Enzymology
Enzymology
Editors-in-Chief
Founding Editors
No part of this publication may be reproduced, stored in a retrieval system or transmitted in any
form or by any means electronic, mechanical, photocopying, recording or otherwise without the
prior written permission of the publisher
Permissions may be sought directly from Elsevier’s Science & Technology Rights Department
in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@
elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at
http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material
Notice
No responsibility is assumed by the publisher for any injury and/or damage to persons or
property as a matter of products liability, negligence or otherwise, or from any use or operation
of any methods, products, instructions or ideas contained in the material herein. Because of rapid
advances in the medical sciences, in particular, independent verification of diagnoses and drug
dosages should be made
ISBN: 978-0-12-374908-6
ISSN: 0076-6879
Sarah Able
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Antonio Alcami
Centro de Biologı́a Molecular Severo Ochoa (Consejo Superior de Investigaciones
Cientı́ficas-Universidad Autónoma de Madrid), Cantoblanco, Madrid, Spain, and
Department of Medicine, University of Cambridge, Cambridge, United Kingdom
Paola Allavena
Department of Immunology and Inflammation, IRCCS Istituto Clinico Humani-
tas, Rozzano (Milan), Italy
Mee Y. Bartee
Division of Cardiovascular Medicine, Department of Medicine and Department of
Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida,
USA
Adit Ben-Baruch
Department of Cell Research and Immunology, George S. Wise Faculty of Life
Sciences, Tel Aviv University, Tel Aviv, Israel
Paolo Bianchi
Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas,
Rozzano (Milan), Italy
Emma Blair
Department of Chemistry, and Division of Immunology, Infection and Inflamma-
tion, Glasgow Biomedical Research Center, Glasgow University, Glasgow,
United Kingdom
Raffaella Bonecchi
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
Elena M. Borroni
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
James R. Broach
Department of Molecular Biology, Princeton University, Princeton, New Jersey,
USA
xiii
xiv Contributors
Chiara Buracchi
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
Erbin Dai
Department of Medicine, University of Florida, Gainesville, Florida, USA
John F. DiPersio
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Patrick Dorr
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Pieter C. Dorrestein
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Marco Erreni
Department of Immunology and Inflammation, IRCCS Istituto Clinico Humani-
tas, Rozzano (Milan), Italy
Barry J. Evans
Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson
University, Philadelphia, Pennsylvania, USA
Marco Fabbri
Department of Immunology and Inflammation, IRCCS Istituto Clinico
Humanitas, Rozzano (Milan), Italy
Nobutaka Fujii
Department of Chemogenomics, Graduate School of Pharmaceutical Sciences,
Kyoto University, Sakyo-ku, Kyoto, Japan
Kerry B. Goralski
Department of Pharmacology, Faculty of Medicine, and College of Pharmacy,
Faculty of Health Professions Dalhousie University, Halifax, Nova Scotia, Canada
Gerard J. Graham
Division of Immunology, Infection and Inflammation, Glasgow Biomedical
Research Center, Glasgow University, Glasgow, United Kingdom
Paul Griffin
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
J. Silvio Gutkind
Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial
Research, National Institutes of Health, Bethesda, Maryland, USA
Contributors xv
Amy-Joan L. Ham
Department of Biochemistry, Vanderbilt University School of Medicine,
Nashville, Tennessee, USA
Tracy M. Handel
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Karen E. Hedin
Department of Immunology, College of Medicine, Mayo Clinic, Rochester,
Minnesota, USA
Richard Horuk
Department of Pharmacology, UC Davis, Davis, California, USA
Becky Irvine
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Neil Isaacs
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow
University, Glasgow, United Kingdom
Ian James
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Tom Kershaw
Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department
of Cell and Developmental Biology, University College London, London,
United Kingdom
Kimberly N. Kremer
Department of Immunology, College of Medicine, Mayo Clinic, Rochester,
Minnesota, USA
Ashok Kumar
Endocrine Research Unit, Mayo Clinic, Rochester, Minnesota, USA
Luigi Laghi
Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas,
Rozzano (Milan), Italy
Meizhang Li
Neuroinflammation Research Center, Department of Neurosciences, Lerner
Research Institute, Cleveland Clinic, Cleveland, Ohio, USA
Sergio A. Lira
Immunology Institute, Mount Sinai School of Medicine, New York, New York,
USA
xvi Contributors
Liying Liu
Department of Medicine, University of Florida, Gainesville, Florida, USA
Massimo Locati
Department of Translational Medicine, University of Milan, IRCCS Istituto
Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia
Alexandra R. Lucas
Division of Cardiovascular Medicine, Department of Medicine and Department of
Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida,
USA
Malcolm Macartney
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Colin Macaulay
Division of Cardiovascular Medicine, University of Florida, Gainesville, Florida, USA
Roy Mansfield
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Alberto Mantovani
Department of Translational Medicine, University of Milan, IRCCS Istituto
Clinico Humanitas, Via Manzoni, Rozzano (Milano), Italia
Adriano Marchese
Department of Pharmacology, Stritch School of Medicine, Loyola University
Chicago, Maywood, Illinois, USA
Mark Marsh
Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department
of Cell and Developmental Biology, University College London, London,
United Kingdom
Andrea P. Martin
Immunology Institute, Mount Sinai School of Medicine, New York, New York,
USA
Daniel Martin
Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial
Research, National Institutes of Health, Bethesda, Maryland, USA
David Maussang
Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry,
Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Clare McCulloch
Department of Chemistry, and Division of Immunology, Infection and Inflamma-
tion, Glasgow Biomedical Research Center, Glasgow University, Glasgow,
United Kingdom
Contributors xvii
Grant McFadden
Department of Molecular Genetics and Microbiology, University of
Florida, Gainesville, Florida, USA
Pauline McLean
Department of Chemistry, and Division of Immunology, Infection and Inflamma-
tion, Glasgow Biomedical Research Center, Glasgow University, Glasgow,
United Kingdom
Dana McIvor
Division of Cardiovascular Medicine, University of Florida, Gainesville,
Florida, USA
Raymond L. Mernaugh
Department of Biochemistry, Vanderbilt University School of Medicine,
Nashville, Tennessee, USA
Tsipi Meshel
Department of Cell Research and Immunology, George S. Wise Faculty of Life
Sciences, Tel Aviv University, Tel Aviv, Israel
Detlef Michel
Institute of Virology, Ulm University Clinic, Ulm, Germany
Ken Miller
Pfizer GRD-Groton Laboratories, Groton, Connecticut, USA
James Mills
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Massimilliano Mirolo
Laboratory of Leukocyte Biology, Department of Translational Medicine, University
of Milan, IRCCS Istituto Clinico Humanitas, Italy
Ganesh Munuswamy-Ramanujam
Division of Cardiovascular Medicine, Department of Medicine and Department of
Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida,
USA
Carolyn Napier
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Iva Navratilova
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Manuela Nebuloni
Pathology Unit, L. Sacco Institute of Medical Sciences, University of Milan, Milan,
Italy
xviii Contributors
Nicole F. Neel
Department of Cancer Biology, Vanderbilt University School of Medicine,
Nashville, Tennessee, USA
Bruno Nervi
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Robert J. B. Nibbs
Division of Immunology, Infection and Inflammation, Glasgow Biomedical
Research Center, Glasgow University, Glasgow, United Kingdom
Morgan O’Hayre
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Shinya Oishi
Department of Chemogenomics, Graduate School of Pharmaceutical Sciences,
Kyoto University, Sakyo-ku, Kyoto, Japan
Fabio Pasqualini
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
James E. Pease
Leukocyte Biology Section, National Heart and Lung Institute, Imperial College
London, London, United Kingdom
Stephen C. Peiper
Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson
University, Philadelphia, Pennsylvania, USA
Manos Perros
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Dayanidhi Raman
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Pablo Ramirez
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Richard M. Ransohoff
Neuroinflammation Research Center, Department of Neurosciences, Lerner
Research Institute, Cleveland Clinic, Cleveland, Ohio, USA
Michael P. Rettig
Division of Oncology, Siteman Cancer Center, Washington University School of
Medicine, St. Louis, Missouri, USA
Contributors xix
Alan Riboldi-Tunniclife
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow
University, Glasgow, United Kingdom
Ann J. Richmond
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Graham Rickett
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Harriet Root
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Remo C. Russo
Department of Biochemistry and Immunology, Instituto de Ciencias Biologicas,
Universidade Federal de Minas Gerais, Belo Horizonte, Brazil, and Laboratory of
Leukocyte Biology, Department of Translational Medicine, University of Milan,
IRCCS Istituto Clinico Humanitas, Italy
Elna van der Ryst
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Jiqing Sai
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Catherina L. Salanga
Skaggs School of Pharmacy and Pharmaceutical Science, University of California,
San Diego, La Jolla, California, USA
Benedetta Savino
Laboratory of Leukocyte Biology, Department of Translational Medicine,
University of Milan, IRCCS Istituto Clinico Humanitas, Italy
Andreas Schreiber
Institute of Virology, Ulm University Clinic, Ulm, Germany
Limin Shang
Immunology Institute, Mount Sinai School of Medicine, New York, New York,
USA
Nathalie Signoret
Centre for Immunology and Infection, Department of Biology and Hull York
Medical School, University of York, York, United Kingdom
Olivia L. Sims
Department of Immunology, College of Medicine, Mayo Clinic, Rochester,
Minnesota, USA
xx Contributors
Christopher J. Sinal
Department of Pharmacology, Faculty of Medicine, Dalhousie University, Halifax,
Nova Scotia, Canada
Martine J. Smit
Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry,
Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Gali Soria
Department of Cell Research and Immunology, George S. Wise Faculty of Life
Sciences, Tel Aviv University, Tel Aviv, Israel
Nagarajan Vaidehi
Division of Immunology, Beckman Research Institute of the City of Hope,
Duarte, California, USA
Abel Viejo-Borbolla
Centro de Biologı́a Molecular Severo Ochoa, (Consejo Superior de Investiga-
ciones Cientı́ficas-Universidad Autónoma de Madrid), Cantoblanco, Madrid,
Spain, and Immunology Institute, Mount Sinai School of Medicine, New York,
New York, USA
Henry F. Vischer
Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry,
Faculty of Sciences, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
Zixuan Wang
Department of Pathology, Anatomy and Cell Biology, and Department of Surgery,
Thomas Jefferson University, Philadelphia, Pennsylvania, USA
Silène T. Wavre-Shapton
Molecular Medicine NHL1, Imperial College, South Kennigton, London, United
Kingdom
Mike Westby
Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom
Jinming Yang
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt
University School of Medicine, Nashville, Tennessee, USA
Yanshi Zhu
Department of Chemistry, Glasgow Biomedical Research Centre, Glasgow
University, Glasgow, United Kingdom
PREFACE
Chemokines and chemokine receptors are the eyes and ears of the immune
system, and under normal healthy conditions they guide the migration of
leukocytes within the body to areas of assault or injury. Of course, this
system can be broken, corrupted, compromised, and led astray in a variety
of ways. Immune cells can attack their own tissues leading to autoimmune
diseases such as rheumatoid arthritis and multiple sclerosis. Many pathogens
have evolved ways to ‘‘blind’’ the immune system, thus allowing them to go
undetected and propagate freely. Viruses such as HIV-1 have been shown to
use specific transmembrane chemokine receptors as one path to cellular
entry and infection. The progression of cancer can even be aided by the
good intentions of immune system–mediated vascularization.
The list goes on, and hence the scientific community has long realized
the importance of understanding and eventually being able to manipulate
this complex system. As a result, the number of papers addressing chemo-
kines and chemokine receptors has grown exponentially over the last
decade. In 1997, Richard Horuk edited volumes 287 and 288 of the
Methods in Enzymology series on chemokines and chemokine receptors,
putting together the first comprehensive practical guide to studying these
molecules.
Since then many new technologies and methodologies have been
designed and implemented in the study of these proteins. Volumes 460
and 461 of Methods in Enzymology seek to compile and highlight these recent
methods, explain their importance, and clearly describe in detail the proto-
cols necessary for successful experimental reproduction. Volume 460
focuses on studying the roles of chemokines and chemokine receptors in
disease states, atypical chemokine receptors, and chemokine signaling, as
well as chemokine related proteins from pathogens. Volume 461 deals with
the assays and methods used to study structure and function of these proteins
and to characterize their ultimate goal of cell migration. These methods
span a wide spectrum of multidisciplinary techniques, from new spectro-
scopic advances to in situ cell-selective protein expression to devices
designed to mimic the conditions of flow present in blood vessels where
in situ leukocyte migration occurs.
Many of the authors from the first volumes have returned in the present
work to build upon the foundation they laid over a decade ago. In addition,
xxi
xxii Preface
many newer researchers have pitched in and lent their expansive expertise to
the cause. Compilations like this are assembled by the immense efforts of many
individual researchers and we emphatically offer our thanks and gratitude to all
of the authors who contributed to making these volumes a reality.
xxiii
xxiv Methods in Enzymology
VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved
in Transport)
Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
VOLUME 258. Redox-Active Amino Acids in Biology
Edited by JUDITH P. KLINMAN
VOLUME 259. Energetics of Biological Macromolecules
Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS
VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A)
Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN
VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids
Edited by THOMAS L. JAMES
VOLUME 262. DNA Replication
Edited by JUDITH L. CAMPBELL
VOLUME 263. Plasma Lipoproteins (Part C: Quantitation)
Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST
VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B)
Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN
VOLUME 265. Cumulative Subject Index Volumes 228, 230–262
VOLUME 266. Computer Methods for Macromolecular Sequence Analysis
Edited by RUSSELL F. DOOLITTLE
VOLUME 267. Combinatorial Chemistry
Edited by JOHN N. ABELSON
VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase)
Edited by LESTER PACKER
VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes)
Edited by LESTER PACKER
VOLUME 270. High Resolution Separation and Analysis of Biological
Macromolecules (Part A: Fundamentals)
Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK
VOLUME 271. High Resolution Separation and Analysis of Biological
Macromolecules (Part B: Applications)
Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK
VOLUME 272. Cytochrome P450 (Part B)
Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN
VOLUME 273. RNA Polymerase and Associated Factors (Part A)
Edited by SANKAR ADHYA
VOLUME 274. RNA Polymerase and Associated Factors (Part B)
Edited by SANKAR ADHYA
Methods in Enzymology xxxix
Contents
1. Introduction 4
2. Modifying Chemokine Expression in Breast Tumor Cells 5
2.1. Transfection (microporation) procedures: MCF-7,
T47D, and MDA-MB-231 cells 5
2.2. Tumor cell handling after microporation 8
2.3. Determination of transfection outcome 9
3. Establishment of Primary Local Breast
Tumors and Pulmonary Metastases 9
3.1. Formation of primary tumors by T47D cells 10
3.2. Formation of pulmonary metastases by MDA-MB-231 cells 12
Acknowledgments 15
References 15
Abstract
Chemokines have been recently recognized as important regulators of breast
malignancy; however, much remains unknown regarding their roles in this dis-
ease. Improved understanding of chemokine contribution to breast cancer often
requires studies in which the expression levels of chemokines by the tumor cells
are modified (increased or decreased). In addition, it is essential to determine the
roles of various chemokines in experimental in vivo model systems of breast
cancer, using hormone-dependent or -independent human breast tumor cells
(such as MCF-7, T47D and MDA-MB-231 cells). Since investigators often encoun-
ter difficulties in implementing these techniques in their studies of breast cancer,
we hereby provide a detailed description of microporation approaches for modify-
ing chemokine expression levels in human breast tumor cells, and of the measures
Department of Cell Research and Immunology, George S. Wise Faculty of Life Sciences,
Tel Aviv University, Tel Aviv, Israel
3
4 Gali Soria et al.
1. Introduction
A large body of evidence indicates that chemokines are major regula-
tors of malignancy, acting at many different levels to reduce or to promote
tumor development and/or progression (Ben-Baruch, 2006a). Chemokine
activities in malignancy are mediated primarily by their ability to induce
chemotaxis of leukocytes, endothelial cells, and/or the tumor cells. Indeed,
it is known that specific chemokines chemoattract to tumor sites leukocyte
subpopulations that may promote antitumor activities (such as Th1 cells or
natural killer cells), while other chemokines are responsible for large quan-
tities of deleterious tumor-associated macrophages (TAM) at tumor sites
(Allavena et al., 2007; Ben-Baruch, 2006a; Soria and Ben-Baruch, 2008;
Vandercappellen et al., 2008). In parallel, specific chemokines upregulate
endothelial cell migration and proliferation, therefore promoting angiogen-
esis, whereas other chemokines have powerful angiostatic properties (Ben-
Baruch, 2006a; Salcedo and Oppenheim, 2003; Strieter et al., 2006).
Another very important activity of chemokines is induction of tumor cell
invasion and migration, thereby playing key roles in dictating site-directed
metastasis formation (Ben-Baruch, 2006a, 2007; Zlotnik et al., 2006).
Chemokines can execute such multifaceted roles in malignancy because
they are expressed by cells of the tumor microenvironment, and in many
cases also by the tumor cells themselves. As such, they can affect through
autocrine pathways the ability of the cancer cells to express tumor-
promoting functions, and can also act in paracrine manners on host cells,
thereby influencing their roles in malignancy.
Of the various malignant diseases, breast cancer has attracted the atten-
tion of many researchers, whose joint efforts have provided improved
insights into the roles of chemokines in disease development and progression
(Ben-Baruch, 2006a,b, 2007; Soria and Ben-Baruch, 2008; Zlotnik et al.,
2006). However, our understanding of chemokine roles in breast cancer is
only at its beginning, and extensive research is required in order to enable
improved use of chemokines for diagnostic, prognostic, or therapeutic
purposes in this disease.
To enable better elucidation of the roles played by specific chemokines
in breast malignancy, it is necessary to define the autocrine and paracrine
effects of tumor-cell–derived chemokines. Such analyses are enabled by
studies modulating chemokine expression levels in the tumor cells, either
Chemokine Expression and Effects in Breast Cancer 5
Additional materials
Cells of interest: MCF-7, T47D, and MDA-MB-231 cells can all be
obtained from the American Type Culture Collection (ATCC).
DNA of interest: DNA of high quality (endotoxin-free plasmid DNA) is
recommended, although lower-grade DNA would also allow reasonable
yields of transfection.
Growth medium: The growth medium for the cells contains DMEM
supplemented with 10% FCS and 2% glutamine. Antibiotics (e.g., peni-
cillin, streptomycin, nystatin) could be used during cell growth, but
should be avoided in the microporation stage (see Section 2.1.2).
Although MCF-7 and T47D cells are hormone dependent, in most
laboratories they are routinely grown in culture without estrogen
(17b-estradiol, E2) or progesterone. Under these conditions, the cells
are highly proliferative, and respond well to a variety of stimuli without
hormone supplementation. However, the growth of these cells in in vivo
xenograft models depends exclusively on estrogen (see Section 3).
Please note that in specific studies there may be a need, or interest, to
perform experiments in cells that were stimulated by the relevant hor-
mones, estrogen or estrogen þ progesterone. In such case, the cells are
routinely grown without the hormones, and are then exposed to a cycle
of stimulation by the hormones. Cells undergoing hormonal treatment
should be grown in phenol-red free medium, supplemented by charcoal-
stripped serum. For cell growth with estrogen only, the hormone
(E8875, Sigma Aldrich, St. Louis, MO) is added at 10–8 or 10–9 M, for
3 to 7 consecutive days (conditions used vary by laboratory). The culture
medium (phenol-red free, including charcoal-stripped serum) should be
Chemokine Expression and Effects in Breast Cancer 7
Other reagents
Trypsin-EDTA solution (trypsin 0.25%, EDTA 0.05%)
Caþþ and Mgþþ-free PBS1
Disposables
1.5-ml (Eppendorf) and 10-ml tubes
6 and 10-cm tissue culture plates
On the day of microporation You will need warm trypsin solution for cell
removal from growth plates. You also need warm growth medium for
trypsin neutralization, and for the microporation procedure (See note at
the end of the paragraph). Therefore, prewarm an aliquot of the trypsin
solution and of the growth medium at 37 . Following microporation, you
will need to transfer the cells from each microporation tube to a tissue
culture plate with growth medium containing serum and supplements. For
T47D cells, use a 6 cm tissue culture plate with 3 ml medium for each
microporation; for MCF-7 and MDA-MB-231 cells, use a 10 cm tissue
culture plate with 8 ml of medium for each microporation. Prepare such
plate/s in advance, in a humidified 37 , 5% CO2 incubator. Note: Do not
add antibiotics (e.g., penicillin, streptomycin, nystatin) to the growth
medium, which is added to the cells prior to microporation. The antibiotics
can be added afterward to the collecting tissue culture plates, used at the end
of the microporation stage.
Prior to the microporation step itself, prepare the cells together
with the DNA. To this end, trypsinize the cells with trypsin-EDTA
solution, neutralize the trypsin by antibiotic free, serum-containing growth
medium. The procedure described below is suitable for one transfection of
1.2 106 cells:
Pellet your pool of tumor cells at 1200 rpm (140g) for 7 min at room
temperature (RT). Count the cells and pellet 1.2 106 cells in 1.5 ml
(Eppendorf ) tube at 2000 rpm (400g) for 3 min at RT. Following cell washing
8 Gali Soria et al.
2.1.3. Microporation
The microporations are done in 10-ml or 100-ml gold-tips, which are
inserted into the microporation tube. The size of the tip, whether 10 ml
or 100 ml, depends on the amount of cells undergoing microporation,
according to the manufacturer’s instructions. For example, for micropora-
tion of 1.2 106 cells, use a 100-ml gold-tip. Please note that you first need
to prepare the microporation apparatus and set up the pulse conditions.
Only then can you proceed to perform the microporation step itself.
Preparation of the microporation apparatus: To prepare the apparatus,
add 3 ml of Buffer E into the microporation tube. Then set up the pulse
conditions of the pipette station, as follows:
For MCF-7 cells: pulse voltage, 1100; pulse width, 20; pulse number, 2.
For T47D cells: pulse voltage, 1100; pulse width, 20; pulse number, 2.
For MDA-MB-231 cells: pulse voltage, 1350; pulse width, 20; pulse
number, 2.
Performing the microporation: The following details are suitable for each
microporation of 1.2 106 cells by a 100-ml gold-tip: Mix the cell-DNA
mixture gently with a standard pipette, and then aspirate the cell-DNA
mixture using the MicroPorator pipette carrying the gold-tip. Avoid air
bubbles during pipetting (the smallest air bubble would induce a spark that
will ruin the transfection). Afterward, insert the MicroPorator pipette
into the Pipette Station and press the Start button on the LCD panel.
When the high-voltage button turns red, press it to transfect by the
MicroPorator. After the pulse, immediately transfer the cell sample into
the 6-cm plate (for T47D cells) or 10-cm plate (for MCF-7 and MDA-
MB-231 cells) that was prepared in advance with warm growth medium
(can include antibiotics).
1.4
1.2 *
expression (OD–450 nm)
1
CCL5 extracellular
0.8
0.6
0.4
0.2
0
pE-GFP pE-GFP-CCL5
Figure 1.1 Overexpression of CCL5 in MCF-7 human breast carcinoma cells. MCF-7
cells were transfected with pE-GFP or pE-GFP-CCL5 vectors, following the procedures
detailed above. Stable transfectants of both cell types were cultured under similar condi-
tions for 24 h in serum-free medium.The expression of secreted CCL5 was determined
in cell supernatants of stable transfectants by ELISA assays, using coating and detecting
antibodies to GFP.The high expression levels of CCL5 in pE-GFP-CCL5 transfectants,
as compared to the pE-GFP control transfected cells, were confirmed by ELISA assays
with coating and detecting antibodies to CCL5 (data not shown). The analyses were
done at the linear range of absorbance (*p ¼ 0.03).
For details on the cells, consult the guidelines of the American Type Culture
Collection [ATCC].)
T47D cells: When the appropriate conditions are used, these hormone-
dependent human breast cancer cells give a high yield of primary local
tumors in the mammary fat pad of female mice. However, due to their
relatively mild aggressiveness, these cells do not form metastases.
Note: Similar to T47D cells, tumor formation by MCF-7 cells is highly
dependent on estrogen supplementation. In essence, it is expected that the
procedure for in vivo tumor formation by MCF-7 cells would follow the
guidelines of T47D cells. Nevertheless, laboratories use different variants of
these cells, such as the MCF-7-ras cells (expressing activated ras oncogene),
which form tumors in the absence of exogenous estrogen and form pulmo-
nary metastases as well (Karnoub et al., 2007; Orimo et al., 2005).
MDA-MB-231 cells: These are highly metastatic, hormone-independent
human breast carcinoma cells. In procedures of intravenous injection of
the tumor cells, these cells form ‘‘experimental’’ pulmonary metastasis (in
contrast to ‘‘spontaneous’’ pulmonary metastases, which are derived from
the primary tumor) with very high yield.
To elucidate the roles of chemokines in tumor growth and metastasis
formation, many different measures could be taken. Between others,
they include overexpression of chemokines or of chemokine knock-down
in the tumor cells, as described above. In these cases, one should consider
the use of vectors in which the transcription of the chemokine can be
controlled in vivo.
Disposables
1.5-ml (Eppendorf ) tubes, 10-ml round-bottom tubes, 1 ml-syringes,
needles (25 gauge)
On the day of tumor cell injection T47D cells are injected at concentration
of 5 105 cells/100 ml, 100 ml/mouse in a suspension that contains matrigel.
The procedure provided below is suitable for injection to 20 mice. Note that
the amounts of cells and matrigel that are given below are suitable for 40 mice:
They were calculated in a large excess due to a considerable loss of material
at the time of cell injection. On the whole, you would need 2 107 cells.
On the day of cell injection, prewarm an aliquot of the culture medium
and the trypsin-EDTA solution. Trypsinize the cells, neutralize the trypsin
with serum-containing growth medium, and centrifuge the cells at
1200 rpm (140g) for 7 min at 4 . Next, resuspend the pelleted cells in
growth medium and after counting them, transfer 2 107 cells to a 10-ml
round bottom tube. Pellet the cells by centrifugation as above, wash them
with 10 ml PBS 1, aspirate the PBS, and transfer the resuspended cells to
4 . Adjust the volume to 2 ml with fresh and ice-cold PBS 1, and mix the
cell suspension with 2 ml of ice-cold matrigel. The resulting cell-matrigel
mixture would be at a final concentration of 5 106 cells/ml.
To avoid warming of the cell-matrigel mixture, and due to its high
viscosity, aliquoting the cell-matrigel mixture into several aliquots
is advised. In the specific example given previously, the cells can be
aliquoted to eight 1.5-ml (Eppendorf) tubes, each containing 500 ml of the
cell-matrigel mixture. Keep the tubes on wet ice until injection.
A
120
100
B C
Number of
Mouse no.
metastases *
1 >300
2 >300
3 240
4 211
5 138
6 134
7 +++
Figure 1.2 Formation of primary tumors and pulmonary metastases by human breast
carcinoma cells in female SCID mice. (A) Formation of primary tumors in the mam-
mary fat pad of female SCID mice byT47D cells. T47D cells were injected subcutane-
ously to the mammary fat pads of five female SCID mice, in concentrations of 5 105
cells/100 ml, 100 ml per mouse. Tumor formation was followed daily. (B) Formation of
pulmonary metastases in female SCID mice by MDA-MB-231 cells. MDA-MB-231 cells
were injected intravenously to the tail vein of seven female SCID mice, in concentrations
of 7.5 105 cells/100 ml, 100 ml per mouse. The mice were sacrificed 21 days after tumor
cell inoculation. Metastases were counted following injection of india ink solution. *In
all cases, micrometastases were present, but they were not counted. þþþA mouse in
which only micrometastases were detected. (C) White pulmonary metastases detected
against the black background of india ink^stained lung.
Disposables:
10 ml round bottom tubes, 1-ml syringes, needles (25 gauge)
14 Gali Soria et al.
On the day of tumor cell injection The MDA-MB-231 cells are injected
at a concentration of 7.5 105 cells/100 ml, 100 ml/mouse. The procedure
provided in the following is suitable for injection of 20 mice. On the whole,
you would need a total of 1.5 107 cells; however, preparing extra cells,
such as a total of 2 107 cells, is advisable.
On the day of tumor cell injection, prewarm an aliquot of culture
medium and the trypsin-EDTA solution. Following cell trypsinization,
neutralize the trypsin with serum-containing growth medium, and centri-
fuge the cells at 1200 rpm (140g) for 7 min at 4 . Next, resuspend the cell
pellet with 5 ml of growth medium and count the cells. Transfer 2 107
cells to a 10-ml round-bottom tube and pellet the cells by centrifugation at
1200 rpm for 7 min at 4 . Wash the cells with 10 ml PBS 1 and aspirate
the PBS, and then add fresh PBS 1 to a final volume of 2.7 ml, leading to
final cell concentration of 7.5 106 cells/ml. Keep the cells on ice until
injection of the tumor cells.
ACKNOWLEDGMENTS
The research relevant to this paper was supported by The Israel Science Foundation; The
Israel Cancer Association; The Ela Kodesz Institute for Research on Cancer Development
and Prevention; The Federico Foundation.
REFERENCES
Allavena, P., Sica, A., Solinas, G., Porta, C., and Mantovani, A. (2007). The inflammatory
micro-environment in tumor progression: The role of tumor-associated macrophages.
Crit. Rev. Oncol. Hematol. 67, 11438–11446.
Ben-Baruch, A. (2006a). The multifaceted roles of chemokines in malignancy. Cancer
Metastasis Rev. 25, 357–371.
Ben-Baruch, A. (2006b). ‘‘Pro-malignancy and putative anti-malignancy chemokines in the
regulation of breast cancer progression.’’ In Veskler, Barbara A., ed., Focus on Immunology
Research, pp. 1–46. Nova Science Publisher, New York.
Ben-Baruch, A. (2007). Organ selectivity in metastasis: Regulation by chemokines and their
receptors. Clin. Exp. Metastasis 25, 345–356.
Karnoub, A. E., Dash, A. B., Vo, A. P., Sullivan, A., Brooks, M. W., Bell, G. W.,
Richardson, A. L., Polyak, K., Tubo, R., and Weinberg, R. A. (2007). Mesenchymal
stem cells within tumour stroma promote breast cancer metastasis. Nature 449, 557–563.
Mullen, P., Ritchie, A., Langdon, S. P., and Miller, W. R. (1996). Effect of Matrigel on the
tumorigenicity of human breast and ovarian carcinoma cell lines. Int. J. Cancer 67,
816–820.
Orimo, A., Gupta, P. B., Sgroi, D. C., Arenzana-Seisdedos, F., Delaunay, T., Naeem, R.,
Carey, V. J., Richardson, A. L., and Weinberg, R. A. (2005). Stromal fibroblasts present
in invasive human breast carcinomas promote tumor growth and angiogenesis through
elevated SDF-1/CXCL12 secretion. Cell 121, 335–348.
Salcedo, R., and Oppenheim, J. J. (2003). Role of chemokines in angiogenesis: CXCL12/
SDF-1 and CXCR4 interaction, a key regulator of endothelial cell responses. Microcircu-
lation 10, 359–370.
16 Gali Soria et al.
Soria, G., and Ben-Baruch, A. (2008). The inflammatory chemokines CCL2 and CCL5 in
breast cancer. Cancer Lett. 267, 281–285.
Strieter, R. M., Burdick, M. D., Mestas, J., Gomperts, B., Keane, M. P., and Belperio, J. A.
(2006). Cancer CXC chemokine networks and tumour angiogenesis. Eur. J. Cancer 42,
768–778.
Vandercappellen, J., Van Damme, J., and Struyf, S. (2008). The role of CXC chemokines
and their receptors in cancer. Cancer Lett. 267, 226–244.
Zlotnik, A., Yoshie, O., and Nomiyama, H. (2006). The chemokine and chemokine
receptor superfamilies and their molecular evolution. Genome Biol. 7, 243.
C H A P T E R T W O
Contents
1. Introduction 18
2. CCR5 Signaling Assays and Application to Quantify and
Characterize Ligand-Dependent Agonism,
Antagonism, and Inverse Agonism 19
2.1. CCR5-mediated Ca2þ signaling 19
2.2. CCR5 cellular internalization assay 24
2.3. Application of CCR5 receptor internalization assay to
investigate antagonist-dependent functional receptor
occupancy in vivo (clinical trials) 25
2.4. GTP-associated CCR5 inverse agonism assay 28
2.5. cAMP-response-element-luciferase reporter gene assay 30
3. CCR5-Associated Ligand-Binding Assays 33
3.1. Radiolabeled CCR5 chemokine-binding assays 33
3.2. Radiolabeled antagonist-binding and -dissociation assays 34
3.3. Real-time ligand binding using Biacore technology 34
3.4. Real time HIV-1 gp120-CCR5 binding assay 35
3.5. Application of gp120 binding to characterize functional
occupancy in vitro 37
4. Surrogate In Vitro Antiviral Assays 38
4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay 38
4.2. Antiviral assays 40
5. CCR5 Site-Directed Mutagenesis and Ligand Docking Studies 43
5.1. Structural model generation 44
5.2. CCR5 site-directed mutagenesis 45
17
18 Roy Mansfield et al.
Abstract
The G protein–coupled chemokine (C-C motif ) receptor, CCR5, was originally
characterized as a protein responding functionally to a number of CC chemo-
kines. As with chemokine receptors in general, studies indicate that CCR5 plays
a role in inflammatory responses to infection, although its exact role in normal
immune function is not completely defined. The vast majority of research into
CCR5 has been focused on its role as an essential and predominant coreceptor
for HIV-1 entry into host immune cells. Discovery of this role was prompted by
the elucidation that individuals homozygous for a 32 bp deletion in the CCR5
gene do not express the receptor at the cell surface, and as a consequence, are
remarkably resistant to HIV-1 infection, and apparently possess no other clear
phenotype. Multiple studies followed with the ultimate aim of identifying drugs
that functionally and physically blocked CCR5 to prevent HIV-1 entry, and thus
provide a completely new approach to treating infection and AIDS, the world’s
biggest infectious disease killer. To this end, functional antagonists with potent
anti–HIV-1 activity have been discovered, as best exemplified by maraviroc, the
first new oral drug for the treatment of HIV-1 infection in 10 years. In this
chapter, the specific methods used to characterize CCR5 primary pharmacology
and apply the data generated to enable drug discovery, notably maraviroc, for
the treatment of HIV infection and potentially inflammatory-based indications,
are described.
1. Introduction
The CCR5-associated methods included in this chapter are described
in fine detail to enable their various subtleties to be captured as far as possible
for the reader, especially where the method in question is subject to failure
due to minor changes in assay conditions. As the predominant application of
CCR5 research is toward the discovery of agents to treat HIV infection,
CCR5-associated virology methodologies are included. Where helpful for
the reader, specific reagent volumes and working conditions are also
described as ‘‘typical’’ in order to help their transfer to practical laboratory
CCR5 Primary Pharmacology Methods and Applications 19
CCR5 antagonist:
status/application Structure and general chemotype
Maraviroc (UK-427857): N
Approved drug for the F N
treatment of HIV-1 N
infection (Dorr et al., F H
N N
2005b; Dorr and Perros,
2008; Fatkenheuer et al., O
2008)
Tropane azole
N
PF-232798: Phase 2
(Dorr et al., 2008) N O
N
H
N N
F
Tropane imidazipiperidine
N
UK-484900:
Eexperimental N O
CCR5 antagonist H N
and inflammatory N N
O
indications tool
O
F
Tropane imidazipiperidine
N
PF-501606: Experimental O O
N N
antagonist and docking
standard. N O
N
Tropane imidazopiperidine
x
Table 2.1 (continued)
CCR5 antagonist:
status/application Structure and general chemotype
UK-396794: Experimental N
CCR5 antagonist N
(Dorr et al., 2005a; O
H
Haworth et al., 2007) N N
Tropane benzimidazole
Me
N
UK-433370: Experimental
F N
CCR5 antagonist N
(Dorr et al., 2005a) H
F
N N
Tropane azole
N
O
UK-438235: Experimental
CCR5 antagonist N
N
(Haworth et al., 2007) H
N N
Tropane benzimidazole
O
O−
SCH-C Former clinical N N+
candidate (Tsamis et al.,
O N
2003a)
N
Br
Bis-piperidine
(continued)
22 Roy Mansfield et al.
CCR5 antagonist:
status/application Structure and general chemotype
N
Imidazopyridine
resulting from its combination with intracellular Ca2þ released from the
ER. This can be monitored in real time using a fluorescent laser imaging
plate reader (FLIPR) or an equivalent workstation technology. This allows a
real-time assay of agonist and antagonist effects on CCR5-mediated Ca2þ
flux in HEK-293 cells expressing the human chemokine receptor.
2.1.2. Calcium dye preparation and cell dye loading for calcium
signaling assays
A Calcium Plus KitTM dye is dissolved in 10 ml Ca2þ flux buffer (see
Section 6.3) before adding 90 ml of the same buffer to create the final
working solution. The media from the plated cells is removed and the
adherent cells washed twice by removal of culture medium and replacement
with 2 100 ml PBS into each well. The PBS is removed and the adherent
cells are incubated with dye preparation (100 ml/well) and left gently rock-
ing for 3 h. The dye is then aspirated and the plates washed three times with
Ca2þ flux buffer, prior to addition of additional buffer (160 ml) immediately
before the Ca2þ flux assay is undertaken.
10,000
9000
8000
7000
Maraviroc RANTES
6000
0 50 100 150 200 250 300 350 400 450
5000
Time (s)
Figure 2.1 Effect of RANTES (CCR5 agonist) and maraviroc (CCR5 functional
antagonist) on recombinant CCR5-mediated Ca2þ signaling in HEK cells. The
dynamic change in fluorescence after the addition of maraviroc (marked) is shown,
as well as subsequent addition of agonist RANTES as marked 4 min later.
24 Roy Mansfield et al.
A B
80 80 Control
Control
SDF-1a
SDF-1a
37 ⬚C RANTES + 2 hr media
4 ⬚C RANTES
RANTES
Counts
Counts
0 0
100 101 102 103 104 100 101 102 103 104
Fluorescence Fluorescence
C
80 Control
SDF-1a
37 ⬚C 10 nM UK-427857
100 nM UK-427857
Counts
0
100 101 102 103 104
Fluorescence
Figure 2.2 Effect of maraviroc on 300.19 cell surface CCR5 levels (anti-CCR5
antibody^dependent cell population fluorescence). Isotype control fluorescence counts
(y-axis) is depicted in grey. RANTES (100 nM)-induced reduction of CCR5 is shown
by a reduction in fluorescence (green line in 2A) relative to parallel experiments using
the negative control ligand SDF-1a (red line in 2A). Reemergence of CCR5 at the cell
surface is apparent following a 2-h incubation period post addition of RANTES (blue
line, 2A). RANTES-induced reduction in cell population fluorescence is reduced at 4
(2B) highlighting internalization to be an active biological process. Maraviroc did not
affect cell population fluorescence at10 nM or 100 nM (blue and green lines, respectively,
in 2C), as also seen for the negative control SDF-1a (red line). (From Dorr P., and Perros,
M. (2008). CCR5 inhibitors in HIV therapy. Expert Opin. Drug Discov.3, 1^16; Dorr, P.,
et al. (2005). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective small-
molecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human
immunodeficiency virus type1activity. Antimicrob. Agents Chemother.49,4721^4732.)
A
120
100
80
Counts
60
40
20
0
100 101 102 103 104
FL2-H
B
120
100
80
Counts
60
40
20
0
100 101 102 103 104
FL2-H
C
120
100
80
Counts
60
40
20
0
100 101 102 103 104
FL2-H
Cell counts
40 40
CCR5 CCR5
30 30
20 20
:
10 10
Figure 2.4 CCR5 occupancy assay in/ex vivo. FACS analysis of PBLs blockade of che-
mokine (MIP-1b)-induced CCR5 internalization by maraviroc in ex vivo PBMCs, as
measured by PE-conjugated anti-CCR5-Mab (2D7) fluorescence measurements on a
FACS technology platform.The presence of maraviroc inhibits MIP-1b^induced CCR5
internalization compared tovehicle. Analysis of placebo versus maraviroc dosed samples
using this methodology enabled the dynamic functional occupancy of CCR5 to be pro-
filed (Fig. 2.5).
120
% CCR5 functional occupancy
100
100 mg
80
25 mg
60 3 mg
10 mg
40
Placebo
20
0
0 10 20 30 40 50 60
Time (h)
1600
1400
MIP-1b
MIP-1
Stimulated/basal GTP binding (%)
1200
1000
800
600
400
200
Maraviroc
0
3 6 10 30 60 100 300 600 1000
Ligand concentration (nM)
Figure 2.6 Inverse agonism of CCR percent by maraviroc. Stimulation of GTP bind-
ing to membrane preparations from CCR5-expressing HEK-293 cells by MIP-1b-
(pink line and data points), and UK-427,857 (blue line and data points). Data points
represent the ratio of GTP binding in the presence of ligand over basal levels of GTP
binding in vehicle control assays.
construct and a plasmid encoding the human CCR5 receptor. The trans-
fected cells are stimulated with forskolin to activate adenylate cyclase, and
increase intracellular cAMP to enable an assay window. The cAMP binds to
its response element, which activates transcription of the luciferase reporter
gene, leading to an increase in measured luminescence. The CCR5 recep-
tor is a Gi-linked GPCR when expressed in an appropriate background, and
agonism inhibits adenylate cyclase, reducing the intracellular cAMP con-
centration and thus decreasing the luminescence signal. The effect of pre-
incubation with antagonists on the dose–response curve to MIP-1b, and
therefore its functional activity at the CCR5 receptor can thereby be
investigated.
150
Control
% Fitted max of control curve
1 nM UK-427, 857
100
3 nM UK-427, 857
10 nM UK-427, 857
50
0
−12 −11 −10 −9 −8 −7 −6
120
100
Maraviroc
80 ka = 1.1 (±0.1) ⫻ 105 M−1s−1
60 kd = 6.0 (±0.2) ⫻ 10−4 s−1
40
KD = 25.0 (±4.0) ⫻ 10−9 M
20
0 t1/2 = 1165 s
Normalised response (% Rmax)
Figure 2.8 Profile of small molecule antagonist and agonist binding in Biacore.
Graphs highlighting association and dissociation of various CCR5 ligands as measured
by dynamic change in refractive index on Biacore.
cell–cell fusion (Fig. 2.9), which better resemble the HIV-1 entry process in
infection, and is now the favored screen for HTS (Dorr et al., 2003a), but
does not define the specific interaction blocked by inhibitory compounds.
Eu-cryptate gp160
CHO TAT
anti-gp120 TAT
CD4 CCR5
gp120 +
sCD4 Hela P4 b-Gal
b-Gal
CCR5
gp120 (e.g., Ba-L strain) are incubated at RT for 15 min before its addition
to PBS-washed cells, in the presence of dilutions of maraviroc to enable
IC50 determination. The assay plates are incubated at 37 for 1 h and washed.
Eu3þ labeled anti-gp120 antibody (1/500 dilution in assay buffer; see Section
6.3) is added to each well (50 ml) and incubated 1 h. The plate is washed three
times with assay buffer, prior to the addition of enhancement solution
(200 ml/well; see Section 6.3) and measurement of Eu3þ fluorescence. Non-
specific binding is taken as the fluorescence measured for gp120 incubated
with cells in the absence of preincubation with sCD4. The data can be used
to examine dose–response for compound-dependent inhibition of HIV
gp120-sCD4 complex binding to CCR5 as shown for maraviroc in Fig. 2.10.
100
90
80
70
60
% Inhibition
50 Fusion
gp120
40
30
20
10
0
0.001 0.01 0.1 1 10 100 1000
[Maraviroc] (nM)
120
80
60
40
No wash
20 Wash and chase
0
0.1 1 10 100 1000 10000
[PF-232798] (nM)
cell–based assays with infectious virus show no advantage in the use of virus
versus CHO cells in this reporter assay (unpublished data, Pfizer GRD),
highlighting the advantage of the cell–cell fusion system in terms of safety
and assay amenability.
Antiviral assay: PBL cultures PBLs are infected for 1 h at 37 with a
predetermined volume of virus calculated to give an equal amount of
HIV-1 reverse transcriptase (RT) activity per virus stock. Infected cells
are washed and added to assay plates (e.g., 7.2 104 cells/well [200 ml]
for a 96-well plate) containing serial dilutions of test compounds (in RPMI
culture medium and DMSO 0.1% (v/v) FAC). After 5 to 7 days of
incubation, the cultures are examined visually with a microscope for evi-
dence of cytotoxicity and viral replication and compound-dependent inhi-
bition is quantified by measuring RT activity (see the following).
Antiviral assay: MDM cultures MDMs are used after 7 days in culture (to
enable full differentiation). The supernatant is replaced with 50 ml of either
compound preparation or vehicle (RPMI medium containing DMSO at
0.1% (v/v) FAC). Cells are transferred to a growth incubator for 1 h, and
then 50 ml of pretiter virus stock (see the following) is added prior to return
to the incubator for 3 h. Following removal of medium, plates are washed
five times using 200 ml of RT PBS per well prior to readdition of test
compounds and vehicle at 2 FAC equivalent. A further 50 ml of cell
culture medium are added to all wells and plates transferred to a growth
incubator for 7 days. After this period, culture supernatant is harvested from
the assay plates and tested directly in the HIV-1 RT detection assay as a
surrogate of HIV-1 replication for compound susceptibility profiling and
quantification (i.e., IC50 and IC90).
120
100
−20
1.0E-11 1.0E-10 1.0E-09 1.0E-08 1.0E-07
[Antagonist] (M)
Example results and data Figure 2.12 shows the dose–response curves for
CCR5 antagonist profiling in PBL-based antiviral assays, using a laboratory-
generated maraviroc-resistant (MVCRES) isolate generated by long-term
serial passage in gradually increasing maraviroc concentrations (Dorr et al.,
2008; Westby et al., 2007). This has been used to show the potential of
second-generation CCR5 antagonists to retain activity against laboratory
generated MVCRES isolates (see Fig. 2.12).
receptor, and the absence of such signaling being seen in the absence of
recombinant receptor, and complete inhibition seen at high doses of applied
CCR5 antagonist. Computer-assisted docking using this ‘‘IC50-shift’’
parameter of antagonists requires an initial dock of a test compound of
known crystal structure and rigidity, with following docks of test compounds
thereafter. Site directed mutagenesis studies as reported here run against this
compound resulted in a loss in potency for the Y108A and E283A mutants.
This enabled an overlay and subsequent docking of other CCR5 antagonists
such as maraviroc, vicriviroc, and PF-232798 into the modeled putative
binding pocket of CCR5 using a Pfizer software package (FLOPS, Flexes
Ligands Optimizing Property Similarity). Similar packages are reported with
this type of utility (Kondru et al., 2008; Tsamis et al., 2003b).
plus reagent, and 800 ml optimem (see Section 6.3). Solution 2 contains
22.5 ml lipofectamine and 800 ml optimem. Transfected cells are washed
with prewarmed (37 ) optimem (10 ml) and growth media (20 ml) prior to
incubation overnight in a growth incubator and trypsin-EDTA treatment
(1 ml supplied reagent; see Section 6.3) incubation for 2 min at RT, media
resuspension, to 3 105 viable cells/ml. Cells are plated at 90 ml/well in
96-well, white opaque plates, incubated overnight prior to functional
(CRE-luc) assay.
ECL2
E283
Y108
B C
E283 E283
Y108
Y108
E283
Y108
Figure 2.13 Computer-assisted docks of CCR5 antagonists and HIV resistance SAR.
Computer-modeled docking of maraviroc (green) into the transmembrane pocket of
CCR5, highlighting hydrophobic interaction between the maraviroc phenyl moiety
with the tyrosine (Y) 108, and the ionic interaction between the tropane basic amine
and the glutamic acid (E) 283 (A). Overlaps between maraviroc and PF-232798 (purple)
and the bicyclic CCR5 antagonist SCH-C (yellow) are highlighted in (B) and (C),
respectively. The extracellular loop 2 (ECL2) hinge region of CCR5 is highlighted.
SAR associated with antiviral activity of CCR5 antagonists in the tropane series against
laboratory-generated MVCRES HIV-1 CC185, with the requirement of differential occu-
pancy at the ECL2 hinge region (specifically achieved by the imidazopiperidine substit-
uent) highlighted, is shown in (D). Maraviroc is depicted in green and test compounds
are depicted in purple. Full structures of compounds are shown inTable 2.1.
48 Roy Mansfield et al.
Stop
ATG
BamH1
Spe
Sca
Xbol
Not1
Kpn
Figure 2.14 CCR5 knock-in miceçtarget vector. Neomycin resistance cassette used
for targeting into ES cells by homologous recombination with murine orthologue^
flanking regions (in situ) for human CCR5 (ORF-only) knock-in mice generation.The
selection, excision, and marker restriction sites are shown.
1988). To achieve the seamless insertion of the human coding sequence into
the mouse locus, the 50 arm of the targeting vector is constructed by
overlapping PCR. The reverse oligo used to amplify the 3 kb of the murine
genomic sequence upstream of the ATG includes 10 bp of the human
coding sequence (Table 2.3). Likewise, the forward oligo used to amplify
the human cDNA incorporated 30 bp of mouse genomic sequence at its 50
end, while the reverse primer contains a BamH1 cloning site, the loxP
sequence, and stop codons. To complete the seamless junction at the ATG,
another PCR is performed, which uses these two products as template to
make a shorter product that bridges the mouse and human sequences. The
full-length 50 homology arm is then assembled using naturally occurring
restriction sites. The 30 homology arm is also made by PCR, using oligos
that included a second loxP site in the forward primer. The completed
homology arms are cloned into the pJNS2 vector containing PGK-
neomycin phosphotransferase for positive selection and the HSV thymidine
kinase gene for negative selection. All products should be sequenced to
ensure accuracy of the PCR.
CCR5-10254R CATGATCTTCTTCATTCTCC
CCR5-9570F TCCTTGCATTTCACTCTAGC
CCR5-585F GGAACTTGAGAATATCATCC
CCR5-1521R GATTTGAAGGTAACAGAGCG
CCR5-Kpn1755F ATGGTACCATTGGTGTCTGGGATAAAGC
CCR5-Not9496R ATAAGAATGCGGCCGCTCCAGCATTCTGCAGATCCACC
CCR5-50 arm-R GATAATCCATCCTGCAAGAG CCTATGAATAAATAAAAGAC
hCCR5-50 F GTCTTTTATTTATTCATAGGCTCTTGCAGGATGGATTA
TCAAGTGTCAAGTCCAATCTATGAC
hCCR5-50 R TTGGATCCATAACTTCGTATAATGTATGCTATACGAA
GTTATTCATCATCACAAGCCCACAG
ATATTTCCTGCTCCCCAGTG
hCCR5 30 arm-F ATACTCGAGATAACTTCGTATAGCATACATTATACGAAGT
TATCCTGGTTGACTTTTGTGTATCACGTAG
hCCR5-690R CCTCTTCTTCTCATTTCG
muCCR5-4697-F CACTACTCATTCTTTCTGGC
6.3. Materials
Most materials described as reagents can be sourced from various commer-
cial suppliers. Bespoke materials (and their final preparation) used in the
methods are listed in the following against each method section number,
with associated supplier.
2.1. CCR5-associated Ca2þ signaling—Ca2þ flux buffer and assay
reagents: One bottle HANKS balanced salts powder (Sigma), 1.6 ml
of 1 M CaCl2 (Sigma), 10 ml of 1 M HEPES, pH 8 (Sigma, cat no.
H-0763), made up to 1 l with sterile water and adjusted to pH 7.4 with
hydrochloric acid (HCl). Calcium Plus Kit (Molecular Devices).
2.2. Receptor internalization signaling assay—Assay buffer: RPMI
(10% FBS) (RPMI, Gibco Invitrogen Corporation), RANTES and
SDF-1a (R&D Systems, Becton Dickinson), FACScalibur (Cell Quest
Software). Mouse antihuman CCR5 monoclonal antibodies: 2D7
(Pharmingen). Isotype control antibodies: mouse IgG2a, (Pharmingen).
Secondary PE-labeled antibody: PE-labeled goat anti-mouse antibody
(Sigma). Sodium citrate CPT (4-ml draw) blood tubes (Becton Dick-
inson). Sample processing tubes (12 75-mm polystyrene round bot-
tomed) and caps (push fit) (Sarstedt Ltd). Reagents: MIP-1b working
solution (R & D systems, 100 nM MIP-1b) aliquots stored frozen at –
70 . CCR5 stabilizing solution (600 nM maraviroc in PBS), stabilizing
control solution (PBS), CCR5 MsIgG R-phycoerythrin 2D7 anti-
CCR5 antibody (Pharmingen) (PE-labeling by custom order).
CCR5 Primary Pharmacology Methods and Applications 51
REFERENCES
Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G.,
Doms, R. W., Proudfoot, A., and Parmentier, M. (2003). The core domain of chemo-
kines binds CCR5 extracellular domains while their amino terminus interacts with the
transmembrane helix bundle. J. Biol. Chem. 278, 5179–5187. Epub 2002 Dec 3.
Bradley, J., Gill, J., Bertelli, F., Letafat, S., Corbau, R., Hayter, P., Harrison, P., Tee, A.,
Keighley, W., Perros, M., Ciaramella, G., Sewing, A., et al. (2004). Development and
automation of a 384-well cell fusion assay to identify inhibitors of CCR5/CD4-mediated
HIV virus entry. J. Biomol. Screen 9, 516–524.
Combadiere, C., Ahuja, S. K., Tiffany, H. L., and Murphy, P. M. (1996). Cloning and
functional expression of CC CKR5, a human monocyte CC chemokine receptor
selective for MIP-1(alpha), MIP-1(beta), and RANTES. J. Leukoc. Biol. 60, 147–152.
Dobbs, S., Perros, M., and Rickett, G. A. (2001). An assay method for determining whether
an agent is capable of mudlating the interaction of CCR5 with gp120.
Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug
Discovery 3, 1–16.
Dorr, P., Corbau, R., Pickford, C., Rickett, G., Macartney, M., Griffin, P., Dobbs, S.,
Irvine, R., Westby, M., and Perros, M. (2003). Evaluation of the mechanism underlying
the anti-HI activity of a series of experimental CCR5 antagonists. on. 43rd Annual
Interscience Conference Antimicrobial Agents and Chemotherapy. Sept 14-17 2003,
Poster, Chicago, F1466.
Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug
Discovery 3, 1345–1361.
Dorr, P., Rickett, G., and Perros, M. (2003). A method for identifying CCR5 receptor
antagonists by measuring residency time. Patent Ref. US20040023845 A1.
Dorr, P., Todd, K., Irvine, B., Robas, N., Thomas, A., Fidock, M., Sultan, H., Mills, J.,
Perrucio, F., Burt, C., Rickett, G., Perkins, H., et al. (2005a). Site-Directed Mutagenesis
Studies of CCR5 Reveal Differences in the Interactions between the Receptor and
Various CCR5 Antagonists. In ‘‘45th Interscience Conference on Antimicrobial Agents
and Chemotherapy,’’ Washington DC, USA.
Dorr, P., Westby, M., Dobbs, S., Griffin, P., Irvine, B., Macartney, M., Mori, J.,
Rickett, G., Smith-Burchnell, C., Napier, C., Webster, R., Armour, D., et al.
CCR5 Primary Pharmacology Methods and Applications 53
Napier, C., Sale, H., Mosley, M., Rickett, G., Dorr, P., Mansfield, R., and Holbrook, M.
(2005). Molecular cloning and radioligand binding characterization of the chemokine
receptor CCR5 from rhesus macaque and human. Biochem. Pharmacol. 71, 163–172.
Epub 2005 Nov. 18.
Navratilova, I., Dioszegi, M., and Myszka, D. G. (2006). Analyzing ligand and small
molecule binding activity of solubilized GPCRs using biosensor technology. Anal.
Biochem. 355, 132–139. Epub 2006 May 15.
Oprian, D. D., Molday, R. S., Kaufman, R. J., and Khorana, H. G. (1987). Expression of a
synthetic bovine rhodopsin gene in monkey kidney cells. Proc. Natl. Acad. Sci. USA 84,
8874–8878.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and
Miyano, M. (2000). Crystal structure of rhodopsin: A G. protein-coupled receptor.
Science 289, 739–745.
Peltonen, J. M., Pihlavisto, M., and Scheinin, M. (1998). Subtype-Specific Stimulation
of [S-35]Gtp-Gamma-S Binding by Recombinant Alpha(2)-Adrenoceptors. European
Journal of Pharmacology 355, 275–279.
Petropoulos, C. J., Parkin, N. T., Limoli, K. L., Lie, Y. S., Wrin, T., Huang, W., Tian, H.,
Smith, D., Winslow, G. A., Capon, D. J., and Whitcomb, J. M. (2000). A novel
phenotypic drug susceptibility assay for human immunodeficiency virus type 1.
Antimicrob. Agents Chemother. 44, 920–928.
Rickett, G., Dobbs, S., Griffin, P., Dorr, P., Hitchcock, C., and Perros, M. (2003).
Development of a high throughput time resolved immunoassay to support discovery of
HIV-1 entry inhibitors. 43rd Annual Interscience Conference on Antimicrobial Agents
and Chemotherapy, Abstract F-1461.
Sauer, B., and Henderson, N. (1988). Site-specific DNA recombination in mammalian cells
by the Cre recombinase of bacteriophage P1. Proc. Natl. Acad. Sci. USA 85, 5166–5170.
Strizki, J. M., Tremblay, C., Xu, S., Wojcik, L., Wagner, N., Gonsiorek, W.,
Hipkin, R. W., Chou, C. C., Pugliese-Sivo, C., Xiao, Y., Tagat, J. R., Cox, K., et al.
(2005). Discovery and characterization of vicriviroc (SCH 417690), a CCR5 antagonist
with potent activity against human immunodeficiency virus type 1. Antimicrob. Agents
Chemother. 49, 4911–4919.
