondary anti-
body diluted in staining buffer (1:20) and incubate cells for 15 to 30 min.
5. Wash the cells as in Step 3 and resuspend cells in 500 ml of staining buffer
containing TO-PRO3 at a dilution of 1:10,000.
6. Read the samples on the flow cytometer following the manufacturer’s
instructions.
We typically acquire 10,000 events and analyze the staining of live cells
by excluding cells in the FL4 channel, which are TO-PRO3þve and
therefore dead.
Notes: The primary and secondary antibodies of choice should be compati-
ble with the detection of the constructs to be analyzed. We routinely make use
of an HA epitope tag, and therefore use an anti-HA primary antibody for
detection. Likewise, we find the goat antimouse secondary antiserum fit
for detection. It may pay to titer the concentrations of both antibodies to get
the best staining.

5.2. Receptor binding


5.2.1. Radioligand binding assays
Reagents and equipment
 Radiolabeled chemokine of choice (2200 Ci/mmol) (New England
Nuclear)
 Appropriate unlabeled competing chemokines and antagonists
 RPMI 1640 Medium (1X), liquid with GlutaMAXTM I, 25 mM HEPES
(Invitrogen, cat. no. 72400-021)
 Bovine serum albumin (BSA), fraction V powder (Sigma-Aldrich, cat.
no. A2153)
 96-well polypropylene plates
 0.4-ml soft polypropylene tubes (Sarstedt, Numbrecht, Germany, Cat.
no. 72.700)
 Nyosil M-25Oil (TAI Lubricants, Inc, Hockessin, DE)
 LP3 tubes (Luckham, Burgess Hill, UK)
 Canine nail clippers
Stock solution
 Binding buffer: 0.1% BSA in RPMI. Readjust the pH to 7.4 if necessary
by adding five to eight drops of 1 M NaOH. Add sufficient 10% sodium
azide solution to give a final concentration of 0.05%.
Small-Molecule Binding to GPCRs 279

Method
1. Prepare serial dilutions of the relevant unlabeled chemokines using the
binding buffer. If the appropriate dose–response is unknown, then final
concentrations of 0.03, 0.1, 0.3, 1, 3, 10, 30, and 1000 nM may prove a
useful staring point. From a 10-mM stock of unlabeled chemokine, dilute
2 ml in 80 ml and 0.6 ml in 80 ml to give 2.5 stock concentrations of
100 nM and 30 nM, respectively. These can be diluted 1:10 to produce
80 ml of each subsequent concentration.
2. Prepare 100 ml of a 1 nM stock concentration of 125I-labeled chemokine
in binding buffer. Refer to the data sheet accompanying the product, but
typically this involves a 1:20 to 1:50 dilution of the radiolabel in binding
buffer.
3. Resuspend the transfected L1.2 cells at 1  106 cells in 25 ml in binding
buffer.
4. Into duplicate wells of the plate, pipette 20 ml of the serial dilutions of
chemokines. In addition, pipette 20 ml of binding buffer into two
separate wells. To each well, also add 5 ml of the diluted radiolabeled
chemokine.
5. Into each well, pipette 25 ml of the transfected cells and mix gently by
pipetting up and down a couple of times. Incubate at RT for 60 to
90 min.
6. While this is incubating, prepare tubes for centrifugation by pipetting
100 ml of Nyosil oil in the 0.5-ml tubes. We find a repeating pipette
helpful here.
7. Prepare 10 ml of salt wash by dissolving 0.4 g of NaCl in assay buffer.
8. At the end of the incubation into each well, pipette 50 ml of salt wash and
mix by gentle pipetting. Remove 80 ml of the mixture and layer onto a
separate centrifugation tube. Close the lids of these tubes and pellet
through the oil by centrifugation at 10,000g for 3 min. After centrifuga-
tion, a cell pellet should be visible at the bottom of the tube and the
binding buffer should be visible as a layer on top of the oil.
9. Using the canine nail clippers, cut the bottom of the tube into an
appropriate counting tube from the supernatant and collect both frac-
tions. We use LP3 tubes on a Canberra Packard Cobra 5010 gamma
counter (Canberra Packard, Pangebourne, UK).
The data are routinely presented as the percentage of maximal binding
observed in the presence of buffer alone and can be subjected to curve
fitting and subsequent analysis using appropriate software such as PRISM
(GraphPad Software Inc, San Diego, CA).
Notes: The dose–response curve should be sigmoidal in nature. For sub-
sequent experiments using antagonists to inhibit ligand binding, we recom-
mend using the same fixed concentration of radiolabeled chemokine as used
for competition with unlabeled chemokine, substituting the unlabeled
280 Nagarajan Vaidehi et al.

chemokine with the appropriate antagonist. We recommend starting with a


range of 0.01 nM to 10 mM of antagonist in the first instance and modifying
this if necessary.
As discussed above, to verify the predicted binding site of a GPCR
elucidated by receptor modeling, receptor mutants have to be generated and
tested in a number of ways. The mutants will, as discussed, include key
residues predicted to be in the binding pocket for the small molecule that
has been docked into a receptor cavity of a GPCR. As an example, recent
modeling with the CCR1 receptor identified several residues, including
Y1133.32, Y1143,33, and I2595.55, as forming contact points with the CCR1
antagonist BX471 (Fig. 13.1). Alanine scan mutants of these residues were
then generated and tested in receptor binding and in chemotaxis assays (to
be described in the following) to verify their role in the antagonist-binding
site. CCR1 point mutants that included these and other residues were all
transiently expressed at high levels on the surface of L1.2 cells (as described
previously). The CCR1 point mutants were tested for the ability of BX 471
to displace the specific binding of 125I-CCL3 to the wildtype and mutant
receptors. Whole-cell binding assays on transiently transfected L1.2 cells
were performed using 0.05-nM radiolabeled CCL3 and increasing concen-
trations of unlabeled competitor. In all experiments, each data point was
assayed in triplicate. Data are presented as the percentage of counts obtained
in the absence of cold competing ligand. The binding data were curve fitted
with the computer program PRISM (GraphPad Software Inc, San Diego,
CA) to determine the affinity and number of sites.
Using this competition-binding assay, the mutations Y113A3.32 and
Y114A3.33 on TM3 and I259A6.55 on TM6 resulted in a significant reduc-
tion in binding of BX 471. Specifically, while the antagonist binds to the
wildtype receptor with an IC50 of 10 nM, the IC50 for the Y113A3.32 and
I259A6.55 mutants is greater than 10 mM, and for Y114A3.33 it is greater than
5 mM. The large effects of these three mutations on BX471 binding had
been predicted in the computational mutation studies that showed a change
in binding energy of 6.28, 5.79, and 9.24 kcal/mol, respectively. A major
assumption in receptor mutagenesis studies is that any loss of function
observed is due to the mutation alone and does not involve structural
changes in the molecule. Such an assumption is generally valid for surface
residues, but is not necessarily true for buried (structural) large hydrophobic
or aromatic residues. Since the residues identified as important for binding,
Y1133.32, Y1143.33, and I2596.55 are buried hydrophobic or aromatic resi-
dues it was important to determine that the mutations did not perturb the
structure of the receptor. To test the structural integrity of the three CCR1
mutants Y113A3.32, Y114A3.33, and I259A6.55, both displacement binding
and chemotaxis studies with the CCR1 ligand CCL3 were carried out.
These studies were carried out in HEK 293 cells that constitutively
expressed high levels of wildtype CCR1 receptor. The binding studies
Small-Molecule Binding to GPCRs 281

revealed that all three mutants had very similar affinities for binding of
CCL3 (WT Ki ¼ 31.8  16.1 nM, Y113A3.32 Ki ¼ 22.3  3.1 nM,
Y114A3.33 Ki  15.3  3.3 nM, I259A6.55 Ki ¼ 14.7  4.9 nM ). These
data suggest that the mutations did not alter the structural integrity of
CCR1, and thus further validated the idea that they played a key role in
ligand binding of the antagonist BX471.

5.2.2. Direct binding assays


Direct binding assays with a 125I-labeled CCR1 antagonist, BX691, were
used to further characterize the CCR1 antagonist–binding site.

Method
1. SPA beads (wheat germ agglutinin–coated beads) were resuspended at a
concentration of 500 mg in 5 ml of binding buffer(50 mM HEPES,
5 mM MgCl2, 1 mM CaCl2, 100 mM NaCl, 5% BSA, pH 7.5). The
beads were stored at 4  C overnight and warmed to RT before use.
2. HEK293 cells expressing recombinant CCR1 were resuspended in
binding buffer at 1  106 cells/ml and 20,000 cells per assay point
were used. Cells were incubated with SPA beads for 30 min at RT
and rotated end over end.
3. Prepare serial dilutions of the CCR1 antagonist, BX 471 using the
binding buffer. From a 100 mM stock of unlabeled BX 471, dilute 2 ml
in 80 ml and 0.6 ml in 80 ml to give 2.5 stock concentrations of 1000 nM
and 300 nM, respectively. These can be diluted 1:10 to produce 80 ml of
each subsequent concentration.
4. Prepare 100 ml of a 1-nM stock concentration of 125I-labeled BX 691 in
binding buffer. This involves a 1:20 to 1:50 dilution of the radiolabel
in the binding buffer.
5. Into duplicate wells of the plate pipette 5 ml of the serial dilutions of the
BX 471. To each well, also add 5 ml of the diluted radiolabeled BX 691.
6. 6. Into each well, pipette 40 ml of the transfected cells/SPA bead mixture
and mix gently by pipetting up and down a couple of times. The plates
were sealed with a clear sealer and incubated for 60 to 90 min at RT on
an orbital shaker.
7. The receptor bound 125I-BX 691 excited the scintillant embedded in the
beads and triggered a signal that could be detected by scintillation
counter (Wallac Microbeta). Nonspecific binding was determined in
the presence of 100 nM of unlabeled ligand.
8. The data are routinely presented as the percentage of maximal binding
observed in the presence of buffer alone and can be subjected to curve
fitting and subsequent analysis using appropriate software such as
PRISM (GraphPad Software Inc, San Diego, CA).
282 Nagarajan Vaidehi et al.

The resulting compound BX 691 is a functional antagonist for CCR1


with similar potency (Ki 1.7 nM ). Since BX 471 and BX 691 behave
similarly as CCR1 antagonists, 125I-BX 691 was used to characterize
the direct interaction of small-molecule CCR1 antagonists with CCR1.
125I-BX 691 binds to CCR1 on human monocytes as well as on HEK293

cells that express the receptor. The binding is dose-responsively inhibited by


unlabeled BX 471 and BX 691, with affinities similar to those for displacing
125I-CCL3 binding. However, the CCR1 agonists CCL3, CCL5, and

CCL7 failed to displace 125I-BX 691 binding to CCR1, suggesting that


they do not bind to the same site on the receptor as the antagonists. These
data clearly suggest that BX 471 and BX 691 are allosteric antagonists of
CCR1 and bind to sites on the receptor that are nonoverlapping and distinct
from the agonist-binding site. Indeed, structure–function studies have
revealed that chemokines such as CCL3 bind to CCR1 via residues in the
N-terminus and in the extracellular loops.
Finally, the receptor mutants are analyzed to determine whether they are
capable of responding functionally to a challenge by chemokines and that the
antagonist can block this response, that is, whether it is a functional antago-
nist. To evaluate this response, we routinely carry out chemotaxis experi-
ments using the same transfected L1.2 cells that we described previously.

5.2.3. Assaying chemokine receptor function by chemotaxis


Reagents
 RPMI 1640 medium with Glutamax-I, 25 mM HEPES (Invitrogen, cat.
no. 72400-021)
 Bovine serum albumin (BSA), fraction V powder (Sigma-Aldrich, cat.
no. A2153)
 96-well disposable chemotaxis plate (Neuroprobe, cat. no. 101-5)
 Chemokines of interest, preferably in PBS at a concentration of 10 mM

Stock solutions
 Blocking buffer, RPMI 1% BSA
 Dissolve 0.1g BSA (bovine serum albumin) in 10 ml of simple RPMI
(A volume of 10 ml is enough to block one plate.)
 Assay buffer, RPMI 0.1% BSA

Make a 1/10 dilution of the blocking buffer with simple RPMI.


A volume of 10 ml is enough to run an assay using one 96-well plate.

Method
1. Into each well of the plate that will be used, pipette 30 ml of blocking
buffer. Incubate for 30 min at RT. This step prevents excessive
adhesion of chemokines to the plastic.
Small-Molecule Binding to GPCRs 283

2. Prepare serial dilutions of the relevant chemokines using the assay


buffer. If the appropriate dose–response is unknown, then a range of
0.1, 1, 10, 100, and 1000 nM may prove to be a useful starting point as
follows:
To make a 1 mM solution, take 8 ml stock chemokine (10 mM ), add 72 ml
assay buffer and mix by gentle flicking of the tube. From this, similar
serial dilutions can be made to generate 80-ml volumes of 100-nM,
10-nM, 1-nM, and 0.1-nM chemokine dilutions.
3. Centrifuge the L1.2 transfectants for 5 min at 300g at RT.
4. Resuspend cells in a volume of assay buffer such that each 20-ml buffer
contains 2  105 cells.
5. Remove the blocking buffer from each well of the chemotaxis plate
with a pipette or a water vacuum with a tip at the end.
6. Into duplicate wells, pipette a final volume of 31 ml of each of the
chemokine dilutions. Into two separate wells also pipette 31 ml of assay
buffer.
7. Secure the membrane on top of the plate by reference to the pegs,
making sure that no air bubbles are visible between the plate and the
membrane.
8. Onto the top of each filter, pipette 20 ml of the cell suspension.
9. Incubate plate in a humidified chamber for 5 h at a 37  C tissue-culture
incubator with 5% CO2.
10. Carefully scrape the cells from the top of the membrane, taking care to
avoid damaging the membrane.
11. Using a hemocytometer, count the number of cells in each well migrat-
ing to the various concentrations of chemokine and to the buffer
control.
12. Subtract the average of the buffer control counts from the averages of
the other wells to generate a dose–response of migration to the
appropriate chemokine.
Notes: The dose–response curve is typically bell-shaped in nature, and
for subsequent experiments using antagonists to inhibit cell migration, we
recommend choosing a fixed concentration of chemokine that provides a
significant level of chemotaxis, but is suboptimal, that is, to the left of the
bell-shaped curve. Assay buffer can be prepared using a fixed concentration
of chemokine and serial dilutions of antagonists generated in this buffer.
These are placed in the lower well as before and cell migration assessed as
before. This should generate a sigmoidal dose–response curve. We recom-
mend starting with a range of 0.01 nM to 10 mM of antagonist in the first
instance and modifying this if necessary.
We used this assay recently to analyze CCR1 mutants that we had tested
in receptor-binding assays as described above. The residues we had identi-
fied as important for binding in this study—Y1133.32, Y1143.33, and
284 Nagarajan Vaidehi et al.

A B
2500 3000

691 bound (CPM)


691 bound, CPM

2000 2500

2000
1500
1500
CCL3 CCL3
1000 CCL5
CCL5 1000
CCL7 CCL7
125I-BX

125I-BX
500 BX 471
500 BX 471
BX 691 BX 691
0 0
−12 −11 −10 −9 −8 −7 −6 −12 −11 −10 −9 −8 −7 −6
Log [competitors], M Log [competitors], M

Figure 13.2 Inhibition of 125I-BX 691 binding to human CCR1 by unlabeled antagonists
and agonists on HEK293 cells stably expressing CCR1 (A) and human monocytes (B). Cells
were incubated for 60 min at RT with 125I-BX 691 in the presence of increasing concentra-
tions of compounds or chemokines. The bound 125I-BX 691 was determined using SPA
technology. Nonspecific binding was defined as the binding in the presence of 1 mM
unlabeled BX 691. Data are shown as total binding standard error from three independent
experiments. (From Vaidehi, N., Schlyer, S., Trabanino, R. J., Floriano, W. B., Abrol, R.,
Sharma, S., Kochanny, M., Koovakat, S., Dunning, L., Liang, M., Fox, J. M.,
de Mendonca, F. L., Pease, J. E., Goddard, W. A., 3rd, and Horuk, R. (2006). Predictions
of CCR1 chemokine receptor structure and BX 471 antagonist binding followed by
experimental validation. J. Biol. Chem. 281, 27613–27620.)

I2596.55—were buried hydrophobic or aromatic residues, and it was impor-


tant to determine that the mutations we made did not perturb the structure
of the receptor. To test for the structural integrity of the three CCR1
mutants Y113A3.32, Y114A3.33, and I259A6.55, we carried out both
displacement-binding and chemotaxis studies with the CCR1 ligand
CCL3. The binding studies revealed (Fig. 13.2) that all three mutants had
very similar affinities for binding of CCL3 (WT Ki ¼ 31.8  16.1 nM,
Y113A3.32 Ki ¼ 22.3  3.1 nM, Y114A3.33 Ki ¼ 15.3  3.3 nM, I259A6.55
Ki ¼ 14.7  4.9 nM ). In addition, all three mutants responded chemotac-
tically in a similar dose-responsive manner as wildtype CCR1 to increasing
concentrations of CCL3 (Fig. 13.3). These data strongly suggested that
the mutations did not alter the structural integrity of CCR1, and thus
validated our contention that they played a key role in ligand binding of
the antagonist BX 471.

6. Conclusions
We have described state-of-the-art methods for small-molecule binding
in GPCRs, with an example of BX471 binding to the chemokine receptor
CCR1. Through this description of results on CCR1, we have shown
that a combination of computational models and site-directed mutagenesis
Small-Molecule Binding to GPCRs 285

120

100

80

% Migration
WT
60 Y113A
Y113F
40 Y114A
I259A
L260A
20 Y291A

0
0.001 0.01 0.1 1 10 100 1000 104
Log BX 471 (nM)

Figure 13.3 BX 471 inhibition of CCL3-mediated chemotaxis of L1.2 cells transiently


expressing selected CCR1 point mutants. (A) Dose–response curves of BX 471 inhibition
of CCL3-induced chemotactic responses of L1.2 cells transiently expressing selected
CCR1 point mutants. The inhibition of the responses of each construct to a 10 nM
concentration of CCL3 is illustrated. Data are representative of a typical experiment of at
least two independent experiments. (From Vaidehi, N., Schlyer, S., Trabanino, R. J.,
Floriano, W. B., Abrol, R., Sharma, S., Kochanny, M., Koovakat, S., Dunning, L., Liang,
M., Fox, J. M., de Mendonca, F. L., Pease, J. E., Goddard, W. A., 3rd, and Horuk, R.
(2006). Predictions of CCR1 chemokine receptor structure and BX 471 antagonist binding
followed by experimental validation. J. Biol. Chem. 281, 27613–27620.)

experiments is vital to elucidate the binding sites of small molecules in GPCRs.


It also suggests that structure-based in silico rational drug design for GPCR
targets is feasible using the validated structural models.
The level of approximations involved in the computational modeling of
ligand binding and calculation of binding energies in GPCRs to date would
allow us to differentiate a very good binder (<10 nM binding affinity) from
weak binding compounds with greater than 1 mM binding affinity. There-
fore, the GPCR models are useful in choosing residues for site-directed
mutagenesis that decrease or increase the binding substantially. The results
of the effect of mutations on the binding affinity and efficacy of ligands can
be interpreted with the models. Nevertheless, mutation experiments do not
give direct structural information, and some of the mutations may elicit a
secondary response on the binding of the ligands. It is possible that certain
mutations would not lead to good surface expression of the mutant recep-
tors, while other mutants would express but are dysfunctional. Therefore,
combining spectroscopic data such as change in inter-residue distances upon
ligand binding/activation with the structural model to get direct structural
information is useful. In the absence of such data for many GPCRs, it is
important to understand the limitations of the model based on the experi-
mental results. However, the interplay of experiments and modeling allows
the improvement of computational methods.
286 Nagarajan Vaidehi et al.

REFERENCES
Akbar, N., Sitkoff, D., and Krystek, S. (2006). A comparative study of available software for
high-accuracy homology modeling: From sequence alignments to structural models.
Protein Sci. 15, 808–824.
Ashton, M., Charlton, M. H., Schwarz, M. K., Thomas, R. J., and Whittaker, M. (2004).
The selection and design of GPCR ligands: From concept to the clinic. Comb. Chem.
High. Throughput Screen 7, 441–452.
Ballesteros, J., and Weinstein, H. (1995). Integrated methods for modeling G-protein
coupled receptors. Methods Neurosci. 25, 366–428.
Becker, O. M., Marantz, Y., Shacham, S., Inbal, B., Heifetz, A., Kalid, O., Bar-Haim, S.,
Warshaviak, D., Fichman, M., and Noiman, S. (2004). G. protein–coupled receptors:
In silico drug discovery in 3D. Proc. Natl. Acad. Sci. USA 101, 11304–11309.
Becker, O. M., Shacham, S., Marantz, Y., and Noiman, S. (2003). Modeling the 3D
structure of GPCRs: Advances and application to drug discovery. Curr. Opin. Drug
Discov. Dev. 6, 353–361.
Becker, O. M., Dhanoa, D. S., Marantz, Y., Chen, D., Shacham, S., Cheruku, S., Heifetz, A.,
Mohanty, P., Fichman, M., Sharadendu, A., Nudelman, R., Kauffman, M., and
Noiman, S. (2006). An integrated in silico 3D model-driven discovery of a novel, potent,
and selective amidosulfonamide 5-HT1A agonist (PRX-00023) for the treatment of
anxiety and depression. J. Med. Chem. 49, 3116–3135.
Bhattacharya, S., Hall, S. E., and Vaidehi, N. (2008a). Agonist-induced conformational
changes in bovine rhodopsin: Insight into activation of G-protein–coupled receptors.
J. Mol. Biol. 382, 539–555.
Bhattacharya, S., Hall, S. E., Li, H., and Vaidehi, N. (2008b). Ligand-stabilized conforma-
tional states of human beta(2) adrenergic receptor: Insight into G-protein–coupled
receptor activation. Biophys. J. 94, 2027–2042.
Bissantz, C., Bernard, P., Hibert, M., and Rognan, D. (2003). Protein-based virtual screening
of chemical databases. II. Are homology models of G-protein coupled receptors suitable
targets? Proteins 50, 5–25.
Canutescu, A. A., Shelenkov, A. A., and Dunbrack, R. L., Jr. (2003). A graph theory
algorithm for protein side-chain prediction. Protein Sci. 12, 2001–2014.
Chamberlain, A. K., and Bowie, J. U. (2004). Analysis of side-chain rotamers in transmem-
brane proteins. Biophys. J. 87, 3460–3469.
Cherezov, V., Rosenbaum, D. M., Hanson, M. A., Rasmussen, S. G., Thian, F. S.,
Kobilka, T. S., Choi, H. J., Kuhn, P., Weis, W. I., Kobilka, B. K., and Stevens, R. C.
(2007). High-resolution crystal structure of an engineered human beta2-adrenergic
G protein–coupled receptor. Science 318, 1258–1265.
Crozier, P. S., Stevens, M. J., and Woolf, T. B. (2007). How a small change in retinal leads to
G-protein activation: Initial events suggested by molecular dynamics calculations. Proteins
66, 559–574.
Eswar, N., Eramian, D., Webb, B., Shen, M. Y., and Sali, A. (2008). Protein structure
modeling with MODELLER. Methods Mol. Biol. 426, 145–159.
Farrens, D. L., Altenbach, C., Yang, K., Hubbell, W. L., and Khorana, H. G. (1996).
Requirement of rigid-body motion of transmembrane helices for light activation of
rhodopsin. Science 274, 768–770.
Freddolino, P., Kalani, M. Y., Vaidehi, N., Floriano, W., Hall, S. E., Trabanino, R.,
Kam, V. W. T., and Goddard, W. A., III. (2004). Predicted 3D structure for the
human b2 adrenergic receptor and its binding site for agonists and antagonists. Proc.
Natl. Acad. Sci. USA 101, 2736–2741.
Ghosh, A., Rapp, C. S., and Friesner, R. A. (1998). Generalized Born model based on a
surface integral formulation. J. Phys. Chem. B 102, 10983–10990.
Small-Molecule Binding to GPCRs 287

Gouldson, P. R., Kidley, N. J., Bywater, R. P., Psaroudakis, G., Brooks, H. D., Diaz, C.,
Shire, D., and Reynolds, C. A. (2004). Toward the active conformations of rhodopsin
and the b2-adrenergic receptor. Proteins 56, 67–84.
Hall, S. E., Mao, A., Nicolaidou, V., Finelli, M., Wise, E. L., Nedjai, B., Kanjanapangka, J.,
Harirchian, P., Chen, D., Selchau, V., Ribeiro, S., Schyler, S., et al. (2009). Elucidation
of binding sites of dual antagonists in the human chemokine receptors CCR2 and
CCR5, Mol. Pharm. (in press).
Hiramoto, T., Nonaka, Y., Inoue, K., Yamamoto, T., Omatsu-Kanbe, M., Matsuura, H.,
Gohda, K., and Fujita, N. (2004). Identification of endogenous surrogate ligands for
human P2Y receptors through an in silico search. J. Pharmacol. Sci. 95, 81–93.
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989). Site-directed
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59.
Isin, B., Schulten, K., Tajkhorshid, E., and Bahar, I. (2008). Mechanism of signal pro-
pagation upon retinal isomerization: Insights from molecular dynamics simulations of
rhodpsin restrained by normal modes. Biophys. J. 95, 789–803.
Jaakola, V. P., Griffith, M. T., Hanson, M. A., Cherezov, V., Chien, E. Y., Lane, J. R.,
Ijzerman, A. P., and Stevens, R. C. (2008). The 2.6-angstrom crystal structure of a
human A2A adenosine receptor bound to an antagonist. Science 322, 1211–1217.
Kobilka, B. K., and Deupi, X. (2007). Conformational complexity of G-protein–coupled
receptors. Trends Pharmacol. Sci. 28, 397–406.
Kristiansen, K. (2004). Molecular mechanisms of ligand binding, signaling, and regulation
within the superfamily of G-protein–coupled receptors: Molecular modeling and
mutagenesis approaches to receptor structure and function. Pharm. Ther. 103, 21–80.
Lefkowitz, R. J. (2004). Historical review: A brief history and personal retrospective of
seven-transmembrane receptors. Trends Pharmacol. Sci. 25, 413–422.
Li, J., Edwards, P. C., Burghammer, M., Villa, C., and Schertler, G. F. (2004). Structure of
bovine rhodopsin in a trigonal crystal form. J. Mol. Biol. 343, 1409–1438.
McDonald, I. K., and Thornton, J. M. (1994). Satisfying hydrogen bonding potential in
proteins. J. Mol. Biol. 238, 777–793.
Mailman, R. B. (2007). GPCR functional selectivity has therapeutic impact. Trends Pharmacol.
Sci. 28, 390–396.
Martinez-Mayorga, K., Pitman, M. C., Grossfield, A., Feller, S. E., and Brown, M. F.
(2006). Retinal counterion switch mechanism in vision evaluated by molecular simula-
tions. J. Am. Chem. Soc. 128, 16502–16503.
Mayo, S. L., Olafson, B. D., and Goddard, W. A., III. (1990). DREIDING—a generic force
field for molecular simulations. J. Phys. Chem. 94, 8897–8909.
Murakami, M., and Kouyama, T. (2008). Crystal structure of squid rhodopsin. Nature 453,
363–367.
Niv, M. Y., Skrabanek, L., Filizola, M., and Weinstein, H. (2006). Modeling activated states
of GPCRs: The rhodopsin template. J. Comput. Aided Mol. Des. 20, 437–448.
Okada, T., Sugihara, M., Bondar, A. N., Elstner, M., Entel, P., and Buss, V. (2004).
The retinal conformation and its environment in rhodopsin in light of a new 2.2
A crystal structure. J. Mol. Biol. 342, 571–583.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le, T. I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M.
(2000). Crystal structure of rhodopsin: A G protein–coupled receptor. Science 289,
739–745.
Park, J. H., Scheerer, P., Hofmann, K. P., Choe, H. W., and Ernst, O. P. (2008). Crystal
structure of the ligand-free G-protein–coupled receptor opsin. Nature 454, 183–187.
Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., Chipot, C.,
Skeel, C., Kalé, L., and Schulten, K. (2005). Scalable molecular dynamics with NAMD.
J. Comput. Chem. 26, 1781–1802.
288 Nagarajan Vaidehi et al.

Rockey, W. M., and Elcock, A. H. (2006). Structure selection for protein kinase docking and
virtual screening: Homology models or crystal structures? Curr. Protein Pept. Sci. 7, 437–457.
Scheerer, P., Park, J. H., Hildebrand, P. W., Kim, Y. J., Krauss, N., Choe, H. W.,
Hofmann, K. P., and Ernst, O. P. (2008). Crystal structure of opsin in its G-protein–
interacting conformation. Nature 455, 497–502.
Schlyer, S., and Horuk, R. (2006). I want a new drug: G-protein–coupled receptors in drug
development. Drug Discov. Today. 11, 481–493.
Shacham, S., Marantz, Y., Bar-Haim, S., Kalid, O., Warshaviak, D., Avisar, N., Inbal, B.,
Heifetz, A., Fichman, M., Topf, M., Naor, Z., Noiman, S., and Becker, O. M. (2004).
PREDICT modeling and in-silico screening for G-protein coupled receptors. Proteins 57,
51–86.
Sousa, S. F., Fernandes, P. A., and Ramos, M. J. (2006). Protein-ligand docking: Current
status and future challenges. Proteins 65, 15–26.
Trabanino, R., Hall, S. E., Vaidehi, N., Floriano, W., and Goddard, W. A. (2004). First
principles prediction of the structure and function of G protein–coupled receptors:
Validation for bovine rhodopsin. Biophys. J. 86, 1904–1921.
Urban, J. D., Clarke, W. P., von Zastrow, M., Nichols, D. E., Kobilka, B., Weinstein, H.,
Javitch, J. A., Roth, B. L., Christopoulos, A., Sexton, P. M., Miller, K. J., Spedding, M.,
and Mailman, R. B. (2007). Functional selectivity and classical concepts of quantitative
pharmacology. J. Pharmacol. Exp. Ther. 320, 1–13.
Vaidehi, N., Schlyer, S., Trabanino, R. J., Floriano, W. B., Abrol, R., Sharma, S.,
Kochanny, M., Koovakat, S., Dunning, L., Liang, M., Fox, J. M., de Mendonca, F. L.,
et al. (2006). Predictions of CCR1 chemokine receptor structure and BX 471 antagonist
binding followed by experimental validation. J. Biol. Chem. 281, 27613–27620.
Vaidehi, N., Floriano, W. B., Trabanino, R., Hall, S., Freddolino, P., Choi, E. J.,
Zamanakos, G., and Goddard, W. A., III. (2002). Structure and function prediction for
G-protein coupled receptors. Proc. Natl. Acad. Sci. USA 99, 12622–12627.
Vogel, R., Mahalingam, M., Lüdeke, S., Huber, T., Siebert, F., and Sakmar, T. P. (2008).
Functional role of the ‘‘ionic lock’’—an interhelical hydrogen-bond network in family
A heptahelical receptors. J. Mol. Biol. 380, 648–655.
Vriend, G. (1990). A molecular modeling and drug design program. J. Mol. Graph 8, 52–56.
Warne, T., Serrano-Vega, M. J., Baker, J. G., Moukhametzianov, R., Edwards, P. C.,
Henderson, R., Leslie, A. G., Tate, C. G., and Schertler, G. F. (2008). Structure of a
beta1-adrenergic G-protein–coupled receptor. Nature 454, 486–491.
Wojciechowski, M., and Skolnick, J. (2002). Docking of small ligands to low-resolution and
theoretically predicted receptor structures. J. Comput. Chem. 23, 189–197.
Yao, X., Parnot, C., Deupi, X., Ratnal, V. R. P., Swaminath, G., Farrens, D., and
Kobilka, B. K. (2006). Coupling ligand structures to specific conformational switches
in the b2 adrenoreceptor. Nat. Chem. Biol. 2, 417–422.
C H A P T E R F O U R T E E N

Elucidation of Chemerin
and Chemokine-Like Receptor-1
Function in Adipocytes by
Adenoviral-Mediated shRNA
Knockdown of Gene Expression
Kerry B. Goralski*,† and Christopher J. Sinal†

Contents
1. Introduction 290
2. The 3T3-L1 Cell Model for Adipogenesis and Adipocyte Metabolism 292
3. RNA Interference 293
3.1. Design of adenoviral shRNA vectors for our study 294
3.2. Titration of adenoviral shRNA particles 294
4. Methods for Adenoviral shRNA Knockdown of
Chemerin and CMKLR1 in 3T3-L1 Cells 297
4.1. Reagents and materials required for adenoviral
transduction of 3T3-L1 cells 297
4.2. Testing the efficacy of CE- and CR-shRNA adenoviral vectors 298
4.3. Maintenance and preparation of 3T3-L1 cells 299
4.4. Predifferentiation knock-down of chemerin and CMKLR1 300
4.5. RNA isolation and quantification of chemerin
and CMKLR1 knock-down by quantitative PCR 302
4.6. Postdifferentiation knock-down of chemerin and CMKLR1 304
4.7. Effect of chemerin and CMKLR1 knock-down
on adipogenesis (oil red O staining) 306
4.8. Effect of chemerin and CMKLR1 knock-down
on adipocyte metabolism 307
5. Concluding Remarks 309
Acknowledgments 309
References 309

* College of Pharmacy, Faculty of Health Professions Dalhousie University, Halifax, Nova Scotia, Canada
{
Department of Pharmacology, Faculty of Medicine, Dalhousie University, Halifax, Nova Scotia, Canada

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05214-8 All rights reserved.

289
290 Kerry B. Goralski and Christopher J. Sinal

Abstract
White adipose tissue has traditionally been regarded as an organ of energy
storage and mobilization. However, it is now recognized that this tissue is also
an active endocrine organ that secretes a variety of signaling molecules termed
adipokines. These adipokines have diverse autocrine-, paracrine-, and
endocrine-like actions that impact a variety of biological and physiological
processes, including adipocyte differentiation, local and systemic inflammation,
overall energy balance, blood pressure, and glucose and lipid metabolism.
Given the regulatory influence on these critical functions, dysregulation of
adipokine secretion is believed to be a major contributor to obesity-related
disorders such as hypertension, diabetes, and cardiovascular disease.
Chemerin is a small, secreted protein that has been reported to serve as a
chemoattractant for cells of the immune system such as macrophages and
immature dendritic cells that express the cognate receptor chemokine-like
receptor-1 (CMKLR1). Using adenoviral- delivered, short hairpin RNAs (shRNAs)
to suppress chemerin or CMKLR1 expression, we have demonstrated a
novel role for chemerin/CMKLR1 signaling as a positive regulator of adipocyte
differentiation and metabolic function in the 3T3-L1 model of adipogenesis.
This experimental approach provides an efficient and powerful means to char-
acterize the functional roles of genes known to be involved in adipocyte forma-
tion and metabolism as well as to identify novel roles for genes in this model
and/or other cells.

1. Introduction
Accumulating evidence indicates that adipose tissue, in addition to
serving an important metabolic role, is an active endocrine organ that
secretes a variety of chemical signals collectively termed adipokines. These
include proinflammatory cytokines and cytokine-related proteins, comple-
ment and complement-related proteins, fibrinolytic proteins, proteins of the
renin-angiotensin system, and a variety of other biologically active proteins
with hormone-like actions (Fantuzzi, 2005; Goralski and Sinal, 2007).
Many adipokines have local autocrine or paracrine actions, which affect
adiposity, adipocyte metabolism and inflammatory responses in adipose
tissue (Goralski and Sinal, 2007; Goralski et al., 2007; Wang et al., 2005;
Warne, 2003; Xu et al., 2003). Adipokines also have important roles in the
regulation of systemic lipid and glucose metabolism through endocrine/
systemic actions in the brain, liver, and muscle (Friedman and Halaas, 1998;
Havel, 2004; Yamauchi et al., 2002). The serum levels of many adipokines
are profoundly affected by degree of adiposity (Dandona et al., 1998;
Folsom et al., 1993; Itoh et al., 2002; Primrose et al., 1992; Samad et al.,
Chemerin and CMKLR1 Regulation of Adipocyte Biology 291

1997, 1998; Yudkin et al., 1999; Zhang et al., 1996; Ziccardi et al., 2002),
indicating that the synthesis and secretion of these signaling molecules is
dynamic and modifiable. This has led to the hypothesis that altered secretion
of adipokines, and in particular those that influence systemic insulin
sensitivity and/or inflammation, underlie the increased risk for diseases
such as type 2 diabetes and cardiovascular disease in the obese
(Hotamisligil et al., 1993; Wellen and Hotamisligil, 2005; Whitehead
et al., 2006; Xu et al., 2003).
Chemerin, also known as tazarotene induced gene 2 (TIG2) and retinoic
acid receptor responder 2 (RARRES2), was originally reported as a gene of
unknown function that was induced in skin cells by the synthetic retinoid
tazarotene (Nagpal et al., 1997). Subsequent studies revealed that chemerin
is an endogenous ligand of the G-protein–coupled receptor, chemokine-
like receptor-1 (CMKLR1) (also known variously as ChemerinR,
ChemR23, and GPCR-DEZ in the scientific literature) (Meder et al.,
2003; Methner et al., 1997; Samson et al., 1998; Wittamer et al., 2003).
Chemerin is secreted as an 18-kDa inactive pro-protein that undergoes
extracellular protease cleavage to generate the active 16-kDa protein
(Meder et al., 2003; Wittamer et al., 2003; Zabel et al., 2006). The first
biological function ascribed to chemerin was that of a proinflammatory
chemokine that exerts a chemoattractant effect on cells of the immune
system, such as macrophages and dendritic cells, that express CMKLR1
(Moretta et al., 2008; Parolini et al., 2007; Vermi et al., 2005; Wittamer
et al., 2003; Zabel et al., 2006). Activation of CMKLR1 by chemerin
decreases intracellular cAMP, increases intracellular calcium, and stimulates
phosphorylation of extracellular signal-regulated kinase-1 and -2 (ERK1/2)
by signaling through a pertussis toxin–sensitive, Gi-coupled heterotrimeric
G-protein (Wittamer et al., 2003). Presumably, these intracellular changes
contribute to the chemotactic response of target cells; however, very little is
presently known regarding the details of the intracellular signaling pathways
involved in chemerin/CMKLR1 signaling.
Our laboratory was the first to identify chemerin as a novel adipokine
and to implicate chemerin/CMKLR1 signaling as determinant of adipocyte
differentiation from human and murine precursor cells (Goralski et al.,
2007). Maturation of these precursor cells into lipid-laden adipocytes leads
to a dramatic increase in chemerin and CMKLR1 mRNA expression
and secretion of greater amounts of bioactive chemerin. Both human and
murine white adipose tissue depots express very high levels of chemerin and
CMKLR1 suggesting that adipocytes are both a source and target for
chemerin signaling. Consistent with this, exogenous chemerin administra-
tion stimulates ERK1/2 phosphorylation in both human and mouse
adipocytes (Goralski et al., 2007). Functionally, chemerin/CMKLR1 sig-
naling is critical for adipogenesis, as RNA interference (RNAi)–mediated
suppression of chemerin or CMKLR1 expression in murine 3T3-L1
292 Kerry B. Goralski and Christopher J. Sinal

preadipocytes almost completely abrogates differentiation of those cells into


mature lipid-containing adipocytes. Subsequently, other research groups
independently corroborated our findings and provided further evidence
that circulating chemerin levels may have an association with obesity and
metabolic syndrome in humans (Bozaoglu et al., 2007; Roh et al., 2007;
Takahashi et al., 2008). Taken together with our data, these findings
implicate chemerin as a novel adipokine that has a critical paracrine/auto-
crine function to promote adipocyte differentiation as well as endocrine/
systemic effects on energy metabolism. In this chapter we provide a brief
description of the 3T3-L1 adipocyte model, a general overview of RNA
interference (RNAi) and the design of adenoviral vectors, the methods for
adenoviral transduction of 3T3-L1 preadipocytes and adipocytes, the meth-
ods for quantification of chemerin and CMKLR1 gene knock-down, and the
methods for assessing the effect of gene knock-down on adipogenesis and
metabolic pathways.

2. The 3T3-L1 Cell Model for Adipogenesis


and Adipocyte Metabolism
Much of what we know about adipogenesis stems from in vitro differ-
entiation of 3T3-L1 mouse preadipocytes into mature lipid-containing
adipocytes. The differentiation of confluent 3T3-L1 cells is initiated by
treatment with a glucocorticoid receptor agonist (dexamethasone), a phos-
phodiesterase inhibitor (isobutylmethylxanthine; IBMX) to increase intra-
cellular cyclic adenosine monophosphate levels and supraphysiological
concentrations of insulin to stimulate insulin-like growth factor receptor
(Fajas, 2003; MacDougald and Mandrup, 2002) (Fig. 14.1). The differenti-
ation cocktail triggers the sequential activation of early transcription factors
c-myc, c-fos, and c-jun and then CCATT/enhancer-binding proteins
(C/EBPb and C/EBPd), leading to a round of clonal expansion prior to
terminal differentiation into adipocytes (Fajas, 2003). The next wave of
transcription factors, C/EBPa and peroxisome proliferator activator receptor
gamma (PPARg), maintain each other’s expression and increase the expres-
sion of secreted factors and adipocyte genes involved in insulin sensitivity,
lipid accumulation, and metabolism (Kim and Spiegelman, 1996; Kim et al.,
1998; Rosen, 2005; Rosen et al., 2000). Sterol regulatory element–binding
protein (SREBP1c) is an additional early transcription factor that promotes
adipocyte differentiation, expression of genes linked to fatty acid metabolism
and production of an endogenous PPARg ligand (Kim and Spiegelman,
1996; Kim et al., 1998). By day 3 postdifferentiation (PD), cells adopt a
rounded appearance and begin to show the first signs of lipid accumulation,
and by day 5 to 10 PD the cells are functionally mature and loaded with lipid
Chemerin and CMKLR1 Regulation of Adipocyte Biology 293

Dex C/EBPa Mature


A
Ins adipocytes
Ibmx C/EBPb
C/EBPd
Preconfluent Confluent PPARg
preadipocytes preadipocytes
Ligands
SREBP1c
Contact Clonal Terminal
Proliferation
inhibition expansion differentiation
B
Day 0 Day 3 Day 5 Day 8 Day 13

Confluent Immature Mature


preadipocytes adipocytes adipocytes

Figure 14.1 The 3T3-L1 cell model of adipogenesis. Summary of key steps involved in
3T3-L1adipogenesis (A). Details of adipogenic pathways are described in the text. Matu-
ration of fat cells after treatment of confluent preadipocytes with the differentiation
cocktail is demonstrated by a progressive increase in intracellular oil red O staining at
100 magnification (B). C/EBP, CCAAT/enhancer binding protein; Dex, dexametha-
sone; Ibmx, isobutylmethylxanthine; Ins, insulin; PPAR, peroxisome proliferator
activator receptor; SREBP, sterol regulatory element binding protein.

vacuoles (Yu and Ginsberg, 2004; Yu and Zhu, 2004). Adenoviral-mediated


gene knock-down provided a highly useful technique to determine the
importance of chemerin and CMKLR1 in the adipogenesis process.

3. RNA Interference
In recent years, RNA interference (RNAi) has become a widely
employed method for the study of mammalian gene function in cellular
and in vivo models. For instance, in preadipocytes or adipocytes, RNAi can
be used to reduce (knock down) the expression of individual genes in a
highly selective fashion and thereby allow functional evaluation of contri-
butions to important cellular processes such as proliferation, differentiation,
or metabolism. The RNAi method harnesses a highly conserved cellular
process, in which small double-stranded RNA molecules bind to and
promote degradation of complementary mRNA targets and thereby, pre-
vent the translation of the mRNA sequence into a functional enzyme or
protein. The RNAi pathway can be induced in mammalian cells by direct
294 Kerry B. Goralski and Christopher J. Sinal

introduction (e.g., through transient transfection) of synthetic 21- to 23-base–


pair, double-stranded, small-interfering RNAs (siRNA). Alternatively,
plasmid or viral vectors, which express double-stranded, short hairpin-loop
RNAs (shRNAs) that are processed intracellularly to siRNAs can be used.
Most commonly, expression of these shRNAs is under the control of a
polymerase III–dependent promoters such as the human U6 or H1 promo-
ters. For a more comprehensive explanation of RNAi, we refer the interested
reader to the following articles (Fire et al., 1998; Leung and Whittaker, 2005).

3.1. Design of adenoviral shRNA vectors for our study


For effective RNAi gene knock-down in mammalian cells, the method of
dsRNA delivery into the host cell must be very efficient. As 3T3-L1 pre-
adipocytes and adipocytes are difficult to transfect with siRNAs or shRNA
expression plasmids, activation of RNAi in these cells is best achieved though
the use of adenoviral shRNA vectors. The overall effectiveness of shRNA is
dependent on the sequence of the short dsRNA sequence that is employed.
The shRNA molecules typically consist of a 19- to 29-base nucleotide
sequence corresponding to the target gene, followed by a spacer region of
4 to 15 nucleotides (loop) and a 19- to 29-base nucleotide sequence that is
reversed and complement to the initial target sequence (Leung and Whittaker,
2005). We designed single-stranded oligonucleotides for chemerin and
CMKLR1 shRNA using the Block-It RNAi designer Web application
(Invitrogen, Carlsbad, CA; http://rnaidesigner.invitrogen.com/rnaiexpress/),
which uses algorithms to predict the most effective sequences for gene knock-
down (Table 14.1). These oligonucleotides were subsequently used in
the construction of chemerin (CE-shRNA) and CMKRL1 (CR-shRNA)
adenoviral shRNA vectors using the Block-It Adenoviral RNAi expression
system (Invitrogen, Carlsbad, CA, cat. no. 4941-00). Simultaneously, a control
adenovirus vector (LZ-shRNA) expressing an shRNA targeting the bacterial
b-galactosidase mRNA was developed utilizing the LacZ oligonucleotides
provided with the Block-It RNAi entry vector kit (Invitrogen). As the LZ
shRNA does not target a mammalian gene, it is useful in experimental studies
to control for nonspecific effects of adenoviral shRNA. For a complete
description of the procedures for generating adenoviral shRNA, see the
detailed manufacturer’s instructions (Block-It Adenoviral RNAi Expression
System, v. B23, September 2004, 25-0707).

3.2. Titration of adenoviral shRNA particles


Prior to performing the gene knock-down assays, each adenovirus must be
titrated. We have used the tissue-culture infectious dose 50 (TCID50)
method (Darling et al., 1998), and recommend this procedure for adenoviral
titration. This method tests the ability of serial dilutions of the adenoviral
Chemerin and CMKLR1 Regulation of Adipocyte Biology 295

Table 14.1 shRNA oligonucleotides

Gene Accession # PCR primers 50 to 30 direction


mchemerin NM_027852 FW:ACCGGATAGTCCAC
TGCCCAATTCcgaaGAATT
GGGCAGTGGACTATCC
RV:AAAAGGATAGTCCACT
GCCCAATTCttcgGAATTG
GGCAGTGGACTATCC
mCMKLR1 NM_008153 FW:CACCGGAAGATAACCT
GCTTCAACAcgaaTGTTGAA
GCAGGTTATCTTCC
RV:AAAAGGAAGATAACC
TGCTTCAACAttcgTGTTG
AAGCAGGTTATCTTCC
LacZ Block-It U6 FW:CACCGCTACACAAATC
RNAi entry AGCGATTTcgaaAAATCGC
vector kit TGATTTGTGTAG
Invitrogen RV:AAAACTACACAAATC
(K4945-00) AGCGATTTttcgAAATCGC
TGATTTGTGTAGC
Notes: shRNA oligonucleotides were synthesized in the sense-loop-antisense orientation. The
underlined regions correspond to the target chemerin and CMKLR1 gene sequences, while lower
case denotes the loop region. The remaining bases are required for cloning into the pENTR/U6 vector.

tissue culture lysates to induce cytopathic effects (CPE) (e.g., cell lysis,
plaque formation) in replication-competent HEK-293A cells. The cells
are aliquoted in a 96-well tissue culture plate (1  104 cells per well in
100 ml of DMEM containing 2% FBS) and allowed to adhere overnight.
While the titer of adenoviral lysates is somewhat variable, a total of eight
serial dilutions ranging from 10–3 to 10–10 and prepared in DMEM/2% FBS
are generally appropriate. A volume of 100 ml is added to the existing media
of individual wells of the plate containing the HEK-293A cells. For each
dilution, 10 replicates are prepared (8 dilutions  10 wells ¼ 80 wells total).
An equivalent volume of DMEM/2% FBS (no adenovirus) should be
added to the remaining wells (16 total), which will serve as negative
controls. When adding the diluted virus, always start with the blank
media, and then proceed in order from highest to lowest viral dilution.
After 10 days at 37  C in a CO2 incubator, the plate is examined using an
inverted microscope and evidence of any CPE is recorded for each well. For
each dilution, the ratio of positive to negative wells is recorded. The assay is
296 Kerry B. Goralski and Christopher J. Sinal

generally considered valid if all of the wells treated with the lowest dilution
(10–3) and none of the wells treated with the highest dilution (10–10) exhibit
CPE. The titer (T) is calculated using the Karber statistical method (Karber,
1931) where for 100 ml of dilution:

T ¼ 101 þ dðS0:5Þ
In this equation, d ¼ log10 of the increments in the dilution series (e.g.,
¼ log10(10) ¼ 1 for the 10-fold dilution increment in this example) and S ¼
the sum of ratios (always starting from a 10–1 dilution). For example, if all
wells (10/10) treated with dilutions 10–3 – 10–6 exhibit CPE, 8/10 and 2/10
wells treated with dilutions 10–7 and 10–8, respectively, exhibit CPE and
no wells (0/10) treated with dilutions 10–9 – 10–10 exhibit CPE, then

S ¼ 1 þ 1 þ 1 þ 1 þ 1 þ 1 þ 0:8 þ 0:2 þ 0 þ 0 ¼ 7:0


Note that even though the lowest possible dilutions of this series
(i.e., 10–1 and 10–2) were not performed in this example assay, they must
always be included in the calculation and can be assumed to have a CPE
ratio of 1 if the lowest dilution performed (i.e., 10–3) has an observed CPE
ratio ¼ 1.

T ¼ 101þ1ð7:00:5Þ per 100 ml


¼ 107:5 per 100 ml
¼ 108:5 TCID50 per 1ml

While this value is useful for standardizing virus preparations, it can be


further converted to plaque-forming units (PFU), the standard measure
obtained from another common method for adenovirus titer determination,
the plaque-forming assay (Darling et al., 1998). In performing this conver-
sion, it is assumed (based on empirical evidence) that the titer measured by
the TCID50 method is 0.7 log higher than the titer obtained from the
plaque-forming assay.

T ¼ 108:50:7 PFU=ml
¼ 107:8 PFU=ml
¼ 6:31  107 PFU=ml
Chemerin and CMKLR1 Regulation of Adipocyte Biology 297

4. Methods for Adenoviral shRNA Knockdown


of Chemerin and CMKLR1 in 3T3-L1 Cells
4.1. Reagents and materials required for adenoviral
transduction of 3T3-L1 cells
4.1.1. Cells, reagents, and chemicals
3T3-L1 preadipocytes were obtained from the American Tissue Culture
Collection (ATCC CL-173, Manassas, VA). Standard fetal bovine serum,
sterile-filtered PBS (without calcium and magnesium), Dulbecco’s modified
eagle’s media (DMEM) with 4.5 mM glucose and without phenol red and
L-glutamine were obtained from Hyclone (South Logan, UT). Cell
culture–grade penicillin/streptomycin, sodium pyruvate, dexamethasone,
IBMX, 10% BSA solution, and poly-L-lysine hydrobromide (MW 30,000
to 70,000) were obtained from Sigma-Aldrich (Oakville, ON, Canada).
The poly-L-lysine hydrobromide (MW 30,000 to 70,000) should be dis-
solved in water at a concentration of 1 mg/ml and stored in 500-ml aliquots
at 20  C. Newborn calf serum, trypsin-EDTA, and phenol red–free
Optimem media were obtained from GIBCO/Invitrogen (Burlington,
ON, Canada). Recombinant human insulin was obtained from Roche
Diagnostics (Laval, QC, Canada). Stratascript Reverse Transcriptase and
Brilliant SYBR Green QPCR Master Mix were obtained from Stratagene
(Cedar Creek, TX). Rneasy plus mini-kits were purchased from Qiagen
(Mississauga, ON, Canada).

4.1.2. Preadipocyte media


 DMEM supplemented with 10% heat-inactivated newborn calf serum
 100 IU/ml penicillin
 250 mg/ml streptomycin
 1 mM sodium pyruvate

4.1.3. Adipocyte differentiation media


 DMEM supplemented with 10% heat-inactivated fetal bovine serum
 100 IU/ml penicillin
 250 mg/ml streptomycin
 1 mM sodium pyruvate
 250 nM dexamethasone
 500 mM IBMX
 100 nM human insulin
The final three ingredients are added to the media just prior to applying
it to the cells. For convenience, prepare a 250-mM stock of dexamethasone
298 Kerry B. Goralski and Christopher J. Sinal

in DMSO and a 10 mg/ml (1.72 mM ) stock of insulin in sterile-filtered


water and store in 100- to 200-ml aliquots at –20  C until needed. The
dexamethasone may be freeze-thawed several times without loss of activity.
Once an insulin aliquot is thawed, it can be stored at 4  C for at least
4 weeks. IBMX is weighed just prior to use and dissolved in an appro-
priate volume of the dexamethasone stock solution prior to adding to the
differentiation media.

4.1.4. Adipocyte maintenance media


 DMEM supplemented with 10% heat-inactivated fetal bovine serum
 100 IU/ml penicillin
 250 mg/ml streptomycin
 1 mM sodium pyruvate
 850 nM insulin
Insulin should be added to the media just prior to applying media to
the cells.

4.1.5. Additional supplies and equipment


 75 cm2 culture flasks
 12-well culture plates
 1-, 2-, 5-, 10- and 25-ml serological pipettes
 15- and 50-ml screw-cap conical culture tubes
 4- or 14-ml polystyrene culture tubes with caps
 10-ml, 200-ml to 1000-ml pipettes with appropriate filter tips
 37  C water bath
 Benchtop centrifuge
 Inverted-phase contrast microscope and laminar flow hood

4.1.6. Safety precautions


All procedures should be carried out using aseptic techniques. Adenovirus is
considered a biosafety 2 level (BL-2) organism; thus, BL-2 guidelines should
be strictly adhered to when working with adenoviral shRNA stocks.

4.2. Testing the efficacy of CE- and CR-shRNA


adenoviral vectors
To illustrate the general procedures for adenoviral transduction in preadi-
pocytes and adipocytes, we have chosen to outline an experiment that is
designed to validate the efficacy of CE-shRNA and CR-shRNA with
respect to knock-down of chemerin and CMKLR1 in 3T3-L1 cells. The
experiment will test 100 and 1000 multiplicity-of-infection (MOI) doses of
CE-shRNA and CR-shRNA on chemerin and CMKLR1 mRNA
Chemerin and CMKLR1 Regulation of Adipocyte Biology 299

Table 14.2 Experimental setup to test adenoviral shRNA knock-down of chemerin


and CMKLR1 in 3T3-L1 cells

Treatment Total samples


a,b
Undifferentiated 3T3-L1 cells (3) 3
Vehicle control (3) 3
LZ-shRNA 100 MOIc (3) and 1000 MOI (3) 6
CE-shRNA 100 MOI (3) and 1000 MOI (3) 6
CR-shRNA 100 MOI (3) and 1000 MOI (3) 6
Total samples required 24
a
The three wells corresponding to this group should be plated on a separate 12-well plate, as they
will be harvested at an earlier time point.
b
For all treatment groups, the number in parentheses indicates the number of replicates for
each treatment.
c
The term MOI (multiplicity of infection) refers to the ratio of infective adenoviral particles
(i.e., PFUs)/number of host cells to be infected).

expression relative to transduction vehicle and LZ-shRNA control vector


and undifferentiated preadipocytes (Table 14.2). The term MOI refers to
the ratio of adenoviral PFU/number of host cells to be infected. It is
recommended that such a standard experiment be performed to validate
the efficacy of each new batch of CE-shRNA and CR-shRNA prior to
performing functional assays. If desired, an intermediate (300 to 500) MOI
dose can be tested in this experiment.

4.3. Maintenance and preparation of 3T3-L1 cells


3T3-L1 cells are maintained in preadipocyte media prior to the adenoviral
transduction and the differentiation protocol. Cells are grown at 37  C in a
humidified atmosphere containing 5% CO2 (standard conditions). For
maintenance of stock 3T3-L1 cells, it is recommended to change media
every 3 to 4 days and pass when they are 80 to 90% confluent (approximately
every 5 to 7 days). To passage the cells, vacuum aspirate the existing media
from the flask, wash with 5 ml of sterile PBS, aspirate and add 2.5 ml of 0.05%
trypsin with 0.2 g/l EDTA-4Na in calcium-free PBS. Incubate for 2–3 min at
37  C and gently tap the side of the flask to release the cells. View cells under
an inverted-phase contrast microscope (100) to verify that the majority have
lifted. Stop trypsinization with the addition of 7.5 ml of preadipocyte media
and transfer the cell suspension to a 15-ml, screw-cap culture tube. It is
not necessary to centrifuge the cell suspension after trypsinization. For the
adenoviral shRNA experiment add 1 ml of the cell suspension to two 75-cm2
flasks, each containing 12.5 ml of preadipocyte media. Add 0.5 to 1 ml of
the cell suspension to a third 75-cm2 flask containing 12.5 ml of preadipocyte
media for continued propagation of the cell line.
300 Kerry B. Goralski and Christopher J. Sinal

When 80% confluent, lift the 3T3-L1 cells by trypsinization as described


in the previous section. Stop the trypsinization and suspend each flask of
3T3-L1 cells by adding 17.5 ml of preadipocyte media to the flask. Transfer
and combine both cell suspensions in a 50-ml, screw-cap culture tube. This
should provide a total of 40 ml of cell suspension. Seed a total of 21 wells
(you will require two 12-well plates) with 1 ml of 3T3-L1 cell suspension
and gently rock the plate back and forth a few times to evenly disperse the
cells. These wells will be for the vehicle, LZ-, CE-, and CR-shRNA
treatments (Table 14.2). On a separate 12-well plate, seed an additional
three wells, which will serve as the undifferentiated controls. If a third MOI
dose (e.g., 300 MOI) is desired, an additional 9 wells may be seeded with
the remaining cell suspension. If desired, the volumes can be scaled up or
down in proportion to surface area if using 6-, 24-, 48-, or 96-well plates.
After plating, the cells should be closely monitored to determine exactly
when confluence is reached as indicated by a tightly packed cobblestone-
like appearance (Fig. 14.1B). At this plating density, the 3T3-L1 cells will
normally reach confluence within 2 to 3 days.

4.4. Predifferentiation knock-down of chemerin and CMKLR1


For predifferentiation knock-down of chemerin and CMKLR1, the adeno-
viral transductions are performed 1 day post-confluence (Fig. 14.2A). The
procedure we use is based on the original methods developed by Orlicky
and Schaack (2001). It is best to start the procedure in the morning, as it
requires 4 to 5 h to complete. The first step is to prepare the adenoviral
transduction media that is composed of reduced serum and antibiotic-free
Optimem media with a final concentration of 0.5 mg/ml poly-l-lysine
hydrobromide (MW 30,000 to 70,000). Prepare 15 ml of poly-l-lysine-
Optimem mix, by combining 15 ml of Optimem media at room tempera-
ture (RT) with 7.5 ml of 1 mg/ml poly-l-lysine solution in a 50-ml,
polypropylene screw-cap culture tube, cap, gently mix, and let stand for
10 to 15 min at RT. While the base transduction media is sitting, remove
1 aliquot of previously titered CE-, CR-, and LZ-shRNA from the 80  C
freezer and rapidly thaw in a 37  C water bath. Set up seven polystyrene
tubes in a rack and label with the names of each treatment and the vehicle
control (Table 14.2). For each treatment and control, 2 ml of transduction
mix will be prepared. Add the indicated amount of poly-l-lysine-Optimem
transduction media (Table 14.3) to the corresponding polystyrene tube, and
then add the crude adenoviral shRNA lysates into the poly-l-lysine-Opti-
mem transduction media to give the required MOI (Table 14.3). Cap each
tube, gently mix, and incubate for 100 min at RT. At the completion of the
100-min incubation, aspirate the media from the 1-day postconfluent pre-
adipocytes, wash once with 1 ml of PBS, and add 500 ml of adenoviral
transduction mix per well. Each treatment and control are performed
Chemerin and CMKLR1 Regulation of Adipocyte Biology 301

A
1-day post 2-day post Mature
Preadipocytes confluent confluent Immature adipocytes adipocytes

Day-3 Day-1 Day 0 Day 1−5 Day 5−10


Plate cells CE-shRNA Differentiate ? Confirmation of chemerin ? Oil red o staining for neutral
CR-shRNA cells and CMKLR1 kncokdown lipid accumulation
LZ-shRNA ? Analysis of adipogenic ? Measurement of adipocyte
treatment transcription factors e.g., genes e.g., insulin receptor,
CEBPa, d, PPARg, SREBP1c perilipin, hormone sensitive lipase,
? Cell proliferation assays leptin

B
2-day post
Preadipocytes confluent Immature adipocytes Mature adipocytes

Day-3 Day 0 Day 4 Day 8−10


Plate cells Differentiate cells CE-shRNA ? Adipocyte function assays
CR-shRNA e.g., Glucose uptake and lipolysis
LZ-shRNA ? Measurement of adipocyte genes
treatment

Figure 14.2 Summary of protocols for chemerin and CMKLR1 knockdown in


3T3-L1 cells using adenoviral shRNA. The protocol for pre-differentiation knock-
down (A) and postdifferentiation knock-down are shown (B). CE, chemerin; CR,
CMKLR1; LZ, LacZ; shRNA, small hairpin loop RNA; C/EBP, CCATT enhancer
binding protein; PPAR, peroxisome proliferator activator receptor.

Table 14.3 Sample calculations for preparing 2 ml of adenoviral shRNA transduction


mix of varying MOI values based on 200,000 3T3-L1 cells per well

100 MOI transduction 1000 MOI transduction


mix (2000 ml) mix (2000 ml)
shRNA PL/Optimem shRNA PL/Optimem
Treatment volume volume volume volume
Vehicle 0 ml 2000 ml -- --
LZ-shRNA 16 ml 1984 ml 160 ml 1840 ml
CE-shRNA 8 ml 1992 ml 80 ml 1920 ml
CR-shRNA 4 ml 1996 ml 40 ml 1960 ml
Notes: The volume of adenovirus lysate required to achieve the specified MOI is based on 200,000 3T3/
L1 cells/well (12-well plate), for the following adenoviral titers: LZ-shRNA ¼ 0.5  107 PFU/ml
CE-shRNA ¼ 1.0  107 PFU/ml, CR-shRNA ¼ 2.0  107 PFU/ml and 4 replicates/per treatment.
The volume of viral lysate required for a specific MOI is given by: Volume ¼ (MOI  200,000 3T3-L1
cells per well  number of wells)/(adenoviral titer). For example, for CE-shRNA the viral titer is
1  107 PFU/ml, the adenoviral volume required to treat 4 wells at a dose of 100 MOI ¼ (100  200,000
3T3-L1 cells per well  4) / (1  107 PFU/ml) ¼ 8 ml. Similarly, poly-l-lysine-Optimem volume ¼
volume of transduction media – adenovirus volume. Adenoviral titers will vary from preparation
to preparation.
MOI, adenoviral plaque-forming units (PFU)/3T3-L1 cells per well; PL/Optimem ¼ poly-l-lysine-
Optimem transduction media.
302 Kerry B. Goralski and Christopher J. Sinal

in triplicate. Incubate the cells under standard conditions for 2 h followed by


addition of 1 ml of DMEM with 0.2% BSA and incubate overnight (18 to
20 h). The next morning aspirate the adenoviral transduction mix and
replace with normal preadipocyte media for 6 h. It is normal for the
preadipocytes to have a long spindly appearance after the overnight trans-
duction protocol; however, upon return to the preadipocyte media, the
cells will revert back to the normal cobblestone-like shape.
After the 6-h incubation is complete, prepare 15 ml of adipocyte
differentiation media according to the instructions described earlier.
Remove the preadipocyte media from the treatment and vehicle control
groups and replace with 500 ml of adipocyte differentiation media. At this
time, the three undifferentiated preadipocyte control wells should be har-
vested for RNA analysis according to the RNA isolation procedure
described in the ensuing paragraph. The differentiation media is removed
after 3 days and replaced with 500 ml of fresh adipocyte maintenance media.
On the 5th day after inducing differentiation, the cells may be harvested for
RNA isolation. For longer maintenance of the cells, the adipocyte media is
replaced every 2nd day. Using an adenoviral-green fluorescent protein
(GFP) expression construct, we were able to confirm the ability to transduce
3T3-L1 cells using the above protocol (Fig. 14.3A). GFP expression was
evident as early as 24 h after performing the viral transductions, was main-
tained throughout the adipocyte differentiation stage (data not shown) and
in mature adipocytes (Fig. 14.3A).

4.5. RNA isolation and quantification of chemerin


and CMKLR1 knock-down by quantitative PCR
We recommend utilizing quantitative PCR (QPCR) for rapid assessment of
chemerin and CMKLR1 knock-down by the adenoviral shRNA vectors
(Goralski et al., 2007). For total RNA isolation from 3T3-L1 preadipocytes
and adipocyte cells, we use the Rneasy plus mini-kit (Qiagen, Mississauga,
ON) according to the manufacturer’s instructions with some specific
recommendations for 3T3-L1 cells. For 3T3-L1 cells grown on 12-well
plates, 350 ml of RLT plus buffer is added per well and incubated at RT on
an orbital shaker for 5 min to lyse the cells. The lysates are transferred to
1.5 ml centrifuge tubes vortexed for 1 min and stored at 80  C until RNA
isolation is performed. Upon thawing the adipocyte samples, they should be
centrifuged for 3 min at 8,000g in a benchtop microcentrifuge tube. Trans-
fer 300 to 325 ml of the cell suspension to the gDNA eliminator column
provided in the kit, being careful to minimize the transfer of any lipid that is
floating on top of the centrifuged cell lysates. After this step, follow the
remaining procedures for RNA isolation from mammalian cells as outlined
in the product instructions.
Chemerin and CMKLR1 Regulation of Adipocyte Biology 303

A Phase contrast GFP Overlay

B Phase contrast GFP Overlay

Figure 14.3 Validation of 3T3-L1 transduction using an adenoviral-green fluorescent


protein (GFP) expression construct. Confluent preadipocytes (A) were transduced
with 1000 MOI of an-adenoviral-GFP expression construct for 100 min in Optimem
media containing 0.5 mg/ml polyl-l-lysine. After 24 h, the cells were differentiated with
the standard adipocyte differentiation cocktail. Phase contrast (left) and GFP images
(center) were taken on day 4 postdifferentiation. An overlay of the GFP and phase-
contrast images is shown on the right. Four days following treatment with the adipocyte
differentiation cocktail, a similar procedure was used to transduce immature adipocytes
with the adenoviral-GFP construct (1000 MOI) (B). Phase-contrast (left) and GFP
images (center) were taken on day 6 postdifferentiation. An overlay of the GFP and
phase-contrast images is shown on the right. Arrows show adipocyte with lipid droplets
and GFP expression. Images were acquired at 100 magnification.

For the RNA elution step, add 30 ml of RNase free water to the spin
column and centrifuge at 8000g for 1 min. Repeat the elution step with an
additional 30 ml of RNase free water. The total volume of the RNA elution
is 60 ml. To quantify the RNA, add 10 ml of RNA to 90 ml of sterile ddH2O
in a 600 ml microfuge tube, vortex, centrifuge briefly, and transfer along
with a 100-ml ddH2O blank to a UV-transparent 96-well plate. Measure the
absorbance at 260 nM and 280 nM using a plate-reader spectrophotometer
with the path-length correction (to 1 cm) feature activated. Calculate the
RNA concentration by multiplying path length corrected absorbance at
260 nm by 40 mg/ml (an absorbance of 1 ¼ 40 mg/ml RNA) and the
dilution factor. The 260/280 ratio is normally between 1.8 and 2.0 for high-
quality nucleic acid. Typical RNA yields are between about 8 to 15 mg for
adipocytes and about 3 to 5 mg for preadipocytes. Total RNA (0.5 to 1.0 mg)
from cells is reverse transcribed using Stratascript Reverse Transcriptase, and
1 ml of the cDNA product is amplified by quantitative PCR using 125-nM
304 Kerry B. Goralski and Christopher J. Sinal

Table 14.4 Quantitative PCR primers for mouse chemerin, CMKLR1,


and control gene cyclophillin A

mchemerin NM_027852.1 FW: TACAGGTGGCTC 195 bp


TGGAGGAGTTC
RV: CTTCTCCCGT
TTGGTTTGATTG
mCMKLR1 NM_008153 FW: CAAGCAAACAG 224 bp
CCACTACCA
RV: TAGATGCCGG
AGTCGTTGTAA
mcyclophilinA X52803.1 FW: GAGCTGTTTGCA 124 bp
GACAAAGTTC
RV: CCCTGGCACA
TGAATCCTGG
Note: The QPCR amplification protocol consisted of a 10-min hot start at 94  C, followed by 35 cycles
of denaturation at 94  C for 15 s, annealing at 60  C for 18 s, and elongation at 72  C for 30 s. Source:
Goralski, K. B., Acott, P. D., Fraser, A. D., Worth, D., and Sinal, C. J. (2006). Brain cyclosporin A levels
are determined by ontogenic regulation of mdr1a expression. Drug Metab. Dispos. 34, 288–295.

gene-specific primers (Table 14.4) in a total volume of 20 ml with Brilliant


SYBR Green QPCR Master Mix using a Stratagene MX3000p thermo-
cycler (Goralski et al., 2006). Relative gene expression is normalized to
cyclophilinA (cycA) expression using the DDCT method (Livak and
Schmittgen, 2001). After 5 days of differentiation, both chemerin and
CMKLR1 expression are elevated in the vehicle-treated cells compared to
the preadipocytes (Fig. 14.4A and B) (Goralski et al., 2007). While chemerin
and CMKLR1 expression is not significantly affected by the 100- or 1000-
MOI doses of LZ-shRNA, the 1000-MOI doses of CE-shRNA and
CR-shRNA produce greater than 95% knock-down of chemerin and
CMKLR1 expression, respectively (Fig. 14.4A and B) (Goralski et al., 2007).

4.6. Postdifferentiation knock-down of chemerin and CMKLR1


For this experimental approach, the 3T3-L1 cells are differentiated prior
to knock-down of chemerin and CMKLR1. A diagrammatic summary of the
protocol for transducing 3T3-L1 adipocytes is shown in Fig. 14.2B. Using
this approach, it is possible to bypass the inhibitory effects of chemerin and
CMKLR1 knock-down on adipogenesis; allowing functional studies of the
role of these genes in mature adipocytes. As before, the 3T3-L1 cells are
grown to confluence on 12-well plates. Two days after reaching conflu-
ence, the preadipocyte media is removed and replaced with 500 ml of the
Chemerin and CMKLR1 Regulation of Adipocyte Biology 305

A B
1.25 1.25

Relative CMKLR1
Relative chemerin
1.00 1.00

mRNA
mRNA

0.75 0.75
0.50 0.50
0.25 0.25
0.00 * 0.00 *

D
EH

LZ 00
00

C 100
00
D
EH

LZ 00
00

C 100

0
00

1
10

10
U

1
10

LZ

R
V

LZ

E
E1

R
C
C
pAD shRNA MOI pAD shRNA MOI

C D Basal Insulin (100 nM)


500 * *
*
Glucose uptake
400

(% control)
#
300
200
100
0

00
ol

00
00
tr

10

10
E1
on

LZ

R
C

C
Treatment

Figure 14.4 Effect of chemerin and CMKLR1knock-down on adipogenesis and glucose


uptake. For the data shown in panels A, B, and C, preadipocytes were transduced with
indicated doses of CE-, CR-, or control LZ-shRNA, according to the predifferentiation
protocol and then subjected to the standard adipocyte differentiation protocol. Chemerin
(A) and CMKLR1 (B) mRNA were measured on day 5 after inducing differentiation
and expressed relative to vehicle (VEH) control. UD represents the undifferentiated
preadipocytes. Oil red O staining of neutral lipid on day 8 after inducing differentiation
(C). In panel (C), CON refers to untreated control cells.The effect of postdifferentiation
transduction of immature adipocytes with 1000 MOI CE-, CR-, and LZ-shRNA on
basal and 1 h insulin (100 nM) stimulated 3H-2-deoxyglucose uptake into adipocytes
(D). *p  0.05 compared toVEH or respective LacZ control; ANOVA followed byTukey’s
post hoc test (A and B). *p  0.05 compared to the within-group basal glucose uptake.
{
p  0.05 compared to the respective insulin-treated VEH, LZ-, and CR-shRNA groups.
# p 0.05 compared to basal glucose uptake in the VEH-treated control; ANOVA fol-
lowed by Tukey’s post hoc test (D). (Panels A and B: Adapted from Goralski, K. B.,
McCarthy, T. C., Hanniman, E. A., Zabel, B. A., Butcher, E. C., Parlee, S. D., Muruga-
nandan, S., and Sinal, C. J. (2007). Chemerin, a novel adipokine that regulates adipogen-
esis and adipocyte metabolism. J. Biol. Chem. 282, 28175^28188, with permission.)

adipocyte differentiation media for 3 days. On the morning of the 3rd day
after inducing differentiation, remove the adipocyte differentiation media
and replace with the adipocyte maintenance media for a period of 24 h. The
immature adipocytes (Day 4 postdifferentiation) are then transduced with the
crude adenoviral lysates exactly as described for the 3T3-L1 preadipocytes.
306 Kerry B. Goralski and Christopher J. Sinal

After 24 h, the transduction media should be removed and replaced with


500 ml of adipocyte maintenance media and this media should be replaced
every 2 days until experiments are performed. When the immature adipo-
cytes were transduced with an adenoviral-GFP expression construct we were
able to detect GFP expression in lipid-containing adipocytes (Fig. 14.3B),
which confirmed the effectiveness of the described postdifferentiation pro-
tocol. Immature adipocytes transduced with 1000-MOI CE-shRNA or
CR-shRNA displayed reduced chemerin (97%) and CMKLR1 (85%)
mRNA levels, respectively, compared to the vehicle or LZ-shRNA controls
(Goralski et al., 2007).

4.7. Effect of chemerin and CMKLR1 knock-down


on adipogenesis (oil red O staining)
Once chemerin and CMKLR1 knock-down is confirmed, it is then possible
to proceed to functional assays including analysis of cell proliferation,
adipogenesis, glucose transport, lipid metabolism, and gene expression
(Fig. 14.2). Oil red O staining of neutral lipid provides a standard marker
of lipid accumulation and adipocyte formation (Lagace and Nachtigal, 2004;
Lagace et al., 2004). In the following section, we will describe the procedure
for oil red O staining of neutral lipid to quantify the effects of chemerin and
CMKLR1 knock-down on adipogenesis.
A saturated oil red O solution should be prepared ahead of time: add
0.7 g of oil red O to 200 ml of isopropanol, stir overnight and pass through a
0.2 mM filter. A working stock of oil red O is prepared by combining 6 parts
of saturated oil red O and 4 parts distilled water. Mix and let stand overnight
and pass through a 0.2 mM filter. Store the saturated and working oil red
O solutions at RT.
Perform the predifferentiation knock-down, adipocyte differentiation,
and adipocyte maintenance protocols as described earlier. For the sample
experiment (Fig. 14.4C), we tested the effect of 100-, 1000-, and
5000-MOI doses of CE-shRNA, CR-shRNA, and LZ-shRNA, compared
to vehicle-treated and untreated controls. Each treatment is performed in
triplicate; therefore, three plates of cells are required for the experiment. On
Day 8 postdifferentiation, aspirate the cell media and rinse each well of cells
with 1 ml of PBS. Add 1 ml of freshly prepared 4% paraformaldehyde to
each well and incubate for 10 min at RT with light shaking. It is also
possible to leave the cells in the fixative overnight at 4  C. Aspirate the
paraformaldehyde and carefully rinse each well of cells with 1 ml of PBS,
and follow this with two rinses with 70% ethanol. The wash solutions
should be carefully added with a serological pipette down the side of the
well to prevent the cells from lifting off the plate. Aspirate the ethanol, add
200 ml of oil red O working solution to each well, and incubate for 15 min
at RT with light shaking. If microscopic images (Fig. 14.1B) are to be taken,
Chemerin and CMKLR1 Regulation of Adipocyte Biology 307

aspirate the oil red O and add 500 ml of PBS; this will prevent the cells from
drying and oil red O from leaching out of the cells. If microscopy is not
required, aspirate oil red O and perform two quick washes in 70% ethanol
(1 ml/well), invert plate over paper towels, and dry for 30 min. Scan the
plate with a standard flatbed document scanner at 300 to 600 DPI resolu-
tion. In the sample plate shown in Fig. 14.4C, preadipocytes transduced
with 1000- and 5000-MOI doses of CE-shRNA or CR-shRNA demon-
strated substantially reduced oil red O staining of the cells compared to
the respective LZ-shRNA-transduced cells and the vehicle-treated and
untreated control cells. The reduction in oil red O staining is consistent
with inhibition of adipogenesis by chemerin and CMKLR1 knock-down as
previously reported by our group (Goralski et al., 2007).
Following image acquisition, the cellular incorporation of oil red O may
be quantified using the following procedure. Add 200 ml of isopropanol to
each well. Shake at RT for 3 min to dissolve the oil red O. Transfer 100 ml
of each sample and 100 ml of isopropanol (blank) into separate wells on
96-well plate. Measure absorbance using a spectrophotometer at 520 nm.
This should be done very quickly as the isopropanol will evaporate.

4.8. Effect of chemerin and CMKLR1 knock-down


on adipocyte metabolism
Energy (triglyceride) storage in mature adipocytes is dependent on the
balance between triglyceride synthesis (lipogenesis) and triglyceride break-
down (lipolysis). In the fed state, insulin stimulates glucose and lipid uptake
into adipocytes and the metabolic conversion of these precursors to trigly-
cerides energy stores (Large et al., 2004). Between meals or in the fasted
state, lipolytic stimuli mobilize fatty acids from adipose tissue for use by
other tissues (Anthonsen et al., 1998; Carmen and Victor, 2006; Garton
et al., 1988). The postdifferentiation knock-down protocol may be
extremely useful for determining whether adipocyte metabolism pathways
are directly regulated by chemerin/CMKLR1 signaling in mature adipo-
cytes. As an example, the ensuing paragraph describes the procedures for
insulin-stimulated, adipocyte glucose uptake assays following postdifferen-
tiation knock-down of chemerin and CMKLR1.
Prepare 100 ml stock solutions of 3 M NaCl, 2 M KCL, 1 M MgSO4,
1 M CaCl2, and 1 M HEPES buffer, ph 7.4, ahead of time. On the day of
the assay, prepare 200 ml of fresh 12 mM Krebs-Ringer-Hepes buffer
containing 121 mM NaCl, 4.9 mM KCL, 1.2 mM MgSO4, and 0.33 M
CaCl2. Check pH and adjust to 7.4 if needed.
Glucose uptake is determined by measuring the cellular uptake of
3H-2-deoxyglucose (1 mCi/ml) (Perkin Elmer Life and Analytical Sciences

Inc, Waltham, MA). The described assay procedure is for 12-well plates.
Two 12-well plates are required for the experiment, one for analysis of basal
308 Kerry B. Goralski and Christopher J. Sinal

glucose uptake and the other for analysis of insulin-stimulated glucose


uptake. Following the postdifferentiation transduction protocol (described
above), treat three wells per plate with each of 1000 MOI CE-, 1000 MOI
CR-, and 1000 MOI LZ-shRNA, and the vehicle control. On day 8 post-
differentiation (4-day after treatment with adenovirus) remove one plate
from the incubator, label it ‘‘basal glucose,’’ and replace the normal adipo-
cyte growth media with 500 ml of serum-free DMEM (without insulin) and
incubate for 2 h under standard conditions to serum starve. After 15 min
repeat this procedure for the second plate, and label the plate ‘‘insulin
stimulated.’’ Upon completion of the 2-h serum-starvation period, aspirate
the media, wash the wells once with 1 ml of Krebs-Ringer buffer, and
aspirate again. For the basal glucose plate, add 500 ml of Krebs-Ringer buffer
to each well. For the insulin-stimulated plate, add 500 ml of Krebs-Ringer
buffer that contains 100 nM insulin to each well. Both plates should then be
incubated for 50 min under standard conditions.
While the cells are incubating make up a 25 mCi/ml 3H-2-deoxyglucose
working solution in Krebs-Ringer buffer by diluting the stock 1 mCi/ml
3H-2-deoxyglucose solution 1:40 with Krebs-Ringer buffer. For each

well, 10 ml of the 25 mCi/ml 3H-2-deoxyglucose working solution are


required. For two plates, make enough for 30 wells (300 ml) by adding 7.5 ml
stock 3H-2-deoxyglucose into 292.5 ml of Krebs-Ringer buffer. Upon
completion of the 50-min incubation, add 10 ml of 3H-2-deoxyglucose to
each well of the basal glucose plate and incubate for 10 min under standard
conditions.
Vacuum aspirate and rapidly wash each well three times with ice-cold
Krebs-Ringer buffer. Repeat the procedure for the insulin-treated plate.
Add 500 ml of 0.1 M NaOH with 1% SDS to each well and incubate for 1 h
at RT with light shaking to solubilize the cells. Following this, add 28 ml of
1 M HCl to neutralize. Add 200 ml of each sample to a scintillation
vial containing 3 ml of Ready Safe scintillation fluid (Beckman Coulter,
Fullerton, CA), vortex mix for 30 s, dark-adapt for 1 h, and then count
radioactivity using a b-scintillation counter (LS6500 Liquid Scintillation
Counter, Beckman Coulter, Fullerton, CA). The counted radioactivity is
recorded as disintegrations per minute (DPM) and multiplied by 2.5 to
determine total radioactive glucose uptake per well. In vehicle-treated and
LZ-shRNA–treated cells, the insulin-stimulated glucose uptake is routinely
between about two- to four-fold higher than basal glucose uptake. In the
sample experiment, chemerin knock-down decreased insulin-stimulated
glucose uptake by 50% as compared to VEH or LZ-transduced controls
(Fig. 14.4D). In comparison, CMKLR1 knock-down produced a slight
increase in basal glucose uptake. These data indicate that chemerin/
CMKLR1 signaling may have regulatory effects on metabolic pathways
pertaining to energy storage in adipocytes.
Chemerin and CMKLR1 Regulation of Adipocyte Biology 309

5. Concluding Remarks
Cell culture models of adipogenesis, such as the 3T3-L1 model, have
been instrumental in unraveling the complex and well-orchestrated cascade
of cell signaling events involved in adipocyte differentiation and metabolic
function. These findings have increased our knowledge of basic develop-
mental biology and provided important mechanistic insight into the dys-
function of adipocytes that commonly occurs with obesity. With the
increasing impact of obesity and prevalent comorbidities such as type
2 diabetes and cardiovascular disease on the global population, there is an
urgent need for new information from adipocyte models. The techniques
described in this chapter have proven extremely effective in identifying
chemerin as a novel adipokine that, in conjunction with CMKLR1, is a
positive regulator of adipogenesis. We have also successfully used this
approach to study the role of chemerin/CMKLR1 signaling in adipogenesis
of other models including both human and murine primary mesenchymal
stem cells. Beyond this, these techniques have a more general adaptability to
the dissection of gene function in a variety of experimental models relevant
to various aspects of mammalian cell biology.

ACKNOWLEDGMENTS
This work was supported by operating grants from the Canadian Institutes of Health
Research (C.J.S. and K.B.G), the Nova Scotia Health Research Foundation (K.B.G.),
the Dalhousie Pharmacy Endowment (K.B.G.), and Dalhousie Medical Research
Foundation (K.B.G.).

REFERENCES
Anthonsen, M. W., Ronnstrand, L., Wernstedt, C., Degerman, E., and Holm, C. (1998).
Identification of novel phosphorylation sites in hormone-sensitive lipase that are phos-
phorylated in response to isoproterenol and govern activation properties in vitro. J. Biol.
Chem. 273, 215–221.
Bozaoglu, K., Bolton, K., McMillan, J., Zimmet, P., Jowett, J., Collier, G., Walder, K., and
Segal, D. (2007). Chemerin is a novel adipokine associated with obesity and metabolic
syndrome. Endocrinology 148, 4687–4694.
Carmen, G. Y., and Victor, S. M. (2006). Signalling mechanisms regulating lipolysis. Cell.
Signal 18, 401–408.
Dandona, P., Weinstock, R., Thusu, K., Abdel-Rahman, E., Aljada, A., and Wadden, T.
(1998). Tumor necrosis factor-alpha in sera of obese patients: Fall with weight loss.
J. Clin. Endocrinol. Metab. 83, 2907–2910.
Darling, A. J., Boose, J. A., and Spaltro, J. (1998). Virus assay methods: Accuracy and
validation. Biologicals 26, 105–110.
310 Kerry B. Goralski and Christopher J. Sinal

Fajas, L. (2003). Adipogenesis: A cross-talk between cell proliferation and cell differentiation.
Ann. Med. 35, 79–85.
Fantuzzi, G. (2005). Adipose tissue, adipokines, and inflammation. J. Allergy Clin. Immunol.
115, 911–919; quiz 920.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998).
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature 391, 806–811.
Folsom, A. R., Qamhieh, H. T., Wing, R. R., Jeffery, R. W., Stinson, V. L., Kuller, L. H.,
and Wu, K. K. (1993). Impact of weight loss on plasminogen activator inhibitor (PAI-1),
factor VII, and other hemostatic factors in moderately overweight adults. Arterioscler
Thromb 13, 162–169.
Friedman, J. M., and Halaas, J. L. (1998). Leptin and the regulation of body weight in
mammals. Nature 395, 763–770.
Garton, A. J., Campbell, D. G., Cohen, P., and Yeaman, S. J. (1988). Primary structure of
the site on bovine hormone-sensitive lipase phosphorylated by cyclic AMP-dependent
protein kinase. FEBS Lett. 229, 68–72.
Goralski, K. B., Acott, P. D., Fraser, A. D., Worth, D., and Sinal, C. J. (2006). Brain
cyclosporin a levels are determined by ontogenic regulation of mdr1a expression. Drug
Metab. Dispos. 34, 288–295.
Goralski, K. B., McCarthy, T. C., Hanniman, E. A., Zabel, B. A., Butcher, E. C.,
Parlee, S. D., Muruganandan, S., and Sinal, C. J. (2007). Chemerin, a novel adipokine
that regulates adipogenesis and adipocyte metabolism. J. Biol. Chem. 282, 28175–28188.
Goralski, K. B., and Sinal, C. J. (2007). Type 2 diabetes and cardiovascular disease: Getting to
the fat of the matter. Can. J. Physiol. Pharmacol. 85, 113–132.
Havel, P. J. (2004). Update on adipocyte hormones: Regulation of energy balance and
carbohydrate/lipid metabolism. Diabetes 53(Suppl 1), S143–S151.
Hotamisligil, G. S., Shargill, N. S., and Spiegelman, B. M. (1993). Adipose expression of
tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 259,
87–91.
Itoh, K., Imai, K., Masuda, T., Abe, S., Tanaka, M., Koga, R., Itoh, H., Matsuyama, T., and
Nakamura, M. (2002). Relationship between changes in serum leptin levels and blood
pressure after weight loss. Hypertens. Res. 25, 881–886.
Karber, G. (1931). Screening methods in pharmacology. Arch. Exp. Pathol. and Pharmacol.
162, 480–483.
Kim, J. B., and Spiegelman, B. M. (1996). ADD1/SREBP1 promotes adipocyte differentia-
tion and gene expression linked to fatty acid metabolism. Genes Dev. 10, 1096–1107.
Kim, J. B., Wright, H. M., Wright, M., and Spiegelman, B. M. (1998). ADD1/SREBP1
activates PPARgamma through the production of endogenous ligand. Proc. Natl. Acad.
Sci. USA 95, 4333–4337.
Lagace, D. C., McLeod, R. S., and Nachtigal, M. W. (2004). Valproic acid inhibits leptin
secretion and reduces leptin messenger ribonucleic acid levels in adipocytes. Endocrinology
145, 5493–5503.
Lagace, D. C., and Nachtigal, M. W. (2004). Inhibition of histone deacetylase activity by
valproic acid blocks adipogenesis. J. Biol. Chem. 279, 18851–18860.
Large, V., Peroni, O., Letexier, D., Ray, H., and Beylot, M. (2004). Metabolism of lipids in
human white adipocyte. Diabetes Metab. 30, 294–309.
Leung, R. K., and Whittaker, P. A. (2005). RNA interference: From gene silencing to gene-
specific therapeutics. Pharmacol. Ther. 107, 222–239.
Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.
MacDougald, O. A., and Mandrup, S. (2002). Adipogenesis: Forces that tip the scales. Trends
Endocrinol. Metab. 13, 5–11.
Chemerin and CMKLR1 Regulation of Adipocyte Biology 311

Meder, W., Wendland, M., Busmann, A., Kutzleb, C., Spodsberg, N., John, H.,
Richter, R., Schleuder, D., Meyer, M., and Forssmann, W. G. (2003). Characterization
of human circulating TIG2 as a ligand for the orphan receptor ChemR23. FEBS Lett.
555, 495–499.
Methner, A., Hermey, G., Schinke, B., and Hermans-Borgmeyer, I. (1997). A novel G
protein-coupled receptor with homology to neuropeptide and chemoattractant receptors
expressed during bone development. Biochem. Biophys. Res. Commun. 233, 336–342.
Moretta, A., Marcenaro, E., Parolini, S., Ferlazzo, G., and Moretta, L. (2008). NK cells at
the interface between innate and adaptive immunity. Cell. Death Differ. 15, 226–233.
Nagpal, S., Patel, S., Jacobe, H., DiSepio, D., Ghosn, C., Malhotra, M., Teng, M.,
Duvic, M., and Chandraratna, R. A. (1997). Tazarotene-induced gene 2 (TIG2),
a novel retinoid-responsive gene in skin. J. Invest. Dermatol. 109, 91–95.
Orlicky, D. J., and Schaack, J. (2001). Adenovirus transduction of 3T3-L1 cells. J. Lipid Res.
42, 460–466.
Parolini, S., Santoro, A., Marcenaro, E., Luini, W., Massardi, L., Facchetti, F.,
Communi, D., Parmentier, M., Majorana, A., Sironi, M., Tabellini, G., Moretta, A.,
et al. (2007). The role of chemerin in the colocalization of NK and dendritic cell subsets
into inflamed tissues. Blood 109, 3625–3632.
Primrose, J. N., Davies, J. A., Prentice, C. R., Hughes, R., and Johnston, D. (1992).
Reduction in factor VII, fibrinogen and plasminogen activator inhibitor-1 activity after
surgical treatment of morbid obesity. Thromb Haemost 68, 396–399.
Roh, S. G., Song, S. H., Choi, K. C., Katoh, K., Wittamer, V., Parmentier, M., and
Sasaki, S. (2007). Chemerin—a new adipokine that modulates adipogenesis via its own
receptor. Biochem. Biophys. Res. Commun. 362, 1013–1018.
Rosen, E. D. (2005). The transcriptional basis of adipocyte development. Prostaglandins
Leukot Essent. Fatty Acids 73, 31–34.
Rosen, E. D., Walkey, C. J., Puigserver, P., and Spiegelman, B. M. (2000). Transcriptional
regulation of adipogenesis. Genes Dev. 14, 1293–1307.
Samad, F., Pandey, M., and Loskutoff, D. J. (1998). Tissue factor gene expression in the
adipose tissues of obese mice. Proc. Natl. Acad. Sci. USA 95, 7591–7596.
Samad, F., Yamamoto, K., Pandey, M., and Loskutoff, D. J. (1997). Elevated expression of
transforming growth factor-beta in adipose tissue from obese mice. Mol. Med. 3, 37–48.
Samson, M., Edinger, A. L., Stordeur, P., Rucker, J., Verhasselt, V., Sharron, M., Govaerts, C.,
Mollereau, C., Vassart, G., Doms, R. W., and Parmentier, M. (1998). ChemR23, a putative
chemoattractant receptor, is expressed in monocyte-derived dendritic cells and macrophages
and is a coreceptor for SIV and some primary HIV-1 strains. Eur. J. Immunol. 28, 1689–1700.
Takahashi, M., Takahashi, Y., Takahashi, K., Zolotaryov, F. N., Hong, K. S., Kitazawa, R.,
Iida, K., Okimura, Y., Kaji, H., Kitazawa, S., Kasuga, M., and Chihara, K. (2008).
Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in
3T3-L1 adipocytes. FEBS Lett. 582, 573–578.
Vermi, W., Riboldi, E., Wittamer, V., Gentili, F., Luini, W., Marrelli, S., Vecchi, A.,
Franssen, J. D., Communi, D., Massardi, L., Sironi, M., Mantovani, A., et al. (2005).
Role of ChemR23 in directing the migration of myeloid and plasmacytoid dendritic cells
to lymphoid organs and inflamed skin. J. Exp. Med. 201, 509–515.
Wang, M. Y., Orci, L., Ravazzola, M., and Unger, R. H. (2005). Fat storage in adipocytes
requires inactivation of leptin’s paracrine activity: Implications for treatment of human
obesity. Proc. Natl. Acad. Sci. USA 102, 18011–18016.
Warne, J. P. (2003). Tumour necrosis factor alpha: A key regulator of adipose tissue mass.
J. Endocrinol. 177, 351–355.
Wellen, K. E., and Hotamisligil, G. S. (2005). Inflammation, stress, and diabetes. J. Clin.
Invest. 115, 1111–1119.
312 Kerry B. Goralski and Christopher J. Sinal

Whitehead, J. P., Richards, A. A., Hickman, I. J., Macdonald, G. A., and Prins, J. B. (2006).
Adiponectin—a key adipokine in the metabolic syndrome. Diabetes Obes Metab. 8,
264–280.
Wittamer, V., Franssen, J. D., Vulcano, M., Mirjolet, J. F., Le Poul, E., Migeotte, I.,
Brezillon, S., Tyldesley, R., Blanpain, C., Detheux, M., Mantovani, A., Sozzani, S.,
et al. (2003). Specific recruitment of antigen-presenting cells by chemerin, a novel
processed ligand from human inflammatory fluids. J. Exp. Med. 198, 977–985.
Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S., Tartaglia, L. A., and Chen, H. (2003). Chronic inflammation in fat plays a
crucial role in the development of obesity-related insulin resistance. J. Clin. Invest. 112,
1821–1830.
Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., Yamashita, S.,
Noda, M., Kita, S., Ueki, K., Eto, K., Akanuma, Y., et al. (2002). Adiponectin stimulates
glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase.
Nat. Med. 8, 1288–1295.
Yu, Y. H., and Ginsberg, H. N. (2004). The role of acyl-CoA:diacylglycerol acyltransferase
(DGAT) in energy metabolism. Ann. Med. 36, 252–261.
Yu, Y. H., and Zhu, H. (2004). Chronological changes in metabolism and functions of
cultured adipocytes: A hypothesis for cell aging in mature adipocytes. Am. J. Physiol.
Endocrinol. Metab. 286, E402–E410.
Yudkin, J. S., Stehouwer, C. D., Emeis, J. J., and Coppack, S. W. (1999). C-reactive protein
in healthy subjects: Associations with obesity, insulin resistance, and endothelial dysfunc-
tion: A potential role for cytokines originating from adipose tissue? Arterioscler Thromb
Vasc Biol. 19, 972–978.
Zabel, B. A., Zuniga, L., Ohyama, T., Allen, S. J., Cichy, J., Handel, T. M., and
Butcher, E. C. (2006). Chemoattractants, extracellular proteases, and the integrated
host defense response. Exp. Hematol. 34, 1021–1032.
Zhang, B., Graziano, M. P., Doebber, T. W., Leibowitz, M. D., White-Carrington, S.,
Szalkowski, D. M., Hey P. J., Wu, M., Cullinan, C. A., Bailey, P., Lollmann, B.,
Frederich, R., et al. (1996). Down-regulation of the expression of the obese gene by an
antidiabetic thiazolidinedione in Zucker diabetic fatty rats and db/db mice. J. Biol. Chem.
271, 9455–9459.
Ziccardi, P., Nappo, F., Giugliano, G., Esposito, K., Marfella, R., Cioffi, M., D’Andrea, F.,
Molinari, A. M., and Giugliano, D. (2002). Reduction of inflammatory cytokine
concentrations and improvement of endothelial functions in obese women after weight
loss over one year. Circulation 105, 804–809.
C H A P T E R F I F T E E N

Characterization of Chemokine
Receptor CXCR2 Interacting Proteins
Using a Proteomics Approach to
Define the CXCR2 ‘‘Chemosynapse’’
Dayanidhi Raman,*,‡,1 Nicole F. Neel,*,1 Jiqing Sai,*,†
Raymond L. Mernaugh,† Amy-Joan L. Ham,† and Ann J. Richmond*,‡

Contents
1. Introduction 316
1.1. The CXCR2 chemosynapse 317
1.2. Proteomic screen for the CXCR2 chemosynapse
adaptor proteins 318
2. Validation of the Interaction of Novel Proteins with CXCR2 320
2.1. Coimmunoprecipitation of CXCR2 and CXCR2-binding proteins 321
2.2. Colocalization CXCR2 and CXCR2-interacting proteins
in dHL-60 cells 321
2.3. Glutathione S-transferase pull-down studies 322
3. Mutational Analysis of Residues at Interactive Interface of CXCR2
and CXCR2-Binding Proteins 324
4. Radioactive Phosphorylation of CXCR2 Interacting Proteins 325
5. Chemotaxis Assay 326
5.1. Chemotaxis and chemokinesis assays in modified
Boyden chamber 326
5.2. Chemotaxis assay in micro fluidic gradient device 327
6. Conclusions 329
Acknowledgments 329
References 329

* Department of Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA
{
Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee, USA
{
Veterans Affairs Medical Center, Vanderbilt University School of Medicine, Nashville, Tennessee, USA
1
Both authors contributed equally

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05215-X All rights reserved.

315
316 Dayanidhi Raman et al.

Abstract
Chemokine-receptor signaling is initiated upon ligand binding to the receptor
and continues through the process of endocytic trafficking by the association of
a variety of adaptor proteins with the chemokine receptor. In order to define the
adaptor proteins that associate with CXCR2 before and after ligand activation,
a protocol was developed using differentiated HL-60 cells transfected to
express CXCR2 stimulated or not stimulated with ligand for one minute.
CXCR2-associating proteins were isolated by immunoprecipitation with CXCR2
antibody and the eluted proteins were electrophoretically run into the separat-
ing gel directly without a stacking gel. The stained single band was subjected to
in-gel trypsin digestion. The tryptic peptides were subjected to, LC/MS/MS
proteomic analysis. Proteins identified in a minimum of three of four separate
experiments with multiple peptides were then validated as CXCR2 adaptor
proteins by coimmunoprecipitation, GST pull-down studies, and immunocyto-
chemical CXCR2-colocalization experiments using dHL-60-CXCR2 cells. Subse-
quently, a functional analysis of the interaction between CXCR2 and CXCR2
interacting proteins was performed. This approach can be used to characterize
chemokine receptor–associating proteins over time both before and after ligand
stimulation, allowing definition of the dynamic spatial and temporal formation
of a ‘‘chemosynapse.’’

1. Introduction
Chemotactic cytokines or chemokines bind to and activate their
cognate G-protein–coupled receptors (GPCRs) and this event results in a
variety of biological responses (Thelen and Stein, 2008). The varied
biological response is due in part to different repertoires of adaptor proteins
binding to chemokine GPCRs at various spatiotemporal points. This dif-
ferential coupling dictates subsequent biological response and fine tuning of
the chemokine GPCR signaling. The assembly of proteins bound to the
chemokine GPCRs is analogous to the immunological or neurosynapse
wherein the protein–protein interactions initiate, maintain, and regulate a
particular biological activity. We are defining this dynamic spatial and
temporal assembly of adaptor/signaling proteins on the chemokine receptor
as the ‘‘chemosynapse.’’ When chemokines activate their chemokine
GPCRs, the active receptors not only signal at the plasma membrane but
also continue to signal at the endosome level. This is possible due to the
binding of different adaptor proteins as the chemokine receptor traverses
through its vesicular trafficking route. The phosphorylation status of the
chemokine GPCR also enables the assembly of different ensembles of
adaptor proteins bound to the receptor, and thus will be very different
from the basal unphosphorylated or dephosphorylated states of the receptor.
Characterization of CXCR2 Chemosynapse 317

Thus, the activity status of the chemokine receptor dictates in part the type
of adaptor protein that may bind the chemokine receptor at a particular time.
In some cases, there is a genetic alteration of chemokine receptors such
as in WHIM syndrome (warts, hypogammaglobulinemia, infections, and
myelokathexis) where CXCR4 is genetically altered at its C-terminus,
resulting in a combined immunodeficiency disease (Hernandez et al.,
2003). Patients with this mutation exhibit altered response to CXCL12,
suggesting that loss of ability to form an appropriate chemosynapse can
result in serious disease (Gulino et al., 2004) (Balabanian et al., 2005; Lagane
et al., 2008). Expression of a similarly truncated CXCR4 in MCF-7 breast
cancer cells in vitro led to an epithelial to mesenchymal-like transition
(EMT) in these cells (Ueda et al., 2006). Expression of C-terminally
truncated CXCR2 with additional mutations in AP-2 binding motif in
mouse keratinocytes in a transgenic mouse under the control of K14
promoter resulted in the loss of the mouse tail and extensive skin lesions
(Yu et al., 2008). Thus, the carboxyl-terminal domain and possibly intracel-
lular cytoplasmic loops of a chemokine receptor provide a structural landing
for components of the chemosynapse and are functionally important for
orchestration of the normal physiological responses of cells and tissues.

1.1. The CXCR2 chemosynapse


To characterize the CXCR2 chemosynapse, a proteomic approach was
pursued to identify novel CXCR2-interacting proteins in response to ligand
activation of the receptor. We then characterized the role of these proteins
in modulation of the CXCR2 receptor function (Fig. 15.1) (Neel, 2008;
Neel et al., 2009).
The ability of the HL-60 human promyelocytic leukemia cells (Gallagher
et al., 1979) to differentiate into neutrophil-like cells was exploited here to
generate cells for proteomic analysis of CXCR2-associated proteins. These
cells express very little CXCR2, so a CXCR2 retroviral construct was trans-
duced into these cells and cells expressing CXCR2 at levels comparable to
human neutrophils were selected based on G418 resistance and by fluorescence
activated cell sorting (FACS) for CXCR2 expression (Sai et al., 2006). The
HL-60-CXCR2 cells were differentiated into neutrophil-like cells (dHL-60
cells) by incubation with 1.3% dimethyl sulfoxide (DMSO) for 6 to 7 days,
followed by stimulation with CXCL8. Since the signaling in neutrophil-like
dHL-60 cells occurs rapidly, and most intracellular signaling molecules such as
Akt, Rac2, and Cdc42 were activated maximally by 1 min (Sai et al., 2006), we
studied the CXCL8-stimulated molecular repertoire of CXCR2 chemo-
synapse at the 1-min time point. Cell lysates were made of differentiated
CXCR2 HL-60 cells not treated with CXCL8 and cells treated with
CXCL8 for 1 min. CXCR2 and CXCR2-associated proteins were immuno-
precipitated from these lysates and characterized by proteomic analysis
318 Dayanidhi Raman et al.

Endothelial cell
The CXCR2 chemosynapse
Perlecan CXCL8

CXCR2 Clathrin-coated pit


CXCR2
CXCR2
Leukocyte

PIP2
b g b g
Gai P CCV
P P AP-2
b-ARR
SRC P P P
X
Y

X GRK
X
Y

CXCR2
Gai
ctin

Y
P
P F-a
HIP
Dock2
Effectors P HSP70

X
P
GTP

Recycling Rac2
vesicle

Lysosome
Rec pH
yclin Endocytic
g Early endosome vesicle
CXCR2
CXCR2

Late
endosome
PP2A P P P

Figure 15.1 Depiction of CXCR2 chemosynapse. CXCR2 receptor signaling initiated


upon CXCL8 binding to the receptor continues through the process of endocytic traffick-
ing through the association of a variety of adaptor proteins to the chemokine receptor.
The various signaling and adaptor proteins that are known to bind CXCR2 include
Giabg, GRK2, b-arrestin 2, AP-2, clathrin, HIP, Rab11-FIP2, and novel proteins X and Y
identified through the proteomic approach. Italicized proteins: CXCR2-interacting
proteins identified in Ann Richmond’s laboratory.

(Neel, 2008). This protocol offers advantages over identification of CXCR2


interacting proteins by the yeast two-hybrid system since, it is possible to
uncover ligand-dependent association of CXCR2 interacting proteins over
time. CXCL8 binding to CXCR2 activates the heterotrimeric G-proteins
(Gabg) and the GRKs that rapidly phosphorylate the carboxyl-terminal domain
(CTD) of CXCR2 on serine residues. The phosphorylated CTD can serve as
a nexus for the binding of a number of adaptor proteins to facilitate the move-
ment of CXCR2 into clathrin-coated pits and endosomal compartments.

1.2. Proteomic screen for the CXCR2 chemosynapse


adaptor proteins
The protocols used for this analysis are those developed and described by
Neel and colleagues (Neel, 2008; Neel et al., 2009). HL-60 cells stably
expressing human CXCR2 were grown in RPMI-1640 (Invitrogen, Carls-
bad, CA) supplemented with 10% heat-inactivated fetal bovine serum
Characterization of CXCR2 Chemosynapse 319

(Atlanta Biologicals, Norcross, GA), 3 mM L-glutamine and penicillin


(50 units/ml)/Streptomycin (50 mg/ml) (Mediatech, Herndon, VA). The
pH of the RPMI-1640 medium was stabilized with 25 mM HEPES, pH 7.4.
The initial seeding density of the cells was set at 1  105 cells/ml in order to
keep them robustly healthy, and they were subcultured every 3rd day for
routine maintenance. In order to differentiate into neutrophil-like cells,
HL-60 cells were seeded at a density of 1  105 cells/ml in antibiotic-free
RPMI-1640 containing 10% heat-inactivated, fetal bovine serum, and 1.3%
endotoxin-free DMSO (Sigma, St. Louis, MO) for 6 to 7 days (Sai et al., 2006).
Differentiated HL-60 cells stably expressing CXCR2 (dHL-60
CXCR2) were washed with serum-free RPMI-1640 and stimulated with
vehicle (0.1% bovine serum albumin in phosphate buffered saline [PBS]) or
CXCL8 100 ng/ml for 1 min. The cell pellet was lysed in 50 mM Tris-HCl,
pH 7.5, 0.05% Triton X-100, 300 mM NaCl with mammalian protease
inhibitor cocktail (AEBSF; [4-(2-Aminoethyl) benzenesulfonyl fluoride
hydrochloride], aprotinin, leupeptin hemisulfate salt, E-64 [(N-trans(epox-
ysuccinyl)-L-leucine 4-guanidinobutylamide], bestatin hydrochloride, and
pepstatin A) and phosphatase inhibitor cocktail I (microcystin LR, canthar-
idin, and bromotetramisole, cat. no. P 2850) and II (sodium orthovanadate,
sodium molybdate, sodium tartrate, and imidazole, cat. no. P 5726) (all
were from Sigma, St. Louis, MO) by nutation for 10 min at 4  C. After
clarification by centrifugation, the lysates were precleared with normal
rabbit IgG ( Jackson Immunoresearch, West Grove, PA) conjugated to
N-hydroxysuccinimide (NHS)-activated sepharose beads (GE Healthcare,
Piscataway, NJ). Following preclearing, lysates from untreated and
CXCL8-treated dHL-60 cells were nutated with either normal rabbit IgG
(mock) or with anti-CXCR2 rabbit antibody conjugated to NHS-activated
sepharose beads for 1 h at 4  C. The beads were centrifuged and washed
thrice with lysis buffer and the proteins were eluted with Laemmli sample
buffer at 60  C for 10 min. The samples were loaded directly onto a 10%
resolving sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-
PAGE) gel (no stacking gel) and ran 1 cm into the gel and stained with
colloidal blue stain (Invitrogen, Carlsbad, CA). The single stained band was
excised and an in-gel trypsin digestion was performed. The tryptic peptides
were analyzed by LC/MS/MS using a Thermo Finnigan LTQ ion trap mass
spectrometer equipped with Thermo MicroAS autosampler, Thermo
Surveyor HPLC pump, Nanospray source, and Xcalibur 1.4 instrument
control. Analysis and protein identification protocols were followed as
described by Neel and colleagues (Neel, 2008; Neel et al., 2009). Proteins
were identified using the Sequest search alogrithm and were filtered
for confident identifications using a database program called Complete
Hierarchical Integration of Protein Searches (CHIPS). Subsequent valida-
tion was performed on proteins that were identified in at least three of the
four experiments with multiple peptides for the same protein (Neel, 2008;
320 Dayanidhi Raman et al.

Non-specific rabbit lgG beads Anti-CXCR2 rabbit lgG beads


Mock control Untreated 1 min CXCL8

Elution: Heat at 65 ⬚C in laemmli

Colloidal blue stained 10% gel


Mock Unt CXCL8

Excise stained regions


containing eluted proteins

In-gel trypsin digest

Load tryptic peptides: HPLC/mass spectrometry


CTQ lon trap mass spectrometer

Sequest search

CHIPS program/identify unique proteins

Figure 15.2 Flow chart of the proteomic approach employed in the characterization of
the CXCR2 chemosynapse.

Neel et al., 2009). We identified 7 proteins that uniquely associate with


CXCR2 after ligand stimulation, 11 proteins that associate with CXCR2 in
the ligand-unstimulated state, and 6 proteins that associate with CXCR2
under both ligand-stimulated and -unstimulated conditions. These proteins
can be grouped into four types: proteins involved in organization of the actin
cytoskeleton, proteins involved in receptor trafficking, proteins involved in
scaffolding and signaling, and other proteins (Fig. 15.2) (Neel, 2008).

2. Validation of the Interaction of Novel


Proteins with CXCR2
Once the novel or known proteins that were previously not known to
bind CXCR2 are identified by proteomics, each was validated for its authentic
interaction with CXCR2 by performing a coimmunoprecipitation experi-
ment as well as colocalization in cells with and without CXCL8 stimulation.
Characterization of CXCR2 Chemosynapse 321

2.1. Coimmunoprecipitation of CXCR2 and


CXCR2-binding proteins
Coimmunoprecipitation was performed similar to that described above for
proteomic identification except that after running the SDS-PAGE, the pro-
teins were transferred to the nitrocellulose membrane, blocked with 5% milk
in TBS (20 mM Tris-HCl, pH 7.5, 150 mM NaCl) for 1 h at room
temperature (RT) and the proteins that were coimmunoprecipitated with
CXCR2 were probed with the primary antibody directed against the
identified proteins in 1% milk in TBST (20 mM Tris-HCl, pH 7.5, 0.05%
Tween-20) overnight at 4  C. This was followed by incubation with either
affinity-purified donkey, antirabbit secondary antibody tagged with IR dye
800 or with affinity-purified goat, antimouse antibody tagged with Alexa
Fluor 680 for 1 h at RT, depending on the host species from which
the primary antibody was derived. During this incubation, the blot was
foil-wrapped to minimize any photobleaching of the IR 800 dye or Alexa
Fluor 680. Following this, the blot was washed thrice with TBST. The
CXCR2-binding protein bands were detected by scanning the wet, drained
blot in an Odyssey detection system (LI-COR Biosciences, Lincoln, NE).
The images were processed initially using LI-COR odyssey software followed
by Photoshop computer program (Adobe Systems, San Jose, CA).

2.2. Colocalization CXCR2 and CXCR2-interacting proteins


in dHL-60 cells
The colocalization of CXCR2 and CXCR2-interacting proteins in dHL-60
cells can be examined by either stimulating the cells with CXCL8 universally
or by a chemokine gradient using a Zigmond chamber (Neuroprobe,
Gaithersburg, MD).

2.2.1. Polarization in Zigmond chamber


Differentiated HL-60 cells stably expressing CXCR2 were seeded onto
fibronectin-coated (100 mg/ml) glass coverslips for 10 min at 37  C in
tissue-culture incubator with 5% CO2. The coverslip was inverted and placed
face down on the Zigmond chamber so that the bridge of the chamber will be
in the middle of the coverslip. The left chamber was filled with 90 ml of
chemotaxis medium (serum-free RPMI-1640 with 0.1% BSA) and the right
chamber with 90 ml of chemotaxis medium with 25 to 50 ng/ml of CXCL8.
The loaded Zigmond chamber was incubated at 37  C for 15 min in tissue-
culture incubator with 5% CO2. After this, the coverslip was gently rinsed in
PBS (58 mM Na2HPO4, 17 mM NaH2PO4, and 68 mM NaCl, pH 7.5)
(optional) and fixed in 4% paraformaldehyde for 10 min at RT.
322 Dayanidhi Raman et al.

2.2.2. Immunocytochemistry and confocal microscopy


The paraformaldehyde-fixed coverslips were washed thrice with PBST
(PBS, pH 7.5, with 0.05% Tween-20). The polarized dHL-60 cells were
permeabilized with 0.2% Triton X-100 for 5 min at RT. After aspiration of
Triton X-100, any trace amount of Triton X-100 was rinsed out with
PBST. The permeabilized cells were blocked with 10% donkey serum
( Jackson Immunoresearch, West Grove, PA) for 30 min to 1 h at RT.
After rinsing in PBST, the coverslips were incubated with the primary
antibodies directed against CXCR2 and the CXCR2-interacting proteins
for 2 h at RT. If phosphorylated CXCR2-interacting proteins were to be
detected, fixation with paraformaldehyde may destroy the phospho-
CXCR2–binding protein signal. Alternatively, fixing in ice-cold methanol
(cooled to –20  C) allows detection of phosphorylated serines and threo-
nines in a given protein but methanol does not stabilize F-actin. After
washing thrice with PBST, the coverslips were incubated with either
donkey antimouse or donkey antirabbit antibodies that are conjugated to
the flourophores cy2 or cy3 ( Jackson Immunoresearch, West Grove, PA).
The filamentous actin (F-actin) was stained with rhodamine-conjugated
phalloidin (Invitrogen, Carlsbad, CA). F-actin is a marker of the leading
edge of the polarized cells and phalloidin is a toxin obtained from death cap
mushroom (Amanita phalloides) that binds to the polymerized actin filaments
(F-actin) more avidly than the actin monomers. After washing thrice with
PBST and once with PBS, the coverslips were mounted with ProLong
Gold antifade reagent (Invitrogen, Carlsbad, CA). The edges of the cover-
slip were sealed with nail polish. Confocal images of the polarized cells were
acquired using a Zeiss Inverted LSM-510 meta laser-scanning confocal
microscope (Carl Zeiss, Thornwood, NY) with a 63 objective and 1.4
Plan-APOCHROMAT oil immersion lens. The images were processed by
the Photoshop computer program (Adobe Systems, San Jose, CA).

2.3. Glutathione S-transferase pull-down studies


2.3.1. GST-CXCR2 C-tail constructs
For glutathione S-transferase (GST) pull-down studies, the gene encoding the
full-length carboxyl terminus of CXCR2 (311-355) was inserted into BamH I
and Xho I sites of the GST vector pGEX-6P-1 (GE Healthcare, Piscataway,
NJ). The PCR primers for the construction of GST-CXCR2-311-355 plasmid
follow: forward, 50 -CTCTAGGGATCCTTCATTGGCCAGAAGT-30 ,
and reverse, 50 -CTAGCTCTCGAGTTAGAGAGTAGTGG-30 . The GST-
CXCR2 C-tail construct was used as a template to generate the GST-CXCR2-
311-330 construct (first half of the CXCR2 C-tail). To make this construct,
a stop codon was introduced at position 331, converting a serine codon (AGC)
to a stop codon (TGA). To accomplish this, the QuikChange mutagenesis
kit (Strategene, La Jolla, CA) was employed. The PCR primers follow: forward,
Characterization of CXCR2 Chemosynapse 323

50 -CTAGCTATACATGGCTTGATCTGAAAGGACTCC-30 , and reverse,


50 -GGGCAGGGAGTCCTTTCAGATCAAGCCATGTAT-30 . To screen
for the binding site for CXCR2 interacting proteins on the CXCR2 C-tail, the
C-terminus was split in two (311-330 and 331-355) and were inserted into
BamH I and Xho I sites of the vector pGEX-6P-1. One microliter of the
restriction enzyme Dpn I was added to the PCR mixture and incubated at 37  C
for 1 h to digest the methylated parental strands of DNA leaving behind the
intact nonmethylated PCR product. This removes any false-positive colonies
showing up after transformation. After Dpn I digestion, about 10% (5 ml out
50 ml) of the PCR product was used to transform XL-1 blue competent cells
supplied with the QuikChange mutagenesis kit. The nick in the PCR product
will be repaired by the bacteria to produce a circular double-stranded plasmid.
Following transformation, LB/Amp Petri plates were incubated overnight
at 37  C. Four colonies were picked up and 5-ml cultures were grown
with ampicillin at 1 mg/ml to isolate the plasmid using the GenElute HP plasmid
mini-prep kit (Sigma, St. Louis, MO, cat. no. NA0160). The mini-prep
plasmids from different colonies were verified for the correct coding or
mutation or stop codon introduction by DNA sequencing using Big Dye
Terminator chemistry at the Vanderbilt DNA sequencing core facility.

2.3.2. Production of GST-fusion proteins


After verification of the cDNA for the GST-fusion protein by sequencing,
the constructs were transformed into BL 21 cells for production of GST-
CXCR2 C-tail protein. Four clones were selected and 3-ml cultures were
grown overnight at 37  C in LB/ampicillin (1 mg/ml) and the clones that
express the optimal amount of protein were selected. For GST-fusion protein
production to be used in pull-down studies, an overnight 20-ml culture with
ampicillin (1 mg/ml) was expanded to 200 ml with ampicillin (1 mg/ml) and
grown for an additional 2 h at 37  C. The fusion protein expression was
induced with 50 mM of isopropyl b-D-thiogalactoside (IPTG) (Sigma,
St. Louis, MO) for 2 h at 30  C. The bacteria were pelleted by centrifugation
at 5000 rpm for 10 min. The bacterial pellet was resuspended in PBS with
0.1% Triton and bacterial protease inhibitor cocktail (AEBSF, Bestatin HCl,
E-64, EDTA [ethylenediaminetetraacetic acid] and pepstatin A; Sigma,
St. Louis, MO, cat. no. P 8465). The bacteria were lysed on ice using a
probe-tip sonicator (Branson Sonifier 250) (four cycles of 10 s each with in-
between cooling on ice). The lysate was clarified by centrifugation at 13,000
rpm for 10 min, and the clear supernatant was nutated with preswollen
glutathione-agarose beads (Sigma, St. Louis, MO, cat no. G 4510) equili-
brated with the lysis buffer for 1 h at 4  C. The beads with bound GST-fusion
proteins were washed thrice with the lysis buffer and once without any
detergent in the lysis buffer. The protein on the beads was quantified by
Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA) and beads were
aliquoted and stored at –80  C.
324 Dayanidhi Raman et al.

2.3.3. GST pull-down experiment


Fifty to 100 mg of the GST-CXCR2-311-355 (full-length C-tail), GST-
CXCR2-311-330 (first half of the C-tail) and GST-CXCR2-331-355
(second half of the C-tail) were washed in the binding buffer (50 mM
Tris-HCl, pH 7.5, 0.05% Triton X-100, 300 mM NaCl) and mixed with
cell lysates expressing the CXCR2-binding proteins for 1 h at 4  C. The
bound proteins were separated from the unbound by washing the beads
thrice by centrifugation at 1000 rpm for 30 s. The bound proteins were
eluted by boiling in Laemmli sample buffer for 5 min, and then the eluent
was analyzed by 10% SDS-PAGE followed by Western blotting and
subsequent probing for the CXCR2-binding proteins with specific anti-
body. GST controls were included for comparison.
Alternatively, the binding of CXCR2-interacting proteins to GST-
CXCR2 C-tail can be followed in a 96-well ELISA format assay. Briefly,
GST-fusion proteins were isolated as described above and eluted with 50 mM
Tris-HCl, pH 8.0, 10 mM reduced glutathione (GSH). A 96-well polyvinyl
plate was coated with GST or GST-CXCR2 (at 3 mg/ml) in triplicate followed
by blocking in 0.5% Tween-20/0.5% Triton X-100 in PBS, pH 7.5. The
coated plate was overlaid with varying amounts of His6-CXCR2–binding
protein for 1 h at RT. The plate was washed six times with PBST (PBS with
0.1% Tween-20). Bound CXCR2–binding protein was probed with His-
probe-HRP (Pierce, Milwaukee, WI) and detected by colorimetry by incu-
bating with peroxidase substrate solution consisting of 50 mM sodium citrate
buffer, pH 4.2, 90 mM 2,20 -azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid
(ABTS) (Sigma, St. Louis, MO) and 0.05 mM H2O2. The reaction was
terminated by adding an equal volume of 1% (w/v) sodium dodecyl sulfate
(SDS) (Sigma, St. Louis, MO). The color intensity was read at 405 nm with an
ELX800NB plate reader (Bio-Tek Instruments, Winooski, VT).