Strizki, J. M., Xu, S., Wagner, N. E., Wojcik, L., Liu, J., Hou, Y., Endres, M., Palani, A.,
Shapiro, S., Clader, J. W., Greenlee, W. J., Tagat, J. R., et al. (2001). SCH-C (SCH
351125), an orally bioavailable, small molecule antagonist of the chemokine receptor
CCR5, is a potent inhibitor of HIV-1 infection in vitro and in vivo. Proc. Natl. Acad. Sci.
USA 98(22), pp. 12718–12723.
Tagat, J. R., McCombie, S. W., Nazareno, D., Labroli, M. A., Xiao, Y., Steensma, R. W.,
Strizki, J. M., Baroudy, B. M., Cox, K., Lachowicz, J., Varty, G., and Watkins, R.
(2004). Piperazine-based CCR5 antagonists as HIV-1 inhibitors. IV. Discovery of
1-[(4,6-dimethyl-5-pyrimidinyl)carbonyl]-4-[4-[2-methoxy-1(R)-4-(trifluoromethyl)
phenyl]ethyl-3(S)-methyl-1-piperaz inyl]-4-methylpiperidine (Sch-417690/Sch-D),
a potent, highly selective, and orally bioavailable CCR5 antagonist. J. Med. Chem. 47,
2405–2408.
Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A.,
Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003a).
Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-
351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry.
J. Virol. 77, 5201–5208.
Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A.,
Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003b).
Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-
CCR5 Primary Pharmacology Methods and Applications 55
351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry. J. Virol.
77, 5201–5208.
Turner, J. E., Steinmetz, O. M., Stahl, R. A., and Panzer, U. (2007). Targeting of
Th1-associated chemokine receptors CXCR3 and CCR5 as therapeutic strategy for
inflammatory diseases. Mini Rev. Med. Chem. 7, 1089–1096.
Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005a). The CCR5 receptor-
based mechanism of action of 873140, a potent allosteric noncompetitive HIV entry
inhibitor. Mol. Pharmacol. 67, 1268–1282.
Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005b). The CCR5 receptor-
based mechanism of action of 873140, a potent allosteric noncompetitive HIV entry
inhibitor. Mol. Pharmacol. 67, 1268–1282. Epub 2005 Jan. 11.
Wells, T. N., Power, C. A., Shaw, J. P., and Proudfoot, A. E. (2006). Chemokine blockers--
therapeutics in the making? Trends Pharmacol. Sci. 27, 41–47. Epub 2005 Nov. 28.
Westby, M., Smith-Burchnell, C., Hamilton, D., Robas, N., Irvine, B., Fidock, M., Mills, J.,
Perruccio, F., Mori, J., Macartney, M., Barber, C., Dorr, P., et al. (2005). UK-427,857-
resistant Primary Isolates are Susceptible to Structurally-related CCR5 Antagonists.
In ‘‘12th Conference on Retroviruses and Opportunistic Infections,’’ Boston, MA.
Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Mosley, M., Stockdale, M., Dorr, P.,
Ciaramella, G., and Perros, M. (2007). Reduced maximal inhibition in phenotypic
susceptibility assays indicates that viral strains resistant to the CCR5 antagonist maraviroc
utilize inhibitor-bound receptor for entry. J. Virol. 81, 2359–2371.
Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Whitcomb, J., Petropoulos, C., and
Perros, M. (2004). In vitro Escape of R5 Primary Isolates from the CCR5 Antagonist,
UK-427,857, is Difficult to Achieve and Involves Continued Use of the CCR5 Receptor.
In ‘‘XIII International HIV Drug Resistance Workshop,’’ Tenerife.
C H A P T E R T H R E E
Contents
1. Introduction 58
2. HSPC Mobilizing Agents that Target the CXCL12/CXCR4 Axis 59
3. Donor Selection for HSPC Mobilization 64
3.1. Selection of mice for HSPC mobilization 64
3.2. Selection of humans for HSPC mobilization 64
4. Flow Cytometric Enumeration of Mobilized HSPCs 65
4.1. Flow cytometric enumeration of murine HSPCs 65
4.2. Flow cytometric enumeration of human HSPCs 65
5. Dosing and Kinetics of HSPC Mobilization by G-CSF and Plerixafor 66
5.1. G-CSF 66
5.2. Plerixafor 67
6. Flow Cytometric Analysis of CXCR4 Expression on Human CD34þ
Subsets 69
6.1. Evaluation of cell surface CXCR4 on human CD34þ cell subsets 70
7. Functional Characterization of Mobilized HSPCs 73
7.1. In vitro assays of differentiation 73
7.2. Transmigration assays 73
7.3. Transplantation assays for mouse and human HSPCs 74
8. Concluding Remarks 80
Acknowledgment 80
References 80
Abstract
The binding of the chemokine [C-X-C motif ] ligand 12 (CXCL12 or stromal cell–
derived factor 1a [SDF-1a]) constitutively produced by bone marrow stromal
cells and osteoblasts, to the CXC receptor (CXCR) 4, a transmembrane chemo-
kine receptor expressed on hematopoietic stem and progenitor cells (HSPCs),
Division of Oncology, Siteman Cancer Center, Washington University School of Medicine, St. Louis,
Missouri, USA
57
58 Michael P. Rettig et al.
has emerged as a key signal for HSPC trafficking to and from the bone marrow.
Disruption of CXCL12/CXCR4 signaling causes leukocytosis, with the release of
HSPCs, neutrophils, and lymphocytes into the peripheral blood. Although
mobilized peripheral blood has become the preferred source of stem cells for
both autologous and allogeneic transplantation, the optimum strategy for
obtaining mobilized products from donors is the subject of ongoing study.
Granulocyte colony–stimulating factor (G-CSF) and plerixafor (AMD3100) are
two agents used clinically to induce HSPC mobilization by disruption of the
CXCL12/CXCR4 interaction. This chapter describes current procedures used
to phenotypically and functionally characterize murine and human HSPCs
mobilized by G-CSF or plerixafor.
1. Introduction
The majority of hematopoietic stem and progenitor cells (HSPCs)
reside in the bone marrow in a highly organized microenvironment con-
sisting of marrow stromal cells, osteoblasts, osteoclasts, and other extracel-
lular matrix proteins (e.g., collagens, fibronectins, proteoglycans) (Adams
and Scadden, 2006; Kiger et al., 2000; Kollet et al., 2007; Wilson and
Trumpp, 2006; Xie and Spradling, 2000). HSPCs express a number of
cell surface molecules such as lymphocyte function–associated antigen-1
(LFA-1), very late antigen 4 (VLA-4), CXCR4, CXCR2, CD44, CD62L,
and CD117 (c-kit) that mediate their adherence in the bone marrow (BM)
microenvironment (Adams and Scadden, 2006; Lapidot et al., 2005; Wilson
and Trumpp, 2006). These interactions play important roles in regulating
HSPC trafficking, as well as self-renewal, proliferation, and differentiation
processes (Kiel and Morrison, 2008; Wilson and Trumpp, 2006).
Under normal conditions, a small number of HSPCs circulate in the
peripheral blood. However, the number of circulating HSPCs can be
increased 10- to 100-fold with administration of chemotherapy and/or
cytokines in a process termed ‘‘stem cell mobilization’’ (Bensinger et al.,
2009; Papayannopoulou and Scadden, 2008; Winkler and Levesque, 2006).
Mobilized HSPCs can be collected by large-volume apheresis techniques in
numbers sufficient for use in hematopoietic stem cell transplants, and upon
reinfusion, are capable of homing to the BM cavity and regenerating the full
array of hematopoietic lineages. Compared to BM, use of peripheral blood
stem cells in hematopoietic stem cell transplantation results in more rapid
hematologic reconstitution, reduced hospitalization costs, and avoids the
risks of general anesthesia and discomfort with a BM harvest (Group, 2005).
Because of these advantages, the use of mobilized HSPCs over marrow as a
stem cell source continues to increase such that greater than 95% of
CXCR4 and Mobilization 59
et al., 2001). More recently, a second receptor, CXCR7, was identified that
binds CXCL12 with an affinity that is approximately 10-fold higher than
the affinity for CXCR4 (Balabanian et al., 2005a; Burns et al., 2006).
Although the role of CXCR7 in CXCL12-dependent chemotaxis is not
fully understood, there is evidence that CXCR7 lacks intrinsic chemotactic
activity toward CXCL12, and functions instead by sequestering CXCL12
and modifying CXCR4 signaling (Boldajipour et al., 2008; Hartmann et al.,
2008; Sierro et al., 2007).
CXCR4 is a member of the large family of seven transmembrane
domain receptors coupled to heterotrimeric Gi proteins and functions as
a coreceptor for HIV-1 cell entry (Bleul et al., 1996; Feng et al., 1996;
Fredriksson et al., 2003; Loetscher et al., 1994; Oberlin et al., 1996). Both
CXCL12 (Bleul et al., 1996; Oberlin et al., 1996) and macrophage migrat-
ing inhibiting factor (MIF) (Bernhagen et al., 2007) are ligands for
CXCR4. The binding of CXCR4 to CXCL12 results in activation of
multiple signal transduction pathways ultimately triggering chemotaxis
(Busillo and Benovic, 2007; Kucia et al., 2004). Targeted disruption of
either CXCL12 or CXCR4 is lethal in mice, resulting in very similar
developmental defects, including the failure of HSPC migration from the
fetal liver to the BM, defects in lymphoid and myeloid hematopoiesis, and
cerebellar dysgenesis (Ma et al., 1998; Nagasawa et al., 1996; Tachibana
et al., 1998; Zou et al., 1998). Furthermore, wildtype mice transplanted
with CXCR4-deficient progenitor cells have high circulating levels of
HSPCs, indicating poor retention in the BM (Christopher et al., 2009;
Ma et al., 1999). Finally, multiple preclinical and clinical studies have
shown that pharmacologic interference in the axis between marrow-
derived CXCL12 and CXCR4 expressed on HSPCs using various
CXCR4 modulators, including antagonist, peptide agonist, and modified
CXCL12 analogues stimulate HSPC mobilization in a target-dependent
manner (Nervi et al., 2006; Pelus, 2008).
There are three potential mechanisms to explain how CXCR4 could
regulate HSPC mobilization: (1) downregulation of cell surface CXCR4 by
internalization or proteolysis, (2) disruption of the CXCL12 chemokine
gradient between the BM and plasma, and (3) receptor antagonism via
direct blocking of the CXCR4/CXCL12 interaction (Table 3.1).
Decreased expression of CXCR4 on mobilized HSPCs has been reported
following administration of G-CSF (Christopher et al., 2009; Dlubek
et al., 2006; Levesque et al., 2003; Oelschlaegel et al., 2007; Semerad et al.,
2005), a CXCL12 analogue (met-SDF-1b) (Shen et al., 2001; Yang et al.,
1999), and CXCL12-derived peptide agonists (CTCE-0021, CTCE-0214)
(Faber et al., 2007; Pelus et al., 2005; Zhong et al., 2004). Since native
CXCL12 itself downregulates CXCR4 expression but does not result
in significant mobilization (Haribabu et al., 1997; Orsini et al., 1999;
Table 3.1 CXCR4-mediated mobilization of murine HSPC
HSPC peak
Compound Class Mechanism Dose Route mobilization Reference
G-CSF Growth factor Granulocyte expansion/ 250 mg/kg/ SC Day 5 Molineux
activation, protease day x 5 days et al., 1990
release, and cleavage of
adhesion molecules,
downregulation of
CXCL12 in osteoblasts
Pegylated Growth factor Granulocyte expansion/ 25 mg SC Day 3 de Haan et al.,
G-CSF activation, protease 2000
release and cleavage
of adhesion molecules,
downregulation of
CXCL12 in osteoblasts
Plerixafor Bicyclam CXCR4 antagonist 5 mg/kg SC 3–6 h Broxmeyer
et al., 2005
3 mg/kg IV 1–3 h Ramirez
et al., 2008
T140 Peptide CXCR4 antagonist 5 mg/kg SC 1–2 h Abraham
et al., 2007
T134 Peptide CXCR4 antagonist 10 mg/kg SC 1h Iyer et al.,
2008
Met-SDF- CXCL12 analog CXCR4 agonist 300 mg IV 48 h Shen et al.,
1b 2001
(continued)
Table 3.1 (continued)
HSPC peak
Compound Class Mechanism Dose Route mobilization Reference
CTCE- CXCL12 peptide CXCR4 agonist 25 mg/kg SC 1h Pelus, et al.,
0021 analog 2005
CTCE- CXCL12 peptide CXCR4 agonist 75 mg IV 4h Zhong et al.,
0214 analog 2004
FucS Sulfated Disruption of CXCL12 100 mg/kg IV 1.5 h Sweeney
polysaccharide chemotactic gradient et al., 2002
G-CSF, granulocyte colony-stimulating factor; Met-SDF, N-terminal methionine stromal cell---derived factor; FucS, sulfated polysaccharide fucoidan; IV, intravenous;
SC, subcutaneous; n.d., not determined.
CXCR4 and Mobilization 63
5.2. Plerixafor
5.2.1. Mobilization of murine HSPCs by plerixafor
Plerixafor (Genzyme, Cambridge, MA) is supplied as a sterile isotonic
aqueous solution at 10 mg/ml. Broxmeyer and colleagues (2005) showed
that a single-dose administration of 5 mg/kg subcutaneous plerixafor
induces rapid mobilization of hematopoietic progenitor cells (HPCs) and
long term repopulating cells to the blood of mice, with maximal mobili-
zation of the HSPCs occurring 1 h postinjection. In agreement with these
published results, we found that treatment of 129 B6 F1 mice with
subcutaneous plerixafor results in rapid mobilization of white blood cells
(WBC) and HPCs, with peak CFU-GM levels achieved 3 h after a single
injection of 5 mg/kg plerixafor (Ramirez et al., 2008). Furthermore, we
reported that repetitive subcutaneous injection of 5 mg/kg plerixafor to
mice every 24 h results in a similar mobilization of progenitors (CFU-GM)
after each injection (Nervi et al., 2009). Similar data were generated by
Hubel et al. (2004) using normal human volunteers. These data demon-
strate that subcutaneous plerixafor can be given daily resulting in similar
kinetics and magnitude of progenitor mobilization with no obvious
tachyphylaxis.
In a separate series of experiments, we tested the efficacy of murine
HSPC mobilization following intravenous administration of 1, 3, or
5 mg/kg plerixafor (Ramirez et al., 2008). Analysis of the dose–response
relationship indicated that intravenous plerixafor resulted in more rapid
mobilization (peak 1 h) than subcutaneous administration. Doses higher
than 3 mg/kg intravenous plerixafor were lethal to the mice.
Plerixafor G-CSF
A
15.7 16.7
CD34
CD34
62.9 21 80.8 2.34
CD45RA CD45RA
B
% of max
% of max
CXCR4 CXCR4
C
% of max
% of max
VLA-4 VLA-4
CD45RA−CD34+
CD45RA+CD34+
CD45RA+CD34dim
Figure 3.1 Coexpression of CD45RA on human CD34þ cells identifies the CD34dim
subset. (A) Healthy donors were treated with a single injection of 240 mg/kg AMD3100
or given 10 mg/kg/day G-CSF for 5 days. CD34þ cells from leukapheresis products
were purified by CD34 immunoselection using an autoMACS device and the expression
of CD34 and CD45RA was evaluated by flow cytometry. CD45RAþCD34dim cells
are enriched in AMD3100-mobilized products. (B-C) CD45RAþCD34dim
cells from AMD3100-mobilized products express high levels of surface CXCR4 (B)
and VLA-4 (C).
Table 3.2 Staining setup for evaluation of CXCR4 on CD34þ cell subsets
7. Functional Characterization
of Mobilized HSPCs
7.1. In vitro assays of differentiation
In vitro assays of differentiation have been developed to quantify murine and
human HSPC content (Sutherland et al., 1989). In short-term colony-
forming cell (CFC) assays, test samples are cultured in a semisolid matrix
supplemented with nutrients and cytokines for 2 weeks at 37 . During this
culture period, CFCs proliferate and produce discrete cell clusters or colo-
nies of morphologically recognizable daughter cells that can be quantified
by light microscopy. Based on the selection of the appropriate media and
culture conditions, CFC assays can be used to quantify myeloid multipo-
tential progenitors (CFU-GEMM and CFU-GM) and lineage-restricted
progenitors of the erythrocyte (CFU-E and BFU-E), granulocyte
(CFU-G), monocyte-macrophage (CFU-M), megakayocyte (CFU-Mk),
and B-cell (CFU–pre-B) lineages.
The standardized short-term colony assays discussed above easily quan-
tify lineage-committed progenitors, but are not adequate for the detection
of more primitive HSPCs. Two assays, the cobblestone-area–forming-cell
(CAFC) assay (de Haan et al., 2002) and the long-term culture-initiating cell
(LTC-IC) assay (Lemieux et al., 1995; Sutherland et al., 1991), have been
developed to measure more primitive stem cell frequencies. Both the
CAFC and LTC-IC assays rely on adherent stromal cells for hematopoietic
support and are quantified in vitro based on their capacity to generate
myeloid cells for at least 5 weeks of culture. Additionally, the LTC-IC
assay can be used in a quantitative manner by limiting dilution analysis to
provide an estimate of the primitive cell pool within a product (Coulombel,
2004). The reader is referred to previous chapters in this series (Broxmeyer
et al., 2006) and elsewhere (Miller et al., 2008; van Os et al., 2008) for
detailed descriptions of the CFC, CAFC, and LTC-IC procedures (see also
www.stemcell.com/technical/manuals.asp).
and each mobilizing agent. For plerixafor and G-CSF mobilized grafts, we
and others (Broxmeyer et al., 2005) have set the ratio of donor (CD45.1þ)
blood cells to competitor (CD45.1þ/CD45.2þ) BM cells as the number
or LDMNCs in three, two, or one donor mice to a constant number of
5 105 competitor BM cells (CD45.1þ/CD45.2þ). For example, at a 3:1
ratio, we mix the number of LDMNCs obtained from the peripheral blood
of three donor mice (CD45.1þ) with 5 105 competitor BM cells
(CD45.1þ/CD45.2þ). Others mix 5 105 competitor BM cells with
2 106, 1.5 106, or 1 106 LDMNCs to yield LDMNC to BM ratios
of 4:1, 3:1, or 2:1, respectively (Fukuda et al., 2007). Pilot experiments are
recommended to obtain the range of LDMNCs required to achieve durable
test sample engraftment. Four B6 (CD45.2þ) mice that received 1000 cGy
TBI and 5 105 competitor BM cells (CD45.1þ/CD45.2þ) without donor
test cells were used as controls.
Hematopoietic repopulation is evaluated monthly for at least 6 months
to demonstrate long-term multilineage reconstitution in the CD45.1þ and
CD45.1þ/CD45.2þ donor cell subsets. Multilineage analysis is performed
on the blood by flow cytometry using antimouse monoclonal antibodies
against CD45.1, CD45.2, and the lineage markers B220 (B lymphoid),
CD3 (T lymphoid), Mac1 (monocyte/macrophage), and Gr1 (granulo-
cyte). At least 20,000 events are acquired on a flow cytometer. Since
myeloid progenitors and their progeny have short half-lives compared to
lymphoid progeny, it is important to demonstrate myeloid reconstitution in
the test-cell subset following transplantation. Furthermore, Bryder et al.
(2004) demonstrated that the RB6-8C5 mAb detecting Gr-1 also binds to
a subpopulation of CD3þCD8þ T cells present in the peripheral blood.
Therefore, granulocyte reconstitution should be defined as Gr-1þ cells
negative for expression of T-cell markers like CD3.
The percentage of chimerism is calculated based on flow cytometry data
as follows: % chimerism ¼ (% test donor cells) 100 / (% test donor cells þ
% competitor cells). Most investigators consider that primitive stem cells are
present in the test donor cells when the percent chimerism is greater than
1% for all myeloid (granulocytes and macrophages), B-lymphoid, and
T-lymphoid lineages at 6 months after transplantation.
The number of repopulating units (RU) in test donor cells is calculated
according to the method of Harrison et al. (1993) as follows: % chimerism ¼
(% chimerism) (no. of competitor cells/105) /(100 – % chimerism). One
RU is defined as the amount of repopulating activity in 105 BM cells from
wildtype mice (Ema et al., 2006; Purton and Scadden, 2007).
In limiting dilution assays, the frequency of competitive repopulating
units (CRU) among test donor cells is estimated on the basis of Poisson
statistics; the ranges of CRUs are given as 95% confidence intervals. Stem-
Cell Technologies has developed a program, L-Calc, to aid in the data
analysis of limiting dilution assays. This software is free to download from
CXCR4 and Mobilization 77
the company website. Of note, CRU and RU are different (Ema et al.,
2006; Purton and Scadden, 2007). CRU measures the quantity of HSPCs,
whereas RU measures the functional quality of HSPCs. Furthermore, since
short-term repopulating cells can reconstitute multiple lineages for at least
16 weeks, most researchers determine RU and CRU values from data
collected at least 6 months post-transplantation.
It should be noted, that noncompetitive primary transplantation assays
can be performed to mimic how transplants are performed clinically. In a
noncompetitive transplant, test cells (typically 1 to 2 106) are injected into
lethally irradiated congenic recipients in the absence of competing BM cells.
Although the primary endpoint in noncompetitive transplants is the time to
recovery of peripheral blood neutrophils, platelets, and hemoglobin, donor
chimerism can also be determined as described.
8. Concluding Remarks
Disruption of CXCL12/CXCR4 signaling is a critical step in HSPC
mobilization by G-CSF, plerixafor, and additional agents in development.
We (Devine et al., 2008; Hess et al., 2007; Rettig et al., 2008) and
others (Fruehauf et al., 2006; Jin et al., 2008; Pelus and Fukuda, 2008)
have found intrinsic differences between HSPCs mobilized with plerixafor
and G-CSF, including differences in cell surface markers, cell cycle, gene
expression profiles, and NOD/SCID repopulating capacity. The optimum
strategy for obtaining mobilized peripheral blood from donors is the subject
of ongoing study.
ACKNOWLEDGMENT
This work was supported by Genzyme Corporation.
REFERENCES
Abraham, M., Biyder, K., Begin, M., Wald, H., Weiss, I. D., Galun, E., Nagler, A., and
Peled, A. (2007). Enhanced unique pattern of hematopoietic cell mobilization induced
by the CXCR4 antagonist 4F-benzoyl-TN14003. Stem Cells 25, 2158–2166.
Adams, G. B., and Scadden, D. T. (2006). The hematopoietic stem cell in its place. Nat.
Immunol. 7, 333–337.
Balabanian, K., Lagane, B., Infantino, S., Chow, K. Y., Harriague, J., Moepps, B.,
Arenzana-Seisdedos, F., Thelen, M., and Bachelerie, F. (2005a). The chemokine
SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in
T lymphocytes. J. Biol. Chem. 280, 35760–35766.
Balabanian, K., Lagane, B., Pablos, J. L., Laurent, L., Planchenault, T., Verola, O.,
Lebbe, C., Kerob, D., Dupuy, A., Hermine, O., Nicolas, J. F., Latger-Cannard, V.,
CXCR4 and Mobilization 81
et al. (2005b). WHIM syndromes with different genetic anomalies are accounted for by
impaired CXCR4 desensitization to CXCL12. Blood 105, 2449–2457.
Balabanian, K., Levoye, A., Klemm, L., Lagane, B., Hermine, O., Harriague, J., Baleux, F.,
Arenzana-Seisdedos, F., and Bachelerie, F. (2008). Leukocyte analysis from WHIM
syndrome patients reveals a pivotal role for GRK3 in CXCR4 signaling. J. Clin. Invest.
118, 1074–1084.
Benboubker, L., Watier, H., Carion, A., Georget, M. T., Desbois, I., Colombat, P.,
Bardos, P., Binet, C., and Domenech, J. (2001). Association between the SDF1-30 A
allele and high levels of CD34(þ) progenitor cells mobilized into peripheral blood in
humans. Br. J. Haematol. 113, 247–250.
Bensinger, W., Appelbaum, F., Rowley, S., Storb, R., Sanders, J., Lilleby, K., Gooley, T.,
Demirer, T., Schiffman, K., and Weaver, C. (1995). Factors that influence collection and
engraftment of autologous peripheral-blood stem cells. J. Clin. Oncol. 13, 2547–2555.
Bensinger, W., Dipersio, J. F., and McCarty, J. M. (2009). Improving stem cell mobilization
strategies: Future directions. Bone Marrow Transplant. 43, 181–195.
Bernhagen, J., Krohn, R., Lue, H., Gregory, J. L., Zernecke, A., Koenen, R. R.,
Dewor, M., Georgiev, I., Schober, A., Leng, L., Kooistra, T., Fingerle-Rowson, G.,
et al. (2007). MIF is a noncognate ligand of CXC chemokine receptors in inflammatory
and atherogenic cell recruitment. Nat. Med. 13, 587–596.
Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., and
Springer, T. A. (1996). The lymphocyte chemoattractant SDF-1 is a ligand for
LESTR/fusin and blocks HIV-1 entry. Nature 382, 829–833.
Blom, B., Ho, S., Antonenko, S., and Liu, Y. J. (2000). Generation of interferon alpha-
producing predendritic cell (Pre-DC)2 from human CD34(þ) hematopoietic stem cells.
J. Exp. Med. 192, 1785–1796.
Blom, B., and Spits, H. (2006). Development of human lymphoid cells. Annu. Rev. Immunol.
24, 287–320.
Boeve, S., Strupeck, J., Creech, S., and Stiff, P. J. (2004). Analysis of remobilization success
in patients undergoing autologous stem cell transplants who fail an initial mobilization:
Risk factors, cytokine use and cost. Bone Marrow Transplant. 33, 997–1003.
Boldajipour, B., Mahabaleshwar, H., Kardash, E., Reichman-Fried, M., Blaser, H.,
Minina, S., Wilson, D., Xu, Q., and Raz, E. (2008). Control of chemokine-guided
cell migration by ligand sequestration. Cell 132, 463–473.
Brown, R. A., Adkins, D., Goodnough, L. T., Haug, J. S., Todd, G., Wehde, M.,
Hendricks, D., Ehlenbeck, C., Laub, L., and DiPersio, J. (1997). Factors that influence
the collection and engraftment of allogeneic peripheral-blood stem cells in patients with
hematologic malignancies. J. Clin. Oncol. 15, 3067–3074.
Broxmeyer, H. E., Orschell, C. M., Clapp, D. W., Hangoc, G., Cooper, S., Plett, P. A.,
Liles, W. C., Li, X., Graham-Evans, B., Campbell, T. B., Calandra, G., Bridger, G., et al.
(2005). Rapid mobilization of murine and human hematopoietic stem and progenitor
cells with AMD3100, a CXCR4 antagonist. J. Exp. Med. 201, 1307–1318.
Broxmeyer, H. E., Srour, E., Orschell, C., Ingram, D. A., Cooper, S., Plett, P. A.,
Mead, L. E., and Yoder, M. C. (2006). Cord blood stem and progenitor cells. Methods
Enzymol. 419, 439–473.
Bryder, D., Sasaki, Y., Borge, O. J., and Jacobsen, S. E. (2004). Deceptive multilineage
reconstitution analysis of mice transplanted with hemopoietic stem cells, and implications
for assessment of stem cell numbers and lineage potentials. J. Immunol. 172, 1548–1552.
Burger, J. A., and Peled, A. (2009). CXCR4 antagonists: Targeting the microenvironment
in leukemia and other cancers. Leukemia 23, 43–52.
Burns, J. M., Summers, B. C., Wang, Y., Melikian, A., Berahovich, R., Miao, Z.,
Penfold, M. E., Sunshine, M. J., Littman, D. R., Kuo, C. J., Wei, K.,
McMaster, B. E., et al. (2006). A novel chemokine receptor for SDF-1 and I-TAC
82 Michael P. Rettig et al.
involved in cell survival, cell adhesion, and tumor development. J. Exp. Med. 203,
2201–2213.
Busillo, J. M., and Benovic, J. L. (2007). Regulation of CXCR4 signaling. Biochim. Biophys.
Acta 1768, 952–963.
Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D. P., Knight, M. C.,
Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F. R., Milner, L. A.,
Kronenberg, H. M., et al. (2003). Osteoblastic cells regulate the haematopoietic stem
cell niche. Nature 425, 841–846.
Cashman, J., Bockhold, K., Hogge, D. E., Eaves, A. C., and Eaves, C. J. (1997). Sustained
proliferation, multi-lineage differentiation and maintenance of primitive human haemo-
poietic cells in NOD/SCID mice transplanted with human cord blood. Br. J. Haematol.
98, 1026–1036.
Christopher, M. J., Liu, F., Hilton, M. J., Long, F., and Link, D. C. (2009). Suppression of
CXCL12 production by bone marrow osteoblasts is a common and critical pathway for
cytokine-induced mobilization. Blood doi: 10.1182/blood-2008-10-184754.
Coulombel, L. (2004). Identification of hematopoietic stem/progenitor cells: strength and
drawbacks of functional assays. Oncogene 23, 7210–7222.
Dar, A., Goichberg, P., Shinder, V., Kalinkovich, A., Kollet, O., Netzer, N., Margalit, R.,
Zsak, M., Nagler, A., Hardan, I., Resnick, I., Rot, A., et al. (2005). Chemokine receptor
CXCR4-dependent internalization and resecretion of functional chemokine SDF-1 by
bone marrow endothelial and stromal cells. Nat. Immunol. 6, 1038–1046.
de Haan, G., Ausema, A., Wilkens, M., Molineux, G., and Dontje, B. (2000). Efficient
mobilization of haematopoietic progenitors after a single injection of pegylated recombi-
nant human granulocyte colony-stimulating factor in mouse strains with distinct
marrow-cell pool sizes. Br. J. Haematol. 110, 638–646.
de Haan, G., Bystrykh, L. V., Weersing, E., Dontje, B., Geiger, H., Ivanova, N.,
Lemischka, I. R., Vellenga, E., and Van Zant, G. (2002). A genetic and genomic analysis
identifies a cluster of genes associated with hematopoietic cell turnover. Blood 100,
2056–2062.
Devine, S. M., Vij, R., Rettig, M., Todt, L., McGlauchlen, K., Fisher, N., Devine, H.,
Link, D. C., Calandra, G., Bridger, G., Westervelt, P., and Dipersio, J. F. (2008). Rapid
mobilization of functional donor hematopoietic cells without G-CSF using AMD3100,
an antagonist of the CXCR4/SDF-1 interaction. Blood 112, 990–998.
Dlubek, D., Drabczak-Skrzypek, D., and Lange, A. (2006). Low CXCR4 membrane
expression on CD34(þ) cells characterizes cells mobilized to blood. Bone Marrow Trans-
plant. 37, 19–23.
Eaves, C., Glimm, H., Eisterer, W., Audet, J., Maguer-Satta, V., and Piret, J. (2001).
Characterization of human hematopoietic cells with short-lived in vivo repopulating
activity. Ann. N. Y. Acad. Sci. 938, 63–70; discussion 70–71.
Ema, H., Morita, Y., Yamazaki, S., Matsubara, A., Seita, J., Tadokoro, Y., Kondo, H.,
Takano, H., and Nakauchi, H. (2006). Adult mouse hematopoietic stem cells: Purifica-
tion and single-cell assays. Nat. Protoc. 1, 2979–2987.
Faber, A., Roderburg, C., Wein, F., Saffrich, R., Seckinger, A., Horsch, K., Diehlmann, A.,
Wong, D., Bridger, G., Eckstein, V., Ho, A. D., and Wagner, W. (2007). The many
facets of SDF-1alpha, CXCR4 agonists and antagonists on hematopoietic progenitor
cells. J. Biomed. Biotechnol. 2007, 260–265.
Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A. (1996). HIV-1 entry cofactor:
Functional cDNA cloning of a seven-transmembrane, G protein–coupled receptor.
Science 272, 872–877.
Forster, R., Kremmer, E., Schubel, A., Breitfeld, D., Kleinschmidt, A., Nerl, C.,
Bernhardt, G., and Lipp, M. (1998). Intracellular and surface expression of the HIV-1
CXCR4 and Mobilization 83
Harrison, D. E., Jordan, C. T., Zhong, R. K., and Astle, C. M. (1993). Primitive hemopoi-
etic stem cells: Direct assay of most productive populations by competitive repopulation
with simple binomial, correlation and covariance calculations. Exp. Hematol. 21,
206–219.
Hartmann, T. N., Grabovsky, V., Pasvolsky, R., Shulman, Z., Buss, E. C., Spiegel, A.,
Nagler, A., Lapidot, T., Thelen, M., and Alon, R. (2008). A crosstalk between intracel-
lular CXCR7 and CXCR4 involved in rapid CXCL12-triggered integrin activation but
not in chemokine-triggered motility of human T lymphocytes and CD34þ cells.
J. Leukoc. Biol. 84, 1130–1140.
Hattori, K., Heissig, B., Tashiro, K., Honjo, T., Tateno, M., Shieh, J. H., Hackett, N. R.,
Quitoriano, M. S., Crystal, R. G., Rafii, S., and Moore, M. A. (2001). Plasma elevation
of stromal cell-derived factor-1 induces mobilization of mature and immature hemato-
poietic progenitor and stem cells. Blood 97, 3354–3360.
Hawley, R. G., Ramezani, A., and Hawley, T. S. (2006). Hematopoietic stem cells. Methods
Enzymol. 419, 149–179.
Henon, P. R., Liang, H., Beck-Wirth, G., Eisenmann, J. C., Lepers, M., Wunder, E., and
Kandel, G. (1992). Comparison of hematopoietic and immune recovery after autologous
bone marrow or blood stem cell transplants. Bone Marrow Transplant. 9, 285–291.
Herbert, K. E., Levesque, J. P., Haylock, D. N., and Prince, H. M. (2008). The use of
experimental murine models to assess novel agents of hematopoietic stem and progenitor
cell mobilization. Biol. Blood Marrow Transplant. 14, 603–621.
Hernandez, J. M., Castilla, C., Gutierrez, N. C., Isidro, I. M., Delgado, M., de las Rivas, J.,
Ferminan, E., Garcia, J. L., Ocio, E. M., del Canizo, M. C., and San Miguel, J. F. (2005).
Mobilisation with G-CSF in healthy donors promotes a high but temporal deregulation
of genes. Leukemia 19, 1088–1091.
Hernandez, P. A., Gorlin, R. J., Lukens, J. N., Taniuchi, S., Bohinjec, J., Francois, F.,
Klotman, M. E., and Diaz, G. A. (2003). Mutations in the chemokine receptor gene
CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease.
Nat. Genet. 34, 70–74.
Hess, D. A., Bonde, J., Craft, T. P., Wirthlin, L., Hohm, S., Lahey, R., Todt, L. M.,
Dipersio, J. F., Devine, S. M., and Nolta, J. A. (2007). Human progenitor cells rapidly
mobilized by AMD3100 repopulate NOD/SCID mice with increased frequency in
comparison to cells from the same donor mobilized by granulocyte colony stimulating
factor. Biol. Blood Marrow Transplant. 13, 398–411.
Hill, G. R., Morris, E. S., Fuery, M., Hutchins, C., Butler, J., Grigg, A., Roberts, A.,
Bradstock, K., Szer, J., Kennedy, G., Morton, J., and Durrant, S. (2006). Allogeneic stem
cell transplantation with peripheral blood stem cells mobilized by pegylated G-CSF. Biol.
Blood Marrow Transplant. 12, 603–607.
Hubel, K., Liles, W. C., Broxmeyer, H. E., Rodger, E., Wood, B., Cooper, S., Hangoc, G.,
Macfarland, R., Bridger, G. J., Henson, G. W., Calandra, G., and Dale, D. C. (2004).
Leukocytosis and mobilization of CD34þ hematopoietic progenitor cells by AMD3100,
a CXCR4 antagonist. Support Cancer Ther. 1, 165–172.
Imai, K., Kobayashi, M., Wang, J., Shinobu, N., Yoshida, H., Hamada, J., Shindo, M.,
Higashino, F., Tanaka, J., Asaka, M., and Hosokawa, M. (1999). Selective secretion of
chemoattractants for haemopoietic progenitor cells by bone marrow endothelial cells:
A possible role in homing of haemopoietic progenitor cells to bone marrow. Br. J.
Haematol. 106, 905–911.
Ito, M., Hiramatsu, H., Kobayashi, K., Suzue, K., Kawahata, M., Hioki, K., Ueyama, Y.,
Koyanagi, Y., Sugamura, K., Tsuji, K., Heike, T., and Nakahata, T. (2002). NOD/
SCID/gamma(c)(null) mouse: An excellent recipient mouse model for engraftment of
human cells. Blood 100, 3175–3182.
CXCR4 and Mobilization 85
Iyer, C. V., Evans, R. J., Lou, Q., Lin, D., Wang, J., Kohn, W., Yan, L. Z., Pulley, S., and
Peng, S. B. (2008). Rapid and recurrent neutrophil mobilization regulated by T134,
a CXCR4 peptide antagonist. Exp. Hematol. 36, 1098–1109.
Jin, P., Wang, E., Ren, J., Childs, R., Shin, J. W., Khuu, H., Marincola, F. M., and
Stroncek, D. F. (2008). Differentiation of two types of mobilized peripheral blood
stem cells by microRNA and cDNA expression analysis. J. Translational Med. 6, 39.
Jung, Y., Wang, J., Schneider, A., Sun, Y. X., Koh-Paige, A. J., Osman, N. I.,
McCauley, L. K., and Taichman, R. S. (2006). Regulation of SDF-1 (CXCL12)
production by osteoblasts; a possible mechanism for stem cell homing. Bone 38, 497–508.
Katayama, Y., Battista, M., Kao, W. M., Hidalgo, A., Peired, A. J., Thomas, S. A., and
Frenette, P. S. (2006). Signals from the sympathetic nervous system regulate hemato-
poietic stem cell egress from bone marrow. Cell 124, 407–421.
Kawai, T., Choi, U., Cardwell, L., DeRavin, S. S., Naumann, N., Whiting-
Theobald, N. L., Linton, G. F., Moon, J., Murphy, P. M., and Malech, H. L. (2007).
WHIM syndrome myelokathexis reproduced in the NOD/SCID mouse xenotransplant
model engrafted with healthy human stem cells transduced with C-terminus–truncated
CXCR4. Blood 109, 78–84.
Kawai, T., Choi, U., Whiting-Theobald, N. L., Linton, G. F., Brenner, S., Sechler, J. M.,
Murphy, P. M., and Malech, H. L. (2005). Enhanced function with decreased internali-
zation of carboxy-terminus truncated CXCR4 responsible for WHIM syndrome. Exp.
Hematol. 33, 460–468.
Khan, A., Greenman, J., and Archibald, S. J. (2007). Small molecule CXCR4 chemokine
receptor antagonists: Developing drug candidates. Curr. Med. Chem. 14, 2257–2277.
Kiel, M. J., and Morrison, S. J. (2008). Uncertainty in the niches that maintain haemato-
poietic stem cells. Nat. Rev. Immunol. 8, 290–301.
Kiel, M. J., Yilmaz, O. H., Iwashita, T., Terhorst, C., and Morrison, S. J. (2005). SLAM
family receptors distinguish hematopoietic stem and progenitor cells and reveal endothe-
lial niches for stem cells. Cell 121, 1109–1121.
Kiger, A. A., White-Cooper, H., and Fuller, M. T. (2000). Somatic support cells restrict
germline stem cell self-renewal and promote differentiation. Nature 407, 750–754.
Kobbe, G., Sohngen, D., Bauser, U., Schneider, P., Germing, U., Thiele, K. P., Rieth, C.,
Hunerliturkoglu, A., Fischer, J., Frick, M., Wernet, P., Aul, C., et al. (1999). Factors
influencing G-CSF–mediated mobilization of hematopoietic progenitor cells during
steady-state hematopoiesis in patients with malignant lymphoma and multiple myeloma.
Ann. Hematol. 78, 456–462.
Kollet, O., Dar, A., and Lapidot, T. (2007). The multiple roles of osteoclasts in host defense:
Bone remodeling and hematopoietic stem cell mobilization. Annu. Rev. Immunol. 25,
51–69.
Kollet, O., Peled, A., Byk, T., Ben-Hur, H., Greiner, D., Shultz, L., and Lapidot, T. (2000).
beta2 microglobulin-deficient (B2m(null)) NOD/SCID mice are excellent recipients for
studying human stem cell function. Blood 95, 3102–3105.
Kollet, O., Spiegel, A., Peled, A., Petit, I., Byk, T., Hershkoviz, R., Guetta, E., Barkai, G.,
Nagler, A., and Lapidot, T. (2001). Rapid and efficient homing of human CD34(þ)
CD38(-/low)CXCR4(þ) stem and progenitor cells to the bone marrow and spleen of
NOD/SCID and NOD/SCID/B2m(null) mice. Blood 97, 3283–3291.
Kroschinsky, F., Holig, K., and Ehninger, G. (2008). The role of pegfilgrastim in mobiliza-
tion of hematopoietic stem cells. Transfus. Apheresis Sci. 38, 237–244.
Kroschinsky, F., Holig, K., Poppe-Thiede, K., Zimmer, K., Ordemann, R.,
Blechschmidt, M., Oelschlaegel, U., Bornhauser, M., Rall, G., Rutt, C., and
Ehninger, G. (2005). Single-dose pegfilgrastim for the mobilization of allogeneic
CD34þ peripheral blood progenitor cells in healthy family and unrelated donors.
Haematologica 90, 1665–1671.
86 Michael P. Rettig et al.
Kucia, M., Jankowski, K., Reca, R., Wysoczynski, M., Bandura, L., Allendorf, D. J.,
Zhang, J., Ratajczak, J., and Ratajczak, M. Z. (2004). CXCR4-SDF-1 signalling,
locomotion, chemotaxis and adhesion. J. Mol. Histol. 35, 233–245.
Lane, T. A., Law, P., Maruyama, M., Young, D., Burgess, J., Mullen, M., Mealiffe, M.,
Terstappen, L. W., Hardwick, A., and Moubayed, M. (1995). Harvesting and enrich-
ment of hematopoietic progenitor cells mobilized into the peripheral blood of normal
donors by granulocyte-macrophage colony-stimulating factor (GM-CSF) or G-CSF:
Potential role in allogeneic marrow transplantation. Blood 85, 275–282.
Lapidot, T., Dar, A., and Kollet, O. (2005). How do stem cells find their way home? Blood
106, 1901–1910.
Larochelle, A., Vormoor, J., Hanenberg, H., Wang, J. C., Bhatia, M., Lapidot, T.,
Moritz, T., Murdoch, B., Xiao, X. L., Kato, I., Williams, D. A., and Dick, J. E.
(1996). Identification of primitive human hematopoietic cells capable of repopulating
NOD/SCID mouse bone marrow: Implications for gene therapy. Nat. Med. 2,
1329–1337.
Lemieux, M. E., Rebel, V. I., Lansdorp, P. M., and Eaves, C. J. (1995). Characterization
and purification of a primitive hematopoietic cell type in adult mouse marrow capable of
lymphomyeloid differentiation in long-term marrow ‘‘switch’’ cultures. Blood 86,
1339–1347.
Levesque, J. P., Hendy, J., Takamatsu, Y., Simmons, P. J., and Bendall, L. J. (2003).
Disruption of the CXCR4/CXCL12 chemotactic interaction during hematopoietic
stem cell mobilization induced by GCSF or cyclophosphamide. J. Clin. Invest. 111,
187–196.
Liles, W. C., Broxmeyer, H. E., Rodger, E., Wood, B., Hubel, K., Cooper, S., Hangoc, G.,
Bridger, G. J., Henson, G. W., Calandra, G., and Dale, D. C. (2003). Mobilization of
hematopoietic progenitor cells in healthy volunteers by AMD3100, a CXCR4 antago-
nist. Blood 102, 2728–2730.
Lin, K. K., and Goodell, M. A. (2006). Purification of hematopoietic stem cells using the side
population. Methods Enzymol. 420, 255–264.
Loetscher, M., Geiser, T., O’Reilly, T., Zwahlen, R., Baggiolini, M., and Moser, B. (1994).
Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly
expressed in leukocytes. J. Biol. Chem. 269, 232–237.
Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa, T., Kishimoto, T.,
Bronson, R. T., and Springer, T. A. (1998). Impaired B-lymphopoiesis, myelopoiesis,
and derailed cerebellar neuron migration in CXCR4- and SDF-1–deficient mice. Proc.
Natl. Acad. Sci. USA 95, 9448–9453.
Ma, Q., Jones, D., and Springer, T. A. (1999). The chemokine receptor CXCR4 is required
for the retention of B lineage and granulocytic precursors within the bone marrow
microenvironment. Immunity 10, 463–471.
Marchese, A., Paing, M. M., Temple, B. R., and Trejo, J. (2008). G protein–coupled
receptor sorting to endosomes and lysosomes. Annu. Rev. Pharmacol. Toxicol. 48,
601–629.
McKenzie, J. L., Gan, O. I., Doedens, M., and Dick, J. E. (2005). Human short-term
repopulating stem cells are efficiently detected following intrafemoral transplantation into
NOD/SCID recipients depleted of CD122þ cells. Blood 106, 1259–1261.
Miller, C. L., Dykstra, B., and Eaves, C. J. (2008). Characterization of mouse hematopoietic
stem and progenitor cells. Curr. Protoc. Immunol. 22, Unit 22B 2.
Molineux, G., Pojda, Z., and Dexter, T. M. (1990). A comparison of hematopoiesis in
normal and splenectomized mice treated with granulocyte colony-stimulating factor.
Blood 75, 563–569.
Montgomery, M., and Cottler-Fox, M. (2007). Mobilization and collection of autologous
hematopoietic progenitor/stem cells. Clin. Adv. Hematol. Oncol. 5, 127–136.
CXCR4 and Mobilization 87
Pusic, I., Jiang, S. Y., Landua, S., Uy, G. L., Rettig, M. P., Cashen, A. F., Westervelt, P.,
Vij, R., Abboud, C. N., Stockerl-Goldstein, K. E., Sempek, D. S., Smith, A. L., et al.
(2008). Impact of mobilization and remobilization strategies on achieving sufficient stem
cell yields for autologous transplantation. Biol. Blood Marrow Transplant. 14, 1045–1056.
Ramirez, P. A., Rettig, M., Holt, M., Ritchey, J. K., and DiPersio, J. F. (2008). Rapid
mobilization of long term repopulating hematopoietic stem cells (HSC) with
AMD15057, a small molecule inhibitor of VLA4; synergism with AMD3100 and
G-CSF. Blood 112, 229:615a.
Rettig, M. P., Shannon, W. D., Ritchey, J., Holt, M., McFarland, K., Lopez, S., Gabriel, J.,
and DiPersio, J. F. (2008). Characterization of human CD34þ hematopoietic stem cells
following administration of G-CSF or plerixafor. Blood 112, 1192:3476a.
Roberts, A. W., Foote, S., Alexander, W. S., Scott, C., Robb, L., and Metcalf, D. (1997).
Genetic influences determining progenitor cell mobilization and leukocytosis induced by
granulocyte colony-stimulating factor. Blood 89, 2736–2744.
Robinson, S. N., and van Os, R. P. (2008). Mobilization of hematopoietic stem and
progenitor cells in mice. Methods Mol. Biol. 430, 31–53.
Schmitz, N., Linch, D. C., Dreger, P., Goldstone, A. H., Boogaerts, M. A., Ferrant, A.,
Demuynck, H. M., Link, H., Zander, A., and Barge, A. (1996). Randomised trial of
filgrastim-mobilised peripheral blood progenitor cell transplantation versus autologous
bone-marrow transplantation in lymphoma patients. Lancet 347, 353–357.
Semerad, C. L., Christopher, M. J., Liu, F., Short, B., Simmons, P. J., Winkler, I.,
Levesque, J. P., Chappel, J., Ross, F. P., and Link, D. C. (2005). G-CSF potently inhibits
osteoblast activity and CXCL12 mRNA expression in the bone marrow. Blood 106,
3020–3027.
Shalekoff, S., and Tiemessen, C. T. (2001). Duration of sample storage dramatically alters
expression of the human immunodeficiency virus coreceptors CXCR4 and CCR5. Clin.
Diagn. Lab. Immunol. 8, 432–436.
Shapira, M. Y., Kaspler, P., Samuel, S., Shoshan, S., and Or, R. (2003). Granulocyte colony
stimulating factor does not induce long-term DNA instability in healthy peripheral blood
stem cell donors. Am. J. Hematol. 73, 33–36.
Shen, H., Cheng, T., Olszak, I., Garcia-Zepeda, E., Lu, Z., Herrmann, S., Fallon, R.,
Luster, A. D., and Scadden, D. T. (2001). CXCR-4 desensitization is associated with
tissue localization of hemopoietic progenitor cells. J. Immunol. 166, 5027–5033.
Sheridan, W. P., Begley, C. G., To, L. B., Grigg, A., Szer, J., Maher, D., Green, M. D.,
Rowlings, P. A., McGrath, K. M., and Cebon, J. (1994). Phase II study of autologous
filgrastim (G-CSF)-mobilized peripheral blood progenitor cells to restore hemopoiesis
after high-dose chemotherapy for lymphoid malignancies. Bone Marrow Transplant. 14,
105–111.
Shultz, L. D., Lyons, B. L., Burzenski, L. M., Gott, B., Chen, X., Chaleff, S., Kotb, M.,
Gillies, S. D., King, M., Mangada, J., Greiner, D. L., and Handgretinger, R. (2005).
Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R gamma null
mice engrafted with mobilized human hemopoietic stem cells. J. Immunol. 174,
6477–6489.
Sierro, F., Biben, C., Martinez-Munoz, L., Mellado, M., Ransohoff, R. M., Li, M.,
Woehl, B., Leung, H., Groom, J., Batten, M., Harvey, R. P., Martinez, A. C., et al.
(2007). Disrupted cardiac development but normal hematopoiesis in mice deficient in the
second CXCL12/SDF-1 receptor, CXCR7. Proc. Natl. Acad. Sci. USA 104,
14759–14764.
Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F.,
Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., Luther, M. A.,
Wells, T. N., et al. (1997). Phorbol esters and SDF-1 induce rapid endocytosis and
down modulation of the chemokine receptor CXCR4. J. Cell Biol. 139, 651–664.
CXCR4 and Mobilization 89
Signoret, N., Rosenkilde, M. M., Klasse, P. J., Schwartz, T. W., Malim, M. H., Hoxie, J. A.,
and Marsh, M. (1998). Differential regulation of CXCR4 and CCR5 endocytosis. J. Cell
Sci. 111(Pt 18), 2819–2830.
Sugiyama, T., Kohara, H., Noda, M., and Nagasawa, T. (2006). Maintenance of the
hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone
marrow stromal cell niches. Immunity 25, 977–988.
Sutherland, H. J., Eaves, C. J., Eaves, A. C., Dragowska, W., and Lansdorp, P. M. (1989).
Characterization and partial purification of human marrow cells capable of initiating
long-term hematopoiesis in vitro. Blood 74, 1563–1570.
Sutherland, H. J., Eaves, C. J., Lansdorp, P. M., Thacker, J. D., and Hogge, D. E. (1991).
Differential regulation of primitive human hematopoietic cells in long-term cultures
maintained on genetically engineered murine stromal cells. Blood 78, 666–672.
Sweeney, E. A., Lortat-Jacob, H., Priestley, G. V., Nakamoto, B., and Papayannopoulou, T.
(2002). Sulfated polysaccharides increase plasma levels of SDF-1 in monkeys and mice:
Involvement in mobilization of stem/progenitor cells. Blood 99, 44–51.
Szilvassy, S. J., Humphries, R. K., Lansdorp, P. M., Eaves, A. C., and Eaves, C. J. (1990).
Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive
repopulation strategy. Proc. Natl. Acad. Sci. USA 87, 8736–8740.
Szilvassy, S. J., Lansdorp, P. M., Humphries, R. K., Eaves, A. C., and Eaves, C. J. (1989).
Isolation in a single step of a highly enriched murine hematopoietic stem cell population
with competitive long-term repopulating ability. Blood 74, 930–939.
Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y.,
Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998).
The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal
tract. Nature 393, 591–594.
Taswell, C. (1981). Limiting dilution assays for the determination of immunocompetent cell
frequencies. I. Data analysis. J. Immunol. 126, 1614–1619.
Tigue, C. C., McKoy, J. M., Evens, A. M., Trifilio, S. M., Tallman, M. S., and
Bennett, C. L. (2007). Granulocyte-colony stimulating factor administration to healthy
individuals and persons with chronic neutropenia or cancer: An overview of safety
considerations from the Research on Adverse Drug Events and Reports project. Bone
Marrow Transplant. 40, 185–192.
Tricot, G., Jagannath, S., Vesole, D., Nelson, J., Tindle, S., Miller, L., Cheson, B.,
Crowley, J., and Barlogie, B. (1995). Peripheral blood stem cell transplants for multiple
myeloma: Identification of favorable variables for rapid engraftment in 225 patients. Blood
85, 588–96.
Uy, G. L., Rettig, M. P., and Cashen, A. F. (2008). Plerixafor, a CXCR4 antagonist for the
mobilization of hematopoietic stem cells. Expert Opin. Biol. Ther. 8, 1797–804.
van Os, R. P., Dethmers-Ausema, B., and de Haan, G. (2008). In vitro assays for cobblestone
area-forming cells, LTC-IC, and CFU-C. Methods Mol. Biol. 430, 143–57.
Voermans, C., Kooi, M. L., Rodenhuis, S., van der Lelie, H., van der Schoot, C. E., and
Gerritsen, W. R. (2001). In vitro migratory capacity of CD34þ cells is related to
hematopoietic recovery after autologous stem cell transplantation. Blood 97, 799–804.
Wang, S., Nademanee, A., Qian, D., Dagis, A., Park, H. S., Fridey, J., Smith, E., Snyder, D.,
Somlo, G., Stein, A., Rosenthal, J., Falk, P., et al. (2007). Peripheral blood hematopoietic
stem cell mobilization and collection efficacy is not an independent prognostic factor for
autologous stem cell transplantation. Transfusion 47, 2207–2216.
Watt, S. M., and Forde, S. P. (2008). The central role of the chemokine receptor, CXCR4,
in haemopoietic stem cell transplantation: Will CXCR4 antagonists contribute to the
treatment of blood disorders? Vox Sang 94, 18–32.
Weaver, C. H., Hazelton, B., Birch, R., Palmer, P., Allen, C., Schwartzberg, L., and
West, W. (1995). An analysis of engraftment kinetics as a function of the CD34 content
90 Michael P. Rettig et al.
of peripheral blood progenitor cell collections in 692 patients after the administration of
myeloablative chemotherapy. Blood 86, 3961–3969.
Weissman, I. L., and Shizuru, J. A. (2008). The origins of the identification and isolation of
hematopoietic stem cells, and their capability to induce donor-specific transplantation
tolerance and treat autoimmune diseases. Blood 112, 3543–3553.
Wilson, A., and Trumpp, A. (2006). Bone-marrow haematopoietic-stem-cell niches. Nat.
Rev. Immunol. 6, 93–106.
Winkler, I. G., and Levesque, J. P. (2006). Mechanisms of hematopoietic stem cell mobili-
zation: When innate immunity assails the cells that make blood and bone. Exp. Hematol.
34, 996–1009.
Xie, T., and Spradling, A. C. (2000). A niche maintaining germ line stem cells in the
Drosophila ovary. Science 290, 328–330.
Yang, O. O., Swanberg, S. L., Lu, Z., Dziejman, M., McCoy, J., Luster, A. D.,
Walker, B. D., and Herrmann, S. H. (1999). Enhanced inhibition of human immunode-
ficiency virus type 1 by Met-stromal-derived factor 1beta correlates with down-
modulation of CXCR4. J. Virol. 73, 4582–4589.
Yuan, R., Astle, C. M., Chen, J., and Harrison, D. E. (2005). Genetic regulation of
hematopoietic stem cell exhaustion during development and growth. Exp. Hematol.
33, 243–250.
Zamboni, W. C. (2003). Pharmacokinetics of pegfilgrastim. Pharmacotherapy 23, 9S–14S.
Zeller, W., Gutensohn, K., Stockschlader, M., Dierlamm, J., Kroger, N., Koehne, G.,
Hummel, K., Kabisch, H., Weh, H. J., Kuhnl, P., Hossfeld, D. K., and Zander, A. R.
(1996). Increase of mobilized CD34-positive peripheral blood progenitor cells in patients
with Hodgkin’s disease, non-Hodgkin’s lymphoma, and cancer of the testis. Bone Marrow
Transplant. 17, 709–713.
Zhang, Y., Foudi, A., Geay, J. F., Berthebaud, M., Buet, D., Jarrier, P., Jalil, A.,
Vainchenker, W., and Louache, F. (2004). Intracellular localization and constitutive
endocytosis of CXCR4 in human CD34þ hematopoietic progenitor cells. Stem Cells
22, 1015–1029.
Zhong, R., Law, P., Wong, D., Merzouk, A., Salari, H., and Ball, E. D. (2004). Small
peptide analogs to stromal derived factor-1 enhance chemotactic migration of human and
mouse hematopoietic cells. Exp. Hematol. 32, 470–475.
Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998).
Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar
development. Nature 393, 595–599.
C H A P T E R F O U R
Contents
1. Introduction 92
2. Basic Protocol for ISH (Using Digoxygenin-Labeled Probe) 93
2.1. Equipment and reagent 93
2.2. Tissue preparation 94
2.3. Total RNA purification 94
2.4. First-strand cDNA synthesis 95
2.5. cDNA clones of chemokine receptors 95
2.6. Generation of ISH probe by in vitro transcription 96
2.7. Hybridization 97
2.8. Posthybridization washing 98
2.9. Development of ISH signals 98
2.10. Controls 99
3. Comments 101
References 102
Abstract
Chemokines are a family of mainly-secreted proteins, traditionally associated
with regulation of leukocyte trafficking during host defense and pathological
immune/inflammatory reactions. All chemokines signal to G protein-coupled
receptors. Recent studies show that chemokines and their receptors are also
expressed by neuroepithelial cells, and govern developmental, physiological
and pathological processes through actions towards these cells, as well
as infiltrating and resident hematopoietic cells. Understanding chemokine
action at the tissue level therefore requires defining which cells express
chemokine receptors. At a first level of approximation (and lacking appropriate
91
92 Meizhang Li and Richard M. Ransohoff
1. Introduction
In the central nervous system (CNS), chemokines and chemokine
receptors are constitutively or inducibly expressed in neurons (Belmadani
et al., 2005; Hermann et al., 2008; Khan et al., 2008; Lu et al., 2002), astrocytes
(Carter et al., 2007; van Heteren et al., 2008; Zheng et al., 2008), microglia
(Biber et al., 2002; Cardona et al., 2006; Huang et al., 2005), and oligoden-
drocyte lineage cells (Dziembowska et al., 2005; Kadi et al., 2006; Padovani-
Claudio et al., 2006). In this regard, chemokines represent an inherent system
that helps establish and maintain CNS homeostasis (Li and Ransohoff, 2008).