3. Mutational Analysis of Residues at


Interactive Interface of CXCR2 and
CXCR2-Binding Proteins
For any two bonafide interacting proteins, the functional significance
behind their interaction can be inferred by mutating the contact surface
residues on both proteins. In the CXCR2 chemosynapse model, the inter-
action of CXCR2 with its binding proteins may up- or down-regulate the
function of CXCR2. If the interaction between CXCR2 and the CXCR2-
binding proteins can be ablated by mutating amino acids either on the
CXCR2 C-terminus or on the CXCR2-binding protein interactive sur-
face, and then the functional outcome will point to the role played by the
adaptor protein at a particular point in the cell within the context of the
Characterization of CXCR2 Chemosynapse 325

chemosynaptic network. To address this, the CXCR2 C-terminus fused to


the GST protein was divided in two to examine the specific half or both
halves of the CXCR2 C-terminus that support the binding of CXCR2-
binding proteins. The construction of these cDNA constructs has been
described in detail previously in the GST pull-down studies section. Once
a small segment has been identified, then the binding capability of all of the
amino acid residues in that segment can be verified by alanine scanning
mutagenesis and performing a CXCR2-binding protein pull-down experi-
ment. This will also yield information on biochemical nature of the interac-
tion between CXCR2 C-tail and the CXCR2-binding proteins. Also, this
same mutation can be substituted in the full-length CXCR2 and the pheno-
type can be assessed in dHL-60 cells with regard to any chemotactic defects.

4. Radioactive Phosphorylation of CXCR2


Interacting Proteins
Cells were seeded onto 150 cm2 dishes and allowed to attach and spread
for 8 h. The cells were then washed with serum-free and phosphate-free
DMEM (Invitrogen, Carlsbad, CA) twice and were starved overnight in the
same medium. After 12 to 14 h, the medium was replaced with 9 ml of fresh
serum and phosphate-free DMEM, and the ATP pool of the cell was
metabolically radiolabeled with 300 mCi of 32P-orthophosphate (Perkin
Elmer Life and Analytical Sciences, Boston, MA) and the incubation
continued for 4 h. Cells were stimulated with ligand for 1 min at 37  C.
The radioactive medium was carefully aspirated out and gently rinsed once in
ice-cold, phosphate-buffered saline (PBS), pH 7.5. The cells were then lysed
on ice using 50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 0.1% IGEPAL
CA-630 (NP-40) (Sigma, St. Louis, MO), 0.1% sodium deoxycholate
(Sigma, St. Louis, MO), 5 mM EDTA supplemented with protease inhibitor
cocktail, and phosphatase inhibitor cocktail I and II (all from Sigma, St. Louis,
MO). These were nutated for 10 min at 4  C. The lysates were clarified by
centrifugation at 7000 for 7 min at 4  C. The clarified lysate was precleared
with 1 mg of normal rabbit IgG ( Jackson Immunoresearch, West Grove, PA)
and 20 ml of Protein A-Sepharose (Santa Cruz Biotech, Santa Cruz, CA). The
precleared lysate was split in three and subjected to immunoprecipitation by
normal rabbit IgG, and the antibody to the CXCR2 interacting protein for
1 h at 4  C. The immune complexes were captured by 40 ml of Protein
A-Sepharose and were washed thrice in lysis buffer and once in 50 mM Tris,
pH 7.5. The proteins were eluted by boiling for 5 min and then resolved by
10% SDS-PAGE. The proteins were transferred to nitrocellulose membrane
and the nitrocellulose filter is dried. Phosphorylated CXCR2 associating
proteins were identified by autoradiography.
326 Dayanidhi Raman et al.

The availability of phospho-specific antibodies for CXCR2 interacting


proteins enables one to examine the relevance of a particular phosphoryla-
tion site in its interaction with CXCR2. Employment of specific mutants
involving combinations of these phosphorylation sites can determine
whether the specific phosphorylations were important for its binding to
CXCR2. The phosphorylated residues on CXCR2 interacting proteins
may directly participate in its binding to CXCR2 or it may induce allosteric
conformational changes that may expose a new binding surface favoring its
interaction to CXCR2.

5. Chemotaxis Assay
To determine the functional significance of a specific protein in the
CXCR2 chemosynapse to CXCR2-mediated chemotaxis, the CXCR2-
binding protein was knocked down in HL-60 cells by shRNA using a
lentiviral delivery system (Kappes and Wu, 2001; Kappes et al., 2003).
shRNA clones against a particular CXCR2 interacting protein were selected
from the GIPZ lentiviral shRNAmir library from Open Biosystems (Hunts-
ville, AL). A nonsilencing construct in the same vector was chosen as the
control. The lentiviruses containing shRNA or nonsilencing sequence were
packaged in the 293-FT cell line (Invitrogen, Carlsbad, CA) by transfecting
6 mg of shRNA construct of the CXCR2 interacting protein, 4 mg of
psPAX2, and 2 mg of pMD2.G. The medium containing the viruses was
collected 48 h and 72 h posttransfection and used to infect HL60-CXCR2
cells after concentration through an Amicon-50 Ultra filter (Millipore,
Billerica, MA). Polyclonal stable cell lines were selected in 0.5 mg/ml
puromycin and the level of knock-down was determined by Western blot,
and cells with at least 70% knock-down were tested in chemotaxis assays.

5.1. Chemotaxis and chemokinesis assays in modified


Boyden chamber
The chemotaxis assay was performed with dHL-60-CXCR2 cells with a
modified Boyden chamber (Neuroprobe, Gaithersburg, MD) as previously
described (Sai et al., 2006, 2008). Briefly, various concentrations of CXCL8
(Peprotech, Rocky Hill, NJ) were prepared in 1% bovine serum albumin/
phenol red–free RPMI (chemotaxis buffer), and 400 ml of the chemotaxis
medium containing different concentrations of CXCL8 are loaded into
a 96-well plate in triplicates. A polycarbonate filter (3-mm pore size)
(Neuroprobe, Gaithersburg, MD) was placed above the wells and the
chamber was assembled. dHL-60-CXCR2 cells were washed twice with
Characterization of CXCR2 Chemosynapse 327

the chemotaxis buffer and resuspended at a density of 5  105 cells/ml.


Two hundred microliters (1  105 cells) of dHL-60-CXCR2 cells were
loaded onto top wells for the series of chemokine concentrations and
incubated for 1 h at 37  C, 5% CO2. After 1 h, the Boyden chamber was
disassembled and the 96-well plate with transmigrated cells was centrifuged
to pellet the cells. The cells were washed three times with modified Hank’s
buffer (mHBSS) (20 mM HEPES, pH 7.2, 150 mM NaCl, 4 mM KCl,
1.2 mM MgCl2, and 10 mg/ml glucose) (Servant et al., 1999), and finally
resuspended in 100 ml of mHBSS. The cells were lysed and a colorimetric
reaction (60 ml of NAG solution [4-nitrophenyl-N-acetyl-b-D-glucosami-
nide], Sigma, St. Louis, MO; 25 mM sodium citrate, 25 mM citric acid, and
0.25% Triton X-100, pH 5.0) was set up overnight at RT in the dark. One
hundred microliters of the stop solution (50 mM glycine, 5 mM EDTA,
pH 10.4) were added to each well, and the yellow color that develops was
read at 405 nm using an ELISA plate reader. The number of transmigrated
cells was calculated from the standard curve obtained from cells loaded at the
bottom, ranging from 0 to 2500, 5000, 10,000, 20,000, and 40,000 cells.
The chemotactic index was calculated by dividing the number of migrated
cells in response to a particular concentration of the chemokine by the
number of cells that transmigrated in response to buffer alone. Chemokin-
esis assay was performed similarly except that equal concentrations of the
chemokine were added to both the top and the bottom wells.

5.2. Chemotaxis assay in micro fluidic gradient device


Generation of a controllable and stable gradient of chemokine has been
challenging for scientists to study chemotaxis in vitro. Jeon et al. (2002)
demonstrated a microfluidic device that allows generation of a variety of
stable gradients by keeping a constant flow of solution. The advantages of
this device are (1) provides a stable gradient of chemokine, (2) generates
different steepness of gradient as designed, and (3) different profiles of
gradient, such as linear, exponential, bimodal, and so on. However, since
the gradient is maintained by a constant flow of solution, the shear force
applied on the cells and its impact on chemotaxis should be considered.
Microfluidic gradient devices were made at the Vanderbilt Institute for
Integrative Biosystems Research and Education (VIIBRE) as described
previously (Fig. 15.3) (Walker et al., 2005).
Devices were precoated with human fibronectin (100 mg/ml) in mod-
ified Hank’s buffer (mHBSS) (20 mM HEPES, pH 7.2, 150 mM NaCl,
4 mM KCl, 1.2 mM MgCl2, and 10 mg/ml glucose) (Servant et al., 1999)
for 1 h at RT and washed briefly with mHBSS before use. Differentiated
HL60-CXCR2 cells were washed and resuspended in serum-free RPMI/
1640 medium at 4  106 cells/ml, and injected into the precoated device.
328 Dayanidhi Raman et al.

INcell
INA

OUT

INB

(a) (b) (c)

A B C
Concentration (mg/ml)

Concentration (mg/ml)

Concentration (mg/ml)
100 100 100
80 80 80
60 60 60
40 40 40
20 20 20
0 0 0
0 100 200 300 400 500 0 100 200 300 400 500 0 100 200 300 400 500
Distance (mm) Distance (mm) Distance (mm)

Figure 15.3 Gradient formation in microfluidic gradient device. FITC-dextran gradi-


ent was formed by a constant flow of 100 mg/ml FITC-dextran (MW 10,000) in Hank’s
buffer, and buffer alone driven by a syringe pump running at 1 ml/min.The fluorescent
images were taken at various locations along the main channel. The intensity of the
fluorescence was quantitated across the channel for each image and shown in the
plots. (From Walker, G. M., Sai, J., Richmond, A., Stremler, M., Chung, C. Y., and
Wikswo, J. P. (2005). Effects of flow and diffusion on chemotaxis studies in a microfabri-
cated gradient generator. Lab Chip 5, 611^618, with permission byThe Royal Society of
Chemistry, http://dx.doi.org/10.1039/b417245k.)

Cells were seeded in the device for 5 min at 37  C, 5% CO2, and placed in a
prewarmed temperature-controlled chamber of the inverted microscope
(Axiovert 200 M, Carl Zeiss Microimage, Germany). The two input tub-
ings of the device were connected to syringes with one filled with CXCL8
in serum-free RPMI/1640 medium containing 1% bovine serum albumin
(BSA) and the other with RPMI/1640 only. The injection of the solutions
from syringes into the device was driven by a syringe pump (Harvard
PHD2000, Harvard Apparatus, Holliston, MA), first at 50 ml/min to
quickly fill the tubings with medium containing CXCL8 or just the
medium and at 0.5 ml/min to maintain a CXCL8 gradient in the main
channel of the device. The live cell microscopic images were taken every
20 s for a period of 30 min by a CCD camera (Hamamatsu, Japan)
controlled by the computer software Metamorph (Molecular Devices Cor-
poration, Downingtown, PA). The data were analyzed by Metamorph to
track the cell movements (Sai et al., 2006, 2008).
Characterization of CXCR2 Chemosynapse 329

6. Conclusions
The use of immunoprecipitation of chemokine-receptor and
receptor-associating proteins from cells stimulated with chemokine ligand
for varying periods of time, followed by LC/MS/MS proteomic analysis of
the receptor-associating proteins reveals important information about the
protein–protein interactions occurring over time in response to ligand
activation of chemokine receptors. This methodology, when combined
with careful GST-pull-down analysis of the interaction with purified pro-
teins, immunofluorescence, and functional analysis of the receptor–receptor
binding protein interacting sites will provide key information about the
spatial and temporal dynamics of the chemosynapse.

ACKNOWLEDGMENTS
This work was supported by grants from the National Cancer Institute (CA34590, A.R.), the
Vanderbilt-Ingram Cancer Center (grant CA 68485), and Vanderbilt Multidisciplinary Basic
Research Training in Cancer (grant T32CA09592). Support also came from the Department
of Veterans Affairs through a VA Senior Research Career Scientist Award (A.R.) and
through the Ingram family through an Ingram Professorship (A.R.).

REFERENCES
Balabanian, K., Lagane, B., Pablos, J. L., Laurent, L., Planchenault, T., Verola, O.,
Lebbe, C., Kerob, D., Dupuy, A., Hermine, O., Nicolas, J. F., Latger-Cannard, V.,
et al. (2005). WHIM syndromes with different genetic anomalies are accounted for by
impaired CXCR4 desensitization to CXCL12. Blood 105, 2449–2457.
Gallagher, R., Collins, S., Trujillo, J., McCredie, K., Ahearn, M., Tsai, S., Metzgar, R.,
Aulakh, G., Ting, R., Ruscetti, F., and Gallo, R. (1979). Characterization of the
continuous, differentiating myeloid cell line (HL-60) from a patient with acute promye-
locytic leukemia. Blood 54, 713–733.
Gulino, A. V., Moratto, D., Sozzani, S., Cavadini, P., Otero, K., Tassone, L., Imberti, L.,
Pirovano, S., Notarangelo, L. D., Soresina, R., Mazzolari, E., Nelson, D. L., et al. (2004).
Altered leukocyte response to CXCL12 in patients with warts hypogammaglobulinemia,
infections, myelokathexis (WHIM) syndrome. Blood 104, 444–452.
Hernandez, P. A., Gorlin, R. J., Lukens, J. N., Taniuchi, S., Bohinjec, J., Francois, F.,
Klotman, M. E., and Diaz, G. A. (2003). Mutations in the chemokine receptor gene
CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease.
Nat. Genet. 34, 70–74.
Kappes, J. C., and Wu, X. (2001). Safety considerations in vector development. Somat. Cell.
Mol. Genet. 26, 147–158.
Kappes, J. C., Wu, X., and Wakefield, J. K. (2003). Production of trans-lentiviral vector
with predictable safety. Methods Mol. Med. 76, 449–465.
Lagane, B., Chow, K. Y. C., Balabanian, K., Levoye, A., Harriague, J., Planchenault, T.,
Baleux, F., Gunera-Saad, N., Arenzana-Seisdedos, F., and Bachelerie, F. (2008).
330 Dayanidhi Raman et al.

CXCR4 dimerization and {beta}-arrestin-mediated signaling account for the enhanced


chemotaxis to CXCL12 in WHIM syndrome. Blood 112, 34–44.
Li Jeon, N., Baskaran, H., Dertinger, S. K., Whitesides, G. M., Van de Water, L., and
Toner, M. (2002). Neutrophil chemotaxis in linear and complex gradients of
interleukin-8 formed in a microfabricated device. Nat. Biotechnol. 20, 826–830.
Neel, N. F. (2008). ‘‘Regulation of CXC chemokine receptor function through intracellu-
lar trafficking and novel receptor-interacting proteins.’’ Ph.D. diss., Vanderbilt
University.
Neel, N. F., Barzik, M., Raman, D., Sobolik-Delmaire, T., Sai, J., Ham, A. J.,
Mernaugh, R. L., Gertler, F. B., and Richmond, A. (2009). VASP is a CXCR2-interacting
protein that regulates CXCR2-mediated polarization and chemotaxis. J. Cell Sci. in press.
Sai, J., Raman, D., Liu, Y., Wikswo, J., and Richmond, A. (2008). Parallel phosphatidyli-
nositol 3-kinase (PI3K)-dependent and Src-dependent pathways lead to CXCL8-
mediated Rac2 activation and chemotaxis. J. Biol. Chem. 283, 26538–26547.
Sai, J., Walker, G., Wikswo, J., and Richmond, A. (2006). The IL sequence in the LLKIL
motif in CXCR2 is required for full ligand-induced activation of Erk, Akt, and chemo-
taxis in HL60 cells. J. Biol. Chem. 281, 35931–35941.
Servant, G., Weiner, O. D., Neptune, E. R., Sedat, J. W., and Bourne, H. R. (1999).
Dynamics of a chemoattractant receptor in living neutrophils during chemotaxis. Mol.
Biol. Cell 10, 1163–1178.
Thelen, M., and Stein, J. V. (2008). How chemokines invite leukocytes to dance. Nat.
Immunol. 9, 953–959.
Ueda, Y., Neel, N. F., Schutyser, E., Raman, D., and Richmond, A. (2006). Deletion of the
COOH-terminal domain of CXC chemokine receptor 4 leads to the down-regulation of
cell-to-cell contact, enhanced motility and proliferation in breast carcinoma cells. Cancer
Res. 66, 5665–5675.
Walker, G. M., Sai, J., Richmond, A., Stremler, M., Chung, C. Y., and Wikswo, J. P.
(2005). Effects of flow and diffusion on chemotaxis studies in a microfabricated gradient
generator. Lab Chip 5, 611–618.
Yu, Y., Su, Y., Opalenik, S. R., Sobolik-Delmaire, T., Neel, N. F., Zaja-Milatovic, S.,
Short, S. T., Sai, J., and Richmond, A. (2008). Short tail with skin lesion phenotype
occurs in transgenic mice with keratin-14 promoter-directed expression of mutant
CXCR2. J. Leukoc. Biol. 84, 406–419.
C H A P T E R S I X T E E N

Phosphoproteomic Analysis of
Chemokine Signaling Networks
Morgan O’Hayre,*,1 Catherina L. Salanga,*,1 Pieter C. Dorrestein,*
and Tracy M. Handel*

Contents
1. Introduction 332
2. Methods 334
2.1. Isolation of chronic lymphocytic leukemia cells 334
2.2. CXCL12 stimulation of CLL cells and lysate preparation 334
2.3. IMAC phosphopeptide enrichment of CLL samples 335
2.4. Reversed-phase liquid chromatography and tandem
mass spectrometry 339
3. Summary 343
Acknowledgments 344
References 345

Abstract
Chemokines induce a number of intracellular signaling pathways by activating
second messengers (e.g. calcium) and phosphorylation cascades in order to
mediate a myriad of functions including cell migration, survival and prolifera-
tion. Although there is some degree of overlap in chemokine receptor–mediated
pathway activation, different chemokines will often elicit distinct signaling
events. Factors such as cell type, receptor expression levels, G protein avail-
ability, and disease state will also influence the signaling response from
chemokine-induced receptor activation. Improvements in mass spectrometry,
enrichment strategies, and database search programs for identifying phospho-
peptides have made phosphoproteomics an accessible biological tool for
studying chemokine-induced phosphorylation cascades. Although signaling
pathways involved in chemokine-mediated migration have been fairly well
characterized, less is known regarding other signaling cascades elicited by
chemokines (e.g. to induce proliferation) or the potential for distinct pathway
activation in a disease state such as cancer. CXCL12(SDF-1)/CXCR4 signaling

* Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego,
La Jolla, California, USA
1
Both authors contributed equally

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05216-1 All rights reserved.

331
332 Morgan O’Hayre et al.

has been shown to play an important role in the survival of chronic lymphocytic
leukemia (CLL) cells, and thus provides a good system for exploring chemokine
signaling, particularly in the interest of survival pathway activation. In this
chapter, we describe the use of immobilized metal affinity chromatography
(IMAC) phosphopeptide enrichment followed by reversed-phase liquid chroma-
tography and tandem mass spectrometry (LC-MS/MS) analysis for exploring
CXCL12-mediated signaling in human CLL patient cells.

1. Introduction
As chemokines bind their respective chemokine receptors, they
induce conformational changes in the receptors leading to activation
of intracellular signaling molecules including G proteins and b-arrestins
(Thelen, 2001). These intracellular signaling molecules activate a variety
of downstream signaling pathways primarily through the initiation of
phosphorylation cascades.
In eukaryotic organisms, phosphorylation, a key reversible post-
translational modification, is critical for the rapid transduction of messages
from extracellular stimuli to elicit a cellular response. Thus, it is not
surprising that an estimated 2 to 3% of the human genome is directly
involved in phosphorylation (kinases, which catalyze the addition of phos-
phate groups, and phosphatases, which catalyze their removal) (Hubbard
and Cohen, 1993; Manning et al., 2002), and an estimated 30 to 50% of
proteins are proposed to exhibit phosphorylation at some point in time
(Kalume et al., 2003). Phosphorylation is known to alter the activity,
stability, localization, and interaction properties of molecules, and has
been linked to a number of cellular processes including cell growth, metab-
olism, differentiation, movement, and apoptosis (de Graauw et al., 2006;
Schreiber et al., 2008). However, the study of protein phosphorylation has
been limited due to a number of challenges, including low abundance of
many phosphoproteins, the low stoichiometry of phosphorylation, the
heterogeneity of phosphorylation sites on a given protein, and the
transient/reversible nature of phosphorylation (Mann et al., 2002).
Classically, immunoblot (Western blot) analysis using phosphorylation-
specific antibodies to a target of interest has been the gold standard for
probing phosphorylation cascades activated in response to extracellular
stimuli. Immunohistochemistry, immunofluorescence, and flow cytometry
are additional methods for probing these signaling events; however, all of
these techniques target specific proteins and require highly specific phos-
phoantibodies. The high costs and limited availability of phosphoantibodies
restrict the use of these techniques, which are generally used when
there is prior knowledge or association with a particular signaling pathway.
Phosphoproteomic Analysis of Chemokine Signaling 333

These methods are not amenable to global examination of phosphorylation


events or for the identification of new phosphorylation sites. Classic meth-
ods to identify new phosphorylation sites including Edman sequencing
and 32P mapping are generally tedious and not commonly performed
(Mann et al., 2002). These limitations in understanding global (as opposed
to a priori knowledge and targeted) protein phosphorylation events and in
identifying novel phosphorylation sites have been a strong driving force for
the development and implementation of phosphoproteomics techniques.
Utilizing phosphoproteomics to investigate intracellular signaling
provides an unbiased approach for globally investigating cellular response
to stimuli. The ability to simultaneously examine many phosphoproteins
within a single sample and discover novel phosphorylations has also
made phosphoproteomics a very attractive alternative from traditional
approaches. However, implementation of mass spectrometry (MS)–based
phosphoproteomics has its own set of challenges including negative ion
suppression effects, limited dynamic range of detection, and difficulties
in confidently identifying phosphopeptides (Paradela and Albar, 2008;
Schreiber et al., 2008). Nevertheless, the development and improvement
of phosphoprotein and phosphopeptide enrichment strategies to counteract
dynamic range problems and database search algorithms incorporating
post-translational modifications have made this technique more accessible
and feasible for signaling studies (Paradela and Albar, 2008; Schreiber
et al., 2008).
Given the improvements in phosphoproteomics strategies, this tech-
nique can be employed to generate a wealth of information on cellular
response to stimuli such as chemokines. Although there is some functional
redundancy in the chemokine system given the approximate 50 chemokine
ligands and 20 chemokine receptors (Allen et al., 2007), many chemokine/
receptor pairs will activate distinct pathways and responses (O’Hayre et al.,
2008). Furthermore, differences in cell type and factors such as G protein
availability and expression of specific isoforms and/or levels of particular
signaling molecules can have dramatic effects on the signaling pathways
utilized and functional response to chemokine stimulation (Salanga et al.,
2008). It is also largely unknown how different disease states such as chronic
inflammation or cancer may alter the response to chemokines, potentially
through misregulation of known pathways, activation of alternative
pathways, or targeting of different downstream effectors.
Here we present the use of MS-based phosphoproteomics method to
investigate the signaling pathways induced by CXCL12 in chronic lympho-
cytic leukemia (CLL) cells. CLL is the most common form of adult leuke-
mia in the Western world and is characterized by the accumulation of a
monoclonal population of CD5þ B cells in the blood, bone marrow, and
secondary lymphoid tissues (Burger et al., 2000). CLL cells are known to
overexpress the chemokine receptor, CXCR4 (Mohle et al., 1999), and its
334 Morgan O’Hayre et al.

ligand, CXCL12, is thought to be an important microenvironmental factor


contributing to the survival of these cells (Burger et al., 2000). Access to
primary CLL cells (not immortalized or passaged cell lines) and the rele-
vance of the CXCL12/CXCR4 axis to cancer pathogenesis (Burger and
Kipps, 2006) make this an ideal system for studying phosphorylation signal-
ing cascades induced by CXCL12. It is important to note that while the
method described here is specific to CXCL12 stimulation of CLL cells, it
can also be used as a starting point for alternative studies involving chemo-
kine/receptor signaling networks as well as non–chemokine signaling net-
works. Within these methods, there are many possibilities for optimization,
as well as additional manipulations that can be exploited to obtain the most
comprehensive results possible.

2. Methods
2.1. Isolation of chronic lymphocytic leukemia cells
Primary CLL cells were obtained in collaboration with Dr. Thomas Kipps at
the University of California, San Diego, Moores Cancer Center. Briefly,
leukopheresis blood was collected from consenting CLL patients, in agree-
ment with institutional guidelines. Peripheral blood mononuclear cells
(PBMCs) were isolated by Ficoll-Paque (Amersham Biosciences, Piscat-
away, NJ) density gradient centrifugation. Any contaminating red blood
cells were lysed at room temperature (RT) for 5 min with red blood cell
lysis buffer (Roche Diagnostics, Indianapolis, IN). The PBMCs from the
CLL patient used for this particular phosphoproteomics data were deter-
mined to contain more than 90% CD19þ/CD5þ/CD3– B cells as assessed
by flow cytometry.

2.2. CXCL12 stimulation of CLL cells and lysate preparation


2.2.1. CXCL12 preparation
CXCL12 was insolubly expressed in inclusion bodies as a His tag fusion in
Escherichia coli. The protein was purified over a Ni-NTA column and
refolded with Hampton Fold-It Buffer #8 (Hampton Research, Aliso
Viejo, CA). Following dialysis and protein concentration, the His tag was
cleaved at RT overnight using enterokinase (NEB, Ipswich, MA) at a
1:100,000 molar ratio. CXCL12 was purified by HPLC, and MS was
performed to verify protein identity and purity. Transwell migration assays
(Corning, Corning, NY) using Jurkat cells (ATCC, Manassas, VA) were
performed to validate the functionality of purified CXCL12.
Phosphoproteomic Analysis of Chemokine Signaling 335

2.2.2. Stimulation of CLL cells


To prepare cell lysates for phosphoproteomic analysis, 3  109 CLL PBMCs
were washed with sterile PBS, and resuspended at 1  107 cells/ml in
serum-free, RPMI-1640 media (Gibco, Rockville, MD). Sixty milliliters
of CLL cell suspension were distributed into each of five 15 cm plates
(Corning Inc, Corning, NY) and cultured for 2 h at 37  C/5% CO2 prior
to stimulation with CXCL12. A CXCL12 stimulation time course was
conducted such that one plate remained unstimulated and the other four
were stimulated for 3 min, 10 min, 30 min, or 60 min, with 30 nM
CXCL12, and all plates were harvested at the same time on ice. Cells
were lysed on ice for 30 min with 3 ml ice cold cytoplasmic lysis buffer
containing 10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM
dithiothreitol (DTT) (Sigma, St. Louis, MO), Complete protease inhibitor
cocktail (Roche Diagnostics, Indianapolis, IN), and Halt phosphatase inhib-
itor cocktail (Pierce, Rockford, IL). Plates were scraped with cell scrapers
(Sarstedt, Newton, NC) and the cell lysates were collected, sonicated on ice
for 15 s pulse (3 s on, 2 s off ), and then centrifuged at 20,000 rcf for 20 min at
4  C. The supernatants were distributed into protein LoBind Eppendorf tubes
(Eppendorf, Westbury, NY) and lysates and pellets were stored at –80  C.
Finally, the total protein concentration of the CLL lysates was determined
using a BCA protein assay (Pierce, Rockford, IL). Two milligrams of CLL
lysate from each time point were used for phosphoproteomic analysis.

2.3. IMAC phosphopeptide enrichment of CLL samples


The IMAC methods presented herein are based on the protocol described
by Payne et al. (2008); however, adjustments to the protocol have been
made for our system using CLL cells. Given that several phosphoproteomic
platforms are available (Schmelzle and White, 2006), factors such as sample
amount/availability, instrument access, time, and cost must be considered in
determining the best approach for a particular study. The strategy (Fig. 16.1)
employed for the current study was selected based on available resources as
well as the primary goal to rapidly identify many potentially interesting
downstream targets of CXCL12 stimulation in CLL cells. Several other
techniques could be used in conjunction with, or alternatively to, the
methods described below, and will be mentioned throughout.

2.3.1. Denaturation, reduction, and alkylation


To prepare lysates for tryptic digest and IMAC enrichment, CLL lysates
were denatured with 1% sodium dodecyl sulfate (SDS) (Fisher Scientific,
Pittsburgh, PA). Disulfides were then reduced by the addition of freshly
prepared DTT (final concentration ¼ 10.5 mM) and heated to 60 to 65  C.
336 Morgan O’Hayre et al.

CLL lysate
(unstimulated, 3⬘, 10⬘, 30⬘, 60⬘)

Denature, reduce, alkylate


P

In-solution
P
trypsin digest

C18 cleanup

IMAC

LC-MS/MS
P P P
P P P
P
InsPecT analysis

Validate results

Figure 16.1 IMAC phosphoenrichment strategy. Brief outline of the MS-based


methods using IMAC for phosphoenrichment of CXCL12-stimulated CLL cells.
Following enrichment and LC-MS/MS analysis, phosphopeptides were identified by
InsPecT and then manually validated.

After 20 min, lysates were cooled to RT for 30 min. Because reduction is
reversible, samples were alkylated with fresh iodoacetamide (Sigma,
St. Louis, MO) to a final concentration of 100 mM and left to incubate at
25  C for 30 min in the dark. Following SDS, DTT, and iodoacetamide
treatment, protein was precipitated by addition of 3 to 4 the starting
volume of 50% ethanol/50% acetone/0.1% acetic acid (HAC) in order to
remove the detergent. To aid precipitation, samples were thoroughly mixed
and stored at –80  C for 10 min. The precipitation reactions were then
centrifuged at 1500 rcf for 10 min. The supernatants were removed and the
pellets were washed again with an equivalent volume of 50% ethanol/50%
acetone/0.1% HAC plus 20% volume of H2O. The washed pellets were
centrifuged at 1500 rcf for 10 min, the supernatant was completely removed
and the protein pellets were left to dry overnight.

2.3.2. Trypsin digest


Protein pellets were resuspended in 200 ml of 6 M urea/0.1 M Tris, pH 8.0,
and vortexed (volume dependent on amount of starting material). Prior to
trypsin digest, the urea concentration was diluted five-fold by addition of
50 mM Tris, pH 8.0. Protein was digested using sequencing- grade modified
trypsin (Promega, Madison, WI) by resuspending trypsin in 50 mM Tris,
Phosphoproteomic Analysis of Chemokine Signaling 337

pH 8.0, and 1 mM CaCl2 (final concentration) and adding to sample at a ratio


of 1:50 (trypsin: protein). Digests were vortexed, parafilmed, and stored at
37  C while shaking. Following an overnight incubation, trypsin was inacti-
vated by acidification of the digests with trifluoroacetic acid to 0.3 to 0.5%
(v/v) and stored at 4  C (for long-term storage, freeze and store at –80  C).

2.3.3. C18 cleanup


Peptide mixtures were desalted with 50 mg Sep-pak C18 cartridges (Waters
Corp, Milford, MA). Prior to use, C18 cartridges (one per time point) were
hydrated with methanol, and then rinsed with 80% acetonitrile (ACN) /1%
HAC and equilibrated with 1% HAC. Peptides were loaded onto the
columns, washed twice with 1% HAC, and eluted with 400 ml of 80%
ACN/0.1% HAC. Fractions were collected in LoBind Eppendorf
tubes, dried on a speed-vac at 50  C for 1 h, and stored at 4  C. Pellets
were resuspended in 100 ml of 1% HAC and centrifuged at 1500 rcf for
2 min. Supernatants were saved and used for subsequent IMAC enrichment
steps.

2.3.4. IMAC bead preparation and enrichment


IMAC beads were prepared by removing the resin from 2 Ni-NTA spin
columns (Qiagen, Valencia, CA) and replacing the Ni for Fe. Nickel resin
was stripped by rotating with 50 mM EDTA, 1 M NaCl in 50 ml for 1 h,
and then centrifuged in a swinging bucket rotor at 1500 rcf for 2 min. The
supernatant was removed and the pellet was washed with 50 ml of Milli-Q
H2O followed by 50 ml of 0.6% HAC. The resin was then charged with
50 ml of 100 mM FeCl3 (Fluka reagent, Sigma, St. Louis, MO) in 0.3%
HAC for 1 h while rotating (Note: prior to FeCl3 stock use, allow any
impurities to settle from the solution for at least 1 month). Finally, superna-
tant was removed to make a 50:50 IMAC bead slurry (600 ml). Individual
IMAC columns were generated with the freshly prepared IMAC beads
using gel-loading tips (Fisher Scientific, Pittsburgh, PA) affixed with a
1 cc syringe to control flow rate. Each column was plugged with a small
amount of glass wool and pinched at the tip before adding 60 ml of IMAC
bead slurry. Before each sample was loaded onto its own gel loading tip, the
IMAC beads were conditioned with 25% ACN/0.1% HAC. Nonspecific
peptides were removed by washing twice with 30 ml of 25% ACN/0.1%
HAC/0.1 M NaCl, and then twice with 0.1% HAC, and finally twice with
30 ml of Milli-Q H2O. Phosphopeptides were eluted with a total volume of
50 ml over three elutions with 1% phosphoric acid. All fractions were
collected in protein LoBind Eppendorf tubes, speed-vac dried, and stored
at –20  C until MS analysis.
338 Morgan O’Hayre et al.

2.3.5. Additional phosphoenrichment strategies


and considerations
In addition to Fe3þ, Ga3þ is another commonly used metal for IMAC
(Paradela and Albar, 2008); ZrO2 (Feng et al., 2007) and TiO2 (Klemm
et al., 2006; Larsen et al., 2005) have also been widely used for phosphopep-
tide enrichment, typically in a tip or column format. To obtain optimal
enrichment, each approach must be tested and optimized individually
to determine its suitability for a given application. Each of these phosphoen-
richment strategies has slightly different phosphopeptide selectivity based
on their variable chemistry, which leads to identification of some nonover-
lapping phosphopeptides (Bodenmiller et al., 2007). Therefore, utilization
of multiple phosphoenrichment strategies will yield complementary data
(Paradela and Albar, 2008). Phosphoprotein enrichment, particularly for
phosphotyrosine proteins, performed by immunoprecipitation with
phosphotyrosine antibodies, in conjunction with phosphopeptide enrich-
ment, has also been quite successful (Paradela and Albar, 2008). An impor-
tant consideration and potential shortcoming to IMAC phosphoenrichment
is the ability of IMAC resin to bind to highly acidic peptides (i.e. rich in
Asp and/or Glu), which can ‘‘contaminate’’ a data set. However, methyl
esterification is one option for reducing this phenomenon (Ficarro et al.,
2002). In our work, despite not doing methyl esterification, we were still
able to obtain an average phosphoenrichment of 30% for all data sets
(Table 16.1). Preferential enrichment and strong binding of multiply phos-
phorylated peptides has also been considered a drawback to IMAC enrich-
ment (Paradela and Albar, 2008). However, we mostly recovered peptides
containing a single phosphate, consistent with observations that acidic
elution conditions mostly yield monophosphorylated peptides (Thingholm
et al., 2008), and may also be related to retention of multiply phosphorylated

Table 16.1 Summary of phosphorylations identified in CXCL12-stimulated CLL cells

30 nM CXCL12
Time point Unstimulated 30 100 300 600
Total peptides 550 734 770 754 737
Phosphopeptides 161 249 236 209 158
False positivesa 8 9 11 13 11
False discovery rate (%) 1.5 1.2 1.4 1.7 1.5
Phosphoenrichment (%) 29.3 33.9 30.6 27.7 21.4
Phosphoproteinsb 93 131 133 104 103
a
Estimated by use of a decoy database approach.
b
Number of phosphoproteins identified within a time point data set.
Notes: The total number of phosphorylation events and correlating false discovery rate and percent of
phosphoenrichment are summarized for each time point data set of CXCL12-stimulated CLL cells.
Phosphoproteomic Analysis of Chemokine Signaling 339

peptides or the challenge of proteomics software to provide a confident


identification of multiphosphorylated peptides. Therefore, additional
strategies, such as SIMAC (sequential elution from IMAC) can be employed
to isolate multiple phosphorylated peptides from monophosphorylated
peptides in a complex sample (Thingholm et al., 2008). Additionally, LC-
MS/MS analysis of IMAC flow-through and wash fractions recovered few
phosphopeptide identifications (1 phosphopeptide per 1000 peptides). The
few phosphopeptides identified from the wash fractions were highly abun-
dant in IMAC elution fractions, suggesting efficient enrichment.

2.4. Reversed-phase liquid chromatography and tandem


mass spectrometry
Phosphoenriched CLL peptides were analyzed by reversed-phase, capillary
liquid chromatography and tandem mass spectrometry (LC-MS/MS) on a
Thermo Finnigan LTQ ion trap mass spectrometer. The capillary LC
columns (17 cm) were packed in-house using deactivated fused silica
(100 mm) (Agilent, Santa Clara, CA) with C18 resin (5 mm, 300 Å)
(Michrom Bioresources, Auburn, CA). Capillary columns were prepared
by drawing a 360 mm O.D., 100 mm I.D. deactivated, fused silica tubing
with a Model P-2000 laser puller (Sutter Instruments, Novato, CA) (heat:
330, 325, 320; vel: 45; del: 125) and were packed at 600 psi to a length of
10 cm with C18 reversed-phase resin suspended in methanol. While
purchasing capillary columns has distinct advantages, such as improved
column-to-column reproducibility, they are about 150 times more expen-
sive than the columns prepared in our laboratory. To prepare samples for
running on LC-MS/MS, dried eluate was resuspended in 50 ml of Milli-Q
H2O. The resuspension volume should be adjusted according to the
amount of starting material and column capacity, as well as the sensitivity
of the mass spectrometer used. Approximately 15 ml of the resuspension was
added to a 96-well plate (Axygen, Union City, CA) of which 10 ml was
loaded onto the capillary column for LC-MS/MS analysis. To minimize
sample evaporation, the 96-well plate was covered with a sealing film (Axy-
gen, Union City, CA). Angiotensin II (Sigma-Aldrich, St. Louis, MO) was
used as a control for column performance and run after every two CLL
sample runs. The standard method used for all samples was as follows: 95%
A/5% B (buffer A ¼ 0.1% HAC in HPLC-grade Milli-Q H2O, buffer B ¼
0.1% HAC in HPLC-grade ACN) for 20 min, 60% A/40% B for 30 min, 20%
A/80% B for 6 min, followed by a final washing step of 95% A/5% B for
30 min at 250 ml/min. The flow of solvent was split before it reached the
column resulting in a flow rate of 200 to 500 nl/min through the capillary
column. Samples were run in data-dependent mode, where the spectrometer
performed one full MS scan followed by six MS/MS scans of the top six most
intense ions in the parent spectrum with a m/z ranging from 400 to 2000.
340 Morgan O’Hayre et al.

A dynamic exclusion list was applied with a repeat count of 1, a repeat


duration of 30 s, an exclusion size of 100, exclusion duration of 180 s, and
an exclusion mass width of 1.50. The spray voltage was 1.8 kV. Because the
instrument cannot fragment all the peptides in the parent spectrum, the
sample can be run several times to saturate the proteomic space for a given
method. At this time, the gold standard in proteomics is three runs for each
sample, but one will miss some of the possible phosphopeptides that can be
identified. Five runs on a given method and identical sample will nearly
saturate all the possible candidate peptides and 10 would be better for a higher
degree of confidence.
On average, the scan rate in this experiment ranged from four to eight
scans per second. The higher the scan rate, the more peptides one will be
able to identify for a given LC run, which is an important consideration
when designing an experiment and/or purchasing a mass spectrometer for
proteomics. While we have provided the parameters for a starting method
for the phosphoproteomic analysis, changing the HPLC gradient, changing
the data-dependent analysis of different top intensity ions (e.g. 7th to the
13th most intense ions in the parent spectrum) and dynamic exclusion
parameters influences the type and amount of data collected. Once the data
is collected, prior to InsPecT analysis, RAW data files were converted to
mzXML data files using the program ReAdW (http://tools.proteomecenter.
org/ReAdW.php).

2.4.1. Additional phosphopeptide separation techniques


Additional separation of phosphopeptides, which can be carried out prior to
LC-MS/MS, include strong cation exchange (SCX) chromatography
(Motoyama et al., 2007) and hydrophilic interaction liquid chromatography
(HILIC) (Albuquerque et al., 2008). Both techniques produce an orthogonal
method of separation to reversed-phase LC and have been shown to
significantly increase the number of phosphopeptides identified. However,
given the limited amount of starting material from the primary CLL cells
(these are not a renewable source) and increased risk of sample loss asso-
ciated with additional steps, these techniques were not utilized in the
present study. Nevertheless, SCX and HILIC present an attractive means
for enhanced phosphopeptide separation and detection.

2.4.2. Phosphopeptide identification with InsPecT


Data analysis was carried out with the open-access database search tool,
InsPecT (http://proteomics.ucsd.edu/index.html), which allows for rapid
identification of post-translationally modified peptides such as phosphopep-
tides (Tanner et al., 2005). InsPecT is particularly useful for identification of
post-translational modifications on peptides in a complex mixture. Its
employment of tag-based filters reduces the overall number of peptides
considered from the database early on, significantly reducing the processing
Phosphoproteomic Analysis of Chemokine Signaling 341

time compared to most other search algorithms available (Tanner et al.,


2005). Additionally, modifications to the InsPecT program have been made
recently to specifically improve the recognition of phosphopeptides.
A highly enriched and validated phosphopeptide data set was used to
develop better recognition and scoring parameters for phosphopeptide
spectra (Payne et al., 2008). This is important because during collision-
induced dissociation (CID) MS/MS, phosphoric acid is typically lost. The
resulting spectral patterns of phosphopeptides are characterized by a strong
neutral loss peak and weaker y- and b-ion fragments. Because of the
decreased intensity of the various fragments, it becomes a difficult and
time consuming task for search databases to correctly identify phosphopep-
tides. However, since the training set for improving the phosphopeptide
identification and scoring was collected on an ion trap using CID to
generate MS/MS data, the program is especially good at recognizing these
phosphopeptide signatures. Gentler dissociation methods, like electron
capture dissociation (ECD) and electron transfer dissociation (ETD) are
alternative methods to CID, and generally retain the phosphate group on
a phosphopeptide facilitating a more precise phosphate localization on a
peptide (Paradela and Albar, 2008).
MS/MS spectra were processed using the UniProt human database, the
UniProt shuffled human decoy database as well as common contaminants
databases (e.g. keratin). Peptide sequencing searches were also defined for
variable modification of up to two phosphorylation sites (Ser, Thr, or Tyr)
on a peptide, and tryptic cleavage search restraints. Using the target decoy
database as a measure of the overall quality of MS/MS data, spectra from
each time point were sorted by p-values. Peptides with a false discovery rate
(FDR) of less than 1 to 2% were manually validated for positive identifica-
tion. Although there are some drawbacks associated with the use of decoy
databases (Kall et al., 2008; Kim et al., 2008), they are generally an acceptable
approach for approximating the confidence of reliable spectra assignments
particularly for tryptic digests (Wang et al., 2009).
Positive hits from each stimulation time point were combined into a
comprehensive list and sorted by protein. Collectively, the five time points
resulted in the identification of 1036 unique phosphopeptides and a total of
251 unique proteins (Table 16.1). Taking into consideration the limited
amount of starting material used in this study, the overall number of
phosphorylation events detected in our analysis is comparable to other
phosphoproteomic studies involving complex biological samples (Moser
and White, 2006). Phosphorylated protein targets of interest were further
probed by alternative mechanisms. In some instances, phospho-specific
antibodies were available for the phosphorylated protein of interest and
could be probed by Western blot for validation. However, in most cases, no
phosphoantibodies existed, and comparisons between time points had to be
determined by other means. The CLL peptide samples were rerun three
342 Morgan O’Hayre et al.

times, and exclusion list restraints were varied in order to obtain more data
for spectral counting comparison. Spectral counting is a straightforward,
cost-saving, semi-quantitative approach to determining the differential
levels of relatively abundant proteins in a dataset (Balgley et al., 2008;
Liu et al., 2004a; Zhang et al., 2006; Zybailov et al., 2006). However, less
abundant peptides are not ideal for this method because there is too much
stochastic variation. Alternatively, a 16O/18O trypsin digest can be used.
This semi-quantitative method involves postdigestion labeling of peptides
by exchanging 16O for 18O in a trypsin-catalyzed reaction (Liu et al.,
2004b). The exchange of 16O for 18O is a specific process in which the
C-termini of tryptic peptides are generally labeled with two 18O atoms,
resulting in a 4-Da shift between coeluting labeled and unlabeled peptides.
Other chemical modification methods available for quantitative proteomics
include isotope-coded affinity tags (ICAT), isobaric tags for quantification
(iTRAQ), and phosphoramidate chemistry (PAC), and have been reviewed
elsewhere (Ong and Mann, 2005; Schreiber et al., 2008). Lastly, the devel-
opment of stable isotope labeling with amino acids in cell culture (SILAC)
has provided an effective and reproducible means of quantification between
sample sets (e.g. unstimulated vs. stimulated) for proteomics studies (Olsen
et al., 2006). This technique involves the metabolic incorporation of isoto-
pically labeled amino acids, generally 13C or 15N labeled Lys and/or Arg,
and then comparison of the peak intensities of mixed unlabeled and labeled
samples. However, several disadvantages of SILAC include the expense of
growing cells in labeled media and the requirement for proliferating cells in
culture preventing its use in primary tissue samples such as the CLL cells.

2.4.3. Considerations for selecting an appropriate search


database program
An additional consideration in choosing the appropriate search database is
cost. Currently, there are several available open source search databases,
such as InsPecT, X!Tandem, and OMSSA (Geer et al., 2004; Matthiesen
and Jensen, 2008). InsPecT is particularly effective for the identification of
phosphopeptides and runs in a fraction of the time compared to other search
databases. However, use of a Windows browser interface is a distinct
advantage to programs like X!Tandem, if the user is unfamiliar with com-
mand lines as in InsPecT, although a current version with a user-friendly
Web interface is being developed at the UCSD center for computational
mass spectrometry. InsPecT tutorials to aid in installation and data proces-
sing are available online. There are also commercially available search
database programs including SEQUEST, Mascot, and Spectrum Mill.
Comparisons using a number of search database programs have been
previously carried out (Bakalarski et al., 2007; Payne et al., 2008).
In many instances, a combination of strategies that include various data
analysis platforms is likely to yield the most comprehensive approach
Phosphoproteomic Analysis of Chemokine Signaling 343

to phosphoproteomics. In particular, the use of several database search


engines for peptide identification is an excellent way to gather the most
information from a data set, because often different database search engines
will identify nonoverlapping peptides due to the inherent differences in
detection and scoring strategies (Payne et al., 2008). For example, Payne
et al. demonstrated that the use of three different search algorithms—X!
Tandem, SEQUEST, and InsPecT (filtered to a 1% false discovery rate)—
collectively identified 1371 phosphopeptide spectra, of which 92, 116, and
203 spectra were nonoverlapping, respectively. The drawback to running a
MS/MS data set against several databases is the run time. For example, in
their studies, SEQUEST required 72 times longer to process the same data
compared to InsPecT, a distinct advantage to using the InsPecT software
package.

2.4.4. Additional proteomics data analysis tools


Following phosphopeptide identification, proteins can be classified through
online bioinformatics tools such as Database for Annotation, Visualization,
and Integrated Discovery (DAVID) (http://david.abcc.ncifcrf.gov/) and
Cytoscape (http://cytoscape.org/). In addition, the phosphorylation site
databases (e.g. Phosida, www.phosida.com, and Phosphobase, http://
phospho.elm.eu.org/) have been developed as a repository for phospho-
peptide identifications and corollary information. Together, these tools
allow data to be more easily evaluated, categorized, and visualized in
different formats, thus enabling a global and/or in-depth view of particular
proteins identified in various biological pathways. For example, classifica-
tion of our phosphopeptide results using DAVID revealed many candidates
involved in cell death, survival, growth, proliferation, and cell cycle
(Table 16.2).

3. Summary
Phosphorylation is a critical post-translational modification regulating
protein activation as well as protein–protein interactions for a variety of
biological responses. With the advances in MS-based phosphoproteomics,
as well as the development of improved enrichment strategies for targeted or
novel identification of phosphorylated peptides, phosphoproteomics has
become an increasingly used application for dissecting signaling networks
in a variety of biological tissues. In this chapter, we have described a general
protocol for IMAC phosphopeptide enrichment followed by LC-MS/MS
analysis for the study of CXCL12 stimulated primary CLL cells. This
method is an excellent starting point for probing a particular phospho-
proteome and generating hypothesis driven targets for further analysis.
344 Morgan O’Hayre et al.

Table 16.2 Functional annotation of phosphoproteomics data

Functional annotation (GO with DAVID) Protein count % of Proteins


G-protein modulator 25 10.4
Cell death 23 9.6
Regulation of gene expression 46 19.3
Leukocyte activation 8 3.4
Cell cycle 23 9.7
Cell growth 8 3.4
Cell proliferation 18 7.6
Lymphocyte proliferation 4 1.7
Cell motility 11 4.6
Immune system development 11 4.6
Cell development 28 11.8
B-cell activation 4 1.7
Leukocyte differentiation 8 3.3
Notes: A subset of interesting categories from DAVID gene ontology functional annotation of
phosphoproteins identified in the CLL cells is displayed. The number and percent of phosphoproteins
implicated in regulation of particular cellular processes are indicated.

Thus far, we have identified many novel downstream targets that are
currently under investigation. However, depending on the circumstances
(i.e. model system and resources available), some modifications and/or
optimization to this method may be required and should be empirically
determined. For the most comprehensive analysis of a phosphoproteome,
either to identify novel or targeted phosphorylation events, a combination
of various techniques, MS detection, and search algorithms is recommended
(Schmelzle and White, 2006).

ACKNOWLEDGMENTS
We gratefully acknowledge the contributions of Dr. Thomas Kipps and Dr. Davorka
Messmer for access to the primary CLL cells used in these studies; Dr. Huilin Zhou and
Marie Reichart for guidance with the IMAC technique; Dr. Larry Gross and Dario Meluzzi
for training on the preparation of capillary LC columns; Dario Meluzzi, David Gonzalez, and
Wei-Ting Liu for assistance with LC-MS/MS and InsPecT analysis; Angel Lee for help with
DAVID functional annotation; and Dr. Steve Bark for many useful discussions and critical
reading of this work. This work was funded by a California Breast Cancer Research Program
Dissertation Award (14GB-0147) to M.O.; a Ruth L. Kirschstein NIGMS MARC
Predoctoral Fellowship (F31) to C.L.S.; awards from the National Institutes of Health
(RO1-AI37113), Department of Defense (BC060331), and Lymphoma Research Foundation
to T.M.H.; and The V-Foundation of Cancer Research scholar award to P.C.D.
Phosphoproteomic Analysis of Chemokine Signaling 345

REFERENCES
Albuquerque, C. P., Smolka, M. B., Payne, S. H., Bafna, V., Eng, J., and Zhou, H. (2008).
A multidimensional chromatography technology for in-depth phosphoproteome
analysis. Mol. Cell. Proteomics 7, 1389–1396.
Allen, S. J., Crown, S. E., and Handel, T. M. (2007). Chemokine: Receptor structure,
interactions, and antagonism. Annu. Rev. Immunol. 25, 787–820.
Bakalarski, C. E., Haas, W., Dephoure, N. E., and Gygi, S. P. (2007). The effects of mass
accuracy, data acquisition speed, and search algorithm choice on peptide identification
rates in phosphoproteomics. Anal. Bioanal. Chem. 389, 1409–1419.
Balgley, B. M., Wang, W., Song, T., Fang, X., Yang, L., and Lee, C. S. (2008). Evaluation
of confidence and reproducibility in quantitative proteomics performed by a capillary
isoelectric focusing-based proteomic platform coupled with a spectral counting approach.
Electrophoresis 29, 3047–3054.
Bodenmiller, B., Mueller, L. N., Mueller, M., Domon, B., and Aebersold, R. (2007).
Reproducible isolation of distinct, overlapping segments of the phosphoproteome.
Nat. Methods 4, 231–237.
Burger, J. A., and Kipps, T. J. (2006). CXCR4: A key receptor in the crosstalk between
tumor cells and their microenvironment. Blood 107, 1761–1767.
Burger, J. A., Tsukada, N., Burger, M., Zvaifler, N. J., Dell’Aquila, M., and Kipps, T. J.
(2000). Blood-derived nurse-like cells protect chronic lymphocytic leukemia B cells
from spontaneous apoptosis through stromal cell-derived factor-1. Blood 96, 2655–2663.
de Graauw, M., Hensbergen, P., and van de Water, B. (2006). Phospho-proteomic analysis
of cellular signaling. Electrophoresis 27, 2676–2686.
Feng, S., Ye, M., Zhou, H., Jiang, X., Zou, H., and Gong, B. (2007). Immobilized
zirconium ion affinity chromatography for specific enrichment of phosphopeptides in
phosphoproteome analysis. Mol. Cell. Proteomics 6, 1656–1665.
Ficarro, S. B., McCleland, M. L., Stukenberg, P. T., Burke, D. J., Ross, M. M., Shabanowitz, J.,
Hunt, D. F., and White, F. M. (2002). Phosphoproteome analysis by mass spectrometry
and its application to Saccharomyces cerevisiae. Nat. Biotechnol. 20, 301–305.
Geer, L. Y., Markey, S. P., Kowalak, J. A., Wagner, L., Xu, M., Maynard, D. M., Yang, X.,
Shi, W., and Bryant, S. H. (2004). Open mass spectrometry search algorithm. J. Proteome
Res. 3, 958–964.
Hubbard, M. J., and Cohen, P. (1993). On target with a new mechanism for the regulation
of protein phosphorylation. Trends Biochem. Sci. 18, 172–177.
Kall, L., Storey, J. D., MacCoss, M. J., and Noble, W. S. (2008). Assigning significance to
peptides identified by tandem mass spectrometry using decoy databases. J. Proteome Res.
7, 29–34.
Kalume, D. E., Molina, H., and Pandey, A. (2003). Tackling the phosphoproteome: Tools
and strategies. Curr. Opin. Chem. Biol. 7, 64–69.
Kim, S., Gupta, N., and Pevzner, P. A. (2008). Spectral probabilities and generating functions
of tandem mass spectra: A strike against decoy databases. J. Proteome Res. 7, 3354–3363.
Klemm, C., Otto, S., Wolf, C., Haseloff, R. F., Beyermann, M., and Krause, E. (2006).
Evaluation of the titanium dioxide approach for MS analysis of phosphopeptides. J. Mass.
Spectrom. 41, 1623–1632.
Larsen, M. R., Thingholm, T. E., Jensen, O. N., Roepstorff, P., and Jorgensen, T. J. (2005).
Highly selective enrichment of phosphorylated peptides from peptide mixtures using
titanium dioxide microcolumns. Mol. Cell. Proteomics 4, 873–886.
Liu, H., Sadygov, R. G., and Yates, J. R. 3rd (2004). A model for random sampling and estimation
of relative protein abundance in shotgun proteomics. Anal. Chem. 76, 4193–4201.
Liu, T., Qian, W. J., Strittmatter, E. F., Camp, D. G. 2nd, Anderson, G. A., Thrall, B. D.,
and Smith, R. D. (2004). High-throughput comparative proteome analysis using a
quantitative cysteinyl-peptide enrichment technology. Anal. Chem. 76, 5345–5353.
346 Morgan O’Hayre et al.

Mann, M., Ong, S. E., Gronborg, M., Steen, H., Jensen, O. N., and Pandey, A. (2002).
Analysis of protein phosphorylation using mass spectrometry: Deciphering the phospho-
proteome. Trends Biotechnol. 20, 261–268.
Manning, G., Plowman, G. D., Hunter, T., and Sudarsanam, S. (2002). Evolution of protein
kinase signaling from yeast to man. Trends Biochem. Sci. 27, 514–520.
Matthiesen, R., and Jensen, O. N. (2008). Analysis of mass spectrometry data in proteomics.
Methods Mol. Biol. 453, 105–122.
Mohle, R., Failenschmid, C., Bautz, F., and Kanz, L. (1999). Overexpression of the
chemokine receptor CXCR4 in B. cell chronic lymphocytic leukemia is associated
with increased functional response to stromal cell-derived factor-1 (SDF-1). Leukemia
13, 1954–1959.
Moser, K., and White, F. M. (2006). Phosphoproteomic analysis of rat liver by high capacity
IMAC and LC-MS/MS. J. Proteome Res. 5, 98–104.
Motoyama, A., Xu, T., Ruse, C. I., Wohlschlegel, J. A., and Yates, J. R. 3rd (2007).
Anion and cation mixed-bed ion exchange for enhanced multidimensional separations of
peptides and phosphopeptides. Anal. Chem. 79, 3623–3634.
O’Hayre, M., Salanga, C. L., Handel, T. M., and Allen, S. J. (2008). Chemokines and
cancer: Migration, intracellular signalling and intercellular communication in the micro-
environment. Biochem. J. 409, 635–649.
Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M.
(2006). Global, in vivo, and site-specific phosphorylation dynamics in signaling networks.
Cell 127, 635–648.
Ong, S. E., and Mann, M. (2005). Mass spectrometry-based proteomics turns quantitative.
Nat. Chem. Biol. 1, 252–262.
Paradela, A., and Albar, J. P. (2008). Advances in the analysis of protein phosphorylation.
J. Proteome Res. 7, 1809–1818.
Payne, S. H., Yau, M., Smolka, M. B., Tanner, S., Zhou, H., and Bafna, V. (2008).
Phosphorylation-specific MS/MS scoring for rapid and accurate phosphoproteome
analysis. J. Proteome Res. 7, 3373–3381.
Salanga, C. L., O’Hayre, M., and Handel, T. (2008). Modulation of chemokine receptor
activity through dimerization and crosstalk. Cell. Mol. Life Sci. [Epub ahead of print].
Schmelzle, K., and White, F. M. (2006). Phosphoproteomic approaches to elucidate cellular
signaling networks. Curr. Opin. Biotechnol. 17, 406–414.
Schreiber, T. B., Mausbacher, N., Breitkopf, S. B., Grundner-Culemann, K., and Daub, H.
(2008). Quantitative phosphoproteomics--an emerging key technology in signal-
transduction research. Proteomics 8, 4416–4432.
Tanner, S., Shu, H., Frank, A., Wang, L. C., Zandi, E., Mumby, M., Pevzner, P. A., and
Bafna, V. (2005). InsPecT: Identification of posttranslationally modified peptides from
tandem mass spectra. Anal. Chem. 77, 4626–4639.
Thelen, M. (2001). Dancing to the tune of chemokines. Nat. Immunol. 2, 129–134.
Thingholm, T. E., Jensen, O. N., Robinson, P. J., and Larsen, M. R. (2008). SIMAC (sequential
elution from IMAC), a phosphoproteomics strategy for the rapid separation of monopho-
sphorylated from multiply phosphorylated peptides. Mol. Cell. Proteomics 7, 661–671.
Wang, G., Wu, W. W., Zhang, Z., Masilamani, S., and Shen, R. F. (2009). Decoy methods
for assessing false positives and false discovery rates in shotgun proteomics. Anal. Chem.
81, 146–159.
Zhang, B., VerBerkmoes, N. C., Langston, M. A., Uberbacher, E., Hettich, R. L., and
Samatova, N. F. (2006). Detecting differential and correlated protein expression in label-
free shotgun proteomics. J. Proteome Res. 5, 2909–2918.
Zybailov, B., Mosley, A. L., Sardiu, M. E., Coleman, M. K., Florens, L., and
Washburn, M. P. (2006). Statistical analysis of membrane proteome expression changes
in Saccharomyces cerevisiae. J. Proteome Res. 5, 2339–2347.
C H A P T E R S E V E N T E E N

Monitoring NF-kB Mediated


Chemokine Transcription
in Tumorigenesis
Jinming Yang and Ann J. Richmond

Contents
1. Introduction 348
2. Development of NF-kB Reporter Model for Tumors 348
3. Bioluminescent Imaging of Intratumor Signaling
of Anesthetized Mice 349
3.1. Firefly luciferase reporter 349
3.2. Gaussian luciferase reporter 349
4. Cell-Based Assays for Kinase and Transcriptional Activity In Vitro 352
5. Peripheral Spying of Intratumoral Signaling of Conscious Mice 353
Acknowledgments 354
References 354

Abstract
Chemokine-receptor signaling plays an important role in the inflammatory
response often associated with tumor growth and metastasis. The NF-kB path-
way, essential for transcription of chemokines/chemokine receptors and other
key inflammatory modulators, has emerged as a potential target for tumor
therapy. Here we describe an efficient approach to monitor drugs that target
the NF-kB signaling as related to tumor growth and metastasis in vivo.
For bioluminescence imaging, the firefly luciferase (Fluc) reporter has the
advantage of stable signaling, while Gaussia luciferase (Gluc) provides very
sensitive signaling based on secretion of Gluc. We introduce the use of moni-
toring intratumoral Gluc, which rapidly diffuses into the blood circulation and
urine. The peripheral Gluc assay may complement bioluminescence imaging
and provide a kinetic, noninvasive, real-time read-out of NF-kB activity by
directly determining Gluc reporter activity in blood or urine samples from
tumor-bearing mice.

Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt University School
of Medicine, Nashville, Tennessee, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05217-3 All rights reserved.

347
348 Jinming Yang and Ann J. Richmond

1. Introduction
Nuclear factor-kB (NF-kB), a key signal transduction pathway in
chemokine–chemokine receptor expression, inflammation, and cancer, is
important target for drug discovery and development. It has been increas-
ingly important to develop noninvasive, high-resolution, in vivo imaging
to elucidate mechanisms that identify and validate drugs that target the
NF-kB pathway. Recent advances in technology allow visualization of
signal transduction as related to biological processes in vivo (Phair and
Misteli, 2001). Use of fluorescent proteins revolutionizes static microscopy
images by providing the ability to make dynamic recordings of protein–
protein interaction in living animals. More recently, a Gaussia luciferase
that possesses a natural secretory signal, allowing secretion into the cell
microenvironment, offers great promise for real-time ex vivo monitoring
of NF-kB signaling in tumor development and progression in conscious
animals.

2. Development of NF-kB Reporter Model


for Tumors
To monitor NF-kB signaling in tumorigenesis, we constructed a
luciferase reporter vector that expresses a transcription factor–mediated
reporter protein. To generate the NF-kB–mediated transcription, firefly-
luciferase reporter vector, we inserted a commercial vector with
a transcription blocker that is composed of adjacent polyadenylation and
transcription pause sites for reducing background transcription. An NF-kB
consensus sequence was fused to a TATA-like promoter, followed by a
firefly- or Gaussia-luciferase reporter gene for monitoring NF-kB signaling
(Yang et al., 2007). These vectors are designated as NF-kB-Fluc or NF-kB-
Gluc, respectively. This system enables signal amplification of a transcription
factor–mediated signal.
To create NF-kB–promoter reporter cells, human melanoma cells
(Hs294T) were transfected with the linearized NF-kB-Gluc vector and
stably transfected cells were selected with 2 mg/ml G418. Gaussia luciferase
in the cultured medium or cell lysate was characterized based on the
catalytic reaction with its substrate, coelenterazine. We subcutaneously
inoculated nude mice with these melanoma NF-kB-Gluc reporter cells
and allowed tumor xenografts to grow over 14 days. The following
approaches are used to monitor NF-kB signaling changes in real time
during tumor progression and in response to molecular targeting therapy.
Detection of Intratumoral Signaling In Vivo 349

3. Bioluminescent Imaging of Intratumor


Signaling of Anesthetized Mice
3.1. Firefly luciferase reporter
Bioluminescence images can be taken using the IVIS 200 Imaging System
(Xenogen Imaging Technologies). The system is composed of an imaging
chamber, gas anesthesia system, and a highly sensitive charge-coupled
device (CCD) camera. The CCD camera is cryogenically cooled for highly
efficiency photon detection and displays a wide-range signal image. It takes
approximately 3 min to anesthetize small mammals such as mice using the
gas anesthesia system that is connected to an oxygen cylinder and isoflurane
tank with flow rates set at scale. Fresh luciferin solution is prepared by
dissolving luciferin powder (15 mg/ml) in phosphate-buffered saline (PBS)
(137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.47 mM KH2PO4, and
adjusted to a final pH of 7.4). Mice are injected intraperitoneally with 150 mg
of luciferin per gram body weight and transferred into the image chamber.
The image field is set according to the number of mice to be imaged. To
acquire the live images, the focus is adjusted to 1.5 cm for a subcutaneous (SC)
tumor (Fig. 17.1), or to 1 cm for deep organ tumors such as a tumor metastatic
to the liver (Fig. 17.2). The exposure time is usually 1 min for SC tumors and
3 min for tumors metastatic to the liver. The peak time of image intensity is
around 10 min postinjection of substrate (luciferin), although this time is
variable depending on the anatomy of the tumor location. The image file is
saved as TIF format and the image intensity is quantitated using the Living
Image software 3.0 from Xenogen Imaging Technologies (Fig. 17.1).

3.2. Gaussian luciferase reporter


To produce a bioluminescence image reporter for Gaussia luciferase activ-
ity, native coelenterazine (50 to 100 mg/mouse) injected intravenously gives
an accurate read-out of NF-kB activity (unpublished). Coelenterazine is
easily dissolved into either ethanol or methanol. To make up a stock of
native coelenterazine, 4 mg coelenterazine is dissolved in 1 ml methanol.
This stock solution can be stored at –70  C for 2 weeks. However, for the
most accurate reproducible comparative data, freshly mixed coelenterazine
is recommended. The coelenterazine stock should be diluted 1:20 (v/v)
with a buffer (150 mmol/l NaCl, 2 mmol/l KCl, 1 mmol/l MgCl2,
10 mmol/l Na2HPO4, 2 mmol/l KH2PO4, pH 7.4) prior to intravenous
injection. The injected mouse will be immediately subjected to biolumi-
nescence imaging for the reason that the Gaussia luciferase signal rapidly
350 Jinming Yang and Ann J. Richmond

A
NF-kB-Fluc + + + + +
H-RasV12 − + + + +
IkBaAA − − + − +

Photograph

10

8
Luminescent image
6

ROI 5 = 4.1905e + 07
OI 1 = 1.5298e + 06
ROI 2 = 2.2484e + 0
ROI 3 = 6.9261e + 07 ROI 4 = 9.3479e + 07
10

8
Quantitation
6

B NF-kB-Gluc + + + + +

Figure 17.1 Intratumoral NF-kB reporter models. (A) NF-kB-Fluc reporter model.
Mouse melanocytes null for INK4A/ARF were genetically engineered with the NF-
kB-Fluc reporter (lanes 1 to 5), CMV promoter^driven oncogenic H-RASV12 expression
(lanes 2 to 5), and/or a Tet-On inducible IkBa(S32A/S36A) superrepressor expression
vector (lanes 3 and 5).These cells were inoculated into nude mice to develop xenografts.
Tumors were photographed (upper panels) and intratumoral NF-kB activities were
determined by quantitative luminescent imaging (lower panels), illustrating that
H-RASV12 induced NF-kB activation in vivo was inhibited with the IkBa superrepressor.
(B) NF-kB-Gluc reporter model. NF-kB-Gluc was stably expressed in human mela-
noma Hs294Tcells (1  106) and these cells were subcutaneously inoculated into nude
mice. The individual bioluminescent image was taken immediately following intrave-
nously injection of 100 mg native coelenterazine per mouse.
Detection of Intratumoral Signaling In Vivo 351

B
10×
H

RBC
M

C
10×

Figure 17.2 Melanoma metastasis to the liver. (A) NF-kB-Fluc reporter model of
metastasis. 2  105 of mouse melanocytes (NF-kB-Flucþ, H-RASV12þ, INK4A/ARF^/^)
were intravenously injected into each nude mouse. Sixty days after injection, the biolu-
minescent images were obtained (upper panel), mice were euthanized and (B) histolog-
ical analysis (H&E staining) of organs were performed, indicating melanoma metastasis
to the liver. (C) 2 105 of GFP-tagged melanocytes (H-RASV12þ, INK4A/ARF^/^) were
intravenously injected into nude mice. Thirty days after cell injection, frozen sections
were examined under the fluorescent microscope (10 magnification). H, hepatocytes;
M, melanoma cells; RBC, red blood cells.

fades relative to firefly luciferase. Thus, Gaussia luciferase imaging allows


analysis of only one mouse at a time, while firefly luciferase imaging can be
performed on a maximum 5 mice for one time point (Fig. 17.1).
352 Jinming Yang and Ann J. Richmond

4. Cell-Based Assays for Kinase and


Transcriptional Activity In Vitro
In a nonstimulated cell, IkBa is tightly complexed with NF-kB to
hold NF-kB in the cytoplasm and keep it in a biologically inactive form.
In this manner, IkBa serves as the brake for the NF-kB signal transduction
cascade. When ligand binding activates receptors at the cell surface, the
signal cascade is triggered through activation of IkB kinase (IKK). The
activated IKK phosphorylates IkBa protein, which enables ubiquitination
followed by degradation of IkBa and the eventual nuclear translocation of
NF-kB (RelA/p50). The classical method for determining IKK activity has
relied on an in vitro kinase assay where the IKK complex is immunopreci-
pitated from cell lysate and the activated IKK catalyzes the transfer of
radiolabeled phosphate to a purified IkBa protein. In contrast, the newly
developed IkB-Gluc reporter plasmid or NF-kB-Gluc reporter plasmid
reflects cellular IkBa levels or transcriptional NF-kB activity in intact cells
without interruption. When cells are transfected to stably express the
reporter plasmid, Gaussia luciferase is naturally secreted into the culture
medium. Addition of the IKK inhibitor, BMS-345541 inhibits NF-kB-Gluc
and increase IkB-Gluc activity. Gaussia luciferase as a reporter accurately
reflects NF-kB activity based on luminescence imaging (Fig. 17.3), or by
measuring 10-s photon counts using a luminometer following a reaction of
10 ml of medium with the substrate (100 micromoles/l coelenterazine) in
buffer containing 500 mmol/l NaCl, 2 mmol/l KCl, 10 mmol/l MgCl2, 10
mmol/l Na2HPO4, 2 mmol/l KH2PO4, 1 mmol/l EDTA and adjusted to a
pH of 7.8.

BMS-345541 (mM)
0 2.5 5 10
1200

IkBa-Gluc 1000

800

600

400
NF-kB-Gluc
200

Figure 17.3 Luminescent imaging of cultured dish. Hs294T IkB-Gluc reporter cells or
Hs294T NF-kB-Gluc reporter cells were treated with the IKK inhibitor, BMS-345541
(0 to 10 mM) for 36 h.The plate containing the cultured cells and medium was subjected
to bioluminescent imaging immediately following addition of 100 mM of coelentera-
zine.Two independent experiments were performed and similar results were achieved.
Data show an increase in the level of IkBa (upper panels) and reduced NF-kB transcrip-
tional activity (lower panels) upon treatment with BMS-345541.
Detection of Intratumoral Signaling In Vivo 353

5. Peripheral Spying of Intratumoral Signaling


of Conscious Mice
Bioluminescence imaging studies have shown that Gaussia luciferase as
a reporter gives a 200-fold brighter signal than that of firefly luciferase
(Tannous et al., 2005). However, the Gaussia luciferase signal is less
stable during bioluminescent process than the firefly luciferase luminescence
imaging. Thus, Gaussia luciferase is not an ideal reporter for luminescence
imaging. Rather, Gluc is a small monomer enzyme that is rapidly secreted
from cells (Verhaegent and Christopoulos, 2002) and much more sensitive
than the other established secretory marker, alkaline phosphatase
(Wurdinger et al., 2008). We demonstrate that Gaussia luciferase expressed
in melanoma cells is secreted into culture medium in vitro; in vivo Gluc
diffuses into blood circulation and subsequently is excreted into the urine in
melanoma-bearing mice. This has been confirmed by reconstitution of
Gluc diffusion through the vascular system (Fig. 17.4). Thus, Gluc may
serve as an ideal reporter of intratumoral NF-kB activity by following the
release of Gluc into the blood and/or urine of tumor-bearing animals.
During the course of exposure to drug treatment, the NF-kB activity in
cultured tumor cells or in mouse tumor xenografts can be continuously
monitored by measuring the Gaussia luciferase activity in cultured medium
or in blood and/or urine samples. Consequently, Gluc can play an impor-
tant role toward predicting cancer drug efficacy in vitro and in vivo. This
system has been validated by well-established IKK inhibitors and IKK

40,000

30,000 In blood
Gluc (RLU)

In urine
20,000

10,000

0
0 1 2 3 4
Time (h)

Figure 17.4 Reconstitution of Gluc diffusion via vascular system. Conditioned


medium containing the secreted Gluc (2  108 RLU) was intraperitoneally injected into
adult mice. The Gluc activity in the blood or the urine was detected over the course of
4 h. The average value of each time point shown was from six animals. Experiments
were repeated twice with similar results. The peak time for Gluc diffusion from the
intraperitoneal compartment into blood is 1 h and into urine is 1.5 h.
354 Jinming Yang and Ann J. Richmond

stimuli, suggesting that this approach is feasible for screening the effect of
cancer drugs on the NF-kB pathway.
To prepare blood samples, 5 ml blood were withdrawn using pipette tip
from a small incision at the tail tip of conscious mice. The 5 ml of blood was
mixed into 10 ml buffer (500 mmol/l NaCl, 2 mmol/l KCl, 10 mmol/l
MgCl2, 10 mmol/l Na2HPO4, 2 mmol/l KH2PO4, 1 mmol/l EDTA,
pH 7.8) and stored at 4  C for measuring Gluc activity within 3 weeks.
Sampling of urine is easily done since the mouse readily offers approxi-
mately 100 ml of urine triggered by the fear response to being ‘‘caught’’ by
the gentle hand of the investigator. Of notice, the daily average mouse
voiding frequency is 16 times and the urine volume per void is approxi-
mately 160 ml; thus, urine samples were also collected from a clean glass jar
where mouse was temporally kept. The urine Gluc activity was determined
between 0 and 24 h without loss of Gluc activity. Gluc activity was
measured using the Monolight TM 3010 luminometer (BD Biosciences
Pharmingen, San Diego, CA). Ten microliters of sample were quickly
mixed well with 20 ml of 100 mM coelenterazine in the buffer above and
10-s photon counts were acquired.
In conclusion, bioluminescence imaging of intratumoral NF-kB signal-
ing in living animals can provide useful information about the molecular
basis of tumorigenesis and molecular response to therapeutic agents. Firefly
luciferase is superior to Gaussia luciferase as a reporter for quantitative
molecular imaging. Advantages of Gaussia luciferase are that it is naturally
secreted and extremely sensitive, suggesting it is extremely useful as a
peripheral marker for real-time monitoring of intratumoral molecular sig-
naling in conscious mice.

ACKNOWLEDGMENTS
We thank colleagues at the Richmond laboratory for insightful discussions and Richard
Baheza of Vanderbilt University Institute of Imaging Science for excellent technical assis-
tance. Work from the authors’ program was supported through funding by the Department
of Veterans Affairs through a VA Merit Award (AR) and a VA Senior Research Career
Scientist Award (AR), National Institutes of Health grants (CA 098807) (A.R.), the
Vanderbilt Ingram Cancer Center support grant (CA 68485), and the Skin Disease Research
Center grant (SP30 AR 41943).

REFERENCES
Phair, R. D., and Misteli, T. (2001). Kinetic modelling approaches to in vivo imaging. Nat.
Rev. Mol. Cell. Biol. 2, 898–907.
Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R., and Breakefield, X. O. (2005).
Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture
and in vivo. Mol. Ther. 11, 435–443.
Detection of Intratumoral Signaling In Vivo 355

Verhaegent, M., and Christopoulos, T. K. (2002). Recombinant Gaussia luciferase. Over-


expression, purification, and analytical application of a bioluminescent reporter for DNA
hybridization. Anal. Chem. 74, 4378–4385.
Wurdinger, T., Badr, C., Pike, L., de Kleine, R., Weissleder, R., Breakefield, X. O., and
Tannous, B.A ., (2008). A secreted luciferase for ex vivo monitoring of in vivo processes.
Nat. Methods 5, 171–173.
Yang, J., Pan, W. H., Clawson, G. A., and Richmond, A. (2007). Systemic targeting
inhibitor of kappaB kinase inhibits melanoma tumor growth. Cancer Res. 67, 3127–3134.
C H A P T E R E I G H T E E N

Analysis of Chemokine Receptor


Endocytosis and Intracellular
Trafficking
Tom Kershaw,* Silène T. Wavre-Shapton,‡ Nathalie Signoret,†
and Mark Marsh*

Contents
1. Introduction 358
2. Receptor Detection 360
3. Cells 362
3.1. Preparation of cells 363
4. Monitoring Receptor Endocytosis 364
4.1. Immunofluorescence microscopy 364
4.2. Flow cytometry 366
5. Monitoring Receptor Recycling 366
5.1. Immunofluorescence microscopy 367
5.2. Flow cytometry 368
6. Monitoring Receptor Degradation 368
6.1. Western blotting 369
6.2. Immunofluorescence 370
7. Electron Microscopy Analysis of Receptor Internalization 371
7.1. Cell surface replicas of whole-mount preparations 371
7.2. Preparation of membrane sheets 372
7.3. Immuno-gold labeling of ultrathin cryosections 374
Acknowledgments 375
References 375

Abstract
Chemokine receptors are G protein–coupled receptors (GPCRs) that, through
their ability to regulate chemotaxis by responding to small chemoattractant
peptides termed chemokines, are involved in the development, maintenance,

* Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department of Cell
and Developmental Biology, University College London, London, United Kingdom
{
Centre for Immunology and Infection, Department of Biology and Hull York Medical School,
University of York, York, United Kingdom
{
Molecular Medicine NHL1, Imperial College, South Kennington, London, United Kingdom

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05218-5 All rights reserved.

357
358 Tom Kershaw et al.

and functional activities of the immune system. In addition, members of the


chemokine receptor family have been implicated in a number of other physio-
logical and pathological processes, including human immunodeficiency virus
infection and malaria. These activities are dependent on receptor expression at
the cell surface and cellular events that reduce the cell-surface expression of
chemokine receptors can abrogate these activities. Moreover, internalization of
chemokine receptors by endocytosis is necessary for both receptor degradation
and recycling, key regulatory processes that determine cell-surface expression
levels. Here we provide detailed methods for the quantitative analysis of CCR5
endocytosis and recycling by flow cytometry, as well as fluorescence and
electron microscopic procedures to analyze the endocytosis and intracellular
trafficking of CCR5 by immunolabeling of cells or cryosections. In principle, the
same approaches can be used for analyzing other chemokine receptors and
other GPCR or non-GPCR cell-surface proteins.

1. Introduction
Chemokine receptors are members of the extended family of seven
transmembrane domain (7TM) G protein–coupled receptors (GPCRs).
These receptors play essential roles in the development, maintenance and
function of the immune system by triggering the directional migration of
leukocytes in response to chemotactic cytokines, known as chemokines
(Sallusto and Baggiolini, 2008). In addition, chemokine receptor activation
is thought to have wider effects on leukocytes by influencing their state of
activation, maturation and other effector functions (Rossi and Zlotnick,
2001). Specific chemokine receptors and their cognate ligands have also
been implicated in neurodevelopment, angiogenesis, organogenesis, the
metastatic migration of tumor cells, and, significantly, the cellular entry of
several important human pathogens, including the human immunodefi-
ciency viruses (HIV-1 and -2) and the malaria parasite Plasmodium vivax
(Murphy et al., 2000).
In order to mediate their functions as receptors, it is essential that
chemokine receptors be expressed on the surface of cells. As with many
GPCRs, ligand binding frequently leads to activation of the receptor and of
downstream signaling pathways mediated principally (although not exclu-
sively) through coupled heterotrimeric G proteins (Defea, 2008; Schulte
and Levy, 2007). As with all cellular signaling pathways this activity must be
regulated. For many GPCRs this regulation is achieved, at least in part,
through internalization of receptors from the cell surface, followed by either
degradation in lysosomes (downmodulation) or termination of the activated
state and recycling of receptors to the cell surface (resensitization). As the
possibility of pharmacological manipulation of these events has significant
therapeutic potential for a number of diseases and conditions, there has been
Analysis of Chemokine Receptor Trafficking 359

interest in understanding the molecular mechanisms involved in regulating


the cell-surface expression and trafficking of chemokine receptors and other
GPCRs (Hanyaloglu and von Zastrow, 2008).
Our laboratories are interested in the chemokine receptors that function
as the cellular coreceptors for HIV. Studies in many laboratories have led
to the view that HIV entry involves interaction with at least two key cell-
surface proteins. Firstly, the surface unit (SU or gp120) component of the
viral envelope glycoprotein (Env) must engage CD4 molecules expressed
on the surface of susceptible leukocytes (principally CD4þve T lymphocytes
and monocytic cells). This interaction leads to conformational changes in
Env that reveal a previously obscured chemokine-receptor binding site on
gp120. Engagement of the chemokine receptor initiates a major reorgani-
zation in Env that results in exposure of the hydrophobic fusion peptide at
the N-terminus of the transmembrane component (TM or gp41) of Env.
This fusion peptide is believed to insert into the target cell plasma mem-
brane leading to fusion of the viral membrane with the target cell’s plasma
membrane (Lusso, 2006). Although several chemokine receptors have
been shown to cooperate with CD4 to mediate fusion in tissue culture
systems, the key receptors implicated in viral infection and pathogenesis
in vivo are CCR5 and CXCR4 (Simmons et al., 2000). Of these, CCR5,
or CCR5-expressing cells, appear to be essential for the initiation and
establishment of infection.
An initial link between chemokine receptors and HIV infection was the
finding that some apparently HIV resistant individuals and so-called long-
term nonprogressors had constitutively elevated blood plasma levels of the
CC (or b) chemokines that act as agonists for CCR5 (Zanussi et al., 1996).
One effect of elevated chemokine levels is that cell-surface CCR5 expres-
sion may be reduced due to internalization of receptors. Experiments in
tissue culture have shown that chemokines that bind CCR5 and CXCR4
can induce endocytosis of these receptors and that this internalization
inhibits HIV infection (Mack et al., 1998; Signoret et al., 1997). Subse-
quently, other methods to reduce cell-surface chemokine receptor expres-
sion, such as RNA interference (RNAi), have also been found to inhibit
HIV infection (Martinez et al., 2002). Thus, there has been interest in trying
to understand the cellular mechanisms regulating chemokine receptor
cell-surface expression. Whereas considerable technical hurdles currently
limit the potential to inhibit coreceptor synthesis in vivo, the fact that soluble
agonists can modulate cell-surface CCR5 and CXCR4 levels does offer
some potential (Mack et al., 1998; Signoret et al., 1997; Verani and Lusso,
2002). In addition to its relevance to HIV biology, a clear description of
chemokine-receptor intracellular trafficking is needed to understand how
these receptors contribute to and control leukocyte migration. Moreover,
studying the trafficking pathways of chemokine receptors should enhance
our understanding of the cellular regulation of GPCRs in general.
360 Tom Kershaw et al.

Studies from our laboratories and others have shown that CCR5 and
CXCR4 undergo b-arrestin–mediated endocytosis through clathrin-coated
pits and are subsequently delivered to early endosomes (Fraile-Ramos et al.,
2003; Signoret et al., 1997, 2000, 2005). In the case of CCR5, which binds
the CC chemokines, CCL3 (MIP-1a), CCL4 (MIP-1b), and CCL5
(RANTES), all of which act as agonists, much of the internalized receptor
pool is subsequently delivered to recycling endosomes, from where it can
return to the cell surface in a resensitized form (Signoret et al., 2000). By
contrast, although recycling of CXCR4 can occur, this receptor can also be
ubiquitinated by a HECT domain-containing E3-ligase, AIP4, and sorted
by an ESCRT-dependent mechanism to lysosomes, where it is degraded
(Marchese et al., 2003; Tarasova et al., 1998).
We have previously published details of procedures using radioiodinated
antibodies to measure cell-surface chemokine receptor levels and receptor
endocytosis, and immunofluorescence to determine the cellular distribution
of internalized receptors (Signoret and Marsh, 2000). Here we provide
detailed methods for the quantitative analysis of CCR5 endocytosis and
recycling, and electron microscopic procedures to analyze the endocytosis
and intracellular distribution of CCR5 by immunolabeling cryosections.
In principle, these approaches can be used for analyzing other chemokine
receptors as well as other GPCR or non-GPCR cell-surface proteins.

2. Receptor Detection
To a large extent, the methods of choice for detecting receptors are
dictated by specific experimental questions. In some cases, fluorescently
labeled chemokines can be used, but the small sizes of soluble chemokine
molecules (8 to 10 kDa) limits the potential to incorporate fluorescent
dyes while maintaining biological activity. Many CC chemokines also
exhibit promiscuous receptor binding or show some propensity to bind
proteoglycans, making them unreliable probes for monitoring specific che-
mokine receptors. Moreover, assays in which these probes are used only
examine events following agonist activation and do not allow the properties
of receptors to be examined in the absence of agonist.
In transfected cell lines, epitope tags (e.g., FLAG or HA) can be used to
identify receptors using well-characterized, tag-specific, commercially
available antibodies. Small molecular tags (and in some cases much larger
peptide domains [Klasse et al., 1999]) added to the N-terminal domain
of chemokine receptors, appear to have little impact on the biology of
the molecules and are likely to be accessible on the cell surface so that the
properties of receptors on living cells can be analyzed. We do not advocate
the use of cytoplasmic C-terminal tags, including GFP and other fluorescent
Analysis of Chemokine Receptor Trafficking 361

proteins, as these can interfere with the trafficking activities of receptors,


particularly receptors with C-terminal sequences, such as PDZ domain
ligands, which may be required for normal trafficking (Delhaye et al.,
2007; McLean and Milligan, 2000).
Our preferred method for following chemokine receptor trafficking is to
use receptor-specific monoclonal antibodies. These can be characterized on
transfected cells expressing recombinant receptor molecules, and then
applied to appropriate primary cells or other cell lines if and when available.
Since the first demonstration that CCR5 and CXCR4 function as HIV
receptors, intense effort has been devoted to developing receptor-specific
antibodies. For the most part, these reagents are directed against cell
surface–exposed epitopes, as they have been identified through their ability
to label their targets in flow cytometric assays, immunofluorescence, or by
inhibition of HIV or simian immunodeficiency virus (SIV) infection
(Blanpain et al., 2002; Endres et al., 1996; Hill et al., 1998; Lee et al.,
1999; McKnight et al., 1997). A number of these antibodies are commer-
cially available or can be obtained through AIDS reagents programs (e.g.,
NIBSC Centralised Facility for AIDS Reagents, http://www.nibsc.ac.uk/
spotlight/aidsreagent/index.html; NIH AIDS Research and Reference
Reagent Program, https://www.aidsreagent.org/Index.cfm). Care should
be taken to select appropriate antibodies. For example, antibodies specific
for epitopes that lie close to, or overlap with, chemokine-binding sites, may
not recognize agonist-occupied receptors. Alternatively, antibodies directed
against conformational epitopes may be useful for flow cytometry or
immunofluorescence studies but inappropriate for immunoprecipitation
or Western blotting. Some antibodies may mimic agonists and induce
partial or full activation and internalization (Blanpain et al., 2002). For
CCR5, we have found the monoclonal antibody MC-5 to be particularly
useful (Segerer et al., 1999; Signoret et al., 2000). MC-5 is a murine IgG2a
that binds the N-terminal domain of human CCR5 with high affinity, but
does not induce any apparent conformational changes in the receptor, nor
does it obscure the binding sites for CCR5 chemokine agonists. Thus,
MC-5 added to cultures of CCR5-expressing cells at 37  C, binds cell-
surface receptor molecules without inducing internalization or reducing
receptor responsiveness to agonist. If conjugated to a fluorochrome, this
antibody can be used for live cell studies of agonist-induced CCR5 traffick-
ing. Moreover, because MC-5 recognizes a linear, N-terminal epitope, it
will immunoprecipitate CCR5 from detergent lysates, identify CCR5 on
Western blots, and can be used for morphological studies at both the light
(immunofluorescence) and electron microscopy (EM) (e.g., immunolabel-
ing of cryosections) levels. Although extremely useful, the high avidity of
MC-5 for cell-surface CCR5 (Kd  1.3 nM ) makes this reagent difficult to
remove from cells by low or high pH treatments; however, Fab fragments
retain sufficiently high affinity to be a useful reagent. Significantly, we have
362 Tom Kershaw et al.

been unable to remove surface-bound MC-5 from CCR5 on intact cells by


proteolysis, nor have we been able to biotinylate cell-surface CCR5
molecules, although these methods can work for other GPCRs.
Antibodies can be labeled with a range of dyes (e.g., Alexa Fluor dyes)
using kits from suppliers such as Invitrogen (http://probes.invitrogen.com/
handbook/sections/0103.html). We routinely use Alexa Fluor 488
(MC-5488). (In our experience, a dye-to-antibody ratio of 3:1 has minimal
effect on antibody avidity for CCR5. Higher dye ratios decrease avidity and
specificity.) Alternatively, antibodies can be conjugated with radioactive
iodine using reagents such as 125I-Bolton and Hunter reagent (GE Healthcare
http://www5.gelifesciences.com) as described (Signoret and Marsh, 2000).

3. Cells
Since the initial functional expression of human CCR5 in Chinese
hamster ovary (CHO) cells, these and other cell lines have been popular
systems for studying CCR5 trafficking. Stable CCR5-expressing cell lines
have several practical advantages over cells that express the receptor consti-
tutively. Apart from being easy to culture, transfected CHO cells maintain
high levels of chemokine receptor expression, whereas in primary cells and
leukocyte cell lines endogenous receptor levels are often low and trafficking
is difficult to study. In addition, transfected cell lines are usually excellent for
morphological experiments. Importantly, CCR5 trafficking appears, at least
in part, to be faithfully recapitulated in transfected cells: By using assays
developed to follow CCR5 in CHO cells, the internalization and recycling
of CCR5 naturally expressed by lymphocytes and monocytes was found to
proceed with similar kinetics (Mack et al., 1998). A final advantage of using
transfected cell lines is that removing CCR5 from its physiological back-
ground reduces the complicating effects of interactions with other chemo-
tactic receptors, such as C5a receptor, where activation of one receptor may
influence the trafficking of the other through cross-activation and/or
hetero-oligomerization (Huttenrauch et al., 2005). Although these interac-
tions will ultimately have to be considered in a fully integrated model for
CCR5 trafficking, simple systems are necessary to understand the funda-
mental properties of the molecule. One disadvantage of the CHO cell
system is that the hamster genome is not yet sequenced, making it difficult
to perform RNAi knock-down experiments that are now routine in cell
lines from species with sequenced genomes.
The CHO cell lines used in our studies (Mack et al., 1998) express an
average of 100,000–200,000 copies of CCR5 per cell, with the majority
present on the plasma membrane in unstimulated cells. However, by
immunofluorescence microscopy, a small intracellular CCR5 pool can be
Analysis of Chemokine Receptor Trafficking 363

observed in the perinuclear region in some cells and probably represents


newly synthesized molecules passing through the secretory pathway. This
intracellular pool can be cleared by treatment with the protein synthesis
inhibitor cycloheximide (CHX) (100 mg ml–1) for 30 to 60 min.

3.1. Preparation of cells


The assays described below use immunofluorescence microscopy (IFM),
flow cytometry, and EM as morphological and quantitative methods to
assess receptor distribution and agonist-induced redistribution. These pro-
cedures require cells in different formats for use as either adherent or
suspension cells. The methods described were developed for CHO cells
but, with adaptation, can be applied to other cell lines and primary cells.

3.1.1. Immunofluorescence
Cells are maintained on 9-cm diameter tissue culture dishes and subcultured
twice per week. (Cells are not cultured for more than 30 passages.) For
experiments, the cells are detached from a confluent 9-cm dish using
trypsin/EDTA (ready-made solution from Invitrogen, http://www.
invitrogen.com/), seeded at a 1:20 dilution onto 13-mm diameter cleaned
and sterilized glass coverslips in a fresh 9-cm dish, and grown for 2 days to
reach approximately 50% confluence. Prior to experiments, the coverslips
are transferred to 16-mm diameter wells in 4-well or 24-well, Nunc plastic
tissue-culture plates (http://www.invitrogen.com), and washed twice in
binding medium (BM) (RPMI-1640 without bicarbonate, containing
0.2% bovine serum albumin [BSA] and 10 mM HEPES, pH 7) at room
temperature (RT 20  C). Cells can be seeded at a similar density in glass-
bottomed dishes (WillCo-Dish, http://www.biosciencetools.com/catalog/
WillCo.htm) for live cell analysis.
Note: BM is not bicarbonate buffered, and incubations can be carried
out without a CO2 buffered environment. If cells are to be incubated for
long periods in a CO2 incubator, appropriate media should be used to
maintain pH.

3.1.2. Flow cytometry


Cells are plated onto 9-cm tissue culture dishes at an appropriate dilution
(usually 1:20 from a confluent 9-cm dish) for the plates to be 80 to 90%
confluent in 48 h. For convenience and better reproducibility, the cells are
detached and handled in suspension for experiments. Prior to experiments,
the cells are washed with PBS prewarmed to 37  C, detached using PBS
containing 10 mM EDTA at 37  C (PBS/EDTA) (trypsin is omitted from
the detachment step to avoid proteolysis of CCR5 extracellular domains),
spun down for 3 min at 150  g, resuspended in 2 ml of BM at 37  C, and
transferred to a 37  C water bath.
364 Tom Kershaw et al.

3.1.3. Electron microscopy


Cells are set up on plastic dishes or 13-mm diameter glass coverslips
essentially as described above and grown to the densities indicated in the
EM protocols (see below).

4. Monitoring Receptor Endocytosis


For the most part, chemokine-receptor endocytosis is measured by
labeling cell-surface receptors, before and after treatment of cells with appro-
priate chemokines, using fluorescently or radioactively labeled antireceptor
antibodies (Mack et al., 1998; Signoret et al., 2000, 2004). Although useful,
these methods do not allow measurement of the constitutive trafficking
properties of receptors in the absence of agonist and may be compromised
by receptor recycling and/or delivery of newly synthesized receptors to the
cell surface. Assays in which endocytosis can be measured directly are depen-
dent on the ability to label cell-surface receptors with fluorescently or
radioactively tagged ligands that do not activate the receptor or stimulate
internalization. These ligands are usually bound at 4  C, a temperature at
which endocytosis does not occur, and unbound ligand is washed away.
Uptake can then be initiated in a synchronous fashion by warming the cells to
37  C. Following incubation at 37  C for various times with or without
agonist, the cells are again placed on ice and the intracellular pool of ligand
quantified by removing accessible ligand remaining at the cell surface. This
can be achieved, among other ways, by acid stripping or protease treatment
(e.g., Marsh and Helenius, 1980; Pelchen-Matthews et al., 1989). The read-
outs for these assays can be IFM, flow cytometry, or, when radiolabeled
antibodies or ligands are used, radioactivity counting (Signoret and Marsh,
2000). For the latter two quantitative methods, the relative amount of
endocytosis can be calculated for each time point using the formula

E ¼ ðI  Bg=T  BgÞ
where E is proportion endocytosed; I, the intracellular signal; T, the total
cell associated signal; and Bg, the background activity associated with acid
stripped– or protease-treated samples at time 0.

4.1. Immunofluorescence microscopy


4.1.1. Pre-labeling of cell-surface receptors
Cells on coverslips are incubated with 1 mg ml–1 MC-5 or MC-5488 in BM
at 4  C for 40 to 60 min. Unbound antibody is removed by three washes
with BM at 4  C.
Analysis of Chemokine Receptor Trafficking 365

4.1.2. Endocytosis of cell-surface receptors


Endocytosis is initiated by transferring cells to a 37  C incubator. One set of
samples should be kept on ice as a zero time point. If required, agonist
should be added by replacing the medium with fresh BM containing
the required concentration of agonist (e.g., 125 nM CCL5) at 37  C.
At the end of the required incubation period, the cells are fixed by removing
the medium and replacing with 3% PFA (TAAB Laboratories, http://www.
taab.co.uk) in PBS and placed on ice. All subsequent washes and incuba-
tions are carried out at RT. After 20 min in PFA solution, the fixative is
removed, the cells washed three times with PBS, and free aldehyde groups
quenched with PBS (pH 7.4) containing 50 mM NH4Cl for 20 min.
Subsequently, the cells are processed for IFM as previously described
(Signoret and Marsh, 2000). MC-5 can be identified using a second layer
antimouse antibody conjugated to an appropriate fluorochrome. (When
MC-5488 is used, this second layer may not be necessary.)
Note: When using MC-5488, cell-surface MC-5 may be distinguished
from intracellular MC-5 by staining intact cells with an antimouse antibody
coupled to a different fluorochrome, such as Alexa 594. In this case, the
intracellular antibody will be green, but cell-surface antigen will carry both
green and red fluorochromes.
To detect cell-surface CCR5/MC-5, cells should be left intact and
labeled using PBS containing 0.2% gelatine. To label both cell-surface
and intracellular CCR5/MC-5, cells should be incubated with blocking
buffer (0.2% gelatine, 0.05% saponin in PBS) for 20 min to block nonspe-
cific sites and permeabilize cellular membranes. Cells are then incubated in
blocking buffer containing antibodies for 1 h at RT, followed by three
washes of 5 min each in blocking buffer, before being incubated with
secondary antibodies in blocking buffer for 45 min. Finally, cells are washed
three times in blocking buffer and once in PBS before rinsing in water and
mounting in Mowiol (Calbiochem, http://www.merckbiosciences.co.uk)
on a microscope slide. The cells can then be visualized using epifluorescence
or confocal microscopy.
Association of internalized CCR5/MC-5 complexes with specific
intracellular compartments can be assessed by co-labeling with compart-
ment-specific antibodies and secondary reagents tagged with appropriate
fluorochromes. Alternatively, cells can be transfected prior to the experiment
to express marker proteins tagged with fluorescent proteins. If two or more
antigens are to be co-labeled and the only primary antibodies available are from
the same species (e.g., mouse monoclonal antibodies), isotype-specific anti-
bodies may be used. Alternatively, we have used the Zenon labeling system
(Invitrogen, http://www.invitrogen.com/) to generate fluorescently labeled
antibody complexes.
366 Tom Kershaw et al.

4.2. Flow cytometry


4.2.1. Prelabeling of cell-surface receptors
Cells in suspension are labeled using 1 mg ml–1 MC-5488 in BM at 4  C for
90 min in a 5-ml Falcon assay tube (5-ml, polystyrene round-bottom tube, BD
Biosciences; http://www.bdbiosciences.com) on a reciprocal shaker. Follow-
ing this incubation, the cells are spun down for 5 min at 300  g at 4  C, washed
twice in BM at 4  C to remove unbound antibody, and resuspended in a
volume of BM to achieve a final cell density of 2  106 cells ml–1.

4.2.2. Quantitative analysis of receptor endocytosis


Before initiating endocytosis, a 50 ml aliquot of the MC-5488–labeled cell
suspension (100,000 cells per aliquot) is transferred to a 96-well, U-bottom
plate (Nalgene, http://www.nalgenunc.com/) containing 100 ml of ice-
cold BM in each well, and kept on ice for staining (see the following).
This serves as a zero time point reference. To elicit internalization, a 0.5 ml
aliquot of the cell suspension is added to a Falcon assay tube containing an
equal volume of 250 nM CCL5 in BM (final concentration of 125 nM
CCL5) in a water bath at 37  C. (We recommend running triplicate repeats
and averaging flow cytometry measurements.) After various periods of
incubation, such as 5, 15, 30, and 60 min, a 100 ml aliquot (i.e., 100,000
cells) is taken from the tube and transferred to the 96-well plate on ice, to stop
CCR5 internalization. The cells in the 96-well plate are then washed twice
with BM at 4  C and each sample is divided in two. One half remains
untreated; the other is incubated with 5 nM anti-Alexa Fluor 488 (Invitrogen,
http://www.invitrogen.com/site/us/en/home/brands/Molecular-Probes.
html) in BM for 90 min on a reciprocal shaker at 4  C. This antibody
quenches the fluorescent signal from accessible cell-surface MC-5488
(Fig. 18.1). Following this, all of the samples are washed twice with cold
BM, before being resuspended in FACS buffer (PBS containing 1% FCS and
0.05% NaN3) and transferred into mini FACS tubes (BD Bioscience; http://
www.bd.com/uk/) for measurement of cell-associated fluorescence. Usually
10,000 events are counted for each condition.
The amount of internalized CCR5 is calculated using the formula in
Section 4 above, where the intracellular signal (I) is the fluorescence in the
presence of the quenching antibody and the total signal (T) is the fluores-
cence in the absence of the quenching antibody.

5. Monitoring Receptor Recycling


For chemokine receptors such as CCR5 that are able to recycle after
endocytosis, removal of agonist from the cells leads to the reaccumulation
of receptor molecules at the cell surface. However, reappearance of
Analysis of Chemokine Receptor Trafficking 367

250

200

150

MFI
100

50

0
0.00 0.01 0.10 1.00 10.00 100.00
Anti-alexa-488 (nM)

Figure 18.1 MC-5488 quenching with anti-Alexa Fluor 488. CHO CCR5 cells were
labeled with MC-5488 in BM for 1 h on ice, and subsequently washed with BM to remove
unbound antibody. The cells were then incubated with increasing concentrations of
anti-Alexa Fluor 488 for 90 min on ice, washed and analyzed by flow cytometry. Samples
that were fixed immediately after washing had a maximum mean fluorescence intensity
(MFI) of 200. Maximum quenching (80%) was achieved with 5 nM anti-Alexa Fluor
488 antibody.

cell-surface receptors may also be due to the delivery of newly synthesized


proteins. Thus, for recycling experiments we usually block protein synthesis
with CHX, or follow antibody-labeled receptors. In addition, we have found
that CCR5 can recycle in an agonist-bound form. In this case, recycled
receptors are rapidly reendocytosed (Signoret et al., 2000). To ensure that
all recycling receptors are detected, we include in the medium during the
recycling step a CCR5 antagonist, TAK-779 (400 nM, National Institutes of
Health AIDS Research and Reference Reagent Program, https://www.
aidsreagent.org/Index.cfm), which promotes agonist dissociation (Baba et al.,
1999; Shiraishi et al., 2000; Signoret et al., 2004).

5.1. Immunofluorescence microscopy


Cells on coverslips are either treated with CHX or surface CCR5 is
prelabeled, as described above. A sample is taken and fixed at this point
for a zero time reference. The cells are then treated with 125 nM CCL5,
CCL3, or CCL4 for 60 min to induce maximal downmodulation.
Subsequently, the cells are transferred to ice and washed rapidly four times
with ice-cold BM. A sample is washed twice with ice-cold PBS and fixed at
this stage, as described above, to measure the extent of CCR5 down-
modulation. To follow receptor recycling, prewarmed 37  C BM contain-
ing 400 nM TAK-799 is added and the cells incubated for various times at
37  C. After this incubation, the cells are placed on ice, washed twice with
ice-cold BM, followed by two washes with ice-cold PBS, before being
fixed and stained as described above.
368 Tom Kershaw et al.

5.2. Flow cytometry


From a cell suspension in BM (2  106 cells ml–1), 50 ml aliquots are
removed as a zero time-point references and transferred to a 96-well,
U-bottom plate on ice, prepared with 100 ml of cold BM in each well.
Fifty-microliter aliquots of cell suspension are also removed at this stage to
later determine nonspecific secondary antibody binding (where the directly
coupled MC-5488 antibody is used, nonspecific antibody binding is assessed
on a similar number of CHO-K1 cells). To initiate agonist-induced CCR5
internalization, 0.5 ml aliquots of cell suspension are added to 0.5 ml of BM
containing 250 nM CCL5 in a 5 ml Falcon assay tube to achieve a final
CCL5 concentration of 125 nM. Aliquots (100 ml) of CCL5-treated cell
suspension are removed after certain time periods over the course of 60 min
and transferred to the 96-well plate. After 60 min, when CCR5 down-
modulation is complete, the assay tube containing CCL5-treated cells is
transferred to ice and 4 ml of BM at 4  C added to inhibit further traffick-
ing. Cells are pelleted by centrifugation (5 min at 300g), washed in 5 ml of
BM to remove the CCL5, pelleted again, resuspended in BM at 37  C
containing 400 nM TAK-779, and returned to the 37  C water bath.
To monitor recycling, 100 ml aliquots of the TAK-779–treated cell
suspension are transferred to the 96-well plate at various times up to
120 min. After the final aliquot has been removed, cells in the 96-well
plate are pelleted by centrifugation and washed with BM at 4  C before
staining for flow cytometry. Cells are then incubated with 1 mg ml–1
purified MC-5 or MC-5488 for 1 h at 4  C on a reciprocal shaker (control
cells used to determine nonspecific secondary antibody binding on CHO
CCR5 cells are incubated with 1 mg ml–1 nonspecific mouse IgG2a anti-
body instead of MC-5). Cells incubated with MC-5 (and the corresponding
control cells) are washed with 4  C BM and further incubated with a goat
antimouse Alexa Fluor secondary antibody in FACS buffer for 1 h at 4  C
on a reciprocal shaker. All cells are then washed three times with cold FACS
buffer and fixed overnight in FACS buffer containing 1% PFA at 4  C.
Subsequently, fixed cells are washed once with FACS buffer at 4  C before
transfer to mini-FACS tubes for analysis (Fig. 18.2).

6. Monitoring Receptor Degradation


Receptor degradation is best monitored using biochemical techniques.
Labeling with radioactive amino acids combined with pulse-chase and
immunoprecipitation can be used. However, as the majority of CCR5
molecules are located on the cell surface, we have used Western blotting as
the primary method for analysis. In these experiments, cells can be treated with
Analysis of Chemokine Receptor Trafficking 369

Rantes TAK-779
(down-modulation) (recycling)

100
Cell surface fluorescence
80

60

40

20

0
0 20 40 60 80 100 120
Time (min)

Figure 18.2 Quantitative analysis of CCR5 recycling by flow cytometry. CHO CCR5
cells were treated with CCL5 in BM for 60 min before being washed and further incu-
bated in BM containing TAK-779 for 60 min. Aliquots of cells were removed at various
time-points and assayed for cell-surface CCR5-associated fluorescence by flow cyto-
metry, using MC-5488 to detect CCR5. Cell-surface CCR5 fluorescence is expressed as
a percentage of the initial cell-surface CCR5 fluorescence and plotted against time.
A representative experiment is shown, with individual data points representing the
mean of triplicate samples; error bars represent the standard deviation of the means.

CHX to minimize any contribution of newly synthesized molecules. Alterna-


tively, the association of receptor molecules with degradative compartments
such as late endosomes and lysosomes can be imaged by immunofluorescence.
In this case, treatment of cells with inhibitors of lysosomal proteases may aid
detection.

6.1. Western blotting


Cells from a confluent 9-cm dish are detached with trypsin/EDTA, seeded
into wells of a 6-well plate at a 1:30 dilution and grown for 24 h. Cells are
treated with 100 mg ml–1 CHX with or without 125 nM CCL5 in BM at
37  C for various time periods, after which the plates are placed on ice,
washed twice with 4  C PBS, and lysed in 200 ml of RIPA buffer (150 mM
NaCl, 50 mM Tris [pH 8.0], 5 mM EDTA [pH 8.0], 1% v/v NP-40, 0.5%
w/v sodium deoxycholate, 0.1% w/v SDS, adjusted to pH 8.0). Protease
inhibitors (Complete Protease Inhibitor Cocktail, Roche Diagnostics,
http://www.roche.com/products) and phosphatase inhibitors (Halt Phos-
phatase Inhibitor Cocktail, Pierce, http://www.piercenet.com/Products)
are added fresh to the lysis buffer. Phenylmethanesulphonylfluoride
(PMSF) (final concentration 1 mM, Sigma-Aldrich, http://www.
370 Tom Kershaw et al.

sigmaaldrich.com/sigma-aldrich/home.html) is added to the lysis buffer to


inhibit serine proteases. Cells are scraped into prechilled 1.5 ml microfuge
tubes and sonicated twice for 10 s to shear DNA and fragment large cellular
debris. Insoluble debris is removed by centrifugation at 15,000g for 10 min
at 4  C. In whole-cell lysates (but not immunoprecipitates), heating
leads to loss of CCR5, presumably due to aggregation via hydrophobic
interactions, thus samples are separated by SDS-PAGE without heating
(Fig. 18.3).
Note: PMSF is made as a concentrated 100 mM stock solution in
anhydrous ethanol and stored at –20  C and should be added to lysis buffers
immediately before use.

6.2. Immunofluorescence
Cells on 13-mm coverslips are grown for 32 h. Protease inhibitors (leupeptin
[100 mM], pepstatin [1 mM], and E64 [10 mM], Sigma-Aldrich) are added to
the medium and the cells cultured for a further 16 h. The coverslips are

Lysates IP: CCR5

Markers RT 95 ⬚C Markers RT 95 ⬚C

C-HC
150
MC-5 (whole)
100 MC-5 (2xHC)
75
Mr (kDa)

50 MC-5 HC

37
CCR5

25 MC-5 LC

20

Figure 18.3 Heating cell lysates to 95  C leads to loss of CCR5. Supernatants of CHO
CCR5 cells lysed in RIPA buffer were either mixed with an equal volume of double
concentration reducing sample buffer (RSB; Lysates) or lysate containing 0.5 mg of
protein was incubated with MC-5 (7.5 mg) and immunocomplexes captured on protein
A^sepharose beads (1.5 h, 4  C) before being eluted by resuspension in RSB (IP:CCR5).
Samples were either heated at 95  C or incubated at RT for 8 min, before equal volumes
were loaded on a 10% SDS polyacrylamide gel. Proteins were transferred to nitrocellu-
lose by immunoblotting and probed for either CCR5 or clathrin heavy chain (C-HC).
After incubation with IRDye 800 GAM, proteins were visualized using an Odyssey
infrared detection system. HC, heavy chain; LC, light chain.
Analysis of Chemokine Receptor Trafficking 371

transferred to 4-well plates and washed twice with BM at RT. Some cells are
fixed at this point, as described above, and stained for total CCR5 and the
lysosomal marker LAMP2 (lgp-B for CHO cells). Others are prelabeled for
cell-surface CCR5 and endocytosis induced by addition of 125 nM CCL5 in
medium containing the protease inhibitors. The coverslips are fixed at the
required times and stained for CCR5 and LAMP2 (see above and Signoret
et al., 2000).

7. Electron Microscopy Analysis of Receptor


Internalization
In addition to analyzing the cellular distribution of receptors by
immunofluorescence, further information on the association of receptors
with specific cellular compartments can be determined by EM approaches.
Pre-embedding labeling, whole-mount and so-called plasma membrane
‘‘rip-off’’ techniques can be used to analyze the distribution and properties
of CCR5 at the cell surface. As in the techniques described above, CCR5
molecules are identified using receptor-specific antibodies (e.g., MC-5) and
probes that can be visualized by EM. For MC-5 we have routinely used
protein A coupled to colloidal gold (PAG) particles of various sizes (usually
5-, 10-, or 15-nm diameter, supplied by The Cell Microscopy Center,
University Medical Center, Utrecht, The Netherlands, http://www.cmc-
utrecht.nl). Antibodies directed against cellular proteins can be used in
combination with PAG conjugates of other sizes to identify specific
receptor-associated cellular proteins. To analyze CCR5 association with
intracellular compartments at the EM level, immunolabeling of cryosections
is the method of choice (Pelchen-Matthews and Marsh, 2007). Again,
specific antibodies and PAG are used to identify receptor molecules
and antibodies directed against cellular proteins can be used in combination
with PAG conjugates of different sizes to identify various cellular compart-
ments or receptor-associated molecules. Here we describe methods for
whole-mount and ‘‘rip-off ’’ preparations.

7.1. Cell surface replicas of whole-mount preparations


To investigate the distribution of receptors on the surface of adherent cells,
we generate whole-mount, cell-surface replicas using methods adapted
from those described by Hopkins and colleagues (Miller et al., 1991;
Signoret et al., 2005). Cells are grown to 50 to 70% confluence on glass
coverslips. Prior to use, the cells are rinsed in BM and incubated at 37  C in
BM with or without 125 nM CCL5 for various times. Subsequently, the
cells are rinsed briefly in 4  C PBS and fixed in 2% PFA/0.1%
372 Tom Kershaw et al.

glutaraldehyde (GA) in 0.1 M phosphate buffer, pH 7.4, at RT. After


washing with PBS, free aldehyde groups are quenched by 2 incubations of
10 min in PBS containing 50 mM glycine/50 mM NH4Cl, after which, the
cells are washed and blocked by three incubations of 5 min in PBS contain-
ing 2% BSA (blocking buffer). CCR5 at the plasma membrane is labeled at
RT with MC-5 (1 mg ml–1) in blocking buffer containing 0.1% acetylated
BSA (BSA-c, Aurion, Wageningen, The Netherlands, http://www.aurion.nl)
for 1 h with gentle reversible shaking. Unbound antibody is washed away
with several changes of blocking buffer and the cells incubated with 15 nM
PAG for 1 h at RT. After washing extensively in blocking buffer
and PBS, the cells are fixed with 4% glutaraldehyde in 0.1 M sodium caco-
dylate buffer, pH 7.4, for 30 min at RT, washed with 0.1 M sodium
cacodylate buffer and postfixed in 1% osmium tetroxide/1.5% potassium
ferricyanide for 1 h on ice. (Appropriate care in handling cacodylate,
osmium, glutaraldehyde and hydrofluoric acid should be taken.) The cells
are then dehydrated by serial incubations of 10 min each in 70%, 90%, and
absolute ethanol, and finally critical point dried. A thin film of platinum/
carbon is evaporated onto the dried specimens by rotary shadowing at an
angle of 45 degrees, and the platinum/carbon replicas reinforced with a
layer of carbon. Coated-cell layers are scored into squares small enough to fit
onto an EM grid. The coverslip is then detached from the cells by gently
placing onto 8% hydrofluoric acid for about 1 min. Using a loop, the cells
are washed twice with double-distilled (dd) H2O and transferred onto 10 M
sodium hydroxide drops for 4 to 6 h, depending on the cell type, to dissolve
cellular material from underneath the replicas. Finally, replicas are washed
twice with ddH2O, placed on 200-mesh copper grids, and viewed by
transmission EM.

7.2. Preparation of membrane sheets


The whole-mount technique allows the distribution of receptors on the cell
surface to be analyzed. However, in many cases it is events occurring on the
cytoplasmic face of the membrane, where signaling complexes or the
endocytic machinery assemble, that are of interest. A number of techniques
have been developed to visualize such events at the EM level. One relatively
simple procedure that we have used to analyze chemokine receptors
involves ripping the plasma membrane off the top of the cell to expose
the cytoplasmic face of the plasma membrane, and to then use immunola-
beling and PAG to investigate the presence and distribution of specific
molecules.
To generate membrane sheets, near-confluent cell monolayers on
13-mm coverslips are rinsed in BM and incubated at 37  C in BM or in
BM containing 125 nM CCL5 for various times. The cells are then washed
in BM at 4  C. If necessary, cell-surface CCR5 can be labeled with MC-5
Analysis of Chemokine Receptor Trafficking 373

in BM for 1 h at 4  C before opening the cells. Unbound antibody is


carefully washed away with BM at 4  C and the cells incubated with
15 nM PAG for 1 h at 4  C. Samples are rinsed in 4  C BM and HEPES
buffer (HB) (25 mM HEPES, 25 mM KCl, and 2.5 mM Mg(OAc)2,
pH 7.0). Cell membranes are prepared using the ‘‘rip-off ’’ technique,
essentially as previously described (Sanan and Anderson, 1991; Signoret
et al., 2005). Prepared grids are positioned film side up on circular pieces
of cellulose membrane filter that have been permeated from underneath
with HB, and placed on a sheet of ice-cold clear glass.
Note: Three-hundred–mesh nickel grids are cleaned with acetone and air
dried. The grids are then coated with a formvar film (1.1% [w/v] formvar in
chloroform). The formvar film is subsequently coated with a very thin layer
of carbon. Finally, the coated grids are incubated on a drop of 1 mg/ml
poly-l-lysine solution for 30 min, carefully washed with ddH2O, drained,
and air dried.
The coverslips are drained slightly onto tissue paper and inverted care-
fully over the grids. A 20-mm–diameter rubber bung is pressed onto the
coverslip with light finger pressure for 10 s while aspirating away buffer that
is extruded from between the coverslip and the cellulose membrane. The
coverslip is then quickly lifted off the cellulose membrane leaving portions
of the upper membrane of the cells attached to the poly-l-lysine–coated
grids. Drops of HB and fixative (4% glutaraldeyde in HB) are placed in a
small plastic tray on ice. The membranes are washed and fixed by inverting
the grids and placing sequentially onto two drops of HB at 4  C, before
leaving them for 10 min on a drop of fixative at 4  C, followed by a further
10 min at RT. The membranes are washed at RT with HB and rinsed twice
in 0.1 M sodium cacodylate. They are subsequently post-fixed with 1%
osmium tetroxide in 0.1 M sodium cacodylate for 10 min at RT in a fume
hood. After two washes for 5 min in 0.1 M sodium cacodylate, the mem-
branes are rinsed with ddH2O and incubated for 10 min in 1% tannic acid.
The membranes are then washed twice for 5 min each in ddH2O, and
stained with 1% uranyl acetate (filtered through a 0.2 mm filter just before
use) for 10 min. Finally, the membranes are rinsed twice in ddH2O, air
dried, and viewed by transmission EM.
To immunolabel the inner face of the plasma membrane, the membrane
sheets are fixed with 2% PFA/1% GA (instead of 4% GA) in 0.1 M sodium
phosphate solution, pH 7.4, for 10 min on ice followed by 10 min at RT.
The membranes are rinsed in HB and PBS, and quenched by incubation in
50 mM glycine/50 mM NH4Cl in PBS three times for 5 min. After several
washes in PBS, the membranes are treated with blocking buffer twice for
5 min and incubated with primary antibody in blocking buffer containing
0.1% Aurion BSA-c for 30 to 60 min at RT. Unbound antibody is carefully
washed away with blocking buffer and the membranes incubated with PAG
in blocking buffer for 30 min at RT. After washing extensively in blocking
374 Tom Kershaw et al.

Figure 18.4 Rip-off membrane sheet from a CHO CCR5 cell. Membrane sheets
prepared from CHO CCR5 cells treated with 125 nM CCL5 for 5 min at 37  C,
were labeled for CCR5 with MC-5 followed by 15 nM PAG. L, flat clathrin lattice.
Scale bar ¼ 200 nm.

buffer and PBS, immunolabeled membranes are fixed in 2% GA in PBS for


10 min at RT, and postfixed and stained as described above (Fig. 18.4).

7.3. Immuno-gold labeling of ultrathin cryosections


To investigate receptor distributions at intracellular sites, we use immuno-
labeling of cryosections (Slot and Geuze, 2007). Following treatment with
agonists as required, confluent monolayers of cells are fixed by adding an
equal volume of double-strength fixative at 37  C (8% PFA in 0.1 M
sodium phosphate solution, pH 7.4) directly into the culture medium for
10 min. This initial fixative is then replaced with single-strength fixative
(4% PFA) for 90 min at RT. The cells are washed with PBS and free
aldehyde groups quenched with 20 mM glycine in PBS for 10 min, before
scraping into 1% gelatine in PBS. The cells are spun down and the superna-
tant exchanged for 12% gelatine in PBS. After 10 min of incubation at
37  C, the cells are pelleted and transferred to ice for the gelatine to harden.
The pellet is then cut into small blocks, infiltrated overnight in 2.3 M
sucrose, mounted on a pin (Leica Microsystems, UK, http://www.leica-
microsystems.com) and frozen in liquid nitrogen. Ultrathin cryosections are
prepared essentially as described using the Tokuyasu technique (Slot and
Geuze, 2007), picked up with 1% methyl cellulose/2.3 M sucrose in 50 mM
sodium phosphate solution, pH 7.4, and transferred onto prepared grids.
For labeling, grids are first placed on 2% gelatine (melted at 37  C) in
0.1 M sodium phosphate, pH 7.4, to remove the methyl cellulose/sucrose
mixture from the pick-up solution. Sections are incubated four times for
1 min on drops of 0.1% glycine in PBS to quench free aldehyde groups, and
Analysis of Chemokine Receptor Trafficking 375

nonspecific sites are blocked with 1% BSA in PBS for 3 min. The sections
are labeled with primary antibody diluted in 1% BSA/PBS for 60 min,
rinsed four times for 2 min with PBS, and incubated for 20 min with
PAG in 1% BSA in PBS. Antibodies that do not react with protein A,
such as mouse IgG1, require a rabbit antimouse–bridging antibody (e.g.,
Dako, http://www.dako.com/). Unbound PAG is removed by washing
with PBS. Labeling is stabilized by fixing with 1% GA in PBS for 5 min.
After 10 1-min washes in ddH2O, sections are stained with 2% uranyl
acetate at pH 7 for 5 min. The sections are rinsed in ddH2O at 4  C and
incubated for 5 min in 1% methyl cellulose/2% uranyl acetate (pH 4) on ice.
Finally, grids are picked up with loops to form a thin support film of
methylcellulose and uranyl acetate and dried at RT. For double labeling,
sections are incubated with an appropriate primary antibody and PAG, fixed
in 1% GA in PBS for 10 min (to inactivate any unoccupied PAG-binding
sites on the primary antibody), quenched, and labeled with the second
primary antibody and a different sized PAG. This procedure works well
for antibodies that bind PAG directly. In situations where a bridging
antibody is required, protocols involving blocking steps may need to be
devised (see Pelchen-Matthews and Marsh 2007 for other protocols and
approaches).

ACKNOWLEDGMENTS
The UK Medical Research Council supported this work through the MRC Cell Biology
Unit. N.S. is supported by the Biotechnology and Biological Sciences Research Council.

REFERENCES
Baba, M., Nishimura, O., Kanzaki, N., Okamoto, M., Sawada, H., Iizawa, Y., Shiraishi, M.,
Aramaki, Y., Okonogi, K., Ogawa, Y., Meguro, K., and Fujino, M. (1999). A small-
molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1
activity. Proc. Natl. Acad. Sci. USA 96, 5698–5703.
Blanpain, C., Vanderwinden, J. M., Cihak, J., Wittamer, V., Le Poul, E., Issafras, H.,
Stangassinger, M., Vassart, G., Marullo, S., Schlndorff, D., Parmentier, M., and
Mack, M. (2002). Multiple active states and oligomerization of CCR5 revealed by
functional properties of monoclonal antibodies. Mol. Biol. Cell 13, 723–737.
Defea, K. (2008). Beta-arrestins and heterotrimeric G-proteins: Collaborators and compe-
titors in signal transduction. Br. J. Pharmacol. 153(Suppl 1), S298–S309.
Delhaye, M., Gravot, A., Ayinde, D., Niedergang, F., Alizon, M., and Brelot, A. (2007).
Identification of a postendocytic sorting sequence in CCR5. Mol. Pharmacol. 72,
1497–1507.
Endres, M. J., Clapham, P. R., Marsh, M., Ahuja, M., Davis-Turner, J., McKnight, A.,
Thomas, J., Stoebenau-Haggarty, B., Choe, S., Vance, P. J., Wells, T. N. C.,
Power, C. A., et al. (1996). CD4-independent infection by HIV-2 is mediated by
fusin. Cell 87, 745–756.
376 Tom Kershaw et al.

Fraile-Ramos, A., Kohout, T., Waldhoer, M., and Marsh, M. (2003). Endocytosis of the
viral chemokine receptor US28 does not require beta-arrestins but is dependent on the
clathrin-mediated pathway. Traffic 4, 243–253.
Hanyaloglu, A. C., and von Zastrow, M. (2008). Regulation of GPCRs by endocytic
membrane trafficking and its potential implications. Annu. Rev. Pharmacol. Toxicol. 48,
537–568.
Hill, C. M., Kwon, D., Jones, M., Davis, C. B., Marmon, S., Daugherty, B. L.,
DeMartino, J. A., Springer, M. S., Unutmaz, D., and Littman, D. R. (1998). The
amino terminus of human CCR5 is required for its function as a receptor for diverse
human and simian immunodeficiency virus envelope glycoproteins. Virology 248,
357–371.
Huttenrauch, F., Pollok-Kopp, B., and Oppermann, M. (2005). G protein-coupled receptor
kinases promote phosphorylation and beta-arrestin-mediated internalization of CCR5
homo- and hetero-oligomers. J. Biol. Chem. 280, 37503–37515.
Klasse, P. J., Rosenkilde, M. M., Signoret, N., Pelchen-Matthews, A., Schwartz, T. W., and
Marsh, M. (1999). CD4-chemokine-receptor hybrids in human immunodeficiency virus
type 1 (HIV-1) infection. J. Virol. 73, 7453–7466.
Lee, B., Sharron, M., Blanpain, C., Doranz, B. J., Vakili, J., Setoh, P., Berg, E., Liu, G.,
Guy, H. R., Durell, S. R., Parmentier, M., Chang, C. N., et al. (1999). Epitope mapping
of CCR5 reveals multiple conformational states and distinct but overlapping structures
involved in chemokine and coreceptor function. J. Biol. Chem. 274, 9617–9626.
Lusso, P. (2006). HIV and the chemokine system: 10 years later. EMBO J. 25, 447–456.
Mack, M., Luckow, B., Nelson, P. J., Cihak, J., Simmons, G., Clapham, P. R., Signoret, N.,
Marsh, M., Stangassinger, M., Borlat, F., Wells, T. N. C., Schlondorff, D., and
Proudfoot, A. E. (1998). Aminooxypentane-RANTES induces CCR5 internalization
but inhibits recycling: A novel inhibitory mechanism of HIV infectivity. J. Exp. Med.
187, 1215–1224.
Marchese, A., Raiborg, C., Santini, F., Keen, J. H., Stenmark, H., and Benovic, J. L. (2003).
The E3 ubiquitin ligase AIP4 mediates ubiquitination and sorting of the G protein-
coupled receptor CXCR4. Dev. Cell 5, 709–722.
Marsh, M., and Helenius, A. (1980). Adsorptive endocytosis of Semliki Forest virus. J. Mol.
Biol. 142, 439–454.
Martinez, M. A., Gutierrez, A., Armand-Ugon, M., Blanco, J., Parera, M., Gomez, J.,
Clotet, B., and Este, J. A. (2002). Suppression of chemokine receptor expression by
RNA interference allows for inhibition of HIV-1 replication. AIDS 16, 2385–2390.
McKnight, A., Wilkinson, D., Simmons, G., Talbot, S., Picard, L., Ahuja, M., Marsh, M.,
Hoxie, J. A., and Clapham, P. R. (1997). Inhibition of human immunodeficiency virus
fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus
strain dependent. J. Virol. 71, 1692–1696.
McLean, A. J., and Milligan, G. (2000). Ligand regulation of green fluorescent protein-
tagged forms of the human beta(1)- and beta(2)-adrenoceptors; comparisons with the
unmodified receptors. Br. J. Pharmacol. 130, 1825–1832.
Miller, K., Shipman, M., Trowbridge, I. S., and Hopkins, C. R. (1991). Transferrin
receptors promote the formation of clathrin lattices. Cell 65, 621–632.
Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsushima, K.,
Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000). International union of
pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52,
145–176.
Pelchen-Matthews, A., Armes, J. E., and Marsh, M. (1989). Internalization and recycling of
CD4 transfected into HeLa and NIH-3T3 cells. EMBO J. 8, 3641–3649.
Pelchen-Matthews, A., and Marsh, M. (2007). EM analysis of viral morphogenesis. Methods
Cell Biol. 79, 515–542.
Analysis of Chemokine Receptor Trafficking 377

Sallusto, F., and Baggiolini, M. (2008). Chemokines and leukocyte traffic. Nat. Immunol. 9,
949–952.
Sanan, D. A., and Anderson, R. G. (1991). Simultaneous visualization of LDL receptor
distribution and clathrin lattices on membranes torn from the upper surface of cultured
cells. J. Histochem. Cytochem. 39, 1017–1024.
Schulte, G., and Levy, F. O. (2007). Novel aspects of G-protein-coupled receptor signal-
ling—Different ways to achieve specificity. Acta Physiol. (Oxford) 190, 33–38.
Segerer, S., Mack, M., Regele, H., Kerjaschki, D., and Schlondorff, D. (1999). Expression of
the C-C chemokine receptor 5 in human kidney diseases. Kidney Int. 56, 52–64.
Shiraishi, M., Aramaki, Y., Seto, M., Imoto, H., Nishikawa, Y., Kanzaki, N., Okamoto, M.,
Sawada, H., Nishimura, O., Baba, M., and Fujino, M. (2000). Discovery of novel,
potent, and selective small-molecule CCR5 antagonists as anti-HIV-1 agents: Synthesis
and biological evaluation of anilide derivatives with a quaternary ammonium moiety.
J. Med. Chem. 43, 2049–2063.
Signoret, N., Christophe, T., Oppermann, M., and Marsh, M. (2004). pH-independent
endocytic cycling of the chemokine receptor CCR5. Traffic 5, 529–543.
Signoret, N., Hewlett, L., Wavre, S., Pelchen-Matthews, A., Oppermann, M., and
Marsh, M. (2005). Agonist-induced endocytosis of CC chemokine receptor 5 is clathrin
dependent. Mol. Biol. Cell 16, 902–917.
Signoret, N., and Marsh, M. (2000). Analysis of chemokine receptor endocytosis and
recycling. Methods Mol. Biol. 138, 197–207.
Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F.,
Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., Luther, M. A.,
Wells, T. N. C., Hoxie, J. A., and Marsh, M. (1997). Phorbol esters and SDF-1 induce
rapid endocytosis and down modulation of the chemokine receptor CXCR4. J. Cell Biol.
139, 651–664.
Signoret, N., Pelchen-Matthews, A., Mack, M., Proudfoot, A. E. I., and Marsh, M. (2000).
Endocytosis and recycling of the HIV co-receptor CCR5. J. Cell Biol. 151, 1281–1294.
Simmons, G., Reeves, J. D., Hibbitts, S., Stine, J. T., Gray, P. W., Proudfoot, A. E., and
Clapham, P. R. (2000). Co-receptor use by HIV and inhibition of HIV infection by
chemokine receptor ligands. Immunol. Rev. 177, 112–126.
Slot, J. W., and Geuze, H. J. (2007). Cryosectioning and immunolabeling. Nat. Protocols 2,
2480–2491.
Tarasova, N. I., Stauber, R. H., and Michejda, C. J. (1998). Spontaneous and ligand-
induced trafficking of CXC-chemokine receptor 4. J. Biol. Chem. 273, 15883–15886.
Verani, A., and Lusso, P. (2002). Chemokines as natural HIV antagonists. Curr. Mol. Med. 2,
691–702.
Zanussi, S., D’Andrea, M., Simonelli, C., Tirelli, U., and De Paoli, P. (1996). Serum levels
of RANTES and MIP-1 alpha in HIV-positive long-term survivors and progressor
patients. AIDS 10, 1431–1432.
C H A P T E R N I N E T E E N

Measuring the Proximity of


T-Lymphocyte CXCR4 and TCR by
Fluorescence Resonance Energy
Transfer (FRET)
Ashok Kumar,† Kimberly N. Kremer,* Olivia L. Sims,*
and Karen E. Hedin*

Contents
1. Introduction 380
1.1. What is FRET? 381
1.2. Advantages of PE/APC mAb FRET 382
1.3. CFP/YFP fusion protein FRET 384
1.4. Using both FRET approaches to study CXCR4–TCR proximity 385
2. Assaying CXCR4-TCR Proximity via the PE/APC mAb FRET Approach 386
2.1. Important considerations for labeling cell-surface
CXCR4 and TCR 386
2.2. Detailed procedure 387
2.3. Examples and results 388
3. Assaying CXCR4-TCR Proximity via the CFP/YFP Fusion
Protein Approach 392
3.1. Transient transfection of fusion proteins into Jurkat T cells 392
3.2. Assaying CXCR4-YFP and TCR-z-CFP proximity by FRET 394
3.3. Example 396
4. Concluding Remarks 396
References 396

Abstract
Multiprotein complexes play an important role in nearly all cell functions;
therefore, the characterization of protein–protein interactions in living cells
constitutes an important step in the analysis of cellular signaling pathways.
Using fluorescence resonance energy transfer (FRET) as a ‘‘molecular ruler’’ is a

* Department of Immunology, College of Medicine, Mayo Clinic, Rochester, Minnesota, USA


{
Endocrine Research Unit, Mayo Clinic, Rochester, Minnesota, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05219-7 All rights reserved.

379
380 Ashok Kumar et al.

powerful approach for identifying biologically relevant molecular interactions


with high spatiotemporal resolution. Here, we describe two methods that use
FRET to detect a physical interaction between the T-cell antigen receptor
(TCR) and the CXCR4 chemokine receptor in living T lymphocytes. These FRET
approaches use two different sets of chromophores. We discuss the design
strategies, control experiments, and pitfalls involved in using these FRET
approaches. Although there is no perfect pair of chromophores for FRET, the
two FRET methods described here provide complementary and reliable insight
into the molecular interactions between these receptor molecules.

1. Introduction
There is compelling evidence that dynamic physical interactions
among proteins play key roles in cellular signal transduction pathways.
Visualizing the intracellular locations of signaling molecules in live cells is
now possible because of the development of new fluorescent probes and
advances in the design of fluorescence microscopy systems. Assays utilizing
the technology of fluorescence resonance energy transfer (FRET) allow
high spatial resolution of protein–protein interactions in living cells, and can
be used to detect protein–protein interactions such as those that mediate
signal transduction pathways. This is in contrast to immunofluorescence
microscopy, which lacks the resolution to distinguish whether two proteins
are actually close in molecular terms or merely located in the same cell
biological neighborhood. The use of FRET in cell biological experiments
has accordingly exploded over the past few years.
Many articles describe the general theory and applications of FRET
assays (Ciruela, 2008; Jares-Erijman and Jovrin, 2003; Shaner et al., 2007;
Vamosi et al., 2008; Xia and Liu, 2001). Here, we describe in detail two
different FRET assays that we used to investigate the formation of a physical
complex between CXCR4 and the T-cell antigen receptor (TCR) in living
T lymphocytes in response to CXCR4 binding to its chemokine ligand,
SDF-1 (CXCL12) (Fig. 19.1) (Kumar et al., 2006). We will focus particu-
larly on our experimental use of a FRET assay that employs the less
commonly utilized phycobiliprotein fluorophores, phycoerythrin (PE),
and allophycocyanin (APC). We will also describe our detailed protocol
for using CFP/YFP FRET to examine CXCR4–TCR interactions.
Finally, will address the advantages in FRET assays of using the PE/APC
fluorophore pair relative to the CFP/YFP FRET fluorophore pair, and the
complementary benefits that can be realized by using both systems to
investigate CXCR4-TCR proximity in T cells.
Measuring CXCR4–TCR Proximity by FRET 381

A B CFP/YFP
PE/APC mAb FRET fusion protein FRET
488 nm
675 nm
PE
SDF-1a
SDF-1a APC

CXCR4
CXCR4 TCR
YFP CFP
TCR
528 nm 433 nm

Figure 19.1 Two experimental approaches for using FRET to assay CXCR4-TCR
complex formation in response to SDF-1 treatment of T lymphocytes: PE/APC mAb
FRET and CFP/YFP fusion protein FRET. (A) Cartoon depicting FRET between
endogenous CXCR4 and TCR receptors, as assayed by using mAbs to link PE and APC
fluorophores to the endogenous cell-surface receptors. (B) Cartoon depicting FRET
between fluorescent CFP and YFP fusion proteins of CXCR4 and the TCR. (From
Kumar, A., Humphreys,T. D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E.,
and Hedin, K. E. (2006). CXCR4 physically associates with the Tcell receptor to signal
inTcells. Immunity 25, 213^224, with permission.)

1.1. What is FRET?


In the late 1940s, Theodor Forster described the nonradiative transfer of
energy from a chromophore in an exited state to another chromophore.
A key feature of this energy transfer, termed FRET, is that it occurs only if
the two chromophores are close together (Forster, 1948; Stryer, 1967,
1978). In addition to chromophore proximity, FRET requires that the
emission spectrum of one chromophore (the donor) overlaps the excitation
spectrum of the other chromophore (the acceptor). FRET also requires an
appropriate relative orientation of the two chromophores. FRET occurs
when an excitated donor transfers energy to the acceptor, resulting in the
acceptor’s excitation and subsequent fluorescence. The distance parameter
determining the efficiency of energy transfer depends on the inverse sixth
power of intermolecular separation, therefore, the detection of FRET
indicates that two molecules are within approximately 5 to 10 nm of each
other (Forster, 1965; Lakowicz, 1999). These distances are on the order of
the size of many individual proteins of biological significance, including
enzymes and receptors. FRET has therefore been extensively employed to
monitor the activity of cellular signaling cascades in live cells (He et al.,
2005; Janetopoulos et al., 2001; Tertoolen et al., 2001; Vilardaga and
Nikolaev, 2007). It should be noted that because FRET depends not only
on chromophore proximity but also on the orientation of the chromo-
phores and their relative abundance, the absence of a FRET signal cannot
be taken as evidence for the absence of chromophore proximity.
382 Ashok Kumar et al.

1.2. Advantages of PE/APC mAb FRET


We describe below a phycobiliprotein FRET assay that we used to show
that SDF-1–dependent signaling increases the proximity of endogenous
CXCR4 and TCR of T cells (Kumar et al., 2006). Although discussed at
length in the historical FRET literature (Stryer, 1978), in recent years
PE/APC FRET has been relatively unused for detecting molecular prox-
imity in biologically relevant contexts. Yet the experimental use of phyco-
biliprotein FRET to detect protein–protein interactions has several
advantages as compared to CFP/YFP FRET.
First, the PE/APC FRET method presented below has the advantage of
not requiring specialized reagents or equipment. The method utilizes com-
mercially available PE- and APC-conjugated antibodies as chromophores
and a standard two laser flow cytometer such as that routinely available to
many research laboratories for FRET detection.
Second, the PE/APC fluorophore pair displays spectral properties that
make it nearly ideal for use in FRET assays. A theoretically ideal pair of
fluorophores for FRET studies should display the following characteristics:
(1) the excitation spectra of the donor and acceptor fluorophores should be
well separated, (2) the emission spectrum of the donor fluorophore should
overlap the excitation spectrum of the acceptor fluorophore, and (3) the
emission spectra of the donor and the acceptor fluorophores should be well
separated. Figure 19.2 shows the excitation and emission spectra of PE and
APC and illustrates how well the PE/APC fluorophore pair meets these
three characteristics. First, the excitation spectra of PE and APC show little
overlap. APC is maximally excited by 615- to 655-nm light, but APC is not
excited by 488-nm light, which maximally excites PE. Second, PE fluor-
esces at wavelengths that show good overlap with the excitation range of
APC. Third, APC emission at long wavelengths does not overlap signifi-
cantly with PE emission. For FRET assay, then, one may use a standard
two-laser flow cytometer to detect APC fluorescence greater than 670 nm
via a long-pass filter (indicated by the rectangle in Fig. 19.2). APC fluores-
cence can be detected when APC is either directly excited by the 635-nm
laser (as when using the cytometer’s FL4 channel), or when APC is indi-
rectly excited from PE via FRET when PE is stimulated by the 488-nm
laser (as when using the cytometer’s FL3 channel).
A third advantage of using the PE/APC fluorophore pair for FRET
assays derives from the fact that these molecules have evolved to mediate
FRET in biological systems, specifically within the phycobilisomes of
Cyanobacteria and eukaryotic algae. Both PE and APC are therefore highly
stable molecules and are also highly efficient at FRET. PE, APC, and other
phycobiliproteins employ covalently linked open-chain tetrapyrrole groups
to capture light energy. The phycobiliproteins used in our FRET assay (i.e.,
PE and APC conjugated to monoclonal antibodies [mAbs]) are in the form
Measuring CXCR4–TCR Proximity by FRET 383

1 APC
absorbance
0.9
PE absorbance
0.8

0.7
Relative amplitude

0.6
APC FL3 (670 nm LP)
0.5 emission (emission window for
FRET assay)
PE emission
0.4

0.3
488 nm
0.2 (excitation for
FRET assay)
0.1

0
450 470 490 510 530 550 570 590 610 630 650 670 690 710 730
Wavelength (nm)

Figure 19.2 Absorbance and emission spectra of PE and APC. For the absorbance
spectra, PE and APC (in the context of anti^CXCR4-PE and anti^TCR-z-APC) were
excited by 488 nm and 580 nm light, respectively. Absorption spectra were recorded on
a Cary 4000 UV/VIS spectrophotometer (Varian Inc, Palo Alto, CA). Emission spectra
were recorded on a SPEX Fluorolog-3 spectrofluorimeter using a 5-nm slit width (Hor-
iba Jobin Yvon, Edison, NJ). FRET signals are detected in our FRETassay when PE is
excited at 488 nm (indicated by the arrow) and the emission of APC > 670 nm is
measured using a long-pass filter (the detection window is indicated by the rectangle).

of six ab monomers arranged as a disc. In phycobilisomes, these discs are


stacked to form a highly ordered array. PE, APC, and other phycobilipro-
teins in the phycobilisomes transfer light energy from one to another via
FRET and ultimately to chlorophyll to achieve photosynthesis (Glazer et al.,
1985; Viskari and Colyer, 2001). The FRET occurring during this process
is characterized by high quantum yields (up to 98 %) and large extinction
coefficients and Stoke’s shifts. Although this very high FRET efficiency
relies on the specific, ordered structure of the phycobilisome, experimental
protocols utilizing less-ordered phycobiliproteins, such as the PE and APC
forms conjugated to mAbs, can nevertheless achieve impressive FRET
efficiencies. The relative efficiency of phycobiliprotein FRET aids in
the detection of FRET signals and simplifies using the PE/APC FRET
chromophore pair for experimental purposes.
Despite these significant advantages, some disadvantages are also asso-
ciated with using the PE/APC fluorophore pair for FRET assays. Chief
among these is the large size of these phycobiliprotein chromophores.
384 Ashok Kumar et al.

The hexameric form of PE and APC is approximately 150 kD, which


makes this FRET pair unsuitable for fine distance measurements, such as
within a single molecule. This problem is compounded in our protocol
since we utilize mAbs to link the chromophores to the receptors. As
discussed below, this disadvantage can be ameliorated by using multiple
approaches to confirm molecular interactions.

1.3. CFP/YFP fusion protein FRET


To avoid potential ambiguity due to the use of receptor-binding antibodies
and the bulky nature of the PE and APC fluorophores and their mAb-
mediated attachment to the receptors, we also used a second FRET
approach for assaying CXCR4-TCR interactions in living T cells (Kumar
et al., 2006). In recent years, the use of green fluorescent protein (GFP) and
its color variants cyan (CFP) and yellow (YFP) fluorescent proteins, has
become a prevalent approach for measuring protein–protein interactions by
FRET (Chan et al., 2001; He et al., 2003a,b; Shaner et al., 2005; Tsien,
1998). In this FRET approach, the entire fluorescent sensor is encoded and
expressed in cells as a fusion with the protein(s) of interest. Molecular
genetic manipulation of expression plasmids makes this easy to achieve
simply by transfecting cells with appropriate expression plasmids. In the
CFP/YFP FRET assay, the excitation of CFP is achieved by 433-nm light,
which leads to the emission of cyan fluorescence with a peak at 475 nm.
If YFP is close by, energy from CFP can be transferred to YFP, and
consequently emission from YFP will occur with a peak wavelength at
528 nm.
Unfortunately, the CFP/YFP FRET system displays several nonideal
spectral characteristics. In contrast to the PE/APC FRET pair discussed
above, the CFP/YFP FRET pair suffers from weak overlap of excitation
spectra and poor separation of excitation spectra, as well as poor separation
of emission spectra. It is therefore more difficult to avoid potential excita-
tion and emission spectra overlap in CFP/YFP FRET systems than in
PE/APC FRET systems. Problems arising from overlap of the excitation
spectra can be avoided by using 433-nm light for excitation (as recom-
mended in our protocol below), whereas use of 458-nm light for excitation
is not recommended. Problems arising from emission spectra overlap are
more difficult to avoid. Very sensitive ratio imaging by a charge-coupled
device (CCD) camera can be used ( Jares-Erijman and Jovrin, 2003) to
reliably establish FRET using this system. Alternatively, as we describe
below, CFP/YFP FRET can be established by using a spectrofluorimeter
that allows examination of the entire emission spectra. This permits the
confirmation of FRET by assuring that increases in YFP (acceptor) fluores-
cence occur concomitant with a decrease in CFP (donor) fluorescence.
Measuring CXCR4–TCR Proximity by FRET 385

1.4. Using both FRET approaches to study


CXCR4–TCR proximity
We used two different FRET approaches to detect CXCR4–TCR interac-
tions (Kumar et al., 2006). Each FRET approach has advantages and dis-
advantages, but by combining the approaches we were able to obtain
complementary data sufficient to provide strong support for our conclusions.
In addition to the technical advantages discussed above, our PE/APC
FRET approach has the advantage of examining interactions between
native receptors expressed on the cell surface at endogenous levels. Because
it does not require transfection, this approach can be used to examine
CXCR4–TCR interactions of normal T lymphocytes and other cells that
are difficult to transfect. On the other hand, this PE/APC FRET approach
may not be generally applicable for studying all protein–protein interac-
tions, primarily because it relies on using mAbs to link the chromophores to
the proteins. The use of mAbs requires that the proteins to be assayed must
be abundantly expressed on the cell surface and that specific antibodies
directed against a cell-surface–accessible epitopes are available. The mAbs
might affect receptor function upon binding to the proteins, or they might
also bind to epitopes too distant to allow the chromophores to interact.
Although we have solved these problems specifically for our CXCR4-
TCR FRET assay by carefully selecting mAbs for use in the FRET assay,
these issues must be considered when modifying this approach to analyze
interactions between other cell-surface proteins. Another general disadvan-
tage of the PE/APC FRET system is that both the mAbs and the PE
and APC chromophores are quite large, and this necessarily reduces the
molecular resolution that can be obtained from the FRET assay.
For these reasons we also examined CXCR4–TCR interactions using
the CFP/YFP FRET system. This system has the advantages of employing
smaller-sized fluorescent probes (YFP and CFP are each approximately only
25 kD in size) and of not requiring mAbs to attach the chromophores to the
proteins. Another advantage is that simple genetic manipulations are all that
is required in order to investigate interactions between any two proteins.
However, this system has specific disadvantages as well. Possible alterations
of protein structure and function may occur simply because they are fused to
the CFP or YFP proteins, and overexpression of fusion proteins might
disrupt normal cellular functions in unanticipated ways. Moreover, this
system can only be used to examine protein–protein interactions in cells
that are transfectable or otherwise permissive of genetic manipulation.
Finally, use of the CFP/YFP FRET system is significantly complicated by
its nonideal spectral characteristics, as described above.
Both FRET assays as we used them might be criticized because they
attach a fluorescent probe (and therefore assay receptor proximity) to only
one subunit of the TCR. However, this criticism is ameliorated by our
386 Ashok Kumar et al.

using two FRET assays that probe behavior of different TCR subunits: the
PE/APC FRET assay measures CXCR4–TCR-e interactions, while the
CFP/YFP FRET assay measures CXCR4–TCR-z interactions. Additional
assurance that the two CXCR4-TCR FRET assays are measuring CXCR4
interactions with the whole TCR comes from the fact that the PE/APC
FRET assay only labels receptors located on the cell surface. It has pre-
viously been shown that the majority of TCR on the cell-surface are
holoreceptors consisting of all a, b, g, d, e, and z TCR subunits (Alarcon
et al., 1988).

2. Assaying CXCR4-TCR Proximity via the PE/APC


mAb FRET Approach
In this approach, flow cytometry is used to detect FRET between
fluorescent monoclonal antibodies bound to endogenous cell-surface
CXCR4 and TCR-CD3-e. We successfully used this first FRET assay
(depicted in Fig. 19.1A) to detect SDF-1–induced increases in proximity
between CXCR4 and the TCR in both normal, human peripheral blood T
cells isolated from peripheral blood mononuclear cell preparations (PBMC)
and the Jurkat T-cell line (Kumar et al., 2006). Unless otherwise indicated,
cells are stimulated at 37  C with 0.5 to 1.0  10–7 M SDF-1 (SDF-1a,
R&D Systems, Minneapolis, MN). SDF-1 is resuspended at 105 M in PBS
supplemented with 0.5 % bovine serum albumin (BSA), aliquoted, and
stored at –70  C. Cells must be metabolically active in order to form
complexes. Solutions should also be prepared using the highest-quality
and purest BSA available.

2.1. Important considerations for labeling cell-surface


CXCR4 and TCR
Several aspects of the labeling step are critical to ensure success of the FRET
assay. First, it is important to use the particular mAb clones specified. These
are CXCR4 mAb conjugated to PE (Clone #44717, R&D Systems) and
TCR-CD3-e mAb conjugated to APC (Clone #UCHT1, Pharmingen,
San Diego, CA). Using different mAbs may not provide the appropriate
orientation and/or proximity of the conjugated fluorophores to permit the
detection of FRET following CXCR4-TCR complex formation. Second,
to increase the ability to detect FRET, it is important to label as high a
fraction as possible of the two cell-surface receptors with the fluorescently
conjugated mAbs. It is particularly critical to achieve optimal labeling of the
FRET donor, which in this case is CXCR4. Care must therefore be taken
Measuring CXCR4–TCR Proximity by FRET 387

to bind the antibodies to the cell-surface receptors under conditions of


considerable antibody excess and for a sufficient amount of time. For this
reason, it is recommended that before attempting FRET assays, the anti–
CXCR4-PE reagent be titrated for optimal labeling conditions as deter-
mined by traditional flow cytometric analysis. We have found that some lots
of anti–CXCR4-PE reagent need to be used at double or more of the per-
cell dose recommended by the manufacturer for traditional flow cytometry
in order to achieve maximal labeling of CXCR4. Different lots of anti–
CXCR4-PE reagent may also vary in their PE/IgG coupling ratio and
thereby affect sensitivity of the FRET assay. When the cell-surface CXCR4
of Jurkat T cells is optimally labeled for FRET assay, the cells are nearly 103
times brighter in the PE/FL2 flow cytometry channel than unstained cells.
The small quantities of azide used to preserve stocks of mAbs will not inhibit
receptor complex formation; however, it is important to otherwise employ
azide-free solutions. Finally, it is important to avoid any warming of the
samples that may permit receptor internalization during the antibody label-
ing step and before SDF-1 treatment. Using an ice-water bath for sample
incubation during these operations is therefore preferable to using ice alone.

2.2. Detailed procedure


Jurkat cells are grown in Medium A (RPMI with phenol red supplemented
with L-glutamine and 5 % fetal calf serum and 5 % calf serum). Cells are used
for experiments when grown to a density between 0.6  106 cells/ml
and 0.9  106 cells/ml. The protocol below is also appropriate for use
with normal, human PBMC T cells. Purify PBMC the same day as blood
draw via a standard ficoll-gradient method from blood-bank buffy coat or
apheresis cone preparations. PBMC can then be used for FRET experi-
ments following 24 h of cell culture at 37  C in Medium A. When using
PBMC, flow cytometric FRET results should be gated to include only
CD3þ cells in the analysis.
Prepare FACS buffer without phenol red or azide (Hanks Balanced Salt
Solution supplemented with 10 mg/ml BSA and 10 mM HEPES pH 7.4).
Prepare Fixing Solution (PBS with 2 % paraformaldehyde). Sterilize solu-
tions by filtering through 0.2 mm tissue-culture filters. Solutions may be
stored at 4  C for several weeks.
Determine the number of cell samples required for the assay. Each
sample should contain 0.5  106 cells. A minimum assay will require
control samples for setting flow cytometry channel voltage and compensa-
tion in addition to experimental samples plus and minus SDF-1. For
example, prepare the following cell samples: (1) unstained cells, (2) cells
stained with anti–CXCR4-PE only, (3) cells stained with anti–TCR-e-
APC only, (4) cells stained only with any perCP-conjugated antibody that
binds to the cells (for FL3 channel setup on the cytometer), and (5) cells
388 Ashok Kumar et al.

stained with both anti–CXCR4-PE anti–TCR-e-APC that will be stimu-


lated later with either vehicle or SDF-1.
Wash cell samples in ice-cold FACS buffer and aliquot into 1.5-ml
Eppendorf tubes on wet ice. Stain cells with the appropriate antibodies by
resuspending cell pellets in the appropriate antibody or mixture of anti-
bodies. For anti–CXCR4-PE anti–TCR-e-APC, use the optimal concen-
tration and volumes determined by prior titration. Incubate cells on wet ice
20 to 40 min to obtain optimal labeling of cell-surface receptors. Wash cells
twice with 0.2 ml ice-cold FACS buffer.
To assay SDF-1–dependent FRET, stimulate the appropriate cell sam-
ples with SDF-1 (or vehicle) as follows. Immediately after staining cells with
mAbs and washing, resuspend each cell pellet in 0.2 ml FACS buffer. Add
an appropriate amount of SDF-1 stock solution (or vehicle) and place test
tubes in a 37  C circulating water bath for exactly 20 min. Care must be
taken to control the time of the stimulation 10 s since FRET signals
increase with time (Kumar et al., 2006). We previously showed that
20 min of SDF-1 stimulation achieves nearly maximal FRET signals
(Kumar et al., 2006). To stop the reactions, transfer each sample into a
chilled test tube containing 0.2 ml ice-cold fixing solution. Place cells at
4  C for at least 1 h to fix them, then analyze by flow cytometry immedi-
ately or after further incubation at 4  C. Fixation is not required for FRET
detection if cells are kept on wet ice until flow cytometric analysis,
however, fixation is recommended in order to prevent temperature- and
time-dependent variations in FRET signals.

2.2.1. Flow cytometer specifications


For flow cytometry, we used a dual-laser (488-nm Ar and 635-nm He-Ne)
FACS Caliber (Becton Dickinson, Franklin Lakes, NJ), as described (Batard
et al., 2002; Kumar et al., 2006). Excitation/emission windows were
488 nm/585 21 nm (FL2), 488 nm > 670 nm (FL3), and 635 nm/661
8 nm (FL4). The optimal voltage settings for each channel are determined
as in conventional flow cytometry, that is, so that the unstained cell peak is
completely on-scale. Compensation is similarly determined as in conven-
tional flow cytometry, except that greater care should be taken to avoid
over- or under-compensation of all channels. Saved instrument settings on
the instrument specified above are usually approximately correct from day
to day, although compensation may require fine daily adjustment.

2.3. Examples and results


Figures 19.3 through 19.5 show examples of using the ‘‘mAb FRET’’
approach to analyze the SDF-1–dependent formation of CXCR4-TCR
complexes. CXCR4 and TCR-CD3-e of Jurkat T cells were labeled as
Measuring CXCR4–TCR Proximity by FRET 389

A B

256
256 Unstained
No SDF-1

Cell number
Cell number

+Vehicle CD3-e-APC alone

Events
Events

+SDF-1 CXCR4-PE alone


0

0
100 101 102 103 104 100 101 102 103 104
FL3/CXCR4-CD3-e-FRET FL3/CXCR4-CD3-e-FRET

C
512

Unstained
Cell number

+Vehicle
Events

+SDF-1
0

100 101 102 103 104


FL3-Hieght
FL3/CXCR4-CD45-FRET

Figure 19.3 Using mAb FRET and flow cytometry to assay SDF-1^dependent
CXCR4-TCR complex formation: typical responses of Jurkat Tcells and control data.
(A) Results from an individual experiment performed as described in Fig. 19.1A and
the text. Both CXCR4-PE and TCR-e-APC mAb were bound to the CXCR4 and
TCR molecules of Jurkat T cells, and then cells were stimulated with either SDF-1 or
vehicle at 37  C for 10 min. The data show that SDF-1, but not vehicle, treatment
induced an increase in per-cell CXCR4-PE^TCR-e-APC FRET fluorescence
(detected using the FL3 channel of the flow cytometer). (B) Control samples in which
cells were analyzed as in (A) after being bound to either CD3-e-APC or CXCR4-PE
alone. These control cells do not display FL3 fluorescence at the level of that induced
by SDF-1 on the dually labeled cells shown in Fig. 19.3A. (C) Control sample in which
cells were analyzed as in (A) after being bound to anti^CD45-APC instead of anti^
TCR-e-APC. Cells were also stained with anti^CXCR4-PE. No increase in FL3/
FRET fluorescence was detected in response to SDF-1. (From Kumar, A., Humphreys,T.
D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E., and Hedin, K. E. (2006).
CXCR4 physically associates with the T cell receptor to signal in T cells. Immunity 25,
213^224, with permission.)

above with receptor-specific mAbs conjugated to PE or APC, respectively.


After stimulation with SDF-1, cellular fluorescence changes associated with
FRET were analyzed by flow cytometry.

2.3.1. Jurkat results and controls


Figure 19.3A shows typical results for Jurkat T cells and recommended
controls. SDF-1 treatment increased per-cell FRET fluorescence, which is
reflected by the increase in FL3 channel fluorescence. The CXCR4-TCR
390 Ashok Kumar et al.

A B
Wild-type (Jurkat) cells

No SDF-1 125

CXCR4-TCR-CD3-e FRET
After SDF-1
100

response to SDF-1
(% of control)
75
Cell number
0

0 1 2 103 4
10 10 10 10
FL3-height 50

TCRb-deficient cells 25
*
No SDF-1 0
Jurkat TCRb-
deficient
After SDF-1
0

100 101 102 103 104


FL3/CXCR4-CD3-e-FRET

Figure 19.4 SDF-1^dependent CXCR4-TCR complex formation requires expression


of theTCR.Wildtype JurkatTcells, or a somatic mutant of Jurkat deficient in expression
of TCRb and consequently deficient in cell-surface TCR expression (Batard et al.,
2002), were assayed for SDF-1^dependent CXCR4-TCR complex formation by the
‘‘mAb FRET’’approach described in Fig. 19.1A, Fig. 19.3, and the text. (A) Histograms
showing examples of individual experiments. (B) Bar graph showing a summary of
multiple experiments as in (A). Each bar denotes the mean SDF-1^dependent FRET
response  standard error of the mean (SEM) for three independent experiments;
results are shown as a percent of the responses of control (i.e., wildtype Jurkat) cells ana-
lyzed the same day). * Significantly different from control responses ( p < 0.05).

FL3/FRET response was specific for SDF-1, since no CXCR4-TCR FRET


signals were induced when cells were stimulated with vehicle alone
(Fig. 19.3A). The levels of FL3 fluorescence associated with FRET were
not seen using cells labeled with either PE or APC alone (Fig. 19.3B). The
controls shown in Fig. 19.3A and B should be performed in every experiment
to provide assurance of proper cytometer setup. An additional control is
shown in Fig. 19.3C. No FL3/FRET signals were detected when a similar
approach was used to assay the proximity of CXCR4 to another abundantly
expressed cell-surface receptor, CD45. The results of this control experiment
indicate that the flexibility and length of the mAbs used to link the fluorophore
to the receptors are not, in themselves, sufficient to permit promiscuous FRET
between any pair of cell-surface receptors. Figure 19.4 shows an additional
control. No FL3/FRET signals were detected using a somatic mutant of the
Jurkat T-cell line that is deficient in TCRb expression and consequently also
Measuring CXCR4–TCR Proximity by FRET 391

A Vehicle pretreated B
256
No SDF-1

+ SDF-1
120

CXCR4-CD3-e : FRET
in response to SDF-1a
100
Cell number

(% of control)
0

100 101 102 103 104 80


MCD pretreated 60
256

No SDF-1a 40
+SDF-1 20 *
0
Vehicle MCD
0

100 101 102 103 104


FL3/CXCR4-TCR-CD3-e-FRET

Figure 19.5 Methyl-b-cyclodextrin (MCD) inhibits the ability of SDF-1 to induce


CXCR4-TCR FRET, suggesting that this process requires cholesterol and/or mem-
brane fluidity.Wildtype JurkatTcells were pretreated for 20 min with 25 mM of the cho-
lesterol chelator, methyl-b-cyclodextrin, or an equivalent amount of vehicle (RPMI).
SDF-1^dependent CXCR4-TCR complex formation was then assayed by the ‘‘mAb
FRET’’approach described in Fig. 19.1A, Fig. 19.3, and the text. (A) Histograms showing
examples of individual experiments. (B) Bar graph showing a summary of multiple
experiments as in (A). Each bar denotes the mean SDF-1^dependent FRET response 
standard error of the mean (SEM) for three independent experiments; results are shown
as a percent of the responses of control cells pretreated with vehicle alone and analyzed
the same day. * Significantly different from control responses ( p < 0.05).

deficient in cell-surface TCR expression (Kumar et al., 2006), providing


assurance that a positive readout in this assay requires expression of the TCR.
Several additional controls useful for confirming the authenticity of
results obtained from using this ‘‘mAb FRET’’ assay are described in our
published paper (Kumar et al., 2006). First, we showed that in addition to
cells from the Jurkat cell line, normal, human PBMC T cells display SDF-
1–dependent CXCR4-TCR FRET responses. Second, we showed that
the SDF-1–induced CXCR4-TCR FRET signals gradually increase with
time after SDF-1 addition and plateau after approximately 20 min. Third,
we showed that SDF-1–induced CXCR4-TCR FRET signals are appro-
priately inhibited by increasing doses of a CXCR4 antagonist. Finally, we
showed that SDF-1–induced CXCR4-TCR FRET signals display a dose–
response relationship consistent with SDF-1 acting by binding to CXCR4
(Kumar et al., 2006). Together, the results in Figs. 19.3 and 19.4 and
additional controls described here indicate that SDF-1 stimulation causes
CXCR4 and the TCR to move into close, physical proximity in both the
Jurkat T-cell line and normal human T cells.
392 Ashok Kumar et al.

2.3.2. Effects of methyl-b-cyclodextrin


Here, we use this PE/APC mAb FRET assay to further characterize SDF-
1–dependent CXCR4-TCR complex formation of T cells. Jurkat T cells
were pretreated with either the cholesterol chelation agent, methyl-b-
cyclodextrin (MCD), or vehicle. Cell-surface CXCR4 and TCR-CD3-e
molecules were then stained with CXCR4-PE and TCR-CD3-e-APC
mAbs, and SDF-1–dependent CXCR4-TCR complex formation was
detected via FRET assay as in Fig. 19.1A. Figure 19.5 shows that MCD
pretreatment abrogated the SDF-1–dependent FRET signals of the cells,
suggesting that SDF-1–dependent CXCR4-TCR complex formation
occurs via a process that requires cholesterol and/or membrane fluidity.

3. Assaying CXCR4-TCR Proximity via the


CFP/YFP Fusion Protein Approach
We also used a second FRET approach (Fig. 19.1B) to assay SDF-1–
induced increases in the proximity between CXCR4-YFP and TCR-z-
CFP in the Jurkat T-cell line (Kumar et al., 2006).

3.1. Transient transfection of fusion proteins into


Jurkat T cells
3.1.1. Plasmids and controls
To express CXCR4 and TCR-CD3-z fluorescent fusion proteins in the
Jurkat T-cell line, we employed transient transfection of expression plasmids
encoding these proteins as fluorescent fusion proteins with YFP and CFP.
We amplified cDNA encoding human CXCR4 and TCR-CD3-z via
PCR and subcloned them into pEYFP-N1 and pECFP-N1, respectively
(Clontech, Mountain View, CA). (The construction of these plasmids is
described in Kumar et al., 2006.) It is important to initially prepare not only
cell samples dually transiently transfected with both YFP and CFP fusion
protein-encoding plasmids, but also control cell samples transiently trans-
fected with either the YFP or CFP fusion protein-encoding plasmids
individually. These first types of control samples are important in order to
delineate the shape and intensity of the individual YFP or CFP fluorescence
emission profiles under the detection conditions used and with the
instrument employed. A second type of control is essential to include in
each experiment: a cell sample transfected only with pcDNA3 (Invitrogen,
Carlsbad, CA) or a similar ‘‘empty’’ vector. This control is required for
background subtraction of fluorescence produced by the cells and media.
To account for effects of transfection-related cell death on the fluorescence
of the sample, it is important that the total amount of DNA used for all
Measuring CXCR4–TCR Proximity by FRET 393

transfections in a given experiment be kept constant for all samples and


controls. This can be achieved by adding to each transfection an amount of
an ‘‘empty’’ vector such as pcDNA3 so as to make the total amount of
plasmid DNA in each transfection equivalent.

3.1.2. Preliminary experiments to determine optimal conditions


Optimal FRET between interacting fluorescent fusion proteins would
ideally be achieved under conditions of high, but molar equivalent,
expression of two interacting fluorescent fusion proteins. If either the
donor or acceptor fusion protein is grossly overexpressed relative to the
other, the FRET signal may be too weak to detect. On the other hand,
depending on the cell type used and the proteins being expressed, too high
a level of expression of one or both fusion proteins may be toxic to the
cells. Thus, before beginning FRET experiments, it is recommended that
test transfections be performed in which the amounts of the fusion
protein-expressing plasmids are titrated. Such test transfections are also
useful for optimizing transfection efficiency. Flow cytometry of the test
transfections, and also of later experimental transfections, is useful for
confirming appropriate levels of protein expression, transfection efficiency,
and cell viability. Figure 19.6B shows an example. For this purpose, we
use a Becton-Dickinson (Franklin Lakes, NJ) LSRII special order flow
cytometer with five lasers. For CFP detection, excitation is achieved via
the 407-nm laser and 505- to 520-nm emitted light is detected via a
combination of a 505-nm, long-pass filter followed by a 500/40-nm band-
pass filter. For YFP detection, the cells are excited with the 488-nm laser
and 515- to 545-nm emitted light is detected via a combination of a
505-nm, long-pass filter followed by a 530/30-nm band-pass filter. In our
hands, transiently transfecting 107 Jurkat T cells with 10 mg each of
CXCR4-YFP and TCR-z-CFP–expressing plasmids yields the optimal
detection of SDF-1–induced FRET signals. FRET signals were detected
with dual plasmid transient transfection efficiencies of 20 to 40%
(Fig. 19.6B).

3.1.3. Detailed protocol for transient transfection


For analysis of complex formation between CXCR4-YFP and TCR-z-
CFP, Jurkat cells are grown in Medium A (RPMI without phenol red but
supplemented with L-glutamine and 10% fetal calf serum) and are used for
transient transfection when grown to a density between 0.6  106 cells/ml
and 0.9  106 cells/ml. Jurkat cells grown to a density of greater than 106
cells/ml are only poorly transfectable by electroporation. Four cell samples
are prepared for each experiment. For each sample, 107 cells in a volume of
350 ml of Medium A are mixed with plasmid DNA as follows: Sample 1,
pcDNA3 (‘‘empty’’ vector, 20 mg); Sample 2, CXCR4-YFP (10 mg) and
394 Ashok Kumar et al.

A
30,000
Relative emission amplitude (arbitrary units)

B
25,000

4
10
3
10
TCR-z-CFP
20,000 Unstimulated cell sample R2

2
Cell sample stimulated

10
15,000 with SDF-1 for 20 min

1
10
10,000

0
10
100 101 102 103 104

CXCR4-YFP
5000

0
460 480 500 520 540 560 580
Fluorescent emission wavelength (nm)
in response to 433 nm excitation

Figure 19.6 Using CFP/YFP fusion protein FRETand spectrophotometry to assay the
formation of complexes between CXCR4-YFP and TCR-z-CFP in response to SDF-1
treatment of Jurkat Tcells. (A) Results from using a fluorescence spectrometer to assay
CXCR4-TCR FRET in JurkatTcells using the CFP/YFP fusion protein FRETapproach
described in Fig. 19.1B and the text. Jurkat Tcells were transiently transfected with plas-
mid vectors expressing CXCR4-YFP and TCR-z-CFP, and then analyzed for FRET.
The background-subtracted, fluorescence-emission spectra of the same cell samples in
response to 433-nm light stimulation before (grey line) and after (black line) 20 min of
SDF-1 treatment are shown. (B) Results from a control flow-cytometric analysis of the
cell sample used in (A), indicating that approximately 20% of live cells (boxed) express
both CFP and YFP fusion proteins.

pcDNA3 (10 mg); Sample 3, TCR-z-CFP (10 mg) and pcDNA3 (10 mg);
and Sample 4, CXCR4-YFP (10 mg) and TCR-z-CFP (10 mg). Each cell
sample is then transferred to a 4-mm gap BTX electroporation cuvette and
subjected to one 315-V pulse for 10 ms using a BTX T820 square-wave
electroporator (BTX, Holliston, MA). The cells from each transfection are
then diluted in 5 ml Medium A and cultured for 24 to 28 h.

3.2. Assaying CXCR4-YFP and TCR-z-CFP proximity by FRET


3.2.1. Preparation of transfected cell samples
The length of the time between cell transfection and FRET analysis criti-
cally affects the levels of fusion protein expression and therefore the experi-
mental outcome. In our hands, and using the conditions and amounts of the
fusion protein-encoding plasmids described here, CXCR4-YFP–TCR-z-
CFP FRET is best detected following 24 to 28 h of culture. It is recom-
mended that other laboratories determine the optimal post-transfection
culture time (which may vary between 18 and 36 h) for their experiments.
After the transfected cells are given the appropriate time in culture to
Measuring CXCR4–TCR Proximity by FRET 395

express the fusion proteins, the cells are resuspended to a density of 1 to 2 


106–cells/ml in Medium B (Hanks Balanced Salt Solution supplemented
with 5% fetal calf serum and 5 mM HEPES, pH 7.4) and cultured at 37  C
with 5% CO2 until FRET analysis. RPMI-based medium cannot be used at
this point due to its high background fluorescence under the conditions
used.

3.2.2. Collection of fluorescent spectra


To detect CXCR4-YFP–TCR-z-CFP FRET, we used a Horiba Jobin
Yvon (Edison, NJ) SPEX Fluorolog-3 spectrofluorimeter with 433-nm
light for excitation. The emission spectra were collected at 1 nm/s from
460 nm to 580 nm. The sample was maintained at 37  C and stirred
constantly using a heated cuvette and a magnetic stir bar, respectively,
during all spectral assays and also throughout the entire time of the SDF-1
stimulation. SDF-1 treatment was performed while cells remained in the
cuvette and the same samples were assayed to obtain spectra both before and
after SDF-1 treatment. Spectral data was collected both before and after
SDF-1 treatment for all four experimental cell samples (including all control
cell samples). We previously determined that CXCR4-TCR complex
formation detectable by the antibody FRET method increases during
20 min of SDF-1 treatment at 37  C and plateaus after 20 min (Kumar
et al., 2006); therefore, we assayed for CXCR4-YFP–TCR-z-CFP
FRET by the spectrofluorimetric method after 20 min of SDF-1 treatment.

3.2.3. Analysis and interpretation of fluorescent emission spectra


Once the emission spectra have been gathered, it is necessary to subtract
from the sample spectrum the background fluorescence emission produced
by the media and cells. This subtraction also accounts for any changes in cell
shape or size that might affect the spectra. To do this, cells transfected only
with a plasmid vector such as pcDNA3 were analyzed for fluorescence
emission before and after SDF-1 treatment. The unstimulated pcDNA3
control spectrum was then subtracted from the unstimulated experimental
sample spectrum. Likewise, the SDF-1–stimulated pcDNA3 control spec-
trum was subtracted from the SDF-1–stimulated experimental sample spec-
trum. The spectra of the background-subtracted experimental samples
before and after SDF-1 stimulation were then overlayed and offset in
order to detect FRET. To unambiguously identify FRET signals using
CFP and YFP, the enhanced emission signal of the YFP acceptor should
occur together with a concomitant decrease in the CFP donor’s emission
signal. As discussed in the introduction, comparing the spectra at these
two wavelengths and assaying reciprocal changes in emission intensity is
particularly important when using the CFP/YFP fluorophore pair to inves-
tigate FRET.
396 Ashok Kumar et al.

3.3. Example
Figure 19.6A shows data from a typical experiment. The grey line denotes
the background-subtracted fluorescence emission spectrum of Jurkat T cells
expressing both CXCR4-YFP and TCR-z-CFP before these cells have
been treated with SDF-1. The background-subtracted spectrum shows a
CFP emission peak centered at 475 nm and a smaller YFP emission peak
centered at 528 nm. The black line denotes the background-subtracted
fluorescence emission spectrum of the same cell sample following its stimu-
lation with 5  10–8 M SDF-1 for 20 min and analyzed again. Comparison
of the two spectra indicates relative changes consistent with CXCR4-YFP–
TCR-z-CFP FRET signals increasing following SDF-1 treatment—a
decrease in the CFP emission peak because it is donating energy to YFP,
and a consequent increase in the YFP emission peak.

4. Concluding Remarks
FRET experiments provide us with valuable insights into molecular
dynamics and can frequently be designed to examine dynamics within living
cellular systems. Combining different types of approaches, including FRET
assays that employ various chromophores and that tag proteins of interest in
different ways, is the most reliable way to obtain conclusions about molec-
ular interactions in the living cell. The addition of biochemical approaches,
such as copurification of proteins, can also be useful for confirming the
presence of protein–protein complexes detected by FRET, and for exam-
ining the physiological significance of the interactions.

REFERENCES
Alarcon, B., Berkhout, B., Breitmeyer, J., and Terhorst, C. (1988). Assembly of the human
T cell receptor-CD3 complex takes place in the endoplasmic reticulum and involves
intermediary complexes between the CD3-g, d, e core and single T cell receptor a or b
chains. J. Biol. Chem. 263, 2953–2961.
Batard, P., Szollosi, J., Luescher, I., Cerottini, J.-C., MacDonald, R., and Romero, P.
(2002). The use of phycoerythrin and allophycocyanin for fluorescence resonance energy
transfer analyzed by flow cytometry: Advantages and limitations. Cytometry 48, 97–105.
Chan, F. K.-M., Sigel, R. M., Zacharias, D., Swofford, R., Holmes, K. L., and Tsien, R. Y.
(2001). Fluorescence resonance energy transfer analysis of cell surface receptor interac-
tions and signaling using spectral variants of the green fluorescent protein. Cytometry 44,
361–368.
Ciruela, F. (2008). Fluorescence-based methods in the study of protein–protein interactions
in living cells. Curr. Opin. Biotechnol. 19, 1–6.
Forster, T. (1948). Zwischenmolekulare energiewanderung and fluoreszenz. Ann. Physik. 2,
55–75.
Measuring CXCR4–TCR Proximity by FRET 397

Forster, T. (1965). Delocalized excitation and excitation transfer. In ‘‘Modern Quantum


Chemistry Part III: Action of Light and Organic Crystals.’’ (O. Sinanoglu, ed.),
pp. 92–137. Academic Press, New York.
Glazer, A. N., Chan, C., Williams, R. C., Yeh, S. W., and Clark, J. H. (1985). Kinetics of
energy flow in the phycobilisome core. Science 230, 1051–1053.
He, L., Bradrick, T. D., Karpova, T. S., Wu, X., Fox, M. H., Fischer, R., McNally, J. G.,
Knutson, J. R., Grammer, A. C., and Lipsky, P. E. (2003a). Flow cytometric measure-
ment of fluorescence (Forster) resonance energy transfer from cyan fluorescent protein to
yellow fluorescent protein using single-laser excitation at 458 nm. Cytometry 53A,
39–54.
He, L., Olson, D. P., Wu, X., Karpova, T. S., McNally, J. G., and Lipsky, P. E. (2003b).
A flow cytometric method to detect protein–protein interaction in living cells by directly
visualizing donor fluorophore quenching during CFP-YFP fluorescence resonance
energy transfer (FRET). Cytometry 55A, 71–85.
He, L., Wu, X., Simone, J., Hewgill, D., and Lipsky, P. E. (2005). Determination of tumor
necrosis factor receptor-associated factor trimerization in living cells by CFP–YFP–
mRFP FRET detected by flow cytometry. Nuc. Acids Res. 33, e61.
Janetopoulos, C., Jin, T., and Devreotes, P. (2001). Receptor-mediated activation of
heterotrimeric G proteins in living cells. Science 291, 2408–2411.
Jares-Erijman, E., and Jovrin, T. M. (2003). FRET imaging. Nat. Biotechnol. 21, 1387–1395.
Kumar, A., Humphreys, T. D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E.,
and Hedin, K. E. (2006). CXCR4 physically associates with the T cell receptor to signal
in T cells. Immunity 25, 213–224.
Lakowicz, J. R. (1999). Principles of fluorescence spectroscopic ruler. Annu. Rev. Biochem.
47, 819–846.
Shaner, N. C., Patterson, G. H., and Davidson, M. W. (2007). Advances in fluorescent
protein technology. J. Cell Sci. 120, 4247–4260.
Shaner, N. C., Steinbach, P. A., and Tsien, R. Y. (2005). A guide to choosing fluorescent
proteins. Nat. Methods 2, 905–909.
Stryer, L. (1967). Energy transfer: A spectroscopic ruler. Proc. Natl. Acad. Sci. USA 58,
719–726.
Stryer, L. (1978). Fluorescence energy transfer as a spectroscopic ruler. Annu. Rev. Biochem.
47, 819–846.
Tertoolen, L. G. J., Blanchetot, C., Jiang, G., Overvoorde, J., Gadella, T. W. J. Jr.,
Hunter, T., and den Hertog, J. (2001). Dimerization of receptor protein-tyrosine
phosphatase alpha in living cells. BMC Cell Biol. 2, 8.
Tsien, R. Y. (1998). The green fluorescent protein. Annu. Rev. Biochem. 67, 509–544.
Vamosi, G., Samjanovich, S., and Szollosi, J. (2008). Dissecting interacting molecular
populations by FRET. Cytometry 73A, 681–684.
Vilardaga, J. P., and Nikolaev, O. (2007). Monitoring receptor signaling by intramolecular
FRET. Curr. Opin. Pharmacol. 7, 547–553.
Viskari, P. J., and Colyer, C. L. (2001). Separation and quantitation of phycobiliproteins
using phytic acid in capillary electrophoresis with laser-induced fluorescence detection.
J. Chromatography 972, 269–276.
Xia, Z., and Liu, Y. (2001). Reliable and global measurement of fluorescence resonance
energy transfer using fluorescence microscopes. Biophys. J. 81, 2395–2402.
C H A P T E R T W E N T Y

Expression of CXCR4, a G-Protein–


Coupled Receptor for CXCL12 in Yeast:
Identification of New-Generation
Inverse Agonists
Barry J. Evans,* Zixuan Wang,*,§ James R. Broach,† Shinya Oishi,‡
Nobutaka Fujii,‡ and Stephen C. Peiper*

Contents
1. Introduction 400
2. Methods and Discussion 402
2.1. Overview of yeast-signaling strategies 402
2.2. Experimental approach 403
2.3. Characterization of inverse agonists for CXCR4 404
3. Summary 408
References 410

Abstract
G-protein–coupled receptors (GPCR) are prime targets for therapies with small
molecule-antagonists. Since yeast have GPCR triggered signaling pathways
analogous to those present in mammalian cells, it is possible to express
human receptors in yeast coupled to the pheromone responsive signaling
cascade in variants that contain mammalian-yeast Ga subunit chimeras.
CXCR4 and CXCR4(N119S), a constitutively active mutant were expressed in
yeast coupled to pheromone responsive reporter genes, HIS3, lacZ, or FUI, and
tested for signaling activity. Compounds derived from T140, an inverse agonist
for CXCR4, were screened for activity using yeast cells expressing CXCR4
(N119S) and containing a FUS1-lacZ reporter gene. Levels of inhibition of
beta-galactosidase activities triggered by constitutive activation of the phero-
mone response pathway that were obtained in the presence of the T140 derived

* Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia,
Pennsylvania, USA
{
Department of Molecular Biology, Princeton University, Princeton, New Jersey, USA
{
Department of Chemogenomics, Graduate School of Pharmaceutical Sciences, Kyoto University,
Sakyo-ku, Kyoto, Japan
}
Department of Surgery, Thomas Jefferson University, Philadelphia, Pennsylvania, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05220-3 All rights reserved.