The healthy CNS is an immune activity–free site, which peripheral leuko-
cytes do not enter freely due to the unique structure of the blood–brain
barrier (BBB) (Ransohoff et al., 2003). Furthermore, dendritic cells (DCs) as
the key antigen-presenting cells in both adaptive immunity and autoimmu-
nity, are absent from the healthy CNS (Pashenkov and Teleshova, 2003).
Thus, aberrant invasion of peripheral leukocytes into the CNS is a cardinal
feature of neuroinflammation-mediated human brain disorders.
Multiple sclerosis (MS) is a neuroinflammation-mediated demyelinating
disease. Previous studies demonstrated expression of chemokines and chemo-
kine receptors in CNS lesions in MS tissue sections (Srensen et al., 2002;
Trebst et al., 2003; Mahad et al., 2004; Kivisäkk, et al., 2004). In a mouse model
of inflammation-mediated demyelination, experimental autoimmune enceph-
alomyelitis (EAE), expression of chemokines was reproducibly and specifically
increased (Ransohoff et al., 1997). Detailed analyses further supported the
hypothesis that chemokines regulated the recruitment of peripheral leukocytes
into the CNS (Huang et al., 2000; Lu et al., 2002; Mahad et al., 2003) during
neuroinflammation. In addition, chemokines potentially mediate local cellular
pathogenesis in the lesion sites of EAE (Carlson et al., 2008; Sunnemark et al.,
2005). Unfortunately, very few chemokine receptor antibodies are suitable for
application in immunohistochemical evaluation of murine CNS tissues. False-
positive results are more the rule than the exception. To further explore the
roles of chemokine receptors in mouse models of CNS diseases, we applied
double-label nonradioactive in situ hybridization (double ISH) to evaluate the
expression of chemokine receptors in various cell types (Fig. 4.1). ISH also
provides a useful method to establish the cellular sources of chemokine recep-
tor expression (Ransohoff et al., 1997).
Double-Label Nonradioactive In Situ Hybridization 93
A B
C D
E F
F⬘
Figure 4.1 Detection of CXCR4 and CXCR7 mRNA expression in healthy ventral
spinal cord by double-fluorescent ISH. Double-fluorescent ISH was performed with
digoxygenin-labeled antisense CXCR4 probe (red, developed with Texas red) and
CXCR7 (green, developed with tyramide-fluorescein). Colocalization of CXCR4 and
CXCR7 in a neuron was indicated by arrows. (A) CXCR7; (B) CXCR4; (C) DAPI;
(D) CXCR7 and CXCR4; (E) CXCR7, CXCR4, and DAPI. An area was shown by
both low power (F) and high power (F0 ). Scale bars: 0.4 cm ¼ 25 mm.
3. After PCR, remove 5 ml PCR product to run a 1.2% agarose gel and
check the PCR amplification.
4. Set up a TOPO cloning reaction by following the standard protocol
provided by the manufacturer. Briefly, prepare 6 ml of reaction mix
(1.0 ml fresh PCR product, 3 ml salt solution, 3 ml water, 1 ml TOPO
vector), and incubate the reaction at RT for 5 min.
5. Mix 2 ml TOPO cloning reaction with competent Escherichia coli cells
and mix gently.
6. Incubate the competent cells on ice for 30 min and heat-shock for 30 s at
42 .
7. Add 250 ml S.O.C. medium (recipe for 1000 ml of S.O.C. medium is
described in the following) and shake the competent cells at 37 for 1 h.
Bacto-tryptone (Becton, Dickinson and Company, USA), 20 g
Bacto-yeast extract (Becton, Dickinson and Company, USA), 5 g
NaCl, 0.5 g
1 M KCl, 2.5 ml
Add water, 1000 ml
Note: Adjust pH to 7.0 with 10 M NaOH, autoclave to sterilize, and add
20 ml of sterile 1 M glucose immediately before use.
8. Spread 10 to 100 ml cells on 100 mg/ml ampicillin agar plates, and
incubate plates at 37 overnight.
9. Randomly pick 10 colonies to culture the bacteria and prepare plasmid
DNAs. Verify the cDNA plasmid clones by restriction enzyme (RE)
analysis or sequencing.
2.7. Hybridization
1. Fix the slides in 4% PFA at RT for 30 min.
2. Wash the slides twice (5 min each time) with DEPC-1 PBS at RT.
3. Treat the slides with 50 mg/ml proteinase K (Sigma) in PK buffer
(see following recipe for 50 ml) at RT for 10 to 15 min.
2.10. Controls
It is essential to generate control hybridizations for each ISH experiment to
enable data interpretation. Such controls must address both technical and
biological variability. Positive controls using housekeeping genes such as
beta-actin or GAPDH are employed to verify the presence of hybridizable
mRNA that is detectable by ISH. Sense probes or sections from gene
knockout mice or control mice (in disease model experiments) are useful
to exclude unspecific signals. Initial screening of all slides is performed by an
observer blinded to genetics, treatment, or illness status of the animal from
which the specimen was derived; probe identity; and probe polarity.
12. Block the slides with 20% heat-inactivated sheep serum in PBT at RT
for 1 h.
13. Incubate the slides with goat anti–fluorescein-AP antibody diluted
1:3000 in 20% heat-inactivated sheep serum in PBT at 4 overnight.
14. Wash the slides three times in PBT at RT for 30 min each.
15. Wash the slides twice in AP buffer at RT for 5 min each.
16. Develop the second ISH signal with 50 ml INT (BioRad) and 175 ml
BCIP at RT for 3 to 4 h.
Note: 40 mg/ml INT (2-[4-iodophenyl]-3-[4-nitrophenyl]-5-phenylte-
trazolium chloride) is prepared in 70% (v/v) dimethyl formamide. To
obtain good double ISH signals, the weaker probe should be developed
first.
17. Fix the slides at RT for 15 min and mount in 50% glycerol with 1
PBS.
14. Wash the slides three times in PBT buffer at RT for 5 min each.
15. Wash the slides three times in 1 PBS at RT for 5 min each.
16. Mount the slides in VECTASHIELD mount medium with or without
DAPI (Vector Laboratory, Burlingame, CA).
3. Comments
Given their wide-ranging biology in the CNS, chemokine receptors
have been extensively investigated. The critical issue of the cellular source(s)
of chemokine receptors in the CNS cannot, in most cases, be addressed by
the direct IHC approach. The remaining options are ISH, use of transgenic
mice with reporter genes expressed from chemokine receptor promoters, or
flow cytometry using CNS tissue lysates.
102 Meizhang Li and Richard M. Ransohoff
REFERENCES
Belmadani, A., Tran, P. B., Ren, D., Assimacopoulos, S., Grove, E. A., and Miller, R. J.
(2005). The chemokine stromal cell-derived factor-1 regulates the migration of sensory
neuron progenitors. J. Neurosci. 25, 3995–4003.
Biber, K., Dijkstra, I., Trebst, D., De Groot, C. J., Ransohoff, R. M., and Boddeke, H. W.
(2002). Functional expression of CXCR3 in cultured mouse and human astrocytes and
microglia. Neuroscience 112, 487–497.
Cardona, A. E., Pioro, E. P., Sasse, M. E., Kostenko, V., Cardona, S. M., Dijkstra, I. M.,
Huang, D., Kidd, G., Dombrowski, S., Dutta, R., Lee, J. C., Cook, D. N., et al. (2006).
Control of microglial neurotoxicity by the fractalkine receptor. Nat. Neurosci. 9,
917–924.
Carlson, T., Kroenke, M., Rao, P., Lane, T. E., and Segal, B. (2008). The Th17-ELRþ
CXC chemokine pathway is essential for the development of central nervous system
autoimmune disease. J. Exp. Med. 205, 811–823.
Carter, S. L., Müller, M., Manders, P. M., and Campbell, I. L. (2007). Induction of the genes
for Cxcl9 and Cxcl10 is dependent on IFN-gamma but shows differential cellular
expression in experimental autoimmune encephalomyelitis and by astrocytes and micro-
glia in vitro. Glia 55, 1728–1739.
Dziembowska, M., Tham, T. N., Lau, P., Vitry, S., Lazarini, F., and Dubois-Dalcq, M.
(2005). A role for CXCR4 signaling in survival and migration of neural and oligoden-
drocyte precursors. Glia 50, 258–269.
Hermann, G. E., Van Meter, M. J., and Rogers, R. C. (2008). CXCR4 receptors in the
dorsal medulla: Implications for autonomic dysfunction. Eur. J. Neurosci. 27, 855–864.
Huang, D., Han, Y., Rani, R. M., Glabinski, A., Trebst, C., Srensen, T., Tani, M.,
Wang, J., Chien, P., O’Bryan, S., Bielecki, B., Zhou, Z. L., et al. (2000). Chemokines
and chemokine receptors in inflammation of the nervous system: Manifold roles and
exquisite regulation. Immunol. Rev. 177, 52–67.
Huang, D., Wujek, J., Kidd, G., He, T. T., Cardona, A., Sasse, M. E., Stein, E. J., Kish, J.,
Tani, M., Charo, I. F., Proudfoot, A. E., Rollins, B. J., et al. (2005). Chronic expression
of monocyte chemoattractant protein-1 in the central nervous system causes delayed
encephalopathy and impaired microglial function in mice. FASEB J. 19, 761–772.
Kadi, L., Selvaraju, R., de Lys, P., Proudfoot, A. E., Wells, T. N., and Boschert, U. (2006).
Differential effects of chemokines on oligodendrocyte precursor proliferation and myelin
formation in vitro. J. Neuroimmunol. 174, 133–146.
Khan, M. Z., Brandimarti, R., Shimizu, S., Nicolai, J., Crowe, E., and Meucci, O. (2008).
The chemokine CXCL12 promotes survival of postmitotic neurons by regulating Rb
protein. Cell Death Differ. 15, 1663–1672.
Kivisäkk, P., Mahad, D. J., Callahan, M. K., Sikora, K., Trebst, C., Tucky, B., Wujek, J.,
Ravid, R., Staugaitis, S. M., Lassmann, H., and Ransohoff, R. M. (2004). Expression of
CCR7 in multiple sclerosis: Implications for CNS immunity. Ann. Neurol. 55, 627–638.
Li, M., and Ransohoff, R. M. (2008). Multiple roles of chemokine CXCL12 in the central
nervous system: A migration from immunology to neurobiology. Prog. Neurobiol. 84,
116–131.
Lu, M., Grove, E. A., and Miller, R. J. (2002). Abnormal development of the hippocampal
dentate gyrus in mice lacking the CXCR4 chemokine receptor. Proc. Natl. Acad. Sci.
USA 99, 7090–7095.
Mahad, D. J., and Ransohoff, R. M. (2003). The role of MCP-1 (CCL2) and CCR2 in
multiple sclerosis and experimental autoimmune encephalomyelitis (EAE). Semin. Immunol.
15, 23–32.
Double-Label Nonradioactive In Situ Hybridization 103
Mahad, D. J., Trebst, C., Kivisäkk, P., Staugaitis, S. M., Tucky, B., Wei, T.,
Lucchinetti, C. F., Lassmann, H., and Ransohoff, R. M. (2004). Expression of chemo-
kine receptors CCR1 and CCR5 reflects differential activation of mononuclear phago-
cytes in pattern II and pattern III multiple sclerosis lesions. J. Neuropathol. Exp. Neurol. 63,
262–273.
Padovani-Claudio, D. A., Liu, L., Ransohoff, R. M., and Miller, R. H. (2006). Alterations
in the oligodendrocyte lineage, myelin, and white matter in adult mice lacking the
chemokine receptor CXCR2. Glia 54, 471–483.
Pashenkov, M., and Teleshova, N. (2003). Inflammation in the central nervous system:
The role for dendritic cells. Brain Pathol. 13, 23–33.
Ransohoff, R. M., Kivisäkk, P., and Kidd, G. (2003). Three or more routes for leukocyte
migration into the central nervous system. Nat. Rev. Immunol. 3, 569–581.
Ransohoff, R. M., Tani, M., Glabinski, A. R., Chernosky, A., Krivacic, K., Peterson, J. W.,
Chien, H. F., and Trapp, B. D. (1997). Chemokines and chemokine receptors in model
neurological pathologies: Molecular and immunocytochemical approaches. Methods
Enzymol. 287, 319–348.
Srensen, T. L., Trebst, C., Kivisäkk, P., Klaege, K. L., Majmudar, A., Ravid, R.,
Lassmann, H., Olsen, D. B., Strieter, R. M., Ransohoff, R. M., and Sellebjerg, F.
(2002). Multiple sclerosis: A study of CXCL10 and CXCR3 co-localization in the
inflamed central nervous system. J. Neuroimmunol. 127, 59–68.
Sunnemark, D., Eltayeb, S., Nilsson, M., Wallström, E., Lassmann, H., Olsson, T.,
Berg, A. L., and Ericsson-Dahlstrand, A. (2005). CX3CL1 (fractalkine) and CX3CR1
expression in myelin oligodendrocyte glycoprotein-induced experimental autoimmune
encephalomyelitis: kinetics and cellular origin. J. Neuroinflammation 2, 17.
Trebst, C., Staugaitis, S. M., Kivisäkk, P., Mahad, D., Cathcart, M. E., Tucky, B., Wei, T.,
Rani, M. R., Horuk, R., Aldape, K. D., Pardo, C. A., Lucchinetti, C. F., et al. (2003).
CC chemokine receptor 8 in the central nervous system is associated with phagocytic
macrophages. Am. J. Pathol. 162, 427–438.
van Heteren, J. T., Rozenberg, F., Aronica, E., Troost, D., Lebon, P., and Kuijpers, T. W.
(2008). Astrocytes produce interferon-alpha and CXCL10, but not IL-6 or CXCL8, in
Aicardi-Goutières syndrome. Glia 56, 568–578.
Zheng, J. C., Huang, Y., Tang, K., Cui, M., Niemann, D., Lopez, A., Morgello, S., and
Chen, S. (2008). HIV-1-infected and/or immune-activated macrophages regulate
astrocyte CXCL8 production through IL-1beta and TNF-alpha: Involvement of
mitogen-activated protein kinases and protein kinase R. J. Neuroimmunol. 200, 100–110.
C H A P T E R F I V E
Contents
1. Introduction 106
2. Materials and Methods 108
2.1. Cell culture and tissue collection and processing 108
2.2. TaqMan Low Density Array 108
2.3. Quantitative real-time RT-PCR (Q-PCR) 109
2.4. Enzyme-linked immunosorbent assay 110
2.5. Statistical analysis 110
3. Results 110
3.1. TaqMan Low Density Array analysis of eight colon cancer
samples 110
3.2. CCL3, CCL4, and CXCL8 expression in colon cancer 112
3.3. Regulation of CXCL8 expression in colon cancer cell lines 115
3.4. CXCL8 correlation with OPN and SPARC 116
4. Discussion 117
Acknowledgments 119
References 119
Abstract
Human colorectal cancer (CRC), the second largest cause of tumor-related death
in Western countries, represents a paradigm for the now well-established
connections between inflammation and cancer. In this study, we investigated
* Department of Immunology and Inflammation, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy
{
Laboratory of Molecular Gastroenterology, IRCCS Istituto Clinico Humanitas, Rozzano (Milan), Italy
{
Department of Translational Medicine, University of Milan, IRCCS Istituto Clinico Humanitas,
Via Manzoni, Rozzano (Milano), Italia
}
Laboratory of Leukocyte Biology, Department of Translational Medicine, University of Milan,
IRCCS Istituto Clinico Humanitas, Italy
105
106 Marco Erreni et al.
1. Introduction
Links between cancer and inflammation were first suggested in the
19th century on the basis of observations that tumors often arise at sites of
chronic inflammation and that inflammatory cells are present in the biopsied
samples from tumors (Mantovani et al., 2001). Epidemiological studies have
shown that chronic inflammation predisposes individuals to various types of
cancer, including microbial infections, autoimmune diseases, and inflam-
matory conditions of unknown origin. The hallmarks of cancer-related
inflammation include the presence in tumor tissues of inflammatory cells
and soluble mediators such as chemokines, cytokines and prostaglandins,
tissue remodeling, and angiogenesis (Coussens and Werb, 2002; Karin,
2006; Mantovani, 2005; Mantovani et al., 2008).
Chemokines are chemotactic cytokines that cause the direct migration of
leukocytes and are induced by inflammatory cytokines, growth factors, and
pathogenic stimuli. Many human cancers have a complex chemokine net-
work that regulates the extent and phenotype of the infiltrating leukocytes, as
well as have an effect on tumor growth, survival, migration, and angiogenesis
(Balkwill, 2004). The pattern of chemokine-receptor and ligand expression
in a tissue is generally correlated with the numbers and types of infiltrating
cells that are present in the tumor microenvironment (Balkwill, 2004; Karin
and Greten, 2005; Rossi and Zlotnik, 2000).
The influence of the immune response in the behavior of neoplasia has
been extensively investigated. There is little doubt that adaptive immune
Chemokines and Receptors in Human Colon Cancer 107
cells, especially cytotoxic CD8þ T-cell effectors, have the potential to limit
tumor progression (Dunn et al., 2004). The protective function of CD8þ T
cells has been demonstrated in patients with melanoma, ovarian, and
colorectal cancer (CRC) (Coukos et al., 2005; Taylor et al., 2007). Recently,
Galon and colleagues (Galon et al., 2006; Pages et al., 2005) demonstrated
that the presence of a strong immune-cell infiltrate is associated with the
absence of early metastatic processes, which include vascular emboli, lym-
phatic invasion, and perineural invasion, demonstrating a beneficial effect of
the host’s immune response.
On the other hand, the persistence of active innate immune responses (i.e.,
chronic inflammation) at tumor sites has been more frequently associated with
poor clinical outcome (Balkwill, 2004; Coussens and Werb, 2002; Dunn et al.,
2004; Karin, 2006; Mantovani, 2005; Mantovani et al., 2001, 2008).
The links between inflammation and cancer promotion are especially
strong in human colorectal carcinoma (CRC), the second largest cause of
cancer-related death in Western countries. Patients with inflammatory
bowel disease, both ulcerative colitis and Crohn’s disease, are at increased
risk of developing colorectal cancer. Even precancerous tissues show signs of
inflammation. Accordingly, treatment with nonsteroidal anti-inflammatory
agents decreases the incidence of colon cancer, and the mortality that results
from it (Bertagnolli, 2003).
The contribution of macrophages to CRC development is quite contro-
versial. Bailey et al. (2007) demonstrated that the increase of macrophages
number in all areas within the tumor correlated with advanced tumor stage.
In contrast, Forssell et al. (2007) showed that in CRC, macrophages are
localized principally at the tumor front and positively influenced prognosis.
These contrasting results may be explained by the ‘‘macrophages balance
hypothesis,’’ proposed by our group, to convey the idea that macrophages
may inhibit or stimulate tumor growth according to their functional polariza-
tion and state of activation (Mantovani et al., 2002, 2004; Pollard, 2004).
While M1-polarized macrophages, activated by IFNg and bacterial products
such as LPS, usually have tumoricidal activity, M2 macrophages, differentiated
in the presence of Th2 cytokines (IL-4, IL-13) or IL-10, most frequently are
not cytotoxic, favor tumor cell proliferation and the angiogenic switch, and
lead to tumor progression and invasion (Mantovani et al., 2008). In this
context, it is clear that inflammatory mediators, such as chemokines, cyto-
kines, and growth factors play a pivotal role in the recruitment of the
inflammatory infiltrate and in the buildup of the tumor microenvironment.
In this study, we investigated the expression of chemokines and
chemokine-receptors in surgical samples of human CRC. We analyzed
the mRNA profile using a customized TaqMan Low Density Array
(Lu et al., 2008). The results show a strong upregulation of chemokines
and chemokine-receptors, indicating the pivotal role of these inflammatory
mediators in the growth and progression of CRC.
108 Marco Erreni et al.
3. Results
3.1. TaqMan Low Density Array analysis of eight colon cancer
samples
To investigate the role of chemokines and their receptors in colon cancer
tissues, we performed a large screening of inflammation-related genes in
eight human colon cancer samples and corresponding normal tissues, using
the TaqMan Low Density Array (Applied Biosystem), customized with
Chemokines and Receptors in Human Colon Cancer 111
mRNA of chemokines and receptors from CRC tumors were analyzed via a customized TaqMan Low
Density Array. Data are expressed relative to autologous normal tissues. Grey box depicts a fold equal or
greater than two. Eight tumor samples representative of various clinical stages are shown.
112 Marco Erreni et al.
and CCR6, were also upregulated, but others, CCR1 and CCR5, were less
than 2. Among CXC chemokines, high levels of CXCL1 and CXCL8 and
the corresponding receptor CXCR2 were found. High levels of CXCL9 and
CXCL10 were also found, but not their receptor CXCR3. Surprisingly, the
chemokine CCL2, frequently produced by several tumor types including
CRC, or the constitutive chemokine CXCL12, were not upregulated.
To better appreciate the configuration of the chemokine system in the
normal colonic mucosa, the data were analyzed relative to the mean of the
five housekeeping genes customized in the LDA. Two representative cases
are presented in Fig. 5.1. Panels A and B show the mRNA levels of chemo-
kines and receptors in one early-stage tumor, while Panels C and D show
levels in an advanced stage tumor, respectively. The normal colonic mucosa
(white bars) expresses several chemokines; CCL2, CCL5, CCL14/CCL15,
CCL20, CCL21, and CXCL12 are expressed most frequently. Some of these
chemokines were further upregulated in tumor samples (black bars), but not
always reach the cut-off of twofold. Other chemokines such as CCL3,
CCL4, and CXCL9, CXCL10, and especially CXCL8 were more selectively
overexpressed in the tumor tissue. Among chemokine receptors, CXCR4
and CXCR7—both binding CXCL12—were found in the normal mucosa,
while in the tumor tissue several receptors were upregulated, including
CCR1 and CCR5, both binding CCL3 and CCL4, and CXCR2, recogniz-
ing CXCL8. We further decided to investigate the expression of these
specific ligands in a larger series of CRC samples.
0.125 0.12
0.100 0.10
0.08
0.075
Arbitrary units
Arbitrary units
0.06
0.050
0.04
0.025
0.02
0 0
L1 L2 L3 L4 L5 L7 L8 L11 L13 L15 L16 L17 L18 L19 L20 L21 L22 L25 L26 L1 L8 L9 L10 L12 L1 L2 L3 L4 L5 L7
C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C
L8 L11 L13 L15 L16 L17 L18 L19 L20 L21 L22 L25 L26 L1 L8 L9 L10 L12
C
C C C C C C C C C ;C C C C C C C C C C CX CX CX X X C C C C C C C C C C C C C C C C C C C C C C C
4 C C C C ; C C C C C C C C C C CX CX CX X X
C C
L1 4
C L1
C C
Chemokines C Chemokines
B D
0.0200
0.025
0.0175
0.020 0.0150
0.0125
0.015
0.0100
0.010 0.0075
Arbitrary units
Arbitrary units
0.0050
0.005
0.0025
0 0
1 2 3 4 5 6 7 8 1 2 3 4 6 7 1 1 2 3 4 5 6 7 8 L1 L2 1 2 3 4 6 7 1
R R R R R R R R L1 L2 R R R R R R R R R R R R R R R R R R R R R R LR
C C C C C C C C R R C C C C C C LR C C C C C C C C C C C C C C C C
C C C C C C C C C C X X X X X X K C C C C C C C C C C X X X X X X K
C C C C C C C C M C C C C C C M
C C
A p = 0.05 CCL3
0.0016
0.0014
0.0012
Arbitrary units
0.0010
0.0008
0.0006
0.0004
0.0002
0.0000
Normal Tumor
p = 0.07
B CCL4
0.0018
0.0016
0.0014
Arbitrary units
0.0012
0.0010
0.0008
0.0006
0.0004
0.0002
0.0000
Normal Tumor
0.206
0.106
0.006
Arbitrary units
0.005
0.004
0.003
0.002
0.001
0.000
Normal Tumor
Figure 5.2 Expression of mRNA of CCL3 (panel A), CCL4 (panel B), and CXCL8
(panel C), in CRC tumor samples and in adjacent normal colonic mucosa analyzed by
RT-PCR. Statistical significance is shown. CCL3 and CXCL8 expression in tumors is
significantly different from normal tissues.
Chemokines and Receptors in Human Colon Cancer 115
A CXCL8
NT
TNFa
7 TNFa + TGFb
6
5
4
ng/ml
2.0
1.5
1.0
0.5
0
HCT116 SW620 HT29
B CXCL8
10
9
8
7
Fold change
6
5
4
3
2
1
0
HCT116 SW620 HT29
Figure 5.3 Regulation of CXCL8 in tumor cells lines derived from human CRC.
Protein levels (panel A) were measured by a commercial ELISA in cell supernatants;
mRNA levels (panel B) were analyzed by RT-PCR. Cells were either untreated
(medium), or stimulated with TNFa (20 ng/ml) and TGFb (20/ ng/ml) for 24 h for pro-
tein expression or 6 h for mRNA.
116 Marco Erreni et al.
A OPN C
P < 0.0001 0.020
0.015
0.010 0.015
0.005
Arbitrary units
0.0025
OPN
0.0020 0.010
0.0015
0.0010 0.005
P = 0.001
0.0005
0 0
Normal Tumor 0 0.1 0.2 0.3
CXCL8
B SPARC D
P < 0.0001
0.08
0.07
0.02
0.0100 0.06
Arbitrary units
SPARC
0.0075
0.04
0.0050
0.02 P = 0.9
0.0025
0 0
Normal Tumor 0 0.1 0.2 0.3
CXCL8
Figure 5.4 Expression of mRNA of osteopontin (OPN) (panel A) and SPARC (panel
B) in CRC tumor samples, and in adjacent normal colonic mucosa analyzed by RT-
PCR. Statistical significance is shown. Both OPN and SPARC are significantly more
expressed in tumor samples. Panels C and D show the linear regression analysis of
CXCL8 and OPN (C) or SPARC (D). mRNA CXCL8 significantly correlates with
mRNAOPN in the tumor tissues.
Chemokines and Receptors in Human Colon Cancer 117
4. Discussion
In this study, we have investigated the chemokine system in samples of
human colorectal tumors. To obtain a global view of which chemokines
and receptors are overexpressed in the tumor microenvironment, we
have used a customized TaqMan Low Density Array containing probes
for 24 ligands and 17 receptors. Several CC and CXC chemokines were
strongly upregulated in tumor samples compared to the paired normal
colonic mucosa. Interestingly, a number of chemokines were constitutively
expressed also in the normal tissue, such as CCL2, CCL20, and CXCL12.
The significance of their expression in normal colonic mucosa is likely
explained by the abundant presence, at this site, of immune effectors of
both innate and adaptive immunity, to maintain the local homeostasis.
These chemokines were not or only slightly elevated in tumor samples. In
contrast, other ligands, such as the inflammatory cytokines CCL3, CCL4,
CXCL8, and a few others, were significantly increased compared to the
normal counterpart tissue.
CCL3 and CCL4 are chemotactic for monocytes/macrophages and T
cells, the major components of tumor-infiltrating leucocytes in colorectal
tumors, as well as in other tumor histotypes. Of note, while the subset of
CD8þ T cells has been defined as protective antitumor effectors in CRC
and their number associated with better prognosis (Galon et al., 2006), the
role of macrophages is more ambiguous. Some studies on different tumor
types, have described divergent result reporting a correlation with a favorable
clinical outcome (Bailey et al., 2007; Forssell et al., 2007) or, in marked
contrast, an association with tumor progression—in the majority of tumors
(Allavena et al., 2008; Deconto et al., 2008). These contrasting results may be
interpreted in view of the macrophage balance hypothesis and the distinct
function of polarized macrophage populations (Mantovani et al., 2002).
In our study, we found an increased expression of CCL3 and CCL4 in
tumor samples, but no association with the stage of disease, in that early-
stage tumors also had high levels of these chemokines compared to normal
tissues (data not shown). The chemokine CXCL8 attracts mainly neutro-
phils; these leukocytes are short-living and are not usually present in tumors.
Recently, it has been reported that myeloid derived suppressor cells
(MDSC) express the CXCR2 receptor and may respond to CXCL8
(Sica and Bronte, 2007). The contribution of CXCL8 in the recruitment
of MDSC warrants further investigation.
CXCL8 and other members of the same family have been extensively
studied for their role in stimulating neoplastic growth, such as in melanoma
118 Marco Erreni et al.
fostering tumor progression. In our study, and in line with previous reports,
mRNA of OPN and SPARC were strongly upregulated in tumor samples.
Of interest, a linear correlation was found between the expression of OPN
and CXCL8. As mentioned above, these two mediators share some impor-
tant functions such as cell mobility and cell survival via integrin activation
(Caruso et al., 2008). In contrast, no significant correlation was found
between the levels of SPARC and CXCL8. Collectively, this study inves-
tigated the complex network of chemokines and receptors in the tumor
microenvironment of human CRCs. The approach we used was to employ
a TaqMan Low Density Array to screen a large number of ligands and
receptors that would have been very laborious to perform with the conven-
tional RT-PCR. This initial screening led to identification of the most
expressed genes in tumor samples, and was therefore very informative for
selection of a more restricted panel of candidate molecules for further
investigation. The results of this study may be helpful to build a solid ratio-
nale for novel therapeutic interventions targeted to specific inflammatory
molecules, and to identify novel prognostic CRC markers.
ACKNOWLEDGMENTS
This work was supported by the Italian Association for Cancer Research (AIRC), MIUR
target project Oncologia 2006, and Alleanza Contro il Cancro.
REFERENCES
Allavena, P., Sica, A., Garlanda, C., and Mantovani, A. (2008). The yin-yang of tumor-
associated macrophages in neoplastic progression and immune surveillance. Immunol.
Rev. 222, 155–161.
Bailey, C., Negus, R., Morris, A., Ziprin, P., Goldin, R., Allavena, P., Peck, D., and
Darzi, A. (2007). Chemokine expression is associated with the accumulation of tumour
associated macrophages (TAMs) and progression in human colorectal cancer. Clin. Exp.
Metastasis 24, 121–130.
Balkwill, F. (2004). Cancer and the chemokine network. Nat. Rev. Cancer 4, 540–550.
Bellahcene, A., Castronovo, V., Ogbureke, K. U., Fisher, L. W., and Fedarko, N. S. (2008).
Small integrin-binding ligand N-linked glycoproteins (SIBLINGs): Multifunctional
proteins in cancer. Nat. Rev. Cancer 8, 212–226.
Bertagnolli, M. M. (2003). The potential of non-steroidal anti-inflammatory drugs
(NSAIDs) for colorectal cancer prevention. J. Surg. Oncol. 84, 113–119.
Caruso, D. J., Carmack, A. J., Lokeshwar, V. B., Duncan, R. C., Soloway, M. S., and
Lokeshwar, B. L. (2008). Osteopontin and interleukin-8 expression is independently
associated with prostate cancer recurrence. Clin. Cancer Res. 14, 4111–4118.
Chlenski, A., Liu, S., Guerrero, L. J., Yang, Q., Tian, Y., Salwen, H. R., Zage, P., and
Cohn, S. L. (2006). SPARC expression is associated with impaired tumor growth,
inhibited angiogenesis and changes in the extracellular matrix. Int. J. Cancer 118, 310–316.
Clark, C. J., and Sage, E. H. (2008). A prototypic matricellular protein in the tumor
microenvironment—where there’s SPARC, there’s fire. J. Cell Biochem. 104, 721–732.
120 Marco Erreni et al.
Coukos, G., Conejo-Garcia, J. R., Roden, R. B., and Wu, T. C. (2005). Immunotherapy
for gynaecological malignancies. Expert Opin. Biol. Ther. 5, 1193–1210.
Coussens, L. M., and Werb, Z. (2002). Inflammation and cancer. Nature 420, 860–867.
Deconto, R. M., Pollard, D., Wilson, P. A., Palike, H., Lear, C. H., and Pagani, M. (2008).
Thresholds for Cenozoic bipolar glaciation. Nature 455, 652–656.
Dunn, G. P., Old, L. J., and Schreiber, R. D. (2004). The three Es of cancer immunoediting.
Annu. Rev. Immunol. 22, 329–360.
Forssell, J., Oberg, A., Henriksson, M. L., Stenling, R., Jung, A., and Palmqvist, R. (2007).
High macrophage infiltration along the tumor front correlates with improved survival in
colon cancer. Clin. Cancer Res. 13, 1472–1479.
Galon, J., Costes, A., Sanchez-Cabo, F., Kirilovsky, A., Mlecnik, B., Lagorce-Pages, C.,
Tosolini, M., Camus, M., Berger, A., Wind, P., Zinzindohoue, F., Bruneval, P., et al.
(2006). Type, density, and location of immune cells within human colorectal tumors
predict clinical outcome. Science 313, 1960–1964.
Graudens, E., Boulanger, V., Mollard, C., Mariage-Samson, R., Barlet, X., Gremy, G.,
Couillault, C., Lajemi, M., Piatier-Tonneau, D., Zaborski, P., Eveno, E., Auffray, C.,
et al. (2006). Deciphering cellular states of innate tumor drug responses. Genome Biol. 7, R19.
Karin, M. (2006). Nuclear factor-kappaB in cancer development and progression. Nature
441, 431–436.
Karin, M., and Greten, F. R. (2005). NF-kappaB: linking inflammation and immunity to
cancer development and progression. Nat. Rev. Immunol. 5, 749–759.
Koh, A., da Silva, A. P., Bansal, A. K., Bansal, M., Sun, C., Lee, H., Glogauer, M., Sodek, J.,
and Zohar, R. (2007). Role of osteopontin in neutrophil function. Immunology 122,
466–475.
Lu, B., Xu, J., Chen, J., Yu, J., Xu, E., and Lai, M. (2008). TaqMan low density array is
roughly right for gene expression quantification in colorectal cancer. Clin. Chim. Acta
389, 146–151.
Mantovani, A. (2005). Cancer: Inflammation by remote control. Nature 435, 752–753.
Mantovani, A., Allavena, P., Sica, A., and Balkwill, F. (2008). Cancer-related inflammation.
Nature 454, 436–444.
Mantovani, A., Muzio, M., Garlanda, C., Sozzani, S., and Allavena, P. (2001). Macrophage
control of inflammation: Negative pathways of regulation of inflammatory cytokines.
Novartis Found. Symp. 234, 120–131; discussion 131–135.
Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., and Locati, M. (2004).
The chemokine system in diverse forms of macrophage activation and polarization.
Trends Immunol. 25, 677–686.
Mantovani, A., Sozzani, S., Locati, M., Allavena, P., and Sica, A. (2002). Macrophage
polarization: Tumor-associated macrophages as a paradigm for polarized M2 mononu-
clear phagocytes. Trends Immunol. 23, 549–555.
McAllister, S. S., Gifford, A. M., Greiner, A. L., Kelleher, S. P., Saelzler, M. P., Ince, T. A.,
Reinhardt, F., Harris, L. N., Hylander, B. L., Repasky, E. A., and Weinberg, R. A.
(2008). Systemic endocrine instigation of indolent tumor growth requires osteopontin.
Cell 133, 994–1005.
Murphy, P. M. (2001). Chemokines and the molecular basis of cancer metastasis. N. Engl. J.
Med. 345, 833–835.
Pages, F., Berger, A., Camus, M., Sanchez-Cabo, F., Costes, A., Molidor, R., Mlecnik, B.,
Kirilovsky, A., Nilsson, M., Damotte, D., Meatchi, T., Bruneval, P., et al. (2005).
Effector memory T cells, early metastasis, and survival in colorectal cancer. N. Engl. J.
Med. 353, 2654–2666.
Podhajcer, O. L., Benedetti, L., Girotti, M. R., Prada, F., Salvatierra, E., and Llera, A. S.
(2008). The role of the matricellular protein SPARC in the dynamic interaction between
the tumor and the host. Cancer Metastasis Rev. 27, 523–537.
Chemokines and Receptors in Human Colon Cancer 121
Contents
1. Introduction 127
2. Cloning of vGPCR 128
2.1. Outline 128
2.2. Procedure 129
3. Assaying vGPCR Transforming Activity In Vitro 130
3.1. Overview 130
3.2. Procedure 130
4. vGPCR Transforming Activity In Vivo Using Xenograft Systems 130
4.1. Overview 130
4.2. Procedure 131
5. In Vivo Targeted Infection Using the TVA-RCAS System 131
5.1. Overview 131
5.2. Procedure 132
5.3. Viral production 132
6. vGPCR-Induced Paracrine Transformation 134
6.1. Overview 134
6.2. Procedure 135
7. Characterization of vGPCR-Induced Molecular Signaling 135
7.1. Outline 135
8. Evaluation of Activation of Second-Messenger–
Generating Systems 136
8.1. Overview 136
8.2. Procedure 136
Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research,
National Institutes of Health, Bethesda, Maryland, USA
125
126 Daniel Martin and J. Silvio Gutkind
Abstract
Kaposi’s sarcoma (KS) is an angioproliferative disease caused by infection with
human herpesvirus 8 (HHV-8), also known as Kaposi’s sarcoma-associated
herpesvirus (KSHV). This virus encodes 84 open-reading frames (ORFs), many
of which represent pirated versions of human genes. One of them, ORF74,
encodes a predicted seven-span transmembrane receptor termed vGPCR that
is similar to the human IL8 receptor CXCR2, which displays strong oncogenic
activity in vitro and in vivo by a complex interplay of direct and autocrine/
paracrine mechanisms. vGPCR has been shown to be both necessary and
sufficient for the formation and progression of KS-like lesions in experimental
model systems. Due to the fundamental role of vGPCR in the pathogenesis of
KS, understanding the molecular mechanisms elicited by this unique chemo-
kine receptor can be exploited to devise new strategies for KS management, as
well as to gain novel insights into how KSHV subverts key physiological pro-
cesses such as cell proliferation, chemotaxis, angiogenesis, and immunomodu-
lation for its replicative advantage. Here we describe multiple techniques and
strategies that have been used to study the unique properties and functions of
vGPCR and its role in oncogenesis.
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 127
1. Introduction
The human herpesvirus 8 (HHV8) (also termed Kaposi’s sarcoma-
associated herpesvirus [KSHV]) is the etiologic agent of Kaposi’s sarcoma
(KS) and two lymphoproliferative diseases, multicentric Castleman’s disease
and primary effusion lymphoma (Cesarman and Mesri, 2007; Chang et al.,
1994). KS is an angioproliferative disease manifested in four different variants
that vary in the onset, progression, and clinical implication (Schwartz et al.,
2008). Classical KS, the first described, affects elderly population of the
Mediterranean area, appearing in extremities, normally as an indolent disease.
The endemic variant is a more aggressive form, occurring mostly in young
males in some sub-Saharan African countries (Morris, 2003). A third variant,
the iatrogenic KS, is developed by transplant recipients undergoing immu-
nosuppression regimes, and finally, the AIDS-associated KS is the most
aggressive variant and is frequently fatal being still the most common cancer
arising in AIDS patients (Laney et al., 2007). The introduction of highly
active antiretroviral therapy (HAART) has caused a dramatic decrease in the
proportion of new AIDS-defining KS cases and a regression in the size of
existing KS lesions (Bower et al., 2006). However, there is still a risk of
recurrence of AIDS-associated KS that we cannot afford to ignore (Rezza
et al., 1999). Indeed, in parts of the developing world, KS has tragically
emerged as one of the most frequent cancers among children and adult
men (Schwartz et al., 2008), and KS remains a significant cause of morbidity
and mortality among the world AIDS population (Cheung et al., 2005).
Initial characterization of KS lesions identified the presence of multiple
cytokines and growth factors. Unlike many other tumor-derived cell cul-
tures, isolates from KS lesions strictly require supplementation with growth
factor and chemokines such as VEGF and oncostatin M, providing an early
insight into the central role secreted factors play in KS development and
maintenance (reviewed in Cesarman and Mesri, 2007; Ganem, 2006). In
this regard, upon sequencing of the KSHV genome, several virally encoded
genes and cytokines have been identified and shown to play roles in cell
proliferation, immune surveillance evasion, and host cell recruitment.
These include multiple virally encoded secreted factors such as vIL6,
vCCL-1, vCCL-2, and vCCL-3, and a number of viral proteins that
promote the production of host cytokines, chemokines, and growth factors
(Ganem, 2006). Among these molecules, the open reading frame 74
(ORF74) encodes a constitutively active G-protein–coupled receptor
termed vGPCR that is highly related to the IL8 chemokine receptor
CXCR2 (Arvanitakis, 1997). vGPCR promotes the release of proangio-
genic growth factors and exhibits potent transforming activity in cells in
culture (Bais et al., 1998; Sodhi et al., 2000). Furthermore, when expressed
as a transgene or when virally transduced into endothelial cells, vGPCR
readily leads to the development of KS-like lesions in animal models
128 Daniel Martin and J. Silvio Gutkind
(Guo et al., 2004; Jensen et al., 2005; Montaner et al., 2003; Yang et al.,
2000). This strong growth-promoting and tumorigenic activity of vGPCR
involves the robust stimulation of the expression and release of multiple
chemokines and endothelial growth factors, which promote the prolifera-
tion of KSHV infected cells in a an autocrine and paracrine fashion (Martin
et al., 2008; Montaner et al., 2003; Sodhi et al., 2004a).
While recent studies have highlighted the critical role of vGPCR in KS
development (Mutlu et al., 2007), the emerging information on how
vGPCR exerts its potent sarcomagenic activity in animal models has now
provided an opportunity for the development of molecularly targeted
therapies aimed at interfering with vGPCR-initiated pathways in human
KS (Montaner et al., 2006; Sodhi et al., 2006). In this regard, early studies
showed that vGPCR stimulates several mitogenic pathways, including the
MAPK and p38 pathways and the small G-protein Rac1, which play a role
in vGPCR-induced pathogenesis (Bais et al., 1998; Dadke et al., 2003;
Montaner et al., 2004; Sodhi et al., 2000). Subsequently, it was observed
that vGPCR promotes the survival and subsequent transformation of endo-
thelial cells by the activation of the phosphatidylinositol-3-kinase (PI3K)–
Akt pathway (Sodhi et al., 2004b). Systematic analysis of the molecular
mechanism by which the activation of Akt contributes to vGPCR-induced
sarcomagenesis revealed that mTOR, a protein kinase that acts as a down-
stream target of Akt, is strictly required for the tumorigenic activity of
vGPCR (Sodhi et al., 2006), thereby providing a molecular target for
therapeutic intervention in this angioproliferative disease. Indeed, drugs
that inhibit the PI3K-Akt-mTOR pathway can halt the progression of KS
and even induce its regression both in animal models and in the clinical
setting (Chaisuparat et al., 2008; Sodhi et al., 2004b; Stallone et al., 2005).
The identification of suitable molecular targets for KS treatment has
ignited renewed interest in understanding the molecular mechanisms
involved in vGPCR-mediated angioproliferation, immunomodulation and
transformation. Here we describe a number of techniques and strategies to
study several molecular aspects of vGPCR with particular focus in its direct
and paracrine transforming ability in vitro and in vivo. We will not assume
previous experience from the reader and we will emphasize practical simpli-
fications that we have developed in some of the protocols that we expect can
be useful also for the characterization of other chemokine receptors.
2. Cloning of vGPCR
2.1. Outline
KSHV RNA can be obtained form several sources including KS biopsies,
pleural effusions, body cavity B-cell lymphomas (BCBL), cell lines, and
KS-derived spindle-cell cultures (Browning et al., 1994) and the KSHV
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 129
2.2. Procedure
RNA should be extracted using standard methods such as the TriZOL
(Invitrogen, Carlsbad, CA) method. Following manufacturer’s recommen-
dations regarding the specific volume of TriZOL reagent to use depending
on the origin of the source (tissue or cell line) and mass, homogenization
will be accomplished by finely mincing, grinding in LN2, or scrapping of
the sample in TriZOL. Incubate the samples for 5 min at room temperature,
centrifuge, and add 1:5 of the volume of chloroform and vortex vigorously.
Incubate the samples for an additional 15 min. Centrifuge the samples at
12,000g for 15 min, and collect the upper phase containing the RNA.
Precipitate the RNA by adding 1:2 of the original TriZol volume of
isopropyl alcohol. Incubate for 15 min at room temperature and centrifuge
at 12,000g for 10 min at 4 . Wash the RNA pellet once with 75% EtOH, air
dry, and resuspend the pellet in RNAse-free water.
Use 100 ng of RNA as template for cDNA synthesis using Superscript II
(Invitrogen). Assemble the reaction following the manufacturer’s recom-
mendations but extend the synthesis at 42 for up to 2 h. Remove RNA by
treatment with RNAse H. This cDNA can be used as template for PCR, or
alternatively, Lambda Phage KSHV Library DNA that can be obtained from
the National Institutes of Health, AIDS Research and Reference Reagent
Program, Rockville, MD, can be used as well.
Amplify vGPCR using the following oligos containing BglII and EcoRI
sites (underlined) used for the subsequent cloning (or modify accordingly);
the vGPCR start codon is boldfaced.
Fwd: 50 -ATAAGATCTATGGCGGCCGAGGATTTCCTAAC-30
Rev: 50 -ATAGAATTCCTACGTGGTGGCGCCGGACATGAA-30
Use 100 ng of cDNA or lambda DNA as template using a high-fidelity
polymerase. Conditions for PCR are as follows: 95 , 2 min initial denatur-
ation; 30 cycles of 95 30 s, 60 30 s, and 68 1.5 min; and a final 7min
extension at 68 . PCR amplification of vGPCR yields a 1.1-Kb fragment.
Gel-purify the PCR product and clone in an expression vector.
130 Daniel Martin and J. Silvio Gutkind
3.2. Procedure
Transfect NIH 3T3 cells by the calcium phosphate precipitation technique
(Wigler et al., 1977) with a vGPCR expression vector and optionally other
expression or shRNA-encoding plasmids together with 1 mg of pcDNAIII-
b-gal, a plasmid expressing the enzyme b-galactosidase, adjusting the total
amount of plasmid DNA with empty vector, and maintaining the cells
in DMEM supplemented with 10% calf bovine serum. The day after
transfection, wash the cells in medium supplemented with 5% calf serum,
and maintain them, changing the same medium twice a week until foci
are scored 3 to 4 weeks later. Fix the plates with PBS containing 2%
(v/v) formaldehyde and 0.2% (v/v) glutaraldehyde and stain at 37 for
b-galactosidase activity with a PBS solution containing 2 mM MgCl2, 5 mM
K3Fe(CN)6, 5 mM K4Fe(CN)6, and 0.1% 5-bromo-4-chloro-3-indolyl-b-D-
galactopyranoside (X-gal) to evaluate the transfection efficiency.
4.2. Procedure
SVEC cells lines were used to induce endothelial tumor xenografts in
athymic mice as described previously (Montaner et al., 2003). Female
athymic (nu/nu) nude mice (Harlan Sprague-Dawley, Frederick, MD),
5 to 6 weeks of age and weighing 18 to 20 g, are routinely used in these
studies, and are housed in appropriate sterile filter-capped cages and fed and
watered ad libitum. Briefly, exponentially growing stable cultures of vGPCR
expressing cells are harvested, washed, and resuspended in DMEM. One
million viable cells are transplanted subcutaneously into both flanks of the
athymic mice. Normally, SVEC-vGPCR induced tumors progress slowly,
within 1 to 2 months. For tumor growth analysis, tumor weight is deter-
mined as described previously (Montaner et al., 2003), whereby tumor
volume (LW 2/2, where L and W represent the length and the width of
the tumor) is converted to weight (milligrams) assuming unit density.
Alternatively, we have begun to use cell lines expressing the red-shifted
GFP derivative mCherry and firefly luciferase. These cell lines allow for
careful quantitative analysis of the tumor volume and ‘‘metabolic status’’
using bioluminescence detectors such as the Xenogen IVIS Lumina II.
Because steady production of mCherry and luciferase is associated with
normal metabolism of these cells, the analysis of these two markers allows
for early visualization of changes in tumor status before apparent changes in
tumor volume occurs, for example when evaluating small molecule inhibi-
tors of tumor growth. Regardless of the method used for evaluation, the
animals are monitored twice weekly for tumor volume. Results of animal
experiments are normally expressed as mean standard error, and the
unpaired Student’s t test is used to determine the difference between
experimental and control groups for each of the cell lines.
5.2. Procedure
For the generation of an endothelial-specific TVA-expressing transgenic
line, the TIE2-Tva transgene was created by insertion of the pg800 tva
cDNA as a NotI fragment into a bluescript SK (þ) vector containing the
murine 2.1-kb HindIII TIE2 promoter fragment and SV40 poly (A) signal
sequence (Montaner et al., 2003). The plasmid also included, downstream
of the tva cassette, a 10-kb autonomous endothelial-specific enhancer
located in the first intron of the mouse TIE2 gene, which allows specific
and uniform gene expression to all vascular endothelial cells in vivo. Trans-
genic mice are generated in FVB/N mice using standard techniques and
identified by Southern blot using the Tva cDNA as a probe. Genotypes are
determined by Southern blotting and by PCR with tail DNA.
Transfection
Retroviral stocks
2 weeks
DF-1 cells
TIE2-TVA mouse
Endothelial cell-
specific
gene transfer
vGPCR
MAPK IL8
Akt
TVA p38 VEGF
NFκB SDF-1
Figure 6.1 Overview of the RCAS system. The two components of the RCAS system
are depicted in the figure. A recombinant avian retrovirus (RCAS) is produced in DF-1
chicken fibroblast. Somatic expression of genes of interest, such as vGPCR, in mice is
achieved by the tissue-restricted transgenic expression of the glycoproteinTVA, which
acts as a receptor for avian leukosis^derived retroviruses. In particular, the expression of
TVA in endothelial cells using the Tie2-TVA transgenic animal system enables the
endothelial-specific expression of vGPCR and other genes of interest in vivo in a high-
throughput fashion.
as retroviruses can only infect cells undergoing division. Once all the cells
are producing virus (as judged by GFP fluorescence), let the cells reach
confluence, wait an additional 48 h, and collect cell-free viral supernatants.
Supernatants can be immediately used, frozen, or combined for concen-
tration. For concentration, 30 ml of virus-containing supernatant are
ultracentrifuged in an SW28 Beckman (Fullerton, CA) rotor at 22,000
rpm at 4 for 2 h. Pellets are resuspended in 1/100 of the original volume
in PBS and viral titers are determined by limiting dilution. Briefly,
134 Daniel Martin and J. Silvio Gutkind
6.2. Procedure
For the generation of the SVEC line expressing the three latent transcripts,
we first generated a line expressing vFLIP and vCyclin, as both are expressed
as a naturally occurring bicistronic mRNA. Once a stable pool of clones was
selected and characterized, cells were submitted to a second round of
transfection with a LANA expression vector cotransfected with 1:10 of
the total DNA of a vector encoding a different resistance gene than the
one used in the first place. To reconstitute the cellular composition of human
KS in mice, 1 105 SVEC-vGPCR cells are combined with 9 105 SVEC
LANA/vFLIP/vCyclin cells prior to injection into female (nu/nu) athymic
mice. As a negative control, SVEC-vGPCR cells can be substituted by
inactive mutant vGPCR (vGPCRD5) or the parental cell line (Montaner
et al., 2003). The animals are monitored twice weekly for tumor formation
for 3 months. For analysis, tumor weight is determined by converting tumor
volume (LW2/2) (where L and W represent longest length and shortest width
of the tumor) to weight.
7. Characterization of vGPCR-Induced
Molecular Signaling
7.1. Outline
Characterization of the molecular responses elicited by vGPCR is essential
to understand its role in KS initiation and progression. A number of
methods have been used to study the cellular signaling triggered by the
expression of this receptor. Initial studies showed that unlike its closest
homolog, CXCR2, this receptor requires no ligand binding to activate a
number of signaling events (Arvanitakis et al., 1997). However, vGPCR still
retains the ability to bind a number of molecules, further modulating its
intrinsic activity and include IL8, Groa and several other CXC and CC type
chemokines (Rosenkilde et al., 1999). A simple method to evaluate the
activity of the receptor is the analysis of second messengers and activated
signaling molecules after transient transfection of the receptor. However,
large overexpression of vGPCR can be toxic to cells, including those
of endothelial and fibroblastic origin. To perform transient transfection
experiments, it is therefore advisable to initially evaluate a range of con-
centrations of vGPCR expression vectors (dose–response) for every cell
line. Most classical vGPCR activity experiments have been performed using
COS-1 and COS-7 cells in addition to NIH 3T3 fibroblasts, but other
cell lines such as the murine immortalized endothelial cell line SVEC 4-10
can be also used.
136 Daniel Martin and J. Silvio Gutkind
8. Evaluation of Activation of
Second-Messenger–Generating Systems
8.1. Overview
The accumulation of second messengers is an early event in the signal
transduction induced by GPCRs. In particular, vGPCR strongly stimulates
phosphatidylinositol bisphosphate (PIP2) hydrolysis upon expression. Gaq
proteins, when triggered by receptors, activate the plasma-membrane–
bound enzyme phospholipase C-b (PLC) (Sternweis and Smrcka, 1992).
This enzyme hydrolyzes PIP2 in the plasma membrane to release inositol
1,4,5-trisphosphate (IP3). This molecule is labile, being quickly hydrolyzed
to two inositol phosphate subproducts, IP2 and IP1. Part of the IP3 gener-
ated binds to specific receptors on the endoplasmic reticulum, which induce
opening of calcium-release channels (Berridge, 2005). This quickly raises
the concentration of Ca2þ ions in the cytosol, causing a burst of ionic
calcium that will lead to the activation of important effectors such as PKC
or the NFAT transcription factor (Berridge, 2005; Crabtree and Olson,
2002). The following procedure is based in the purification and measure-
ment of inositol produced in response to vGPCR expression from a radi-
olabeled precursor.
8.2. Procedure
To measure inositol phosphate levels in transiently transfected cells, perform
transfections in 12-well plates using increasing amounts of a vGPCR
expression vector and a GFP or other fluorescent protein–encoding plasmid
to assess for efficiency of transfection and vGPCR-induced toxicity. DNA
amounts should be maintained constant by the addition of empty expression
vector. The transfection method should be optimized beforehand for every
particular cell type. We have successfully transfected a number of cell lines,
including COS-7, NIH 3T3, and SVEC using the ExGen500 reagent
(Fermentas, Burlington, Ontario). Briefly, dissolve 2 mg of the DNA mix-
ture in 100 ml of 150 mM NaCl, and add 6.6 ml of ExGen500 reagent, mix
by vortexing and incubate for 10 min at room temperature. Add complexes
drop-wise to the wells and swirl to ensure appropriate distribution. Incubate
the cells for 12 to 16 h before removing complexes, and label the cells by
adding fresh complete medium containing 1 mCi/ml myo-[3H]-inositol
(DuPont/NEN, Boston, MA), incubating for an additional 24 h. Remove
and safely discard the media, rinse once with warm PBS, and replace with
prewarmed serum-free medium containing 10 mM HEPES, pH 7.4, and
10 mM LiCl, an inhibitor of inositol phosphatases. Cells are collected at
different time points (usually 10 min to 1 h), rinsed once with ice-cold
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 137
10.2. Procedure
To assay for Akt activation induced by vGPCR, split COS-7 1:5 in 10%
fetal bovine serum containing DMEM the day previous to transfection.
Transfect cells using ExGen500 reagent (see above) with a cocktail contain-
ing 0.5 mg pCEFL-HA-Akt1 (or other epitope-tagged Akt expression
vector) plus increasing concentrations of a vGPCR-encoding vector, nor-
malizing DNA amounts to 10 mg per plate using empty vector. It is
recommended to also add 1 to 2 mg of a GFP encoding vector to monitor
efficiency of transfection and toxicity. Incubate the cells with transfection
complexes for 24 h, and then starve cells in serum free medium for 16 h, or
alternatively, 4 h, if cells are too sensitive to starvation. Discard medium and
138 Daniel Martin and J. Silvio Gutkind
wash with cold PBS twice, making sure to aspirate as much PBS as possible.
Add 1 ml (for a 10 cm plate) or 600 ml (for a 6-cm plate) of cold lysis buffer
(1% triton X-100, 10% glycerol, 137 mM NaCl, 20 mM Tris-HCl, pH 7.5,
1 mg/ml aprotinin and leupeptin, 1 mM PMSF, 20 mM NaF, 1 mM NaPPi,
and 1 mM of freshly prepared Na3VO4). Scrape cells and transfer to
Eppendorf tubes. Shake 10 min at 4 (vortexing 30 s also works). Clear
the samples by centrifugation at 12,000g, for 10 min at 4 . This will
sediment unbroken cells, membranes, mitochondria, and nuclei. Transfer
cleared supernatant to new tubes containing 1 ml of anti-HA antibody
(12CA5 clone, Covance, Princeton, NJ). Transfer the samples to an orbital
rocker and leave rocking at 4 for 2 h. Add 20 ml of a 50% slurry of
Gammabind Protein-G sepharose beads (GE Healthcare, Piscataway, NJ).
Rock the samples for an additional 1 h at 4 . Centrifuge at 12,000g for 15 s.
As the beads loosely pack at the bottom of the tube, use a micropipette
instead of suction to carefully remove the supernatant and discard. Resus-
pend in 1 ml of cold lysis buffer and centrifuge again. Wash the beads twice
with 1 ml cold lysis buffer. Wash once with 1 ml cold water and finally wash
once with 1 ml ‘‘cold’’ kinase buffer (1 kinase buffer: 20 mM HEPES,
pH 7.4, 10 mM MgCl2, 10 mM MnCl2, prepared as a 10 stock) and
carefully remove all supernatant. For the kinase reaction, resuspend beads in
25 ml of 1 complete ‘‘hot’’ kinase buffer (supplement 1 kinase buffer
with 0.05 mg/ml histone H2B substrate, 5 mM ATP, 1 mM DTT, and
10 mCi of [g32P]-ATP). Shake 30 min at room temperature (30 min at 30
also works). Terminate the reaction by adding 5 ml of 5 protein loading
buffer, boil, and load into a 15% SDS-PAGE acrylamide gel including the
beads. Transfer gel to Immobilon-P membranes (Millipore, Billerica, MA)
and expose the area containing the substrate H2B, around 15 kDa. Confirm
by Western blot the presence of immunoprecipitated HA-Akt (around
60 kDa, but note that it runs very close to the IgG heavy chain).
11.2. Procedure
Preparation of PAK-N beads
The expression vector pGEX encodes the glutathione S-transferase (GST)
fusion protein with the isolated GTP-dependent binding domain of the
Rac1 effector PAK1 (Teramoto et al., 1996). Transform BL21 Escherichia coli
with GST-PAK-N and plate the bacteria on LB-agar containing 50 mg/ml
ampicillin. Pick a colony of GST-PAK-N–transformed BL21 cells and start
a liquid culture in 5 ml of LB-ampicillin, leave overnight at 37 with
constant shaking. On the following day, transfer the culture into a 1-1
bottle containing 250 ml of LB-ampicillin, and leave 2 to 3 h at 37 with
constant shaking. Add 0.2 mM IPTG (isopropyl b-D-thiogalactopyranoside,
Sigma, cat. no. I-5502, prepare a 200-mM stock in water and keep it frozen
in small aliquots), transfer the culture to room temperature and leave it
overnight with constant shaking. Harvest the bacteria by centrifugation and
resuspend in 10 ml of ice-cold PBS-Triton-EDTA including protease
inhibitors (1% Triton X-100, 1 mM EDTA, 1 mM PMSF, 10 mg/ml each
aprotinin and leupeptin). Transfer the lysates to a 50-ml polypropylene
centrifuge tube and freeze-thaw three times by immersing in an ethanol
dry-ice bath followed by thawing in cold water. Keep the lysates on ice and
sonicate three times for 10 s each to disrupt genomic DNA. Centrifuge at
14,000 rpm (Beckman JA-17 Rotor or equivalent). In the meantime
prepare 250 ml of glutathione-sepharose beads (GE Healthcare cat. no.
17-0756-01 or similar) by washing them with PBS-Triton-EDTA. Transfer
the supernatant of the lysates to a 15-ml tube and incubate with the beads
for 30 min at 4 with constant shaking. Centrifuge at 4 for 1 min at 3000
rpm. Resuspend the beads in PBS-Triton-EDTA containing protease
inhibitors, transfer to a microcentrifuge tube, and wash three times; resus-
pend the beads each time by vortexing, and spin down briefly. Wash three
times with PBS containing protease inhibitors and resuspend in 500 ml of
this buffer. For the experiment, use 50 ml of resuspended beads per sample.
We prefer to keep the beads at 4 and use them within a week.
Experiment
Transfect COS-7 cells with wildtype vGPCR or a mutant inactive form
such as vGPCR R143A to be used as a negative control. The day after
transfection leave the cells in serum free media and process the experiment
the following day. Wash once with ice cold PBS and keep the plates on ice
from that point on, and use ice-cold buffers. Lyse the cells at 4 with 1 ml
of a buffer containing 50 mM Tris, pH 7.5, 0.15 M NaCl, 1% Triton X-100,
5 mM EDTA, 10 mM MgCl2, 10 mg/ml aprotinin, 10 mg/ml leupeptin, and
140 Daniel Martin and J. Silvio Gutkind
12.2. Procedure
Cell and tissue lysates are prepared by incubation on an appropriate volume
of SDS-lysis buffer (50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM
EDTA, 1% SDS, 2% Triton X-100, 1% b-mercaptoethanol). This buffer
will extract and denature all the proteins in the cell but disrupts the nuclear
membrane, provoking the release of genomic DNA that will increase the
viscosity of the solution. Scrape the cells or grind the tissue in this buffer and
transfer to Eppendorf tubes. Cutting the pipette tips to increase the diameter
will ease pipetting into the tubes. Keep samples at 4 . Sonicate samples for
10 sec on ice with a tip sonicator (5 watts) to shear the DNA; avoid
overheating the samples. The viscosity will be reduced after this procedure.
Add 5 SDS-loading buffer and boil the samples. Resolve the samples by
SDS-PAGE, transfer into Immobilon-P membranes (Millipore), and pro-
ceed with Western blotting. We normally block for 1 h in 5% non-fat dry
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 141
14.2. Procedure
We provide here a brief summary of the steps that we follow routinely
when performing microarrays in our murine endothelial cells. We system-
atically use Agilent’s supplied materials and reagents and follow the manu-
facturer’s protocols, as they have been extensively optimized for this
particular application. Briefly, total RNA is extracted from exponentially
growing SVEC lines serum starved for 16 h using GenEluteTM Mammalian
Total RNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO). Total RNAs are
quality evaluated with Agilent 2100 Bioanalyzer normally discarding sam-
ples with RNA integrity number, RIN less than 7 (Schroeder et al., 2006).
Labeled cDNA used as targets for hybridizations are synthesized by Quick
Amp kit (Agilent Technologies, Palo Alto, CA) from total RNA samples
and universal mouse reference (Stratagene, La Jolla, CA) in the presence of
CyTM3 and CyTM5 reactive dye, respectively. The labeled probes are
hybridized with oligonucleotide microarrays for 17 h at 65 . Slides are
immediately scanned in an Agilent DNA Microarray Scanner. Spot quanti-
fication and data normalization are performed using Agilent’s Feature
Extraction software and data analysis is performed on the TIGR Multi
Experiment Viewer (TMEV) v4.1 platform (Institute for Genome
Research, TIGR, Rockville, MD, http://www.tm4.org/).
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 143
15.2. Procedure
SVEC cells are split the day before so that they are 60 to 70% confluent at
the time of transfection. Cells are transfected at least in triplicate, in 24-well
plates using the ExGen500 reagent (Fermentas) with various quantities of
empty vector or a vGPCR expression plasmid in combination with 100 ng
of the NFkB luciferase reporter (Stratagene, La Jolla, CA) and 50 ng of
pCEFLmyc hRL-EGFP, an EF-1a–driven humanized Renilla reniformis
luciferase for normalization. Sixteen h after transfection, complexes are
removed, and cells washed once with PBS and incubated for 24 h in
serum-free DMEM. Extending the time after transfection before the lucif-
erase assay is performed is not recommended, as this normally leads to
increased background luciferase expression while not improving the induc-
tion of luciferase by vGPCR. Luciferase activity is detected using a Dual-
Glo Luciferase Assay Kit (Promega, Madison, WI) and a microtiter plate
luminometer (Dynex Tech, Chantilly, VA). Briefly, media is removed from
the wells and the cells are washed once with PBS. Cells are lysed by
incubation in 100 ml of 1 Dual-Glo luciferase reagent (diluted in
DMEM) for 15 min at room temperature. Lysates are then transferred to a
96-well opaque microtiter plate, including blanks, and firefly luciferase
activity is measured using a glow-type protocol. Once finished, 50 ml of
Stop’n’Glo reagent are added to each well, and incubated for an additional
15 min. After that incubation, Renilla luciferase activity can be measured,
again using a glow protocol. The normalized relative luciferase activity for
each data point is obtained by dividing the firefly counts by the
corresponding Renilla counts.
sequence (reviewed in Hayden and Ghosh, 2008; Karin, 2006). The p50/p65
heterodimers and the p50 homodimers are the most common dimers found
in the NFkB signaling pathway (Karin, 2006). A traditional method for
assaying these events are the electrophoretic mobility shift assays (EMSA),
where cell lysates or nuclear extracts are incubated with radiolabeled oligo-
nucleotides containing the binding sequence of the transcription factor of
interest. After incubation, the samples are resolved by nondenaturing elec-
trophoresis and autoradiography and analyzed for the presence of retarded,
transcription factor–bound oligonucleotide bands. The identity of the tran-
scription factor bound to the sequence is determined by super-shift assays,
where the samples are incubated with the oligonucleotides in the presence
of antibodies specific to the transcription factor of interest. This results in
even higher retardation due to the increased molecular weight of the
antibody-transcription factor complexes. Alternatively, a new type of tran-
scription factor–binding assays are being developed based on an ELISA-like
format, that do not require the use the radioactivity and inherently identify
the bound transcription factor. In this case, samples are incubated in a
96-well plate coated with immobilized oligonucleotides containing the
binding sequence and then the bound factors are detected with appropriate
antibodies followed by ECL or chromogenic assays, thus providing quanti-
tative results. We have successfully used these assays to quantify the activa-
tion of NFkB in response to vGPCR.
16.2. Procedure
This procedure is based on the TransAM NF-kB p65 kit from Activemotif
(Carlsbad, CA). The assay requires the preparation of nuclear extracts from
transiently or stably vGPCR-transfected cells, serum-starved for 16 h prior
to the experiment. As a positive control, cells treated for 1 h with 20 ng/ml
of either TNFa or IL-1b could be used. For consistency, nuclear extracts
are prepared using Nuclear Extract Kit (Active Motif ), and the assay is
performed following the manufacturer’s recommendations. Briefly, pro-
teins in nuclear extracts are quantified and 1 mg of total protein is incubated
for 1 h in the presence of binding buffer to allow the binding of activated
NFkB to the immobilized oligonucleotides in the well. Bound factors are
washed three times and incubated in the presence of p65 antibodies for 1 h.
Wells are washed again three times and incubated for an additional hour
with a horseradish peroxidase (HRP)–conjugated secondary antibody.
After washing the wells four times, a chemiluminescent reaction is used.
Light emission is evaluated using a Dynex MLX system (Dynex Tech)
luminometer.
146 Daniel Martin and J. Silvio Gutkind
17.2. Procedure
This procedure is meant to be used for formalin-fixed paraffin-embedded
tissues of mouse and human origin, for tissue culture samples, see the
following. Briefly, tissue slides are dewaxed in xylene, hydrated through
graded alcohols and distilled water, and washed thoroughly with PBS.
Antigen retrieval is done using 10 mM citrate buffer (pH 6) in a microwave
oven for 20 min (2 min at 100% power and 18 min at 10% power). The
slides are allowed to cool down for 30 min at room temperature, rinsed
twice with PBS, and incubated in 3% hydrogen peroxide in PBS for 30 min
to quench the endogenous peroxidase. The sections are then washed in
distilled water and PBS and incubated in the blocking solution (5% bovine
serum albumin in PBS) for 1 h at room temperature. Excess solution is
discarded and the sections incubated overnight with primary antibody
(rabbit polyclonal anti-p65, purchased from Neomarkers, Fremont, CA)
diluted in 1:100 blocking solution at 4 . After washing with PBS, the slides
are sequentially incubated with the biotinylated secondary antibody (Vector
Laboratories, Burlingame, CA; 1:300) for 1 h, followed by the ABC
complex (Vector Stain Elite, ABC kit, Vector Laboratories) for 30 min at
room temperature. The slides are washed and developed in 3,3-diamino-
benzidine (Sigma FASTDAB tablet, Sigma Chemical, St. Louis, MO)
under microscopic control. The reactions are stopped by immersing the
slides in tap water; the tissues are then counterstained with Mayer’s hema-
toxylin, dehydrated, cleared in xylene, and mounted.
For immunofluorescence experiments using cell lines, cells are trans-
fected in 35-mm dishes with the appropriate expression plasmids. After 8 h,
cells are split and seeded onto collagen IV–coated glass slides and cultured
for an additional 48 h. Cells are serum-starved for 16 h, washed once with
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 147
ACKNOWLEDGMENTS
This research was supported by the National Institutes of Health Intramural AIDS Targeted
Antiviral Program and the National Institute of Dental and Craniofacial Research.
REFERENCES
Arvanitakis, L., Geras-Raaka, E., Varma, A., Gershengorn, M. C., and Cesarman, E. (1997).
Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor
linked to cell proliferation. Nature 385, 347–350.
Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S.,
Cesarman, E., Gershengorn, M. C., and Mesri, E. A. (1998). G-protein-coupled receptor
of Kaposi’s sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator.
Nature 391, 86–89.
Berridge, M. J. (2005). Unlocking the secrets of cell signaling. Annu. Rev. Physiol. 67, 1–21.
Bower, M., Palmieri, C., and Dhillon, T. (2006). AIDS-related malignancies: Changing
epidemiology and the impact of highly active antiretroviral therapy. Curr. Opin. Infect
Dis. 19, 14–19.
Browning, P. J., Sechler, J. M., Kaplan, M., Washington, R. H., Gendelman, R.,
Yarchoan, R., Ensoli, B., and Gallo, R. C. (1994). Identification and culture of Kaposi’s
sarcoma-like spindle cells from the peripheral blood of human immunodeficiency virus-
1-infected individuals and normal controls. Blood 84, 2711–2720.
Cannon, M., Philpott, N. J., and Cesarman, E. (2003). The Kaposi’s sarcoma-associated
herpesvirus G protein-coupled receptor has broad signaling effects in primary effusion
lymphoma cells. J. Virol. 77, 57–67.
Cesarman, E., and Mesri, E. A. (2007). Kaposi sarcoma-associated herpesvirus and other
viruses in human lymphomagenesis. Curr. Top. Microbiol. Immunol. 312, 263–287.
Chaisuparat, R., Hu, J., Jham, B. C., Knight, Z. A., Shokat, K. M., and Montaner, S. (2008).
Dual inhibition of PI3Kalpha and mTOR as an alternative treatment for Kaposi’s
sarcoma. Cancer Res. 68, 8361–8368.
148 Daniel Martin and J. Silvio Gutkind
Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M., and
Moore, P. S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-asso-
ciated Kaposi’s sarcoma. Science 266, 1865–1869.
Cheung, M. C., Pantanowitz, L., and Dezube, B. J. (2005). AIDS-related malignancies:
Emerging challenges in the era of highly active antiretroviral therapy. Oncologist 10, 412–426.
Chiou, C. J., Poole, L. J., Kim, P. S., Ciufo, D. M., Cannon, J. S., ap Rhys, C. M.,
Alcendor, D. J., Zong, J. C., Ambinder, R. F., and Hayward, G. S. (2002). Patterns of
gene expression and a transactivation function exhibited by the vGCR (ORF74) chemo-
kine receptor protein of Kaposi’s sarcoma-associated herpesvirus. J. Virol. 76, 3421–3439.
Crabtree, G. R., and Olson, E. N. (2002). NFAT signaling: Choreographing the social lives
of cells. Cell 109(Suppl), S67–S79.
Dadke, D., Fryer, B. H., Golemis, E. A., and Field, J. (2003). Activation of p21-activated
kinase 1-nuclear factor kappaB signaling by Kaposi’s sarcoma-associated herpes virus G
protein-coupled receptor during cellular transformation. Cancer Res. 63, 8837–8847.
Fakhari, F. D., and Dittmer, D. P. (2002). Charting latency transcripts in Kaposi’s sarcoma-
associated herpesvirus by whole-genome real-time quantitative PCR. J. Virol. 76,
6213–6223.
Fisher, G. H., Orsulic, S., Holland, E., Hively, W. P., Li, Y., Lewis, B. C., Williams, B. O.,
and Varmus, H. E. (1999). Development of a flexible and specific gene delivery system
for production of murine tumor models. Oncogene 18, 5253–5260.
Ganem, D. (2006). KSHV infection and the pathogenesis of Kaposi’s sarcoma. Annu. Rev.
Pathol. 1, 273–296.
Guo, H. G., Pati, S., Sadowska, M., Charurat, M., and Reitz, M. (2004). Tumorigenesis by
human herpesvirus 8 vGPCR is accelerated by human immunodeficiency virus type 1
Tat. J. Virol. 78, 9336–9342.
Gutkind, J. S., Novotny, E. A., Brann, M. R., and Robbins, K. C. (1991). Muscarinic
acetylcholine receptor subtypes as agonist-dependent oncogenes. Proc. Natl. Acad. Sci. USA
88, 4703–4707.
Hayden, M. S., and Ghosh, S. (2008). Shared principles in NF-kappaB signaling. Cell 132,
344–362.
Hughes, S. H. (2004). The RCAS vector system. Folia Biol. (Praha) 50, 107–119.
Jensen, K. K., Manfra, D. J., Grisotto, M. G., Martin, A. P., Vassileva, G., Kelley, K.,
Schwartz, T. W., and Lira, S. A. (2005). The human herpes virus 8-encoded chemokine
receptor is required for angioproliferation in a murine model of Kaposi’s sarcoma.
J. Immunol. 174, 3686–3694.
Karin, M. (2006). Nuclear factor-kappaB in cancer development and progression. Nature
441, 431–436.
Laney, A. S., Cannon, M. J., Jaffe, H. W., Offermann, M. K., Ou, C. Y., Radford, K. W.,
Patel, M. M., Spira, T. J., Gunthel, C. J., Pellett, P. E., and Dollard, S. C. (2007). Human
herpesvirus 8 presence and viral load are associated with the progression of AIDS-
associated Kaposi’s sarcoma. Aids 21, 1541–1545.
Martin, D., Galisteo, R., Ji, Y., Montaner, S., and Gutkind, J. S. (2008). An NF-kappaB
gene expression signature contributes to Kaposi’s sarcoma virus vGPCR-induced direct
and paracrine neoplasia. Oncogene 27, 1844–1852.
Montaner, S., Sodhi, A., Molinolo, A., Bugge, T. H., Sawai, E. T., He, Y., Li, Y.,
Ray, P. E., and Gutkind, J. S. (2003). Endothelial infection with KSHV genes in vivo
reveals that vGPCR initiates Kaposi’s sarcomagenesis and can promote the tumorigenic
potential of viral latent genes. Cancer Cell 3, 23–36.
Montaner, S., Sodhi, A., Pece, S., Mesri, E. A., and Gutkind, J. S. (2001). The Kaposi’s
sarcoma-associated herpesvirus G protein-coupled receptor promotes endothelial cell
survival through the activation of Akt/protein kinase B. Cancer Res. 61, 2641–2648.
Kaposi’s Sarcoma Herpesvirus Chemokine Receptor 149
Montaner, S., Sodhi, A., Ramsdell, A. K., Martin, D., Hu, J., Sawai, E. T., and
Gutkind, J. S. (2006). The Kaposi’s sarcoma-associated herpesvirus G protein-coupled
receptor as a therapeutic target for the treatment of Kaposi’s sarcoma. Cancer Res. 66,
168–174.
Montaner, S., Sodhi, A., Servitja, J. M., Ramsdell, A. K., Barac, A., Sawai, E. T., and
Gutkind, J. S. (2004). The small GTPase Rac1 links the Kaposi sarcoma-associated
herpesvirus vGPCR to cytokine secretion and paracrine neoplasia. Blood 104, 2903–2911.
Morris, K. (2003). Cancer? In Africa? Lancet Oncol. 4, 5.
Mutlu, A. D., Cavallin, L. E., Vincent, L., Chiozzini, C., Eroles, P., Duran, E. M.,
Asgari, Z., Hooper, A. T., La Perle, K. M., Hilsher, C., Gao, S. J., Dittmer, D. P.,
et al. (2007). In vivo-restricted and reversible malignancy induced by human herpesvirus-
8 KSHV: A cell and animal model of virally induced Kaposi’s sarcoma. Cancer Cell 11,
245–258.
Nador, R. G., Milligan, L. L., Flore, O., Wang, X., Arvanitakis, L., Knowles, D. M., and
Cesarman, E. (2001). Expression of Kaposi’s sarcoma-associated herpesvirus G protein-
coupled receptor monocistronic and bicistronic transcripts in primary effusion lympho-
mas. Virology 287, 62–70.
Rezza, G., Andreoni, M., Dorrucci, M., Pezzotti, P., Monini, P., Zerboni, R., Salassa, B.,
Colangeli, V., Sarmati, L., Nicastri, E., Barbanera, M., Pristera, R., et al. (1999).
Human herpesvirus 8 seropositivity and risk of Kaposi’s sarcoma and other acquired
immunodeficiency syndrome-related diseases. J. Natl. Cancer Inst. 91, 1468–1474.
Rosenkilde, M. M., Kledal, T. N., Brauner-Osborne, H., and Schwartz, T. W. (1999).
Agonists and inverse agonists for the herpesvirus 8-encoded constitutively active seven-
transmembrane oncogene product, ORF-74. J. Biol. Chem. 274, 956–961.
Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S.,
Menzel, W., Granzow, M., and Ragg, T. (2006). The RIN: An RNA integrity number
for assigning integrity values to RNA measurements. BMC Mol. Biol. 7, 3.
Schwartz, R. A., Micali, G., Nasca, M. R., and Scuderi, L. (2008). Kaposi sarcoma:
A continuing conundrum. J. Am. Acad. Dermatol. 59, 179–206; quiz 207-208.
Shepard, L. W., Yang, M., Xie, P., Browning, D. D., Voyno-Yasenetskaya, T., Kozasa, T.,
and Ye, R. D. (2001). Constitutive activation of NF-kappa B and secretion of
interleukin-8 induced by the G protein-coupled receptor of Kaposi’s sarcoma-associated
herpesvirus involve G alpha(13) and RhoA. J. Biol. Chem. 276, 45979–45987.
Sodhi, A., Chaisuparat, R., Hu, J., Ramsdell, A. K., Manning, B. D., Sausville, E. A.,
Sawai, E. T., Molinolo, A., Gutkind, J. S., and Montaner, S. (2006). The TSC2/mTOR
pathway drives endothelial cell transformation induced by the Kaposi’s sarcoma-asso-
ciated herpesvirus G protein-coupled receptor. Cancer Cell 10, 133–143.
Sodhi, A., Montaner, S., and Gutkind, J. S. (2004a). Viral hijacking of G-protein-coupled-
receptor signalling networks. Nat. Rev. Mol. Cell Biol. 5, 998–1012.
Sodhi, A., Montaner, S., Patel, V., Gomez-Roman, J. J., Li, Y., Sausville, E. A.,
Sawai, E. T., and Gutkind, J. S. (2004b). Akt plays a central role in sarcomagenesis
induced by Kaposi’s sarcoma herpesvirus-encoded G protein-coupled receptor. Proc.
Natl. Acad. Sci. USA 101, 4821–4826.
Sodhi, A., Montaner, S., Patel, V., Zohar, M., Bais, C., Mesri, E. A., and Gutkind, J. S.
(2000). The Kaposi’s sarcoma-associated herpes virus G protein-coupled receptor up-
regulates vascular endothelial growth factor expression and secretion through mitogen-
activated protein kinase and p38 pathways acting on hypoxia-inducible factor 1alpha.
Cancer Res. 60, 4873–4880.
Stallone, G., Schena, A., Infante, B., Di Paolo, S., Loverre, A., Maggio, G., Ranieri, E.,
Gesualdo, L., Schena, F. P., and Grandaliano, G. (2005). Sirolimus for Kaposi’s sarcoma
in renal-transplant recipients. N. Engl. J. Med. 352, 1317–1323.
150 Daniel Martin and J. Silvio Gutkind
Contents
1. Introduction 152
2. Virally Encoded GPCR Engineering 154
3. vGPCR Expression, Trafficking, and Radioligand Binding 156
3.1. Microscopic visualization of the cellular localization of vGPCRs 156
3.2. Enzyme-linked immunosorbent assay 156
3.3. Radioligand binding assays 157
3.4. Internalization assays 159
4. vGPCR-Induced Signal Transduction 159
4.1. Inositol phosphate production 159
4.2. Intracellular [Ca2þ] measurements 160
4.3. Reporter gene assays 160
5. vGPCR-Induced Oncogenesis 162
5.1. Cellular transformation: Foci formation assay 162
5.2. Cell proliferation assay: Cyclin D1 expression 163
5.3. In vivo xenograft models 164
6. Generation of Recombinant HCMV Strains by Markerless Bacterial
Artificial Chromosome Mutagenesis 165
7. Conclusions 167
Acknowledgments 167
References 167
* Leiden/Amsterdam Center for Drug Research, Division of Medicinal Chemistry, Faculty of Sciences,
Vrije Universiteit Amsterdam, Amsterdam, The Netherlands
{
Institute of Virology, Ulm University Clinic, Ulm, Germany
1
Both authors contributed equally to this work
151
152 David Maussang et al.
Abstract
Human cytomegalovirus (HCMV) is a widely spread herpesvirus that can have
serious consequences in immunocompromised hosts. Interestingly, HCMV
genome encodes for four viral G protein–coupled receptors (vGPCRs), namely,
US27, US28, UL33, and UL78. Thus far, US28 and UL33 have been shown to
activate signaling pathways in a ligand-independent manner. US28 is the best
characterized vGPCR and has been shown to be potentially involved in the
development of HCMV-related diseases. As such, detailed investigation of
these viral GPCR is of importance in order to understand molecular events
occurring during viral pathogenesis and the potential identification of novel
therapeutic targets. Herewith, we describe several approaches to study these
HCMV-encoded vGPCRs. Using molecular biology, tags can be introduced in the
vGPCRs, which may facilitate the study of their protein expression with various
techniques, such as microscopy, Western blotting, enzyme-linked immunosor-
bent assay (ELISA), and flow cytometry. Furthermore, radioligand binding stud-
ies can be performed to screen for ligands for vGPCRs, but also to study kinetics
of internalization. We also describe several signal transduction assays that can
evaluate the signaling activity of these vGPCRs. In addition, we discuss different
proliferation assays and an in vivo xenograft model that were used to identify
the oncogenic potential of US28. The study of these vGPCRs in their viral
context can be examined using recombinant HCMV strains generated by bacte-
rial artificial chromosome mutagenesis. Finally, we show how these mutants can
be used in several pharmacological and biochemical assays.
1. Introduction
Human cytomegalovirus (HCMV), a member of the human b-herpes-
virus family, also referred to as human herpesvirus-5 (HHV-5), is widely
spread among the population. Although its presence is mostly asymptomatic
in immunocompetent hosts, HCMV-positive immunosuppressed patients are
at risk for the development of serious inflammatory diseases (Soderberg-
Naucler, 2006). Furthermore, HCMV has been linked to the development
of proliferative diseases, such as colon cancer and glioblastoma (Cobbs et al.,
2002; Harkins et al., 2002). While the Kaposi’s sarcoma–associated herpesvirus
(KSHV) and the Epstein-Barr virus (EBV) are considered oncogenic viruses,
HCMV appears to preferentially infect cancer cells to further increase their
malignant phenotype (Cinatl et al., 2004).
Interestingly, like other herpesviruses, the HCMV genome encodes viral
G protein–coupled receptors (vGPCRs), referred to as US27, US28, UL33,
and UL78, that appear on the surface of human cells upon viral infection
(Fig. 7.1A) (Rosenkilde et al., 2008). Thus far, UL33 and US28 have
been shown to constitutively activate various signaling pathways in a
Characterization of HCMV-Encoded Viral GPCRs 153
g g
HCMV a a
b b
Signaling
C Δ2–22
UL33 UL78 US27 US28 US28 mutants
g g
a a
R129A b b Δ300
signaling
Human cell
Figure 7.1 Expression and signaling of vGPCRs. (A) HCMV infection of human cells
leads to the expression of the four viral GPCRUS27, US28, UL33, and UL78. (B) US28
signals both in a ligand-independent and -dependent manner and undergoes rapid con-
stitutive internalization. (C) US28 mutants show different signaling and internalization
properties than the wildtype receptor. US28-R129A does not couple to G proteins and
presents no constitutive activity. D2-22-US28 still shows constitutive activity but can
no longer bind chemokines. US28-D300 still binds chemokines and exhibits a higher
constitutive activity due to a reduced internalization rate compared to the wildtype
receptor.
GPCRs are still required to elucidate their role during viral infection and
their importance in the development of viral diseases.
In this chapter, we describe several techniques that can be applied to
study virally encoded GPCRs in more detail. Various research questions can
be addressed using molecular, cellular, as well as viral techniques.
Stropes and Miller, 2008; Waldhoer et al., 2002, 2003). The most optimal
tag needs to be empirically determined for each receptor and should
not interfere significantly with ligand binding, receptor signaling, and
expression.
Various methodologies can be used to introduce site-directed mutations
or epitope tags, or to generate fusion proteins (Blomenröhr et al., 2004;
McIlhinney, 2004). Nonetheless, PCR-based approaches using high-
fidelity DNA polymerase (e.g., Pfu) can be used universally to generate all
these different constructs. Short N-terminal tags are introduced after the
initial methionine of a vGPCR by using chimeric forward primer (Tf ),
consisting of the tag-encoding sequence at the 50 end and a fully comple-
mentary GPCR-specific sequence at the 30 end, in combination with a
reverse open-reading frame (ORF) primer (Or) in a single PCR (Fig. 7.2A).
Site-directed mutations are introduced using a three-step PCR strategy
(Fig. 7.2B). In the first PCR, the 50 - and 30 -end cDNA fragments are
generated in parallel by using overlapping reverse (Mr) and forward (Mf )
mutation primers in combination with forward (Of ) and reverse (Or) ORF
primers, respectively. The two PCR fragments are then fused in a self-
primed PCR, taking advantage of the introduced overlapping sequences.
Next, the fusion products are amplified in a third PCR using the primers Of
and Or (Blomenröhr et al., 2004). In principle, this three-step PCR
approach can also be used to generate GPCR–GFP fusion proteins. How-
ever, such fusion proteins are more easily generated by substituting the stop
A B
Tf Of Mf
5⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘
3⬘ 5⬘ 3⬘ 5⬘ 3⬘ 5⬘
Or Mr Or
5⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘
3⬘ 5⬘ 3⬘ 5⬘ Gel purify 3⬘ 5⬘
5⬘ 3⬘
3⬘ 5⬘ Self-primed fusion PCR (2)
PCR (3)
Of
5⬘ 3⬘
3⬘ 5⬘
Or
A B
0.6 1250
Total
(absorbance at 450 nm)
[125I]-CX3CL1 (dpm)
0.5 Surface 1000
HA detection
0.4
750
0.3
500
0.2
0.1 250
0 0
C
100
% internalization
75
50
25
0 10 20 30 40 50 60
Time (s)
Figure 7.3 US28 protein expression and internalization in transfected cells. (A) Hem-
agglutinin-tagged US28 (HA-US28) encoding plasmid is transfected into HEK 293T
cells. Twenty-four hours later, the epitope-tagged protein is detected using an ELISA
assay against the HA tag. (B) Radiolabeled [125I]-CX3CL1 binds to US28-expressing
membranes. Cold CX3CL1 displaces the radioligand in a dose-dependent manner
down to the level observed in membranes prepared from mock-transfected control
cells. (C) Internalization studies indicate that US28 rapidly internalizes radiolabeled
chemokines as soon as 5 min after their addition at 37 C.
A B
[3H]-InsP (% US28) 125 25
100 20
[Ca2+]i (% max)
75 15
50 10
25 5
0 0
C D
4
Control
NF-kB
NF-kB
NF-kB
NF-kB
NF-kB
US28
3
Luciferase
2
NF-kB binding sites
STAT3
1
HRE
AP-2
Sp1
Sp1
Luciferase 0
VEGF promoter
NF-kB VEGF
5. vGPCR-Induced Oncogenesis
5.1. Cellular transformation: Foci formation assay
Cellular transformation induced by human or viral oncogenes is typically
assessed using stably transfected NIH-3T3 cells. These mouse fibroblasts are
on the verge of transformation and allow sensitive detection of oncogenic
signals, resulting in cellular transformation. However, in order to ascertain
the oncogenic properties of the studied proteins, mock-transfected cells
always have to be taken as a negative control in the experiment to estimate
the background activity. NIH-3T3 cells are transfected with a US28-
encoding plasmid using the calcium phosphate method (Chen and
Okayama, 1988). This plasmid also contains the antibiotic-resistant gene
neomycin, allowing the selection of geneticin-resistant US28-expressing
cells. NIH-3T3 cells possess cell contact–inhibition properties that disable
them to proliferate when entering in contact with adjacent cells within a cell
monolayer. Upon transformation, cells lose this ability and uncontrolled
growth of cells leads to formation of cell foci (Maussang et al., 2006). The
transforming ability of US28-expressing NIH-3T3 cells is measured when
cells are cultured together with native NIH-3T3 cells that still possess
cell contact inhibition. The latter grow in a monolayer, while US28-
transformed cells grow on top of one another, leading to the formation of
foci. To this end, 2 105 naive NIH-3T3 cells are cultured together with
2 103 mock or US28 stably transfected NIH-3T3 cells for 14 days in the
Characterization of HCMV-Encoded Viral GPCRs 163
A B
Control US28
Cyclin D1
b-actin
Control US28
A B
400 100 Control
US28
presenting tumors (%)
Tumor size (mm3)
300 75
Inoculated sites
200 50
100 25
0 0
0 10 20 30 0 10 20 30
Time (days) Time (days)
removing the negative and positive selection marker. This step is performed
by induction of the red recombination system at 42 C for 20 min and the
parallel induction of I-SceI endonuclease by 1% arabinose, resulting in a
mutated BAC carrying only the CMV genome with the desired mutation.
The mutated BAC is checked again by PCR, RFLP with at least three
restriction enzymes and sequencing of the mutated region. Recombinant
virus is reconstituted by electroporation of the mutated BAC DNA
into CMV permissive cells (Chevillotte et al., 2009; Sinzger et al., 2008).
A B
25 25
[125I]-CCL5 (103 sites/cell)
20 20
[3H]-InsP (⫻103)
15 15
10 10
5 5
0 0
C
10.0
VEGF promoter activation
7.5
(fold control)
5.0
2.5
Control WT ΔUS28
Titan
Figure 7.7 Cell surface expression and signaling properties of vGPCRs in HCMV-
infected cells. (A) Human foreskin fibroblasts (HFF) are infected with the AD169 WT
and DUS28 (lacking the US28 gene) strains. Eight hours post-infection, [125I]-CCL5
specific binding is detected in cells infected with the WT virus, but it is almost
completely abrogated in cells infected with the DUS28 mutant. (B) Infection of HFF
cells with HCMV strain AD169 leads to a constitutive formation of inositol phosphate
(InsP) 48 h postinfection. Deletion of either US28 only (DUS28) or the four vGPCRsç
US27, US28, UL33, and UL78 (Quattro)çcompletely impairs InsP accumulation ( Jens
Holl, Andreas Schreiber and Detlef Michel, unpublished data). (C) Human glioblas-
toma U373 cells infected with the HCMV strainTitan present an increased activation of
the humanVEGF promoter, which is impaired after deletion of US28 gene.
Characterization of HCMV-Encoded Viral GPCRs 167
7. Conclusions
The study of HCMV-encoded vGPCRs can be performed at several
levels. For the quest of nonpeptidergic drug–like compounds that can
inhibit US28-mediated activities, high-throughput screening methods for
InsP formation and radioligand binding have been successfully used. Similar
approaches can be used to identify cognate ligands for US27, UL33, and
UL78. Signaling assays determine whether these vGPCRs are constitutively
active and whether they present ligand-induced signaling properties once
these receptors are deorphanized. The BAC mutagenesis method is also a
very useful tool to determine the importance of vGPCRs in the context of
HCMV-infected cells. In vitro and xenograft in vivo models have enabled us
to delineate the oncogenic properties of US28 and highlight its potential
importance in viral proliferative diseases.
ACKNOWLEDGMENTS
D.M., H.F.V., and M.J.S. are supported by the Dutch Organization for Scientific Research
(NWO).
REFERENCES
Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S.,
Cesarman, E., Gershengorn, M. C., and Mesri, E. A. (1998). G-protein-coupled receptor
of Kaposi’s sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator.
Nature 391, 86–89.
Beisser, P. S., Vink, C., Van Dam, J. G., Grauls, G., Vanherle, S. J., and Bruggeman, C. A.
(1998). The R33 G protein-coupled receptor gene of rat cytomegalovirus plays an
essential role in the pathogenesis of viral infection. J. Virol. 72, 2352–2363.
168 David Maussang et al.
Billstrom, M. A., Johnson, G. L., Avdi, N. J., and Worthen, G. S. (1998). Intracellular
signaling by the chemokine receptor US28 during human cytomegalovirus infection.
J. Virol. 72, 5535–5544.
Billstrom, M. A., Lehman, L. A., and Scott Worthen, G. (1999). Depletion of extracellular
RANTES during human cytomegalovirus infection of endothelial cells. Am. J. Respir.
Cell Mol. Biol. 21, 163–167.
Blomenrohr, M., Vischer, H. F., and Bogerd, J. (2004). Receptor mutagenesis strategies for
examination of structure-function relationships. Methods Mol. Biol. 259, 307–322.
Bodaghi, B., Jones, T. R., Zipeto, D., Vita, C., Sun, L., Laurent, L., Arenzana-Seisdedos, F.,
Virelizier, J. L., and Michelson, S. (1998). Chemokine sequestration by viral chemor-
eceptors as a novel viral escape strategy: Withdrawal of chemokines from the environ-
ment of cytomegalovirus-infected cells. J. Exp. Med. 188, 855–866.
Borst, E. M., Mathys, S., Wagner, M., Muranyi, W., and Messerle, M. (2001). Genetic
evidence of an essential role for cytomegalovirus small capsid protein in viral growth.
J. Virol. 75, 1450–1458.
Brandish, P. E., Hill, L. A., Zheng, W., and Scolnick, E. M. (2003). Scintillation proximity
assay of inositol phosphates in cell extracts: High-throughput measurement of G-protein-
coupled receptor activation. Anal. Biochem. 313, 311–318.
Brune, W., Messerle, M., and Koszinowski, U. H. (2000). Forward with BACs: New tools
for herpesvirus genomics. Trends Genet. 16, 254–259.
Bylund, D. B., Deupree, J. D., and Toews, M. L. (2004). Radioligand-binding methods for
membrane preparations and intact cells. Methods Mol. Biol. 259, 1–28.
Casarosa, P., Bakker, R. A., Verzijl, D., Navis, M., Timmerman, H., Leurs, R., and
Smit, M. J. (2001). Constitutive signaling of the human cytomegalovirus-encoded
chemokine receptor US28. J. Biol. Chem. 276, 1133–1137.
Casarosa, P., Gruijthuijsen, Y. K., Michel, D., Beisser, P. S., Holl, J., Fitzsimons, C. P.,
Verzijl, D., Bruggeman, C. A., Mertens, T., Leurs, R., Vink, C., and Smit, M. J. (2003a).
Constitutive signaling of the human cytomegalovirus-encoded receptor UL33 differs
from that of its rat cytomegalovirus homolog R33 by promiscuous activation of
G proteins of the Gq, Gi, and Gs classes. J. Biol. Chem. 278, 50010–50023.
Casarosa, P., Menge, W. M., Minisini, R., Otto, C., van Heteren, J., Jongejan, A.,
Timmerman, H., Moepps, B., Kirchhoff, F., Mertens, T., Smit, M. J., and Leurs, R.
(2003b). Identification of the first nonpeptidergic inverse agonist for a constitutively
active viral-encoded G protein-coupled receptor. J. Biol. Chem. 278, 5172–5178.
Casarosa, P., Waldhoer, M., LiWang, P. J., Vischer, H. F., Kledal, T., Timmerman, H.,
Schwartz, T. W., Smit, M. J., and Leurs, R. (2005). CC and CX3C chemokines
differentially interact with the N terminus of the human cytomegalovirus-encoded
US28 receptor. J. Biol. Chem. 280, 3275–3285.
Chen, C. A., and Okayama, H. (1988). Calcium phosphate-mediated gene transfer: A highly
efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques
6, 632–638.
Cheng, Y., and Prusoff, W. (1973). Relationship between the inhibition constant (Ki) and
the concentration of inhibitor which causes 50 per cent inhibition (IC50) of the
enzymatic reaction. Biochem. Pharmacol. 22, 3099–3108.
Chevillotte, M., Landwehr, S., Linta, L., Frascaroli, G., Luske, A., Buser, C., Mertens, T.,
and von Einem, J. (2009). Major tegument protein pp65 of human cytomegalovirus is
required for the incorporation of pUL69 and pUL97 into the virus particle and for viral
growth in macrophages. J. Virol. 83, 2480–2490.
Cinatl, J. Jr., Vogel, J. U., Kotchetkov, R., and Wilhelm Doerr, H. (2004). Oncomodula-
tory signals by regulatory proteins encoded by human cytomegalovirus: A novel role for
viral infection in tumor progression. FEMS Microbiol. Rev. 28, 59–77.
Characterization of HCMV-Encoded Viral GPCRs 169
Cobbs, C. S., Harkins, L., Samanta, M., Gillespie, G. Y., Bharara, S., King, P. H.,
Nabors, L. B., Cobbs, C. G., and Britt, W. J. (2002). Human cytomegalovirus infection
and expression in human malignant glioma. Cancer Res. 62, 3347–3350.
Daugherty, B. L., Siciliano, S. J., and Springer, M. S. (2000). Radiolabeled chemokine
binding assays. Methods Mol. Biol. 138, 129–134.
Davis-Poynter, N. J., Lynch, D. M., Vally, H., Shellam, G. R., Rawlinson, W. D.,
Barrell, B. G., and Farrell, H. E. (1997). Identification and characterization of a
G protein-coupled receptor homolog encoded by murine cytomegalovirus. J. Virol.
71, 1521–1529.
Fraile-Ramos, A., Kledal, T. N., Pelchen-Matthews, A., Bowers, K., Schwartz, T. W., and
Marsh, M. (2001). The human cytomegalovirus US28 protein is located in endocytic
vesicles and undergoes constitutive endocytosis and recycling. Mol. Biol. Cell 12,
1737–1749.
Fraile-Ramos, A., Pelchen-Matthews, A., Kledal, T. N., Browne, H., Schwartz, T. W., and
Marsh, M. (2002). Localization of HCMV UL33 and US27 in endocytic compartments
and viral membranes. Traffic 3, 218–232.
Gao, J. L., and Murphy, P. M. (1994). Human cytomegalovirus open reading frame US28
encodes a functional beta chemokine receptor. J. Biol. Chem. 269, 28539–28542.
Harkins, L., Volk, A. L., Samanta, M., Mikolaenko, I., Britt, W. J., Bland, K. I., and
Cobbs, C. S. (2002). Specific localisation of human cytomegalovirus nucleic acids and
proteins in human colorectal cancer. Lancet 360, 1557–1563.
Huckle, W. R., and Conn, P. M. (1987). Use of lithium ion in measurement of stimulated
pituitary inositol phospholipid turnover. Methods Enzymol. 141, 149–155.
Hulshof, J. W., Vischer, H. F., Verheij, M. H., Fratantoni, S. A., Smit, M. J., de Esch, I. J.,
and Leurs, R. (2006). Synthesis and pharmacological characterization of novel inverse
agonists acting on the viral-encoded chemokine receptor US28. Bioorg. Med. Chem. 14,
7213–7230.
Kaptein, S. J., Beisser, P. S., Gruijthuijsen, Y. K., Savelkouls, K. G., van Cleef, K. W.,
Beuken, E., Grauls, G. E., Bruggeman, C. A., and Vink, C. (2003). The rat cytomega-
lovirus R78 G protein-coupled receptor gene is required for production of infectious
virus in the spleen. J. Gen. Virol. 84, 2517–2530.
Kledal, T. N., Rosenkilde, M. M., and Schwartz, T. W. (1998). Selective recognition of the
membrane-bound CX3C chemokine, fractalkine, by the human cytomegalovirus-
encoded broad-spectrum receptor US28. FEBS Lett. 441, 209–214.
Lim, H. D., Smits, R. A., Bakker, R. A., van Dam, C. M., de Esch, I. J., and Leurs, R.
(2006). Discovery of S-(2-guanidylethyl)-isothiourea (VUF 8430) as a potent nonimi-
dazole histamine H4 receptor agonist. J. Med. Chem. 49, 6650–6651.
Margulies, B. J., Browne, H., and Gibson, W. (1996). Identification of the human cyto-
megalovirus G protein-coupled receptor homologue encoded by UL33 in infected cells
and enveloped virus particles. Virology 225, 111–125.
Maussang, D., Verzijl, D., van Walsum, M., Leurs, R., Holl, J., Pleskoff, O., Michel, D., van
Dongen, G. A., and Smit, M. J. (2006). Human cytomegalovirus-encoded chemokine
receptor US28 promotes tumorigenesis. Proc. Natl. Acad. Sci. USA 103, 13068–13073.
McIlhinney, R. A. (2004). Generation and use of epitope-tagged receptors. Methods Mol.
Biol. 259, 81–98.
McLean, K. A., Holst, P. J., Martini, L., Schwartz, T. W., and Rosenkilde, M. M. (2004).
Similar activation of signal transduction pathways by the herpesvirus-encoded chemo-
kine receptors US28 and ORF74. Virology 325, 241–251.
Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H., and Koszinowski, U. H.
(1997). Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial
artificial chromosome. Proc. Natl. Acad. Sci. USA 94, 14759–14763.
170 David Maussang et al.
Michel, D., Milotic, I., Wagner, M., Vaida, B., Holl, J., Ansorge, R., and Mertens, T.
(2005). The human cytomegalovirus UL78 gene is highly conserved among clinical
isolates, but is dispensable for replication in fibroblasts and a renal artery organ-culture
system. J. Gen. Virol. 86, 297–306.
Miller, W. E., Houtz, D. A., Nelson, C. D., Kolattukudy, P. E., and Lefkowitz, R. J. (2003).
G-protein-coupled receptor (GPCR) kinase phosphorylation and beta-arrestin recruit-
ment regulate the constitutive signaling activity of the human cytomegalovirus US28
GPCR. J. Biol. Chem. 278, 21663–21671.
Minisini, R., Tulone, C., Luske, A., Michel, D., Mertens, T., Gierschik, P., and Moepps, B.
(2003). Constitutive inositol phosphate formation in cytomegalovirus-infected human
fibroblasts is due to expression of the chemokine receptor homologue pUS28. J. Virol.
77, 4489–4501.
Mokros, T., Rehm, A., Droese, J., Oppermann, M., Lipp, M., and Hopken, U. E. (2002).
Surface expression and endocytosis of the human cytomegalovirus-encoded chemokine
receptor US28 is regulated by agonist-independent phosphorylation. J. Biol. Chem. 277,
45122–45128.
Randolph-Habecker, J. R., Rahill, B., Torok-Storb, B., Vieira, J., Kolattukudy, P. E.,
Rovin, B. H., and Sedmak, D. D. (2002). The expression of the cytomegalovirus
chemokine receptor homolog US28 sequesters biologically active CC chemokines and
alters IL-8 production. Cytokine 19, 37–46.
Rosenkilde, M. M., Smit, M. J., and Waldhoer, M. (2008). Structure, function and
physiological consequences of virally encoded chemokine seven transmembrane recep-
tors. Br. J. Pharmacol. 153, S154–S166.
Sinzger, C., Hahn, G., Digel, M., Katona, R., Sampaio, K. L., Messerle, M., Hengel, H.,
Koszinowski, U., Brune, W., and Adler, B. (2008). Cloning and sequencing of a highly
productive, endotheliotropic virus strain derived from human cytomegalovirus TB40/E.
J. Gen. Virol. 89, 359–368.
Smit, M. J., Bakker, R. A., and Burstein, E. S. (2002). G protein-coupled receptors and
proliferative signaling. Methods Enzymol. 343, 430–447.
Soderberg-Naucler, C. (2006). Does cytomegalovirus play a causative role in the develop-
ment of various inflammatory diseases and cancer? J. Intern. Med. 259, 219–246.
Streblow, D. N., Soderberg-Naucler, C., Vieira, J., Smith, P., Wakabayashi, E., Ruchti, F.,
Mattison, K., Altschuler, Y., and Nelson, J. A. (1999). The human cytomegalovirus
chemokine receptor US28 mediates vascular smooth muscle cell migration. Cell 99,
511–520.
Stropes, M. P., and Miller, W. E. (2008). Functional analysis of human cytomegalovirus
pUS28 mutants in infected cells. J. Gen. Virol. 89, 97–105.
Tischer, B. K., von Einem, J., Kaufer, B., and Osterrieder, N. (2006). Two-step red-
mediated recombination for versatile high-efficiency markerless DNA manipulation in
Escherichia coli. Biotechniques 40, 191–197.
Verzijl, D., Storelli, S., Scholten, D. J., Bosch, L., Reinhart, T. A., Streblow, D. N.,
Tensen, C. P., Fitzsimons, C. P., Zaman, G. J., Pease, J. E., de Esch, I. J., Smit, M. J.,
et al. (2008). Noncompetitive antagonism and inverse agonism as mechanism of action of
nonpeptidergic antagonists at primate and rodent CXCR3 chemokine receptors.
J. Pharmacol. Exp. Ther. 325, 544–555.
Vischer, H. F., Leurs, R., and Smit, M. J. (2006). HCMV-encoded G-protein-coupled
receptors as constitutively active modulators of cellular signaling networks. Trends
Pharmacol. Sci. 27, 56–63.
Wagner, M., Ruzsics, Z., and Koszinowski, U. H. (2002). Herpesvirus genetics has come of
age. Trends Microbiol. 10, 318–324.
Characterization of HCMV-Encoded Viral GPCRs 171
Waldhoer, M., Casarosa, P., Rosenkilde, M. M., Smit, M. J., Leurs, R., Whistler, J. L., and
Schwartz, T. W. (2003). The carboxyl terminus of human cytomegalovirus-encoded 7
transmembrane receptor US28 camouflages agonism by mediating constitutive endocy-
tosis. J. Biol. Chem. 278, 19473–19482.
Waldhoer, M., Kledal, T. N., Farrell, H., and Schwartz, T. W. (2002). Murine cytomega-
lovirus (CMV) M33 and human CMV US28 receptors exhibit similar constitutive
signaling activities. J. Virol. 76, 8161–8168.
Warming, S., Costantino, N., Court, D. L., Jenkins, N. A., and Copeland, N. G. (2005).
Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res.
33, e36.
Yang, T. Y., Chen, S. C., Leach, M. W., Manfra, D., Homey, B., Wiekowski, M.,
Sullivan, L., Jenh, C. H., Narula, S. K., Chensue, S. W., and Lira, S. A. (2000).
Transgenic expression of the chemokine receptor encoded by human herpesvirus 8
induces an angioproliferative disease resembling Kaposi’s sarcoma. J. Exp. Med. 191,
445–454.
C H A P T E R E I G H T
Contents
1. Introduction 174
2. Methods for Studying Chemokine-Binding Proteins 175
2.1. Preparation of media from virus-infected cell cultures 175
2.2. Cross-linking of chemokines to soluble vCKBPs 176
2.3. Ligand blot assay 178
2.4. Chemokine binding to cells 179
2.5. Scintillation-proximity assay 180
2.6. FlashPlateâ assay 182
2.7. Surface plasmon resonance to characterize vCKBP–chemokine
interactions 184
2.8. The use of SPR in GAG competition assays 187
2.9. SPR technology to investigate the interaction between vCKBPs
and GAGs 188
Acknowledgments 189
References 189
Abstract
Poxviruses and herpesviruses encode a unique family of proteins that are
secreted from infected cells and bind chemokines, in spite of their lack of
amino acid sequence similarity to cellular chemokine receptors. Many of the
methods used with host chemokines and chemokine receptors may be used to
characterize these virus-encoded chemokine inhibitors. Here we focus on meth-
odologies that have been adapted to identify secreted chemokine binding
proteins from viruses, to determine their binding specificity for chemokines
and to characterize their interaction with the chemokine domains involved in
the recognition of chemokine receptors or glycosaminoglycans.
173
174 Antonio Alcami and Abel Viejo-Borbolla
1. Introduction
Viruses modulate the chemokine network by encoding homologues
of chemokines and chemokine receptors, and secreted proteins that bind
chemokines (Alcami, 2003; Seet et al., 2003). These mechanisms have been
mainly identified in large DNA viruses such as herpesviruses and poxviruses.
Virus-encoded chemokine homologues function as agonists, binding the
cellular receptors and transducing signals, or antagonists, preventing the
activity of chemokines by occupying chemokine receptors. Viral homolo-
gues of G protein–coupled receptors (GPCRs), the seven-transmembrane–
domain chemokine receptors, are expressed at the surface of infected cells
and may transduce signals in the absence of ligand.
Several viral chemokine-binding proteins (vCKBPs) have been identi-
fied to date (Alcami and Saraiva, 2009). These vCKBPs are secreted in large
amounts from infected cells and, despite the lack of sequence similarity to
GPCRs, bind chemokines with high affinity. The myxoma virus M-T7
protein has been propose to inhibit chemokine activity by preventing the
interaction of chemokines with glycolaminoglycans (GAGs) and disrupting
the chemokine gradient ( Lalani et al., 1997). The interaction of chemokines
with GAGs is believed to be required for proper presentation of the
chemokine to the GPCRs present in the target cell in vivo (Handel et al.,
2005; Johnson et al., 2005). The vaccinia virus 35-kDa protein and myxoma
virus M-T1 bind CC chemokines with high affinity and neutralize their
activity by preventing interaction with cellular chemokine receptors
(Alcami et al., 1998; Graham et al., 1997; Smith et al., 1997). A secreted
protein related to the 35-kDa vCKBP, known as A41 in vaccinia virus and
E163 in ectromelia virus, has been recently shown to bind chemokines, but
does not block chemokine-induced migration and it has been proposed to
block chemokine–GAG interactions ( Bahar et al., 2008; Ruiz-Arguello
et al., 2008). The CrmB and CrmD secreted tumor-necrosis-factor receptor
homologues from poxviruses have a C-terminal domain, designated small-
pox virus–encoded chemokine receptor (SECRET) domain, that binds a
reduced set of chemokines. The SECRET domain is also present in three
poxvirus secreted proteins and inhibits the biological activity of chemokines
(Alejo et al., 2006). Three vCKBPs have been identified in herpesviruses.
The M3 protein encoded by murine gammaherpesvirus 68 binds a broad
range of chemokines, including CC, CXC, C, and CX3C chemokines, and
neutralizes their activity ( Parry et al., 2000; van Berkel et al., 2000). The
glycoprotein G from several alphaherpesviruses infecting animals binds a
broad range of chemokines ( Bryant et al., 2003; Costes et al., 2005). Both
M3 and glycoprotein G inhibit the interaction of chemokines with
both cellular receptors and GAGs (Alexander-Brett and Fremont, 2007;
Viral Chemokine Binding Proteins 175
Bryant et al., 2003; Webb et al., 2004). Finally, the pUL21.5 protein encoded
by human cytomegalovirus binds CCL5 and blocks its interaction with
cellular receptors (Wang et al., 2004).
The methods used to study the binding properties and biological activity
of viral chemokines and chemokine receptors are similar to those used to
characterize the cellular homologues. This chapter will focus on methods that
have been specifically used to identify vCKBPs and to characterize their
binding properties. A chemokine-binding assay for cells that can also be
used to characterize the binding properties of the viral chemokine and
chemokine receptor homologues is described. The ability of vCKBPs to
neutralize the biological activity of chemokines can be determined in standard
chemokine-induced cell migration and calcium mobilization assays.
5 k ck
A Δ3 mo 1 1 B 5 k ck
- 68 ster ster K -1 -4 -5 V- V- V-1 Δ3 mo
V li li B H H 68 ter ter -1 -1 1
H V- V- D HV HV HV an ap erH 1 4 5 V V -
M V V M B B B R C C V--lis -lis BKV- V- V- nH pH rHV
H V D a
M VV V M BH BH BH R Ca Ce
175
* 175
83 *
83
62 * 62 *
47 *
* 47 *
32 32
25 25
16 16
CK
CK
5k k
Δ3 ck oc k B4
68 ster ster mo -1 -3 -4
m
1 4 5 V V -
-1 -1 1 oc A
C -
V l li i
H - V- L V V V
D BK - - - H H V
D HV HV HV an ap erH L
m -1
V
M VV V EE EH EH EH M B B B R C C EE EH
175
175
*
83
83
* 62 *
62
47 * 47
32 32
25 25
16 16
CK CK
TM
ll ll + M
E EHV-1
4 4
ce ce + T
4 4
3 k B B B B
18 oc 1 A 1 A 1 A 1 A
H y 83 449 492281 047 644 244 202 013 062 966 529 L m V- V- V- V-
ac rm 4
R A 50 82 10 32 84 82 82 32 10 62 60 82 EE EH EH EH EH
175
83
62
47
*
32
25
16
CK
A B
20,000 25,000
20,000
Bound MIP - Ia (CPM)
15,000
10,000
10,000
5000
5000
0 0
1 10 100 1000 10,000 100,000 1,000,000 1 10 100 1000 10,000 100,000 1,000,000
C D
15,000 8000
6000
Bound IL - 8 (CPM)
Bound IL - 8 (CPM)
10,000
4000
5000
2000
0 0
1 10 100 1000 10,000 100,000 1,000,000 1 10 100 1000 10,000 100,0001,000,000
Dose (cell equivalents) Dose (cell equivalents)
A B
vCKBP-Fc
+ 50
125I-chemokine
40
125I-CCL3 bound, pM
30
20
vCKBP-Fc
SPA
Prot.A 125I-chemokine 10
CCL3 KD 103 ± 4 pM
Protein A
0
0 100 200 300 400 500 600 700
Scintillation proximity assay 125I-CCL3 (pM)
C
100
KD (nM)
bound, %
80
CCL11 1.4 ± 0.6
60
CCL5 7.2 ± 0.8
125I-CCL3
CCL3
40 CCL11 CCL2 15.1 ± 0.6
CCL5
20 CCL2
0
0.01 0.1 1 10 100 1000
Cold competitor (nM)
Figure 8.3 SPA to study the interaction of vCKBPs with chemokines. (A) Illustration
of SPA using protein A-fluoromicrospheres containing scintillant (SPA Prot. A) to
detect the interaction of 125I-chemokines with a vCKBP fused to the Fc portion of
human IgG1 (vCKBP-Fc). (B) Saturation curve and Scatchard analysis of 125I-CCL3
binding to vaccinia virus 35K-Fc.The mean ( SEM) specific binding of triplicate sam-
ples and the affinity constant are shown. (C) Competitive inhibition with various doses
of CC chemokines. Purified vaccinia virus 35K-Fc protein was incubated in triplicate
with 50 pM 125I-CCL3 in the presence of increasing doses of unlabeled human CC
chemokines: CCL2, CCL3, CCL5, and CCL11. The percentage of specific binding
(mean SEM) refers to binding in the absence of competitor. The affinity constant
(KD) values calculated are indicated.
ligands (Brown et al., 1997). The interior of each well is coated with a thin
layer of polystyrene-based scintillant. Following the SPA principle, the
radioisotope must be in close proximity to the surface of the well to excite
the scintillant (Fig. 8.4). Unbound radioligand does not activate the scintil-
lant and thus there is no need to carry out extensive washings. FlashPlate
was designed for use with microplate scintillation counters.