399
400 Barry J. Evans et al.

compounds correlated with affinities measured in radioligand binding inhibition


experiments. The yeast signaling system may provide an effective approach for
screening chemokine receptor antagonists.

1. Introduction
G-protein–coupled receptors (GPCR) are encoded by a superfamily of
genes that constitute approximately 1 to 2% of the human genome
(Fredriksson and Schioth, 2005). It is one of the largest gene families in
mammals and there is a high degree of diversity among the receptors
encoded. GPCRs are present in virtually all eukaryotic cells and have a
broad repertoire of ligands that include light, lipids, nucleotides, polypeptides,
and proteins. The unifying topologic characteristic of GPCRs is the presence
of seven hydrophobic helices that span the plasma membrane, resulting in
exposure of the N-terminus and three interhelical loops to the extracellular
space and orientation of the C-terminus and three interhelical loops into the
cytoplasm. Signaling is mediated by coupling to heterotrimeric G proteins.
GPCRs are highly accessible molecular targets for drug therapy and
current estimates are that 30 to 50% of drugs are directed toward these
receptors (Hopkins and Groom, 2002). Many strategies for the development
of therapeutic agents use structural information to generate lead compounds,
so-called rational drug design. The high-resolution structure has been
determined for only two GPCRs (Palczewski et al., 2000; Rosenbaum
et al., 2007), which restricts the application of this approach. In addition,
the diversity among GPCRs and the integral membrane topology has lim-
ited and complicated the use of computational modeling strategies to
approximate structural architecture for virtual drug design. This highlights
the need for efficient screening technologies to identify lead compounds for
therapeutic applications.
The receptors for chemoattractant cytokines, chemokines, are GPCRs in
the rhodopsin subfamily. These receptors number approximately 19, 10 for
CC chemokines, 7 for CXC chemokines, 1 for C chemokines, 1 for
the CX3C chemokine, and 2 nonsignaling binding heptahelical proteins
(Murphy et al., 2000). There is significant redundancy in the repertoire of
chemokine- and receptor-binding activities, but several chemokine–
receptor pairs are exclusive. Stromal cell–derived factor 1 (SDF-1,
CXCL12) is the sole ligand for CXCR4 (Bleul et al., 1996; Oberlin et al.,
1996). Studies with knockout mice demonstrated that both the ligand and
receptor are critical for development of the central nervous system, the
cardiovascular system, and bone marrow hematopoiesis during embryologic
development (Nagasawa et al., 1996; Tachibana et al., 1998; Zou et al., 1998).
Expression of CXCR4 401

This axis is also involved in the development of B lymphocytes and the


chemotaxis of lymphocytes (both T cells and B cells), granulocytes, and
other inflammatory cells in response to a CXCL12 gradient. CXCR4 is
expressed on primordial germ cells (Doitsidou et al., 2002) and human hema-
topoietic stem cells (Deichmann et al., 1997; Möhle et al., 1998). Recently, a
CXCR4 inhibitor of the weak partial agonist type was approved for mobili-
zation of hematopoietic stem cells in humans.
In addition to its critical role in normal physiology, CXCR4
has prominent roles in pathologic physiology. CXCR4 was the first cor-
eceptor identified that is permissive for entry of T-cell tropic strains of the
human immunodeficiency virus type 1 (HIV-1) into human target cells that
coexpress CD4 (Feng et al., 1996), leading to the designation X4 for these
strains. The recognition that a then-orphan GPCR closely genetically
related to chemokine receptors led to the rapid identification of CCR5,
the front-line coreceptor for commonly transmitted strains of HIV-1 (R5)
(Deng et al., 1996; Dragic et al., 1996). Rare patients who lack functional
CCR5, and are highly resistant to infection with R5 strains, may be infected
with X4 strains and those treated with CCR5 antagonists may undergo a
shift in tropism from R5 to X4. CXCR4, which is expressed by tumor cells
of many types of malignancies, has also been shown to play a critical role in
their metastasis to lung and lymph nodes, which secrete (a chemotactic
gradient of ) CXCL12, and inhibition of CXCR4 blocked the spread of
tumor cells (Muller et al., 2001). The finding that metastatic variants derived
by biological selection from nonmetastatic cell lines have upregulation of a
cadre of genes that includes CXCR4 implicates it in the migration/homing
mechanisms of metastasis (Kang et al., 2003). Moreover, the formation of a
niche of carcinoma-associated fibroblasts that supports tumor cells involves
the CXCL12–CXCR4 axis.
Thus, CXCR4 provides an opportunity as a potential molecular
target in HIV-1 infection and numerous malignancies in addition to
the approved role in mobilization of hematopoietic stem cells. The first
CXCR4 antagonist, AMD3100, was identified through binding screens
and biological assays, which have some drawbacks for high-throughput
analysis. Since GPCRs play a critical role in pheromone and nutrient
sensing in yeast through the MAP kinase pathway, it was possible to
genetically engineer yeast strains for screening mammalian GPCRs. We
have previously developed a yeast system in which human CXCR4 is
functionally coupled to the pheromone response pathway for the evalu-
ation of candidates for their inverse agonist or weak partial agonist
activity for this GPCR using a reporter gene driven by a pheromone-
responsive promoter. Here we describe three yeast systems and examples of
their utilization for characterizing a group of compounds derived from T140, a
polypeptide CXCR4-inverse agonist.
402 Barry J. Evans et al.

2. Methods and Discussion


2.1. Overview of yeast-signaling strategies
Saccharomyces cerevisiae have two genes encoding GPCRs that transduce
the signal of mating pheromones (STE2 and STE3) (Xue et al., 2008).
The downstream pheromone-response signaling pathway initiates with
activation of a G-alpha subunit (Gpa1) and is dependent on release of the
Gb/Gg heterodimer (Ste4/Ste18). The liberated Ste4/Ste18 complex binds
three downstream targets: Ste5, a scaffold protein; Ste20, PAK kinase; and
the MAPK phospho-circuit (Ste11, Ste7, and Fus3). Upon phosphoryla-
tion, Fus3 liberates Ste12, a transcription factor, from the inhibitory com-
plex Dig1/Dig2, thereby inducing the expression of pheromone-responsive
mating genes. Transcription of the FUS1 gene is dependent on multiple
members of the pheromone response–signaling pathway (Ste4, Ste4, Ste7,
Ste11, and Ste12), and the upstream promoter region of FUS1 was found to
have four copies of the canonical pheromone response element (Hagen
et al., 1991). The pheromone response pathway provides a template for
genetic engineering of a ‘‘customized’’ signaling system that can be used to
characterize and select signaling variants of mammalian GPCRs, as well as
an approach for screening of pharmacologic agents for these targets.
We have previously described the expression of wildtype human CXCR4
linked to the pheromone response pathway in Saccharomyces cerevisiae (Zhang
et al., 2002, 2004). This required the development of a yeast strain (CY12946)
that contained a chimeric Ga subunit composed of segments that couple to
mammalian GPCRs and yeast segments that interact with the Gb/Gg subunits
that regulate the pheromone response signaling cascade. Since activation of
this pathway results in cell cycle arrest, mutations in negative regulators were
introduced into this yeast strain. Sequences encoding human CXCR4 (and
variants) were introduced into this strain using the Cp4258 plasmid containing
a selectable marker for leucine synthesis. Reporter genes lacZ and HIS3 were
placed downstream of the FUS1 promoter, which is turned on following
activation of this pathway. The FUS1-HIS3 reporter gene was used for
growth survival experiments in yeast that are histidine auxotrophs, because
HIS3 can complement this phenotype. Thus, with activation of the phero-
mone response pathway, yeast cells that cannot grow in medium lacking
histidine are converted to histidine prototrophs that produce histidine and
can grow in the absence of supplementation of the medium. This provides a
growth selection strategy mechanism in which histidine-deficient cells can
survive in the absence of this amino acid when there is activation of the
pheromone response pathway and expression of HIS3. While the FUS1-
HIS3 system is ideally suited for the selection of signaling variants that confer
yeast survival in selective medium, it lacks the sensitivity required for screening
Expression of CXCR4 403

for antagonists. Therefore, the FUS1-lacZ reporter gene was used for screen-
ing experiments because it programs the expression of beta-galactosidase,
which can be detected with sensitive assays with a fluorescent substrate
(fluorescein di-b-D-galactopyranoside [FDG]).

2.2. Experimental approach


We first used the FUS1-HIS3 reporter gene system to express human
CXCR4 in Saccharomyces cerevisiae functionally coupled to the pheromone
response pathway. Exposure of these yeast strains to CXCL12 induced
expression of HIS3 and survival in medium lacking histidine. We were
able to adapt this system to select constitutively active CXCR4 mutants.
This signaling variant was isolated from a pool of CXCR4 open reading
frames randomly mutated at a frequency of 0.1% to 0.3%. The open
reading frames were cloned into the Cp4258 vector and introduced into
yeast cells. Selection of the pool of yeast cell transformants yielded rare
colonies, which contained CXCR4 that carried a mutation of Asn-119 to Ser.
Further characterization of this mutant revealed that it conferred constitutive
signaling in yeast and mammalian cells.
In the current experiments, the Cp4258 vector was used to introduce
wildtype CXCR4 or the constitutively active mutant, CXCR4(N119S),
into the engineered CY12946 yeast cell strain. In addition, the FUS1-lacZ
reporter gene (Cp1584) was also introduced into the yeast cells used for
screening assays. Constructs were cotransformed into yeast cells using the
Frozen EZ Yeast Transformation-II kit (Zymo Research, Orange, CA).
Yeast cells incorporating and expressing both of these plasmids were selected
for expression of the selectable marker by growth in medium lacking leucine
(selection for Cp4258) and tryptophan (selection for Cp1584), respectively.
These yeast cells were used for growth screens and reporter gene assays to
evaluate the compounds for activity as a weak partial agonist based on the
ability to stimulate either the wildtype receptor or the constitutively active
mutant, a more sensitive indicator, and as an inverse agonist that suppresses
the autonomous signaling of the constitutively active mutant.
A third yeast-based signaling system was also tested for its utility as a
screen for inhibitors using the constitutively active mutant to identify
inverse agonists and, theoretically wildtype CXCR4 and CXCL12 to detect
neutral antagonists and weak partial agonists. This system uses the induction
of a reporter gene (FUI ) ( Jund and Lacroute, 1970) that is a permease for
5-fluoropyrimidines. In this case, CXCR4-mediated activation of the
pheromone response cascade upregulates permease expression and sensitiv-
ity to 5-fluorouridine (5-FU) toxicity. Inhibition of CXCR4 signaling
would suppress permease expression and block the toxicity from 5-FU.
In practice, this system could be employed for inverse agonist screens with
the constitutively active CXCR4 mutant, but not for neutral antagonists
404 Barry J. Evans et al.

and weak partial agonists due to the prohibitive cost of the ligand that would
be required to activate CXCR4. Sequences encoding the FUI transporter
downstream of a FUS1 promoter were incorporated into the genome of
CY12946 yeast cells at the URA3 locus by homologous recombination
with the pAA7 vector using the transformation procedure described above.
The assay for detection of the HIS3 reporter gene was performed as
previously described (Ahang et al., 2002, 2004). Briefly, CY12946 yeast cells
were grown in broth lacking leucine and histidine in 96-well plates. Growth as
measured using absorbance at 600 nm was determined at sequential intervals
to determine the level of expression of the pheromone responsive HIS3
reporter gene. Screening assays were performed using the FUS1-lacZ reporter
gene. Yeast cells transformed with this construct were grown overnight in
medium lacking leucine and tryptophan and then diluted to an absorbance at
600 nm of 0.1. The yeast was then grown in 96-well plates in the same broth in
the presence or absence of candidate compounds until the absorbance at
600 nm reached 0.5. Aliquots of the yeast cell culture (10 ml) were solubilized,
incubated in the presence of the fluorescent substrate (FDG) for 45 min at
37  C, and analyzed for fluorescence in a FUSION (Packard).
The 5-fluorouridine assay was performed using cells expressing native
CXCR4 or the N119S constitutively active mutant. CY12946 cells con-
taining the FUS1-FUI reporter gene were grown overnight in the presence
or absence of the candidate antagonist and 5-FU in broth lacking leucine
and uracil (as selective pressure for maintenance of the plasmids). Growth
was determined from the absorbance at 600 nm. This system is also a growth
assay in which inhibition of CXCR4 signaling results in decreased permease
expression and decreased sensitivity to 5-FU.

2.3. Characterization of inverse agonists for CXCR4


Analysis of CY12946-CXCR4 cells in the growth assay is shown in
Fig. 20.1A. Expression of CXCR4 in CY12946 cells did not induce the
pheromone responsive HIS3 gene, thus, there was no growth in histidine-
free medium. In contrast, expression of CXCR4(N119S) in CY12946 cells
stimulated autonomous activation of the pheromone response pathway
and expression of the FUS1-HIS3 reporter gene resulting in growth in
histidine-free medium. Exposure of CY12946-CXCR4(N119S) cells
to 1 mM FC131 resulted in low-level inhibition of CXCR4(N119S) con-
stitutive activity (data not shown), but the relative effect was less than
was observed in the FUS1-lacZ reporter gene system, as shown below.
As shown with the FUS1-lacZ reporter assay in Fig. 20.1B, there is a low
level of basal beta-galactosidase activity detected in CY12946-CXCR4 cells
that is not significantly different from that seen with parental CY12946
cells (data not shown). The level of enzymatic activity is not altered by
FC131, which suggests that it reflects the true background of the system.
A 0.25

0.2

0.15 WT
OD600
N119S
0.1

0.05

0
0 5 10 15 20 25
Time (h)
B
1600
1400
Fluorescence (RFU)

1200
1000
800
600
400
200
0
WT WT + N119S N119S +
FC131 FC131
C 0.7

0.6

0.5

0.4 WT
OD600

N119S
0.3

0.2

0.1

0
0 200 400 600 800 1000 1200
[5FU] (mM)

Figure 20.1 Comparison of yeast reporter gene assays. (A) Growth of yeast CY12946
cells containing a FUS1-HIS3 reporter gene programmed to express human CXCR4 or
CXCR4(N119S), a constitutively active mutant, and grown in histidine-deficient medium
for the indicated time. Growth is evaluated from absorbance at 600 nm. (B) b-galactosi-
dase assay of CY12946 cells containing a FUS1-lacZ reporter gene programmed to express
human CXCR4 or the constitutively active mutant.The effect of FC131 is demonstrated.
(C) Growth of yeast containing a FUS1-FUI reporter gene programmed to express
human CXCR4 or the constitutively active mutant. Cells are exposed to incremental
concentrations of 5-fluorouridine. Growth is evaluated from absorbance at 600 nm.
406 Barry J. Evans et al.

The beta-galactosidase activity is elevated by approximately fivefold in


CY12946-CXCR4(N119S) cells in this experiment, consistent with the
constitutive signaling activity of this CXCR4 variant (ratios of activated to
background may vary significantly depending on subtle variations in exper-
imental conditions). Exposure of CY12946-CXCR4(N119S) cells to
FC131, a second generation cyclic pentapeptide with inverse agonist activ-
ity, resulted in 60% inhibition of FUS1-lacZ reporter gene expression.
The yeast FUS1-FUI permease reporter gene system was compared to
the FUS1-lacZ strategy. Exposure of CY12946-CXCR4 cells to increasing
amounts of 5-FU revealed a moderate decrease in cell density evident from
the absorbance at 600 nm (Fig. 20.1C). Parallel exposure of CY12946-
CXCR4(N119S) cells to the incremental concentrations of 5-FU resulted
in decreased cell density, consistent with increased transport of this toxic
agent resulting from signaling by the constitutively active mutant. Whereas
exposure of the constitutively active variant of CXCR4 to FC131 resulted
in significant suppression of signaling in the FUS1-lacZ reporter system, this
effect could not be detected in the pheromone-responsive permease system
(data not shown).
The basal activity of native CXCR4 (in the absence of CXCL12) was
not sufficient to activate FUS1-lacZ reporter gene expression in CY12946
cells. As shown in Fig. 20.2A, exposure of CY12946-CXCR4 cells to
incremental concentrations of CXCL12 resulted in activation of the
reporter gene in a dose-responsive fashion. Low levels of beta-galactosidase
activity were detected in cells exposed to 1 mM CXCL12, and the EC50 was
approximately 3 to 5 mM. The CXCR4 response to CXCL12 in yeast cells
occurs at ligand concentrations approximately three orders of magnitude
higher than is seen in mammalian systems using ligand binding, calcium
mobilization, or other assays, such as activation of MAP kinase signaling and
chemotaxis. This may be due to the presence of a cell wall in yeast that
could interfere with the binding of CXCL12 to CXCR4. This effect was
not apparent at the same degree with the antagonists tested, perhaps because
they are smaller than CXCL12. Alternatively, since yeast lack tyrosine
sulfation, the absence of sulfation of tyrosine residues in the N-terminus
of CXCR4 could be responsible for the decreased ligand binding, as has
been demonstrated in mammalian systems. The requirement for high con-
centrations of CXCL12 for activation of signaling in CY12946-CXCR4 cells
makes this approach impractical for the screening of compounds. In addition,
this system cannot distinguish between the pharmacologic types of inhibitors:
neutral antagonists, weak partial agonists, and inverse agonists.
In contrast, the fluorescent assay for the FUS1-lacZ reporter gene using
CY12946-CXCR4(N119S) cells was sensitive for the detection of the
inverse agonist activity of T140 and FC131, as well as the weak partial
agonist activity of AMD3100 (Fig. 20.2B). Exposure to T140, a 14–amino
acid polypeptide containing an internal disulfide bond, decreased the
Expression of CXCR4 407

A
20

Fold buffer fluorescence


15

10

mM
nM

M
nM

mM
M
r
ffe

0n

6n

1m
Bu

16

10
10

.6

10

31
31

3.
[CXCL12]
B
200 T140
% of buffer fluorescence

FC131
150
AMD3100
100

50

0
nM

M
nM

mM
nM

M
0n

1m
6n
10
16

16
.6

10

31
31
3.

3.

[compound]

Figure 20.2 Fluorescent screening assay in yeast containing the FUS1-lacZ reporter
gene. (A) b-galactosidase activity of yeast expressing human CXCR4 exposed to incre-
mental concentrations of CXCL12. (B) b-galactosidase activity of yeast expressing the
CXCR4 constitutively active mutant exposed to incremental concentrations of T140,
FC131, or AMD3100.
signaling of the constitutively active receptor mutant. Beta-galactosidase
activity was decreased in CY12946-CXCR4(N119S) cultures exposed
to 31.6 nM T140 and reached maximal inhibition at 316 nM. Exposure to
10 nM FC131, a cyclic pentapeptide downsized from the T140 template,
induced slight inhibition of beta-galactosidase activity and complete inhibi-
tion was detected at concentrations of 1.0 mM. While the inhibition of [125I]
CXCL12 binding to CXCR4 (in mammalian cells) by T140 and FC131
gave similar IC50 values (2 to 10 nM ) and they block HIV-1 infection of
CD4 positive target cells at similar concentrations, their efficiency for
inhibition of chemotaxis is different. T140 has a greater efficacy for blocking
directed migration toward a CXCL12 gradient. The slopes of the ligand
binding inhibition curves for T140 and FC131 are different, with T140
demonstrating a steeper decrease in binding than FC131. That relationship
resembles the difference in inhibition curves obtained in the FUS1-lacZ
assay with CY12946-CXCR4(N119S) cells. Exposure to AMD3100
resulted in slight inhibition of beta-galactosidase activity at 31.6 nM, with
408 Barry J. Evans et al.

an increase in the lacZ reporter gene expression beginning at 316 nM. These
findings are compatible with the presence of a weak partial agonist.
Eight compounds derived from the T140 structure were developed in
the Department of Chemogenomics, Graduate School of Pharmaceutical
Sciences, Kyoto University, and tested for activity using the yeast FUS1-lacZ
screening system. All compounds showed some inhibition of the autono-
mous activation of the pheromone response pathway by the constitutively
active CXCR4. Exposure to incremental concentrations revealed that the
IC50 concentrations for TR1403, TR1404, TR1405, and TY14010.R5
were between 100 nM and 500 nM (Fig. 20.3A). The latter four com-
pounds all had complete inhibition of FUS1-lacZ activation at concentra-
tions of 1 mM. The IC50 concentrations for FNC003, A5, A7, and A8 were
all greater than 1 mM (Fig 20.3B). In contrast, the four compounds with
IC50 values greater than 1 mM did not achieve full inhibition of this activity.
The compounds were tested in parallel in radioligand-binding experi-
ments to verify the findings in the yeast assay system. As we have previously
described (Zhang et al., 2002), CHO cell CXCR4 transfectants were
incubated with [125I]CXCL12 in the presence and absence of incremental
concentrations of the individual compounds and cell bound ligand was
separated from free by centrifugation through oil. As shown in Fig. 20.3C
and D, the group of high-affinity inverse agonists gave standard sigmoidal
inhibition kinetics for [125I]CXCL12 binding. The IC50 values for the
binding inhibition studies are listed in Table 20.1. The three TR com-
pounds all had IC50 values of 20 nM (TR14003, 23 nM; TR14004,
21 nM; TR14005, 18 nM). TY14010.R5 had an IC50 value of 13 nM
and the FCN003 compound was 40 nM. Values for A5 and A8 were greater
than 10 mM, and A7 was between 1 mM and 10 mM. There was good
relative correlation between IC50 values determined from the fluorescent
yeast system and those obtained by inhibition of radioligand ([125I]
CXCL12) binding, with the exception of TY14010.R5 (TR14003:
23 nM [125I]CXCL12/246 nM yeast, TR14004: 21 nM [125I]CXCL12/
119 nM yeast, TR14005: 18 nM [125I]CXCL12/208 nM yeast, TY14010.
R5 13 nM [125I]CXCL12/526 nM yeast). Maximum inhibition was
obtained at 1 mM of the active inverse agonists in both the yeast and
radioligand inhibition systems. The latter technique detected inhibition at
lower concentrations of compound. This could be due in part to the
presence of the yeast cell wall or the size and/or structure of the antagonists.

3. Summary
Human CXCR4 was expressed in Saccharomyces cerevisiae coupled to
the yeast pheromone response pathway. High levels of CXCL12 were
required to activate signaling using either pheromone-responsive HIS3 or
A B

% of buffer fluorescence
% of buffer fluorescence
120 TR14003 140 FCN003
100 TR14004 120 A5
80 TR14005 100 A7
60 TY14010.R5 80 A8
60
40
40
20 20
0 0

M
nM

nM

nM

nM

mM
nM
nM

mM
0n

6n

1m

0n

6n

1m
10

16
10

.6
16
.6

16
16

10

31

10

31
31
31

3.
3.
3.
3.

[compound] [compound]

C D
150 150 FCN003
% of buffer I125 CXCL12

% of buffer I125 CXCL12


TR14003
TR14004 A5
100 TR14005 100 A7
TY14010.R5 A8

bound
bound

50 50

0 0

−50 −50
−12 −11 −10 −9 −8 −7 −6 −5 −10 −9 −8 −7 −6 −5 −4
Log [compound] Log [compound]

Figure 20.3 Characterization of T140 derivatives in yeast containing the FUS1-lacZ reporter gene and radioligand-binding inhibition.
(A and B) b-galactosidase activity of yeast expressing the CXCR4 constitutively active mutant exposed to incremental concentrations of can-
didate compounds. (C and D) Inhibition of [125I]CXCL12 binding to CHO cells exposed to incremental concentrations of candidate
compounds.
410 Barry J. Evans et al.

Table 20.1 Affinity of inverse agonist candidates by


radioligand binding

Compound EC50
A5 >10 mM
A7 1 < EC50 < 10 mM
A8 >10 M
FCN003 40 nM
TR14003 23 nM
TR14004 21 nM
TR14005 18 nM
TY1410.R5 13 nM

lacZ reporter genes to detect growth or cleavage of a fluorescent substrate,


respectively. The expense of this approach precluded using ligand stimula-
tion of native CXCR4 for screening compounds. The pheromone-
responsive HIS3 reporter gene approach, which enables positive growth
selection for CXCR4 signaling, while lacking sensitivity for screening
compounds, was used to select mutant forms of CXCR4 with constitutive
signaling. A CXCR4 mutant with constitutive signaling was identified using
the pheromone-responsive HIS3 selection. A sensitive screening assay was
developed using the CXCR4 constitutively active mutant with the FUS1-
lacZ reporter gene to detect activation of beta-galactosidase expression using
a fluorescent substrate. The sensitivity of the yeast assay, although less than
inhibition of [125I]CXCL12 binding, was sufficient to detect candidates with
intermediate levels of activity for CXCR4. The use of the constitutively
active CXCR4 mutant has the advantage of detecting both weak partial
agonists and inverse agonists (but not neutral antagonists) and distinguishing
between these pharmacologic classes of antagonists. The fluorescent yeast
assay is rapid, inexpensive, and easy to perform. It is well suited for high-
throughput screening of libraries for GPCR antagonists. Full characteriza-
tion requires the subsequent analysis of lead compounds by standard
approaches, including ligand-binding inhibition and biological assays.

REFERENCES
Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., and
Springer, T. A. (1996). The lymphocyte chemoattractant SDF-1 is a ligand for
LESTR/fusin and blocks HIV-1 entry. Nature 382, 829–833.
Deichmann, M., Kronenwett, R., and Haas, R. (1997). Expression of the human immuno-
deficiency virus type-1 coreceptors CXCR-4 (fusin, LESTR) and CKR-5 in CD34þ
hematopoietic progenitor cells. Blood 89, 3522–3528.
Expression of CXCR4 411

Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., DiMarzio, P.,
Marmon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., et al. (1996).
Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661–666.
Doitsidou, M., Reichman-Fried, M., Stebler, J., Koprunner, M., Dorries, J., Meyer, D.,
Esguerra, C. V., Leung, T., and Raz, E. (2002). Guidance of primordial germ cell
migration by the chemokine SDF-1. Cell 111, 647–659.
Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y., Nagashima, K. A.,
Cayanan, C., Maddon, P. J., Koup, R. A., Moore, J. P., and Paxton, W. A. (1996).
HIV-1 entry into CD4þ cells is mediated by the chemokine receptor CC-CKR-5.
Nature 381, 667–673.
Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A. (1996). HIV-1 entry cofactor:
Functional cDNA cloning of a seven-transmembrane, G. protein-coupled receptor.
Science 272, 872–877.
Fredriksson, R., and Schioth, H. B. (2005). The repertoire of G-protein-coupled receptors
in fully sequenced genomes. Mol. Pharmacol. 67, 1414–1425.
Hagen, D. C., McCaffrey, G., and Sprague, G. F., Jr., (1991). Pheromone response elements
are necessary and sufficient for basal and pheromone-induced transcription of the FUS1
gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 2952–2961.
Hopkins, A. L., and Groom, C. R. (2002). The druggable genome. Nat. Rev. Drug Discov. 1,
727–730.
Jund, R., and Lacroute, F. (1970). Genetic and physiological aspects of resistance to
5-fluoropyrimidines in Saccharomyces cerevisiae. J. Bacteriol. 102, 607–615.
Kang, Y., Siegel, P. M., Shu, W., Drobnjak, M., Kakonen, S. M., Cordon-Cardo, C.,
Guise, T. A., and Massague, J. (2003). A multigenic program mediating breast cancer
metastasis to bone. Cancer Cell 3, 537–549.
Möhle, R., Bautz, F., Rafii, S., Moore, M. A., Brugger, W., and Kanz, L. (1998). The
chemokine receptor CXCR-4 is expressed on CD34þ hematopoietic progenitors and
leukemic cells and mediates transendothelial migration induced by stromal cell-derived
factor-1. Blood 91, 4523–4530.
Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T.,
Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., Mohar, A., et al. (2001). Involve-
ment of chemokine receptors in breast cancer metastasis. Nature 410, 50–56.
Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsuchima, K.,
Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000). International union of
pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52,
145–176.
Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y.,
Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis
and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1.
Nature 382, 635–638.
Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F.,
Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M.,
et al. (1996). The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents
infection by T-cell-line-adapted HIV-1. Nature 382, 833–835.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and
Miyano, M. (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science
289, 739–745.
Roesnbaum, D. M., Cherezov, V., Hanson, M. A., Rasmussen, S. G., Thian, F. S.,
Kobilka, T. S., Choi, H. J., Yao, X. J., Weis, W. I., Stevens, R. C., and
Kobilka, B. K. (2007). GPCR engineering yields high-resolution structural insights
into beta2-adrenergic receptor function. Science 318, 1266–1273.
412 Barry J. Evans et al.

Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y.,
Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998).
The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal
tract. Nature 393, 591–594.
Xue, C., Hseuh, Y. P., and Heitman, J. (2008). Magnificent seven: Roles of G protein-
coupled receptors in extracellular sensing in fungi. FEMS Microbiol. Rev. 32, 1010–1032.
Zhang, W. B., Navenot, J. M., Haribabu, B., Tamamura, H., Hiramatu, K., Omagari, A.,
Pei, G., Manfredi, J. P., Fjuii, N., Broach, J. R., and Peiper, S. C. (2002). A point
mutation that confers constitutive activity to CXCR4 reveals that T140 is an inverse
agonist and that AMD3100 and ALX40-4C are weak partial agonists. J. Biol. Chem. 277,
24515–24521.
Zhang, W. B., Wang, Z. X., Murray, J. L., Fujii, N., Broach, J., and Peiper, S. C. (2004).
Functional expression of CXCR4 in S. cerevisiae: Development of tools for mechanistic
and pharmacologic studies. Ernst Schering Res. Found. Workshop 45, 125–152.
Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998).
Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar
development. Nature 393, 595–599.
C H A P T E R T W E N T Y- O N E

Ubiquitination of
Chemokine Receptors
Adriano Marchese

Contents
1. Introduction 414
2. Cell Culture and Transfections 416
3. Agonist Treatment and Ubiquitination Assay 417
4. E3 Ubiquitin Ligase AIP4 Mediates Ubiquitination of CXCR4 419
References 421

Abstract
Ubiquitin modification of proteins has traditionally been linked to proteasomal
degradation, but it is now well established that it also serves nonproteasomal
functions, such as DNA repair, signal transduction and endocytic trafficking
among others. It is now emerging that G-protein–coupled receptor (GPCR)
downregulation is mediated by receptor ubiquitination. For example, agonist-
dependent ubiquitination of the chemokine receptor CXCR4 by the E3 ubiquitin
ligase AIP4 (atrophin interacting protein 4) targets CXCR4 for degradation in
lysosomes. The ubiquitin moiety on CXCR4 serves as a signal on endosomes for
entry into the degradative pathway and long-term attenuation of signaling or
downregulation. Several GPCRs have been shown to be ubiquitinated, and
ubiquitin-dependent trafficking may represent a general mechanism by which
GPCRs are targeted to lysosomes, although some GPCRs that are targeted to
lysosomes may not be directly regulated by ubiquitination. Here we describe a
simple biochemical assay that we have used to study the ubiquitination of
CXCR4 that can be easily applied to study the ubiquitination of any GPCR.

Department of Pharmacology, Stritch School of Medicine, Loyola University Chicago, Maywood,


Illinois, USA

Methods in Enzymology, Volume 460 # 2009 Elsevier Inc.


ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05221-5 All rights reserved.

413
414 Adriano Marchese

1. Introduction
Chemokine receptors belong to the large superfamily of G-protein–
coupled receptors (GPCRs) that are coupled to heterotrimeric G proteins,
especially the Gai subfamily, through which a wide variety of intracellular
signaling pathways are activated (Busillo and Benovic, 2007). In order to
ensure that signals are of the appropriate magnitude and duration signaling is
rapidly terminated by a complex series of events giving rise to the phenom-
enon known as desensitization. Desensitization is a process whereby signal-
ing is attenuated even in the continuous presence of stimulus. Multiple
mechanisms contribute to GPCR desensitization, including, in part, the
removal of the receptor from the cell surface through a process involving
internalization, which sequesters the receptor from its stimulus (Moore
et al., 2006; Pierce et al., 2002). The mechanisms involving GPCR inter-
nalization are not completely understood but generally involve receptor
phosphorylation by G protein–coupled receptor kinases (GRKs) resulting
in arrestin binding and recruitment for internalization through clathrin-
coated pits (Drake et al., 2006; Moore et al., 2006). As is true for many
GPCRs, chemokine receptors readily undergo ligand-dependent internali-
zation into a vesicular compartment known as an early endosome. Once on
early endosomes, GPCRs are subject to an endocytic sorting event that
targets them into either a recycling pathway and/or a degradative pathway
(Hanyaloglu and von Zastrow, 2008; Marchese et al., 2008). Receptors that
enter the recycling pathway are returned to the cell surface, giving rise to
receptor resensitization where they are able to respond to further stimula-
tion. Receptors that enter the degradative pathway are targeted to lyso-
somes for proteolysis, giving rise to long-term attenuation of signaling or
downregulation. The mechanisms mediating endosomal sorting remain
poorly understood, although for some receptors it appears that sorting
into the degradative pathway is mediated by receptor ubiquitination
(Hanyaloglu and von Zastrow, 2008; Marchese et al., 2008).
We have shown that the CXCR4 chemokine receptor undergoes
ligand-dependent post-translational modification by ubiquitin (Marchese
and Benovic, 2001). Ubiquitin is a 76–amino-acid protein and is attached to
proteins through an ATP-dependent enzymatic process involving three
sequential enzymatic steps (Hershko and Ciechanover, 1998; Kerscher
et al., 2006; Pickart, 2001). The first step is carried out by an E1 enzyme,
or activating enzyme, that activates ubiquitin through hydrolysis of ATP
leading to the formation of a ubiquitin-adenylate intermediate before ubi-
quitin is transferred to the active-site cysteine residue of the E1 to form
a thiol ester intermediate with the C-terminal glycine residue of ubiquitin.
In the second step, ubiquitin is subsequently transferred to the active site
CXCR4 Ubiquitination 415

cysteine residue of an E2 enzyme, or ubiquitin conjugating enzyme. The


third and final step in the process is carried out by the action of an E3
enzyme or ubiquitin ligase. E3 ubiquitin ligases can be broadly classified as
falling within two subfamilies, HECT domain and RING finger; they differ
in the manner in which ubiquitin is transferred to acceptor lysine residues
on the target protein (Hershko and Ciechanover, 1998; Kerscher et al.,
2006; Pickart, 2001). HECT domain E3s have an active site cysteine residue
that forms a direct thiol ester intermediate with ubiquitin before transfer of
the ubiquitin moiety to the e amine group of lysine residues on the target
protein. In contrast, RING finger E3s do not form a direct thiol ester
intermediate with ubiquitin, but rather, they act as a bridge by bringing
the E2 into close proximity to the bound substrate such that transfer of
ubiquitin directly from the E2 to the acceptor site lysine residue on the
substrate protein can occur. Despite these differences both types of E3s play
a significant role in substrate recognition thus providing the substrate
specificity associated with ubiquitination reactions. Ubiquitin forms a cova-
lent isopeptide bond with the substrate protein via the carboxyl side group
of the terminal glycine residue on ubiquitin and the e amine group of a
lysine residue on the substrate. Ubiquitin attachment is reversible and is
subject to removal by deubiquitinating enzymes (Nijman et al., 2005).
Therefore, the ubiquitination status of a protein at any given time will be
dependent upon the relative ratio of ubiquitination/deubiquitination
reactions occurring in cells.
We have shown that the chemokine receptor CXCR4 is targeted to
lysosomes via a ubiquitin-dependent pathway (Marchese and Benovic,
2001). Agonist-promoted ubiquitination of CXCR4 on carboxyl-terminal
tail lysine residues by the E3 ubiquitin ligase AIP4 targets the receptor for
degradation in lysosomes (Marchese and Benovic, 2001; Marchese et al.,
2003b). The ubiquitin moiety on CXCR4 serves as an endosomal signal by
likely mediating interactions with core components of the endocytic sorting
machinery that contain ubiquitin-binding domains (Marchese et al., 2003b).
Although CXCR4 has been shown to be modified with ubiquitin and
targeted to lysosomes via a ubiquitin-dependent pathway, this may not
occur for all chemokine receptors (Meiser et al., 2008). However, whether
other chemokine receptors are regulated by ubiquitin in a similar manner to
CXCR4 remains to be determined.
One of the easiest methods used to determine whether a protein is
modified by ubiquitin is by SDS-PAGE and immunoblotting to detect
the protein of interest. Ubiquitin is a 76–amino-acid protein and when
conjugated to proteins will add 8 kDa to the size of the protein. There-
fore, if a protein is ubiquitinated, distinct bands that migrate slower than the
unmodified protein by a factor of 8 kDa will indicate the incorporation of
one ubiquitin molecule (mono-ubiquitin), 16 kDa for two (di-ubiquitin)
and so on. The presence of a smear would suggest that the protein is
416 Adriano Marchese

polyubiquitinated. The unfortunate caveat with this method with respect to


GPCRs is the lack of adequate GPCR antibodies to detect the low density
of endogenous receptors in many cell types and tissues. Also, the presence of
slower migrating bands/smears would still make it difficult to distinguish
ubiquitin modification from other types of similar post-translational mod-
ifications. Another more commonly used approach relies on the enrichment
of the receptor from cells usually by immunoprecipitation followed by
SDS-PAGE and immunoblotting with antiubiquitin antibodies to detect
incorporated ubiquitin. This approach has been used successfully to detect
ubiquitination of CXCR4 (Marchese and Benovic, 2001, 2004; Marchese
et al., 2003b) as well as other GPCRs (Shenoy et al., 2008), although there
are caveats associated with this method. One caveat that would apply to
CXCR4 (and most GPCRs and/or other proteins) is that because of the
low percentage of the total cellular complement of CXCR4 that is ubiqui-
tinated at any given time, we have found it difficult to detect incorporation
of endogenous ubiquitin into CXCR4 by using antiubiquitin antibodies.
To obviate this difficulty we have resorted to expressing a tagged version of
ubiquitin in order to facilitate the ability to detect ubiquitination of
CXCR4 (Marchese and Benovic, 2001, 2004; Marchese et al., 2003b).
Here we describe a method that we have developed to detect ubiquitination
of CXCR4 that can also be readily applied to other chemokine receptors or
other members of the GPCR family.

2. Cell Culture and Transfections


We use HEK293 (Microbix, Toronto, ON, Canada) and HeLa
(ATCC) cells as our model cells to study CXCR4 ubiquitination and
trafficking; both cell types express endogenous levels of CXCR4, although
we typically use HEK293 cells for heterologous expression studies. We have
shown that endogenous CXCR4 is rapidly targeted to lysosomes for prote-
olysis in CEM cells, a T-cell line; therefore, it appears that endocytic
trafficking pathways are conserved among various cell types (Marchese
and Benovic, 2001). For ubiquitination assays, we use HEK293 cells and
transiently transfect cells with HA-tagged CXCR4 and FLAG-tagged
ubiquitin. As discussed above, in our hands it has been difficult to observe
ubiquitination of CXCR4 by immunoblotting for endogenous ubiquitin,
although others have been successful (Li et al., 2004; Zaitseva et al., 2005).
We typically grow HEK293 cells on 10-cm tissue culture–grade Petri
dishes. HEK293 cells are seeded from a confluent 10-cm dish at a dilution of
1:3 onto a 10-cm dish containing 10 ml culture medium (DMEM supple-
mented with 10% fetal bovine serum). We find that with this dilution,
the next-day cells are approximately 60 to 70% confluent, which is ideal
CXCR4 Ubiquitination 417

for transfection. On the day of transfection, the medium is replaced with


10 ml of fresh culture medium. We typically use FuGENE6 transfection
reagent (Roche), following the manufacturer’s instructions. We cotransfect
a total of 10 mg of DNA per 10-cm dish using 30 ml of FuGENE6. For
ubiquitination assays, we typically use 7 mg HA-tagged CXCR4 plus 3 mg
FLAG-tagged ubiquitin. We have successfully used FLAG-tagged ubiquitin
to detect ubiquitinated CXCR4 (Bhandari et al., 2007; Marchese and
Benovic, 2001; Marchese et al., 2003b). As controls, parallel plates are
transfected with DNA encoding either receptor or ubiquitin alone. The
following day, cells from each transfection should be 100% confluent.
Transfected cells are seeded onto two 6-cm dishes and allowed to grow for
an additional day (18 to 24 h). The next day (i.e., day of the experiment),
the cells should be approximately 90% confluent (500,000 cells). Two
plates from each transfection condition are plated to allow for treatment
with vehicle and agonist. By following this transfection procedure it will
permit multiple treatment conditions using cells derived from the same
transfection, which will reduce variability owing to differences in expres-
sion levels among transfections from plate to plate. The agonist for CXCR4
is stromal-cell–derived factor 1a (SDF-1a), also known as CXCL12,
purchased from PeproTech (Rocky Hill, NJ). Single-use aliquots of
SDF-1a (10 mM) resuspended in PBS containing 0.1% BSA are stored
frozen at –20  C for up to 3 months.

3. Agonist Treatment and Ubiquitination Assay


On the day of the experiment, cells are washed 1 with 2 ml warm
DMEM and incubated with fresh 1.5 ml DMEM supplemented with
20 mM HEPES for 3 h. The media is replaced with the same media
containing either vehicle (0.1% BSA in PBS) or SDF-1a (100 nM; final
concentration) in a total volume of 1.5 ml. The cells are treated at 37  C for
30 min. We typically use SDF-1a at a maximal final concentration of
100 nM to ensure full receptor occupancy, enabling maximal receptor
ubiquitination to facilitate detection of ubiquitinated CXCR4. We typi-
cally treat cells for 30 min because we have determined that under these
conditions maximal levels of ubiquitinated CXCR4 are detected (Marchese
et al., 2003b). Optimal concentrations of ligand and length of treatments
will have to be empirically determined for different cell types and/or
specific chemokine receptors being examined.
After treatment, plates are immediately placed on ice, media is aspirated
and cells are scraped in 800 ml ice-cold lysis buffer (50 mM Tris-HCl, pH 8,
150 mM NaCl, 5 mM EDTA, 0.5% sodium deoxycholate [w/v], 1% non-
idet P-40 [NP40, v/v], 0.1% sodium dodecyl sulfate [SDS, w/v], 20 mM
418 Adriano Marchese

NEM and protease inhibitors [10 mg/ml each of pepstatin A, leupeptin,


aprotinin]). It is important to include NEM to the buffer in order to block
free sulfhydryl groups on catalytic-site cysteine residues of deubiquitinating
enzymes (DUBs). Active DUBs in cellular lysates may remove ubiquitin
attached to proteins, thus making it difficult to detect ubiquitinated pro-
teins. In addition, please note that the lysis buffer we use to immunoprecipi-
tate HA-tagged CXCR4 is somewhat stringent to reduce the likelihood of
co-immunoprecipitating proteins that may themselves be ubiquitinated,
which could confound data interpretation. We have found that these
conditions work best for immunoprecipitating HA-CXCR4 from lysates
prepared from HEK293 cells. If different epitope tags and/or different
receptors are used, optimization studies will have to be performed.
Transfer the lysates to fresh microcentrifuge tubes and place at 4  C
while gently rocking for approximately 30 min to ensure complete lysis,
followed by sonication on ice for 10 s at setting 10% (Branson Digital
Sonifier 450). Samples are clarified by centrifugation at 21,000g for
20 min at 4  C. Save an aliquot of the cleared lysate in an equal volume
of 2 sample buffer (0.0375 M Tris-HCl, pH 6.5, 8% SDS, 10% glycerol,
5% b-mercaptoethanol, 0.003% bromophenol blue) for Western blotting to
assess the expression of the various constructs. To immunoprecipitate the
receptor, incubate 600 ml of the cleared lysate for 1 h with a polyclonal
antibody against the HA epitope (HA.11, 1:300 dilution; Covance, Emery-
ville, CA). Add 20 ml of a 1:1 ratio of protein A equilibrated in lysis buffer
and incubate for an additional 1 h at 4  C while rocking. Briefly wash
samples twice with 750 ml lysis buffer. Elute bound proteins with 20 ml
2 sample buffer at room temperature (RT) for 30 min. Because most
GPCRs will aggregate when boiled and will not properly separate even
under denaturing conditions, it is important not to boil samples that contain
GPCRs. We typically use a Hamilton syringe equipped with a 24-gauge
needle to load samples on 7% SDS-PAGE, followed by electrophoretic
transfer onto nitrocellulose membranes according to the manufacturer’s
recommendations (Bio-Rad, Hercules, CA). We typically separate proteins
using 7% polyacrylamide gels to ensure robust separation and transfer of
high-molecular-weight ubiquitinated proteins.
The membrane is blocked for 30 min in 10 ml Tris-buffered saline
(TBS) (50 mM Tris-HCl, pH 7.4, 150 mM NaCl) with 0.05% Tween 20
(v/v) (TBST) containing 5% non-fat dried milk (w/v) at RT while rocking.
To detect incorporation of tagged ubiquitin into the receptor the mem-
brane is probed with anti-FLAG M2 monoclonal antibody (5 mg/ml;
Sigma) for at least 1 h at RT or overnight at 4  C while rocking. Wash
the membrane at least 3 for 5 min at RT. Incubate the nitrocellulose
membrane with 10 ml TBST-5% milk containing goat antimouse IgG
conjugated to horseradish peroxidase (HRP) at a dilution of 1:10, 000.
Wash the nitrocellulose membrane 5 for 10 min each in TBST.
CXCR4 Ubiquitination 419

Overlay the nitrocellulose with 1 to 2 ml of Supersignal Chemilumines-


cence reagent (Pierce, Rockford, IL) for 5 min, allow the blot to dry,
wrap in plastic wrap, and visualize on x-ray film. Nitrocellulose membranes
can be treated with stripping buffer (62.5 mM Tris-HCl, pH 6.7, 100 mM
b-mercaptoethanol, 2% SDS) to remove bound antibody and reprobed
with a monoclonal anti-HA antibody (HA.11, Covance, Emeryville, CA)
to detect receptor levels and to assess loading.

4. E3 Ubiquitin Ligase AIP4 Mediates


Ubiquitination of CXCR4
As discussed above, the E3 ubiquitin ligase is one of the most impor-
tant enzymes involved in the conjugation of ubiquitin to an acceptor lysine
residue on the target protein as it provides the specificity associated with
ubiquitin reactions while it mediates binding to the target protein. To
further understand how CXCR4 is regulated by ubiquitin, we determined
that AIP4 (atrophin interacting protein 4), a HECT-domain E3 ubiquitin
ligase mediates ubiquitination of CXCR4 (Marchese et al., 2003b). To
identify AIP4 as an E3 ubiquitin ligase for CXCR4, we took a candidate
protein approach. There are 600 sequences in the human genome that
potentially encode E3 ubiquitin ligases (Li et al., 2008), presenting a daunt-
ing to task to identify the E3 that mediates ubiquitination of any protein
let alone CXCR4. Information about the possible ligase that may regulate
CXCR4 came from studies performed in S. cerevisiae, the budding yeast, in
which Rsp5 was found to mediate ubiquitination and internalization of the
a-mating factor receptor, a GPCR (Dunn and Hicke, 2001). The human
genome encodes nine orthologous E3s to yeast Rsp5, which are part of the
Nedd4-like family of E3 ubiquitin ligases (Ingham et al., 2004). Members of
this family are characterized by the presence of a calcium-dependent
phospholipid-binding domain, three to four tandemly linked WW domains,
and a HECT domain (Ingham et al., 2004). In general, the WW domains
either directly or indirectly interact with their target proteins typically via
PY motifs (i.e., PPXY, PPPY) (Ingham et al., 2005). As mentioned above,
HECT domain E3s have a catalytic cysteine residue that forms a direct thiol
ester intermediate with the terminal glycine residue of ubiquitin before
transfer to an acceptor lysine residue on the target protein (Huibregtse et al.,
1995). Changing the catalytic cysteine residue to a serine or alanine residue
creates a catalytically inactive mutant that behaves as a dominant-negative
when overexpressed in cells by inhibiting binding of the endogenous E3 to
its target and thus inhibiting its activity. Initially, we took a dominant-
negative approach to determine whether CXCR4 ubiquitination was regu-
lated by E3s belonging to this family. Members of this family that we have
420 Adriano Marchese

examined include AIP4, Nedd4, and Nedd4-2 (Marchese et al., 2003b).


HEK293 cells grown on 10-cm dishes are cotransfected as described above
with HA-tagged CXCR4 (1 mg) and either wildtype or mutant versions of
Nedd4, AIP4, or Nedd4-2 (1 mg) plus FLAG-ubiquitin (1 mg). Cells are
treated with vehicle or SDF-1a and ubiquitination of CXCR4 is assessed as
described above. Under these conditions, we have observed that cotransfec-
tion with AIP4-C830A, a catalytically inactive mutant of AIP4, attenuates
agonist-promoted ubiquitination of CXCR4 and that either wildtype or
catalytically inactive forms of Nedd4 and Nedd4-2 had no noticeable effect
on CXCR4 ubiquitination (Marchese et al., 2003b). The amount of DNA
to transfect for each construct will have to be empirically determined and
titrated accordingly to avoid off-target effects.
Once a candidate E3 is identified by taking the dominant-negative
approach, the next step will be to further confirm a specific role for the
E3 in the ubiquitination of the receptor of interest by taking a genetic
approach (Marchese et al., 2003b). We have employed siRNA to reduce
endogenous levels of AIP4 in HEK293 and HeLa cells (Marchese et al.,
2003b). We have used a custom-designed siRNA sequence targeting
AIP4 (GenBank Accession No. AF095745): GGU GAC AAA GAG
CCA ACA GAG, and corresponds to nucleotides 190 to 211 relative to
the start codon. The AIP4 siRNA was synthesized by Dharmacon Research
(Lafayette, CO) and is supplied as 23-nucleotide duplexes with
2-nucleotide 30 (2-deoxy) thymidine overhangs. Control siRNA can be
against an irrelevant protein such as luciferase. HEK293 cells are cotrans-
fected with HA-CXCR4 plus FLAG-ubiquitin together either with
vehicle, control siRNA, or AIP4-specific siRNA.
Cells are seeded onto 10-cm dishes the day before transfection (about
15 h) such that the confluency at the time of transfection is at least 80%,
which appears to have less-toxic effects on the cells when the transfection
reagent is applied. Although there are many reagents available for siRNA
transfection, we have had great success using Lipofectamine 2000 (Invitro-
gen, Carlsbad, CA). Add 30 ml of Lipofectamine 2000 to 1.5 ml OPTI-
MEM (Invitrogen, Carlsbad, CA) and incubate at RT for 5 min. In another
tube, add 1.5 ml OPTI-MEM, DNA encoding receptor (1 mg), tagged
ubiquitin (1 mg), and the siRNA equaling 600 pmol. Add the DNA/
siRNA/OPTI-MEM mixture dropwise to the tube containing the
OPTI-MEM plus Lipofectamine 2000 and incubate at RT for 20 min.
Add the mixture drop wise to cells grown on a 10-cm Petri dish containing
3.5 ml culture medium and place at 37  C for 24 h. The final concentration
of the siRNA will be 100 nM. After 24 h, passage the cells onto 6-cm dishes
and perform the ubiquitination experiments the next day as described above.
Also, pass cells into a parallel plate to test for expression of AIP4. The custom
AIP4 siRNA significantly (>90%) reduces AIP4 expression compared to
vehicle- or control siRNA–treated cells (Marchese et al., 2003b).
CXCR4 Ubiquitination 421

Commercially available siRNA and shRNA targeting AIP4 and other E3


ubiquitin ligases are available from several companies. Recently, Nedd4 has
been shown to mediate ubiquitination of the b2-adrenergic receptor
(Shenoy et al., 2008), suggesting that members of the Nedd4-like E3 ubi-
quitin ligases may play a broad role in regulating ubiquitination of GPCRs.