Various FlashPlate formats are available that have secondary antibodies
or other proteins precoated in the wells. In the protocol described here, a
nickel-chelate FlashPlate format is used to study the interaction of chemo-
kines with vCKBPs fused to a C-terminal 6xhis tag (vCKBP-his) (Alcami,
2004). Protein A–coated FlashPlate can also be used when the vCKBP or
other receptors are expressed fused to the Fc portion of human IgG1.
125l-chemokine
vCKBP-his
Scintillant
Nickel chelate flashplate
(PerkinElmer life sciences)
B C
10000
18000
bound (cpm)
8000
bound (cpm)
12000
6000
8000
4000
125I-IL-8
125I-IL-8
4000
2000
0 0
1 10 100 1000 0 200 400 600 800
Purified M3 (ng) 125I-IL-8 added (pM)
Figure 8.4 FlashPlate assay to characterize the interaction of vCKBPs with chemo-
kines. (A) Illustration of FlashPlate assay to determine the interaction of radiolabeled
chemokines with purified vCKBP expressed with a C-terminal 6xhis tag (vCKBP-his)
in nickel chelate FlashPlate. (B) Binding of 200 pM 125I-IL-8 (125I-CXCL8) to increasing
doses of purified murine gammaherpesvirus 68 M3 protein fused to a C-terminal 6xhis
tag. The mean ( standard deviation) specific binding of triplicate samples is shown.
(C) Saturation curve of 125I-IL-8 (125I-CXCL8) binding to purified M3 (1 ng).The mean
( standard deviation) specific binding of triplicate samples is shown. (From Alcami,
A. (2004). Interaction of viral chemokine inhibitors with chemokines. Methods Mol. Biol.
239, 167^180, with permission.)
184 Antonio Alcami and Abel Viejo-Borbolla
1600
500
Resp. diff. (RU)
380 mCCL25
260 mCCL21
mCCL24
140 mCXCL12b
20 mCXCL10
mCXCL12a
0 100 200 300 400
Time (s)
chemokines have been described in both mouse and human systems, and
purified recombinant chemokines are available from a number of companies
such as Peprotech or R&D Systems. Another advantage of SPR is the
monitoring of the vCKBP–chemokine interaction in real time, allowing
the quantification of binding affinities and providing additional information
on the stability of the vCKBP–chemokine complex. This is relevant in
order to understand the biology of these viral proteins. For example, a slow
dissociation of the complex may enhance the ability of a particular vCKBP
to inhibit chemokine activity in vivo. Another application of this technology
is the screening of chemokine and vCKBP mutants to map the amino
acid residues involved in the interaction and to assess the relative contribu-
tion of different binding domains when multiple interactions are occurring
between two proteins.
The vCKBP can be immobilized onto the biosensor chip through various
methods: amine-, thiol-, and streptavidine-coupling. Proteins containing a
histidine-tag can also be immobilized using NTA sensor chips. The choice of
the method depends on the chemical nature of the ligand. The most common
method used for vCKBPs is amine coupling since most of the vCKBPs
contain free amine groups and are not very acidic. When the protein is
186 Antonio Alcami and Abel Viejo-Borbolla
very acidic, does not have free amine groups, or, on the other hand, has too
many amine groups, thiol coupling is a good alternative. Thiol groups are
normally present in the vCKBP, but can also be inserted into the vCKBP if
needed. Reducing conditions for either the binding or regeneration of the
chip should not be employed if thiol coupling is performed. When neither
thiol nor amine coupling are suitable for the immobilization of the vCKBP,
the protein can be biotinylated prior to the immobilization in a streptavidin-
containing chip. In this section, we describe the methodology used to
determine the binding properties of vCKBPs using the amine groups
to immobilize the protein. The use of streptavidine coupling is described
later (Section 2.9). The BIAcore chips contain several cells allowing the
coupling of the vCKBP to one cell while leaving the other empty or occupied
by a protein control unable to interact with chemokines. This reference cell is
required for the analysis of the BIAcore sensorgram (see the following).
The main limitation of the SPR technology over the cross-linking is that
it does not allow the screening of complex protein mixtures such as crude
medium from virus-infected cells to identify the presence of secreted
vCKBPs. Moreover, the cross-linking assay allows the comparison of the
binding profiles of supernatant from cells infected with wildtype virus versus
a virus mutant lacking the vCKBP, to test whether a protein is the sole
vCKBP encoded by a particular virus.
1. Dyalize purified recombinant vCKBP against acetate buffer. The pH of
the buffer depends on the isoelectric point of the vCKBP.
2. Activate all cells of the carboxy methyl dextran 5 (CM5) chip (Biacore
Life Sciences, GE Healthcare) by addition of 35 ml of NHS/EDC. This
results in the modification of the carboxymethyl groups of the chip to
N-hydroxysuccinimide esters.
3. Inject the vCKBP at a flow rate of 5 ml/min only in one of the chip cells.
Covalent interactions will form between the amine groups of the vCKBP
and the N-Hydroxysuccinimide esters of the chip surface. For initial
screening purposes, approximately 5000 response units ( RU) (5000 pg/
mm2) should be coupled to the chip. To determine the kinetics of associ-
ation and dissociation and to calculate the affinity constants, lower
densities of vCKBP are immobilized to the chip (Rmax < 200 RU).
4. Deactivate all cells of the chip by injecting 35 ml of 1 M ethanolamine
hydrochloride, pH 8.5. This will impede that the free esters react with
the analyte later on.
5. Inject recombinant chemokines dissolved in HBS-EP buffer (10 mM
Hepes, 150 mM, NaCl, 3 mM EDTA, 0.005% surfactant P20, pH 7.4).
For initial screening purposes, the chemokines are injected at a concen-
tration of 100 nM at a flow rate of 10 ml/min, and association and
dissociation phases are monitored. The dissociation phase in a screening
experiment is approximately 2 min. For kinetics experiments, the
Viral Chemokine Binding Proteins 187
hCXCL12b
100
mCCL25
mCXCL10
80
Binding (%)
60
40
20
0
1:0 1:0.1 1:0.5 1:1 1:10 1:100 1:1000
Chemokine:heparin (molar ratio)
Figure 8.6 SPR analysis of the interacion of avCKBP to chemokines in the presence of
GAGs. SPR binding assay of mouse CCL25, mouse CXCL10 or human CXCL12b to pur-
ified E163 from ectromelia virus in the presence of increasing concentrations of heparin.
Chemokine and heparin were incubated for 15 min before injection over a E163-coupled
chip and maximum response was recorded.The percentage of binding refers to the binding
in the absence of heparin. (From Ruiz-Arguello, M. B., Smith,V. P., Campanella, G. S.,
Baleux, F., Arenzana-Seisdedos, F., Luster, A. D., and Alcami, A. (2008). An ectromelia
virus protein that interacts with chemokines through their glycosaminoglycan binding
domain. J.Virol. 82,917^926, with permission.)
ACKNOWLEDGMENTS
The work in the A.A.’s laboratory is funded by the Wellcome Trust, European Union,
Spanish Ministry of Science and Innovation, and Comunidad de Madrid. A.V.-B. is
supported by a postdoctoral contract program from the Instituto de Salud Carlos III (Spanish
Ministry of Health).
REFERENCES
Alcami, A. (2003). Viral mimicry of cytokines, chemokines and their receptors. Nat. Rev.
Immunol 3, 36–50.
Alcami, A. (2004). Interaction of viral chemokine inhibitors with chemokines. Methods Mol.
Biol. 239, 167–180.
Alcami, A., and Saraiva, M. (2009). Chemokine binding proteins encoded by pathogens.
In ‘‘Pathogen-Derived Immunomodulatory Molecules.’’ (Fallon, P., ed.), Landes
Bioscience, Austin Tx.
190 Antonio Alcami and Abel Viejo-Borbolla
Alcami, A., Symons, J. A., Collins, P. D., Williams, T. J., and Smith, G. L. (1998). Blockade
of chemokine activity by a soluble chemokine binding protein from vaccinia virus.
J. Immunol. 160, 624–633.
Alejo, A., Ruiz-Arguello, M. B., Ho, Y., Smith, V. P., Saraiva, M., and Alcami, A. (2006).
A chemokine-binding domain in the tumor necrosis factor receptor from variola
(smallpox) virus. Proc. Natl. Acad. Sci. USA 103, 5995–6000.
Alexander-Brett, J. M., and Fremont, D. H. (2007). Dual GPCR and GAG mimicry by the
M3 chemokine decoy receptor. J. Exp. Med. 204, 3157–3172.
Bahar, M. W., Kenyon, J. C., Putz, M. M., Abrescia, N. G., Pease, J. E., Wise, E. L.,
Stuart, D. I., Smith, G. L., and Grimes, J. M. (2008). Structure and function of A41,
a vaccinia virus chemokine binding protein. PLoS Pathog. 4, e5.
Bosworth, N., and Towers, P. (1989). Scintillation proximity assay. Nature 341, 167–168.
Brown, B. A., Cain, M., and Broadbent, J. (1997). FlashPlate technology. In ‘‘High
Throughput Screening.’’ (Devlin, J., ed.), pp. 317–328. CRC Press, Boca Raton, FL.
Bryant, N. A., Davis-Poynter, N., Vanderplasschen, A., and Alcami, A. (2003). Glycopro-
tein G isoforms from some alphaherpesviruses function as broad-spectrum chemokine
binding proteins. EMBO J. 22, 833–846.
Costes, B., Ruiz-Arguello, M. B., Bryant, N. A., Alcami, A., and Vanderplasschen, A. (2005).
Both soluble and membrane-anchored forms of Felid herpesvirus 1 glycoprotein G
function as a broad-spectrum chemokine-binding protein. J. Gen. Virol. 86, 3209–3214.
Dower, S. K., Kronheim, S. R., March, C. J., Conlon, P. J., Hopp, T. P., Gillis, S., and
Urdal, D. L. (1985). Detection and characterization of high affinity plasma membrane
receptors for human interleukin 1. J. Exp. Med 162, 501–515.
Graham, K. A., Lalani, A. S., Macen, J. L., Ness, T. L., Barry, M., Liu, L. Y., Lucas, A.,
Clark-Lewis, I., Moyer, R. W., and McFadden, G. (1997). The T1/35kDa family of
poxvirus-secreted proteins bind chemokines and modulate leukocyte influx into virus-
infected tissues. Virology 229, 12–24.
Handel, T. M., Johnson, Z., Crown, S. E., Lau, E. K., and Proudfoot, A. E. (2005).
Regulation of protein function by glycosaminoglycans—as exemplified by chemokines.
Annu. Rev. Biochem. 74, 385–410.
Johnson, Z., Proudfoot, A. E., and Handel, T. M. (2005). Interaction of chemokines and
glycosaminoglycans: A new twist in the regulation of chemokine function with oppor-
tunities for therapeutic intervention. Cytokine Growth Factor Rev. 16, 625–636.
Lalani, A. S., Graham, K., Mossman, K., Rajarathnam, K., Clark-Lewis, I., Kelvin, D., and
McFadden, G. (1997). The purified myxoma virus gamma interferon receptor homolog
M-T7 interacts with the heparin-binding domains of chemokines. J. Virol. 71,
4356–4363.
Parry, C. M., Simas, J. P., Smith, V. P., Stewart, C. A., Minson, A. C., Efstathiou, S., and
Alcami, A. (2000). A broad spectrum secreted chemokine binding protein encoded by a
herpesvirus. J. Exp. Med. 191, 573–578.
Ruiz-Arguello, M. B., Smith, V. P., Campanella, G. S., Baleux, F., Arenzana-Seisdedos, F.,
Luster, A. D., and Alcami, A. (2008). An ectromelia virus protein that interacts with
chemokines through their glycosaminoglycan binding domain. J. Virol. 82, 917–926.
Seet, B. T., Barrett, J., Robichaud, J., Shilton, B., Singh, R., and McFadden, G. (2001).
Glycosaminoglycan binding properties of the myxoma virus CC-chemokine inhibitor,
M-T1. J. Biol. Chem. 276, 30504–30513.
Seet, B. T., Johnston, J. B., Brunetti, C. R., Barrett, J. W., Everett, H., Cameron, C.,
Sypula, J., Nazarian, S. H., Lucas, A., and McFadden, G. (2003). Poxviruses and immune
evasion. Annu. Rev. Immunol. 21, 377–423.
Smith, C. A., Smith, T. D., Smolak, P. J., Friend, D., Hagen, H., Gerhart, M., Park, L.,
Pickup, D. J., Torrance, D., Mohler, K., Schooley, K., and Goodwin, R. G. (1997).
Poxvirus genomes encode a secreted, soluble protein that preferentially inhibits beta
Viral Chemokine Binding Proteins 191
Contents
1. Introduction 193
2. Generation of Transgenic Mice Expressing
M3 in Insulin-Producing b Cells 195
3. M3 Expression in Islets of Langerhans Blocks CCL2-, CCL21-,
and CXCL13-Induced Migration of Cells to Islets 198
4. M3 Expression in b Cells Blocks Cellular Infiltration and Prevents
Diabetes Development 199
5. Generation of a Conditional Transgenic System
for Expression of M3 202
6. Concluding Remarks 204
References 205
Abstract
Murine herpesvirus 68 (MHV-68) codes for a secreted chemokine-binding
protein, termed M3, which interacts with a broad range of chemokines with
very high affinity, inhibiting chemokine function both in vitro and in vivo. Here
we describe the transgenic methodology used to study the role of M3 as an
immune modulator in vivo.
1. Introduction
Chemokines are chemoattractant cytokines that orchestrate the
migration of leukocytes to tissues during homeostasis and following injury
and infection. They are responsible for the initiation of a series of events that
* Immunology Institute, Mount Sinai School of Medicine, New York, New York, USA
{
Centro de Biologı́a Molecular Severo Ochoa, Consejo Superior de Investigaciones Cientı́ficas-Universidad
Autónoma de Madrid, Madrid, Spain
193
194 Sergio A. Lira et al.
inhibits a broad spectrum of chemokines. Our group was the first one to
explore the use of M3 as a chemokine blocker in vivo using transgenic mice
( Jensen et al., 2003). The use of this technology has improved our under-
standing of the immunomodulatory role of M3 in vivo. Moreover, the
characterization of mice expressing M3 has shed light into the role of
chemokines during homeostasis and inflammation.
Here we review the methods used to understand the role of M3 as an
inhibitor of chemokine function in vivo. Specifically, we review the meth-
odology employed to generate and characterize transgenic mice expressing
M3. The technical approaches utilized to identify M3 as a chemokine
binding protein and the molecular mechanism of chemokine inhibition
are covered in Chapter 8 in this volume.
described (Gotoh et al., 1985). The common bile duct was clamped distal to the
pancreatic duct junction at its hepatic insertion and the proximal common bile
duct was then cannulated using a 27-gauge needle. Then, the pancreas was
infused by retrograde injection of 2 ml of ice-cold collagenase solution (1.0 mg/
ml; Sigma, St. Louis, MO) in HBSS (Invitrogen, Carlsbad, CA). Pancreatic
tissue was recovered and subjected to a 15-min digestion at 37 . Subsequently,
ice-cold HBSS was added and the suspension was vortexed at full speed for 10 s.
Islets were handpicked under a dissection microscope. To analyze M3 expres-
sion, 200 islets from control and transgenic animals were incubated for 24 h in
glucose-free medium and supernatants were collected. Twenty micrograms of
protein from each sample was processed. Blots were incubated with primary
antibodies against M3 and a peroxidase-conjugated goat anti-rabbit IgG
(Abcam Inc, Cambridge, MA). Chemiluminescence was detected using the
Western Blot Chemiluminescence Reagent Plus (Enhanced Luminol, Perkin
Elmer Life Sciences). We found that transgenic RIP-M3 mice secreted immu-
noreactive 44-kD M3 protein after 24 h of culture, which was not present in
media from control islets.
To examine whether constitutive expression of M3 in the pancreas had
affected the development of lymphoid or nonlymphoid tissue, we examined
H&E-stained sections from RIP-M3 transgenic mice. All major organs of
the RIP-M3 mice, including pancreas, kidney, thymus, spleen, and periph-
eral lymph nodes, appeared normal by light microscopy (data not shown).
To rule out that expression of M3 affected b-cell function we performed
both in vitro (insulin content and insulin release) and in vivo experiments
(glucose tolerance test). To measure the insulin content, 20 fresh islets were
collected in Eppendorf tubes in duplicate. To extract insulin, islets were
sonicated in acid ethanol (75% ethanol, 15% HCl), and insulin content was
measured by ELISA (ALPCO Diagnostic, Windham, NH) following the
manufacturer’s instructions. We did not find significant differences in the
insulin content between islets from control and RIP-M3 mice (n ¼ 15 per
group). Later, we performed the insulin secretion assay as described by
Eizirik et al. (1992) with some modifications. Briefly, 20 islets from each
group were set in quintuplicate in a 24-well plate and incubated in CMRL
medium (Cellgro, Mediatech Inc, Herndon, VA) supplemented with
1.7 mM glucose or with 16.7 mM glucose for 60 min at 37 in an atmosphere
of 95% O2/5% CO2. Insulin released into supernatants was measured by
ELISA (ALPCO Diagnostic, Windham, NH). Although higher levels of
secreted insulin were detected in supernatants of cultured islets from both
control and RIP-M3 transgenic mice after they were exposed to high
concentrations of glucose, there was no difference between the groups.
Finally, we performed a intraperitoneal glucose tolerance test. After a 16-h
fast, glucose (1.5 g/kg body weight in saline [0.9% NaCl]) was administered
intraperitoneally (IP). The blood glucose was monitored at 0, 30, 60, 120,
and 240 min using a one-touch blood Ascensia Elite XL glucometer
198 Sergio A. Lira et al.
(Bayer, Elkhart, IN). We found that the blood glucose curves on 8-week-old
control and RIP-M3 transgenic mice were identical. Altogether these results
indicate that the insulin synthesis and secretion are not altered by expression
of M3.
Insulin/CD45
two groups. We presume that the recruitment of cells into the perivascular
space was due to the increased amount of CCL2 produced by the islets of
animals in line 254. When coexpressed with CXCL13 or CCL21 in
pancreatic islets, M3 inhibited CXCL13- and CCL21-induced accumula-
tion of mononuclear cells (Fig. 9.2F, data not shown). The number of islets
infiltrated and the total number of cells per islet were significantly reduced
in each case. Furthermore, M3 expression disturbed the organization of the
infiltrates promoted by CXCL13 and CCL21 expression. The lymphocytes
did not segregate in specific areas, and tended to accumulate in the periph-
ery of the islets or closer to the ducts. Taken together these results indicate
that expression of M3 in pancreatic islets blocks the accumulation of
mononuclear cells induced by the ectopic expression of CCL2, CCL21,
and CXCL13, and that this effect is less pronounced in RIP-M3/CCL2
mice expressing higher levels of CCL2 in the pancreas.
the destruction of the islets are still not known, but it is well accepted
that immune-based mechanisms involving macrophages and T cells are
responsible for the death of the b cells (Adorini et al., 2002; Yoon et al.,
1998). We tested the hypothesis that M3 could block chemokine function,
infiltration of islets and diabetes development using two different models:
multiple low doses of streptozotocin (MLDS) and the non-obese diabetic
(NOD) mouse. The MLDS model is a widely used model that has clinical
and histoimmunological features similar to those of human disease, with
T cells and macrophages playing a major pathogenic role (Elliott et al.,
1997). When administered in animals at multiple low doses, b-cell toxin
streptozotocin (STZ) alkylates the DNA in islet cells (Like and Rossini,
1976) and promotes release of nitric oxide (Kwon et al., 1994). Subse-
quently, as a result of a novel b-cell antigen expression, mononuclear cells
that infiltrate the islets start a multifactorial process (Kolb-Bachofen and
Kolb, 1989) resulting in the expansion of pathological response from a
‘‘mini-autoimmune response’’ into chronic immune-mediated disease.
We have previously shown that only CCL20 and CCL19 were expressed
at low levels in pancreatic islets of control mice prior to MLDS treatment
(Martin et al., 2007). However, MLDS treatment induced high expression
of several chemokines, including CXCL9, CXCL10, and CCL2, prior to
the onset of diabetes (Martin et al., 2007). To induce diabetes, mice (6 to 10
weeks of age) were injected IP with STZ (40 mg/kg freshly dissolved in
cold 0.1 M citrate buffer, pH 4.5; Calbiochem, EMD Biosciences, San
Diego, CA) for 5 consecutive days as previously described (Flodstrom
et al., 1999). The blood glucose was monitored weekly over the following
35 or 70 days using a one-touch blood Ascensia Elite XL glucometer
(Bayer, Elkhart, IN). Animals were considered diabetic when their blood
glucose levels were greater than 250 mg/dl in two consecutive daily
measurements. Mice in the control group received a corresponding volume
of sodium citrate buffer alone. Four weeks after the beginning of treatment
85% of the control mice treated with MLDS were diabetic, but only 35% of
the RIP-M3 tg/wt mice and, remarkably, none of the homozygous RIP-
M3 mice were diabetic. After 70 days, all control mice were diabetic, but
only 60% of heterozygous mice and none of the homozygous RIP-M3
mice developed disease (n ¼ 5 per group) (Fig. 9.3A).
To study the cellular changes promoted by STZ treatment, we
performed semiquantitative analysis on insulin/CD45-stained sections,
assessing 20 to 80 islets per animal. Three grades of infiltration were based
on the number of CD45-positive cells in or around the islet: grade 1 (10 to
20 cells), grade 2 (20 to 50 cells) and grade 3 (>50 cells). At least 20 sections
were evaluated per mouse and per day in a blinded fashion. Mice (n ¼ 3 per
group) were treated with MLDS and were sacrificed at 7, 14, and 21 days
after the first injection. Infiltration of CD45þ cells into the islets of control
mice was first seen on day 7 and the number of inflammatory cells and
M3 and Transgenic Mice 201
A B 100
100 wt
80
RIP-M3 tg/tg
60 60
40 WT 40
RIP-M3 tg/wt
20 20
RIP-M3 tg/tg
0 0
0 7 14 21 28 0 7 14 21
Days Days
C D
100 100
Diabetes free (%)
Figure 9.4 Transgenic system for conditional expression of M3.The system consists of
an activator transgene that encodes the transcriptional activator rtTA and a responder
transgene that encodes M3 and LacZ. In the presence of DOX, rtTA present in tissues
tareted by the CMV/b-actin promoter, binds to a tetracycline responsive element
(TRE) and drives expression of both M3 and lacZ. CMV promoter, CMV enhancer/
chicken b-actin promoter; rtTA, reverse tetracycline-controlled transactivator;
b-globin p(A), rabbit b-globin polyadenylation signal; TRE, tetracycline-responsive
element; SV40 p(A), SV40 polyadenylation signal.
ratio (p < 0.05). The data demonstrated that the inducible expression of M3
was able to block bilateral femoral arterial injury (Pyo et al., 2004).
6. Concluding Remarks
Previous work using knockout or transgenic mice has demonstrated
the role of particular chemokines in the recruitment of distinct cell popula-
tions, and their relevance to specific disease processes. These studies
provided the rationale for the development of pharmacological reagents
targeting chemokine receptors. The initial failure of some of these reagents
in clinical trials has prompted a reevaluation of the concept of targeting
specific chemokines or their receptors. Attempts to better define the role of
the chemokine system have thus far included a better description of the
pattern of expression of chemokines during particular disease conditions and
experiments with chemokine blockers with multiple specificities. Using
genetic approaches in mice, we showed that M3 is a powerful tool to
understand chemokine function in vivo. First, we showed that M3 can
block chemokine-induced mobilization of leukocytes in vitro and in vivo
( Jensen et al., 2003). Second, we showed that M3 expression could prevent
development of disease in two different settings: autoimmune diabetes and
bilateral femoral arterial injury (Martin et al., 2007, 2008; Pyo et al., 2004).
In the former studies, M3 was constitutively expressed in the pancreas of
mice and was able to inhibit islet mononuclear infiltration and diabetes
development in NOD mice and after STZ treatment (Martin et al., 2007,
2008). The latter study took advantage of an inducible expression system to
show that M3 could have a therapeutic role (Pyo et al., 2004).
While these results suggest that multichemokine blockade may represent
a superior alternative to single chemokine blockade, the usefulness of this
approach remains to be fully tested vis-à-vis safety and therapeutic delivery.
The therapeutic use of virus-encoded chemokine blockers such as M3, may
be effective in acute conditions, but may be problematic in chronic settings
due to their antigenicity. In this regard, the development of multispecific
oral small molecules may be a superior alternative. The existence of
chemokine-binding proteins in different viruses and even in higher organ-
isms, suggests that chemokine-binding proteins are used to evade the
immune system. It is likely that different chemokine-binding proteins
may have evolved to block sets of chemokines that are relevant during
specific stages of infection. The challenge ahead will be to understand which
chemokine sets are important during the various stages of disease and how
to develop safe and effective strategies to interfere with them.
M3 and Transgenic Mice 205
REFERENCES
Adorini, L., Gregori, S., and Harrison, L. C. (2002). Understanding autoimmune diabetes:
Insights from mouse models. Trends Mol. Med. 8, 31–38.
Alcami, A. (2003a). Structural basis of the herpesvirus M3-chemokine interaction. Trends
Microbiol. 11, 191–192.
Alcami, A. (2003b). Viral mimicry of cytokines, chemokines and their receptors. Nat. Rev.
Immunol. 3, 36–50.
Alexander, J. M., Nelson, C. A., van Berkel, V., Lau, E. K., Studts, J. M., Brett, T. J.,
Speck, S. H., Handel, T. M., Virgin, H. W., and Fremont, D. H. (2002). Structural basis
of chemokine sequestration by a herpesvirus decoy receptor. Cell 111, 343–356.
Atkinson, M. A., and Wilson, S. B. (2002). Fatal attraction: Chemokines and type 1 diabetes.
J. Clin. Invest. 110, 1611–1613.
Bouma, G., Coppens, J. M., Mourits, S., Nikolic, T., Sozzani, S., Drexhage, H. A., and
Versnel, M. A. (2005). Evidence for an enhanced adhesion of DC to fibronectin and a
role of CCL19 and CCL21 in the accumulation of DC around the pre-diabetic islets in
NOD mice. Eur J. Immunol. 35, 2386–2396.
Cardozo, A. K., Proost, P., Gysemans, C., Chen, M. C., Mathieu, C., and Eizirik, D. L.
(2003). IL-1beta and IFN-gamma induce the expression of diverse chemokines and
IL-15 in human and rat pancreatic islet cells, and in islets from pre-diabetic NOD
mice. Diabetologia 46, 255–266.
Chen, S. C., Vassileva, G., Kinsley, D., Holzmann, S., Manfra, D., Wiekowski, M. T.,
Romani, N., and Lira, S. A. (2002). Ectopic expression of the murine chemokines
CCL21a and CCL21b induces the formation of lymph node-like structures in pancreas,
but not skin, of transgenic mice. J. Immunol. 168, 1001–1008.
Cinamon, G., Shinder, V., and Alon, R. (2001). Shear forces promote lymphocyte migra-
tion across vascular endothelium bearing apical chemokines. Nat. Immunol. 2, 515–522.
Eizirik, D. L., Korbutt, G. S., and Hellerstrom, C. (1992). Prolonged exposure of human
pancreatic islets to high glucose concentrations in vitro impairs the beta-cell function.
J. Clin. Invest. 90, 1263–1268.
Elliott, J. I., Dewchand, H., and Altmann, D. M. (1997). Streptozotocin-induced diabetes in
mice lacking alphabeta T cells. Clin. Exp. Immunol. 109, 116–120.
Flodstrom, M., Tyrberg, B., Eizirik, D. L., and Sandler, S. (1999). Reduced sensitivity of
inducible nitric oxide synthase-deficient mice to multiple low-dose streptozotocin-
induced diabetes. Diabetes 48, 706–713.
Foulis, A. K., Oakley, C. L. (1987). The pathogenesis of beta cell destruction in type I
(insulin-dependent) diabetes mellitus. J. Pathol. 152, 141–148.
Fuentes, M. E., Durham, S. K., Swerdel, M. R., Lewin, A. C., Barton, D. S., Megill, J. R.,
Bravo, R., and Lira, S. A. (1995). Controlled recruitment of monocytes and macrophages
to specific organs through transgenic expression of monocyte chemoattractant protein-1.
J. Immunol. 155, 5769–5776.
Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547–5551.
Gotoh, M., Maki, T., Kiyoizumi, T., Satomi, S., and Monaco, A. P. (1985). An improved
method for isolation of mouse pancreatic islets. Transplantation 40, 437–438.
Grewal, I. S., Grewal, K. D., Wong, F. S., Picarella, D. E., Janeway, C. A. Jr., and
Flavell, R. A. (1996). Local expression of transgene encoded TNF alpha in islets prevents
autoimmune diabetes in nonobese diabetic (NOD) mice by preventing the development
of auto-reactive islet-specific T cells. J. Exp. Med. 184, 1963–1974.
Hogan, B., Constantini, F., and Lacy, L. (1986). ‘‘Manipulating the mouse embryo.’’ Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
206 Sergio A. Lira et al.
Jensen, K. K., Chen, S. C., Hipkin, R. W., Wiekowski, M. T., Schwarz, M. A.,
Chou, C. C., Simas, J. P., Alcami, A., and Lira, S. A. (2003). Disruption of CCL21-
induced chemotaxis in vitro and in vivo by M3, a chemokine-binding protein encoded by
murine gammaherpesvirus 68. J. Virol. 77, 624–630.
Kolb-Bachofen, V., and Kolb, H. (1989). A role for macrophages in the pathogenesis of type 1
diabetes. Autoimmunity 3, 145–154.
Kwon, N. S., Lee, S. H., Choi, C. S., Kho, T., and Lee, H. S. (1994). Nitric oxide
generation from streptozotocin. FASEB J. 8, 529–533.
Like, A. A., and Rossini, A. A. (1976). Streptozotocin-induced pancreatic insulitis: New
model of diabetes mellitus. Science 193, 415–417.
Luther, S. A., Bidgol, A., Hargreaves, D. C., Schmidt, A., Xu, Y., Paniyadi, J.,
Matloubian, M., and Cyster, J. G. (2002). Differing activities of homeostatic chemokines
CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and
lymphoid neogenesis. J. Immunol. 169, 424–433.
Luther, S. A., Lopez, T., Bai, W., Hanahan, D., and Cyster, J. G. (2000). BLC expression in
pancreatic islets causes B cell recruitment and lymphotoxin-dependent lymphoid
neogenesis. Immunity 12, 471–481.
Martin, A. P., Alexander-Brett, J. M., Canasto-Chibuque, C., Garin, A., Bromberg, J. S.,
Fremont, D. H., and Lira, S. A. (2007). The chemokine binding protein M3 prevents
diabetes induced by multiple low doses of streptozotocin. J. Immunol. 178, 4623–4631.
Martin, A. P., Canasto-Chibuque, C., Shang, L., Rollins, B. J., and Lira, S. A. (2006). The
chemokine decoy receptor M3 blocks CC chemokine ligand 2 and CXC chemokine
ligand 13 function in vivo. J. Immunol. 177, 7296–7302.
Martin, A. P., Coronel, E. C., Sano, G., Chen, S. C., Vassileva, G., Canasto-Chibuque, C.,
Sedgwick, J. D., Frenette, P. S., Lipp, M., Furtado, G. C., and Lira, S. A. (2004). A novel
model for lymphocytic infiltration of the thyroid gland generated by transgenic
expression of the CC chemokine CCL21. J. Immunol. 173, 4791–4798.
Martin, A. P., Grisotto, M. G., Canasto-Chibuque, C., Kunkel, S. L., Bromberg, J. S.,
Furtado, G. C., and Lira, S. A. (2008). Islet expression of M3 uncovers a key role for
chemokines in the development and recruitment of diabetogenic cells in NOD mice.
Diabetes 57, 387–394.
Morimoto, J., Yoneyama, H., Shimada, A., Shigihara, T., Yamada, S., Oikawa, Y.,
Matsushima, K., Saruta, T., and Narumi, S. (2004). CXC chemokine ligand 10 neutrali-
zation suppresses the occurrence of diabetes in nonobese diabetic mice through enhanced
beta cell proliferation without affecting insulitis. J. Immunol. 173, 7017–7024.
Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., and Nishimune, Y. (1997). ‘‘Green
mice’’ as a source of ubiquitous green cells. FEBS Lett. 407, 313–319.
Parry, C. M., Simas, J. P., Smith, V. P., Stewart, C. A., Minson, A. C., Efstathiou, S., and
Alcami, A. (2000). A broad spectrum secreted chemokine binding protein encoded by a
herpesvirus. J. Exp. Med. 191, 573–578.
Proudfoot, A. E., Handel, T. M., Johnson, Z., Lau, E. K., LiWang, P., Clark-Lewis, I.,
Borlat, F., Wells, T. N., and Kosco-Vilbois, M. H. (2003). Glycosaminoglycan binding
and oligomerization are essential for the in vivo activity of certain chemokines. Proc. Natl.
Acad. Sci. USA 100, 1885–1890.
Pyo, R., Jensen, K. K., Wiekowski, M. T., Manfra, D., Alcami, A., Taubman, M. B., and
Lira, S. A. (2004). Inhibition of intimal hyperplasia in transgenic mice conditionally
expressing the chemokine-binding protein M3. Am. J. Pathol. 164, 2289–2297.
Rot, A. (1992). Endothelial cell binding of NAP-1/IL-8: Role in neutrophil emigration.
Immunol. Today 13, 291–294.
van Berkel, V., Barrett, J., Tiffany, H. L., Fremont, D. H., Murphy, P. M., McFadden, G.,
Speck, S. H., and Virgin, H. I. (2000). Identification of a gammaherpesvirus selective
chemokine binding protein that inhibits chemokine action. J. Virol. 74, 6741–6747.
M3 and Transgenic Mice 207
Wiekowski, M. T., Chen, S. C., Zalamea, P., Wilburn, B. P., Kinsley, D. J., Sharif, W. W.,
Jensen, K. K., Hedrick, J. A., Manfra, D., and Lira, S. A. (2001). Disruption of neutrophil
migration in a conditional transgenic model: Evidence for CXCR2 desensitization
in vivo. J. Immunol. 167, 7102–7110.
Yang, T. Y., Chen, S. C., Leach, M. W., Manfra, D., Homey, B., Wiekowski, M.,
Sullivan, L., Jenh, C. H., Narula, S. K., Chensue, S. W., and Lira, S. A. (2000).
Transgenic expression of the chemokine receptor encoded by human herpesvirus
8 induces an angioproliferative disease resembling Kaposi’s sarcoma. J. Exp. Med. 191,
445–454 (see comments).
Yoon, J. W., Jun, H. S., and Santamaria, P. (1998). Cellular and molecular mechanisms for
the initiation and progression of beta cell destruction resulting from the collaboration
between macrophages and T cells. Autoimmunity 27, 109–122.
C H A P T E R T E N
M-T7: Measuring
Chemokine-Modulating Activity
Mee Y. Bartee,*,†,‡ Erbin Dai,† Liying Liu,†
Ganesh Munuswamy-Ramanujam,*,†,‡ Colin Macaulay,*
Dana McIvor,* Grant McFadden,‡ and Alexandra R. Lucas*,†,‡
Contents
1. Introduction 210
1.1. Chemokine–glycosaminoglycan interaction 210
1.2. Discovery and identification of the M-T7 gene 211
1.3. M-T7 inhibits inflammation and vasculopathic
disease in animal models 213
2. Protein Expression 213
2.1. Generation of viral constructs 213
2.2. Purification of M-T7 215
3. Quantifying the Effects of M-T7 In Vitro and Ex Vivo 216
3.1. Cell adhesion 216
3.2. Membrane fluidity 217
3.3. Ascites assay 219
4. Quantifying the Effects of M-T7 on Vascular Inflammatory
Responses in Rodent Vascular Transplant Models 220
4.1. Aortic transplant model 220
4.2. Tissue staining 223
4.3. Morphometric analysis of aortic plaque area 224
4.4. Statistics 225
5. Preclinical Toxicity Testing 225
References 227
Abstract
Chemokines are important for activation of a host of cellular immune and
inflammatory responses including cell signaling, activation, and communication.
M-T7, a myxoma virus protein, inhibits the activity of chemokines by direct
binding to chemokines and/or with glycosaminoglycans (GAGs). To study the
effects of this chemokine-modulating protein (CMP), we use a variety of in vitro
* Division of Cardiovascular Medicine, University of Florida, Gainesville, Florida, USA
{
Department of Medicine, University of Florida, Gainesville, Florida, USA
{
Department of Molecular Genetics and Microbiology, University of Florida, Gainesville, Florida, USA
209
210 Mee Y. Bartee et al.
1. Introduction
1.1. Chemokine–glycosaminoglycan interaction
Chemokines are small 8 to 12 kDa proteins that attract cells of the inflam-
matory and immune response systems into arteries and tissues in reaction to
damage or pathogen invasion ( Weber et al., 2004). These small chemoat-
tractant proteins create a gradient along connective tissue and cell layers by
binding to highly charged, sulfated, polysaccharide chains of glycosamino-
glycans (GAGs). Increasing concentrations of chemokines bound to GAGs
form this gradient, also termed an ‘‘array,’’ which directs cell taxis. Once
bound to GAGs, exposed chemokine domains interact with G-protein–
coupled receptors (GPCRs) to direct trafficking of cells in the innate and
acquired immune response systems (Parish, 2005). While the chemokine–
receptor interaction is reported to have wide overlap between receptor
recognition and chemokine classes, that is, to be a nonspecific and promis-
cuous interaction, the secondary requirement for chemokine binding to
tissue GAGs is now postulated to increase the specificity of cell to chemo-
kine and receptor interactions.
The chemokine–GPCR interaction has long been known to modify
cellular activation responses, but only recently has it been reported that
chemokine–GAG binding also modifies immune cellular responses
( Johnson et al., 2004a,b; Proudfoot et al., 2003). GAGs have the capacity
to alter cellular adhesion through binding to selectins, adhesion molecules,
chemokines, and growth factors (Forsberg and Kjellen, 2001). GAGs are
also reported to alter activation of serine proteases and serpins in the
coagulation cascades. There are extensive layers of both cell surface and
connective tissue-associated GAGs, the dominant GAG being heparan
sulfate (HS). Tissue and arterial GAGs include heparan sulfate, hyaluronan,
chondroitin sulfate, dermatan sulfate, and keratan sulfate.
GAGs can exist as free molecules or bound to proteins to form proteo-
glycans with chain lengths that vary from 1 up to 25,000 disaccharide units.
GAGs are highly varied and are defined by disaccharide sequences, which
are modified by acetylation and/or N and O sulfation as introduced by
M-T7: Measuring Chemokine-Modulating Activity 211
A B M-T7
pDONR221
M-T
FP 7-H
eG is6x
pFastBacDual
BV BV
BV
2. Protein Expression
2.1. Generation of viral constructs
Expression of some of the myxoma viral gene products has been unsuccessful
in conventional bacterial protein expression systems. Exact mechanistic
reasons are unknown, but protein folding and glycosylation may be
contributing factors. Since the functionality of M-T7 is not easily tested,
we selected an expression system that has been proven successful for expres-
sion of another myxoma virus protein, Serp-1. A baculovirus-mediated
expression system in Sf 21 (Spodoptera frugiperda) (Invitrogen) and High
Five (Trichoplusia ni ) (Invitrogen) cells was used for the expression and
purification of M-T7. M-T7 has also been expressed in a Chinese hamster
ovary (Weber et al., 2004) mammalian cell system, but we will describe the
baculoviral expression here.
To generate the virus, a C-terminal His–tagged construct was cloned
into a pFastBacDual (Invitrogen) expression vector containing an eGFP
(enhanced green fluorescent protein) reporter driven by the p10 promoter.
The reporter gene is important for selection of foci containing the M-T7
214 Mee Y. Bartee et al.
electrophoresis) and gels stained with Coomassie stain. Samples used for
in vivo experiments are kept under sterile conditions after filtration through
a 0.22 micron filter.
A B
300
Fluorescence intensity
100
Dimer Monomer
0 −P PMA(Iexc/Imon = 0.89)
−100
300 400 500 600 700
Wavelength (nm)
Figure 10.2 Membrane fluidity measurement with BPP. BPP is a fluorescent probe
useful for measuring the activation of cells by chemokines.The linker between the two
pyrene rings affects the ‘‘monomer’’ versus ‘‘dimer’’ state of the probe. In unactivated
cells, the lipid bilayer is more rigid, and therefore BPP is less mobile, resulting in a higher
ratio of dimers. In activated cells, the membrane is more fluid, resulting in more mobility
of BPP, and a lower ratio of dimers. In addition to the fluorescence emission at 390 nm of
the monomer, when BPP is a dimer (also termed an excimer), there is an additional
emission at 485 nm.The ratio of the excimer to monomer state can be used to determine
the activated state of cells.
abdominal viscus (such as bladder or colon) has not been penetrated. If clear
yellow ascites fluid is detected, then 50 ng of a chemokine (MCP-1, MIP-1a,
or RANTES) in 100 ml sterile saline is injected into the abdominal cavity.
M-T7 is given either intravenously (IV) via tail vein or via IP injection
depending on whether local or systemic responses are to be assayed. A single
dose of 1.5 mg of M-T7 in 100 ml sterile saline is given by IV or IP injection.
After injection, the animals are observed carefully at least twice daily, and
monitored for signs of distress, hunching, chattering, decreased activity,
dyspnea, anorexia, or local ascites-peritonitis. Animals having any pain or
discomfort (hunching, chattering, etc.) are given 0.05 to 0.1 mg/kg weight of
buprenorphine, an analgesic that is given subcutaneously (SC).
After 18 h following IP injection, animals are sacrificed for collection
of peritoneal fluid and cells. Mice are euthanized with an IP injection of
120 mg/kg weight of pentobarbital. In prior work, during the 18 h monitored,
minimal if any abdominal distention was observed, and the risk of other side
effects or mortality rate has been less than 5%. The abdominal cavity is washed
with 5 ml of saline. Using sterile technique, ascitic fluid is collected with a
syringe by placing an 18 or 19 gauge needle into the abdomen. Cells from
ascites are isolated for further analysis by FACS, cell adhesion, and membrane
fluidity.
EOS 900 operating microscope and SurgiVet Vaporizer with a rat mask
attachment and a gas scavenging system, are required. We will describe the
rat aortic transplant surgical model in detail, but many of the techniques
here can be transferred to the mouse model with careful attention to the
differences in body size for rats and mice, specifically transplanted aortic
section length, suture sizes, and dosing of anesthetics.
4.1.1. Anesthetic
Rats are anesthetized using a mixture of ketamine and xylazine (23.75 mg/
ml ketamine plus 1.25 mg/ml xylazine) in sterile saline. This mixture is
given by IP injection at 0.1 ml/100 g weight. The rat belly is shaved and
then prepared for surgery by a three-step sterilization: (1) wash with beta-
dine soap, (2) wash with alcohol, and (3) clean with a betadine topical wash.
For pain control, an SC injection of buprenorphine is given (0.05 to 0.1
mg/kg weight of the rat) immediately after the anesthetic. Isoflurane gas, an
anesthetic, is given by mask with 2% oxygen as needed at a titration of 1 to
3% isoflurane until surgery is finished.
Donor aorta
Figure 10.3 Schematic of rat aortic transplant:The donor rat is illustrated in black and
the recipient rat in purple. After the donor rat is anesthetized, aorta is removed from
the region between the renal artery (where the kidney is attached) and the bifurcation
of the aorta (where the aorta branches). Side branch vessels off of the aorta are first tied
and removed and the aorta is divided in half. One-half of the aorta is used for the saline
control and the other half for the M-T7 treated recipient rat. The donor aorta is
transplanted according to end-to-end anastomosis in the recipient rat.
200x 200x
Figure 10.4 Trichrome staining of rat aortic transplant.Transplanted aortas from rats
treated with either saline or M-T7 were trichrome stained. The arrows indicate the
boundary of the plaque. The areas between the arrowheads demarcate the limits of the
intimal plaque area. Compared to saline, M-T7 significantly reduced plaque formation.
224 Mee Y. Bartee et al.
This software allows the user to manually outline the plaque area as well as
trace the internal elastic lamina and external elastic lamina. Lumen narrow-
ing can be assessed by measuring the IEL area and subtracting the plaque
area. In a normal artery, the lumen area should be close to the IEL area, as
the intimal layer is in general composed of one or two endothelial cell layers.
Invading inflammatory cells can be counted in three separate high-power
field areas and can be further normalized to the area of tissue where cells
are counted. Cells can be specifically stained using immunohistochemical
staining techniques to identify cell types and are counted in the intimal,
medial, and adventitial layers for each specimen. Visualization of each
sample is adjusted and normalized to the objective lens of the microscope,
to provide accurate measurement of plaque areas. The software then
quantifies the enclosed plaque area, and that number is used to calculate
the significance of plaque reduction compared to the saline controls.
4.4. Statistics
When aorta samples are processed, each aortic transplant sample is cut into
two or three equal-length segments, and then plaque areas are measured on
two to three sections from each sample. This provides a minimum of four to
six stained plaque sections from each aorta for analysis. The mean value for
plaque area, internal elastic lamina, lumen area, as well as percentage
narrowing is calculated for each animal. These mean values are then utilized
for all later statistical analyses. If more than two treatment variables are
present in the study, an analysis of variance (ANOVA) is calculated to assess
significance. Individual treatment groups can then be assessed using
Fischer’s post-hoc least significant difference (PLSD) analysis. If only two
experimental treatment groups are examined, then a Student’s unpaired,
two-tailed t-test is used. For assessing cellular invasion, three areas in three
differing sites using 100 microscopic objective are counted (cells per field)
for each sample section and for each of the three arterial layers, intima,
media, and adventitial layers. Occasionally, linear regression analysis is also
performed for selected studies for correlations. The Stat view statistics
program is used for all statistical analysis.
drug delivery routes and dosing to provide a guide for effective dose range
with minimal adverse events (toxicity). While initial efficacy or prelimi-
nary experimental studies are performed in basic research labs, further
testing in general for toxicity or potentially to confirm efficacy are
performed in labs that use good lab practice (GLP) approaches, where
animal testing is carefully monitored and each stage of testing standar-
dized. Toxicity will assess half-life, organ targets at risk for toxic
responses, and immunogenicity of the reagent tested. The preclinical
toxicity testing will encompass generalized effects on mortality, morbid-
ity, and additionally a half-life analysis. These studies are aimed at a
specific clinical application and the studies will vary depending on the
disease to be addressed. Toxicity testing is generally done in a facility
that specializes in preclinical toxicity testing under GLP conditions.
This work must be very meticulously performed with rigorous standards.
The baseline toxicity tests are generally performed in rodent models.
For some selected studies, analyses are performed in primate models, as
for example when testing for cardiac toxicity, wherein the potential
effects on electrocardiogram (ECG), cardiac enzymes, and heart function
can be assessed with minimal invasive approaches using simple blood tests
and transthoracic noninvasive echocardiography (ultrasound of the
heart), reducing potential discomfort and harm to the test subjects.
If proven to have low toxicity, the subsequent analysis is used to approach
the Food and Drug Administration (FDA) in the United States, the
Health Protection Branch (HPB) in Canada, or equivalent governmental
regulatory agencies in Europe and elsewhere in the world for assessment
and approval for Phase I testing in normal volunteers. Phase I testing is
then performed in normal volunteers to assess safety in humans. These
tests are again performed in facilities that specialize in early clinical studies
with prior approval by regulatory boards such as the FDA or HPB.
Development of a new biologic is thus a complex and long-term
endeavor, but with careful planning and a good team, can be successfully
accomplished.
REFERENCES
Allen, S. J., Crown, S. E., and Handel, T. M. (2007). Chemokine: Receptor structure,
interactions, and antagonism. Annu. Rev. Immunol. 25, 787–820.
Arnold, K., Bordoli, L., Kopp, J., and Schwede, T. (2006). The SWISS-MODEL work-
space: A web-based environment for protein structure homology modelling. Bioinformatics
22, 195–201.
Bedard, E. L., Kim, P., Jiang, J., Parry, N., Liu, L., Wang, H., Garcia, B., Li, X.,
McFadden, G., Lucas, A., and Zhong, R. (2003). Chemokine-binding viral protein
M-T7 prevents chronic rejection in rat renal allografts. Transplantation 76, 249–252.
228 Mee Y. Bartee et al.
Forsberg, E., and Kjellen, L. (2001). Heparan sulfate: Lessons from knockout mice. J. Clin.
Invest. 108, 175–180.
Handel, T. M., Johnson, Z., Crown, S. E., Lau, E. K., and Proudfoot, A. E. (2005).
Regulation of protein function by glycosaminoglycans—as exemplified by chemokines.
Annu. Rev. Biochem. 74, 385–410.
Johnson, Z., Kosco-Vilbois, M. H., Herren, S., Cirillo, R., Muzio, V., Zaratin, P.,
Carbonatto, M., Mack, M., Smailbegovic, A., Rose, M., Lever, R., Page, C., et al.
(2004a). Interference with heparin binding and oligomerization creates a novel anti-
inflammatory strategy targeting the chemokine system. J. Immunol. 173, 5776–5785.
Johnson, Z., Power, C. A., Weiss, C., Rintelen, F., Ji, H., Ruckle, T., Camps, M.,
Wells, T. N., Schwarz, M. K., Proudfoot, A. E., and Rommel, C. (2004b). Chemokine
inhibition—Why, when, where, which and how? Biochem. Soc. Trans. 32, 366–377.
Kopp, J., and Schwede, T. (2004). The SWISS-MODEL repository of annotated three-
dimensional protein structure homology models. Nucleic Acids Res. 32, D230–D234.
Lalani, A. S., Ness, T. L., Singh, R., Harrison, J. K., Seet, B. T., Kelvin, D. J.,
McFadden, G., and Moyer, R. W. (1998). Functional comparisons among members
of the poxvirus T1/35kDa family of soluble CC-chemokine inhibitor glycoproteins.
Virology 250, 173–184.
Liu, L., Dai, E., Miller, L., Seet, B., Lalani, A., Macauley, C., Li, X., Virgin, H. W.,
Bunce, C., Turner, P., Moyer, R., McFadden, G., and Lucas, A. (2004). Viral
chemokine-binding proteins inhibit inflammatory responses and aortic allograft
transplant vasculopathy in rat models. Transplantation 77, 1652–1660.
Liu, L., Lalani, A., Dai, E., Seet, B., Macauley, C., Singh, R., Fan, L., McFadden, G., and
Lucas, A. (2000). The viral anti-inflammatory chemokine-binding protein M-T7 reduces
intimal hyperplasia after vascular injury. J. Clin. Invest. 105, 1613–1621.
Mossman, K., Nation, P., Macen, J., Garbutt, M., Lucas, A., and McFadden, G. (1996).
Myxoma virus M-T7, a secreted homolog of the interferon-gamma receptor, is a critical
virulence factor for the development of myxomatosis in European rabbits. Virology 215,
17–30.
Mossman, K., Upton, C., and McFadden, G. (1995). The myxoma virus-soluble interferon-
gamma receptor homolog, M-T7, inhibits interferon-gamma in a species-specific
manner. J. Biol. Chem. 270, 3031–3038.
Parish, C. R. (2005). Heparan sulfate and inflammation. Nat. Immunol. 6, 861–862.
Proudfoot, A. E., Power, C. A., Rommel, C., and Wells, T. N. (2003). Strategies for
chemokine antagonists as therapeutics. Semin. Immunol. 15, 57–65.
Seet, B. T., Singh, R., Paavola, C., Lau, E. K., Handel, T. M., and McFadden, G. (2001).
Molecular determinants for CC-chemokine recognition by a poxvirus CC-chemokine
inhibitor. Proc. Natl. Acad. Sci. USA 98, 9008–9013.
Serabian, M. A., and Pilaro, A. M. (1999). Safety assessment of biotechnology-derived
pharmaceuticals: ICH and beyond. Toxicol. Pathol. 27, 27–31.
Tolner, B., Smith, L., Hillyer, T., Bhatia, J., Beckett, P., Robson, L., Sharma, S. K.,
Griffin, N., Vervecken, W., Contreras, R., Pedley, R. B., Begent, R. H., et al. (2007).
From laboratory to Phase I/II cancer trials with recombinant biotherapeutics. Eur. J.
Cancer 43, 2515–2522.
Upton, C., Mossman, K., and McFadden, G. (1992). Encoding of a homolog of the
IFN-gamma receptor by myxoma virus. Science 258, 1369–1372.
Weber, C., Schober, A., and Zernecke, A. (2004). Chemokines: Key regulators of
mononuclear cell recruitment in atherosclerotic vascular disease. Arterioscler. Thromb.
Vasc. Biol. 24, 1997–2008.
C H A P T E R E L E V E N
Contents
1. Introduction 232
2. Methods 232
2.1. Immunohistochemistry 232
2.2. TB infection model 233
2.3. Chemokine neutralization in vivo 233
2.4. Cell transfection 233
2.5. Immunofluorescence and confocal microscopy analysis 234
2.6. Chemokine scavenging assay 234
3. Results 235
4. Discussion 236
References 241
Abstract
Chemokines play a major role in the induction of inflammatory reactions and
development of an appropriate immune response by coordinating leukocyte
recruitment. The appropriate control of the chemokine system involves several
chemokine decoy receptors, with distinct specificity and tissue distribution,
defined as nonactivating chemokine receptors able to bind the ligands and
target them to degradation. The best-characterized representative of these
receptors is D6, which is located on lymphatic endothelium and controls most
inflammatory CC chemokines. Here we will discuss the expression and
231
232 Elena M. Borroni et al.
regulation of D6 during challenge with the pathogen, and its role in dampen-
ing inflammation in tissues and draining lymph nodes and in the organization
of a protective immune response.
1. Introduction
Leukocyte trafficking is a key element in the orientation of innate and
adaptive immunity, and it is mainly controlled by chemokines, small
secreted proteins with chemotactic and cytokine-like activities (Mantovani,
1999). These molecules are classified according to structural properties
related to the number and position of conserved cysteine residues in two
major (CXC and CC) and two minor (C and CX3C) subfamilies, and
according to their production in homeostatic (i.e., produced constitutively)
and inflammatory (i.e., produced in response to inflammatory or immuno-
logical stimuli) chemokines (Charo and Ransohoff, 2006). Chemokine
biological activities are mediated by chemokine receptors, a distinct sub-
family of G protein–coupled receptors that mainly transduce intracellular
signals through the activation of heterotrimeric Gai proteins. A distinct
subfamily of chemoattractant receptors unable to sustain signaling activities,
which includes the chemokine receptors D6, Duffy antigen receptor for
chemokines (DARC, also known as the Duffy antigen), and CCX-CKR,
has recently been identified (Mantovani et al., 2006).
The D6 molecule recognizes an unusual broad spectrum of ligands, being
able to interact with most agonists at inflammatory CC chemokine receptors
from CCR1 through CCR5, while homeostatic CC chemokines, agonists at
CCR6 to CCR10, are not recognized, nor are chemokines belonging to other
subfamilies. While the ligand-binding profile is unusually broad, its expression
is fairly restricted, D6 being detectable only in placenta and on endothelial cells
of lymphatic afferent vessels in skin, gut, and lung (Martinez de la Torre et al.,
2007; Nibbs et al., 1997, 2001). In vivo results in several models, including
challenge with complete Freund adjuvant, have clearly demonstrated that D6
and its scavenger function are mandatory for controlling the outcome of
an inflammatory reaction (Liu et al., 2006; Martinez de la Torre et al., 2005).
Here we focus on how D6 is regulated during the development of an immune
response, and on its role in balancing the inflammatory and protective adaptive
immune response after challenge with Mycobacterium tuberculosis (TB).
2. Methods
2.1. Immunohistochemistry
D6 expression was analyzed in human lung lymph nodes obtained from
patients with pulmonary tuberculosis. Tissues were selected on the basis of
the presence of giant cell–associated necrotic granulomas, and the tubercular
D6 Role in Inflammation and Immune Activation 233
3. Results
Expression of the D6 receptor during TB infection was investigated by
immunohistochemistry on lung lymph nodes from patients with pulmonary
tuberculosis. As shown in Fig. 11.1A, D6 expression was prominent in
lymphatic endothelial cells, while CD68-positive macrophages did not stain
for D6, both within and around granulomas.
To better define the role of D6 in this pathological setting, D6-null mice
were infected via the IN route with TB. At the dosage used, WT mice resisted
to the infection, while D6-null mice showed significant mortality (Fig. 11.1B).
Interestingly, the exaggerated susceptibility of D6-null mice to TB infection
was not due to impaired control of the infectious agent, as the bacterial loads in
the lung, liver, and spleen were not different in WT and D6-null mice.
Conversely, a prominent inflammation-driven tissue damage was observed
in several tissue districts, including lung, liver, and kidney, in D6-null animals,
as compared to WT mice (data not shown) (Di Liberto et al., 2008).
We therefore investigated the role of individual inflammatory CC chemokines
by treating TB-infected D6-null mice with monoclonal antibodies blocking
A CD68 D6
B
100
80
Survival rate (%)
WT
60 D6−/−
D6−/− + a CCL2
40 D6−/− + a CCL3
D6−/− + a CCL4
20 D6−/− + a CCL5
D6−/− + mix antibodies
0
0 4 8 12 16
Time after infection (weeks)
4. Discussion
D6 is the best-described chemokine decoy receptor and plays a crucial
role in controlling leukocyte recruitment in inflamed tissues and the levels
of inflammatory chemokines in draining lymph nodes (Borroni et al., 2006).
D6 Role in Inflammation and Immune Activation 237
A 7
6
Degradation rate
5
(nmoli/s ⫻ 10−8)
4
3
2
1
0
0 1 10 100
Chemokine (nM)
B 100
80
125I-CCL2 (% Cpm)
60
40
20
0
0 30 60 90 120 150 180
Time (min)
Figure 11.2 D6 increased its scavenging rate upon ligand stimulation. (A) CHO-K1/
D6 cells were incubated for 4 h at 37 C with 0.1 nM of 125I-CCL4or 125I-CCL2 and 1 to
100 nM of CCL4 (□) or CCL2 (▪); (B) CHO-K1/D6 cells were incubated with 0.1 nM of
125
I-CCL2 and 10 nM CCL2 for the indicated time points. Data are representative of
(A) the degradation rate (nmoli/s) of TCA soluble fraction of supernatants or (B) the
percentage of radioactivity counted (cpm) over CHO-K1 cells in the TCA soluble (○)
and TCA insoluble () fractions of the supernatants. Results (mean standard error)
are from triplicates of one representative experiment of three performed.
Medium CCL2
A B
10 mm 10 mm
C D
20 mm 10 mm
E F
20 mm 10 mm
TB D6
Anti-CC chemokines D6−/−
+ CK
- -
CK + CK
- +
Adequate balancing of
Inflammation: reduced inflammatory reaction Inflammation: excessive
Antimicrobial activity: reduced and antimicrobial activity Antimicrobial activity: preserved
RAB11 RAB11
REFERENCES
Bonecchi, R., Borroni, E. M., Anselmo, A., Doni, A., Savino, B., Mirolo, M., Fabbri, M.,
Jala, V. R., Haribabu, B., Mantovani, A., and Locati, M. (2008). Regulation of D6
chemokine scavenging activity by ligand- and Rab11-dependent surface up-regulation.
Blood 112, 493–503.
Bonecchi, R., Locati, M., Galliera, E., Vulcano, M., Sironi, M., Fra, A. M., Gobbi, M.,
Vecchi, A., Sozzani, S., Haribabu, B., Van Damme, J., and Mantovani, A. (2004).
Differential recognition and scavenging of native and truncated macrophage-derived
chemokine (macrophage-derived chemokine/CC chemokine ligand 22) by the D6
decoy receptor. J. Immunol. 172, 4972–4976.
Borroni, E. M., Buracchi, C., de la Torre, Y. M., Galliera, E., Vecchi, A., Bonecchi, R.,
Mantovani, A., and Locati, M. (2006). The chemoattractant decoy receptor D6 as a
negative regulator of inflammatory responses. Biochem. Soc. Trans. 34, 1014–1017.
Charo, I. F., and Ransohoff, R. M. (2006). The many roles of chemokines and chemokine
receptors in inflammation. N. Engl. J. Med. 354, 610–621.
242 Elena M. Borroni et al.
Di Liberto, D., Locati, M., Caccamo, N., Vecchi, A., Meraviglia, S., Salerno, A., Sireci, G.,
Nebuloni, M., Caceres, N., Cardona, P. J., Dieli, F., and Mantovani, A. (2008). Role of
the chemokine decoy receptor D6 in balancing inflammation, immune activation, and
antimicrobial resistance in Mycobacterium tuberculosis infection. J. Exp. Med. 205,
2075–2084.
Dugani, C. B., and Klip, A. (2005). Glucose transporter 4: Cycling, compartments and
controversies. EMBO Rep. 6, 1137–1142.
Fra, A. M., Locati, M., Otero, K., Sironi, M., Signorelli, P., Massardi, M. L., Gobbi, M.,
Vecchi, A., Sozzani, S., and Mantovani, A. (2003). Cutting edge: Scavenging of inflam-
matory CC chemokines by the promiscuous putatively silent chemokine receptor D6.
J. Immunol. 170, 2279–2282.
Galliera, E., Jala, V. R., Trent, J. O., Bonecchi, R., Signorelli, P., Lefkowitz, R. J.,
Mantovani, A., Locati, M., and Haribabu, B. (2004). Beta-Arrestin-dependent constitu-
tive internalization of the human chemokine decoy receptor D6. J. Biol. Chem. 279,
25590–25597.
Jamieson, T., Cook, D. N., Nibbs, R. J., Rot, A., Nixon, C., McLean, P., Alcami, A.,
Lira, S. A., Wiekowski, M., and Graham, G. J. (2005). The chemokine receptor D6
limits the inflammatory response in vivo. Nat. Immunol. 6, 403–411.
liu, L., Graham, G. J., Damodaran, A., Hu, T., Lira, S. A., Sasse, M., Canasto-Chibuque, C.,
Cook, D. N., and Ransohoff, R. M. (2006). Cutting edge: The silent chemokine
receptor D6 is required for generating T cell responses that mediate experimental
autoimmune encephalomyelitis. J. Immunol. 177, 17–21.
Mantovani, A. (1999). The chemokine system: Redundancy for robust outputs. Immunol.
Today 20, 254–257.
Montovani, A., Bonecchi, R., and Locati, M. (2006). Tuning inflammation and immunity
by chemokine sequestration: Decoys and more. Nat. Rev. Immunol. 6, 907–918.
Martinez de la Torre, Y., Buracchi, C., Borroni, E. M., Dupor, J., Bonecchi, R.,
Nebuloni, M., Pasqualini, F., Doni, A., Lauri, E., Agostinis, C., Bulla, R.,
Cook, D. N., et al. (2007). Protection against inflammation- and autoantibody-
caused fetal loss by the chemokine decoy receptor D6. Proc. Natl. Acad. Sci. USA 104,
2319–2324.
Martinez de la Torre, Y., Locati, M., Buracchi, C., Dupor, J., Cook, D. N., Bonecchi, R.,
Nebuloni, M., Rukavina, D., Vago, L., Vecchi, A., Lira, S. A., and Mantovani, A.
(2005). Increased inflammation in mice deficient for the chemokine decoy receptor D6.
Eur. J. Immunol. 35, 1342–1346.
McKimmie, C. S., Fraser, A. R., Hansell, C., Gutiérrez, L., Philipsen, S., Connell, L.,
Rot, A., Kurowska-Stolarska, M., Carreno, P., Pruenster, M., Chu, C. C.,
Lombardi, G., et al. (2008). Hemopoietic cell expression of the chemokine decoy
receptor D6 is dynamic and regulated by GATA1. J. Immunol. 181, 3353–3363.
Nibbs, R. J., Kriehuber, E., Ponath, P. D., Parent, D., Qin, S., Campbell, J. D.,
Henderson, A., Kerjaschki, D., Maurer, D., Graham, G. J., and Rot, A. (2001). The
beta-chemokine receptor D6 is expressed by lymphatic endothelium and a subset of
vascular tumors. Am. J. Pathol. 158, 867–877.
Nibbs, R. J., Wylie, S. M., Yang, J., Landau, N. R., and Graham, G. J. (1997). Cloning and
characterization of a novel promiscuous human beta-chemokine receptor D6. J. Biol.
Chem. 272, 32078–32083.
Palframan, R. T., Jung, S., Cheng, G., Weninger, W., Luo, Y., Dorf, M., Littman, D. R.,
Rollins, B. J., Zweerink, H., Rot, A., and von Andrian, U. H. (2001). Inflammatory
chemokine transport and presentation in HEV: A remote control mechanism for mono-
cyte recruitment to lymph nodes in inflamed tissues. J. Exp. Med. 194, 1361–1373.
Park, M., Penick, E. C., Edwards, J. G., Kauer, J. A., and Ehlers, M. D. (2004). Recycling
endosomes supply AMPA receptors for LTP. Science 305, 1972–1975.
D6 Role in Inflammation and Immune Activation 243
Prevo, R., Banerji, S., Ni, J., and Jackson, D. G. (2004). Rapid plasma membrane-endoso-
mal trafficking of the lymph node sinus and high endothelial venule scavenger receptor/
homing receptor stabilin-1 (FEEL-1/CLEVER-1). J. Biol. Chem. 279, 52580–52592.
Royle, S. J., and Murrell-Lagnado, R. D. (2003). Constitutive cycling: A general mechanism
to regulate cell surface proteins. Bioessays 25, 39–46.
Schaer, C. A., Schoedon, G., Imhof, A., Kurrer, M. O., and Schaer, D. J. (2006). Constitu-
tive endocytosis of CD163 mediates hemoglobin-heme uptake and determines the
noninflammatory and protective transcriptional response of macrophages to hemoglobin.
Circ. Res. 99, 943–950.
Weber, M., Blair, E., Simpson, C. V., O’Hara, M., Blackburn, P. E., Rot, A., Graham, G. J.,
and Nibbs, R. J. (2004). The chemokine receptor D6 constitutively traffics to and from
the cell surface to internalize and degrade chemokines. Mol. Biol. Cell. 15, 2492–2508.
C H A P T E R T W E LV E
Contents
1. Introduction 246
1.1. Investigating D6 function using in vitro model systems 247
1.2. D6 as a model for determining chemokine receptor structure 255
Ackowledgments 260
References 260
Abstract
Chemokines direct leukocyte migration by activating intracellular signalling
pathways through G-protein coupled chemokine receptors. However, they
also bind to other surface proteins, including a group of molecules which we
refer to as ‘atypical’ chemokine receptors. One such molecule is D6. D6 is
structurally-related to other chemokine receptors, and binds specific pro-
inflammatory chemokines with high affinity, but surprisingly, when expressed
in heterologous cell lines, it is unable to transduce signals after chemokine
engagement. Instead, by using the approaches outlined in this chapter, evi-
dence has emerged that D6 acts as a chemokine scavenger which uses unique
intracellular trafficking properties to continuously sequester extracellular che-
mokines into cells. It is envisaged that this suppresses inflammation in vivo by
limiting pro-inflammatory chemokine bioavailability, and indeed, D6 deficient
mice show exaggerated inflammatory responses to a variety of challenges. In
addition to the in vitro functional studies, we also describe the methods we
have used to express, purify and analyse large quantities of D6 protein. The
unusually high stability of D6 and its broad subcellular distribution enables D6
to be expressed to very high levels in transfected cells, making it possible, at
least in principal, to produce enough D6 to allow for purification of quantities
245
246 Robert J. B. Nibbs et al.
suitable for crystallisation. This is a key step on the path towards generating a
three-dimensional structure of the molecule. Thus, the protocols we outline
have helped establish chemokine scavenging as a novel paradigm in chemokine
biology, and may also ultimately provide unprecedented insight into the struc-
ture of D6 and other chemokine receptors.
1. Introduction
Chemokines exert their biological activity by binding to heptahelical
G-protein–coupled receptors (GPCRs) on the surface of their target cells
which activate intracellular signaling pathways (Rot and von Andrian, 2004).
Currently, 10 signaling receptors for the CC chemokines (CCRs1–10) have
been identified, along with 6 for the CXC chemokines (CXCRs1–6) and single
receptors for the XC and CX3C families (Rot and von Andrian, 2004). How-
ever, there also exists a small but discrete family of ‘‘atypical receptors,’’ currently
consisting of DARC, D6, CCXCKR, and CXCR7 (reviewed in Graham,
2009; Mantovani et al., 2006; Nibbs et al., 2003). These molecules show
structural similarity to signaling chemokine receptors, and bind specific subsets
of chemokines with high affinity. Thus, DARC and D6 bind many inflamma-
tory chemokines; CCX-CKR binds to CCL19, 21, and 25; and CXCR7
interacts with CXCL11 and 12. Importantly, however, when expressed in
heterologous cell lines, these molecules are unable to couple to signal transduc-
tion pathways used by typical signaling chemokine receptors and cannot
stimulate cell migration. In fact, in these model systems, atypical receptors
appear completely unable to transduce signals on chemokine binding. This is
associated with subtle alterations in the canonical DRYLAIV motif found in
the second intracellular loop of the signaling chemokine receptors, and mod-
ifying the DKYLEIV motif of D6 to DKYLAIV confers weak ligand-induced
signaling activity (Nibbs, unpublished). Inability to signal in vitro led to
hypotheses that atypical receptors act as chemokine scavengers and/or trans-
porters designed to regulate chemokine abundance and/or localization, and
thereby indirectly control leukocyte migration driven through signaling che-
mokine receptors.
Roles for D6 and CCX-CKR as chemokine scavengers have now been
supported by in vitro studies of transfected cell lines that have clearly shown these
molecules to have specific biochemical properties that enable them
to progressively scavenge large quantities of extracellular chemokines
(Bonecchi et al., 2004, 2008; Comerford et al., 2006; Fra et al., 2003;
McCulloch et al., 2008; Weber et al., 2004). D6 achieves this by constitutively
trafficking to and from the cell surface via early and recycling endosomes
(Bonecchi et al., 2008; Galliera et al., 2004; McCulloch et al., 2008; Weber
et al., 2004). Thus, when an extracellular chemokine binds surface D6, it is
Structure–Function Dissection of D6 247
treated with PE-labeled chemokine tetramers or S-PE alone, after (1) not
having been transiently transfected with GFP constructs, or (2) having been
transiently transfected with untagged GFP (i.e., GFP, which has no protein
attached to it). These samples are then used at the beginning of the analysis to set
the detection parameters of the FACS machine and compensate correctly to
avoid fluorescence bleed-through between channels. Thus, for example, when
analyzing the impact of dominant-negative (DN) rab5-GFP on D6 function
(Weber et al., 2004), PE-/GFP-, GFP-/PEþ, GFPþ/PE-, and PEþGFPþ
gates are set using (1) untransfected parental HEK293 cells fed PE-labeled
CCL3 tetramers or S-PE alone (no red, no green), (2) untransfected D6-
expressing cells fed PE-labeled CCL3 tetramers (red only), (3) GFP-transfected
parental or D6-expressing HEK293 cells fed S-PE (green only), and (4) GFP-
transfected, D6-expressing cells fed PE-labeled CCL3 tetramers (red and
green). Then data are collected from test samples, that is, D6-expressing
HEK293 cells transiently transfected with DN rab5-GFP constructs incubated
in PE-labeled CCL3 tetramers or S-PE only. On analysis, gates of high and low
rab5-GFP expressors can be set, and the mean PE fluorescence intensity and
the number of PE-positive cells determined and compared with identical gates
set on D6-expressing cells expressing untagged GFP, that is, with no DN rab5
attached. These approaches have revealed that atypical chemokine receptors
use different routes for entry into HEK293 cells: CCX-CKR requires caveo-
lin-1 and enters via caveolae/lipid rafts, while D6 uses clathrin-coated pits to
enter rab5þ early endosomes (Comerford et al., 2006; Weber et al., 2004).
In summary, the development of new methodologies to explore how
chemokines are controlled by chemokine receptors has allowed new para-
digms of chemokine receptor function to be proposed, and is beginning to
provide insight into the molecular mechanisms responsible for these unique
chemokine receptor properties. Importantly, despite the limitations of
in vitro model systems, data generated by these approaches underpin our
interpretation of phenotypes observed in animals lacking atypical chemo-
kine receptors, and form the foundation of our understanding of their
function in vivo.
Bell jar protocol Under sterile conditions, 2.5 l of growth medium (see
above) and 500 ml of D6-expressing L1.2 cells are poured into the bell jar.
These cells have been previously maintained in 5 175–cm2 flasks in 37 C,
5% CO2 incubators, and are cultured to ensure that they have a density of
106 cells/ml on the day of seeding the bell jar. Fifty milliliters of 10%
Pluronic F-68 (Gibco)—an antifoaming reagent—are also added. The bell jar
in then incubated, with constant stirring, in a 37 C cabinet and is attached to
sterile compressed air and CO2 sources running at pressures of 500 ml/min
(for air) and 25 ml/min (for CO2). This provides a final concentration of 5%
CO2. Five days later, 50 ml of sterile 1-M sodium butyrate and a further 2 l of
medium are added. The next day the cells are harvested.
piece of equipment than the bell jars. The bioreactor is loaded with 5 l of
medium and 100 ml of 10% Pluronic F-68. This is allowed to reach 37 C and
pH 7.4 by constant stirring and regulation of the CO2 concentration in the
‘‘air mix’’ being bubbled through the culture. Temperature is maintained by
attaching a controlled heating sheet around the glass bioreactor. Temperature
and pH are constantly monitored and automatically regulated throughout the
culture period. The bioreactor is seeded with 1 l of L1.2 cells (previously
cultured in 10 175–cm2 flasks to 106 cells/ml) and left to grow for 3 days.
On day 4, an aliquot of cells is removed for counting using sterile sampling via
an outflow tube attached to the bioreactor. At this stage, the bioreactor is
perfused by circulating media at low flow rate (3.5 ml/min) through the
bioreactor. This can be achieved in the Applikon bioreactor without losing
cells, and allows the gradual, gentle, and continual replenishment of medium.
This markedly improves cell growth. On day 5, a further aliquot of cells is
taken for counting, perfusion is stopped, the volume of media is increased to
10 l, and 100 ml of 1 M sodium butyrate dissolved in serum-free RPMI is
added to the culture and left for 18 to 24 h. On day 6, the cells are collected
via a ‘‘harvest tube’’ attached to the Bioreactor.
1.2.4. Purification of D6
Cells harvested from the bell jars or the bioreactor are centrifuged at 3500
rpm for 10 min in 500-ml bottles in a GS-3 rotor in a Sorval centrifuge. The
cell pellets are washed twice with PBS and then resuspended in 50 ml of
buffer A (20 mM phosphate buffer, 150 mM NaCl, 10% [v/v] glycerol,
pH 8.0, containing dissolved complete EDTA-free protease inhibitor cock-
tail tablets [Roche]) and stored at –20 C. D6 is then purified by one of the
following two methods (Blackburn et al., 2004).
Solubilization using DDM At all stages, samples are kept on ice and
protease inhibitor tablets added as appropriate. Cells from 5 l of culture
are disrupted using a French press (6555 kPa; 950 lbf/in2), and cell debris
removed by centrifugation for 20 min at 20,000g. Membranes are isolated
by centrifugation at 120,000g for 1 h, and the pellet resuspended in 50 ml of
buffer A containing 0.05% (w/v) CHS (cholesteryl hemisuccinate, Sigma)
and 2% (w/v) DDM (n-dodecyl b-D-maltoside, Glycon). This is stirred
gently for 2 h at 4 C, after which any insoluble debris is removed by
a 30-min spin at 120,000g. Solubilized membranes are then applied to a
5-ml nickel Hitrap column (Amersham Biosciences) connected to an
AKTA Purifier 100 (Amersham Biosciences). A step gradient of imidazole
in buffer A (containing 0.2% DDM and 0.005% CHS) is applied, with
D6 eluting at 300 mM imidazole. Western blotting is used to identify
fractions containing D6, which are then combined. For further purification
and concentration of D6, the imidazole is reduced to 15 mM by dilution
in buffer A (containing 0.2% DDM and 0.005% CHS), the sample is added
Structure–Function Dissection of D6 259
for 10 min and the supernatant mixed with an equal volume of LDS loading
dye. Finally, the beads are stripped with EDTA (200 mM ), and the super-
natant mixed with an equal volume of LDS Loading dye. All samples are
then run on SDS-PAGE, Western blots prepared, and probed for D6 (as
described above using anti-D6) and bioCCL22 (as described above using
HRP-coupled streptavidin). In these experiments, we have found, as
expected, that His10-tagged D6 binds very well to nickel beads, and
importantly, that only in the presence of D6 is bioCCL22 also capable of
binding to the beads. Although we do not yet know whether all purified D6
molecules retain chemokine binding activity, this simple ‘‘pull-down’’ assay
has provided reassuring evidence that D6 can retain chemokine-binding
activity after the rigors of its purification from L1.2 cells.
The unique biochemical properties of D6 have made it possible to
consider its purification in sufficient quantities to generate crystals with
which to determine its three-dimensional structure. Clearly, this is not a
trivial task but by optimizing D6 expression in a cell line that can be
grown to high density in large culture vessels, and by developing methods
to purify and analyze this protein, we are making progress toward this
goal. It is hoped that armed with these methodologies, we will soon be
in a position to provide the first structural information on a crystallized
chemokine receptor.
ACKOWLEDGMENTS
The authors are supported by research grants from the Biotechnology and Biological
Sciences Research Council. R.J.B.N. thanks A. Wilson for providing support services.
REFERENCES
Blackburn, P. E. (2004). Purification and biochemical characterization of the D6 chemokine
receptor. Biochem. J. 379, 263–272.
Bonecchi, R. (2004). Differential recognition and scavenging of native and truncated
macrophage-derived chemokine (macrophage-derived chemokine/CC chemokine
ligand 22) by the D6 decoy receptor. J. Immunol. 172, 4972–4976.
Bonecchi, R. (2008). Regulation of D6 chemokine scavenging activity by ligand- and
Rab11–dependent surface up-regulation. Blood 112, 493–503.
Comerford, I., Milasta, S., Morrow, V., Milligan, G., and Nibbs, R. (2006). The chemokine
receptor CCX-CKR mediates effective scavenging of CCL19 in vitro. Eur. J. Immunol.
36, 1904–1916.
Di Liberto, D. (2008). Role of the chemokine decoy receptor D6 in balancing inflammation,
immune activation, and antimicrobial resistance in Mycobacterium tuberculosis
infection. J. Exp. Med. 205, 2075–2084.
Fra, A. M. (2003). Cutting edge: Scavenging of inflammatory CC chemokines by the
promiscuous putatively silent chemokine receptor D6. J. Immunol. 170, 2279–2282.
Structure–Function Dissection of D6 261
Contents
1. Introduction 264
2. Similarity and Differences in the Crystal Structures of Class-A
GPCRs Solved to Date 265
3. GPCR Modeling Methods 266
3.1. Homology structure modeling methods 266
3.2. Ab Initio modeling methods 267
3.3. Ligand-docking methods 270
4. Computational Methods for Receptor Flexibility and Ligand-
Induced Conformational Changes in GPCRs 271
4.1. Liticon method 273
5. Validation of GPCR–Ligand Models 274
5.1. General strategies for mutagenesis 275
5.2. Receptor binding 278
6. Conclusions 284
References 286
Abstract
G-protein–coupled receptors (GPCRs) form a superfamily of membrane proteins
that play a crucial role in mediating physiological processes as well as patho-
genesis of many critical diseases. They are one of the most successful drug
targets, accounting for more than 30% of prescription drugs on the market
today. Three-dimensional structural information on GPCRs will greatly aid the
drug design process, and great strides are being made in obtaining crystallo-
graphic information on GPCRs. Since this process is both tedious and risky,
a combination of computational methods and biophysical experiments is a
useful approach to rapidly obtain information on a wide variety of GPCRs.
* Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, California, USA
{
Leukocyte Biology Section, National Heart and Lung Institute, Imperial College London, London,
United Kingdom
{
Department of Pharmacology, UC Davis, Davis, California, USA
263
264 Nagarajan Vaidehi et al.
1. Introduction
The superfamily of membrane-bound proteins known as G-protein–
coupled receptors (GPCRs) play a critical role in many physiological pro-
cesses as well as in the pathogenesis of many diseases (Lefkowitz, 2004).
GPCRs form the largest superfamily of membrane proteins that are targeted
by more than 30% of the blockbuster drugs in the market today (Schlyer and
Horuk, 2006). Drug design for the GPCR family can be challenging for
a number of reasons, not least of which is the fact that GPCRs within a
subfamily can have high sequence identity to each other, making it difficult
to obtain subtype-specific drugs. Another important factor in drug design is
that GPCR conformations are highly dynamic and this conformational
flexibility leads to structural and functional diversity in this highly conserved
topology for this class of receptors. Small-molecule ligands of varied efficacy
stabilize different receptor conformations (Kobilka and Deupi, 2007) lead-
ing to functional selectivity of ligands (Mailman, 2007; Urban et al., 2007).
This ligand-induced specific state is important for drug design as well.
Recently great strides have been made in solving the crystal structures
of squid rhodopsin (Murakami and Kouyama, 2008), ligand-free opsin
(Park et al., 2008) with and without the carboxy terminus peptide of the
G-protein–bound receptor (Scheerer et al., 2008), turkey b1-adrenergic
receptor (Warne et al., 2008), human b2-adrenergic receptor (Cherezov
et al., 2007; Rosenbaum et al., 2007), and human adenosine A2A receptor
( Jaakola et al., 2008). These structures are in addition to the earlier crystal
structures of inactive rhodopsin (Li et al., 2004; Okada et al., 2004; Palczewski
et al., 2000). The structures of turkey b1-adrenergic, and human b2-
adrenergic receptor, human adenosine A2A receptor and squid rhodopsin
are in their inactive conformations. The ligand-free opsin and G-protein-
peptide–bound opsin are in partially active to active state of the receptor.
This surge in crystal structures not only facilitates crystallization of other
class A GPCRs, but also opens new doors for understanding the dynamics of
GPCR conformations and drug discovery research on class A GPCRs.
Small-Molecule Binding to GPCRs 265
3.1.1. Materials
Access to any of the software packages listed above. Some of them are free
of cost for academic users.
A computer running Red Hat Linux/Unix, Microsoft Windows 98/
NT/2000/XP, or Apple Mac OSX operating systems; 512 MB RAM
or higher; minimum of 1 GB of free hard-disk space for the output files
generated, especially after optimization methods used for structure
refinement.
Knowledge of scripting languages such as Python and/or Perl, depending
on the software used to run the scripts used for each package.
Small-Molecule Binding to GPCRs 267
3.1.2. Methods
Homology modeling methods in general involve three major steps:
Identification of the template structure to be used for modeling the
GPCR under investigation.
The sequence alignment of the GPCR to be modeled with the sequences
of the template(s). In the case of class A GPCRs, highly conserved residues
in each TM helix are used for alignment to b-adrenergic receptors,
rhodopsin, and A2A receptors.
Methods to optimize the main-chain and side-chain conformations to
refine the structure.
The quality of the homology model depends on the similarity in the
sequence alignment and the resolution of the template structure used.
The modeled structures have the same backbone as the template structure,
and this could be misleading for sequences with low similarity to the
template. For GPCRs, the helical kinks, the tilt and rotational orientation
of the TM helices can thus be misplaced; therefore, homology models have
to be optimized to enable docking of ligands of different sizes and shapes.
Refinement of the homology model is usually performed using a combina-
tion of tools such as molecular dynamics (MD), that is, molecular mechanics
combined with experimental information as constraints. In the absence of
direct structural information, optimization of the model is based on the user’s
intuition and indirect experimental results such as effects of point mutation
on ligand binding. Homology modeling techniques have been successful in
obtaining small-molecule hits from virtual screening of ligands for some cases
(Bissantz et al., 2003; Schyler and Horuk, 2006). These models will become
more robust with the availability of more crystal structures. While these
models are useful in explaining experimental observations, the quality
of the model is dependent on the pre-existing experimental information
on the receptor structure. Hence, these methods have limited use for
GPCRs with very little experimental information.
3.2.1. Materials
A computer running Red Hat Linux/Unix, 512 MB RAM or higher;
minimum of 5 GB of free hard disk space for the output files generated.
MembStruk has a graphical user interface that can be used to execute the
various steps involved in modeling the GPCR structure.
3.2.2. Method
The MembStruk computational method uses the topological arrangement
information of the seven TM helices from rhodopsin or the b-adrenergic
receptor as a starting template for further optimization.
The first step of the MembStruk method is identification of the TM
helices in the sequence, using a hydrophobicity profile generated from a
multiple sequence alignment. The accuracy of the TM length predictions
is plus or minus three residues on each terminus of the helix, and this is
achieved by including sequences with low sequence identity (less than
20%) in generating the multiple sequence alignment.
Canonical a-helices are built and the helices are arranged in an initial
template similar to those of rhodopsin or b-adrenergic receptors. Unlike
homology modeling, this procedure uses only the rough relative orienta-
tions of the helical axes, with no data on atomic positions. This serves as
the starting point for optimization of the helices in the helical bundle.
The translational orientation of the TM helices is optimized by aligning
the residues that represent the position of maximum hydrophobicity in
each of the TM helix to a plane. The initial rotational orientation
positioning of the helices is based on hydrophobic moment and each
helix is rotated so that the net hydrophobic moment of the middle of the
helix (14 residues about the hydrophobic maximum) is pointing toward
the lipid bilayer.
The helical kinks are optimized by performing MD simulations on
individual helices with all atom force field (Mayo et al., 1990) in low
dielectric medium representing the lipid.
Optimization of the rotational orientation of the helices: The optimiza-
tion of the rotational orientation of each helix with respect to the TM
bundle is important in determining which residues are inside the bundle.
The rotational orientation is further optimized by deliberately rotating
each of the seven helices by plus or minus 30 degrees in 5-degree incre-
ments, and reassigning the side-chains conformation using SCWRL
(Canutescu et al., 2003); the potential energy of the rotated helix in the
presence of all other helices is minimized. We start this procedure with
helix3 and then take the best rotation angle for helix3 and further perform
this optimization for helix4, followed by helices 5, 6, 7, 1, and 2. This
allows optimization of the TM bundle based on the sequence of the
Small-Molecule Binding to GPCRs 269
hydrogen bond with N2977.49 and a 2.1-Å hydrogen bond with N521.50.
E1203.39 forms a 2.9-Å hydrogen bond with N2977.49 and a longer
hydrogen bond with H2937.45 on helix7. There is a weak or perhaps a
water-mediated hydrogen bond between N752.45 and W1584.50 and also
between S792.49 and S1193.38. The information gleaned from this model is
valuable for understanding the similarities and differences between chemo-
kine receptors and other class A GPCRs with known structures.
Figure 13.1 The predicted binding site of BX471 in the human CCR1 chemokine
receptor. (A) A top view of the predicted structure of BX 471 in the CCR1 binding
pocket. The residues shown in red (Tyr-113, Tyr-114, and Ile-259) are responsible for
anchoring the ligand in this cavity. The binding site shown is located between trans-
membrane helices 3, 4, 5, 6, and 7. (B) The residues within 5Å of the ligand BX471 are
shown in pink sticks. The residues Y1133.32, Y1143.33, and I2596.55 shown in red
contribute the most to the binding of BX471 in human CCR1. (From Vaidehi, N.,
Schlyer, S., Trabanino, R. J., Floriano, W. B., Abrol, R., Sharma, S., Kochanny, M.,
Koovakat, S., Dunning, L., Liang, M., Fox, J. M., de Mendonca, F. L., Pease, J. E.,
Goddard, W. A., 3rd, and Horuk, R. (2006). Predictions of CCR1 chemokine receptor
structure and BX 471 antagonist binding followed by experimental validation. J. Biol.
Chem. 281, 27613–27620.)
using spin labeling and fluorescent measurements (Farrens et al., 1996; Yao
et al., 2006). The active state model of rhodopsin has been modeled using
annealing MD simulations with the available experimental data as
Small-Molecule Binding to GPCRs 273
4. Electroporate the cells at 330 volts and 975 mF. If the electorporator is
set to view the time constant, this typically reads 16 ms following
transfection.
5. Incubate the cuvette at RT for 20 to 30 min (preferably inside the hood).
6. Break any surface cell clump by gentle pipetting and transfer the contents
of the cuvette into a T-75 tissue-culture flask, containing enough
complete RPMI at a final concentration of 1 106 cells/ml.
7. Incubate the transfected cells for 3 to 5 h at 37 C, 5% CO2 in a tissue-
culture incubator.
8. Add sufficient sodium butyrate solution to a final concentration of
10 mM (1:100 dilution).
9. After 18 to 24 h of culture, examine receptor cell surface expression by
flow cytometry.
Stock Solutions
10% sodium azide solution (1000 stock solution): Dissolve 2 g of
sodium azide in 20 ml of milli-Q grade water. Store at RT.
Flow cytometry staining buffer: To a 500-ml bottle of PBS, add 1.25 g of
BSA and dissolve by gentle stirring to make a 0.25% (w/v) solution.
Readjust the pH to 7.4 if necessary by adding five to eight drops of 1 M
NaOH. Add 500 ml of 10% sodium azide solution.
5 min at 300g at RT, and then decant the media. Typically, 0.5 to
1 106 transfected cells are adequate for staining.
2. Resuspend the cell pellet by gentle pipetting in 100 ml of staining buffer
containing either the primary antibody or isotype control at 10 mg/ml
and incubate for 15 to 30 min.
3. Wash the cells by adding 1 ml of staining buffer and centrifuge at 300g
for 5 min at RT.
4. Decant the supernatant and resuspend the cells in 100 ml of secondary anti-
body diluted in staining buffer (1:20) and incubate cells for 15 to 30 min.
5. Wash the cells as in Step 3 and resuspend cells in 500 ml of staining buffer
containing TO-PRO3 at a dilution of 1:10,000.
6. Read the samples on the flow cytometer following the manufacturer’s
instructions.
We typically acquire 10,000 events and analyze the staining of live cells
by excluding cells in the FL4 channel, which are TO-PRO3þve and
therefore dead.
Notes: The primary and secondary antibodies of choice should be compati-
ble with the detection of the constructs to be analyzed. We routinely make use
of an HA epitope tag, and therefore use an anti-HA primary antibody for
detection. Likewise, we find the goat antimouse secondary antiserum fit
for detection. It may pay to titer the concentrations of both antibodies to get
the best staining.
Method
1. Prepare serial dilutions of the relevant unlabeled chemokines using the
binding buffer. If the appropriate dose–response is unknown, then final
concentrations of 0.03, 0.1, 0.3, 1, 3, 10, 30, and 1000 nM may prove a
useful staring point. From a 10-mM stock of unlabeled chemokine, dilute
2 ml in 80 ml and 0.6 ml in 80 ml to give 2.5 stock concentrations of
100 nM and 30 nM, respectively. These can be diluted 1:10 to produce
80 ml of each subsequent concentration.
2. Prepare 100 ml of a 1 nM stock concentration of 125I-labeled chemokine
in binding buffer. Refer to the data sheet accompanying the product, but
typically this involves a 1:20 to 1:50 dilution of the radiolabel in binding
buffer.
3. Resuspend the transfected L1.2 cells at 1 106 cells in 25 ml in binding
buffer.
4. Into duplicate wells of the plate, pipette 20 ml of the serial dilutions of
chemokines. In addition, pipette 20 ml of binding buffer into two
separate wells. To each well, also add 5 ml of the diluted radiolabeled
chemokine.
5. Into each well, pipette 25 ml of the transfected cells and mix gently by
pipetting up and down a couple of times. Incubate at RT for 60 to
90 min.
6. While this is incubating, prepare tubes for centrifugation by pipetting
100 ml of Nyosil oil in the 0.5-ml tubes. We find a repeating pipette
helpful here.
7. Prepare 10 ml of salt wash by dissolving 0.4 g of NaCl in assay buffer.
8. At the end of the incubation into each well, pipette 50 ml of salt wash and
mix by gentle pipetting. Remove 80 ml of the mixture and layer onto a
separate centrifugation tube. Close the lids of these tubes and pellet
through the oil by centrifugation at 10,000g for 3 min. After centrifuga-
tion, a cell pellet should be visible at the bottom of the tube and the
binding buffer should be visible as a layer on top of the oil.
9. Using the canine nail clippers, cut the bottom of the tube into an
appropriate counting tube from the supernatant and collect both frac-
tions. We use LP3 tubes on a Canberra Packard Cobra 5010 gamma
counter (Canberra Packard, Pangebourne, UK).
The data are routinely presented as the percentage of maximal binding
observed in the presence of buffer alone and can be subjected to curve
fitting and subsequent analysis using appropriate software such as PRISM
(GraphPad Software Inc, San Diego, CA).
Notes: The dose–response curve should be sigmoidal in nature. For sub-
sequent experiments using antagonists to inhibit ligand binding, we recom-
mend using the same fixed concentration of radiolabeled chemokine as used
for competition with unlabeled chemokine, substituting the unlabeled
280 Nagarajan Vaidehi et al.
revealed that all three mutants had very similar affinities for binding of
CCL3 (WT Ki ¼ 31.8 16.1 nM, Y113A3.32 Ki ¼ 22.3 3.1 nM,
Y114A3.33 Ki 15.3 3.3 nM, I259A6.55 Ki ¼ 14.7 4.9 nM ). These
data suggest that the mutations did not alter the structural integrity of
CCR1, and thus further validated the idea that they played a key role in
ligand binding of the antagonist BX471.
Method
1. SPA beads (wheat germ agglutinin–coated beads) were resuspended at a
concentration of 500 mg in 5 ml of binding buffer(50 mM HEPES,
5 mM MgCl2, 1 mM CaCl2, 100 mM NaCl, 5% BSA, pH 7.5). The
beads were stored at 4 C overnight and warmed to RT before use.
2. HEK293 cells expressing recombinant CCR1 were resuspended in
binding buffer at 1 106 cells/ml and 20,000 cells per assay point
were used. Cells were incubated with SPA beads for 30 min at RT
and rotated end over end.
3. Prepare serial dilutions of the CCR1 antagonist, BX 471 using the
binding buffer. From a 100 mM stock of unlabeled BX 471, dilute 2 ml
in 80 ml and 0.6 ml in 80 ml to give 2.5 stock concentrations of 1000 nM
and 300 nM, respectively. These can be diluted 1:10 to produce 80 ml of
each subsequent concentration.
4. Prepare 100 ml of a 1-nM stock concentration of 125I-labeled BX 691 in
binding buffer. This involves a 1:20 to 1:50 dilution of the radiolabel
in the binding buffer.
5. Into duplicate wells of the plate pipette 5 ml of the serial dilutions of the
BX 471. To each well, also add 5 ml of the diluted radiolabeled BX 691.
6. 6. Into each well, pipette 40 ml of the transfected cells/SPA bead mixture
and mix gently by pipetting up and down a couple of times. The plates
were sealed with a clear sealer and incubated for 60 to 90 min at RT on
an orbital shaker.
7. The receptor bound 125I-BX 691 excited the scintillant embedded in the
beads and triggered a signal that could be detected by scintillation
counter (Wallac Microbeta). Nonspecific binding was determined in
the presence of 100 nM of unlabeled ligand.
8. The data are routinely presented as the percentage of maximal binding
observed in the presence of buffer alone and can be subjected to curve
fitting and subsequent analysis using appropriate software such as
PRISM (GraphPad Software Inc, San Diego, CA).
282 Nagarajan Vaidehi et al.
Stock solutions
Blocking buffer, RPMI 1% BSA
Dissolve 0.1g BSA (bovine serum albumin) in 10 ml of simple RPMI
(A volume of 10 ml is enough to block one plate.)
Assay buffer, RPMI 0.1% BSA
Method
1. Into each well of the plate that will be used, pipette 30 ml of blocking
buffer. Incubate for 30 min at RT. This step prevents excessive
adhesion of chemokines to the plastic.
Small-Molecule Binding to GPCRs 283
A B
2500 3000
2000 2500
2000
1500
1500
CCL3 CCL3
1000 CCL5
CCL5 1000
CCL7 CCL7
125I-BX
125I-BX
500 BX 471
500 BX 471
BX 691 BX 691
0 0
−12 −11 −10 −9 −8 −7 −6 −12 −11 −10 −9 −8 −7 −6
Log [competitors], M Log [competitors], M
Figure 13.2 Inhibition of 125I-BX 691 binding to human CCR1 by unlabeled antagonists
and agonists on HEK293 cells stably expressing CCR1 (A) and human monocytes (B). Cells
were incubated for 60 min at RT with 125I-BX 691 in the presence of increasing concentra-
tions of compounds or chemokines. The bound 125I-BX 691 was determined using SPA
technology. Nonspecific binding was defined as the binding in the presence of 1 mM
unlabeled BX 691. Data are shown as total binding standard error from three independent
experiments. (From Vaidehi, N., Schlyer, S., Trabanino, R. J., Floriano, W. B., Abrol, R.,
Sharma, S., Kochanny, M., Koovakat, S., Dunning, L., Liang, M., Fox, J. M.,
de Mendonca, F. L., Pease, J. E., Goddard, W. A., 3rd, and Horuk, R. (2006). Predictions
of CCR1 chemokine receptor structure and BX 471 antagonist binding followed by
experimental validation. J. Biol. Chem. 281, 27613–27620.)
6. Conclusions
We have described state-of-the-art methods for small-molecule binding
in GPCRs, with an example of BX471 binding to the chemokine receptor
CCR1. Through this description of results on CCR1, we have shown
that a combination of computational models and site-directed mutagenesis
Small-Molecule Binding to GPCRs 285
120
100
80
% Migration
WT
60 Y113A
Y113F
40 Y114A
I259A
L260A
20 Y291A
0
0.001 0.01 0.1 1 10 100 1000 104
Log BX 471 (nM)
REFERENCES
Akbar, N., Sitkoff, D., and Krystek, S. (2006). A comparative study of available software for
high-accuracy homology modeling: From sequence alignments to structural models.
Protein Sci. 15, 808–824.
Ashton, M., Charlton, M. H., Schwarz, M. K., Thomas, R. J., and Whittaker, M. (2004).
The selection and design of GPCR ligands: From concept to the clinic. Comb. Chem.
High. Throughput Screen 7, 441–452.
Ballesteros, J., and Weinstein, H. (1995). Integrated methods for modeling G-protein
coupled receptors. Methods Neurosci. 25, 366–428.
Becker, O. M., Marantz, Y., Shacham, S., Inbal, B., Heifetz, A., Kalid, O., Bar-Haim, S.,
Warshaviak, D., Fichman, M., and Noiman, S. (2004). G. protein–coupled receptors:
In silico drug discovery in 3D. Proc. Natl. Acad. Sci. USA 101, 11304–11309.
Becker, O. M., Shacham, S., Marantz, Y., and Noiman, S. (2003). Modeling the 3D
structure of GPCRs: Advances and application to drug discovery. Curr. Opin. Drug
Discov. Dev. 6, 353–361.
Becker, O. M., Dhanoa, D. S., Marantz, Y., Chen, D., Shacham, S., Cheruku, S., Heifetz, A.,
Mohanty, P., Fichman, M., Sharadendu, A., Nudelman, R., Kauffman, M., and
Noiman, S. (2006). An integrated in silico 3D model-driven discovery of a novel, potent,
and selective amidosulfonamide 5-HT1A agonist (PRX-00023) for the treatment of
anxiety and depression. J. Med. Chem. 49, 3116–3135.
Bhattacharya, S., Hall, S. E., and Vaidehi, N. (2008a). Agonist-induced conformational
changes in bovine rhodopsin: Insight into activation of G-protein–coupled receptors.
J. Mol. Biol. 382, 539–555.
Bhattacharya, S., Hall, S. E., Li, H., and Vaidehi, N. (2008b). Ligand-stabilized conforma-
tional states of human beta(2) adrenergic receptor: Insight into G-protein–coupled
receptor activation. Biophys. J. 94, 2027–2042.
Bissantz, C., Bernard, P., Hibert, M., and Rognan, D. (2003). Protein-based virtual screening
of chemical databases. II. Are homology models of G-protein coupled receptors suitable
targets? Proteins 50, 5–25.
Canutescu, A. A., Shelenkov, A. A., and Dunbrack, R. L., Jr. (2003). A graph theory
algorithm for protein side-chain prediction. Protein Sci. 12, 2001–2014.
Chamberlain, A. K., and Bowie, J. U. (2004). Analysis of side-chain rotamers in transmem-
brane proteins. Biophys. J. 87, 3460–3469.
Cherezov, V., Rosenbaum, D. M., Hanson, M. A., Rasmussen, S. G., Thian, F. S.,
Kobilka, T. S., Choi, H. J., Kuhn, P., Weis, W. I., Kobilka, B. K., and Stevens, R. C.
(2007). High-resolution crystal structure of an engineered human beta2-adrenergic
G protein–coupled receptor. Science 318, 1258–1265.
Crozier, P. S., Stevens, M. J., and Woolf, T. B. (2007). How a small change in retinal leads to
G-protein activation: Initial events suggested by molecular dynamics calculations. Proteins
66, 559–574.
Eswar, N., Eramian, D., Webb, B., Shen, M. Y., and Sali, A. (2008). Protein structure
modeling with MODELLER. Methods Mol. Biol. 426, 145–159.
Farrens, D. L., Altenbach, C., Yang, K., Hubbell, W. L., and Khorana, H. G. (1996).
Requirement of rigid-body motion of transmembrane helices for light activation of
rhodopsin. Science 274, 768–770.
Freddolino, P., Kalani, M. Y., Vaidehi, N., Floriano, W., Hall, S. E., Trabanino, R.,
Kam, V. W. T., and Goddard, W. A., III. (2004). Predicted 3D structure for the
human b2 adrenergic receptor and its binding site for agonists and antagonists. Proc.
Natl. Acad. Sci. USA 101, 2736–2741.
Ghosh, A., Rapp, C. S., and Friesner, R. A. (1998). Generalized Born model based on a
surface integral formulation. J. Phys. Chem. B 102, 10983–10990.
Small-Molecule Binding to GPCRs 287
Gouldson, P. R., Kidley, N. J., Bywater, R. P., Psaroudakis, G., Brooks, H. D., Diaz, C.,
Shire, D., and Reynolds, C. A. (2004). Toward the active conformations of rhodopsin
and the b2-adrenergic receptor. Proteins 56, 67–84.
Hall, S. E., Mao, A., Nicolaidou, V., Finelli, M., Wise, E. L., Nedjai, B., Kanjanapangka, J.,
Harirchian, P., Chen, D., Selchau, V., Ribeiro, S., Schyler, S., et al. (2009). Elucidation
of binding sites of dual antagonists in the human chemokine receptors CCR2 and
CCR5, Mol. Pharm. (in press).
Hiramoto, T., Nonaka, Y., Inoue, K., Yamamoto, T., Omatsu-Kanbe, M., Matsuura, H.,
Gohda, K., and Fujita, N. (2004). Identification of endogenous surrogate ligands for
human P2Y receptors through an in silico search. J. Pharmacol. Sci. 95, 81–93.
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989). Site-directed
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59.
Isin, B., Schulten, K., Tajkhorshid, E., and Bahar, I. (2008). Mechanism of signal pro-
pagation upon retinal isomerization: Insights from molecular dynamics simulations of
rhodpsin restrained by normal modes. Biophys. J. 95, 789–803.
Jaakola, V. P., Griffith, M. T., Hanson, M. A., Cherezov, V., Chien, E. Y., Lane, J. R.,
Ijzerman, A. P., and Stevens, R. C. (2008). The 2.6-angstrom crystal structure of a
human A2A adenosine receptor bound to an antagonist. Science 322, 1211–1217.
Kobilka, B. K., and Deupi, X. (2007). Conformational complexity of G-protein–coupled
receptors. Trends Pharmacol. Sci. 28, 397–406.
Kristiansen, K. (2004). Molecular mechanisms of ligand binding, signaling, and regulation
within the superfamily of G-protein–coupled receptors: Molecular modeling and
mutagenesis approaches to receptor structure and function. Pharm. Ther. 103, 21–80.
Lefkowitz, R. J. (2004). Historical review: A brief history and personal retrospective of
seven-transmembrane receptors. Trends Pharmacol. Sci. 25, 413–422.
Li, J., Edwards, P. C., Burghammer, M., Villa, C., and Schertler, G. F. (2004). Structure of
bovine rhodopsin in a trigonal crystal form. J. Mol. Biol. 343, 1409–1438.
McDonald, I. K., and Thornton, J. M. (1994). Satisfying hydrogen bonding potential in
proteins. J. Mol. Biol. 238, 777–793.
Mailman, R. B. (2007). GPCR functional selectivity has therapeutic impact. Trends Pharmacol.
Sci. 28, 390–396.
Martinez-Mayorga, K., Pitman, M. C., Grossfield, A., Feller, S. E., and Brown, M. F.
(2006). Retinal counterion switch mechanism in vision evaluated by molecular simula-
tions. J. Am. Chem. Soc. 128, 16502–16503.
Mayo, S. L., Olafson, B. D., and Goddard, W. A., III. (1990). DREIDING—a generic force
field for molecular simulations. J. Phys. Chem. 94, 8897–8909.
Murakami, M., and Kouyama, T. (2008). Crystal structure of squid rhodopsin. Nature 453,
363–367.
Niv, M. Y., Skrabanek, L., Filizola, M., and Weinstein, H. (2006). Modeling activated states
of GPCRs: The rhodopsin template. J. Comput. Aided Mol. Des. 20, 437–448.
Okada, T., Sugihara, M., Bondar, A. N., Elstner, M., Entel, P., and Buss, V. (2004).
The retinal conformation and its environment in rhodopsin in light of a new 2.2
A crystal structure. J. Mol. Biol. 342, 571–583.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le, T. I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M.
(2000). Crystal structure of rhodopsin: A G protein–coupled receptor. Science 289,
739–745.
Park, J. H., Scheerer, P., Hofmann, K. P., Choe, H. W., and Ernst, O. P. (2008). Crystal
structure of the ligand-free G-protein–coupled receptor opsin. Nature 454, 183–187.
Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., Chipot, C.,
Skeel, C., Kalé, L., and Schulten, K. (2005). Scalable molecular dynamics with NAMD.
J. Comput. Chem. 26, 1781–1802.
288 Nagarajan Vaidehi et al.
Rockey, W. M., and Elcock, A. H. (2006). Structure selection for protein kinase docking and
virtual screening: Homology models or crystal structures? Curr. Protein Pept. Sci. 7, 437–457.
Scheerer, P., Park, J. H., Hildebrand, P. W., Kim, Y. J., Krauss, N., Choe, H. W.,
Hofmann, K. P., and Ernst, O. P. (2008). Crystal structure of opsin in its G-protein–
interacting conformation. Nature 455, 497–502.
Schlyer, S., and Horuk, R. (2006). I want a new drug: G-protein–coupled receptors in drug
development. Drug Discov. Today. 11, 481–493.
Shacham, S., Marantz, Y., Bar-Haim, S., Kalid, O., Warshaviak, D., Avisar, N., Inbal, B.,
Heifetz, A., Fichman, M., Topf, M., Naor, Z., Noiman, S., and Becker, O. M. (2004).
PREDICT modeling and in-silico screening for G-protein coupled receptors. Proteins 57,
51–86.
Sousa, S. F., Fernandes, P. A., and Ramos, M. J. (2006). Protein-ligand docking: Current
status and future challenges. Proteins 65, 15–26.
Trabanino, R., Hall, S. E., Vaidehi, N., Floriano, W., and Goddard, W. A. (2004). First
principles prediction of the structure and function of G protein–coupled receptors:
Validation for bovine rhodopsin. Biophys. J. 86, 1904–1921.
Urban, J. D., Clarke, W. P., von Zastrow, M., Nichols, D. E., Kobilka, B., Weinstein, H.,
Javitch, J. A., Roth, B. L., Christopoulos, A., Sexton, P. M., Miller, K. J., Spedding, M.,
and Mailman, R. B. (2007). Functional selectivity and classical concepts of quantitative
pharmacology. J. Pharmacol. Exp. Ther. 320, 1–13.
Vaidehi, N., Schlyer, S., Trabanino, R. J., Floriano, W. B., Abrol, R., Sharma, S.,
Kochanny, M., Koovakat, S., Dunning, L., Liang, M., Fox, J. M., de Mendonca, F. L.,
et al. (2006). Predictions of CCR1 chemokine receptor structure and BX 471 antagonist
binding followed by experimental validation. J. Biol. Chem. 281, 27613–27620.
Vaidehi, N., Floriano, W. B., Trabanino, R., Hall, S., Freddolino, P., Choi, E. J.,
Zamanakos, G., and Goddard, W. A., III. (2002). Structure and function prediction for
G-protein coupled receptors. Proc. Natl. Acad. Sci. USA 99, 12622–12627.
Vogel, R., Mahalingam, M., Lüdeke, S., Huber, T., Siebert, F., and Sakmar, T. P. (2008).
Functional role of the ‘‘ionic lock’’—an interhelical hydrogen-bond network in family
A heptahelical receptors. J. Mol. Biol. 380, 648–655.
Vriend, G. (1990). A molecular modeling and drug design program. J. Mol. Graph 8, 52–56.
Warne, T., Serrano-Vega, M. J., Baker, J. G., Moukhametzianov, R., Edwards, P. C.,
Henderson, R., Leslie, A. G., Tate, C. G., and Schertler, G. F. (2008). Structure of a
beta1-adrenergic G-protein–coupled receptor. Nature 454, 486–491.
Wojciechowski, M., and Skolnick, J. (2002). Docking of small ligands to low-resolution and
theoretically predicted receptor structures. J. Comput. Chem. 23, 189–197.
Yao, X., Parnot, C., Deupi, X., Ratnal, V. R. P., Swaminath, G., Farrens, D., and
Kobilka, B. K. (2006). Coupling ligand structures to specific conformational switches
in the b2 adrenoreceptor. Nat. Chem. Biol. 2, 417–422.
C H A P T E R F O U R T E E N
Elucidation of Chemerin
and Chemokine-Like Receptor-1
Function in Adipocytes by
Adenoviral-Mediated shRNA
Knockdown of Gene Expression
Kerry B. Goralski*,† and Christopher J. Sinal†
Contents
1. Introduction 290
2. The 3T3-L1 Cell Model for Adipogenesis and Adipocyte Metabolism 292
3. RNA Interference 293
3.1. Design of adenoviral shRNA vectors for our study 294
3.2. Titration of adenoviral shRNA particles 294
4. Methods for Adenoviral shRNA Knockdown of
Chemerin and CMKLR1 in 3T3-L1 Cells 297
4.1. Reagents and materials required for adenoviral
transduction of 3T3-L1 cells 297
4.2. Testing the efficacy of CE- and CR-shRNA adenoviral vectors 298
4.3. Maintenance and preparation of 3T3-L1 cells 299
4.4. Predifferentiation knock-down of chemerin and CMKLR1 300
4.5. RNA isolation and quantification of chemerin
and CMKLR1 knock-down by quantitative PCR 302
4.6. Postdifferentiation knock-down of chemerin and CMKLR1 304
4.7. Effect of chemerin and CMKLR1 knock-down
on adipogenesis (oil red O staining) 306
4.8. Effect of chemerin and CMKLR1 knock-down
on adipocyte metabolism 307
5. Concluding Remarks 309
Acknowledgments 309
References 309
* College of Pharmacy, Faculty of Health Professions Dalhousie University, Halifax, Nova Scotia, Canada
{
Department of Pharmacology, Faculty of Medicine, Dalhousie University, Halifax, Nova Scotia, Canada
289
290 Kerry B. Goralski and Christopher J. Sinal
Abstract
White adipose tissue has traditionally been regarded as an organ of energy
storage and mobilization. However, it is now recognized that this tissue is also
an active endocrine organ that secretes a variety of signaling molecules termed
adipokines. These adipokines have diverse autocrine-, paracrine-, and
endocrine-like actions that impact a variety of biological and physiological
processes, including adipocyte differentiation, local and systemic inflammation,
overall energy balance, blood pressure, and glucose and lipid metabolism.
Given the regulatory influence on these critical functions, dysregulation of
adipokine secretion is believed to be a major contributor to obesity-related
disorders such as hypertension, diabetes, and cardiovascular disease.
Chemerin is a small, secreted protein that has been reported to serve as a
chemoattractant for cells of the immune system such as macrophages and
immature dendritic cells that express the cognate receptor chemokine-like
receptor-1 (CMKLR1). Using adenoviral- delivered, short hairpin RNAs (shRNAs)
to suppress chemerin or CMKLR1 expression, we have demonstrated a
novel role for chemerin/CMKLR1 signaling as a positive regulator of adipocyte
differentiation and metabolic function in the 3T3-L1 model of adipogenesis.
This experimental approach provides an efficient and powerful means to char-
acterize the functional roles of genes known to be involved in adipocyte forma-
tion and metabolism as well as to identify novel roles for genes in this model
and/or other cells.
1. Introduction
Accumulating evidence indicates that adipose tissue, in addition to
serving an important metabolic role, is an active endocrine organ that
secretes a variety of chemical signals collectively termed adipokines. These
include proinflammatory cytokines and cytokine-related proteins, comple-
ment and complement-related proteins, fibrinolytic proteins, proteins of the
renin-angiotensin system, and a variety of other biologically active proteins
with hormone-like actions (Fantuzzi, 2005; Goralski and Sinal, 2007).
Many adipokines have local autocrine or paracrine actions, which affect
adiposity, adipocyte metabolism and inflammatory responses in adipose
tissue (Goralski and Sinal, 2007; Goralski et al., 2007; Wang et al., 2005;
Warne, 2003; Xu et al., 2003). Adipokines also have important roles in the
regulation of systemic lipid and glucose metabolism through endocrine/
systemic actions in the brain, liver, and muscle (Friedman and Halaas, 1998;
Havel, 2004; Yamauchi et al., 2002). The serum levels of many adipokines
are profoundly affected by degree of adiposity (Dandona et al., 1998;
Folsom et al., 1993; Itoh et al., 2002; Primrose et al., 1992; Samad et al.,
Chemerin and CMKLR1 Regulation of Adipocyte Biology 291
1997, 1998; Yudkin et al., 1999; Zhang et al., 1996; Ziccardi et al., 2002),
indicating that the synthesis and secretion of these signaling molecules is
dynamic and modifiable. This has led to the hypothesis that altered secretion
of adipokines, and in particular those that influence systemic insulin
sensitivity and/or inflammation, underlie the increased risk for diseases
such as type 2 diabetes and cardiovascular disease in the obese
(Hotamisligil et al., 1993; Wellen and Hotamisligil, 2005; Whitehead
et al., 2006; Xu et al., 2003).