REFERENCES
Bhandari, D., Trejo, J., Benovic, J. L., and Marchese, A. (2007). Arrestin-2 Interacts with
the Ubiquitin-Protein Isopeptide Ligase Atrophin-interacting Protein 4 and Mediates
Endosomal Sorting of the Chemokine Receptor CXCR4. J. Biol. Chem. 282,
36971–36979.
Busillo, J. M., and Benovic, J. L. (2007). Regulation of CXCR4 signaling. Biochim. Biophys.
Acta. 1768, 952–963.
Drake, M. T., Shenoy, S. K., and Lefkowitz, R. J. (2006). Trafficking of G. protein-coupled
receptors. Circ Res. 99, 570–582.
Dunn, R., and Hicke, L. (2001). Multiple roles for Rsp5p-dependent ubiquitination at the
internalization step of endocytosis. J. Biol. Chem. 276, 25974–25981.
Hanyaloglu, A. C., and von Zastrow, M. (2008). Regulation of GPCRs by endocytic
membrane trafficking and its potential implications. Annu. Rev. Pharmacol. Toxicol. 48,
537–568.
Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu. Rev. Biochem. 67,
425–479.
Huibregtse, J. M., Scheffner, M., Beaudenon, S., and Howley, P. M. (1995). A family of
proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proc.
Natl. Acad. Sci. USA 92, 2563–2567.
Ingham, R. J., Colwill, K., Howard, C., Dettwiler, S., Lim, C. S., Yu, J., Hersi, K.,
Raaijmakers, J., Gish, G., Mbamalu, G., Taylor, L., Yeung, B., et al. (2005).
WW domains provide a platform for the assembly of multiprotein networks. Mol. Cell.
Biol. 25, 7092–7106.
Ingham, R. J., Gish, G., and Pawson, T. (2004). The Nedd4 family of E3 ubiquitin ligases:
Functional diversity within a common modular architecture. Oncogene 23, 1972–1984.
Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006). Modification of proteins by
ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell. Dev. Biol. 22, 159–180.
Li, W., Bengtson, M. H., Ulbrich, A., Matsuda, A., Reddy, V. A., Orth, A., Chanda, S. K.,
Batalov, S., and Joazeiro, C. A. (2008). Genome-wide and functional annotation of
human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates the
organelle’s dynamics and signaling. PLoS ONE 3, e1487.
Li, Y. M., Pan, Y., Wei, Y., Cheng, X., Zhou, B. P., Tan, M., Zhou, X., Xia, W.,
Hortobagyi, G. N., Yu, D., and Hung, M. C. (2004). Upregulation of CXCR4 is
essential for HER2-mediated tumor metastasis. Cancer Cell. 6, 459–469.
Marchese, A., and Benovic, J. L. (2001). Agonist-promoted ubiquitination of the
G. protein-coupled receptor CXCR4 mediates lysosomal sorting. J. Biol. Chem. 276,
45509–45512.
Marchese, A., and Benovic, J. L. (2004). Ubiquitination of G. protein-coupled receptors.
Methods Mol. Biol. 259, 299–306.
Marchese, A., Paing, M. M., Temple, B. R., and Trejo, J. (2008). G. Protein-Coupled
Receptor Sorting to Endosomes and Lysosomes. Annu. Rev. Pharmacol. Toxicol. 48,
601–629.
422 Adriano Marchese

Marchese, A., Raiborg, C., Santini, F., Keen, J. H., Stenmark, H., and Benovic, J. L. (2003).
The E3 ubiquitin ligase AIP4 mediates ubiquitination and sorting of the G. protein-
coupled receptor CXCR4. Dev. Cell. 5, 709–722.
Meiser, A., Mueller, A., Wise, E. L., McDonagh, E. M., Petit, S. J., Saran, N., Clark, P. C.,
Williams, T. J., and Pease, J. E. (2008). The chemokine receptor CXCR3 is degraded
following internalization and is replenished at the cell surface by de novo synthesis of
receptor. J. Immunol. 180, 6713–6724.
Moore, C. A., Milano, S. K., and Benovic, J. L. (2006). Regulation of Receptor Trafficking
by GRKs and Arrestins. Annu. Rev. Physiol. 69, 451–482.
Nijman, S. M., Luna-Vargas, M. P., Velds, A., Brummelkamp, T. R., Dirac, A. M.,
Sixma, T. K., and Bernards, R. (2005). A genomic and functional inventory of
deubiquitinating enzymes. Cell 123, 773–786.
Pickart, C. M. (2001). Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70, 503–533.
Pierce, K. L., Premont, R. T., and Lefkowitz, R. J. (2002). Seven-transmembrane receptors.
Nat. Rev. Mol. Cell. Biol. 3, 639–650.
Shenoy, S. K., Xiao, K., Venkataramanan, V., Snyder, P. M., Freedman, N. J., and
Weissman, A. M. (2008). Nedd4 Mediates Agonist-dependent Ubiquitination, Lyso-
somal Targeting, and Degradation of the {beta}2-Adrenergic Receptor. J. Biol. Chem.
283, 22166–22176.
Zaitseva, M., Romantseva, T., Manischewitz, J., Wang, J., Goucher, D., and Golding, H.
(2005). Increased CXCR4-dependent HIV-1 fusion in activated T cells: Role of CD4/
CXCR4 association. J. Leukoc Biol. 78, 1306–1317.
Author Index

A Ambinder, R. F., 134


Amiel, A., 59
Abboud, C. N., 68 Anastassov, V., 29
Abdel-Rahman, E., 290 Anderson, G. A., 342
Abe, S., 290 Anderson, J., 66
Able, S., 17 Anderson, R. G., 358
Abraham, M., 61, 62 Andreoni, M., 127
Abrescia, N. G., 174 Anselmo, A., 236, 240, 241
Abrol, R., 270 Ansorge, R., 165
Acott, P. D., 304 Anthonsen, M. W., 307
Adams, G. B., 58, 59 Antonenko, S., 70
Adkins, D., 65 Appelbaum, F., 65
Adler, B., 166 ap Rhys, C. M., 134
Adorini, L., 200 Aramaki, Y., 367
Aebersold, R., 338 Archibald, S. J., 59, 69, 72
Agostinis, C., 232, 233 Arenzana-Seisdedos, F., 10, 59, 60, 63,
Ahearn, M., 317 153, 159, 185, 188, 317, 401
Ahuja, M., 361 Armand-Ugon, M., 359
Ahuja, S. K., 19, 33 Armes, J. E., 371, 375
Akanuma, Y., 290 Armour, D., 19, 20, 22, 24, 26, 29, 30, 33, 40
Akbar, N., 266 Arnold, K., 212
Alarcon, B., 386 Aronica, E., 92
Albar, J. P., 333, 338, 341 Arvanitakis, L., 127, 128, 130, 134, 135, 137, 153
Albuqerque, C. P., 340 Asaka, M., 59
Alcami, A., 173, 174, 175, 176, 178, 179, Asch, A. S., 127, 128, 130, 137, 153
180, 181, 183, 184, 185, 187, 188, Asgari, Z., 128
194, 195, 198, 203, 204, 213, 236 Ashton, M., 270
Alcendor, D. J., 134 Assimacopoulos, S., 92
Aldape, K. D., 92 Astle, C. M., 74, 76
Alejo, A., 174, 184 Atkinson, M. A., 201
Alexander, J. M., 194 Audet, J., 78
Alexander, W. S., 64 Auffray, C., 118
Alexander-Brett, J. M., 174, 184, 200, 204 Aul, C., 67
Ali, H., 60 Aulakh, G., 317
Alizon, M., 361 Ausema, A., 61, 66
Aljada, A., 290 Avdi, N. J., 159
Allavena, P., 4, 105, 106, 107, 117 Avisar, N., 267
Allaway, G. P., 401 Avivi, L., 59
Allen, C., 65 Axel, R., 130
Allen, S. J., 211, 291, 305, 333 Ayinde, D., 361
Allendorf, D. J., 60, 63
Alon, R., 59, 60, 194 B
Alsina, M., 66
Alt, F. W., 49 Baba, M., 367
Altenbach, C., 265, 272 Bachelerie, F., 60, 63, 317, 401
Altmann, D. M., 200 Badr, C., 353
Altschuler, Y., 153, 165 Bafna, V., 335, 340, 341, 342, 343
Alvarez, R., 66 Baggiolini, M., 60, 358, 400, 401
Amara, A., 60, 401 Bahar, I., 273

423
424 Author Index

Bahar, M. W., 174 Bell, G. W., 10


Bai, W., 198 Bellahcene, A., 118
Bailey, C., 107, 117 Belmadani, A., 92
Bailey, P., 291 Belperio, J. A., 4, 118
Baiocchi, R. A., 69 Ben-Baruch, A., 3, 4
Bais, C., 127, 128, 130, 137, 140, 141, 153 Benboubker, L., 59
Bakalarski, C. E., 342 Bendall, L. J., 58, 60
Baker, J. G., 264 Benedetti, L., 118
Bakker, R. A., 153, 160, 162, 164 Bengtson, M. H., 419
Balabanian, K., 60, 63, 317 Ben-Hur, H., 59, 78
Baleux, F., 63, 185, 188, 317 Bennett, C. L., 59
Balgley, B. M., 342 Benovic, J. L., 60, 63, 69, 360, 414, 415, 416, 417,
Balkwill, F., 106, 107 419, 420
Ball, E. D., 60, 62 Bensinger, W., 58, 59, 65, 67, 68
Ballesteros, J., 269 Berahovich, R., 60
Bandura, L., 60, 63 Berg, A. L., 92
Banerji, S., 240 Berg, E., 361
Bannert, N., 51 Berger, A., 107, 117
Bansal, A. K., 118 Berger, E. A., 60, 401
Bansal, M., 118 Berkhout, B., 386
Barac, A., 128, 137, 138, 143 Bernard, P., 267, 270
Barbanera, M., 127 Bernards, R., 415
Barber, C., 46 Bernhagen, J., 60
Bardos, P., 59 Bernhardt, G., 70, 72
Barge, A., 66 Berridge, M. J., 136
Bar-Haim, S., 267 Bertagnolli, M. M., 107
Barkai, G., 78 Bertelli, F., 39
Barlet, X., 118 Berthebaud, M., 69
Barlogie, B., 65 Bessia, C., 60, 401
Barnes, G. T., 290, 291 Beuken, E., 165
Baroudy, B. M., 21, 33, 45, 46 Beyermann, M., 338
Barrell, B. G., 165 Beylot, M., 307
Barrera, J. L., 401 Bhandari, D., 417
Barrett, J., 174, 175, 176, 184, 188, 194 Bharara, S., 152
Barrett, J. W., 174 Bhatia, J., 226
Barry, M., 174, 175, 176 Bhatia, M., 77
Bartee, M. Y., 209 Bhattacharya, S., 273, 274
Barton, D. S., 198 Bian, H., 60, 62, 65, 74, 76
Barzik, M., 210, 317, 318, 319 Bianchi, P., 105
Baskaran, H., 327 Biben, C., 60
Bass, G., 65 Biber, K., 92
Batalov, S., 419 Bidgol, A., 198
Batard, P., 388, 390 Bielecki, B., 92
Batten, M., 60 Billstrom, M. A., 159, 160
Battista, M., 63 Binet, C., 59
Bauser, U., 67 Birch, R., 65
Bautz, F., 333, 401 Bissantz, C., 267, 270
Beaudenon, S., 419 Biyder, K., 61, 62
Becker, O. M., 267, 269 Blackburn, P. E., 237, 240, 247, 249,
Beckett, P., 226 250, 256, 257, 258, 259
Becknell, B., 69 Blagoev, B., 342
Beck-Wirth, G., 66 Blair, E., 237, 240, 245
Bedard, E. L., 213 Blanchetot, C., 381
Begent, R. H., 226 Blanco, J., 359
Begin, M., 61, 62 Bland, K. I., 152
Begley, C. G., 67 Blanpain, C., 17, 291, 361
Behnke, C. A., 44, 264, 400 Blaser, H., 60
Beisser, P. S., 153, 160, 165 Blechschmidt, M., 66
Author Index 425

Bleul, C. C., 60, 400 Brekken, R. A., 118


Blom, B., 69, 70 Brelot, A., 361
Blomenrohr, M., 168 Brenner, S., 63
Bloxham, D., 65 Bresnahan, W., 175, 176, 184
Bockhold, K., 77 Brett, T. J., 194
Bodaghi, B., 153, 159 Brezillon, S., 291
Boddeke, H. W., 92 Bridger, G., 60, 61, 63, 64, 67, 68,
Bodenmiller, B., 338 69, 76, 80
Boeve, S., 67 Bridger, G. J., 63, 67
Bogerd, J., 168 Bringhurst, F. R., 59
Bohinjec, J., 63, 317 Britt, W. J., 152
Boldajipour, B., 60 Broach, J. R., 399, 402, 408
Bolton, K., 292 Broadbent, J., 183
Bondar, A. N., 264 Broder, C. C., 60, 401
Bonde, J., 80 Bromberg, J. S., 200, 201, 204
Bondue, A., 17 Bronson, R. T., 60
Bonecchi, R., 231, 232, 233, 236, 237, Bronte, V., 117
238, 240, 241, 246 Brooks, H. D., 273
Boogaerts, M. A., 66 Brooks, M. W., 10
Boose, J. A., 294, 296 Brown, B. A., 183
Bordoli, L., 212 Brown, M. F., 273
Borge, O. J., 76 Brown, R. A., 65
Borghesani, P. R., 60 Browne, H., 154
Borlat, F., 194, 359, 362, 364 Browning, D. D., 143
Bornhauser, M., 60, 66 Browning, P. J., 128
Borroni, E. M., 231, 236, 240, 241 Broxmeyer, H. E., 61, 63, 64, 67, 73, 76
Borst, E. M., 165 Bruggeman, C. A., 153, 160, 165
Bosch, L., 156 Brugger, W., 401
Boschert, U., 92 Brummelkamp, T. R., 415
Bosworth, N., 180 Brune, W., 165, 166
Botham, A., 34 Brunetti, C. R., 174
Boulanger, V., 118 Bruneval, P., 107, 117
Bouma, G., 201 Bryant, N. A., 174, 178, 180
Bourne, H. R., 327 Bryant, S. H., 342
Bower, M., 127 Bryder, D., 76
Bowers, K., 154, 159 Buchanan, M. E., 401
Bowie, J. U., 269 Buet, D., 69
Boxberger, S., 60 Bugge, T. H., 128, 131, 132, 134, 135
Bozaoglu, K., 292 Bujard, H., 202
Bradfield, L., 380, 381, 382, 384, 385, Bulla, R., 232, 233
386, 388, 391, 392, 395 Buller, R. M., 175
Bradley, J., 39 Bunce, C., 213
Bradrick, T. D., 384 Buracchi, C., 231, 232, 233, 236, 238
Bradstock, K., 66 Burdick, M. D., 4, 118
Brady, M. S., 107 Burger, J. A., 59, 333, 334
Bramati, P. S., 380, 381, 382, 384, 385, Burger, M., 333, 334
386, 388, 391, 392, 395 Burgess, J., 66
Brandimarti, R., 92 Burghammer, M., 264
Brandish, P. E., 160 Burke, D. J., 338
Brann, M. R., 137 Burkhart, M., 401
Brass, L. F., 63, 359, 360 Burns, J. M., 60
Braun, R., 271 Burstein, E. S., 164
Brauner-Osborne, H., 135 Burt, C., 24, 36, 39
Bravo, R., 198 Burzenski, L. M., 78
Breakefield, X. O., 353 Busam, K. J., 107
Breitfeld, D., 70, 72 Buser, C., 166
Breitkopf, S. B., 332, 333, 342 Busillo, J. M., 60, 63, 69, 414
Breitmeyer, J., 386 Busmann, A., 291
426 Author Index

Buss, E. C., 60 Catron, D., 401


Buss, V., 264 Cavadini, P., 63, 317
Butcher, E. C., 290, 291, 302, 304, 305, 306 Cavallin, L. E., 128
Butler, J., 66 Cayanan, C., 401
Byk, T., 59, 78 Cebon, J., 67
Bylund, D. B., 157 Cerottini, J.-C., 388, 390
Bystrykh, L. V., 61, 66 Cesarman, E., 127, 128, 130, 134, 135,
Bywater, R. P., 273 137, 141, 153
Chaisuparat, R., 128
C Chaleff, S., 78
Chamberlain, A. K., 269
Caccamo, N., 235, 239 Chan, C., 383
Caceres, N., 235, 239 Chan, F. K.-M., 384
Cain, M., 183 Chanda, S. K., 419
Calandra, G., 60, 61, 63, 64, 67, 68, Chandraratna, R. A., 291
69, 76, 80 Chang, C. N., 361
Caligiuri, M. A., 69 Chang, Y., 127
Callahan, M. K., 92 Chappel, J., 60, 63
Callander, N., 66 Charlton, M. H., 270
Calvi, L. M., 59 Charo, I. F., 92, 232, 358, 400
Cameron, C., 174 Charurat, M., 128
Camp, D. G. II, 342 Chen, C. A., 162
Campanella, G. S., 185, 188 Chen, D., 269, 270
Campbell, D. G., 307 Chen, H., 290, 291
Campbell, I. L., 92 Chen, J., 74, 107
Campbell, J. D., 232, 239 Chen, M. C., 201
Campbell, T. B., 61, 63, 64, 67, 76 Chen, S., 92
Camps, M., 210, 211 Chen, S. C., 128, 153, 195, 196, 198, 203, 204
Camus, M., 107, 117 Chen, X., 78
Canasto-Chibuque, C., 198, 200, 201, Cheng, G., 239
204, 232 Cheng, T., 60, 61
Cannon, J. S., 134 Cheng, X., 416
Cannon, M., 141 Cheng, Y., 130, 158
Cannon, M. J., 127 Chensue, S. W., 128, 153, 196
Canutescu, A. A., 268 Cherezov, V., 264, 400
Capon, D. J., 40 Chernosky, A., 92
Cappetti, B., 118 Cheruku, S., 269
Carbonatto, M., 210, 212 Cheson, B., 65
Cardona, A. E., 92 Cheung, M. C., 127
Cardona, P. J., 235, 239 Chevillotte, M., 166
Cardona, S. M., 92 Chien, E. Y., 264
Cardozo, A. K., 201 Chien, H. F., 92
Cardwell, L., 63 Chien, P., 92
Carey, V. J., 10 Chihara, K., 292
Carion, A., 59 Childs, R., 80
Carlson, T., 91 Chiodoni, C., 118
Carmack, A. J., 119 Chiou, C. J., 134
Carmen, G. Y., 307 Chiozzini, C., 128
Carreno, P., 239 Chlenski, A., 118
Carter, S. L., 92 Choe, H., 60, 400
Caruso, D. J., 119 Choe, H. W., 264, 271
Caruz, A., 59 Choe, S., 361, 401
Casarosa, P., 153, 154, 155, 156, 160, 165 Choi, C. S., 200
Cashen, A. F., 59, 63, 68 Choi, E. J., 267, 269, 270, 272, 285
Cashman, J., 77, 78 Choi, H. J., 264, 400
Castilla, C., 59 Choi, K. C., 292
Castronovo, V., 118 Choi, U., 63
Cathcart, M. E., 92 Chou, C. C., 33, 195, 198, 204
Author Index 427

Chou, C. J., 290, 291 Cordon-Cardo, C., 401


Chow, K. Y., 60 Coronel, E. C., 198
Chow, K. Y. C., 317 Coso, O., 127, 128, 130, 137, 153
Christophe, T., 364, 367 Coso, O. A., 139
Christopher, M. J., 60, 63, 66 Costantino, N., 165
Christopoulos, A., 264, 271 Costes, A., 107, 117
Christopoulos, T. K., 353 Costes, B., 174
Chu, C. C., 239 Cottler-Fox, M., 65
Chung, C. Y., 327, 328 Couillault, C., 118
Ciaramella, G., 24, 39, 40, 43, 44, 46 Coukos, G., 107
Cichy, J., 291, 305 Coulombel, L., 73, 77
Ciechanover, A., 414, 415 Court, D. L., 165
Cihak, J., 359, 361, 362, 364 Coussens, L. M., 106, 107
Cinamon, G., 194 Cox, K., 33
Cinatl, J., Jr., 152 Crabtree, G. R., 136
Cioffi, M., 291 Craft, T. P., 80
Cirillo, R., 210, 212 Creech, S., 67
Ciruela, F., 380 Crnkovic, I., 165
Ciufo, D. M., 134 Crowe, E., 92
Clader, J. W., 21, 33, 45, 46 Crowley, J., 65
Clapham, P. R., 359, 361, 362, 364 Crown, S. E., 174, 211, 333
Clapp, D. W., 61, 63, 64, 67, 76 Crozier, P. S., 273
Clark, C. J., 118 Cruz, J., 66
Clark, J. H., 383 Crystal, R. G., 63
Clark, P. C., 415 Cui, M., 92
Clarke, W. P., 264, 271 Cullinan, C. A., 291
Clark-Lewis, I., 60, 174, 175, 176, 184, Culpepper, J., 127
187, 194, 400, 401 Cyster, J. G., 198
Clawson, G. A., 348
Clotet, B., 359 D
Cobbs, C. G., 152
Cobbs, C. S., 152 Dadke, D., 128, 137, 143
Cohen, P., 307, 332 Dagis, A., 67
Cohn, S. L., 118 Dai, E., 209, 213
Colangeli, V., 127 Dale, D. C., 63, 67
Coleman, M. K., 342 Dallas, W., 63, 359, 360
Collier, G., 292 Damodaran, A., 232
Collins, P. D., 174, 175, 176, 179, 181 Damotte, D., 107
Collins, S., 317 Dandona, P., 290
Colombat, P., 59 D’Andrea, F., 291
Colombo, M. P., 118 D’Andrea, M., 359
Colwill, K., 419 Dar, A., 58, 59
Colyer, C. L., 383 Darkes, M., 29
Combadiere, C., 19, 33 Darling, A. J., 294, 296
Comerford, I., 246, 251, 254, 255 Darzi, A., 107, 117
Communi, D., 291 Dash, A. B., 10
Conejo-Garcia, J. R., 107 da Silva, A. P., 118
Conlon, P. J., 178 Daub, H., 332, 333, 342
Conn, P. M., 159 Daugherty, B. L., 157, 361
Connell, L., 239 Davidson, M. W., 380
Constantini, F., 196 Davies, J. A., 290
Contreras, R., 226 Davis, C. B., 361, 401
Cook, D. N., 92, 213, 232, 233, 236, 238 Davis, J., 20, 38, 43, 48
Cooper, S., 61, 63, 64, 67, 73, 76 Davis-Poynter, N. J., 165, 178, 180
Copeland, N. G., 165 Davis-Turner, J., 361
Coppack, S. W., 291 Deconto, R. M., 117
Coppens, J. M., 201 de Esch, I. J., 156, 160, 162
Corbau, R., 24, 36, 39 Defea, K., 358
428 Author Index

Degerman, E., 307 Dirac, A. M., 415


de Graauw, M., 332 DiSepio, D., 291
De Groot, C. J., 92 Dittmer, D. P., 128, 134
de Haan, G., 61, 66, 73 Divieti, P., 59
Deichmann, M., 401 Dlubek, D., 61
de Kleine, R., 353 Dobbs, S., 19, 20, 22, 24, 26, 29, 30, 33,
de las Rivas, J., 59 35, 36, 39, 40
de la Torre, Y. M., 236 Doebber, T. W., 291
Delaunay, T., 10 Doedens, M., 78
del Canizo, M. C., 59 Doitsidou, M., 401
De Leener, A., 17 Dollard, S. C., 127
Delgado, M., 59 Dombrowski, S., 92
Delhaye, M., 361 Domenech, J., 59
Dell’Aquila, M., 333, 334 Domon, B., 338
de Lys, P., 92 Doms, R. W., 17, 291
DeMartino, J. A., 361 Doni, A., 232, 233, 236, 240, 241
de Mendonca, F. L., 270 Dontje, B., 61, 66
Demirer, T., 65 Doranz, B. J., 17, 361
Demuynck, H. M., 66 Dorf, M., 239
Deng, H., 401 Dorr, P., 17, 19, 20, 21, 22, 24, 26, 28,
den Hertog, J., 381 29, 30, 33, 34, 35, 36, 38, 39, 40,
De Paoli, P., 359 42, 43, 44, 46, 48
Dephoure, N. E., 342 Dorrestein, P. C., 331
DeRavin, S. S., 63 Dorries, J., 401
Dertinger, S. K., 327 Dorrucci, M., 127
Desbois, I., 59 Dower, S. K., 178
Detheux, M., 291 Drabczak-Skrzypek, D., 61
Dethmers-Ausema, B., 73 Dragic, T., 401
Dettwiler, S., 419 Dragowska, W., 73
Deupi, X., 264, 271, 272 Drake, M. T., 414
Deupree, J. D., 157 Dreger, P., 66
Devine, H., 68, 69, 80 Drexhage, H. A., 201
Devine, S. M., 68, 69, 80 Driver, S. E., 294
Devore, P., 66 Drobnjak, M., 401
Devreotes, P., 381 Droese, J., 154
Dewchand, H., 200 Dubois-Dalcq, M., 92
Dewor, M., 60 Dugani, C. B., 240
Dexter, T. M., 61, 66 Dunbrack, R. L., Jr., 268
Dezube, B. J., 127 Duncan, R. C., 119
Dhanoa, D. S., 269 Dunn, G. P., 107
Dhillon, T., 127 Dunn, R., 419
Diaz, C., 273 Dunning, L., 270
Diaz, G. A., 63, 317 Dupor, J., 232, 233, 238
Di Carlo, E., 118 Dupuy, A., 63, 317
Dick, J. E., 77, 78 Duran, E. M., 128
Diehlmann, A., 60 Durell, S. R., 361
Dieli, F., 235, 239 Durham, S. K., 198
Dierlamm, J., 67 Durrant, S., 66
Digel, M., 166 Dutta, R., 92
Dijkstra, I., 92 Duvic, M., 291
Dijkstra, I. M., 92 Dykstra, B., 73
Di Liberto, D., 235, 239, 247 Dziejman, M., 60
Dimarzio, P., 401 Dziembowska, M., 92
Dinter, H., 118 E
Dioszegi, M., 35, 44, 45
Di Paolo, S., 128 Eaves, A. C., 73, 74, 77
DiPersio, J. F., 57, 58, 59, 60, 61, 65, Eaves, C. J., 73, 74, 77, 78
67, 68, 69, 80 Ebert, B. L., 143
Author Index 429

Eckstein, V., 60, 80 Feng, S., 338


Edgar, C. E., 380, 381, 382, 384, 385, Feng, Y., 60, 401
386, 388, 391, 392, 395 Fenyk, J. R., Jr., 63
Edinger, A. L., 291 Ferketich, A. K., 69
Edwards, J. G., 240 Ferlazzo, G., 291
Edwards, P. C., 264 Ferminan, E., 59
Efstathiou, S., 174, 175, 176, 179, 194, 195 Fernandes, P. A., 270
Ehlenbeck, C., 65 Fernandez, J. L., 353
Ehlers, M. D., 240 Ferrant, A., 66
Ehninger, G., 60, 66 Ficarro, S. B., 338
Eisenmann, J. C., 66 Fichman, M., 267, 269
Eisterer, W., 78 Fidock, M., 21, 24, 28, 30, 36, 39, 46
Eizirik, D. L., 197, 200, 201 Field, J., 128, 137, 143
Elcock, A. H., 270 Filizola, M., 273
Elliott, J. I., 200 Finelli, M., 269, 270
Ellmeier, W., 401 Fingerle-Rowson, G., 60
Elstner, M., 264 Fire, A., 294
Eltayeb, S., 92 Fischer, J., 67
Ema, H., 65, 76, 77 Fischer, R., 384
Emeis, J. J., 291 Fisher, G. H., 131
Endres, M., 33 Fisher, I., 60
Endres, M. J., 361 Fisher, L. W., 118
Eng, J., 340 Fisher, N., 68, 69, 80
Ensoli, B., 128 Fitzsimons, C. P., 153, 156, 160, 165
Entel, P., 264 Flavell, R. A., 195
Eramian, D., 266, 269 Flodstrom, M., 200
Ericsson-Dahlstrand, A., 92 Flore, O., 134
Ernst, O. P., 264, 271 Florens, L., 342
Eroles, P., 128 Floriano, W., 267, 270
Esguerra, C. V., 401 Floriano, W. B., 267, 269, 270, 272, 285
Esposito, K., 291 Folsom, A. R., 290
Este, J. A., 359 Foote, S., 64
Eswar, N., 266, 269 Forde, S. P., 59
Eto, K., 290 Forsberg, E., 210
Evans, B. J., 399 Forssell, J., 107, 108, 117
Evans, R. J., 61, 63 Forssmann, W. G., 291
Eveno, E., 118 Forster, R., 70, 72
Evens, A. M., 59 Forster, T., 381
Everett, H., 174 Foudi, A., 69
F Foulis, A. K., 199
Fox, B. A., 44, 264, 400
Fabbri, M., 105, 236, 240, 241 Fox, J. M., 270
Faber, A., 60 Fox, M. H., 384
Facchetti, F., 291 Fra, A. M., 237, 239, 240, 246, 250, 254
Failenschmid, C., 333 Fraile-Ramos, A., 154, 159, 360
Fajas, L., 292 Francois, F., 63, 317
Fakhari, F. D., 134 Frank, A., 340, 341
Falk, P., 67 Franssen, J. D., 291
Fallon, R., 60, 61 Frascaroli, G., 166
Fan, L., 213 Fraser, A. D., 304
Fang, X., 342 Fraser, A. R., 239
Fantuzzi, G., 290 Fratantoni, S. A., 160
Farrell, H. E., 155, 165 Freddolino, P., 267, 269, 270, 272, 285
Farrens, D.L., 265, 271, 272 Frederich, R., 291
Farzan, M., 51, 60, 400 Fredriksson, R., 60, 400
Fedarko, N. S., 118 Freedman, N. J., 416, 421
Felberbaum, R., 414, 415 Fremont, D. H., 174, 175, 176, 184,
Feller, S. E., 273 194, 200, 204
430 Author Index

Frenette, P. S., 63, 198 Geras-Raaka, E., 127, 135


Freud, A. G., 69 Gerhart, M., 174
Freytes, C. O., 66 Germing, U., 67
Frick, M., 67 Gerritsen, W. R., 73
Fricker, S. P., 29 Gershengorn, M. C., 127, 128, 130,
Fridey, J., 67 135, 137, 153
Friedman, J. M., 290 Gertler, F. B., 210, 317, 318, 319
Friend, D., 174 Gesualdo, L., 128
Friesner, R. A., 271, 274 Geuze, H. J., 374
Fruehauf, S., 80 Ghosh, A., 271, 274
Fryer, B. H., 128, 137, 143 Ghosh, S., 143, 145
Fuentes, M. E., 198 Ghosn, C., 291
Fuery, M., 66 Gibson, W., 154
Fujii, N., 59, 399, 402, 408 Giebel, B., 65
Fujino, M., 367 Giershik, P., 165
Fujita, N., 270 Gifford, A. M., 118
Fukuda, S., 60, 62, 65, 74, 76, 80 Gill, J., 39
Fuller, M. T., 58 Gillespie, G. Y., 152
Furtado, G. C., 198, 201, 204 Gillette, M. A., 143
Gillies, S. D., 78
G Gillis, S., 178
Ginsberg, H. N., 293
Gabriel, J., 68, 69, 80 Girotti, M. R., 118
Gadella, T. W. J., Jr., 381 Gish, G., 419
Galisteo, R., 128, 141, 143 Giugliano, D., 291
Gallagher, R., 317 Giugliano, G., 291
Galliera, E., 236, 237, 238, 246 Glabinski, A., 92
Gallo, R. C., 128, 317 Glazer, A. N., 383
Galon, J., 107, 117 Glimm, H., 78
Galun, E., 61, 62 Glogauer, M., 118
Gan, O. I., 78 Gnad, F., 342
Gandhi, M. K., 65 Gobbi, M., 237, 239, 240
Ganem, D., 127 Goddard, W. A., 267
Gao, J. L., 160 Goddard, W. A. III, 267, 268, 269, 270,
Gao, S. J., 128 272, 285
Garbutt, M., 211 Goddell, M. A., 65
Garcia, B., 213 Goedecke, M. C., 28
Garcia, J. L., 59 Gohda, K., 270
Garcia-Zepeda, E., 60, 61 Goichberg, P., 59
Gariboldi, S., 118 Goldin, R., 107, 117
Garin, A., 200, 204 Golding, H., 416
Garlanda, C., 106, 107, 117 Goldstone, A. H., 66
Garofalo, A., 59 Golemis, E. A., 128, 137, 143
Garton, A. J., 307 Golub, T. R., 143
Gassmann, M., 142 Gomez, J., 359
Gavrilov, S., 21, 45, 46 Gomperts, B., 4, 118
Gazitt, Y., 66 Gong, B., 338
Ge, N., 401 Gonsiorek, W., 33
Geay, J. F., 69 Goodnough, L. T., 65
Geer, L. Y., 342 Goodwin, R. G., 174
Geiger, H., 61, 66 Gooley, T., 65
Geiser, T., 60 Goralski, K. B., 289, 290, 291, 302,
Gelb, B., 63 304, 305, 306
Gendelman, R., 128 Gorlin, R. J., 63, 317
Gentili, F., 291 Gorman, J. R., 49
Georget, M. T., 59 Gossen, M., 202
Georgiev, I., 60 Gotoh, M., 197
Author Index 431

Gott, B., 78 Gutensohn, K., 67


Goucher, D., 416 Gutierrez, A., 359
Gouldson, P. R., 273 Gutiérrez, L., 239
Govaerts, C., 17, 291 Gutierrez, N. C., 59
Grabovsky, V., 60 Gutkind, J. S., 125, 127, 128, 130, 131,
Graham, G. J., 213, 232, 236, 237, 239, 132, 134, 135, 137, 138, 139, 140,
240, 245, 246, 247, 248, 250 141, 143, 153
Graham, K. A., 174, 175, 176, 187 Guy, H. R., 361
Graham-Evans, B., 61, 63, 64, 67, 76 Gygi, S. P., 342
Grammer, A. C., 384 Gysemans, C., 201
Grandaliano, G., 128
Grande, F., 59 H
Granzow, M., 142
Graudens, E., 118 Haas, R., 401
Grauls, G., 165 Haas, W., 342
Grauls, G. E., 165 Habler, L., 59
Gravot, A., 361 Hackett, N. R., 63
Gray, A., 34 Hagen, D. C., 402
Gray, P. W., 359 Hagen, H., 174
Graziano, M. P., 291 Hahn, G., 166
Green, M. D., 67 Halaas, J. L., 290
Greenlee, W. J., 33 Hall, S. E., 267, 269, 270, 272, 273, 274, 285
Greenman, J., 59, 69, 72 Ham, A. J., 210, 315, 317, 318, 319
Gregori, S., 200 Hamada, J., 59
Gregory, J. L., 60 Hamilton, D., 46
Greiner, A. L., 118 Hammerschmidt, W., 165
Greiner, D., 78 Han, Y., 92
Greiner, D. L., 78 Hanahan, D., 198
Gremy, G., 118 Handel, T. M., 174, 194, 211, 212, 291,
Greten, F. R., 106 305, 331, 333
Grewal, I. S., 195 Handgretinger, R., 78
Grewal, K. D., 195 Handyside, A., 49
Griffin, N., 226 Hanenberg, H., 77
Griffin, P., 17, 19, 20, 22, 24, 26, 29, Hangoc, G., 61, 63, 64, 67, 76
30, 33, 35, 36, 39, 40 Hanniman, E. A., 290, 291, 302, 304,
Griffith, M. T., 264 305, 306
Grigg, A., 66, 67 Hansell, C., 239
Grimes, J. M., 174 Hansell, C. A., 261
Grisotto, M. G., 128, 201, 204 Hanson, M. A., 264, 400
Gronborg, M., 332, 333 Hanyaloglu, A. C., 359, 414
Groom, C. R., 400 Hardan, I., 59
Groom, J., 60 Hardwick, A., 66
Grossfield, A., 273 Hardy, K., 49
Group, S. C., 58 Hargreaves, D. C., 198
Grove, E. A., 92 Haribabu, B., 60, 236, 237, 238, 240,
Gruijthuijsen, Y. K., 153, 160, 165 241, 402, 408
Grundner-Culemann, K., 332, 333, 342 Harirchian, P., 269, 270
Guerrero, L. J., 118 Harkins, L., 152
Guetta, E., 78 Harriague, J., 60, 63, 317
Guimond, M., 69 Harris, L. N., 118
Guise, T. A., 401 Harrison, D. E., 74, 76
Gulino, A. V., 63, 317 Harrison, J. K., 211
Gulizia, R. J., 24 Harrison, L. C., 200
Gunera-Saad, N., 317 Harrison, P., 39
Gunthel, C. J., 127 Hartmann, T. N., 60
Guo, H. G., 128 Harvey, R. P., 60
Gupta, N., 341 Haseloff, R. F., 338
Gupta, P. B., 10 Hattori, K., 63
432 Author Index

Haug, J. S., 65 Hildebrand, P. W., 264


Havel, P. J., 290 Hill, C. M., 361, 401
Hawley, R. G., 65 Hill, D. A., 66
Hawley, T. S., 65 Hill, L. A., 160
Haworth, B., 21, 28, 30 Hillyer, T., 226
Hayden, M. S., 143, 145 Hilsher, C., 128
Haylock, D. N., 64, 65, 74 Hilton, M. J., 60, 63, 66
Hayter, P., 39 Hioki, K., 78
Hayward, G. S., 134 Hipkin, R. W., 33, 195, 198, 204
Hazelton, B., 65 Hiramatsu, H., 78
He, L., 381, 384 Hiramatu, K., 402, 408
He, T. T., 92 Hiramoto, T., 270
He, Y., 128, 131, 132, 134, 135 Hirota, S., 60, 400
Heard, J. M., 60, 401 Hitchcock, C., 35
Hebert, C. A., 358, 400 Hively, W. P., 131
Hedin, K. E., 379, 380, 381, 382, 384, Ho, A. D., 60
385, 386, 388, 391, 392, 395 Ho, S., 70
Hedrick, J. A., 203 Ho, S. N., 275
Heifetz, A., 267, 269 Ho, Y., 174, 184
Heike, T., 78 Hochstrasser, M., 414, 415
Heissig, B., 63 Hoelig, K., 60
Heitman, J., 402 Hofmann, K. P., 264, 271
Helenius, A., 364 Hofmann, W., 51
Hellerstrom, C., 197 Hogan, B., 196
Henderson, A., 232, 239 Hogge, D. E., 73, 77
Henderson, N., 48 Hohm, S., 80
Henderson, R., 264 Holbrook, M., 19, 33, 34
Hendricks, D., 65 Holig, K., 66
Hendy, J., 58, 60 Holl, J., 153, 160, 162, 163, 165
Hengel, H., 166 Holland, E., 131
Henon, P. R., 66 Holle, L., 66
Henriksson, M. L., 107, 108, 117 Holm, C., 307
Hensbergen, P., 332 Holmes, K. L., 384
Henson, G. W., 63, 67 Holmes, W., 63, 359, 360
Herbert, K. E., 64, 65, 74 Holst, P. J., 162
Hermann, G. E., 92 Holt, M. S., 61, 67, 68, 69, 80
Hermann, S., 60, 61 Holyoake, T. L., 78
Hermans-Borgmeyer, I., 291 Holzmann, S., 198
Hermey, G., 291 Homey, B., 128, 153, 196, 401
Hermine, O., 63, 317 Hong, K. S., 292
Hernandez, J. M., 59 Honjo, T., 63
Hernandez, P. A., 63, 317 Hooper, A. T., 128
Herren, S., 210, 212 Hooper, M., 49
Herrmann, S. H., 60 Hopken, U. E., 154
Hershko, A., 414, 415 Hopkins, A. L., 400
Hershkoviz, R., 78 Hopkins, C. R., 371
Hersi, K., 419 Hopp, T. P., 178
Hess, D. A., 80 Hori, T., 44, 264, 400
Hettich, R. L., 342 Horsch, K., 60
Hewgill, D., 381 Hortobagyi, G. N., 416
Hewlett, L., 360, 368, 373 Horton, R. M., 275
Hey, P. J., 291 Horuk, R., 60, 92, 263, 264, 266, 358, 400
Hibbitts, S., 359 Hosokawa, M., 59
Hibert, M., 267, 270 Hossfeld, D. K., 67
Hicke, L., 419 Hotamisligil, G. S., 291
Hickman, I. J., 291 Hou, Y., 33
Hidalgo, A., 63 Houtz, D. A., 154
Higashino, F., 59 Howard, C., 419
Author Index 433

Howley, P. M., 419 Issafras, H., 361


Hoxie, J. A., 63, 359, 360, 361 Ito, M., 78
Hseuh, Y. P., 402 Ito, Y., 290
Hu, J., 128 Itoh, H., 290
Hu, T., 232 Itoh, K., 290
Huang, D., 92 Ivanova, N., 61, 66
Huang, W., 40 Iwashita, T., 65
Huang, Y., 92, 401 Iyer, C. V., 61, 63
Hubbard, M. J., 332 Izac, B., 77
Hubbell, W. L., 265, 272
Hubel, K., 63, 67 J
Huber, T., 265
Huckle, W. R., 159 Jaakola, V. P., 264
Hughes, R., 290 Jackson, D. G., 240
Hughes, S. H., 131 Jacobe, H., 291
Hughes, T. L., 69 Jacobsen, S. E., 76
Huibregtse, J. M., 419 Jaffe, H. W., 127
Hulshof, J. W., 160 Jagannath, S., 65
Hummel, K., 67 Jala, V. R., 236, 237, 238, 240, 241
Humphreys, T. D., 380, 381, 382, 384, Jalil, A., 69
385, 386, 388, 391, 392, 395 James, I., 17
Humphries, R. K., 74 Jamieson, T., 213, 236, 247
Hunerliturkoglu, A., 67 Janetopoulos, C., 381
Hung, M. C., 416 Janeway, C. A., Jr., 195
Hunt, D. F., 338 Jankowski, K., 60, 63
Hunt, H. D., 275 Jansson, C. C., 29
Hunter, S, 49 Jares-Erijman, E., 380, 383
Hunter, T., 332, 381 Jarrier, P., 69
Hutchins, C., 66 Javitch, J. A., 264, 271
Huttenrauch, F., 362 Jeffery, R. W., 290
Hylander, B. L., 118 Jenh, C. H., 128, 153, 196
Jenkins, N. A., 165
I Jenkinson, S., 33, 34
Jensen, K. K., 128, 195, 198, 203, 204
Igishi, T., 139 Jensen, O. N., 332, 333, 338, 339, 342
Iida, K., 292 Jestice, K., 65
Iizasa, H., 60, 400 Jham, B. C., 128
Iizawa, Y., 367 Ji, C., 44, 45
Ijzerman, A. P., 264 Ji, H., 210, 211
Ikawa, M., 195 Ji, Y., 128, 141, 143
Illmer, T., 60 Jiang, G., 381
Imai, K., 59, 290 Jiang, J., 213
Imberti, L., 63, 317 Jiang, S. Y., 68
Imhof, A., 240 Jiang, X., 338
Imoto, H., 367 Jin, P., 80
Inbal, B., 267 Jin, T., 381
Ince, T. A., 118 Joazeiro, C. A., 419
Infante, B., 128 John, H., 291
Infantino, S., 60 Johnson, G. L., 159
Ingham, R. J., 419 Johnson, Z., 174, 194, 210, 211, 212
Ingram, D. A., 73 Johnston, D., 290
Inoue, K., 270 Johnston, J. B., 174
Irvine, B., 17, 19, 20, 22, 24, 26, 29, Jones, D., 60
30, 33, 36, 39, 40, 46 Jones, M., 361
Irvine, R., 24, 36, 39 Jones, R., 20, 38, 43, 48
Isaacs, N., 245 Jones, T. R., 153, 159
Isidro, I. M., 59 Jongejan, A., 154
Isin, B., 273 Jordan, C. T., 74, 76
434 Author Index

Jorgensen, T. J., 338 Kelvin, D. J., 174, 176, 187, 211


Jovrin, T. M., 380, 383 Kenakin, T., 33, 34
Jowett, J., 292 Kennedy, G., 66
Jun, H. S., 200 Kennedy, P. E., 60, 401
Jund, R., 404 Kenyon, J. C., 174
Jung, A., 107, 108, 117 Kerjaschki, D., 232, 239, 361
Jung, S., 239 Kerob, D., 63, 317
Jung, Y., 59 Kerscher, O., 414, 415
Kershaw, T., 357
K Ketas, T., 21, 45, 46
Khan, A., 59, 69, 72
Kabisch, H., 67 Khan, M. Z., 92
Kadi, L., 92 Kho, T., 200
Kaji, H., 292 Khorana, H. G., 51, 265, 272
Kajumo, F., 21, 45, 46 Khuu, H., 80
Kakonen, S. M., 401 Kidd, G., 92
Kalani, M. Y., 270 Kidley, N. J., 273
Kalid, O., 267 Kiel, M. J., 58, 65
Kalinkovich, A., 59 Kiger, A. A., 58
Kall, L., 342 Kikutani, H., 60, 400
Kalume, D. E., 332 Kim, D. E., 353
Kam, V. W. T., 270 Kim, J. B., 292
Kamon, J., 290 Kim, P. S., 134, 213
Kandel, G., 66 Kim, S., 341
Kang, Y., 401 Kim, Y. J., 264
Kanjanapangka, J., 269, 270 King, A. G., 65, 74, 76
Kanz, L., 333, 401 King, M., 78
Kanzaki, N., 367 King, P. H., 152
Kao, W. M., 63 Kinsley, D., 198
Kaplan, M., 128 Kinsley, D. J., 203
Kappes, J. C., 326 Kipps, T. J., 333, 334
Kaptein, S. J., 165 Kirchhoff, F., 154
Karber, G., 296 Kirilovsky, A., 107, 117
Kardash, E., 60 Kish, J., 92
Karin, M., 106, 107, 145 Kishimoto, T., 60, 400
Karnoub, A. E., 10 Kita, S., 290
Karpova, T. S., 384 Kitamura, Y., 60, 400
Kaspler, P., 59 Kitazawa, R., 292
Kasuga, M., 292 Kitazawa, S., 292
Kataoka, Y., 60, 400 Kivisäkk, P., 92
Katayama, Y., 63 Kiyoizumi, T., 197
Kato, I., 77 Kjellen, L., 210
Katoh, K., 292 Klaege, K. L., 92
Katona, R., 166 Klasse, P. J., 63, 359, 360
Katz, A., 77 Kledal, T. N., 135, 153, 154, 155, 156,
Kauer, J. A., 240 159, 160
Kaufer, B., 165 Kleinschmidt, A., 70, 72
Kauffman, M., 269 Klemm, C., 338
Kaufman, R. J., 51 Klemm, L., 63
Kawabata, K., 60, 400 Klip, A., 240
Kawahata, M., 78 Klotman, M. E., 63, 317
Kawai, T., 63 Knight, M. C., 59
Kazmierski, W., 33, 34 Knight, Z. A., 128
Keane, M. P., 4, 118 Knowles, D. M., 127, 134
Keen, J. H., 360, 415, 416, 417, 419, 420 Knutson, J. R., 384
Keighley, W., 39 Kobayashi, K., 78
Kelleher, S. P., 118 Kobayashi, M., 59
Kelley, K., 128 Kobbe, G., 67
Author Index 435

Kobilka, B., 264, 271 Kuhn, P., 264


Kobilka, B. K., 264, 271, 272, 400 Kuhnl, P., 67
Kobilka, T. S., 264, 400 Kuijpers, T. W., 92
Kochanny, M., 270 Kuller, L. H., 290
Koehne, G., 67 Kumar, A., 379, 380, 381, 382, 384,
Koenen, R. R., 60 385, 386, 388, 391, 392, 395
Koga, R., 290 Kumar, C., 342
Koh, A., 118 Kumasaka, T., 44, 264, 400
Kohara, H., 59 Kunkel, S. L., 201, 204
Kohn, W., 61, 63 Kuo, C. J., 60
Kohout, T., 360 Kuo, P. C., 118
Koh-Paige, A. J., 59 Kuroda, M., 60, 400
Kolattukudy, P. E., 154, 159 Kurowska-Stolarska, M., 239
Kolb, H., 200 Kurrer, M. O., 240
Kolb-Bachofen, V., 200 Kutzleb, C., 291
Kolchinsky, P., 51 Kwon, D., 361
Kollet, O., 58, 59, 78 Kwon, N. S., 200
Kominami, K., 195
Kondo, H., 65, 76, 77 L
Kondru, R., 44, 45
Kooi, M. L., 73 Labrecque, J., 29
Kooistra, T., 60 Labroli, M. A., 33
Koovakat, S., 270 Lachowicz, J., 33
Kopp, J., 212 Lacroute, F., 404
Koprunner, M., 401 Lacy, L., 196
Korbutt, G. S., 197 Lagace, D. C., 306
Korenstein-Ilan, A., 59 Lagane, B., 60, 63, 317
Kosco-Vilbois, M. H., 194, 210, 212 Lagerstrom, M. C., 60
Koshimoto, T., 60 Laghi, L., 105
Kostas, S. A., 294 Lagorce-Pages, C., 107, 117
Kostenko, V., 92 Lahav, M., 59
Koszinowski, U. H., 165, 166 Lahey, R., 80
Kotb, M., 78 Lai, M., 107
Kotchetkov, R., 152 Lajemi, M., 118
Kottmann, A. H., 60, 400 Lakowicz, J. R., 381
Koup, R. A., 401 Lakso, M., 49
Kouyama, T., 264 Lalani, A. S., 174, 175, 176, 187, 211, 213
Kowalak, J. A., 342 Landau, N. R., 232, 237
Koyanagi, Y., 78 Lander, E. S., 143
Kozasa, T., 143 Landua, S., 68
Krause, E., 338 Landwehr, S., 166
Krauss, N., 264 Lane, J. R., 264
Kremer, K. N., 379, 380, 381, 382, 384, Lane, T. A., 66
385, 386, 388, 391, 392, 395 Lane, T. E., 91
Kremmer, E., 70, 72 Laney, A. S., 127
Kriehuber, E., 232, 239 Lang, J., 29
Kristiansen, K., 265 Langdon, S. P., 10
Krivacic, K., 92 Lange, A., 61
Kroenke, M., 91 Langston, M. A., 342
Kroger, N., 67 Lansdorp, P. M., 73, 74
Krohn, R., 60 La Perle, K. M., 128
Kronenberg, H. M., 59 Lapidot, T., 58, 60, 77, 78
Kronenwett, R., 401 Large, V., 307
Kronheim, S. R., 178 Larochelle, A., 77
Kroschinsky, F., 60, 66 Larsen, M. R., 338, 339
Krystek, S., 266 Lassmann, H., 92
Kucia, M., 60, 63 Latger-Cannard, V., 63, 317
Kuhmann, S., 21, 45, 46 Lau, E. K., 174, 194, 211, 212
436 Author Index

Lau, G., 29 Lider, O., 59


Lau, P., 92 Lie, Y. S., 40
Laub, L., 65 Lightfoot, S., 142
Laufs, S., 80 Li Jeon, N., 327
Laurent, L., 63, 153, 159, 317 Like, A. A., 200
Lauri, E., 232, 233 Liles, W. C., 61, 63, 64, 67, 76
Law, P., 60, 62, 66 Lilleby, K., 65
Lazarini, F., 92 Lim, C. S., 419
Le, T. I., 264 Lim, H. D., 162
Leach, M. W., 128, 153, 196 Limoli, K. L., 40
Lear, C. H., 117 Lin, H., 21, 28, 30
Lebbe, C., 63, 317 Lin, K. K., 65
Lebon, P., 92 Linch, D. C., 66
Lee, B., 361 Link, D. C., 60, 63, 66, 68, 69, 80
Lee, C. S., 342 Link, H., 66
Lee, E., 49 Linta, L., 166
Lee, F., 127 Linton, G. F., 63
Lee, H., 118 Lipp, M., 70, 72, 154, 198
Lee, H. S., 200 Lipsky, P. E., 381, 384
Lee, J. C., 92 Lira, S. A., 128, 153, 193, 195, 196, 198, 200,
Lee, K., 78 201, 203, 204, 213, 232, 233, 236, 238
Lee, L. S., 130 Littman, D. R., 60, 239, 361, 400
Lee, S. H., 200 Litwin, V., 401
Lefkowitz, R. J., 154, 237, 238, 264, 414, 419 Liu, F., 60, 63, 66
Legler, D. F., 60, 401 Liu, G., 361
Lehman, L. A., 160 Liu, H., 342
Leiber, M., 142 Liu, J., 33
Leibowitz, M. D., 291 Liu, L., 92, 209, 213, 232
Lemieux, M. E., 73 Liu, L. Y., 174, 175, 176
Lemischka, I. R., 61, 66 Liu, R., 401
Leng, L., 60 Liu, S., 118
Lepers, M., 66 Liu, T., 342
Le Poul, E., 291, 361 Liu, Y., 317, 319, 326, 328, 380
Leslie, A. G., 264 Liu, Y. J., 70
Letafat, S., 39 Livak, K. J., 304
Letexier, D., 307 LiWang, P. J., 156, 160, 194
Le Trong, I., 44, 400 Llera, A. S., 118
Leung, H., 60 Locati, M., 105, 107, 117, 231, 232, 233, 235,
Leung, R. K., 294 236, 237, 238, 239, 240, 241, 246
Leung, T., 401 Loetscher, M., 60, 401
Leurs, R., 153, 154, 155, 156, 160, 162, 163, 165 Lofsness, K. G., 63
Lever, R., 210, 212 Lokeshwar, V. B., 119
Levesque, J. P., 58, 60, 63, 64, 65, 74 Lollmann, B., 291
Levoye, A., 63, 317 Lombardi, G., 239
Levy, F. O., 358 Long, F., 60, 63, 66
Lewin, A. C., 198 Lopez, A., 92
Lewis, B. C., 131 Lopez, S., 68, 69, 80
Lewis, M., 24, 40, 43, 44, 46 Lopez, T., 198
Ley, T. J., 67 Lortat-Jacob, H., 62, 63
Li, J., 264 Loskutoff, D. J., 290
Li, L., 80 Lou, Q., 61, 63
Li, M., 60, 91, 92 Louache, F., 69
Li, W., 419 Loverre, A., 128
Li, X., 61, 63, 64, 67, 76, 213 Lu, B., 107
Li, Y., 128, 131, 132, 134, 135 Lu, M., 92
Li, Y. M., 416 Lu, Z., 60, 61
Liang, H., 66 Lucas, A., 174, 175, 176, 209, 211, 213
Liang, M., 270 Lucchinetti, C. F., 92
Author Index 437

Luckow, B., 359, 362, 364 Mann, M., 332, 333, 342
Lüdeke, S., 265 Manning, B. D., 128
Lue, H., 60 Manning, G., 332
Luescher, I., 388, 390 Mansfield, R., 17, 19, 33, 34
Luini, W., 291 Mantovani, A., 4, 105, 106, 107, 117,
Lukens, J. N., 63, 317 231, 232, 233, 235, 236, 237, 238,
Luna-Vargas, M. P., 415 239, 240, 241, 246, 291
Lundin, L. G., 60 Many, A., 59
Luo, Y., 239 Mao, A., 269, 270
Luske, A., 165, 166 Mao, H. C., 69
Lusso, P., 359 Marantz, Y., 267, 269
Luster, A. D., 60, 61, 185, 188 Marburger, T. B., 69
Luther, M. A., 63, 359, 360 Marcenaro, E., 291
Luther, S. A., 198 March, C. J., 178
Lynch, D. M., 165 March, M., 364
Lyons, B. L., 78 Marchese, A., 60, 69, 360, 413, 414, 415, 416,
417, 419, 420
M Marco, E., 105
Marcus, R. E., 65
Ma, Q., 60 Marfella, R., 291
Macartney, M., 17, 19, 20, 22, 24, 26, 29, 30, 33, Margalit, R., 59
36, 39, 40, 46 Margulies, B. J., 154
Macauley, C., 209, 213 Mariage-Samson, R., 118
MacCoss, M. J., 342 Marincola, F. M., 80
Macdonald, G. A., 291 Markey, S. P., 342
MacDonald, R., 388, 390 Marmon, S., 361, 401
MacDougald, O. A., 292 Marrelli, S., 291
Macek, B., 342 Marsh, M., 63, 154, 159, 357, 359, 360, 361,
Macen, J. L., 174, 175, 176, 211 362, 364, 365, 367, 368, 371, 373, 375
Macfarland, R., 67 Marti, W., 175
MacGrath, M., 66 Martin, A. P., 128, 193, 198, 200, 201, 204
Mack, M., 210, 212, 359, 360, 361, 362, 364, Martin, D., 125, 128, 138, 141, 143
367, 371 Martin, R. P., 59
Maddon, P. J., 401 Martin, S. R., 401
Magerus, A., 59 Martinez, A. C., 60
Maggio, G., 128 Martinez, M. A., 359
Magid, M., 59 Martinez de la Torre, Y., 232, 233, 238, 247
Maguer-Satta, V., 78 Martinez-Mayorga, K., 273
Mahabaleshwar, H., 60 Martinez-Munoz, L., 60
Mahad, D., 92 Martini, L., 162
Mahad, D. J., 92 Marullo, S., 361
Mahalingam, M., 265 Maruyama, M., 66
Maher, D., 67 Masilamani, S., 341
Mahmoud, N. G., 28 Massague, J., 401
Maier, P., 80 Massardi, L., 291
Mailman, R. B., 264, 271 Massardi, M. L., 237, 239, 240, 291
Majmudar, A., 92 Masuda, T., 290
Majorana, A., 291 Mathieu, C., 201
Maki, T., 197 Mathys, S., 165
Malech, H. L., 63 Matloubian, M., 198
Malhotra, M., 291 Matsubara, A., 65, 76, 77
Malim, M. H., 63 Matsuchima, K., 400
Manders, P. M., 92 Matsuda, A., 419
Mandrup, S., 292 Matsushima, K., 60, 201, 358, 400
Manfra, D. J., 128, 153, 196, 198, 203, 204 Matsuura, H., 270
Manfredi, J. P., 402, 408 Matsuyama, T., 290
Mangada, J., 78 Matthiesen, R., 342
Manischewitz, J., 416 Mattison, K., 153, 165
438 Author Index

Maurer, D., 232, 239 Meshel, T., 3


Mausbacher, N., 332, 333, 342 Mesirov, J. P., 143
Maussang, D., 151, 153, 162, 163 Mesri, E. A., 127, 128, 130, 137,
Maynard, D. M., 342 140, 141, 153
Mayo, S. L., 268 Messerle, M., 165, 166
Mazzolari, E., 63, 317 Mestas, J., 4, 118
Mbamalu, G., 419 Metcalf, D., 64
McAllister, S. S., 118 Methner, A., 291
McCaffrey, G., 402 Metzgar, R., 317
McCarthy, T. C., 290, 291, 302, 304, 305, 306 Meucci, O., 92
McCarty, J. M., 58, 59, 67, 68 Meyer, D., 401
McCauley, L. K., 59 Meyer, M., 291
McClanahan, T., 401 Miao, Z., 60
McCleland, M. L., 338 Micali, G., 127, 134
McCombie, S. W., 21, 33, 45, 46 Michejda, C. J., 360
McCoy, J., 60 Michel, D., 151, 153, 160, 162, 163, 165
McCredie, K., 317 Michelson, S., 153, 159
McCulloch, C., 245 Middleton, D., 20, 38, 43, 48
McCulloch, C. V., 246, 248, 249, 250, Migeotte, L., 291
251, 253, 256 Miki, T., 139
McDonagh, E. M., 415 Mikolaenko, I., 152
McDonald, I. K., 274 Milano, S. K., 414
McFadden, G., 174, 175, 176, 184, 187, 188, 194, Milasta, S., 246, 251, 254, 255
209, 211, 212, 213 Miller, C. L., 73
McFadyen, L., 20, 38, 43, 48 Miller, K., 17, 371
McFarland, K., 68, 69, 80 Miller, K. J., 264, 271
McGlauchlen, K., 68, 69, 80 Miller, L., 65, 213
McGrath, K. M., 67 Miller, L. H., 358, 400
McIlhinney, R. A., 154, 155 Miller, R. H., 92
McIvor, D., 209 Miller, R. J., 92
McKeating, J. A., 28 Miller, W. E., 154, 155
McKenzie, J. L., 78 Miller, W. R., 10
McKimmie, C. S., 239 Milligan, G., 246, 251, 254, 255, 361
McKnight, A., 361 Milligan, L. L., 134
McKoy, J. M., 59 Mills, J., 17, 24, 36, 39, 46
McLean, A. J., 361 Milner, L. A., 59
McLean, K. A., 162 Milotic, I., 165
McLean, P., 213, 236, 245 Minina, S., 60
McLeod, R. S., 306 Minisini, R., 154, 165
McMaster, B. E., 60 Minokoshi, Y., 290
McMillan, J., 292 Minson, A. C., 174, 175, 176, 179, 194, 195
McNally, J. G., 384 Miotti, S., 118
Mead, L. E., 73 Mirjolet, J. F., 291
Mealiffe, M., 66 Mirolo, M., 105, 236, 240, 241
Meatchi, T., 107 Mirzabekov, T., 51
Meder, W., 291 Mirzadegan, T., 44, 45
Megill, J. R., 198 Misteli, T., 348
Meguro, K., 367 Miyano, M., 44, 264, 400
Meiser, A., 415 Miyata, H., 139
Melikian, A., 60 Mlecnik, B., 107, 117
Mellado, M., 60 Moepps, B., 60, 154, 165
Mello, C. C., 294 Mohanty, P., 269
Menge, W. M., 154 Mohar, A., 401
Menzel, W., 142 Mohle, R., 333, 401
Meraviglia, S., 235, 239 Mohler, K., 174
Mernaugh, R. L., 210, 315, 317, 318, 319 Mokros, T., 154
Mertens, T., 153, 154, 160, 165, 166 Molday, R. S., 51
Merzouk, A., 60, 62 Molidor, R., 107
Author Index 439

Molina, H., 332 Mumby, M., 340, 341


Molinari, A. M., 291 Mundell, S. J., 60
Molineux, G., 61, 66 Munuswamy-Ramanujam, G., 209
Molinolo, A., 128, 131, 132, 134, 135 Murakami, M., 264
Mollard, C., 118 Muranyi, W., 165
Mollereau, C., 291 Murdoch, B., 77
Monaco, A. P., 197 Murphy, E., 401
Monini, P., 127 Murphy, P. M., 19, 33, 63, 118, 160, 174, 175,
Monk, M., 49 176, 194, 358, 400
Montaner, S., 127, 128, 131, 132, 134, Murray, J. L., 402
135, 137, 138, 140, 141, 143 Murrell-Lagnado, R. D., 240
Montgomery, M., 65 Muruganandan, S., 290, 291, 302, 304, 305, 306
Montgomery, M. K., 294 Mutlu, A. D., 128
Moon, J., 63 Muzio, M., 106, 107
Moore, C. A., 414 Muzio, V., 210, 212
Moore, J. P., 401 Myszka, D. G., 35
Moore, M. A., 63, 401
Moore, P. S., 127 N
Mootha, V. K., 143
Moratto, D., 63, 317 Nabors, L. B., 152
Moretta, A., 291 Nachtigal, M. W., 306
Moretta, L., 291 Nademanee, A., 67
Morgello, S., 92 Nador, R. G., 134
Mori, J., 19, 20, 22, 24, 26, 29, 30, 33, 38, Naeem, R., 10
40, 43, 44, 46, 48 Nagasawa, T., 59, 60, 400
Morimoto, J., 201 Nagashima, K. A., 401
Morita, Y., 65, 76, 77 Nagler, A., 59, 60, 61, 62, 78
Moritz, T., 77 Nagpal, S., 291
Morris, A., 107, 117 Nakahata, T., 78
Morris, E. S., 66 Nakamoto, B., 62, 63
Morris, K., 127 Nakamura, M., 290
Morrison, S. J., 58, 65 Nakanishi, T., 195
Morrow, V., 246, 251, 254, 255 Nakauchi, H., 65, 76, 77
Mortensen, P., 342 Naor, Z., 267
Morton, J., 66 Napier, C., 17, 19, 20, 22, 24, 26, 29,
Moser, B., 60 30, 33, 34, 40
Moser, K., 341 Nappo, F., 291
Mosi, R., 29 Narula, S. K., 128, 153, 196
Mosier, D. E., 24 Narumi, S., 201
Mosley, A. L., 342 Nasca, M. R., 127, 134
Mosley, M., 19, 24, 33, 34, 40, 43, 44, 46 Nation, P., 211
Mossman, K., 174, 176, 187, 211 Naumann, N., 63
Motoshima, H., 44, 264, 400 Navenot, J. M., 402, 408
Motoyama, A., 340 Navis, M., 153, 160
Moubayed, M., 66 Navratilova, I., 17, 35
Moukhametzianov, R., 264 Nazareno, D., 33
Mourits, S., 201 Nazarian, S. H., 174
Moyer, R. W., 174, 175, 176, 211, 213 Neamati, N., 59
Mozobil, 59, 67 Nebuloni, M., 231, 232, 233, 235, 238, 239
Mueller, A., 28, 415 Nedjai, B., 269, 270
Mueller, L. N., 338 Neel, N. F., 210, 315, 317, 318, 319
Mueller, M., 338 Negus, R., 107, 117
Mueller, O., 142 Nelson, C. A., 194
Mukherjee, S., 143 Nelson, C. D., 154
Mullen, M., 66 Nelson, D. L., 63, 317
Mullen, P., 10 Nelson, J., 65
Muller, A., 401 Nelson, J. A., 153, 165
Müller, M., 92 Nelson, P. J., 359, 362, 364
440 Author Index

Neptune, E. R., 327 Okabe, M., 195


Nerl, C., 70, 72 Okada, T., 44, 264, 400
Nervi, B., 57, 60, 67 Okamoto, M., 367
Ness, T. L., 174, 175, 176, 211 Okamoto, Y., 49
Netzer, N., 59 Okayama, H., 162
Neupogen, 66 Okimura, Y., 292
Ni, J., 240 Okonogi, K., 367
Nibbs, R. J., 213, 232, 236, 237, 239, 240, 245, Olafson, B. D., 268
246, 247, 248, 251, 254, 255, 261 Old, L. J., 107
Nicastri, E., 127 Oldridge, J., 63, 359, 360
Nicholas, J. F., 63 Olsen, D. B., 92
Nichols, A., 290, 291 Olsen, J. V., 342
Nichols, D. E., 264, 271 Olson, D. P., 59, 384
Nicolai, J., 92 Olson, E. N., 136
Nicolaidou, V., 269, 270 Olsson, T., 92
Nicolas, J. F., 317 Olszak, I., 60, 61
Nicolini, F., 78 Omagari, A., 402, 408
Niedergang, F., 361 Omatsu-Kanbe, M., 270
Niemann, D., 92 Ong, S. E., 332, 333, 342
Nijman, S. M., 415 Opalenik, S. R., 317
Nikolaev, O., 381 Oppenheim, J. J., 4, 358, 400
Nikolic, T., 201 Oppermann, M., 154, 360, 362, 364,
Nilsson, M., 92, 107 367, 368, 373
Nishikawa, S., 60, 400 Oprian, D. D., 51
Nishikawa, Y., 367 Or, R., 59
Nishimune, Y., 195 Orci, L., 290
Nishimura, O., 367 Ordemann, R., 66
Niv, M. Y., 273 O’Reilly, T., 60
Nixon, C., 213, 236 Orimo, A., 10
Noble, W. S., 342 Orlicky, D. J., 300
Noda, M., 59, 290 Orschell, C. M., 61, 63, 64, 67, 73, 76
Noiman, S., 267, 269 Orsini, M. J., 60
Nolta, J. A., 80 Orsulic, S., 131
Nomiyama, H., 4 Orth, A., 419
Nonaka, Y., 270 Osman, N. I., 59
Norton, J. A., 175 Osterrieder, N., 165
Notarangelo, L. D., 63, 317 Otero, K., 63, 237, 239, 240, 317
Novotny, E. A., 137 Otto, C., 154
Nudelman, R., 269 Otto, S., 338
Nuovo, G. J., 69 Ou, C. Y., 127
Overvoorde, J., 381
O
P
Oakley, C. L., 199
Oberg, A., 107, 108, 117 Paavola, C., 212
Oberlin, E., 60, 401 Pablos, J. L., 63, 317
O’Bryan, S., 92 Padovani-Claudio, D. A., 92
Ocio, E. M., 59 Pagani, M., 117
Oelschlaegel, U., 60, 66 Page, C., 210, 212
Offermann, M. K., 127 Pages, F., 107
Offord, R. E., 24 Paing, M. M., 69, 414
Ogawa, Y., 367 Palani, A., 21, 33, 45, 46
Ogbureke, K. U., 118 Palczewski, K., 44, 264, 400
O’Hara, M., 237, 240 Palframan, R. T., 239
O’Hayre, M., 331, 333 Palike, H., 117
Ohyama, T., 291, 305 Palmer, P., 65
Oikawa, Y., 201 Palmieri, C., 127
Oishi, S., 399 Palmqvist, R., 107, 108, 117
Author Index 441