Chemerin, also known as tazarotene induced gene 2 (TIG2) and retinoic
acid receptor responder 2 (RARRES2), was originally reported as a gene of
unknown function that was induced in skin cells by the synthetic retinoid
tazarotene (Nagpal et al., 1997). Subsequent studies revealed that chemerin
is an endogenous ligand of the G-protein–coupled receptor, chemokine-
like receptor-1 (CMKLR1) (also known variously as ChemerinR,
ChemR23, and GPCR-DEZ in the scientific literature) (Meder et al.,
2003; Methner et al., 1997; Samson et al., 1998; Wittamer et al., 2003).
Chemerin is secreted as an 18-kDa inactive pro-protein that undergoes
extracellular protease cleavage to generate the active 16-kDa protein
(Meder et al., 2003; Wittamer et al., 2003; Zabel et al., 2006). The first
biological function ascribed to chemerin was that of a proinflammatory
chemokine that exerts a chemoattractant effect on cells of the immune
system, such as macrophages and dendritic cells, that express CMKLR1
(Moretta et al., 2008; Parolini et al., 2007; Vermi et al., 2005; Wittamer
et al., 2003; Zabel et al., 2006). Activation of CMKLR1 by chemerin
decreases intracellular cAMP, increases intracellular calcium, and stimulates
phosphorylation of extracellular signal-regulated kinase-1 and -2 (ERK1/2)
by signaling through a pertussis toxin–sensitive, Gi-coupled heterotrimeric
G-protein (Wittamer et al., 2003). Presumably, these intracellular changes
contribute to the chemotactic response of target cells; however, very little is
presently known regarding the details of the intracellular signaling pathways
involved in chemerin/CMKLR1 signaling.
Our laboratory was the first to identify chemerin as a novel adipokine
and to implicate chemerin/CMKLR1 signaling as determinant of adipocyte
differentiation from human and murine precursor cells (Goralski et al.,
2007). Maturation of these precursor cells into lipid-laden adipocytes leads
to a dramatic increase in chemerin and CMKLR1 mRNA expression
and secretion of greater amounts of bioactive chemerin. Both human and
murine white adipose tissue depots express very high levels of chemerin and
CMKLR1 suggesting that adipocytes are both a source and target for
chemerin signaling. Consistent with this, exogenous chemerin administra-
tion stimulates ERK1/2 phosphorylation in both human and mouse
adipocytes (Goralski et al., 2007). Functionally, chemerin/CMKLR1 sig-
naling is critical for adipogenesis, as RNA interference (RNAi)–mediated
suppression of chemerin or CMKLR1 expression in murine 3T3-L1
292 Kerry B. Goralski and Christopher J. Sinal
Figure 14.1 The 3T3-L1 cell model of adipogenesis. Summary of key steps involved in
3T3-L1adipogenesis (A). Details of adipogenic pathways are described in the text. Matu-
ration of fat cells after treatment of confluent preadipocytes with the differentiation
cocktail is demonstrated by a progressive increase in intracellular oil red O staining at
100 magnification (B). C/EBP, CCAAT/enhancer binding protein; Dex, dexametha-
sone; Ibmx, isobutylmethylxanthine; Ins, insulin; PPAR, peroxisome proliferator
activator receptor; SREBP, sterol regulatory element binding protein.
3. RNA Interference
In recent years, RNA interference (RNAi) has become a widely
employed method for the study of mammalian gene function in cellular
and in vivo models. For instance, in preadipocytes or adipocytes, RNAi can
be used to reduce (knock down) the expression of individual genes in a
highly selective fashion and thereby allow functional evaluation of contri-
butions to important cellular processes such as proliferation, differentiation,
or metabolism. The RNAi method harnesses a highly conserved cellular
process, in which small double-stranded RNA molecules bind to and
promote degradation of complementary mRNA targets and thereby, pre-
vent the translation of the mRNA sequence into a functional enzyme or
protein. The RNAi pathway can be induced in mammalian cells by direct
294 Kerry B. Goralski and Christopher J. Sinal
tissue culture lysates to induce cytopathic effects (CPE) (e.g., cell lysis,
plaque formation) in replication-competent HEK-293A cells. The cells
are aliquoted in a 96-well tissue culture plate (1 104 cells per well in
100 ml of DMEM containing 2% FBS) and allowed to adhere overnight.
While the titer of adenoviral lysates is somewhat variable, a total of eight
serial dilutions ranging from 10–3 to 10–10 and prepared in DMEM/2% FBS
are generally appropriate. A volume of 100 ml is added to the existing media
of individual wells of the plate containing the HEK-293A cells. For each
dilution, 10 replicates are prepared (8 dilutions 10 wells ¼ 80 wells total).
An equivalent volume of DMEM/2% FBS (no adenovirus) should be
added to the remaining wells (16 total), which will serve as negative
controls. When adding the diluted virus, always start with the blank
media, and then proceed in order from highest to lowest viral dilution.
After 10 days at 37 C in a CO2 incubator, the plate is examined using an
inverted microscope and evidence of any CPE is recorded for each well. For
each dilution, the ratio of positive to negative wells is recorded. The assay is
296 Kerry B. Goralski and Christopher J. Sinal
generally considered valid if all of the wells treated with the lowest dilution
(10–3) and none of the wells treated with the highest dilution (10–10) exhibit
CPE. The titer (T) is calculated using the Karber statistical method (Karber,
1931) where for 100 ml of dilution:
T ¼ 101 þ dðS0:5Þ
In this equation, d ¼ log10 of the increments in the dilution series (e.g.,
¼ log10(10) ¼ 1 for the 10-fold dilution increment in this example) and S ¼
the sum of ratios (always starting from a 10–1 dilution). For example, if all
wells (10/10) treated with dilutions 10–3 – 10–6 exhibit CPE, 8/10 and 2/10
wells treated with dilutions 10–7 and 10–8, respectively, exhibit CPE and
no wells (0/10) treated with dilutions 10–9 – 10–10 exhibit CPE, then
T ¼ 108:50:7 PFU=ml
¼ 107:8 PFU=ml
¼ 6:31 107 PFU=ml
Chemerin and CMKLR1 Regulation of Adipocyte Biology 297
A
1-day post 2-day post Mature
Preadipocytes confluent confluent Immature adipocytes adipocytes
B
2-day post
Preadipocytes confluent Immature adipocytes Mature adipocytes
For the RNA elution step, add 30 ml of RNase free water to the spin
column and centrifuge at 8000g for 1 min. Repeat the elution step with an
additional 30 ml of RNase free water. The total volume of the RNA elution
is 60 ml. To quantify the RNA, add 10 ml of RNA to 90 ml of sterile ddH2O
in a 600 ml microfuge tube, vortex, centrifuge briefly, and transfer along
with a 100-ml ddH2O blank to a UV-transparent 96-well plate. Measure the
absorbance at 260 nM and 280 nM using a plate-reader spectrophotometer
with the path-length correction (to 1 cm) feature activated. Calculate the
RNA concentration by multiplying path length corrected absorbance at
260 nm by 40 mg/ml (an absorbance of 1 ¼ 40 mg/ml RNA) and the
dilution factor. The 260/280 ratio is normally between 1.8 and 2.0 for high-
quality nucleic acid. Typical RNA yields are between about 8 to 15 mg for
adipocytes and about 3 to 5 mg for preadipocytes. Total RNA (0.5 to 1.0 mg)
from cells is reverse transcribed using Stratascript Reverse Transcriptase, and
1 ml of the cDNA product is amplified by quantitative PCR using 125-nM
304 Kerry B. Goralski and Christopher J. Sinal
A B
1.25 1.25
Relative CMKLR1
Relative chemerin
1.00 1.00
mRNA
mRNA
0.75 0.75
0.50 0.50
0.25 0.25
0.00 * 0.00 *
D
EH
LZ 00
00
C 100
00
D
EH
LZ 00
00
C 100
0
00
1
10
10
U
1
10
LZ
R
V
LZ
E
E1
R
C
C
pAD shRNA MOI pAD shRNA MOI
(% control)
#
300
200
100
0
00
ol
00
00
tr
10
10
E1
on
LZ
R
C
C
Treatment
adipocyte differentiation media for 3 days. On the morning of the 3rd day
after inducing differentiation, remove the adipocyte differentiation media
and replace with the adipocyte maintenance media for a period of 24 h. The
immature adipocytes (Day 4 postdifferentiation) are then transduced with the
crude adenoviral lysates exactly as described for the 3T3-L1 preadipocytes.
306 Kerry B. Goralski and Christopher J. Sinal
aspirate the oil red O and add 500 ml of PBS; this will prevent the cells from
drying and oil red O from leaching out of the cells. If microscopy is not
required, aspirate oil red O and perform two quick washes in 70% ethanol
(1 ml/well), invert plate over paper towels, and dry for 30 min. Scan the
plate with a standard flatbed document scanner at 300 to 600 DPI resolu-
tion. In the sample plate shown in Fig. 14.4C, preadipocytes transduced
with 1000- and 5000-MOI doses of CE-shRNA or CR-shRNA demon-
strated substantially reduced oil red O staining of the cells compared to
the respective LZ-shRNA-transduced cells and the vehicle-treated and
untreated control cells. The reduction in oil red O staining is consistent
with inhibition of adipogenesis by chemerin and CMKLR1 knock-down as
previously reported by our group (Goralski et al., 2007).
Following image acquisition, the cellular incorporation of oil red O may
be quantified using the following procedure. Add 200 ml of isopropanol to
each well. Shake at RT for 3 min to dissolve the oil red O. Transfer 100 ml
of each sample and 100 ml of isopropanol (blank) into separate wells on
96-well plate. Measure absorbance using a spectrophotometer at 520 nm.
This should be done very quickly as the isopropanol will evaporate.
Inc, Waltham, MA). The described assay procedure is for 12-well plates.
Two 12-well plates are required for the experiment, one for analysis of basal
308 Kerry B. Goralski and Christopher J. Sinal
5. Concluding Remarks
Cell culture models of adipogenesis, such as the 3T3-L1 model, have
been instrumental in unraveling the complex and well-orchestrated cascade
of cell signaling events involved in adipocyte differentiation and metabolic
function. These findings have increased our knowledge of basic develop-
mental biology and provided important mechanistic insight into the dys-
function of adipocytes that commonly occurs with obesity. With the
increasing impact of obesity and prevalent comorbidities such as type
2 diabetes and cardiovascular disease on the global population, there is an
urgent need for new information from adipocyte models. The techniques
described in this chapter have proven extremely effective in identifying
chemerin as a novel adipokine that, in conjunction with CMKLR1, is a
positive regulator of adipogenesis. We have also successfully used this
approach to study the role of chemerin/CMKLR1 signaling in adipogenesis
of other models including both human and murine primary mesenchymal
stem cells. Beyond this, these techniques have a more general adaptability to
the dissection of gene function in a variety of experimental models relevant
to various aspects of mammalian cell biology.
ACKNOWLEDGMENTS
This work was supported by operating grants from the Canadian Institutes of Health
Research (C.J.S. and K.B.G), the Nova Scotia Health Research Foundation (K.B.G.),
the Dalhousie Pharmacy Endowment (K.B.G.), and Dalhousie Medical Research
Foundation (K.B.G.).
REFERENCES
Anthonsen, M. W., Ronnstrand, L., Wernstedt, C., Degerman, E., and Holm, C. (1998).
Identification of novel phosphorylation sites in hormone-sensitive lipase that are phos-
phorylated in response to isoproterenol and govern activation properties in vitro. J. Biol.
Chem. 273, 215–221.
Bozaoglu, K., Bolton, K., McMillan, J., Zimmet, P., Jowett, J., Collier, G., Walder, K., and
Segal, D. (2007). Chemerin is a novel adipokine associated with obesity and metabolic
syndrome. Endocrinology 148, 4687–4694.
Carmen, G. Y., and Victor, S. M. (2006). Signalling mechanisms regulating lipolysis. Cell.
Signal 18, 401–408.
Dandona, P., Weinstock, R., Thusu, K., Abdel-Rahman, E., Aljada, A., and Wadden, T.
(1998). Tumor necrosis factor-alpha in sera of obese patients: Fall with weight loss.
J. Clin. Endocrinol. Metab. 83, 2907–2910.
Darling, A. J., Boose, J. A., and Spaltro, J. (1998). Virus assay methods: Accuracy and
validation. Biologicals 26, 105–110.
310 Kerry B. Goralski and Christopher J. Sinal
Fajas, L. (2003). Adipogenesis: A cross-talk between cell proliferation and cell differentiation.
Ann. Med. 35, 79–85.
Fantuzzi, G. (2005). Adipose tissue, adipokines, and inflammation. J. Allergy Clin. Immunol.
115, 911–919; quiz 920.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998).
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature 391, 806–811.
Folsom, A. R., Qamhieh, H. T., Wing, R. R., Jeffery, R. W., Stinson, V. L., Kuller, L. H.,
and Wu, K. K. (1993). Impact of weight loss on plasminogen activator inhibitor (PAI-1),
factor VII, and other hemostatic factors in moderately overweight adults. Arterioscler
Thromb 13, 162–169.
Friedman, J. M., and Halaas, J. L. (1998). Leptin and the regulation of body weight in
mammals. Nature 395, 763–770.
Garton, A. J., Campbell, D. G., Cohen, P., and Yeaman, S. J. (1988). Primary structure of
the site on bovine hormone-sensitive lipase phosphorylated by cyclic AMP-dependent
protein kinase. FEBS Lett. 229, 68–72.
Goralski, K. B., Acott, P. D., Fraser, A. D., Worth, D., and Sinal, C. J. (2006). Brain
cyclosporin a levels are determined by ontogenic regulation of mdr1a expression. Drug
Metab. Dispos. 34, 288–295.
Goralski, K. B., McCarthy, T. C., Hanniman, E. A., Zabel, B. A., Butcher, E. C.,
Parlee, S. D., Muruganandan, S., and Sinal, C. J. (2007). Chemerin, a novel adipokine
that regulates adipogenesis and adipocyte metabolism. J. Biol. Chem. 282, 28175–28188.
Goralski, K. B., and Sinal, C. J. (2007). Type 2 diabetes and cardiovascular disease: Getting to
the fat of the matter. Can. J. Physiol. Pharmacol. 85, 113–132.
Havel, P. J. (2004). Update on adipocyte hormones: Regulation of energy balance and
carbohydrate/lipid metabolism. Diabetes 53(Suppl 1), S143–S151.
Hotamisligil, G. S., Shargill, N. S., and Spiegelman, B. M. (1993). Adipose expression of
tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 259,
87–91.
Itoh, K., Imai, K., Masuda, T., Abe, S., Tanaka, M., Koga, R., Itoh, H., Matsuyama, T., and
Nakamura, M. (2002). Relationship between changes in serum leptin levels and blood
pressure after weight loss. Hypertens. Res. 25, 881–886.
Karber, G. (1931). Screening methods in pharmacology. Arch. Exp. Pathol. and Pharmacol.
162, 480–483.
Kim, J. B., and Spiegelman, B. M. (1996). ADD1/SREBP1 promotes adipocyte differentia-
tion and gene expression linked to fatty acid metabolism. Genes Dev. 10, 1096–1107.
Kim, J. B., Wright, H. M., Wright, M., and Spiegelman, B. M. (1998). ADD1/SREBP1
activates PPARgamma through the production of endogenous ligand. Proc. Natl. Acad.
Sci. USA 95, 4333–4337.
Lagace, D. C., McLeod, R. S., and Nachtigal, M. W. (2004). Valproic acid inhibits leptin
secretion and reduces leptin messenger ribonucleic acid levels in adipocytes. Endocrinology
145, 5493–5503.
Lagace, D. C., and Nachtigal, M. W. (2004). Inhibition of histone deacetylase activity by
valproic acid blocks adipogenesis. J. Biol. Chem. 279, 18851–18860.
Large, V., Peroni, O., Letexier, D., Ray, H., and Beylot, M. (2004). Metabolism of lipids in
human white adipocyte. Diabetes Metab. 30, 294–309.
Leung, R. K., and Whittaker, P. A. (2005). RNA interference: From gene silencing to gene-
specific therapeutics. Pharmacol. Ther. 107, 222–239.
Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.
MacDougald, O. A., and Mandrup, S. (2002). Adipogenesis: Forces that tip the scales. Trends
Endocrinol. Metab. 13, 5–11.
Chemerin and CMKLR1 Regulation of Adipocyte Biology 311
Meder, W., Wendland, M., Busmann, A., Kutzleb, C., Spodsberg, N., John, H.,
Richter, R., Schleuder, D., Meyer, M., and Forssmann, W. G. (2003). Characterization
of human circulating TIG2 as a ligand for the orphan receptor ChemR23. FEBS Lett.
555, 495–499.
Methner, A., Hermey, G., Schinke, B., and Hermans-Borgmeyer, I. (1997). A novel G
protein-coupled receptor with homology to neuropeptide and chemoattractant receptors
expressed during bone development. Biochem. Biophys. Res. Commun. 233, 336–342.
Moretta, A., Marcenaro, E., Parolini, S., Ferlazzo, G., and Moretta, L. (2008). NK cells at
the interface between innate and adaptive immunity. Cell. Death Differ. 15, 226–233.
Nagpal, S., Patel, S., Jacobe, H., DiSepio, D., Ghosn, C., Malhotra, M., Teng, M.,
Duvic, M., and Chandraratna, R. A. (1997). Tazarotene-induced gene 2 (TIG2),
a novel retinoid-responsive gene in skin. J. Invest. Dermatol. 109, 91–95.
Orlicky, D. J., and Schaack, J. (2001). Adenovirus transduction of 3T3-L1 cells. J. Lipid Res.
42, 460–466.
Parolini, S., Santoro, A., Marcenaro, E., Luini, W., Massardi, L., Facchetti, F.,
Communi, D., Parmentier, M., Majorana, A., Sironi, M., Tabellini, G., Moretta, A.,
et al. (2007). The role of chemerin in the colocalization of NK and dendritic cell subsets
into inflamed tissues. Blood 109, 3625–3632.
Primrose, J. N., Davies, J. A., Prentice, C. R., Hughes, R., and Johnston, D. (1992).
Reduction in factor VII, fibrinogen and plasminogen activator inhibitor-1 activity after
surgical treatment of morbid obesity. Thromb Haemost 68, 396–399.
Roh, S. G., Song, S. H., Choi, K. C., Katoh, K., Wittamer, V., Parmentier, M., and
Sasaki, S. (2007). Chemerin—a new adipokine that modulates adipogenesis via its own
receptor. Biochem. Biophys. Res. Commun. 362, 1013–1018.
Rosen, E. D. (2005). The transcriptional basis of adipocyte development. Prostaglandins
Leukot Essent. Fatty Acids 73, 31–34.
Rosen, E. D., Walkey, C. J., Puigserver, P., and Spiegelman, B. M. (2000). Transcriptional
regulation of adipogenesis. Genes Dev. 14, 1293–1307.
Samad, F., Pandey, M., and Loskutoff, D. J. (1998). Tissue factor gene expression in the
adipose tissues of obese mice. Proc. Natl. Acad. Sci. USA 95, 7591–7596.
Samad, F., Yamamoto, K., Pandey, M., and Loskutoff, D. J. (1997). Elevated expression of
transforming growth factor-beta in adipose tissue from obese mice. Mol. Med. 3, 37–48.
Samson, M., Edinger, A. L., Stordeur, P., Rucker, J., Verhasselt, V., Sharron, M., Govaerts, C.,
Mollereau, C., Vassart, G., Doms, R. W., and Parmentier, M. (1998). ChemR23, a putative
chemoattractant receptor, is expressed in monocyte-derived dendritic cells and macrophages
and is a coreceptor for SIV and some primary HIV-1 strains. Eur. J. Immunol. 28, 1689–1700.
Takahashi, M., Takahashi, Y., Takahashi, K., Zolotaryov, F. N., Hong, K. S., Kitazawa, R.,
Iida, K., Okimura, Y., Kaji, H., Kitazawa, S., Kasuga, M., and Chihara, K. (2008).
Chemerin enhances insulin signaling and potentiates insulin-stimulated glucose uptake in
3T3-L1 adipocytes. FEBS Lett. 582, 573–578.
Vermi, W., Riboldi, E., Wittamer, V., Gentili, F., Luini, W., Marrelli, S., Vecchi, A.,
Franssen, J. D., Communi, D., Massardi, L., Sironi, M., Mantovani, A., et al. (2005).
Role of ChemR23 in directing the migration of myeloid and plasmacytoid dendritic cells
to lymphoid organs and inflamed skin. J. Exp. Med. 201, 509–515.
Wang, M. Y., Orci, L., Ravazzola, M., and Unger, R. H. (2005). Fat storage in adipocytes
requires inactivation of leptin’s paracrine activity: Implications for treatment of human
obesity. Proc. Natl. Acad. Sci. USA 102, 18011–18016.
Warne, J. P. (2003). Tumour necrosis factor alpha: A key regulator of adipose tissue mass.
J. Endocrinol. 177, 351–355.
Wellen, K. E., and Hotamisligil, G. S. (2005). Inflammation, stress, and diabetes. J. Clin.
Invest. 115, 1111–1119.
312 Kerry B. Goralski and Christopher J. Sinal
Whitehead, J. P., Richards, A. A., Hickman, I. J., Macdonald, G. A., and Prins, J. B. (2006).
Adiponectin—a key adipokine in the metabolic syndrome. Diabetes Obes Metab. 8,
264–280.
Wittamer, V., Franssen, J. D., Vulcano, M., Mirjolet, J. F., Le Poul, E., Migeotte, I.,
Brezillon, S., Tyldesley, R., Blanpain, C., Detheux, M., Mantovani, A., Sozzani, S.,
et al. (2003). Specific recruitment of antigen-presenting cells by chemerin, a novel
processed ligand from human inflammatory fluids. J. Exp. Med. 198, 977–985.
Xu, H., Barnes, G. T., Yang, Q., Tan, G., Yang, D., Chou, C. J., Sole, J., Nichols, A.,
Ross, J. S., Tartaglia, L. A., and Chen, H. (2003). Chronic inflammation in fat plays a
crucial role in the development of obesity-related insulin resistance. J. Clin. Invest. 112,
1821–1830.
Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., Yamashita, S.,
Noda, M., Kita, S., Ueki, K., Eto, K., Akanuma, Y., et al. (2002). Adiponectin stimulates
glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase.
Nat. Med. 8, 1288–1295.
Yu, Y. H., and Ginsberg, H. N. (2004). The role of acyl-CoA:diacylglycerol acyltransferase
(DGAT) in energy metabolism. Ann. Med. 36, 252–261.
Yu, Y. H., and Zhu, H. (2004). Chronological changes in metabolism and functions of
cultured adipocytes: A hypothesis for cell aging in mature adipocytes. Am. J. Physiol.
Endocrinol. Metab. 286, E402–E410.
Yudkin, J. S., Stehouwer, C. D., Emeis, J. J., and Coppack, S. W. (1999). C-reactive protein
in healthy subjects: Associations with obesity, insulin resistance, and endothelial dysfunc-
tion: A potential role for cytokines originating from adipose tissue? Arterioscler Thromb
Vasc Biol. 19, 972–978.
Zabel, B. A., Zuniga, L., Ohyama, T., Allen, S. J., Cichy, J., Handel, T. M., and
Butcher, E. C. (2006). Chemoattractants, extracellular proteases, and the integrated
host defense response. Exp. Hematol. 34, 1021–1032.
Zhang, B., Graziano, M. P., Doebber, T. W., Leibowitz, M. D., White-Carrington, S.,
Szalkowski, D. M., Hey P. J., Wu, M., Cullinan, C. A., Bailey, P., Lollmann, B.,
Frederich, R., et al. (1996). Down-regulation of the expression of the obese gene by an
antidiabetic thiazolidinedione in Zucker diabetic fatty rats and db/db mice. J. Biol. Chem.
271, 9455–9459.
Ziccardi, P., Nappo, F., Giugliano, G., Esposito, K., Marfella, R., Cioffi, M., D’Andrea, F.,
Molinari, A. M., and Giugliano, D. (2002). Reduction of inflammatory cytokine
concentrations and improvement of endothelial functions in obese women after weight
loss over one year. Circulation 105, 804–809.
C H A P T E R F I F T E E N
Characterization of Chemokine
Receptor CXCR2 Interacting Proteins
Using a Proteomics Approach to
Define the CXCR2 ‘‘Chemosynapse’’
Dayanidhi Raman,*,‡,1 Nicole F. Neel,*,1 Jiqing Sai,*,†
Raymond L. Mernaugh,† Amy-Joan L. Ham,† and Ann J. Richmond*,‡
Contents
1. Introduction 316
1.1. The CXCR2 chemosynapse 317
1.2. Proteomic screen for the CXCR2 chemosynapse
adaptor proteins 318
2. Validation of the Interaction of Novel Proteins with CXCR2 320
2.1. Coimmunoprecipitation of CXCR2 and CXCR2-binding proteins 321
2.2. Colocalization CXCR2 and CXCR2-interacting proteins
in dHL-60 cells 321
2.3. Glutathione S-transferase pull-down studies 322
3. Mutational Analysis of Residues at Interactive Interface of CXCR2
and CXCR2-Binding Proteins 324
4. Radioactive Phosphorylation of CXCR2 Interacting Proteins 325
5. Chemotaxis Assay 326
5.1. Chemotaxis and chemokinesis assays in modified
Boyden chamber 326
5.2. Chemotaxis assay in micro fluidic gradient device 327
6. Conclusions 329
Acknowledgments 329
References 329
* Department of Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA
{
Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee, USA
{
Veterans Affairs Medical Center, Vanderbilt University School of Medicine, Nashville, Tennessee, USA
1
Both authors contributed equally
315
316 Dayanidhi Raman et al.
Abstract
Chemokine-receptor signaling is initiated upon ligand binding to the receptor
and continues through the process of endocytic trafficking by the association of
a variety of adaptor proteins with the chemokine receptor. In order to define the
adaptor proteins that associate with CXCR2 before and after ligand activation,
a protocol was developed using differentiated HL-60 cells transfected to
express CXCR2 stimulated or not stimulated with ligand for one minute.
CXCR2-associating proteins were isolated by immunoprecipitation with CXCR2
antibody and the eluted proteins were electrophoretically run into the separat-
ing gel directly without a stacking gel. The stained single band was subjected to
in-gel trypsin digestion. The tryptic peptides were subjected to, LC/MS/MS
proteomic analysis. Proteins identified in a minimum of three of four separate
experiments with multiple peptides were then validated as CXCR2 adaptor
proteins by coimmunoprecipitation, GST pull-down studies, and immunocyto-
chemical CXCR2-colocalization experiments using dHL-60-CXCR2 cells. Subse-
quently, a functional analysis of the interaction between CXCR2 and CXCR2
interacting proteins was performed. This approach can be used to characterize
chemokine receptor–associating proteins over time both before and after ligand
stimulation, allowing definition of the dynamic spatial and temporal formation
of a ‘‘chemosynapse.’’
1. Introduction
Chemotactic cytokines or chemokines bind to and activate their
cognate G-protein–coupled receptors (GPCRs) and this event results in a
variety of biological responses (Thelen and Stein, 2008). The varied
biological response is due in part to different repertoires of adaptor proteins
binding to chemokine GPCRs at various spatiotemporal points. This dif-
ferential coupling dictates subsequent biological response and fine tuning of
the chemokine GPCR signaling. The assembly of proteins bound to the
chemokine GPCRs is analogous to the immunological or neurosynapse
wherein the protein–protein interactions initiate, maintain, and regulate a
particular biological activity. We are defining this dynamic spatial and
temporal assembly of adaptor/signaling proteins on the chemokine receptor
as the ‘‘chemosynapse.’’ When chemokines activate their chemokine
GPCRs, the active receptors not only signal at the plasma membrane but
also continue to signal at the endosome level. This is possible due to the
binding of different adaptor proteins as the chemokine receptor traverses
through its vesicular trafficking route. The phosphorylation status of the
chemokine GPCR also enables the assembly of different ensembles of
adaptor proteins bound to the receptor, and thus will be very different
from the basal unphosphorylated or dephosphorylated states of the receptor.
Characterization of CXCR2 Chemosynapse 317
Thus, the activity status of the chemokine receptor dictates in part the type
of adaptor protein that may bind the chemokine receptor at a particular time.
In some cases, there is a genetic alteration of chemokine receptors such
as in WHIM syndrome (warts, hypogammaglobulinemia, infections, and
myelokathexis) where CXCR4 is genetically altered at its C-terminus,
resulting in a combined immunodeficiency disease (Hernandez et al.,
2003). Patients with this mutation exhibit altered response to CXCL12,
suggesting that loss of ability to form an appropriate chemosynapse can
result in serious disease (Gulino et al., 2004) (Balabanian et al., 2005; Lagane
et al., 2008). Expression of a similarly truncated CXCR4 in MCF-7 breast
cancer cells in vitro led to an epithelial to mesenchymal-like transition
(EMT) in these cells (Ueda et al., 2006). Expression of C-terminally
truncated CXCR2 with additional mutations in AP-2 binding motif in
mouse keratinocytes in a transgenic mouse under the control of K14
promoter resulted in the loss of the mouse tail and extensive skin lesions
(Yu et al., 2008). Thus, the carboxyl-terminal domain and possibly intracel-
lular cytoplasmic loops of a chemokine receptor provide a structural landing
for components of the chemosynapse and are functionally important for
orchestration of the normal physiological responses of cells and tissues.
Endothelial cell
The CXCR2 chemosynapse
Perlecan CXCL8
PIP2
b g b g
Gai P CCV
P P AP-2
b-ARR
SRC P P P
X
Y
X GRK
X
Y
CXCR2
Gai
ctin
Y
P
P F-a
HIP
Dock2
Effectors P HSP70
X
P
GTP
Recycling Rac2
vesicle
Lysosome
Rec pH
yclin Endocytic
g Early endosome vesicle
CXCR2
CXCR2
Late
endosome
PP2A P P P
Sequest search
Figure 15.2 Flow chart of the proteomic approach employed in the characterization of
the CXCR2 chemosynapse.
5. Chemotaxis Assay
To determine the functional significance of a specific protein in the
CXCR2 chemosynapse to CXCR2-mediated chemotaxis, the CXCR2-
binding protein was knocked down in HL-60 cells by shRNA using a
lentiviral delivery system (Kappes and Wu, 2001; Kappes et al., 2003).
shRNA clones against a particular CXCR2 interacting protein were selected
from the GIPZ lentiviral shRNAmir library from Open Biosystems (Hunts-
ville, AL). A nonsilencing construct in the same vector was chosen as the
control. The lentiviruses containing shRNA or nonsilencing sequence were
packaged in the 293-FT cell line (Invitrogen, Carlsbad, CA) by transfecting
6 mg of shRNA construct of the CXCR2 interacting protein, 4 mg of
psPAX2, and 2 mg of pMD2.G. The medium containing the viruses was
collected 48 h and 72 h posttransfection and used to infect HL60-CXCR2
cells after concentration through an Amicon-50 Ultra filter (Millipore,
Billerica, MA). Polyclonal stable cell lines were selected in 0.5 mg/ml
puromycin and the level of knock-down was determined by Western blot,
and cells with at least 70% knock-down were tested in chemotaxis assays.
INcell
INA
OUT
INB
A B C
Concentration (mg/ml)
Concentration (mg/ml)
Concentration (mg/ml)
100 100 100
80 80 80
60 60 60
40 40 40
20 20 20
0 0 0
0 100 200 300 400 500 0 100 200 300 400 500 0 100 200 300 400 500
Distance (mm) Distance (mm) Distance (mm)
Cells were seeded in the device for 5 min at 37 C, 5% CO2, and placed in a
prewarmed temperature-controlled chamber of the inverted microscope
(Axiovert 200 M, Carl Zeiss Microimage, Germany). The two input tub-
ings of the device were connected to syringes with one filled with CXCL8
in serum-free RPMI/1640 medium containing 1% bovine serum albumin
(BSA) and the other with RPMI/1640 only. The injection of the solutions
from syringes into the device was driven by a syringe pump (Harvard
PHD2000, Harvard Apparatus, Holliston, MA), first at 50 ml/min to
quickly fill the tubings with medium containing CXCL8 or just the
medium and at 0.5 ml/min to maintain a CXCL8 gradient in the main
channel of the device. The live cell microscopic images were taken every
20 s for a period of 30 min by a CCD camera (Hamamatsu, Japan)
controlled by the computer software Metamorph (Molecular Devices Cor-
poration, Downingtown, PA). The data were analyzed by Metamorph to
track the cell movements (Sai et al., 2006, 2008).
Characterization of CXCR2 Chemosynapse 329
6. Conclusions
The use of immunoprecipitation of chemokine-receptor and
receptor-associating proteins from cells stimulated with chemokine ligand
for varying periods of time, followed by LC/MS/MS proteomic analysis of
the receptor-associating proteins reveals important information about the
protein–protein interactions occurring over time in response to ligand
activation of chemokine receptors. This methodology, when combined
with careful GST-pull-down analysis of the interaction with purified pro-
teins, immunofluorescence, and functional analysis of the receptor–receptor
binding protein interacting sites will provide key information about the
spatial and temporal dynamics of the chemosynapse.
ACKNOWLEDGMENTS
This work was supported by grants from the National Cancer Institute (CA34590, A.R.), the
Vanderbilt-Ingram Cancer Center (grant CA 68485), and Vanderbilt Multidisciplinary Basic
Research Training in Cancer (grant T32CA09592). Support also came from the Department
of Veterans Affairs through a VA Senior Research Career Scientist Award (A.R.) and
through the Ingram family through an Ingram Professorship (A.R.).
REFERENCES
Balabanian, K., Lagane, B., Pablos, J. L., Laurent, L., Planchenault, T., Verola, O.,
Lebbe, C., Kerob, D., Dupuy, A., Hermine, O., Nicolas, J. F., Latger-Cannard, V.,
et al. (2005). WHIM syndromes with different genetic anomalies are accounted for by
impaired CXCR4 desensitization to CXCL12. Blood 105, 2449–2457.
Gallagher, R., Collins, S., Trujillo, J., McCredie, K., Ahearn, M., Tsai, S., Metzgar, R.,
Aulakh, G., Ting, R., Ruscetti, F., and Gallo, R. (1979). Characterization of the
continuous, differentiating myeloid cell line (HL-60) from a patient with acute promye-
locytic leukemia. Blood 54, 713–733.
Gulino, A. V., Moratto, D., Sozzani, S., Cavadini, P., Otero, K., Tassone, L., Imberti, L.,
Pirovano, S., Notarangelo, L. D., Soresina, R., Mazzolari, E., Nelson, D. L., et al. (2004).
Altered leukocyte response to CXCL12 in patients with warts hypogammaglobulinemia,
infections, myelokathexis (WHIM) syndrome. Blood 104, 444–452.
Hernandez, P. A., Gorlin, R. J., Lukens, J. N., Taniuchi, S., Bohinjec, J., Francois, F.,
Klotman, M. E., and Diaz, G. A. (2003). Mutations in the chemokine receptor gene
CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease.
Nat. Genet. 34, 70–74.
Kappes, J. C., and Wu, X. (2001). Safety considerations in vector development. Somat. Cell.
Mol. Genet. 26, 147–158.
Kappes, J. C., Wu, X., and Wakefield, J. K. (2003). Production of trans-lentiviral vector
with predictable safety. Methods Mol. Med. 76, 449–465.
Lagane, B., Chow, K. Y. C., Balabanian, K., Levoye, A., Harriague, J., Planchenault, T.,
Baleux, F., Gunera-Saad, N., Arenzana-Seisdedos, F., and Bachelerie, F. (2008).
330 Dayanidhi Raman et al.
Phosphoproteomic Analysis of
Chemokine Signaling Networks
Morgan O’Hayre,*,1 Catherina L. Salanga,*,1 Pieter C. Dorrestein,*
and Tracy M. Handel*
Contents
1. Introduction 332
2. Methods 334
2.1. Isolation of chronic lymphocytic leukemia cells 334
2.2. CXCL12 stimulation of CLL cells and lysate preparation 334
2.3. IMAC phosphopeptide enrichment of CLL samples 335
2.4. Reversed-phase liquid chromatography and tandem
mass spectrometry 339
3. Summary 343
Acknowledgments 344
References 345
Abstract
Chemokines induce a number of intracellular signaling pathways by activating
second messengers (e.g. calcium) and phosphorylation cascades in order to
mediate a myriad of functions including cell migration, survival and prolifera-
tion. Although there is some degree of overlap in chemokine receptor–mediated
pathway activation, different chemokines will often elicit distinct signaling
events. Factors such as cell type, receptor expression levels, G protein avail-
ability, and disease state will also influence the signaling response from
chemokine-induced receptor activation. Improvements in mass spectrometry,
enrichment strategies, and database search programs for identifying phospho-
peptides have made phosphoproteomics an accessible biological tool for
studying chemokine-induced phosphorylation cascades. Although signaling
pathways involved in chemokine-mediated migration have been fairly well
characterized, less is known regarding other signaling cascades elicited by
chemokines (e.g. to induce proliferation) or the potential for distinct pathway
activation in a disease state such as cancer. CXCL12(SDF-1)/CXCR4 signaling
* Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego,
La Jolla, California, USA
1
Both authors contributed equally
331
332 Morgan O’Hayre et al.
has been shown to play an important role in the survival of chronic lymphocytic
leukemia (CLL) cells, and thus provides a good system for exploring chemokine
signaling, particularly in the interest of survival pathway activation. In this
chapter, we describe the use of immobilized metal affinity chromatography
(IMAC) phosphopeptide enrichment followed by reversed-phase liquid chroma-
tography and tandem mass spectrometry (LC-MS/MS) analysis for exploring
CXCL12-mediated signaling in human CLL patient cells.
1. Introduction
As chemokines bind their respective chemokine receptors, they
induce conformational changes in the receptors leading to activation
of intracellular signaling molecules including G proteins and b-arrestins
(Thelen, 2001). These intracellular signaling molecules activate a variety
of downstream signaling pathways primarily through the initiation of
phosphorylation cascades.
In eukaryotic organisms, phosphorylation, a key reversible post-
translational modification, is critical for the rapid transduction of messages
from extracellular stimuli to elicit a cellular response. Thus, it is not
surprising that an estimated 2 to 3% of the human genome is directly
involved in phosphorylation (kinases, which catalyze the addition of phos-
phate groups, and phosphatases, which catalyze their removal) (Hubbard
and Cohen, 1993; Manning et al., 2002), and an estimated 30 to 50% of
proteins are proposed to exhibit phosphorylation at some point in time
(Kalume et al., 2003). Phosphorylation is known to alter the activity,
stability, localization, and interaction properties of molecules, and has
been linked to a number of cellular processes including cell growth, metab-
olism, differentiation, movement, and apoptosis (de Graauw et al., 2006;
Schreiber et al., 2008). However, the study of protein phosphorylation has
been limited due to a number of challenges, including low abundance of
many phosphoproteins, the low stoichiometry of phosphorylation, the
heterogeneity of phosphorylation sites on a given protein, and the
transient/reversible nature of phosphorylation (Mann et al., 2002).
Classically, immunoblot (Western blot) analysis using phosphorylation-
specific antibodies to a target of interest has been the gold standard for
probing phosphorylation cascades activated in response to extracellular
stimuli. Immunohistochemistry, immunofluorescence, and flow cytometry
are additional methods for probing these signaling events; however, all of
these techniques target specific proteins and require highly specific phos-
phoantibodies. The high costs and limited availability of phosphoantibodies
restrict the use of these techniques, which are generally used when
there is prior knowledge or association with a particular signaling pathway.
Phosphoproteomic Analysis of Chemokine Signaling 333
2. Methods
2.1. Isolation of chronic lymphocytic leukemia cells
Primary CLL cells were obtained in collaboration with Dr. Thomas Kipps at
the University of California, San Diego, Moores Cancer Center. Briefly,
leukopheresis blood was collected from consenting CLL patients, in agree-
ment with institutional guidelines. Peripheral blood mononuclear cells
(PBMCs) were isolated by Ficoll-Paque (Amersham Biosciences, Piscat-
away, NJ) density gradient centrifugation. Any contaminating red blood
cells were lysed at room temperature (RT) for 5 min with red blood cell
lysis buffer (Roche Diagnostics, Indianapolis, IN). The PBMCs from the
CLL patient used for this particular phosphoproteomics data were deter-
mined to contain more than 90% CD19þ/CD5þ/CD3– B cells as assessed
by flow cytometry.
CLL lysate
(unstimulated, 3⬘, 10⬘, 30⬘, 60⬘)
In-solution
P
trypsin digest
C18 cleanup
IMAC
LC-MS/MS
P P P
P P P
P
InsPecT analysis
Validate results
After 20 min, lysates were cooled to RT for 30 min. Because reduction is
reversible, samples were alkylated with fresh iodoacetamide (Sigma,
St. Louis, MO) to a final concentration of 100 mM and left to incubate at
25 C for 30 min in the dark. Following SDS, DTT, and iodoacetamide
treatment, protein was precipitated by addition of 3 to 4 the starting
volume of 50% ethanol/50% acetone/0.1% acetic acid (HAC) in order to
remove the detergent. To aid precipitation, samples were thoroughly mixed
and stored at –80 C for 10 min. The precipitation reactions were then
centrifuged at 1500 rcf for 10 min. The supernatants were removed and the
pellets were washed again with an equivalent volume of 50% ethanol/50%
acetone/0.1% HAC plus 20% volume of H2O. The washed pellets were
centrifuged at 1500 rcf for 10 min, the supernatant was completely removed
and the protein pellets were left to dry overnight.
30 nM CXCL12
Time point Unstimulated 30 100 300 600
Total peptides 550 734 770 754 737
Phosphopeptides 161 249 236 209 158
False positivesa 8 9 11 13 11
False discovery rate (%) 1.5 1.2 1.4 1.7 1.5
Phosphoenrichment (%) 29.3 33.9 30.6 27.7 21.4
Phosphoproteinsb 93 131 133 104 103
a
Estimated by use of a decoy database approach.
b
Number of phosphoproteins identified within a time point data set.
Notes: The total number of phosphorylation events and correlating false discovery rate and percent of
phosphoenrichment are summarized for each time point data set of CXCL12-stimulated CLL cells.
Phosphoproteomic Analysis of Chemokine Signaling 339
times, and exclusion list restraints were varied in order to obtain more data
for spectral counting comparison. Spectral counting is a straightforward,
cost-saving, semi-quantitative approach to determining the differential
levels of relatively abundant proteins in a dataset (Balgley et al., 2008;
Liu et al., 2004a; Zhang et al., 2006; Zybailov et al., 2006). However, less
abundant peptides are not ideal for this method because there is too much
stochastic variation. Alternatively, a 16O/18O trypsin digest can be used.
This semi-quantitative method involves postdigestion labeling of peptides
by exchanging 16O for 18O in a trypsin-catalyzed reaction (Liu et al.,
2004b). The exchange of 16O for 18O is a specific process in which the
C-termini of tryptic peptides are generally labeled with two 18O atoms,
resulting in a 4-Da shift between coeluting labeled and unlabeled peptides.
Other chemical modification methods available for quantitative proteomics
include isotope-coded affinity tags (ICAT), isobaric tags for quantification
(iTRAQ), and phosphoramidate chemistry (PAC), and have been reviewed
elsewhere (Ong and Mann, 2005; Schreiber et al., 2008). Lastly, the devel-
opment of stable isotope labeling with amino acids in cell culture (SILAC)
has provided an effective and reproducible means of quantification between
sample sets (e.g. unstimulated vs. stimulated) for proteomics studies (Olsen
et al., 2006). This technique involves the metabolic incorporation of isoto-
pically labeled amino acids, generally 13C or 15N labeled Lys and/or Arg,
and then comparison of the peak intensities of mixed unlabeled and labeled
samples. However, several disadvantages of SILAC include the expense of
growing cells in labeled media and the requirement for proliferating cells in
culture preventing its use in primary tissue samples such as the CLL cells.
3. Summary
Phosphorylation is a critical post-translational modification regulating
protein activation as well as protein–protein interactions for a variety of
biological responses. With the advances in MS-based phosphoproteomics,
as well as the development of improved enrichment strategies for targeted or
novel identification of phosphorylated peptides, phosphoproteomics has
become an increasingly used application for dissecting signaling networks
in a variety of biological tissues. In this chapter, we have described a general
protocol for IMAC phosphopeptide enrichment followed by LC-MS/MS
analysis for the study of CXCL12 stimulated primary CLL cells. This
method is an excellent starting point for probing a particular phospho-
proteome and generating hypothesis driven targets for further analysis.
344 Morgan O’Hayre et al.
Thus far, we have identified many novel downstream targets that are
currently under investigation. However, depending on the circumstances
(i.e. model system and resources available), some modifications and/or
optimization to this method may be required and should be empirically
determined. For the most comprehensive analysis of a phosphoproteome,
either to identify novel or targeted phosphorylation events, a combination
of various techniques, MS detection, and search algorithms is recommended
(Schmelzle and White, 2006).
ACKNOWLEDGMENTS
We gratefully acknowledge the contributions of Dr. Thomas Kipps and Dr. Davorka
Messmer for access to the primary CLL cells used in these studies; Dr. Huilin Zhou and
Marie Reichart for guidance with the IMAC technique; Dr. Larry Gross and Dario Meluzzi
for training on the preparation of capillary LC columns; Dario Meluzzi, David Gonzalez, and
Wei-Ting Liu for assistance with LC-MS/MS and InsPecT analysis; Angel Lee for help with
DAVID functional annotation; and Dr. Steve Bark for many useful discussions and critical
reading of this work. This work was funded by a California Breast Cancer Research Program
Dissertation Award (14GB-0147) to M.O.; a Ruth L. Kirschstein NIGMS MARC
Predoctoral Fellowship (F31) to C.L.S.; awards from the National Institutes of Health
(RO1-AI37113), Department of Defense (BC060331), and Lymphoma Research Foundation
to T.M.H.; and The V-Foundation of Cancer Research scholar award to P.C.D.
Phosphoproteomic Analysis of Chemokine Signaling 345
REFERENCES
Albuquerque, C. P., Smolka, M. B., Payne, S. H., Bafna, V., Eng, J., and Zhou, H. (2008).
A multidimensional chromatography technology for in-depth phosphoproteome
analysis. Mol. Cell. Proteomics 7, 1389–1396.
Allen, S. J., Crown, S. E., and Handel, T. M. (2007). Chemokine: Receptor structure,
interactions, and antagonism. Annu. Rev. Immunol. 25, 787–820.
Bakalarski, C. E., Haas, W., Dephoure, N. E., and Gygi, S. P. (2007). The effects of mass
accuracy, data acquisition speed, and search algorithm choice on peptide identification
rates in phosphoproteomics. Anal. Bioanal. Chem. 389, 1409–1419.
Balgley, B. M., Wang, W., Song, T., Fang, X., Yang, L., and Lee, C. S. (2008). Evaluation
of confidence and reproducibility in quantitative proteomics performed by a capillary
isoelectric focusing-based proteomic platform coupled with a spectral counting approach.
Electrophoresis 29, 3047–3054.
Bodenmiller, B., Mueller, L. N., Mueller, M., Domon, B., and Aebersold, R. (2007).
Reproducible isolation of distinct, overlapping segments of the phosphoproteome.
Nat. Methods 4, 231–237.
Burger, J. A., and Kipps, T. J. (2006). CXCR4: A key receptor in the crosstalk between
tumor cells and their microenvironment. Blood 107, 1761–1767.
Burger, J. A., Tsukada, N., Burger, M., Zvaifler, N. J., Dell’Aquila, M., and Kipps, T. J.
(2000). Blood-derived nurse-like cells protect chronic lymphocytic leukemia B cells
from spontaneous apoptosis through stromal cell-derived factor-1. Blood 96, 2655–2663.
de Graauw, M., Hensbergen, P., and van de Water, B. (2006). Phospho-proteomic analysis
of cellular signaling. Electrophoresis 27, 2676–2686.
Feng, S., Ye, M., Zhou, H., Jiang, X., Zou, H., and Gong, B. (2007). Immobilized
zirconium ion affinity chromatography for specific enrichment of phosphopeptides in
phosphoproteome analysis. Mol. Cell. Proteomics 6, 1656–1665.
Ficarro, S. B., McCleland, M. L., Stukenberg, P. T., Burke, D. J., Ross, M. M., Shabanowitz, J.,
Hunt, D. F., and White, F. M. (2002). Phosphoproteome analysis by mass spectrometry
and its application to Saccharomyces cerevisiae. Nat. Biotechnol. 20, 301–305.
Geer, L. Y., Markey, S. P., Kowalak, J. A., Wagner, L., Xu, M., Maynard, D. M., Yang, X.,
Shi, W., and Bryant, S. H. (2004). Open mass spectrometry search algorithm. J. Proteome
Res. 3, 958–964.
Hubbard, M. J., and Cohen, P. (1993). On target with a new mechanism for the regulation
of protein phosphorylation. Trends Biochem. Sci. 18, 172–177.
Kall, L., Storey, J. D., MacCoss, M. J., and Noble, W. S. (2008). Assigning significance to
peptides identified by tandem mass spectrometry using decoy databases. J. Proteome Res.
7, 29–34.
Kalume, D. E., Molina, H., and Pandey, A. (2003). Tackling the phosphoproteome: Tools
and strategies. Curr. Opin. Chem. Biol. 7, 64–69.
Kim, S., Gupta, N., and Pevzner, P. A. (2008). Spectral probabilities and generating functions
of tandem mass spectra: A strike against decoy databases. J. Proteome Res. 7, 3354–3363.
Klemm, C., Otto, S., Wolf, C., Haseloff, R. F., Beyermann, M., and Krause, E. (2006).
Evaluation of the titanium dioxide approach for MS analysis of phosphopeptides. J. Mass.
Spectrom. 41, 1623–1632.
Larsen, M. R., Thingholm, T. E., Jensen, O. N., Roepstorff, P., and Jorgensen, T. J. (2005).
Highly selective enrichment of phosphorylated peptides from peptide mixtures using
titanium dioxide microcolumns. Mol. Cell. Proteomics 4, 873–886.
Liu, H., Sadygov, R. G., and Yates, J. R. 3rd (2004). A model for random sampling and estimation
of relative protein abundance in shotgun proteomics. Anal. Chem. 76, 4193–4201.
Liu, T., Qian, W. J., Strittmatter, E. F., Camp, D. G. 2nd, Anderson, G. A., Thrall, B. D.,
and Smith, R. D. (2004). High-throughput comparative proteome analysis using a
quantitative cysteinyl-peptide enrichment technology. Anal. Chem. 76, 5345–5353.
346 Morgan O’Hayre et al.
Mann, M., Ong, S. E., Gronborg, M., Steen, H., Jensen, O. N., and Pandey, A. (2002).
Analysis of protein phosphorylation using mass spectrometry: Deciphering the phospho-
proteome. Trends Biotechnol. 20, 261–268.
Manning, G., Plowman, G. D., Hunter, T., and Sudarsanam, S. (2002). Evolution of protein
kinase signaling from yeast to man. Trends Biochem. Sci. 27, 514–520.
Matthiesen, R., and Jensen, O. N. (2008). Analysis of mass spectrometry data in proteomics.
Methods Mol. Biol. 453, 105–122.
Mohle, R., Failenschmid, C., Bautz, F., and Kanz, L. (1999). Overexpression of the
chemokine receptor CXCR4 in B. cell chronic lymphocytic leukemia is associated
with increased functional response to stromal cell-derived factor-1 (SDF-1). Leukemia
13, 1954–1959.
Moser, K., and White, F. M. (2006). Phosphoproteomic analysis of rat liver by high capacity
IMAC and LC-MS/MS. J. Proteome Res. 5, 98–104.
Motoyama, A., Xu, T., Ruse, C. I., Wohlschlegel, J. A., and Yates, J. R. 3rd (2007).
Anion and cation mixed-bed ion exchange for enhanced multidimensional separations of
peptides and phosphopeptides. Anal. Chem. 79, 3623–3634.
O’Hayre, M., Salanga, C. L., Handel, T. M., and Allen, S. J. (2008). Chemokines and
cancer: Migration, intracellular signalling and intercellular communication in the micro-
environment. Biochem. J. 409, 635–649.
Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M.
(2006). Global, in vivo, and site-specific phosphorylation dynamics in signaling networks.
Cell 127, 635–648.
Ong, S. E., and Mann, M. (2005). Mass spectrometry-based proteomics turns quantitative.
Nat. Chem. Biol. 1, 252–262.
Paradela, A., and Albar, J. P. (2008). Advances in the analysis of protein phosphorylation.
J. Proteome Res. 7, 1809–1818.
Payne, S. H., Yau, M., Smolka, M. B., Tanner, S., Zhou, H., and Bafna, V. (2008).
Phosphorylation-specific MS/MS scoring for rapid and accurate phosphoproteome
analysis. J. Proteome Res. 7, 3373–3381.
Salanga, C. L., O’Hayre, M., and Handel, T. (2008). Modulation of chemokine receptor
activity through dimerization and crosstalk. Cell. Mol. Life Sci. [Epub ahead of print].
Schmelzle, K., and White, F. M. (2006). Phosphoproteomic approaches to elucidate cellular
signaling networks. Curr. Opin. Biotechnol. 17, 406–414.
Schreiber, T. B., Mausbacher, N., Breitkopf, S. B., Grundner-Culemann, K., and Daub, H.
(2008). Quantitative phosphoproteomics--an emerging key technology in signal-
transduction research. Proteomics 8, 4416–4432.
Tanner, S., Shu, H., Frank, A., Wang, L. C., Zandi, E., Mumby, M., Pevzner, P. A., and
Bafna, V. (2005). InsPecT: Identification of posttranslationally modified peptides from
tandem mass spectra. Anal. Chem. 77, 4626–4639.
Thelen, M. (2001). Dancing to the tune of chemokines. Nat. Immunol. 2, 129–134.
Thingholm, T. E., Jensen, O. N., Robinson, P. J., and Larsen, M. R. (2008). SIMAC (sequential
elution from IMAC), a phosphoproteomics strategy for the rapid separation of monopho-
sphorylated from multiply phosphorylated peptides. Mol. Cell. Proteomics 7, 661–671.
Wang, G., Wu, W. W., Zhang, Z., Masilamani, S., and Shen, R. F. (2009). Decoy methods
for assessing false positives and false discovery rates in shotgun proteomics. Anal. Chem.
81, 146–159.
Zhang, B., VerBerkmoes, N. C., Langston, M. A., Uberbacher, E., Hettich, R. L., and
Samatova, N. F. (2006). Detecting differential and correlated protein expression in label-
free shotgun proteomics. J. Proteome Res. 5, 2909–2918.
Zybailov, B., Mosley, A. L., Sardiu, M. E., Coleman, M. K., Florens, L., and
Washburn, M. P. (2006). Statistical analysis of membrane proteome expression changes
in Saccharomyces cerevisiae. J. Proteome Res. 5, 2339–2347.
C H A P T E R S E V E N T E E N
Contents
1. Introduction 348
2. Development of NF-kB Reporter Model for Tumors 348
3. Bioluminescent Imaging of Intratumor Signaling
of Anesthetized Mice 349
3.1. Firefly luciferase reporter 349
3.2. Gaussian luciferase reporter 349
4. Cell-Based Assays for Kinase and Transcriptional Activity In Vitro 352
5. Peripheral Spying of Intratumoral Signaling of Conscious Mice 353
Acknowledgments 354
References 354
Abstract
Chemokine-receptor signaling plays an important role in the inflammatory
response often associated with tumor growth and metastasis. The NF-kB path-
way, essential for transcription of chemokines/chemokine receptors and other
key inflammatory modulators, has emerged as a potential target for tumor
therapy. Here we describe an efficient approach to monitor drugs that target
the NF-kB signaling as related to tumor growth and metastasis in vivo.
For bioluminescence imaging, the firefly luciferase (Fluc) reporter has the
advantage of stable signaling, while Gaussia luciferase (Gluc) provides very
sensitive signaling based on secretion of Gluc. We introduce the use of moni-
toring intratumoral Gluc, which rapidly diffuses into the blood circulation and
urine. The peripheral Gluc assay may complement bioluminescence imaging
and provide a kinetic, noninvasive, real-time read-out of NF-kB activity by
directly determining Gluc reporter activity in blood or urine samples from
tumor-bearing mice.
Department of Cancer Biology, and Veterans Affairs Medical Center, Vanderbilt University School
of Medicine, Nashville, Tennessee, USA
347
348 Jinming Yang and Ann J. Richmond
1. Introduction
Nuclear factor-kB (NF-kB), a key signal transduction pathway in
chemokine–chemokine receptor expression, inflammation, and cancer, is
important target for drug discovery and development. It has been increas-
ingly important to develop noninvasive, high-resolution, in vivo imaging
to elucidate mechanisms that identify and validate drugs that target the
NF-kB pathway. Recent advances in technology allow visualization of
signal transduction as related to biological processes in vivo (Phair and
Misteli, 2001). Use of fluorescent proteins revolutionizes static microscopy
images by providing the ability to make dynamic recordings of protein–
protein interaction in living animals. More recently, a Gaussia luciferase
that possesses a natural secretory signal, allowing secretion into the cell
microenvironment, offers great promise for real-time ex vivo monitoring
of NF-kB signaling in tumor development and progression in conscious
animals.
A
NF-kB-Fluc + + + + +
H-RasV12 − + + + +
IkBaAA − − + − +
Photograph
10
8
Luminescent image
6
ROI 5 = 4.1905e + 07
OI 1 = 1.5298e + 06
ROI 2 = 2.2484e + 0
ROI 3 = 6.9261e + 07 ROI 4 = 9.3479e + 07
10
8
Quantitation
6
B NF-kB-Gluc + + + + +
Figure 17.1 Intratumoral NF-kB reporter models. (A) NF-kB-Fluc reporter model.
Mouse melanocytes null for INK4A/ARF were genetically engineered with the NF-
kB-Fluc reporter (lanes 1 to 5), CMV promoter^driven oncogenic H-RASV12 expression
(lanes 2 to 5), and/or a Tet-On inducible IkBa(S32A/S36A) superrepressor expression
vector (lanes 3 and 5).These cells were inoculated into nude mice to develop xenografts.
Tumors were photographed (upper panels) and intratumoral NF-kB activities were
determined by quantitative luminescent imaging (lower panels), illustrating that
H-RASV12 induced NF-kB activation in vivo was inhibited with the IkBa superrepressor.