Pan, W. H., 348 Penick, E. C., 240


Pan, Y., 416 Perkins, H., 24, 36, 39
Panageas, K. S., 107 Peroni, O., 307
Pandey, A., 332, 333 Perros, M., 17, 20, 24, 26, 35, 36, 38, 39, 40, 42,
Pandey, M., 290 43, 44, 46, 48
Paniyadi, J., 198 Perruccio, F., 20, 24, 36, 38, 39, 43, 46, 48
Pantanowitz, L., 127 Pessin, M. S., 127
Panzer, U., 48 Peterson, J. W., 92
Papayannopoulou, T., 58, 62, 63 Petit, I., 59, 78
Paradela, A., 333, 338, 341 Petit, S. J., 415
Pardo, C. A., 92 Petropoulos, C. J., 24, 40, 44, 46
Parent, D., 232, 239 Pevzner, P. A., 340, 341
Parent, J. L., 60 Pezzotti, P., 127
Parenza, M., 118 Pflumio, F., 77
Parera, M., 359 Phair, R. D., 348
Parish, C. R., 210 Philipsen, S., 239
Park, H. S., 67 Phillips, J. C., 271
Park, J. H., 264 Philpott, N. J., 141
Park, L., 174 Piatier-Tonneau, D., 118
Park, M., 240 Picard, L., 24, 361
Parkin, N. T., 40 Picarella, D. E., 195
Parlee, S. D., 290, 291, 302, 304, 305, 306 Picchio, G. R., 24
Parmentier, M., 17, 291, 292, 361 Pichel, J. G., 49
Parnot, C., 271, 272 Pickart, C. M., 414, 415
Parolin, C., 60, 400 Pickford, C., 24, 36, 39
Parolini, S., 291 Pickup, D. J., 174
Parry, C. M., 174, 175, 176, 179, 194, 195 Pierce, K. L., 414, 419
Parry, N., 213 Pihlavisto, M., 28
Pashenkov, M., 92 Pike, L., 353
Pasqualini, F., 231 Pilaro, A. M., 226
Pasvolsky, R., 60 Pioro, E. P., 92
Patel, A., 107 Piret, J., 78
Patel, M. M., 127 Pirovano, S., 63, 317
Patel, S., 291 Pitman, M. C., 273
Patel, V., 127, 128, 137, 140, 141 Pittelkow, M. R., 63
Pati, S., 128 Piwnica-Worms, D., 67
Patterson, G. H., 380 Planchenault, T., 63, 317
Paulovich, A., 143 Platzbecker, U., 60
Pawson, T., 419 Pleskoff, O., 153, 162, 163
Paxton, W. A., 401 Plett, P. A., 61, 63, 64, 67, 73, 76
Payne, S. H., 335, 340, 341, 342, 343 Plowman, G. D., 332
Pease, J. E., 156, 174, 263, 415 Podhajcer, O. L., 118
Pease, L. R., 275 Pohjanoksa, K., 29
Pece, S., 137, 140 Poignard, P., 24
Peck, D., 107, 117 Pojda, Z., 61, 66
Pedley, R. B., 226 Pollard, D., 117
Pei, G., 402, 408 Pollard, J. W., 107
Peiper, S. C., 60, 399, 401, 402, 408 Pollok-Kopp, B., 362
Peired, A. J., 63 Polyak, K., 10
Pelchen-Matthews, A., 63, 154, 159, 359, 360, Pomeroy, S. L., 143
361, 364, 367, 368, 371, 373, 375 Ponath, P. D., 232, 239
Peled, A., 59, 61, 62, 78 Ponomaryov, T., 59
Pellett, P. E., 127 Poole, L. J., 134
Pellicer, A., 130 Poppe-Thiede, K., 66
Peltonen, J. M., 28 Porta, C., 4
Pelus, L. M., 60, 62, 65, 74, 76, 80 Power, C. A., 48, 210, 211, 358, 361, 400
Penfold, M. E., 60 Prada, F., 118
Peng, S. B., 61, 63 Premont, R. T., 414, 419
442 Author Index

Prentice, C. R., 290 Ratajczak, J., 60, 63


Prevo, B., 240 Ratajczak, M. Z., 60, 63
Priestley, G. V., 62, 63 Ratnal, V. R. P., 271, 272
Primrose, J. N., 290 Ravazzola, M., 290
Prince, H. M., 64, 65, 74 Ravid, R., 92
Prins, J. B., 291 Rawlinson, W. D., 165
Prior, J. L., 67 Ray, H., 307
Pristera, T., 127 Ray, P. E., 128, 131, 132, 134, 135
Proost, P., 201 Raz, E., 60, 401
Proudfoot, A. E., 17, 48, 92, 174, 194, 210, 211, Rebel, V. I., 73
359, 360, 361, 362, 364, 367, 371 Reca, R., 60, 63
Pruenster, M., 239 Reddy, V. A., 419
Prusoff, W., 158 Reeves, J. D., 359
Psaroudakis, G., 273 Regele, H., 361
Pugliese-Sivo, C., 33 Rehm, A., 154
Puigserver, P., 292 Reichman-Fried, M., 60, 401
Pullen, J. K., 275 Reinhardt, F., 118
Pullen, S., 34 Reinhart, T. A., 156
Pulley, S., 61, 63 Reitz, M., 128
Punzel, M., 65 Ren, D., 92
Purton, L. E., 74, 75, 76, 77 Ren, J., 80
Pusic, I., 68 Repasky, E. A., 118
Putz, M. M., 174 Resnick, I., 59
Pyo, R., 203, 204 Rettig, M. P., 57, 59, 61, 63, 67, 68, 69, 80
Reynolds, C. A., 273
Q Rezza, G., 127
Ribeiro, S., 269, 270
Qamhieh, H. T., 290
Riboldi, E., 291
Qian, D., 67
Riboldi-Tunnicliffe, A., 245
Qian, W. J., 342
Richards, A. A., 291
Qin, S., 232, 239
Richardson, A. L., 10
Quitoriano, M. S., 63
Richardson, R. M., 60
Richmond, A., 118, 210, 315, 317, 318,
R
319, 326, 327, 328, 347, 348
Raaijmakers, J., 419 Richter, R., 291
Raaka, E. G., 127, 128, 130, 137, 153 Rickett, G., 17, 19, 20, 22, 24, 26, 29, 30,
Radford, K. W., 127 33, 34, 35, 36, 39, 40
Rafii, S., 63, 401 Rieth, C., 67
Ragg, T., 142 Rintelen, F., 210, 211
Rahill, B., 159 Ritchey, J. K., 61, 67, 68, 69, 80
Raiborg, C., 360, 414, 415, 416, 417, 419, 420 Ritchie, A., 10
Rajarathnam, K., 174, 176, 187 Robas, N., 24, 36, 39, 46
Rall, G., 66 Robb, L., 64
Raman, D., 210, 315, 317, 318, 319, 326, 328 Robbins, K. C., 137
Ramani, N., 198 Roberts, A., 66
Ramezani, A., 65 Roberts, A. W., 64
Ramirez, P., 57, 67 Robichaud, J., 184, 188
Ramirez, P. A., 61, 67, 68 Robinson, P. J., 338, 339
Ramos, M. J., 270 Robinson, S. N., 65
Ramsdell, A. K., 128, 137, 138, 143 Robson, L., 226
Randolph-Habecker, J. R., 159 Rockey, W. M., 270
Rani, M. R., 92 Roden, R. B., 107
Rani, R. M., 92 Rodenhuis, S., 73
Ranieri, E., 128 Roderburg, C., 60
Ransohoff, R. M., 60, 91, 92, 232 Rodger, E., 63, 67
Rao, P., 91 Roepstorff, P., 338
Rapp, C. S., 271, 274 Rogers, R. C., 92
Rasmussen, S. G., 264, 400 Rognan, D., 267, 270
Author Index 443

Roh, S. G., 292 Salowsky, R., 142


Rollins, B. J., 92, 198, 239 Salvatierra, E., 118
Romantseva, T., 416 Salwen, H. R., 118
Romero, P., 388, 390 Samad, F., 290
Rommel, C., 210, 211 Samanta, M., 152
Ronnstrand, L., 307 Samatova, N. F., 342
Root, H., 17 Samjanovich, S., 380
Rose, M., 210, 212 Sampaio, K. L., 166
Rosen, E. D., 292 Samson, M., 291
Rosenbaum, D. M., 264, 400 Samuel, S., 59
Rosenkilde, M. M., 63, 135, 152, 153, Sanchez-Cabo, F., 107, 117
154, 155, 162, 359, 360 Sandbank, J., 59
Rosenthal, J., 67 Sanders, J., 65
Ross, F. P., 60, 63 Sandler, S., 200
Ross, J. S., 290, 291 Sangaletti, S., 118
Ross, M. M., 338 Sankuratri, S., 44, 45
Rossi, D., 106 San Miguel, J. F., 59
Rossini, A. A., 200 Sano, G., 198
Rot, A., 59, 194, 213, 232, 236, 237, 239, 240, Santamaria, P., 200
246, 247, 248 Santini, F., 360, 415, 416, 417, 419, 420
Roth, B. L., 264, 271 Santomasso, B., 127, 128, 130, 137, 153
Rotstein, D., 44, 45 Santoro, A., 291
Rovin, B. H., 159 Saraiva, M., 174, 184
Rowley, S., 65 Saran, N., 415
Rowlings, P. A., 67 Sardiu, M. E., 342
Roychowdhury, S., 69 Sarmati, L., 127
Royle, S. J., 240 Saruta, T., 201
Rozenberg, F., 92 Sasaki, S., 292
Ruchti, F., 153, 165 Sasaki, Y., 76
Rucker, J., 291 Sasse, M. E., 92, 232
Ruckle, T., 210, 211 Satomi, S., 197
Ruiz-Arguello, M. B., 174, 184, 185, 188 Sauer, B., 48, 49
Rukavina, D., 232, 233, 238 Sausville, E. A., 127, 128, 134, 137, 140, 141
Rumio, C., 118 Savelkouls, K. G., 165
Ruscetti, F., 317 Savino, B., 231, 236, 240, 241
Ruse, C. I., 340 Savola, J. M., 29
Russo, R. C., 231 Sawada, H., 367
Rutt, C., 66 Sawai, E. T., 127, 128, 131, 132, 134, 135, 137,
Ruzsics, Z., 165 138, 140, 141, 143
Scadden, D. T., 58, 60, 61, 74, 75, 76, 77
S Schaack, J., 300
Schaer, C. A., 240
Sabbe, R., 24 Schaer, D. J., 240
Sadowska, M., 128 Scheerer, P., 264
Sadygov, R. G., 342 Scheffner, M., 419
Saelzler, M. P., 118 Scheinin, M., 28, 29
Saffrich, R., 60 Schena, A., 128
Sage, E. H., 118 Schena, F. P., 128
Sai, J., 210, 315, 317, 318, 319, 326, 327, 328 Schertler, G. F., 264
Sakmar, T. P., 265 Schiffman, K., 65
Salanga, C. L., 331, 333 Schinke, B., 291
Salari, H., 60, 62 Schioth, H. B., 60, 400
Salassa, B., 127 Schipani, E., 59
Salcedo, R., 4 Schleuder, D., 291
Sale, H., 19, 33, 34 Schlondorff, D., 359, 361, 362, 364
Salerno, A., 235, 239 Schlyer, S., 264, 266, 270
Sali, A., 266, 269 Schmelzle, K., 335, 344
Sallusto, F., 358 Schmidt, A., 198
444 Author Index

Schmittgen, T. D., 304 Shabanowitz, J., 338


Schmitz, N., 66 Shacham, S., 267, 269
Schneider, A., 59 Shalekoff, S., 70
Schneider, P., 67 Shaner, N. C., 380, 384
Schober, A., 60, 210, 213 Shang, L., 193, 198
Schoedon, G., 240 Shannon, W. D., 68, 69, 80
Scholten, D. J., 156 Shapira, M. Y., 59
Schooley, K., 174 Shapiro, S., 33
Schottelius, A. J., 118 Sharadendu, A., 269
Schreiber, A., 151, 332, 333, 342 Shargill, N. S., 291
Schreiber, R. D., 107 Sharif, W. W., 203
Schroeder, A., 142 Sharma, S. K., 226, 270
Schubel, A., 70, 72 Sharron, M., 291, 361
Schulte, G., 358 Shaw, J. P., 48
Schulten, K., 273 Shelenkov, A. A., 268
Schutyser, E., 317 Shellam, G. R., 165
Schwartz, O., 60, 401 Shen, H., 60, 61
Schwartz, R. A., 127, 134 Shen, M. Y., 266, 269
Schwartz, T. W., 63, 128, 135, 153, 154, 155, Shen, R. F., 341
156, 159, 160, 162, 359, 360 Shenk, T., 175, 176, 184
Schwartzberg, L., 65 Shenoy, S. K., 414, 416, 421
Schwarz, M. A., 195, 198, 204 Shepard, L. W., 143
Schwarz, M. K., 210, 211, 270 Sheridan, W. P., 67
Schwede, T., 212 Shi, W., 342
Schyler, S., 269, 270 Shieh, J. H., 63
Scolnick, E. M., 160 Shigihara, T., 201
Scott, C., 64 Shilton, B., 184, 188
Scott, M. A., 65 Shimada, A., 201
Scott Worthen, G., 160 Shimizu, S., 92
Scuderi, L., 127, 134 Shin, J. W., 80
Sechler, J. M., 63, 128 Shinder, V., 59, 194
Seckinger, A., 60 Shindo, M., 59
Sedat, J. W., 327 Shinobu, N., 59
Sedgwick, J. D., 198 Shipman, M., 371
Sedmak, D. D., 159 Shiraishi, M., 367
Seeger, T., 80 Shire, D., 273
Seet, B. T., 174, 184, 188, 211, 212, 213 Shizuru, J. A., 65, 69
Segal, B., 91 Shokat, K. M., 128
Segal, D., 292 Short, B., 60, 63
Segal, R. A., 60 Short, S. T., 317
Segerer, S., 361 Shoshan, S., 59
Seibert, C., 21, 45, 46 Shu, H., 340, 341
Seita, J., 65, 76, 77 Shu, W., 401
Selchau, V., 269, 270 Shulman, Z., 60
Sellebjerg, F., 92 Shultz, L., 59
Selvaraju, R., 92 Shultz, L. D., 77, 78
Semerad, C. L., 60, 63 Sica, A., 106, 107, 117
Sempek, D. S., 68 Siciliano, S. J., 157
Serabian, M. A., 226 Siebert, F., 265
Serrano-Vega, M. J., 264 Siegel, P. M., 401
Servant, G., 327 Sierro, F., 60
Servitja, J. M., 128, 137, 138, 143 Sigel, R. M., 384
Seto, M., 367 Signorelli, P., 237, 238, 239, 240
Setoh, P., 361 Signoret, N., 63, 357, 359, 360, 361, 362, 364,
Sewing, A., 39 365, 367, 368, 371, 373
Sexton, P. M., 264, 271 Sikora, K., 92
Sgroi, D. C., 10 Silverstein, S., 130
Author Index 445

Simas, J. P., 174, 175, 176, 179, 194, Soto, H., 401
195, 198, 204 Sousa, S. F., 270
Simmons, G., 359, 361, 362, 364 Sozzani, S., 60, 63, 106, 107, 117, 201, 237, 239,
Simmons, P. J., 58, 60, 63 240, 291, 317
Simone, J., 381 Spaltro, J., 294, 296
Simpson, C. V., 237, 240, 261 Speck, S. H., 174, 175, 176, 194
Sims, O. L., 379 Spedding, M., 264, 271
Sinal, C. J., 289, 290, 291, 302, 304, 305, 306 Spiegel, A., 60, 78
Singh, R., 184, 188, 211, 212 Spiegelman, B. M., 291, 292
Sinzger, C., 166 Spira, T. J., 127
Sireci, G., 235, 239 Spits, H., 69
Sironi, M., 237, 239, 240, 291 Spodsberg, N., 291
Sitkoff, D., 266 Spradling, A. C., 58
Sixma, T. K., 415 Sprague, G. F., Jr., 402
Skolnick, J., 270 Springer, M. S., 157, 361
Skrabanek, L., 273 Springer, T. A., 60, 400
Slot, J. W., 374 Srour, E., 73
Smailbegovic, A., 210, 212 Stahl, R. A., 48
Smit, M. J., 151, 152, 153, 154, 155, 156, 160, Stallone, G., 128
162, 163, 164, 165 Stangassinger, M., 359, 361, 362, 364
Smith, A. L., 68 Stauber, R. H., 360
Smith, C. A., 174 Staugaitis, S. M., 92
Smith, D., 40 Stebler, J., 401
Smith, E., 67 Steen, H., 332, 333
Smith, G. L., 174, 175, 176, 178, 179, 181 Steensma, R. W., 33
Smith, L., 226 Stehouwer, C. D., 291
Smith, M. J., 154, 156 Stein, A., 67
Smith, P., 153, 165 Stein, E. J., 92
Smith, R. D., 342 Stein, J. V., 316
Smith, T. D., 174 Steinbach, P. A., 384
Smith, V. P., 174, 175, 176, 179, 184, 185, 188, Steinmetz, O. M., 48
194, 195 Stenkamp, R. E., 44, 264, 400
Smith-Burchnell, C., 19, 20, 22, 24, 26, 29, 30, Stenling, R., 107, 108, 117
33, 40, 43, 44, 46 Stenmark, H., 360, 415, 416, 417, 419, 420
Smits, R. A., 162 Sternweis, P. C., 136
Smolak, P. J., 174 Stevens, M. J., 273
Smolka, M. B., 335, 340, 341, 342, 343 Stevens, R. C., 264, 400
Smrcka, A. V., 136 Stewart, C. A., 174, 175, 176, 179, 194, 195
Snyder, D., 67 Stiff, P. J., 67
Snyder, P. M., 416, 421 Stine, J. T., 359
Snyderman, R., 60 Stinson, V. L., 290
Sobolik-Delmaire, T., 210, 317, 318, 319 Stockdale, M., 24, 40, 43, 44, 46
Sodek, J., 118 Stocker, S., 142
Soderberg-Naucler, C., 152, 153, 165 Stockerl-Goldstein, K. E., 68
Sodhi, A., 127, 128, 131, 132, 134, 135, 137, 138, Stockschlader, M., 67
140, 141, 143 Stoebenau-Haggarty, B., 361
Sodroski, J., 51, 60, 400 Storb, R., 65
Sohngen, D., 67 Stordeur, P., 291
Sole, J., 290, 291 Storelli, S., 156
Solinas, G., 4 Storey, J. D., 342
Soloway, M. S., 119 Strange, P. G., 21, 28, 30
Somlo, G., 67 Streblow, D. N., 153, 156, 165
Song, S. H., 292 Stremler, M., 327, 328
Song, T., 342 Strieter, R. M., 4, 92, 118
Srensen, T., 92 Strittmatter, E. F., 342
Srensen, T. L., 92 Strizki, J. M., 29, 30, 33
Soresina, R., 63, 317 Stroncek, D. F., 80
Soria, G., 3, 4 Stropes, M. P., 154, 155
446 Author Index

Strupeck, J., 67 Tan, W., 138


Struyf, S., 4 Tanaka, J., 59
Stryer, L., 381, 382 Tanaka, M., 290
Stuart, D. I., 174 Tang, K., 92
Studts, J. M., 194 Tani, M., 92
Stukenberg, P. T., 338 Taniuchi, I., 60, 400
Stupple, P., 20, 38, 43, 48 Taniuchi, S., 63, 317
Su, Y., 317 Tanner, S., 335, 340, 341, 342, 343
Subramanian, A., 143 Tannous, B. A., 353
Sudarsanam, S., 332 Tarasova, N. I., 360
Sugamura, K., 78 Tartaglia, L. A., 290, 291
Sugihara, M., 264 Tashiro, K., 63
Sugiyama, T., 59 Tassone, L., 63, 317
Sullivan, A., 10 Taswell, C., 74
Sullivan, L., 128, 153, 196 Tate, C. G., 264
Sultan, H., 24, 36, 39 Tateno, M., 63
Summers, B. C., 60 Taubman, M. B., 203, 204
Sun, C., 118 Taylor, L., 419
Sun, L., 153, 159 Taylor, R. C., 107
Sun, Y. Z., 59 Tee, A., 39
Sung, J., 69 Teleshova, N., 92
Sunnemark, D., 92 Teller, D. C., 44, 264, 400
Sunshine, M. J., 60 Temple, B. R., 69, 414
Sutherland, H. J., 73 Teng, M., 291
Sutton, R. E., 401 Tensen, C. P., 156
Suzue, K., 78 Teramoto, H., 139
Swaminath, G., 271, 272 Terhorst, C., 65, 386
Swanberg, S. L., 60 Terstappen, L. W., 66
Sweeney, E. A., 62, 63 Tertoolen, L. G. J., 381
Swerdel, M. R., 198 Thacker, J. D., 73
Swofford, R., 384 Tham, T. N., 92
Symons, J. A., 174, 175, 176, 178, 179, 181 Thelen, M., 60, 316, 332
Sypula, J., 174 Thian, F. S., 264, 400
Szalkowski, D. M., 291 Thiele, K. P., 67
Szer, J., 66, 67 Thingholm, T. E., 338, 339
Szilvassy, S. J., 74 Thomas, A., 24, 36, 39
Szollosi, J., 380, 388, 390 Thomas, J., 361
Thomas, R. J., 270
T Thomas, S. A., 63
Thompson, D. A., 24
Tabellini, G., 291 Thornton, J. M., 274
Tachibana, K., 60, 400 Thrall, B. D., 342
Tadokoro, Y., 65, 76, 77 Thusu, K., 290
Tagat, J. R., 21, 29, 30, 33, 45, 46 Tian, H., 40
Taichman, R. S., 59 Tian, Y., 118
Tajkhorshid, E., 273 Tiemessen, C. T., 70
Takahashi, K., 292 Tiffany, H. L., 19, 33, 174, 175, 176, 194
Takahashi, M., 292 Tigue, C. C., 59
Takahashi, Y., 292 Timmerman, H., 153, 154, 156, 160
Takakura, N., 60, 400 Tindle, S., 65
Takamatsu, Y., 58, 60 Ting, R., 317
Takano, H., 65, 76, 77 Tirelli, U., 359
Talbot, S., 361 Tischer, B. K., 165
Tallman, M. S., 59 To, L. B., 67
Tamamura, H., 402, 408 Todd, G., 65
Tamayo, P., 143 Todd, K., 24, 36, 39
Tan, G., 290, 291 Todt, L., 68, 69, 80
Tan, M., 416 Toews, M. L., 157
Author Index 447

Tolner, B., 226 Vaidehi, N., 263, 267, 269, 270, 272,
Toner, M., 327 273, 274, 285
Topf, M., 267 Vainchenker, W., 69, 77
Torok-Storb, B., 159 Vakili, J., 361
Torrance, D., 174 Vally, H., 165
Torre, Y., 232, 233, 238 Vamosi, G., 380
Tosolini, M., 107, 117 van Berkel, V., 174, 175, 176, 194
Towers, P., 180 Vance, P. J., 361
Trabanino, R., 267, 269, 270, 272, 285 van Cleef, K. W., 165
Trabanino, R. J., 270 van Dam, C. M., 162
Tran, P. B., 92 Van Dam, J. G., 165
Tran, T., 63, 359, 360 Van Damme, J., 4, 237
Trapp, B. D., 92 Vandercappellen, J., 4
Trebst, C., 92 van der Lelie, H., 73
Trebst, D., 92 Vanderplasschen, A., 174, 178, 180
Trejo, J., 69, 414, 417 van der Ryst, E., 17
Tremblay, C., 33 van der Schoot, C. E., 73
Trent, J. O., 237, 238 Vanderwinden, J. M., 361
Tricot, G., 65 van de Water, B., 332
Trifilio, S. M., 59 Van de Water, L., 327
Trkola, A., 21, 45, 46 van Dongen, G. A., 153, 162, 163
Troost, D., 92 van Heteren, J., 154
Trowbridge, I. S., 371 van Heteren, J. T., 92
Trujillo, J., 317 Van Meter, M. J., 92
Trumpp, A., 58 van Os, R. P., 65, 73
Tsai, S., 317 van Walsum, M., 153, 162, 163
Tsai, T. W., 66 Van Zant, G., 61, 66
Tsamis, F., 21, 45, 46 Varma, A., 127, 135
Tsien, R. Y., 384 Varmus, H. E., 131
Tsuji, K., 78 Varty, G., 33
Tsukada, N., 333, 334 Vassart, G., 17, 291, 361
Tsung, K., 175 Vassileva, G., 128, 198
Tubo, R., 10 Vecchi, A., 107, 232, 233, 235, 236, 237, 238,
Tucky, B., 92 239, 240, 291
Tulone, C., 165 Velds, A., 415
Turner, J. E., 48 Vellenga, E., 61, 66
Turner, P., 213 Venherle, S. J., 165
Tyldesley, R., 291 Venkataramanan, V., 416, 421
Tyrberg, B., 200 Verani, A., 359
VerBerkmoes, N. C., 342
U Verhaegent, M., 353
Uberbacher, E., 342 Verhasselt, V., 291
Uchida, S., 290 Verheij, M. H., 160
Ueda, Y., 317 Vermi, W., 291
Ueki, K., 290 Verola, O., 63, 317
Ueyama, Y., 78 Versnel, M. A., 201
Ulbrich, A., 419 Vervecken, W., 226
Unger, R. H., 290 Verzijl, D., 153, 156, 160, 162, 163, 165
Unutmaz, D., 361, 401 Vesole, D., 65
Upton, C., 211 Victor, S. M., 307
Urban, J. D., 264, 271 Vieira, J., 153, 159, 165
Urdal, D. L., 178 Viejo-Borbolla, A., 173, 193
Uy, G. L., 59, 63, 67, 68 Vij, R., 68, 69, 80
Vilardaga, J. P., 381
V Villa, C., 264
Vincent, L., 128
Vago, L., 232, 233, 238 Vink, C., 165
Vaida, B., 165 Virelizier, J. L., 60, 153, 159, 401
448 Author Index

Virgin, H. I., 174, 175, 176, 194 Washington, R. H., 128


Virgin, H. W., 194, 213 Watier, H., 59
Vischer, H. F., 151, 154, 156, 160, 168 Watkins, R., 33
Viskari, P. J., 383 Watson, C., 33, 34
Vita, C., 153, 159 Watt, S. M., 59
Vitry, S., 92 Wavre, S., 360, 368, 373
Vo, A. P., 10 Wavre-Shapton, S. T., 357
Voermans, C., 73 Weaver, C., 65
Vogel, J. U., 152 Weaver, C. H., 65
Vogel, R., 265 Webb, B., 266, 269
Volk, A. L., 152 Webb, L. M., 175, 184, 187
von Andrian, U. H., 239, 246 Weber, C., 210, 213
von Einem, J., 165, 166 Weber, J. M., 59
von Kalle, C., 78 Weber, M., 237, 240, 246, 247, 248, 249, 250,
von Zastrow, M., 264, 271, 359, 414 251, 252, 253, 254, 255, 256
Vormoor, J., 77 Webster, R., 19, 20, 22, 24, 26, 29,
Voyno-Yasenetskaya, T., 143 30, 33, 40
Vriend, G., 269 Weersing, E., 61, 66
Vulcano, M., 237, 291 Weh, H. J., 67
Wehde, M., 65
W Wei, K., 60
Wei, T., 92
Wadden, T., 290 Wei, Y., 416
Wagner, L., 342 Weibrecht, K. W., 59
Wagner, M., 165 Wein, F., 60
Wagner, N., 29, 30, 33 Weinberg, R. A., 10, 118
Wagner, S. N., 401 Weiner, O. D., 327
Wagner, W., 60, 80 Weinhardt, S., 80
Wai, P. Y., 118 Weinstein, H., 264, 269, 271, 273
Wakabayashi, E., 153, 165 Weinstock, R., 290
Wakefield, J. K., 326 Weis, W. I., 264, 400
Waki, H., 290 Weiss, C., 210, 211
Wald, H., 61, 62 Weiss, I. D., 61, 62
Walder, K., 292 Weissleder, R., 353
Waldhoer, M., 152, 154, 155, 156, 160, 360 Weissman, A. M., 416, 421
Walker, B. D., 60 Weissman, I. L., 65, 69
Walker, G., 326, 328 Wellen, K. E., 291
Walker, G. M., 327, 328 Wells, T. N., 48, 63, 92, 194, 210, 211
Walkey, C. J., 292 Wells, T. N. C., 359, 360, 361, 362, 364
Wallström, E., 92 Wendland, M., 291
Wang, D., 175, 176, 184 Weninger, W., 239
Wang, E., 80 Wenz, F., 80
Wang, G., 341 Werb, Z., 106, 107
Wang, H., 213 Wernet, P., 67
Wang, J., 59, 61, 63, 92, 416 Wernstedt, C., 307
Wang, J. C., 77 West, G., 66
Wang, L. C., 340, 341 West, W., 65
Wang, M. Y., 290 Westby, M., 17, 19, 20, 22, 24, 26,
Wang, S., 67 29, 30, 33, 36, 38, 39, 40, 43,
Wang, W., 342 44, 46, 48
Wang, X., 134 Westervelt, P., 68, 69, 80
Wang, Y., 60 Westphal, H., 49
Wang, Z., 399, 402 Whistler, J. L., 154, 155
Warming, S., 165 Whitcomb, J. M., 24, 40, 44, 46
Warne, J. P., 290 White, F. M., 335, 338, 341, 344
Warne, T., 264 White-Carrington, S., 291
Warshaviak, D., 267 White-Cooper, H., 58
Washburn, M. P., 342 Whitehead, G. S., 247
Author Index 449

Whitehead, J. P., 291 X


Whitesides, G. M., 327
Whiting-Theobald, N. L., 63 Xia, W., 416
Whittaker, M., 270 Xia, Z., 380
Whittaker, P. A., 294 Xiao, K., 416, 421
Wiekowski, M., 128, 153, 196, 213, 236 Xiao, X. L., 77
Wiekowski, M. T., 195, 198, 203, 204 Xiao, Y., 33
Wigler, M., 130 Xie, P., 143
Wikswo, J., 317, 319, 326, 327, 328 Xie, T., 58
Wilburn, B. P., 203 Xu, E., 107
Wilhelm Doerr, H., 152 Xu, H., 290, 291
Wilken, J., 24 Xu, J., 107
Wilkens, M., 61, 66 Xu, M., 342
Wilkinson, D., 361 Xu, Q., 60
Williams, B. O., 131 Xu, S., 29, 30, 33, 294
Williams, D. A., 77 Xu, T., 340
Williams, R. C., 383 Xu, Y., 198
Williams, T. J., 174, 175, 176, 179, 181, 415 Xue, C., 402
Wilson, A., 58
Y
Wilson, D., 60
Wilson, P. A., 117 Yamada, S., 201
Wilson, S. B., 201 Yamamoto, K., 290
Wind, P., 107, 117 Yamamoto, M., 44, 264, 400
Wing, R. R., 290 Yamamoto, T., 270
Winkler, I., 60, 63 Yamashita, S., 290
Winkler, I. G., 58 Yamauchi, T., 290
Winslow, G. A., 40 Yamazaki, S., 65, 76, 77
Wirthlin, L., 80 Yan, L. Z., 61, 63
Wise, E. L., 174, 269, 270, 415 Yang, D., 290, 291
Wittamer, V., 291, 292, 361 Yang, J., 232, 237, 347, 348
Woehl, B., 60 Yang, K., 265, 272
Wohlschlegel, J. A., 340 Yang, L., 342
Wojciechowski, M., 270 Yang, M., 143
Wojcik, L., 29, 30, 33 Yang, O. O., 60
Wolf, C., 338 Yang, Q., 118, 290, 291
Wong, D., 60, 62 Yang, T. Y., 128, 153, 196
Wong, F. S., 195 Yang, X., 342
Wood, B., 63, 67 Yao, X., 271, 272
Woolf, T. B., 273 Yao, X. J., 400
Worth, D., 304 Yarchoan, R., 128
Worthen, G. S., 159 Yates, J. R. III, 340, 342
Wright, H. M., 292 Yau, M., 335, 341, 342, 343
Wright, M., 292 Ye, M., 338
Wrin, T., 40 Ye, R. D., 143
Wu, K. K., 290 Yeaman, S. J., 307
Wu, L., 51 Yeh, S. W., 383
Wu, M., 291 Yeung, B., 419
Wu, T. C., 107 Yilmaz, O. H., 65
Wu, W. W., 341 Yim, J. H., 175
Wu, X., 326, 381, 384 Yoder, M. C., 73
Wujek, J., 92 Yoneyama, H., 201
Wunder, E., 66 Yoon, J. W., 200
Wurdinger, T., 353 Yoshida, H., 59, 60, 400
Wurster, S., 29 Yoshida, N., 60, 400
Wyatt, R., 51 Yoshie, O., 4
Wylie, S. M., 232, 237 Young, D., 66
Wysoczynski, M., 60, 63 Yu, D., 416
450 Author Index

Yu, J., 107, 419 Zhang, Z., 341


Yu, Y., 317 Zheng, J. C., 92
Yu, Y. H., 293 Zheng, W., 160
Yuan, R., 74 Zhong, R., 60, 62, 213
Yuan, W., 401 Zhong, R. K., 74, 76
Yudkin, J. S., 291 Zhou, B. P., 416
Zhou, H., 335, 338, 340, 341, 342, 343
Z Zhou, X., 416
Zhou, Z. L., 92
Zabel, B. A., 290, 291, 302, 304, 305, 306 Zhu, H., 293
Zaborski, P., 118 Zhu, Y., 245
Zacharias, D., 384 Ziccardi, P., 291
Zage, P., 118 Ziegler, H., 165
Zaitseva, M., 416 Zimmer, K., 66
Zaja-Milatovic, S., 317 Zimmet, P., 292
Zalamea, P., 203 Zinzindohoue, F., 107, 117
Zaman, G. J., 156 Zipeto, D., 153, 159
Zamanakos, G., 267, 269, 270, 272, 285 Ziprin, P., 107, 117
Zamboni, W. C., 66 Zlotnik, A., 4, 106
Zander, A., 66 Zohar, M., 127, 128, 137, 140, 141
Zander, A. R., 67 Zohar, R., 118
Zandi, E., 340, 341 Zolotaryov, F. N., 292
Zanussi, S., 359 Zong, J. C., 134
Zaratin, P., 210, 212 Zou, H., 338
Zeller, W., 67 Zou, Y. R., 60, 400
Zeller, W. J., 80 Zsak, M., 59
Zerboni, R., 127 Zuniga, L., 291, 305
Zernecke, A., 60, 210, 213 Zvaifler, N. J., 333, 334
Zhang, B., 291, 342 Zwahlen, R., 60
Zhang, J., 44, 45, 60, 63 Zweerink, H., 239
Zhang, W. B., 402, 408 Zybailov, B., 342
Zhang, Y., 69
Subject Index

A fluorescence measurement, 23
materials, 50
Adipokine overview, 19, 22
chemerin, see Chemerin cytomegalovirus-encoded G protein-coupled
functional overview, 290 receptor signaling assay, 160
AIP4, see Atrophin-interacting protein–4 CCL3, colorectal cancer expression studies,
Akt, activation assay via Kaposi’s 112, 114, 117
sarcoma-associated herpesvirus-encoded CCL4, colorectal cancer expression studies,
G protein-coupled receptor, 137–138 112, 114, 117
Atrophin-interacting protein–4, CXCR4 CCR1, ligand docking modeling of small
ubiquitin ligase activity, 419–421 molecule binding, 270–271
CCR5
B antagonists, 20–22
Bacterial artificial chromosome mutagenesis, antiviral assays
cytomegalovirus-encoded G antagonist resistance assay, 42–43
protein-coupled receptor, 165–167 human immunodeficiency virus stock
Biacore, see Surface plasmon resonance expansion and storage, 42
Breast cancer materials, 51
chemokine transfection in human cell lines primary cell preparation
cell culture, 8 monocyte-derived macrophages, 41
cell preparation, 7–8 peripheral blood lymphocytes, 40–41
chemokine quantification, 9 reverse transcriptase assay, 41–42
materials, 6–7 calcium signaling assay
microporation overview, 5–6 cell culture and transfection, 22–23
technique, 8 data analysis, 23
xenograft models dye preparation and loading, 23
human cell lines, 9–10 fluorescence measurement, 23
primary tumor formation using T47D cells materials, 50
inoculation, 12 overview, 19, 22
materials, 11 cell lines for expression, 362–363
mouse handling, 11 cognate ligands, 22
overview, 10 cyclic AMP response element-luciferase
tumor cell preparation, 11–12 reporter gene assay
tumor growth and survival assays, 12 data interpretation, 32–33
pulmonary metastasis model using luminescence measurement, 32
MDA-MB–231 cells materials, 51
inoculation, 14 plate preparation, 32
materials, 12–13 principles, 30–31
metastasis formation assay, 14–15 transient transfection, 31–32
mouse handling, 14 degradation assays
tumor cell preparation, 14 immunofluorescence microscopy, 370–371
Western blot, 369–370
C detection techniques, 360–362
endocytosis
Calcium flux electron microscopy
CCR5 signaling assay cell surface replicas of whole-mount
cell culture and transfection, 22–23 preparations, 372–372
data analysis, 23 immuno-gold labeling of cryosections,
dye preparation and loading, 23 374–375

451
452 Subject Index

CCR5 (cont.) Chemerin


membrane sheet preparation, 372–374 cell model for adipogenesis and adipocyte
overview, 364, 371 metabolism, 292–293
flow cytometry, 363, 366 functional overview, 291–292
immunofluorescence microscopy, 363–365 receptor, see Chemokine-like receptor–1
mechanism, 360 RNA interference
GTP-associated inverse agonism assay, adenoviral vectors
28–30, 51 design, 294
human immunodeficiency virus testing, 298–299
coreceptor, 359 titration, 294–296
gp160–CCR5-mediated cell–cell fusion adipocyte metabolism effects, 307–308
assay, 38–40, 51 adipogenesis effects, 306–307
internalization assay cell preparation and maintenance, 299–300
cell culture, 24 materials, 297–298
clinical analysis of agonist-dependent postdifferentiation knockdown studies,
functional receptor occupancy 304–306
dosing and sampling regimen, 27 predifferentiation knockdown studies,
fluorescence-activated cell sorting, 28 300, 302
principles, 25–26 principles, 293–294
data analysis, 25 RNA isolation and quantification, 302–304
fluorescence-activated cell sorting, 24–25 safety precautions, 298
materials, 50 Chemokine-binding proteins, see Viral
overview, 24 chemokine-binding proteins
knockin human CCR5 mice Chemokine-like receptor–1
overview, 48 cell model for adipogenesis and adipocyte
vector construction, 48–49 metabolism, 292–293
embryonic stem cell transfection, 49 ligand, see Chemerin
materials, 52 RNA interference
ligand-binding assays adenoviral vectors
human immunodeficiency virus design, 294
gp120-binding assays testing, 298–299
functional occupancy characterization titration, 294–296
in vitro, 37–38 adipocyte metabolism effects, 307–308
gp120 assay, 36 adipogenesis effects, 306–307
materials, 51 cell preparation and maintenance, 299–300
overview, 35–36 materials, 297–298
time-resolved fluorescence postdifferentiation knockdown studies,
immunoassay, 36–37 304–306
radioassays predifferentiation knockdown studies,
antagonist binding and dissociation, 34 300, 302
chemokine ligands, 33–34 principles, 293–294
surface plasmon resonance RNA isolation and quantification, 302–304
antibody immobilization, 34 safety precautions, 298
data analysis, 35 Chemokine receptors, see CCR1; CCR5;
ligand binding, 35 Chemokine-like receptor–1; CXCR2;
materials, 51 CXCR4; CXCR7; D6; G protein-coupled
ligand docking studies receptors; Phosphoproteomics
computer modeling, 43–44, 46–47 Chronic lymphocytic leukemia, CXCL12
cyclic AMP response element-luciferase signaling phosphoproteomics in cells
reporter gene assay, 46 cell isolation, 334
materials, 51–52 CXCL12 stimulation, 334–335
site-directed mutagenesis, 45 functional annotation of data, 344
structural model generation, 44–45 high-performance liquid chromatography of
transfection of human embryonic kidney phosphopeptides, 339–340
cells, 45–46 immobilized metal affinity chromatography
recycling assays enrichment of phosphopeptides
flow cytometry, 368 bead preparation, loading, and elution, 337
immunofluorescence microscopy, 367 C18 cartridge cleanup, 337
Subject Index 453

denaturation, reduction, and alkylation, high-performance liquid chromatography of


335–336 phosphopeptides, 339–340
metals for elution, 338 immobilized metal affinity chromatography
sequential elution, 339 enrichment of phosphopeptides
trypsin digestion, 336–337 bead preparation, loading, and elution,
lysate preparation, 335 337
principles, 333–334 C18 cartridge cleanup, 337
protein classification with Database for denaturation, reduction, and alkylation,
Annotation, Visualization, and Integrated 335–336
Discovery, 343 metals for elution, 338
tandem mass spectrometry sequential elution, 339
database search program selection trypsin digestion, 336–337
considerations, 342–343 lysate preparation, 335
InsPecT identification of phosphopeptides, principles, 333–334
340–342 protein classification with Database for
running conditions, 339–340 Annotation, Visualization, and
CLL, see Chronic lymphocytic leukemia Integrated Discovery, 343
CMLKR1, see Chemokine-like receptor–1 tandem mass spectrometry
Coimmunoprecipitation, CXCR2 and binding database search program selection
proteins, 321 considerations, 342–343
Colorectal cancer InsPecT identification of
chemokine and receptor expression studies phosphopeptides, 340–342
CCL3, 112, 114, 117 running conditions, 339–340
CCL4, 112, 114, 117 receptor, see CXCR4
cell culture and tissue collection/processing, stem cell mobilization, see Hematopoietic stem
108 cell
CXCL8 expression CXCR2
analysis, 112, 114, 117–118 chemosynapse overview, 317–318
correlation with osteopontin and secreted proteomic screening for chemosynapse adaptor
protein acidic and rich in cysteine proteins, 318–320
expression, 116–119 protein–protein interactions
regulation, 115 coimmunoprecipitation, 321
enzyme-linked immunosorbent assay, 110 colocalization in dHL–60 cells
low-density array analysis, 108–113 confocal microscopy, 322
quantitative real-time polymerase chain polarization in Zigmond chamber, 321
reaction, 109, 112, 114 glutathione S-transferase pulldown assays
rationale, 107 fusion protein constructs, 322–323
statistical analysis, 110 fusion protein production, 323
inflammation and immune response, pull down, 324
106–107 site-directed mutagenesis of residues at
Confocal microscopy interface, 324–325
CXCR2 and binding proteins, 322 radioactive phosphorylation of interacting
D6, 234, 238, 253 proteins, 325–326
knockout mice, 235–239 chemotaxis assays of ligand effects
CR, see Colorectal cancer Boyden chamber, 326–327
CRE, see Cyclic AMP response element micro fluidic gradient device, 327–328
CXCL8, colorectal cancer expression studies CXCR4
assays, 112, 114, 117–118 central nervous system expression analysis with
correlation with osteopontin and secreted in situ hybridization
protein acidic and rich in cysteine color development, 98–99
expression, 116–119 complementary DNA
regulation, 115 cloning, 95–96
CXCL12 first-strand synthesis, 95
phosphoproeomics of signaling in chronic controls, 99–101
lymphocytic leukemia cells hybridization, 97–98
cell isolation, 334 materials, 93–94
CXCL12 stimulation, 334–335 overview of chemokine receptor
functional annotation of data, 344 distribution, 92
454 Subject Index

CXCR4 (cont.) 5-fluorouridine toxicity assay, 403–404


probe generation with in vitro transcription, FUS1-HIS3 reporter, 402–403, 406
96–97 reporter gene system comparison, 404–407
RNA purification, 94–95 vector, 403
tissue preparation, 94 CXCR7, central nervous system expression
washing, 98 analysis with in situ hybridization
endocytosis mechanism, 360 color development, 98–99
functional overview, 400–401 complementary DNA
ligands, 60 cloning, 95–96
stem cell mobilization first-strand synthesis, 95
approaches, 58–59 controls, 99–101
characterization of mobilized cells hybridization, 97–98
differentiation assays, 73 materials, 93–94
transmigration assays, 73–74 overview of chemokine receptor
CXCL4/CXCR4 axis-mobilizing agents, distribution, 92
59–63 probe generation with in vitro
donor selection transcription, 96–97
humans, 64–65 RNA purification, 94–95
mice, 64 tissue preparation, 94
flow cytometry washing, 98
CXCR4 expression, 69–72 Cyclic AMP response element, luciferase reporter
mobilized cell counting, 65 gene assay for CCR5
granulocyte colony-stimulating data interpretation, 32–33
factor-induced mobilization luminescence measurement, 32
human cells, 66–67 materials, 51
mouse cells, 66 plate preparation, 32
plerixafor-induced mobilization principles, 30–31
human cells, 67–68 transient transfection, 31–32
mouse cells, 67 Cyclin D1, assay of cytomegalovirus-encoded G
transplantation assays protein-coupled receptor-induced cell
immune-deficient mouse models, 77–80 proliferation, 163–164
limiting dilution competitive Cytomegalovirus-encoded G protein-coupled
repopulation assay, 75–77 receptors
overview, 74–75 bacterial artificial chromosome mutagenesis,
secondary transplantation, 77 165–167
T-cell receptor interaction analysis with binding assays, 157–158
fluorescence resonance energy transfer enzyme-linked immunosorbent assay, 156
dye-linked monoclonal antibody probes genetic engineering, 154–156
advantages and limitations, 382–386 internalization assays, 159
cell surface labeling, 386–387 oncogenesis induction assays
chemokine treatment, 388 cyclin D1 assay of cell proliferation, 163–164
controls, 390–391 foci formation assay, 162–163
flow cytometry, 388 xenograft models, 164
Jurkat T-cell findings, 388–391 signal transduction assays
methyl-b-cyclodextrin effects, 392 calcium flux, 160
fluorescent protein fusion protein probes inositol phosphate production, 159–160
advantages and limitations, 384–386 reporter gene assays, 160, 162
emission spectra interpretation, 395 subcellular localization, 156
fluorescence spectroscopy, 395 types, 152–154
Jurkat T-cell findings, 396 US28 receptor, 153
transient transfection, 392–395
principles, 380–381 D
therapeutic targeting, 401
WHIM syndrome defects, 63, 317 D6
yeast expression of human protein for inverse confocal microscopy of internalization, 253
agonist screening flow cytometry
affinities of compounds, 408–410 receptor recycling, 253–254
constitutively active mutant utilization, 410 chemokine uptake assays, 254–255
Subject Index 455

functional overview, 246–247 F


ligands, 232, 246
pull-down assay of binding, 259–260 FlashPlate, viral chemokine-binding protein
purification binding assays, 182–184
large-scale production Flow cytometry
bell jar, 257 CCR5
bioreactor, 257–258 endocytosis assays, 24–25, 366
nickel affinity chromatography, 258–259 overview, 363
solubilization, 258–259 recycling assay, 368
transfection, 256–257 CXCR4–T-cell receptor interaction analysis
regulation under homeostatic and with fluorescence resonance energy
inflammatory conditions, 240–241 transfer, 388
scavenging assays D6 studies
biotinylated chemokines, 250–251 chemokine uptake assays, 254–255
detection, 251–252 receptor recycling, 253–254
kinetic analysis, 252 stem cell mobilization assays
radiolabeled chemokines, 250 CXCR4 expression, 69–72
trichloroacetic acid precipitation, 251 mobilized cell counting, 65
transfection of expression constructs, 247–249 Fluorescence resonance energy transfer
tuberculosis studies CXCR4–T-cell receptor interaction analysis
chemokine neutralization in vivo, 233 dye-linked monoclonal antibody probes
chemokine scavenging assay, 234 advantages and limitations, 382–386
immune response overview, 239–240 cell surface labeling, 386–387
immunohistochemistry of human lung chemokine treatment, 388
lymph nodes, 232–233, 235, 239 controls, 390–391
mouse models, 233, 235–236 flow cytometry, 388
transfection and localization of Rab11 Jurkat T-cell findings, 388–391
mutant–green fluorescent protein methyl-b-cyclodextrin effects, 392
construct, 233–234, 236 fluorescent protein fusion protein probes
Western blot analysis, 249–250 advantages and limitations, 384–386
Database for Annotation, Visualization, and emission spectra interpretation, 395
Integrated Discovery, 343 fluorescence spectroscopy, 395
DAVID, see Database for Annotation, Jurkat T-cell findings, 396
Visualization, and Integrated Discovery transient transfection, 392–395
Diabetes, murine herpesvirus–68 M3 protein principles, 380–381
inhibition of development in mice, 199–202 FRET, see Fluorescence resonance energy transfer
DNA microarray, Kaposi’s sarcoma-associated FucS, stem cell mobilization, 62
herpesvirus-encoded G protein-coupled
receptor signaling studies, 141–143 G
DOCK, ligand docking modeling of small
G-CSF, see Granulocyte colony-stimulating factor
molecule binding to G protein-coupled
Glycosaminoglycan–chemokine interactions
receptors, 270–271
overview, 210–211
E surface plasmon resonance of viral
chemokine-binding protein binding
Electron microscopy, CCR5 binding assays, 188–189
internalization monitoring chemokine competition assays, 187
cell surface replicas of whole-mount GPCRs, see G protein-coupled receptors
preparations, 372–372 G protein-coupled receptors, see also Chemokine
immuno-gold labeling of cryosections, receptors
374–375 crystal structures, 264–265
membrane sheet preparation, 372–374 flexibility and ligand-induced conformational
overview, 364, 371 change computational modeling
ELISA, see Enzyme-linked immunosorbent assay Liticon, 273–274
Enzyme-linked immunosorbent assay overview, 271–273
colorectal cancer chemokine and receptor internalization, 358, 414
expression studies, 110 pathophysiology, 264
cytomegalovirus-encoded G protein-coupled site-directed mutagenesis for model validation
receptors, 156 binding assays
456 Subject Index

G protein-coupled receptors, see also Chemokine Human immunodeficiency virus


receptors (cont.) CCR5 assays
chemotaxis assay, 282–284 antiviral assays
direct binding assays, 281–282 antagonist resistance assay, 42–43
radiolabeled ligands, 278–281 human immunodeficiency virus stock
cell culture, 275–276 expansion and storage, 42
expression assay, 277–278 materials, 51
overview, 274–275 primary cell preparation, 40–41
transient transfection, 276–277 reverse transcriptase assay, 41–42
small molecule binding computational modeling gp120-binding assays
ab initio modeling, 267–270 functional occupancy characterization
homology modeling, 266–267 in vitro, 37–38
ligand docking, 270–271 gp120 assay, 36
therapeutic targeting, 400 materials, 51
viral chemokine receptors, see overview, 35–36
Cytomegalovirus-encoded G time-resolved fluorescence
protein-coupled receptors; Kaposi’s immunoassay, 36–37
sarcoma-associated herpesvirus-encoded gp160–CCR5-mediated cell–cell fusion
G protein-coupled receptor assay, 38–40, 51
Granulocyte colony-stimulating factor, stem cell CXCR4 therapeutic targeting, 401
mobilization, 61, 66–67
GTP, CCR5 inverse agonism assay, 28–30, 51 I
InsPecT, identification of phosphopeptides,
H 340–342
Hematopoietic stem cell ISH, see In Situ hybridization
receptors, 58 K
stem cell mobilization
approaches, 58–59 Kaposi’s sarcoma-associated herpesvirus-encoded
characterization of mobilized cells G protein-coupled receptor
differentiation assays, 73 functional overview, 127–128
transmigration assays, 73–74 gene cloning, 128–129
CXCL4/CXCR4 axis-mobilizing agents, Kaposi’s sarcoma features, 127
59–63 paracrine transformation induction, 134–135
donor selection signaling characterization
humans, 64–65 activation of second messenger-generating
mice, 64 systems, 136–137
flow cytometry Akt activation assay, 137–138
CXCR4 expression, 69–72 DNA microarray analysis of gene expression,
mobilized cell counting, 65 141–143
granulocyte colony-stimulating nuclear factor-kB
factor-induced mobilization activation assay, 143–144
human cells, 66–67 binding assay, 144–145
mouse cells, 66 translocation assay, 146–147
plerixafor-induced mobilization overview, 135
human cells, 67–68 Rac1 pulldown assay
mouse cells, 67 bead preparation, 139
transplantation assays principles, 138–139
immune-deficient mouse models, 77–80 transfection and pulldown, 139–140
limiting dilution competitive transcription factor activation, 141
repopulation assay, 75–77 Western blot of phosphoproteins, 140–141
overview, 74–75 targeted infection in vivo
secondary transplantation, 77 overview, 131–132
HIV, see Human immunodeficiency virus transgenesis, 132
Human herpesvirus–5, see Cytomegalovirus- viral production, 132–134
encoded G protein-coupled receptor therapeutic targeting rationale, 129
Human herpesvirus–8, see Kaposi’s transforming activity assays
sarcoma-associated herpesvirus-encoded G in vitro, 130
protein-coupled receptor in vivo, 130–131
Subject Index 457

L repopulation capacity characterization,


77–80
LDA, see Low-density array analysis Nuclear factor-kB
Liticon, G protein-coupled receptor chemokine transcription modulation in
conformational modeling, 273–274 tumorigenesis
Low-density array, colorectal cancer chemokine bioluminescent imaging of
and receptor expression studies, 108–113 intratumor signaling in
anesthetized mice
M firefly luciferase, 349
M3, see Murine herpesvirus–68 M3 protein Gaussia luciferase reporter, 349–351
Maraviroc, CCR5 antagonism and structure, 20 bioluminescent imaging of intratumor
Mass spectrometry, tandem mass spectrometry for signaling in conscious mice, 353–354
CXCL12 signaling phosphoproteomics kinase and transcriptional activity assays
database search program selection in vitro, 352
considerations, 342–343 reporter model development, 349
InsPecT identification of phosphopeptides, functional overview, 348
340–342 Kaposi’s sarcoma-associated
running conditions, 339–340 herpesvirus-encoded G protein-coupled
MembStruk, ab initio modeling of small molecule receptor signaling characterization
binding to G protein-coupled receptors, activation assay, 143–144
267–270 binding assay, 144–145
Metastasis, see Breast cancer translocation assay, 146–147
Microporation, see Breast cancer
M-T7, see Myxoma virus M-T7 O
Multiple sclerosis, chemokine receptor
expression, 92 OPN, see Osteopontin
Murine herpesvirus–68 M3 protein Osteopontin, colorectal cancer expression,
b cell expression studies 116–119
chemokine-induced cell migration
inhibition, 198–199 P
conditional transgenic expression system, PAM, see Tumor-associated macrophage
202–204 PCR, see Polymerase chain reaction
diabetes prevention in mice, 199–202 Phosphoproteomics
transgenic mouse generation, 195–198 CXCL12 signaling in chronic lymphocytic
overview, 194–195 leukemia cells
prospects for study, 204 cell isolation, 334
Myxoma virus M-T7 CXCL12 stimulation, 334–335
ascites assay, 219–220 functional annotation of data, 344
cell adhesion assay, 216–217 high-performance liquid chromatography of
gene discovery and identification, 211–212 phosphopeptides, 339–340
inflammatory vasculopathic disease inhibition immobilized metal affinity chromatography
aortic transplant rat model studies enrichment of phosphopeptides
anesthesia, 221 bead preparation, loading,
donor, 221 and elution, 337
morphometric analysis of aortic plaque, C18 cartridge cleanup, 337
224–225 denaturation, reduction, and alkylation,
recipient, 221–222 335–336
staining of tissue, 223–224 metals for elution, 338
statistical analysis, 225 sequential elution, 339
overview, 213 trypsin digestion, 336–337
membrane fluidity assay, 217–219 lysate preparation, 335
purification, 215–216 principles, 333–334
toxicity testing in preclinical studies, 225–227 protein classification with Database for
viral constructs for expression, 213–215 Annotation, Visualization, and
N Integrated Discovery, 343
tandem mass spectrometry
Nonobese diabetic/severe combined database search program selection
immunodeficient mouse, human stem cell considerations, 342–343
458 Subject Index

Phosphoproteomics (cont.) RNA purification, 94–95


InsPecT identification of tissue preparation, 94
phosphopeptides, 340–342 washing, 98
running conditions, 339–340 SPA, see Scintillation proximity assay
overview of strategies, 332–333 SPARC, see Secreted protein acidic and rich in
Plerixafor, stem cell mobilization, 61, 67–69 cysteine
Polymerase chain reaction, colorectal cancer SPR, see Surface plasmon resonance
chemokine and receptor expression studies Stem cell mobilization, see Hematopoietic
low-density array analysis, 108–113 stem cell
quantitative real-time polymerase chain Stromal cell-derived factor–1, see CXCL12
reaction, 109, 112, 114 Surface plasmon resonance
CCR5 binding assays
R antibody immobilization, 34
data analysis, 35
Rac1, pulldown assay of Kaposi’s ligand binding, 35
sarcoma-associated herpesvirus-encoded G materials, 51
protein-coupled receptor signaling viral chemokine-binding protein binding assays
bead preparation, 139 chemokine binding, 184–187
principles, 138–139 glycosaminoglycan binding, 188–189
transfection and pulldown, 139–140 glycosaminoglycan competition
Rhodopsin, structure elucidation, 264 assays, 187
RNA interference
chemerin/chemokine-like receptor–1 T
knockdown
adenoviral vectors T134, stem cell mobilization, 61, 63
design, 294 T140, stem cell mobilization, 61, 63
testing, 298–299 T-cell receptor, CXCR4 interaction analysis with
titration, 294–296 fluorescence resonance energy transfer
adipocyte metabolism effects, 307–308 dye-linked monoclonal antibody probes
adipogenesis effects, 306–307 advantages and limitations, 382–386
cell preparation and maintenance, 299–300 cell surface labeling, 386–387
materials, 297–298 chemokine treatment, 388
postdifferentiation knockdown, 304–306 controls, 390–391
predifferentiation knockdown studies, flow cytometry, 388
300, 302 Jurkat T-cell findings, 388–391
RNA isolation and quantification, 302–304 methyl-b-cyclodextrin effects, 392
safety precautions, 298 fluorescent protein fusion protein probes
principles, 293–294 advantages and limitations, 384–386
emission spectra interpretation, 395
S fluorescence spectroscopy, 395
Jurkat T-cell findings, 396
Scintillation proximity assay, viral chemokine- transient transfection, 392–395
binding protein binding assays, 180–182 principles, 380–381
Secreted protein acidic and rich in cysteine, TCR, see T-cell receptor
colorectal cancer expression, 116–119 Transgenic mouse, see CCR5
Site-directed mutagenesis, see CXCR2; G Tumor-associated macrophage, chemokine
protein-coupled receptors regulation, 4
In Situ hybridization, chemokine receptor
expression analysis in central nervous system U
color development, 98–99
complementary DNA Ubiquitination, chemokine receptors
cloning, 95–96 CXCR4
first-strand synthesis, 95 agonist treatment, 417
controls, 99–101 atrophin-interacting protein–4 as ubiquitin
hybridization, 97–98 ligase, 419–421
materials, 93–94 cell culture, 416–417
overview of chemokine receptor distribution, 92 immunoprecipitation, 418
probe generation with in vitro transcription, overview, 414–416
96–97 transfection, 417
Subject Index 459

Western blot, 418–419 scintillation proximity assay, 180–182


G protein-coupled receptor degradation, 414 surface plasmon resonance
US28, see Cytomegalovirus-encoded G chemokine binding, 184–187
protein-coupled receptors glycosaminoglycan binding, 188–189
glycosaminoglycan competition assays,
V 187
media preparation from virus-infected cell
vCKBPs, see Viral chemokine-binding proteins cultures, 175–176
vGPCR, see Cytomegalovirus-encoded G overview, 174–175
protein-coupled receptors; Kaposi’s
sarcoma-associated herpesvirus-encoded G W
protein-coupled receptor
Viral chemokine-binding proteins, see also Murine Western blot
herpesvirus–68 M3 protein; Myxoma virus CCR5 degradation, 369–370
M-T7 CXCR4 ubiquitination, 418–419
binding studies D6, 249–250
cell binding assay, 179 phosphoproteins in Kaposi’s
cross-linking, 176–178 sarcoma-associated herpesvirus-encoded
FlashPlate assay, 182–184 G protein-coupled receptor signaling,
ligand blot assay, 178–179 140–141

You might also like