(B) NF-kB-Gluc reporter model. NF-kB-Gluc was stably expressed in human mela-
noma Hs294Tcells (1 106) and these cells were subcutaneously inoculated into nude
mice. The individual bioluminescent image was taken immediately following intrave-
nously injection of 100 mg native coelenterazine per mouse.
Detection of Intratumoral Signaling In Vivo 351
B
10×
H
RBC
M
C
10×
Figure 17.2 Melanoma metastasis to the liver. (A) NF-kB-Fluc reporter model of
metastasis. 2 105 of mouse melanocytes (NF-kB-Flucþ, H-RASV12þ, INK4A/ARF^/^)
were intravenously injected into each nude mouse. Sixty days after injection, the biolu-
minescent images were obtained (upper panel), mice were euthanized and (B) histolog-
ical analysis (H&E staining) of organs were performed, indicating melanoma metastasis
to the liver. (C) 2 105 of GFP-tagged melanocytes (H-RASV12þ, INK4A/ARF^/^) were
intravenously injected into nude mice. Thirty days after cell injection, frozen sections
were examined under the fluorescent microscope (10 magnification). H, hepatocytes;
M, melanoma cells; RBC, red blood cells.
BMS-345541 (mM)
0 2.5 5 10
1200
IkBa-Gluc 1000
800
600
400
NF-kB-Gluc
200
Figure 17.3 Luminescent imaging of cultured dish. Hs294T IkB-Gluc reporter cells or
Hs294T NF-kB-Gluc reporter cells were treated with the IKK inhibitor, BMS-345541
(0 to 10 mM) for 36 h.The plate containing the cultured cells and medium was subjected
to bioluminescent imaging immediately following addition of 100 mM of coelentera-
zine.Two independent experiments were performed and similar results were achieved.
Data show an increase in the level of IkBa (upper panels) and reduced NF-kB transcrip-
tional activity (lower panels) upon treatment with BMS-345541.
Detection of Intratumoral Signaling In Vivo 353
40,000
30,000 In blood
Gluc (RLU)
In urine
20,000
10,000
0
0 1 2 3 4
Time (h)
stimuli, suggesting that this approach is feasible for screening the effect of
cancer drugs on the NF-kB pathway.
To prepare blood samples, 5 ml blood were withdrawn using pipette tip
from a small incision at the tail tip of conscious mice. The 5 ml of blood was
mixed into 10 ml buffer (500 mmol/l NaCl, 2 mmol/l KCl, 10 mmol/l
MgCl2, 10 mmol/l Na2HPO4, 2 mmol/l KH2PO4, 1 mmol/l EDTA,
pH 7.8) and stored at 4 C for measuring Gluc activity within 3 weeks.
Sampling of urine is easily done since the mouse readily offers approxi-
mately 100 ml of urine triggered by the fear response to being ‘‘caught’’ by
the gentle hand of the investigator. Of notice, the daily average mouse
voiding frequency is 16 times and the urine volume per void is approxi-
mately 160 ml; thus, urine samples were also collected from a clean glass jar
where mouse was temporally kept. The urine Gluc activity was determined
between 0 and 24 h without loss of Gluc activity. Gluc activity was
measured using the Monolight TM 3010 luminometer (BD Biosciences
Pharmingen, San Diego, CA). Ten microliters of sample were quickly
mixed well with 20 ml of 100 mM coelenterazine in the buffer above and
10-s photon counts were acquired.
In conclusion, bioluminescence imaging of intratumoral NF-kB signal-
ing in living animals can provide useful information about the molecular
basis of tumorigenesis and molecular response to therapeutic agents. Firefly
luciferase is superior to Gaussia luciferase as a reporter for quantitative
molecular imaging. Advantages of Gaussia luciferase are that it is naturally
secreted and extremely sensitive, suggesting it is extremely useful as a
peripheral marker for real-time monitoring of intratumoral molecular sig-
naling in conscious mice.
ACKNOWLEDGMENTS
We thank colleagues at the Richmond laboratory for insightful discussions and Richard
Baheza of Vanderbilt University Institute of Imaging Science for excellent technical assis-
tance. Work from the authors’ program was supported through funding by the Department
of Veterans Affairs through a VA Merit Award (AR) and a VA Senior Research Career
Scientist Award (AR), National Institutes of Health grants (CA 098807) (A.R.), the
Vanderbilt Ingram Cancer Center support grant (CA 68485), and the Skin Disease Research
Center grant (SP30 AR 41943).
REFERENCES
Phair, R. D., and Misteli, T. (2001). Kinetic modelling approaches to in vivo imaging. Nat.
Rev. Mol. Cell. Biol. 2, 898–907.
Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R., and Breakefield, X. O. (2005).
Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture
and in vivo. Mol. Ther. 11, 435–443.
Detection of Intratumoral Signaling In Vivo 355
Contents
1. Introduction 358
2. Receptor Detection 360
3. Cells 362
3.1. Preparation of cells 363
4. Monitoring Receptor Endocytosis 364
4.1. Immunofluorescence microscopy 364
4.2. Flow cytometry 366
5. Monitoring Receptor Recycling 366
5.1. Immunofluorescence microscopy 367
5.2. Flow cytometry 368
6. Monitoring Receptor Degradation 368
6.1. Western blotting 369
6.2. Immunofluorescence 370
7. Electron Microscopy Analysis of Receptor Internalization 371
7.1. Cell surface replicas of whole-mount preparations 371
7.2. Preparation of membrane sheets 372
7.3. Immuno-gold labeling of ultrathin cryosections 374
Acknowledgments 375
References 375
Abstract
Chemokine receptors are G protein–coupled receptors (GPCRs) that, through
their ability to regulate chemotaxis by responding to small chemoattractant
peptides termed chemokines, are involved in the development, maintenance,
* Cell Biology Unit, MRC Laboratory for Molecular Cell Biology, and Department of Cell
and Developmental Biology, University College London, London, United Kingdom
{
Centre for Immunology and Infection, Department of Biology and Hull York Medical School,
University of York, York, United Kingdom
{
Molecular Medicine NHL1, Imperial College, South Kennington, London, United Kingdom
357
358 Tom Kershaw et al.
1. Introduction
Chemokine receptors are members of the extended family of seven
transmembrane domain (7TM) G protein–coupled receptors (GPCRs).
These receptors play essential roles in the development, maintenance and
function of the immune system by triggering the directional migration of
leukocytes in response to chemotactic cytokines, known as chemokines
(Sallusto and Baggiolini, 2008). In addition, chemokine receptor activation
is thought to have wider effects on leukocytes by influencing their state of
activation, maturation and other effector functions (Rossi and Zlotnick,
2001). Specific chemokine receptors and their cognate ligands have also
been implicated in neurodevelopment, angiogenesis, organogenesis, the
metastatic migration of tumor cells, and, significantly, the cellular entry of
several important human pathogens, including the human immunodefi-
ciency viruses (HIV-1 and -2) and the malaria parasite Plasmodium vivax
(Murphy et al., 2000).
In order to mediate their functions as receptors, it is essential that
chemokine receptors be expressed on the surface of cells. As with many
GPCRs, ligand binding frequently leads to activation of the receptor and of
downstream signaling pathways mediated principally (although not exclu-
sively) through coupled heterotrimeric G proteins (Defea, 2008; Schulte
and Levy, 2007). As with all cellular signaling pathways this activity must be
regulated. For many GPCRs this regulation is achieved, at least in part,
through internalization of receptors from the cell surface, followed by either
degradation in lysosomes (downmodulation) or termination of the activated
state and recycling of receptors to the cell surface (resensitization). As the
possibility of pharmacological manipulation of these events has significant
therapeutic potential for a number of diseases and conditions, there has been
Analysis of Chemokine Receptor Trafficking 359
Studies from our laboratories and others have shown that CCR5 and
CXCR4 undergo b-arrestin–mediated endocytosis through clathrin-coated
pits and are subsequently delivered to early endosomes (Fraile-Ramos et al.,
2003; Signoret et al., 1997, 2000, 2005). In the case of CCR5, which binds
the CC chemokines, CCL3 (MIP-1a), CCL4 (MIP-1b), and CCL5
(RANTES), all of which act as agonists, much of the internalized receptor
pool is subsequently delivered to recycling endosomes, from where it can
return to the cell surface in a resensitized form (Signoret et al., 2000). By
contrast, although recycling of CXCR4 can occur, this receptor can also be
ubiquitinated by a HECT domain-containing E3-ligase, AIP4, and sorted
by an ESCRT-dependent mechanism to lysosomes, where it is degraded
(Marchese et al., 2003; Tarasova et al., 1998).
We have previously published details of procedures using radioiodinated
antibodies to measure cell-surface chemokine receptor levels and receptor
endocytosis, and immunofluorescence to determine the cellular distribution
of internalized receptors (Signoret and Marsh, 2000). Here we provide
detailed methods for the quantitative analysis of CCR5 endocytosis and
recycling, and electron microscopic procedures to analyze the endocytosis
and intracellular distribution of CCR5 by immunolabeling cryosections.
In principle, these approaches can be used for analyzing other chemokine
receptors as well as other GPCR or non-GPCR cell-surface proteins.
2. Receptor Detection
To a large extent, the methods of choice for detecting receptors are
dictated by specific experimental questions. In some cases, fluorescently
labeled chemokines can be used, but the small sizes of soluble chemokine
molecules (8 to 10 kDa) limits the potential to incorporate fluorescent
dyes while maintaining biological activity. Many CC chemokines also
exhibit promiscuous receptor binding or show some propensity to bind
proteoglycans, making them unreliable probes for monitoring specific che-
mokine receptors. Moreover, assays in which these probes are used only
examine events following agonist activation and do not allow the properties
of receptors to be examined in the absence of agonist.
In transfected cell lines, epitope tags (e.g., FLAG or HA) can be used to
identify receptors using well-characterized, tag-specific, commercially
available antibodies. Small molecular tags (and in some cases much larger
peptide domains [Klasse et al., 1999]) added to the N-terminal domain
of chemokine receptors, appear to have little impact on the biology of
the molecules and are likely to be accessible on the cell surface so that the
properties of receptors on living cells can be analyzed. We do not advocate
the use of cytoplasmic C-terminal tags, including GFP and other fluorescent
Analysis of Chemokine Receptor Trafficking 361
3. Cells
Since the initial functional expression of human CCR5 in Chinese
hamster ovary (CHO) cells, these and other cell lines have been popular
systems for studying CCR5 trafficking. Stable CCR5-expressing cell lines
have several practical advantages over cells that express the receptor consti-
tutively. Apart from being easy to culture, transfected CHO cells maintain
high levels of chemokine receptor expression, whereas in primary cells and
leukocyte cell lines endogenous receptor levels are often low and trafficking
is difficult to study. In addition, transfected cell lines are usually excellent for
morphological experiments. Importantly, CCR5 trafficking appears, at least
in part, to be faithfully recapitulated in transfected cells: By using assays
developed to follow CCR5 in CHO cells, the internalization and recycling
of CCR5 naturally expressed by lymphocytes and monocytes was found to
proceed with similar kinetics (Mack et al., 1998). A final advantage of using
transfected cell lines is that removing CCR5 from its physiological back-
ground reduces the complicating effects of interactions with other chemo-
tactic receptors, such as C5a receptor, where activation of one receptor may
influence the trafficking of the other through cross-activation and/or
hetero-oligomerization (Huttenrauch et al., 2005). Although these interac-
tions will ultimately have to be considered in a fully integrated model for
CCR5 trafficking, simple systems are necessary to understand the funda-
mental properties of the molecule. One disadvantage of the CHO cell
system is that the hamster genome is not yet sequenced, making it difficult
to perform RNAi knock-down experiments that are now routine in cell
lines from species with sequenced genomes.
The CHO cell lines used in our studies (Mack et al., 1998) express an
average of 100,000–200,000 copies of CCR5 per cell, with the majority
present on the plasma membrane in unstimulated cells. However, by
immunofluorescence microscopy, a small intracellular CCR5 pool can be
Analysis of Chemokine Receptor Trafficking 363
3.1.1. Immunofluorescence
Cells are maintained on 9-cm diameter tissue culture dishes and subcultured
twice per week. (Cells are not cultured for more than 30 passages.) For
experiments, the cells are detached from a confluent 9-cm dish using
trypsin/EDTA (ready-made solution from Invitrogen, http://www.
invitrogen.com/), seeded at a 1:20 dilution onto 13-mm diameter cleaned
and sterilized glass coverslips in a fresh 9-cm dish, and grown for 2 days to
reach approximately 50% confluence. Prior to experiments, the coverslips
are transferred to 16-mm diameter wells in 4-well or 24-well, Nunc plastic
tissue-culture plates (http://www.invitrogen.com), and washed twice in
binding medium (BM) (RPMI-1640 without bicarbonate, containing
0.2% bovine serum albumin [BSA] and 10 mM HEPES, pH 7) at room
temperature (RT 20 C). Cells can be seeded at a similar density in glass-
bottomed dishes (WillCo-Dish, http://www.biosciencetools.com/catalog/
WillCo.htm) for live cell analysis.
Note: BM is not bicarbonate buffered, and incubations can be carried
out without a CO2 buffered environment. If cells are to be incubated for
long periods in a CO2 incubator, appropriate media should be used to
maintain pH.
E ¼ ðI Bg=T BgÞ
where E is proportion endocytosed; I, the intracellular signal; T, the total
cell associated signal; and Bg, the background activity associated with acid
stripped– or protease-treated samples at time 0.
250
200
150
MFI
100
50
0
0.00 0.01 0.10 1.00 10.00 100.00
Anti-alexa-488 (nM)
Figure 18.1 MC-5488 quenching with anti-Alexa Fluor 488. CHO CCR5 cells were
labeled with MC-5488 in BM for 1 h on ice, and subsequently washed with BM to remove
unbound antibody. The cells were then incubated with increasing concentrations of
anti-Alexa Fluor 488 for 90 min on ice, washed and analyzed by flow cytometry. Samples
that were fixed immediately after washing had a maximum mean fluorescence intensity
(MFI) of 200. Maximum quenching (80%) was achieved with 5 nM anti-Alexa Fluor
488 antibody.
Rantes TAK-779
(down-modulation) (recycling)
100
Cell surface fluorescence
80
60
40
20
0
0 20 40 60 80 100 120
Time (min)
Figure 18.2 Quantitative analysis of CCR5 recycling by flow cytometry. CHO CCR5
cells were treated with CCL5 in BM for 60 min before being washed and further incu-
bated in BM containing TAK-779 for 60 min. Aliquots of cells were removed at various
time-points and assayed for cell-surface CCR5-associated fluorescence by flow cyto-
metry, using MC-5488 to detect CCR5. Cell-surface CCR5 fluorescence is expressed as
a percentage of the initial cell-surface CCR5 fluorescence and plotted against time.
A representative experiment is shown, with individual data points representing the
mean of triplicate samples; error bars represent the standard deviation of the means.
6.2. Immunofluorescence
Cells on 13-mm coverslips are grown for 32 h. Protease inhibitors (leupeptin
[100 mM], pepstatin [1 mM], and E64 [10 mM], Sigma-Aldrich) are added to
the medium and the cells cultured for a further 16 h. The coverslips are
Markers RT 95 ⬚C Markers RT 95 ⬚C
C-HC
150
MC-5 (whole)
100 MC-5 (2xHC)
75
Mr (kDa)
50 MC-5 HC
37
CCR5
25 MC-5 LC
20
Figure 18.3 Heating cell lysates to 95 C leads to loss of CCR5. Supernatants of CHO
CCR5 cells lysed in RIPA buffer were either mixed with an equal volume of double
concentration reducing sample buffer (RSB; Lysates) or lysate containing 0.5 mg of
protein was incubated with MC-5 (7.5 mg) and immunocomplexes captured on protein
A^sepharose beads (1.5 h, 4 C) before being eluted by resuspension in RSB (IP:CCR5).
Samples were either heated at 95 C or incubated at RT for 8 min, before equal volumes
were loaded on a 10% SDS polyacrylamide gel. Proteins were transferred to nitrocellu-
lose by immunoblotting and probed for either CCR5 or clathrin heavy chain (C-HC).
After incubation with IRDye 800 GAM, proteins were visualized using an Odyssey
infrared detection system. HC, heavy chain; LC, light chain.
Analysis of Chemokine Receptor Trafficking 371
transferred to 4-well plates and washed twice with BM at RT. Some cells are
fixed at this point, as described above, and stained for total CCR5 and the
lysosomal marker LAMP2 (lgp-B for CHO cells). Others are prelabeled for
cell-surface CCR5 and endocytosis induced by addition of 125 nM CCL5 in
medium containing the protease inhibitors. The coverslips are fixed at the
required times and stained for CCR5 and LAMP2 (see above and Signoret
et al., 2000).
Figure 18.4 Rip-off membrane sheet from a CHO CCR5 cell. Membrane sheets
prepared from CHO CCR5 cells treated with 125 nM CCL5 for 5 min at 37 C,
were labeled for CCR5 with MC-5 followed by 15 nM PAG. L, flat clathrin lattice.
Scale bar ¼ 200 nm.
nonspecific sites are blocked with 1% BSA in PBS for 3 min. The sections
are labeled with primary antibody diluted in 1% BSA/PBS for 60 min,
rinsed four times for 2 min with PBS, and incubated for 20 min with
PAG in 1% BSA in PBS. Antibodies that do not react with protein A,
such as mouse IgG1, require a rabbit antimouse–bridging antibody (e.g.,
Dako, http://www.dako.com/). Unbound PAG is removed by washing
with PBS. Labeling is stabilized by fixing with 1% GA in PBS for 5 min.
After 10 1-min washes in ddH2O, sections are stained with 2% uranyl
acetate at pH 7 for 5 min. The sections are rinsed in ddH2O at 4 C and
incubated for 5 min in 1% methyl cellulose/2% uranyl acetate (pH 4) on ice.
Finally, grids are picked up with loops to form a thin support film of
methylcellulose and uranyl acetate and dried at RT. For double labeling,
sections are incubated with an appropriate primary antibody and PAG, fixed
in 1% GA in PBS for 10 min (to inactivate any unoccupied PAG-binding
sites on the primary antibody), quenched, and labeled with the second
primary antibody and a different sized PAG. This procedure works well
for antibodies that bind PAG directly. In situations where a bridging
antibody is required, protocols involving blocking steps may need to be
devised (see Pelchen-Matthews and Marsh 2007 for other protocols and
approaches).
ACKNOWLEDGMENTS
The UK Medical Research Council supported this work through the MRC Cell Biology
Unit. N.S. is supported by the Biotechnology and Biological Sciences Research Council.
REFERENCES
Baba, M., Nishimura, O., Kanzaki, N., Okamoto, M., Sawada, H., Iizawa, Y., Shiraishi, M.,
Aramaki, Y., Okonogi, K., Ogawa, Y., Meguro, K., and Fujino, M. (1999). A small-
molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1
activity. Proc. Natl. Acad. Sci. USA 96, 5698–5703.
Blanpain, C., Vanderwinden, J. M., Cihak, J., Wittamer, V., Le Poul, E., Issafras, H.,
Stangassinger, M., Vassart, G., Marullo, S., Schlndorff, D., Parmentier, M., and
Mack, M. (2002). Multiple active states and oligomerization of CCR5 revealed by
functional properties of monoclonal antibodies. Mol. Biol. Cell 13, 723–737.
Defea, K. (2008). Beta-arrestins and heterotrimeric G-proteins: Collaborators and compe-
titors in signal transduction. Br. J. Pharmacol. 153(Suppl 1), S298–S309.
Delhaye, M., Gravot, A., Ayinde, D., Niedergang, F., Alizon, M., and Brelot, A. (2007).
Identification of a postendocytic sorting sequence in CCR5. Mol. Pharmacol. 72,
1497–1507.
Endres, M. J., Clapham, P. R., Marsh, M., Ahuja, M., Davis-Turner, J., McKnight, A.,
Thomas, J., Stoebenau-Haggarty, B., Choe, S., Vance, P. J., Wells, T. N. C.,
Power, C. A., et al. (1996). CD4-independent infection by HIV-2 is mediated by
fusin. Cell 87, 745–756.
376 Tom Kershaw et al.
Fraile-Ramos, A., Kohout, T., Waldhoer, M., and Marsh, M. (2003). Endocytosis of the
viral chemokine receptor US28 does not require beta-arrestins but is dependent on the
clathrin-mediated pathway. Traffic 4, 243–253.
Hanyaloglu, A. C., and von Zastrow, M. (2008). Regulation of GPCRs by endocytic
membrane trafficking and its potential implications. Annu. Rev. Pharmacol. Toxicol. 48,
537–568.
Hill, C. M., Kwon, D., Jones, M., Davis, C. B., Marmon, S., Daugherty, B. L.,
DeMartino, J. A., Springer, M. S., Unutmaz, D., and Littman, D. R. (1998). The
amino terminus of human CCR5 is required for its function as a receptor for diverse
human and simian immunodeficiency virus envelope glycoproteins. Virology 248,
357–371.
Huttenrauch, F., Pollok-Kopp, B., and Oppermann, M. (2005). G protein-coupled receptor
kinases promote phosphorylation and beta-arrestin-mediated internalization of CCR5
homo- and hetero-oligomers. J. Biol. Chem. 280, 37503–37515.
Klasse, P. J., Rosenkilde, M. M., Signoret, N., Pelchen-Matthews, A., Schwartz, T. W., and
Marsh, M. (1999). CD4-chemokine-receptor hybrids in human immunodeficiency virus
type 1 (HIV-1) infection. J. Virol. 73, 7453–7466.
Lee, B., Sharron, M., Blanpain, C., Doranz, B. J., Vakili, J., Setoh, P., Berg, E., Liu, G.,
Guy, H. R., Durell, S. R., Parmentier, M., Chang, C. N., et al. (1999). Epitope mapping
of CCR5 reveals multiple conformational states and distinct but overlapping structures
involved in chemokine and coreceptor function. J. Biol. Chem. 274, 9617–9626.
Lusso, P. (2006). HIV and the chemokine system: 10 years later. EMBO J. 25, 447–456.
Mack, M., Luckow, B., Nelson, P. J., Cihak, J., Simmons, G., Clapham, P. R., Signoret, N.,
Marsh, M., Stangassinger, M., Borlat, F., Wells, T. N. C., Schlondorff, D., and
Proudfoot, A. E. (1998). Aminooxypentane-RANTES induces CCR5 internalization
but inhibits recycling: A novel inhibitory mechanism of HIV infectivity. J. Exp. Med.
187, 1215–1224.
Marchese, A., Raiborg, C., Santini, F., Keen, J. H., Stenmark, H., and Benovic, J. L. (2003).
The E3 ubiquitin ligase AIP4 mediates ubiquitination and sorting of the G protein-
coupled receptor CXCR4. Dev. Cell 5, 709–722.
Marsh, M., and Helenius, A. (1980). Adsorptive endocytosis of Semliki Forest virus. J. Mol.
Biol. 142, 439–454.
Martinez, M. A., Gutierrez, A., Armand-Ugon, M., Blanco, J., Parera, M., Gomez, J.,
Clotet, B., and Este, J. A. (2002). Suppression of chemokine receptor expression by
RNA interference allows for inhibition of HIV-1 replication. AIDS 16, 2385–2390.
McKnight, A., Wilkinson, D., Simmons, G., Talbot, S., Picard, L., Ahuja, M., Marsh, M.,
Hoxie, J. A., and Clapham, P. R. (1997). Inhibition of human immunodeficiency virus
fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus
strain dependent. J. Virol. 71, 1692–1696.
McLean, A. J., and Milligan, G. (2000). Ligand regulation of green fluorescent protein-
tagged forms of the human beta(1)- and beta(2)-adrenoceptors; comparisons with the
unmodified receptors. Br. J. Pharmacol. 130, 1825–1832.
Miller, K., Shipman, M., Trowbridge, I. S., and Hopkins, C. R. (1991). Transferrin
receptors promote the formation of clathrin lattices. Cell 65, 621–632.
Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsushima, K.,
Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000). International union of
pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52,
145–176.
Pelchen-Matthews, A., Armes, J. E., and Marsh, M. (1989). Internalization and recycling of
CD4 transfected into HeLa and NIH-3T3 cells. EMBO J. 8, 3641–3649.
Pelchen-Matthews, A., and Marsh, M. (2007). EM analysis of viral morphogenesis. Methods
Cell Biol. 79, 515–542.
Analysis of Chemokine Receptor Trafficking 377
Sallusto, F., and Baggiolini, M. (2008). Chemokines and leukocyte traffic. Nat. Immunol. 9,
949–952.
Sanan, D. A., and Anderson, R. G. (1991). Simultaneous visualization of LDL receptor
distribution and clathrin lattices on membranes torn from the upper surface of cultured
cells. J. Histochem. Cytochem. 39, 1017–1024.
Schulte, G., and Levy, F. O. (2007). Novel aspects of G-protein-coupled receptor signal-
ling—Different ways to achieve specificity. Acta Physiol. (Oxford) 190, 33–38.
Segerer, S., Mack, M., Regele, H., Kerjaschki, D., and Schlondorff, D. (1999). Expression of
the C-C chemokine receptor 5 in human kidney diseases. Kidney Int. 56, 52–64.
Shiraishi, M., Aramaki, Y., Seto, M., Imoto, H., Nishikawa, Y., Kanzaki, N., Okamoto, M.,
Sawada, H., Nishimura, O., Baba, M., and Fujino, M. (2000). Discovery of novel,
potent, and selective small-molecule CCR5 antagonists as anti-HIV-1 agents: Synthesis
and biological evaluation of anilide derivatives with a quaternary ammonium moiety.
J. Med. Chem. 43, 2049–2063.
Signoret, N., Christophe, T., Oppermann, M., and Marsh, M. (2004). pH-independent
endocytic cycling of the chemokine receptor CCR5. Traffic 5, 529–543.
Signoret, N., Hewlett, L., Wavre, S., Pelchen-Matthews, A., Oppermann, M., and
Marsh, M. (2005). Agonist-induced endocytosis of CC chemokine receptor 5 is clathrin
dependent. Mol. Biol. Cell 16, 902–917.
Signoret, N., and Marsh, M. (2000). Analysis of chemokine receptor endocytosis and
recycling. Methods Mol. Biol. 138, 197–207.
Signoret, N., Oldridge, J., Pelchen-Matthews, A., Klasse, P. J., Tran, T., Brass, L. F.,
Rosenkilde, M. M., Schwartz, T. W., Holmes, W., Dallas, W., Luther, M. A.,
Wells, T. N. C., Hoxie, J. A., and Marsh, M. (1997). Phorbol esters and SDF-1 induce
rapid endocytosis and down modulation of the chemokine receptor CXCR4. J. Cell Biol.
139, 651–664.
Signoret, N., Pelchen-Matthews, A., Mack, M., Proudfoot, A. E. I., and Marsh, M. (2000).
Endocytosis and recycling of the HIV co-receptor CCR5. J. Cell Biol. 151, 1281–1294.
Simmons, G., Reeves, J. D., Hibbitts, S., Stine, J. T., Gray, P. W., Proudfoot, A. E., and
Clapham, P. R. (2000). Co-receptor use by HIV and inhibition of HIV infection by
chemokine receptor ligands. Immunol. Rev. 177, 112–126.
Slot, J. W., and Geuze, H. J. (2007). Cryosectioning and immunolabeling. Nat. Protocols 2,
2480–2491.
Tarasova, N. I., Stauber, R. H., and Michejda, C. J. (1998). Spontaneous and ligand-
induced trafficking of CXC-chemokine receptor 4. J. Biol. Chem. 273, 15883–15886.
Verani, A., and Lusso, P. (2002). Chemokines as natural HIV antagonists. Curr. Mol. Med. 2,
691–702.
Zanussi, S., D’Andrea, M., Simonelli, C., Tirelli, U., and De Paoli, P. (1996). Serum levels
of RANTES and MIP-1 alpha in HIV-positive long-term survivors and progressor
patients. AIDS 10, 1431–1432.
C H A P T E R N I N E T E E N
Contents
1. Introduction 380
1.1. What is FRET? 381
1.2. Advantages of PE/APC mAb FRET 382
1.3. CFP/YFP fusion protein FRET 384
1.4. Using both FRET approaches to study CXCR4–TCR proximity 385
2. Assaying CXCR4-TCR Proximity via the PE/APC mAb FRET Approach 386
2.1. Important considerations for labeling cell-surface
CXCR4 and TCR 386
2.2. Detailed procedure 387
2.3. Examples and results 388
3. Assaying CXCR4-TCR Proximity via the CFP/YFP Fusion
Protein Approach 392
3.1. Transient transfection of fusion proteins into Jurkat T cells 392
3.2. Assaying CXCR4-YFP and TCR-z-CFP proximity by FRET 394
3.3. Example 396
4. Concluding Remarks 396
References 396
Abstract
Multiprotein complexes play an important role in nearly all cell functions;
therefore, the characterization of protein–protein interactions in living cells
constitutes an important step in the analysis of cellular signaling pathways.
Using fluorescence resonance energy transfer (FRET) as a ‘‘molecular ruler’’ is a
379
380 Ashok Kumar et al.
1. Introduction
There is compelling evidence that dynamic physical interactions
among proteins play key roles in cellular signal transduction pathways.
Visualizing the intracellular locations of signaling molecules in live cells is
now possible because of the development of new fluorescent probes and
advances in the design of fluorescence microscopy systems. Assays utilizing
the technology of fluorescence resonance energy transfer (FRET) allow
high spatial resolution of protein–protein interactions in living cells, and can
be used to detect protein–protein interactions such as those that mediate
signal transduction pathways. This is in contrast to immunofluorescence
microscopy, which lacks the resolution to distinguish whether two proteins
are actually close in molecular terms or merely located in the same cell
biological neighborhood. The use of FRET in cell biological experiments
has accordingly exploded over the past few years.
Many articles describe the general theory and applications of FRET
assays (Ciruela, 2008; Jares-Erijman and Jovrin, 2003; Shaner et al., 2007;
Vamosi et al., 2008; Xia and Liu, 2001). Here, we describe in detail two
different FRET assays that we used to investigate the formation of a physical
complex between CXCR4 and the T-cell antigen receptor (TCR) in living
T lymphocytes in response to CXCR4 binding to its chemokine ligand,
SDF-1 (CXCL12) (Fig. 19.1) (Kumar et al., 2006). We will focus particu-
larly on our experimental use of a FRET assay that employs the less
commonly utilized phycobiliprotein fluorophores, phycoerythrin (PE),
and allophycocyanin (APC). We will also describe our detailed protocol
for using CFP/YFP FRET to examine CXCR4–TCR interactions.
Finally, will address the advantages in FRET assays of using the PE/APC
fluorophore pair relative to the CFP/YFP FRET fluorophore pair, and the
complementary benefits that can be realized by using both systems to
investigate CXCR4-TCR proximity in T cells.
Measuring CXCR4–TCR Proximity by FRET 381
A B CFP/YFP
PE/APC mAb FRET fusion protein FRET
488 nm
675 nm
PE
SDF-1a
SDF-1a APC
CXCR4
CXCR4 TCR
YFP CFP
TCR
528 nm 433 nm
Figure 19.1 Two experimental approaches for using FRET to assay CXCR4-TCR
complex formation in response to SDF-1 treatment of T lymphocytes: PE/APC mAb
FRET and CFP/YFP fusion protein FRET. (A) Cartoon depicting FRET between
endogenous CXCR4 and TCR receptors, as assayed by using mAbs to link PE and APC
fluorophores to the endogenous cell-surface receptors. (B) Cartoon depicting FRET
between fluorescent CFP and YFP fusion proteins of CXCR4 and the TCR. (From
Kumar, A., Humphreys,T. D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E.,
and Hedin, K. E. (2006). CXCR4 physically associates with the Tcell receptor to signal
inTcells. Immunity 25, 213^224, with permission.)
1 APC
absorbance
0.9
PE absorbance
0.8
0.7
Relative amplitude
0.6
APC FL3 (670 nm LP)
0.5 emission (emission window for
FRET assay)
PE emission
0.4
0.3
488 nm
0.2 (excitation for
FRET assay)
0.1
0
450 470 490 510 530 550 570 590 610 630 650 670 690 710 730
Wavelength (nm)
Figure 19.2 Absorbance and emission spectra of PE and APC. For the absorbance
spectra, PE and APC (in the context of anti^CXCR4-PE and anti^TCR-z-APC) were
excited by 488 nm and 580 nm light, respectively. Absorption spectra were recorded on
a Cary 4000 UV/VIS spectrophotometer (Varian Inc, Palo Alto, CA). Emission spectra
were recorded on a SPEX Fluorolog-3 spectrofluorimeter using a 5-nm slit width (Hor-
iba Jobin Yvon, Edison, NJ). FRET signals are detected in our FRETassay when PE is
excited at 488 nm (indicated by the arrow) and the emission of APC > 670 nm is
measured using a long-pass filter (the detection window is indicated by the rectangle).
using two FRET assays that probe behavior of different TCR subunits: the
PE/APC FRET assay measures CXCR4–TCR-e interactions, while the
CFP/YFP FRET assay measures CXCR4–TCR-z interactions. Additional
assurance that the two CXCR4-TCR FRET assays are measuring CXCR4
interactions with the whole TCR comes from the fact that the PE/APC
FRET assay only labels receptors located on the cell surface. It has pre-
viously been shown that the majority of TCR on the cell-surface are
holoreceptors consisting of all a, b, g, d, e, and z TCR subunits (Alarcon
et al., 1988).
A B
256
256 Unstained
No SDF-1
Cell number
Cell number
Events
Events
0
100 101 102 103 104 100 101 102 103 104
FL3/CXCR4-CD3-e-FRET FL3/CXCR4-CD3-e-FRET
C
512
Unstained
Cell number
+Vehicle
Events
+SDF-1
0
Figure 19.3 Using mAb FRET and flow cytometry to assay SDF-1^dependent
CXCR4-TCR complex formation: typical responses of Jurkat Tcells and control data.
(A) Results from an individual experiment performed as described in Fig. 19.1A and
the text. Both CXCR4-PE and TCR-e-APC mAb were bound to the CXCR4 and
TCR molecules of Jurkat T cells, and then cells were stimulated with either SDF-1 or
vehicle at 37 C for 10 min. The data show that SDF-1, but not vehicle, treatment
induced an increase in per-cell CXCR4-PE^TCR-e-APC FRET fluorescence
(detected using the FL3 channel of the flow cytometer). (B) Control samples in which
cells were analyzed as in (A) after being bound to either CD3-e-APC or CXCR4-PE
alone. These control cells do not display FL3 fluorescence at the level of that induced
by SDF-1 on the dually labeled cells shown in Fig. 19.3A. (C) Control sample in which
cells were analyzed as in (A) after being bound to anti^CD45-APC instead of anti^
TCR-e-APC. Cells were also stained with anti^CXCR4-PE. No increase in FL3/
FRET fluorescence was detected in response to SDF-1. (From Kumar, A., Humphreys,T.
D., Kremer, K. N., Bramati, P. S., Bradfield, L., Edgar, C. E., and Hedin, K. E. (2006).
CXCR4 physically associates with the T cell receptor to signal in T cells. Immunity 25,
213^224, with permission.)
A B
Wild-type (Jurkat) cells
No SDF-1 125
CXCR4-TCR-CD3-e FRET
After SDF-1
100
response to SDF-1
(% of control)
75
Cell number
0
0 1 2 103 4
10 10 10 10
FL3-height 50
TCRb-deficient cells 25
*
No SDF-1 0
Jurkat TCRb-
deficient
After SDF-1
0
A Vehicle pretreated B
256
No SDF-1
+ SDF-1
120
CXCR4-CD3-e : FRET
in response to SDF-1a
100
Cell number
(% of control)
0
No SDF-1a 40
+SDF-1 20 *
0
Vehicle MCD
0
A
30,000
Relative emission amplitude (arbitrary units)
B
25,000
4
10
3
10
TCR-z-CFP
20,000 Unstimulated cell sample R2
2
Cell sample stimulated
10
15,000 with SDF-1 for 20 min
1
10
10,000
0
10
100 101 102 103 104
CXCR4-YFP
5000
0
460 480 500 520 540 560 580
Fluorescent emission wavelength (nm)
in response to 433 nm excitation
Figure 19.6 Using CFP/YFP fusion protein FRETand spectrophotometry to assay the
formation of complexes between CXCR4-YFP and TCR-z-CFP in response to SDF-1
treatment of Jurkat Tcells. (A) Results from using a fluorescence spectrometer to assay
CXCR4-TCR FRET in JurkatTcells using the CFP/YFP fusion protein FRETapproach
described in Fig. 19.1B and the text. Jurkat Tcells were transiently transfected with plas-
mid vectors expressing CXCR4-YFP and TCR-z-CFP, and then analyzed for FRET.
The background-subtracted, fluorescence-emission spectra of the same cell samples in
response to 433-nm light stimulation before (grey line) and after (black line) 20 min of
SDF-1 treatment are shown. (B) Results from a control flow-cytometric analysis of the
cell sample used in (A), indicating that approximately 20% of live cells (boxed) express
both CFP and YFP fusion proteins.
pcDNA3 (10 mg); Sample 3, TCR-z-CFP (10 mg) and pcDNA3 (10 mg);
and Sample 4, CXCR4-YFP (10 mg) and TCR-z-CFP (10 mg). Each cell
sample is then transferred to a 4-mm gap BTX electroporation cuvette and
subjected to one 315-V pulse for 10 ms using a BTX T820 square-wave
electroporator (BTX, Holliston, MA). The cells from each transfection are
then diluted in 5 ml Medium A and cultured for 24 to 28 h.
3.3. Example
Figure 19.6A shows data from a typical experiment. The grey line denotes
the background-subtracted fluorescence emission spectrum of Jurkat T cells
expressing both CXCR4-YFP and TCR-z-CFP before these cells have
been treated with SDF-1. The background-subtracted spectrum shows a
CFP emission peak centered at 475 nm and a smaller YFP emission peak
centered at 528 nm. The black line denotes the background-subtracted
fluorescence emission spectrum of the same cell sample following its stimu-
lation with 5 10–8 M SDF-1 for 20 min and analyzed again. Comparison
of the two spectra indicates relative changes consistent with CXCR4-YFP–
TCR-z-CFP FRET signals increasing following SDF-1 treatment—a
decrease in the CFP emission peak because it is donating energy to YFP,
and a consequent increase in the YFP emission peak.
4. Concluding Remarks
FRET experiments provide us with valuable insights into molecular
dynamics and can frequently be designed to examine dynamics within living
cellular systems. Combining different types of approaches, including FRET
assays that employ various chromophores and that tag proteins of interest in
different ways, is the most reliable way to obtain conclusions about molec-
ular interactions in the living cell. The addition of biochemical approaches,
such as copurification of proteins, can also be useful for confirming the
presence of protein–protein complexes detected by FRET, and for exam-
ining the physiological significance of the interactions.
REFERENCES
Alarcon, B., Berkhout, B., Breitmeyer, J., and Terhorst, C. (1988). Assembly of the human
T cell receptor-CD3 complex takes place in the endoplasmic reticulum and involves
intermediary complexes between the CD3-g, d, e core and single T cell receptor a or b
chains. J. Biol. Chem. 263, 2953–2961.
Batard, P., Szollosi, J., Luescher, I., Cerottini, J.-C., MacDonald, R., and Romero, P.
(2002). The use of phycoerythrin and allophycocyanin for fluorescence resonance energy
transfer analyzed by flow cytometry: Advantages and limitations. Cytometry 48, 97–105.
Chan, F. K.-M., Sigel, R. M., Zacharias, D., Swofford, R., Holmes, K. L., and Tsien, R. Y.
(2001). Fluorescence resonance energy transfer analysis of cell surface receptor interac-
tions and signaling using spectral variants of the green fluorescent protein. Cytometry 44,
361–368.
Ciruela, F. (2008). Fluorescence-based methods in the study of protein–protein interactions
in living cells. Curr. Opin. Biotechnol. 19, 1–6.
Forster, T. (1948). Zwischenmolekulare energiewanderung and fluoreszenz. Ann. Physik. 2,
55–75.
Measuring CXCR4–TCR Proximity by FRET 397
Contents
1. Introduction 400
2. Methods and Discussion 402
2.1. Overview of yeast-signaling strategies 402
2.2. Experimental approach 403
2.3. Characterization of inverse agonists for CXCR4 404
3. Summary 408
References 410
Abstract
G-protein–coupled receptors (GPCR) are prime targets for therapies with small
molecule-antagonists. Since yeast have GPCR triggered signaling pathways
analogous to those present in mammalian cells, it is possible to express
human receptors in yeast coupled to the pheromone responsive signaling
cascade in variants that contain mammalian-yeast Ga subunit chimeras.
CXCR4 and CXCR4(N119S), a constitutively active mutant were expressed in
yeast coupled to pheromone responsive reporter genes, HIS3, lacZ, or FUI, and
tested for signaling activity. Compounds derived from T140, an inverse agonist
for CXCR4, were screened for activity using yeast cells expressing CXCR4
(N119S) and containing a FUS1-lacZ reporter gene. Levels of inhibition of
beta-galactosidase activities triggered by constitutive activation of the phero-
mone response pathway that were obtained in the presence of the T140 derived
* Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, Philadelphia,
Pennsylvania, USA
{
Department of Molecular Biology, Princeton University, Princeton, New Jersey, USA
{
Department of Chemogenomics, Graduate School of Pharmaceutical Sciences, Kyoto University,
Sakyo-ku, Kyoto, Japan
}
Department of Surgery, Thomas Jefferson University, Philadelphia, Pennsylvania, USA
399
400 Barry J. Evans et al.
1. Introduction
G-protein–coupled receptors (GPCR) are encoded by a superfamily of
genes that constitute approximately 1 to 2% of the human genome
(Fredriksson and Schioth, 2005). It is one of the largest gene families in
mammals and there is a high degree of diversity among the receptors
encoded. GPCRs are present in virtually all eukaryotic cells and have a
broad repertoire of ligands that include light, lipids, nucleotides, polypeptides,
and proteins. The unifying topologic characteristic of GPCRs is the presence
of seven hydrophobic helices that span the plasma membrane, resulting in
exposure of the N-terminus and three interhelical loops to the extracellular
space and orientation of the C-terminus and three interhelical loops into the
cytoplasm. Signaling is mediated by coupling to heterotrimeric G proteins.
GPCRs are highly accessible molecular targets for drug therapy and
current estimates are that 30 to 50% of drugs are directed toward these
receptors (Hopkins and Groom, 2002). Many strategies for the development
of therapeutic agents use structural information to generate lead compounds,
so-called rational drug design. The high-resolution structure has been
determined for only two GPCRs (Palczewski et al., 2000; Rosenbaum
et al., 2007), which restricts the application of this approach. In addition,
the diversity among GPCRs and the integral membrane topology has lim-
ited and complicated the use of computational modeling strategies to
approximate structural architecture for virtual drug design. This highlights
the need for efficient screening technologies to identify lead compounds for
therapeutic applications.
The receptors for chemoattractant cytokines, chemokines, are GPCRs in
the rhodopsin subfamily. These receptors number approximately 19, 10 for
CC chemokines, 7 for CXC chemokines, 1 for C chemokines, 1 for
the CX3C chemokine, and 2 nonsignaling binding heptahelical proteins
(Murphy et al., 2000). There is significant redundancy in the repertoire of
chemokine- and receptor-binding activities, but several chemokine–
receptor pairs are exclusive. Stromal cell–derived factor 1 (SDF-1,
CXCL12) is the sole ligand for CXCR4 (Bleul et al., 1996; Oberlin et al.,
1996). Studies with knockout mice demonstrated that both the ligand and
receptor are critical for development of the central nervous system, the
cardiovascular system, and bone marrow hematopoiesis during embryologic
development (Nagasawa et al., 1996; Tachibana et al., 1998; Zou et al., 1998).
Expression of CXCR4 401
for antagonists. Therefore, the FUS1-lacZ reporter gene was used for screen-
ing experiments because it programs the expression of beta-galactosidase,
which can be detected with sensitive assays with a fluorescent substrate
(fluorescein di-b-D-galactopyranoside [FDG]).
and weak partial agonists due to the prohibitive cost of the ligand that would
be required to activate CXCR4. Sequences encoding the FUI transporter
downstream of a FUS1 promoter were incorporated into the genome of
CY12946 yeast cells at the URA3 locus by homologous recombination
with the pAA7 vector using the transformation procedure described above.
The assay for detection of the HIS3 reporter gene was performed as
previously described (Ahang et al., 2002, 2004). Briefly, CY12946 yeast cells
were grown in broth lacking leucine and histidine in 96-well plates. Growth as
measured using absorbance at 600 nm was determined at sequential intervals
to determine the level of expression of the pheromone responsive HIS3
reporter gene. Screening assays were performed using the FUS1-lacZ reporter
gene. Yeast cells transformed with this construct were grown overnight in
medium lacking leucine and tryptophan and then diluted to an absorbance at
600 nm of 0.1. The yeast was then grown in 96-well plates in the same broth in
the presence or absence of candidate compounds until the absorbance at
600 nm reached 0.5. Aliquots of the yeast cell culture (10 ml) were solubilized,
incubated in the presence of the fluorescent substrate (FDG) for 45 min at
37 C, and analyzed for fluorescence in a FUSION (Packard).
The 5-fluorouridine assay was performed using cells expressing native
CXCR4 or the N119S constitutively active mutant. CY12946 cells con-
taining the FUS1-FUI reporter gene were grown overnight in the presence
or absence of the candidate antagonist and 5-FU in broth lacking leucine
and uracil (as selective pressure for maintenance of the plasmids). Growth
was determined from the absorbance at 600 nm. This system is also a growth
assay in which inhibition of CXCR4 signaling results in decreased permease
expression and decreased sensitivity to 5-FU.
0.2
0.15 WT
OD600
N119S
0.1
0.05
0
0 5 10 15 20 25
Time (h)
B
1600
1400
Fluorescence (RFU)
1200
1000
800
600
400
200
0
WT WT + N119S N119S +
FC131 FC131
C 0.7
0.6
0.5
0.4 WT
OD600
N119S
0.3
0.2
0.1
0
0 200 400 600 800 1000 1200
[5FU] (mM)
Figure 20.1 Comparison of yeast reporter gene assays. (A) Growth of yeast CY12946
cells containing a FUS1-HIS3 reporter gene programmed to express human CXCR4 or
CXCR4(N119S), a constitutively active mutant, and grown in histidine-deficient medium
for the indicated time. Growth is evaluated from absorbance at 600 nm. (B) b-galactosi-
dase assay of CY12946 cells containing a FUS1-lacZ reporter gene programmed to express
human CXCR4 or the constitutively active mutant.The effect of FC131 is demonstrated.
(C) Growth of yeast containing a FUS1-FUI reporter gene programmed to express
human CXCR4 or the constitutively active mutant. Cells are exposed to incremental
concentrations of 5-fluorouridine. Growth is evaluated from absorbance at 600 nm.
406 Barry J. Evans et al.
A
20
10
mM
nM
M
nM
mM
M
r
ffe
0n
6n
1m
Bu
16
10
10
.6
10
31
31
3.
[CXCL12]
B
200 T140
% of buffer fluorescence
FC131
150
AMD3100
100
50
0
nM
M
nM
mM
nM
M
0n
1m
6n
10
16
16
.6
10
31
31
3.
3.
[compound]
Figure 20.2 Fluorescent screening assay in yeast containing the FUS1-lacZ reporter
gene. (A) b-galactosidase activity of yeast expressing human CXCR4 exposed to incre-
mental concentrations of CXCL12. (B) b-galactosidase activity of yeast expressing the
CXCR4 constitutively active mutant exposed to incremental concentrations of T140,
FC131, or AMD3100.
signaling of the constitutively active receptor mutant. Beta-galactosidase
activity was decreased in CY12946-CXCR4(N119S) cultures exposed
to 31.6 nM T140 and reached maximal inhibition at 316 nM. Exposure to
10 nM FC131, a cyclic pentapeptide downsized from the T140 template,
induced slight inhibition of beta-galactosidase activity and complete inhibi-
tion was detected at concentrations of 1.0 mM. While the inhibition of [125I]
CXCL12 binding to CXCR4 (in mammalian cells) by T140 and FC131
gave similar IC50 values (2 to 10 nM ) and they block HIV-1 infection of
CD4 positive target cells at similar concentrations, their efficiency for
inhibition of chemotaxis is different. T140 has a greater efficacy for blocking
directed migration toward a CXCL12 gradient. The slopes of the ligand
binding inhibition curves for T140 and FC131 are different, with T140
demonstrating a steeper decrease in binding than FC131. That relationship
resembles the difference in inhibition curves obtained in the FUS1-lacZ
assay with CY12946-CXCR4(N119S) cells. Exposure to AMD3100
resulted in slight inhibition of beta-galactosidase activity at 31.6 nM, with
408 Barry J. Evans et al.
an increase in the lacZ reporter gene expression beginning at 316 nM. These
findings are compatible with the presence of a weak partial agonist.
Eight compounds derived from the T140 structure were developed in
the Department of Chemogenomics, Graduate School of Pharmaceutical
Sciences, Kyoto University, and tested for activity using the yeast FUS1-lacZ
screening system. All compounds showed some inhibition of the autono-
mous activation of the pheromone response pathway by the constitutively
active CXCR4. Exposure to incremental concentrations revealed that the
IC50 concentrations for TR1403, TR1404, TR1405, and TY14010.R5
were between 100 nM and 500 nM (Fig. 20.3A). The latter four com-
pounds all had complete inhibition of FUS1-lacZ activation at concentra-
tions of 1 mM. The IC50 concentrations for FNC003, A5, A7, and A8 were
all greater than 1 mM (Fig 20.3B). In contrast, the four compounds with
IC50 values greater than 1 mM did not achieve full inhibition of this activity.
The compounds were tested in parallel in radioligand-binding experi-
ments to verify the findings in the yeast assay system. As we have previously
described (Zhang et al., 2002), CHO cell CXCR4 transfectants were
incubated with [125I]CXCL12 in the presence and absence of incremental
concentrations of the individual compounds and cell bound ligand was
separated from free by centrifugation through oil. As shown in Fig. 20.3C
and D, the group of high-affinity inverse agonists gave standard sigmoidal
inhibition kinetics for [125I]CXCL12 binding. The IC50 values for the
binding inhibition studies are listed in Table 20.1. The three TR com-
pounds all had IC50 values of 20 nM (TR14003, 23 nM; TR14004,
21 nM; TR14005, 18 nM). TY14010.R5 had an IC50 value of 13 nM
and the FCN003 compound was 40 nM. Values for A5 and A8 were greater
than 10 mM, and A7 was between 1 mM and 10 mM. There was good
relative correlation between IC50 values determined from the fluorescent
yeast system and those obtained by inhibition of radioligand ([125I]
CXCL12) binding, with the exception of TY14010.R5 (TR14003:
23 nM [125I]CXCL12/246 nM yeast, TR14004: 21 nM [125I]CXCL12/
119 nM yeast, TR14005: 18 nM [125I]CXCL12/208 nM yeast, TY14010.
R5 13 nM [125I]CXCL12/526 nM yeast). Maximum inhibition was
obtained at 1 mM of the active inverse agonists in both the yeast and
radioligand inhibition systems. The latter technique detected inhibition at
lower concentrations of compound. This could be due in part to the
presence of the yeast cell wall or the size and/or structure of the antagonists.
3. Summary
Human CXCR4 was expressed in Saccharomyces cerevisiae coupled to
the yeast pheromone response pathway. High levels of CXCL12 were
required to activate signaling using either pheromone-responsive HIS3 or
A B
% of buffer fluorescence
% of buffer fluorescence
120 TR14003 140 FCN003
100 TR14004 120 A5
80 TR14005 100 A7
60 TY14010.R5 80 A8
60
40
40
20 20
0 0
M
nM
nM
nM
nM
mM
nM
nM
mM
0n
6n
1m
0n
6n
1m
10
16
10
.6
16
.6
16
16
10
31
10
31
31
31
3.
3.
3.
3.
[compound] [compound]
C D
150 150 FCN003
% of buffer I125 CXCL12
bound
bound
50 50
0 0
−50 −50
−12 −11 −10 −9 −8 −7 −6 −5 −10 −9 −8 −7 −6 −5 −4
Log [compound] Log [compound]
Figure 20.3 Characterization of T140 derivatives in yeast containing the FUS1-lacZ reporter gene and radioligand-binding inhibition.
(A and B) b-galactosidase activity of yeast expressing the CXCR4 constitutively active mutant exposed to incremental concentrations of can-
didate compounds. (C and D) Inhibition of [125I]CXCL12 binding to CHO cells exposed to incremental concentrations of candidate
compounds.
410 Barry J. Evans et al.
Compound EC50
A5 >10 mM
A7 1 < EC50 < 10 mM
A8 >10 M
FCN003 40 nM
TR14003 23 nM
TR14004 21 nM
TR14005 18 nM
TY1410.R5 13 nM
REFERENCES
Bleul, C. C., Farzan, M., Choe, H., Parolin, C., Clark-Lewis, I., Sodroski, J., and
Springer, T. A. (1996). The lymphocyte chemoattractant SDF-1 is a ligand for
LESTR/fusin and blocks HIV-1 entry. Nature 382, 829–833.
Deichmann, M., Kronenwett, R., and Haas, R. (1997). Expression of the human immuno-
deficiency virus type-1 coreceptors CXCR-4 (fusin, LESTR) and CKR-5 in CD34þ
hematopoietic progenitor cells. Blood 89, 3522–3528.
Expression of CXCR4 411
Deng, H., Liu, R., Ellmeier, W., Choe, S., Unutmaz, D., Burkhart, M., DiMarzio, P.,
Marmon, S., Sutton, R. E., Hill, C. M., Davis, C. B., Peiper, S. C., et al. (1996).
Identification of a major co-receptor for primary isolates of HIV-1. Nature 381, 661–666.
Doitsidou, M., Reichman-Fried, M., Stebler, J., Koprunner, M., Dorries, J., Meyer, D.,
Esguerra, C. V., Leung, T., and Raz, E. (2002). Guidance of primordial germ cell
migration by the chemokine SDF-1. Cell 111, 647–659.
Dragic, T., Litwin, V., Allaway, G. P., Martin, S. R., Huang, Y., Nagashima, K. A.,
Cayanan, C., Maddon, P. J., Koup, R. A., Moore, J. P., and Paxton, W. A. (1996).
HIV-1 entry into CD4þ cells is mediated by the chemokine receptor CC-CKR-5.
Nature 381, 667–673.
Feng, Y., Broder, C. C., Kennedy, P. E., and Berger, E. A. (1996). HIV-1 entry cofactor:
Functional cDNA cloning of a seven-transmembrane, G. protein-coupled receptor.
Science 272, 872–877.
Fredriksson, R., and Schioth, H. B. (2005). The repertoire of G-protein-coupled receptors
in fully sequenced genomes. Mol. Pharmacol. 67, 1414–1425.
Hagen, D. C., McCaffrey, G., and Sprague, G. F., Jr., (1991). Pheromone response elements
are necessary and sufficient for basal and pheromone-induced transcription of the FUS1
gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 2952–2961.
Hopkins, A. L., and Groom, C. R. (2002). The druggable genome. Nat. Rev. Drug Discov. 1,
727–730.
Jund, R., and Lacroute, F. (1970). Genetic and physiological aspects of resistance to
5-fluoropyrimidines in Saccharomyces cerevisiae. J. Bacteriol. 102, 607–615.
Kang, Y., Siegel, P. M., Shu, W., Drobnjak, M., Kakonen, S. M., Cordon-Cardo, C.,
Guise, T. A., and Massague, J. (2003). A multigenic program mediating breast cancer
metastasis to bone. Cancer Cell 3, 537–549.
Möhle, R., Bautz, F., Rafii, S., Moore, M. A., Brugger, W., and Kanz, L. (1998). The
chemokine receptor CXCR-4 is expressed on CD34þ hematopoietic progenitors and
leukemic cells and mediates transendothelial migration induced by stromal cell-derived
factor-1. Blood 91, 4523–4530.
Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T.,
Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., Mohar, A., et al. (2001). Involve-
ment of chemokine receptors in breast cancer metastasis. Nature 410, 50–56.
Murphy, P. M., Baggiolini, M., Charo, I. F., Hebert, C. A., Horuk, R., Matsuchima, K.,
Miller, L. H., Oppenheim, J. J., and Power, C. A. (2000). International union of
pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52,
145–176.
Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y.,
Yoshida, N., Kikutani, H., and Kishimoto, T. (1996). Defects of B-cell lymphopoiesis
and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1.
Nature 382, 635–638.
Oberlin, E., Amara, A., Bachelerie, F., Bessia, C., Virelizier, J. L., Arenzana-Seisdedos, F.,
Schwartz, O., Heard, J. M., Clark-Lewis, I., Legler, D. F., Loetscher, M., Baggiolini, M.,
et al. (1996). The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents
infection by T-cell-line-adapted HIV-1. Nature 382, 833–835.
Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A.,
Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and
Miyano, M. (2000). Crystal structure of rhodopsin: A G protein-coupled receptor. Science
289, 739–745.
Roesnbaum, D. M., Cherezov, V., Hanson, M. A., Rasmussen, S. G., Thian, F. S.,
Kobilka, T. S., Choi, H. J., Yao, X. J., Weis, W. I., Stevens, R. C., and
Kobilka, B. K. (2007). GPCR engineering yields high-resolution structural insights
into beta2-adrenergic receptor function. Science 318, 1266–1273.
412 Barry J. Evans et al.
Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y.,
Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., and Nagasawa, T. (1998).
The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal
tract. Nature 393, 591–594.
Xue, C., Hseuh, Y. P., and Heitman, J. (2008). Magnificent seven: Roles of G protein-
coupled receptors in extracellular sensing in fungi. FEMS Microbiol. Rev. 32, 1010–1032.
Zhang, W. B., Navenot, J. M., Haribabu, B., Tamamura, H., Hiramatu, K., Omagari, A.,
Pei, G., Manfredi, J. P., Fjuii, N., Broach, J. R., and Peiper, S. C. (2002). A point
mutation that confers constitutive activity to CXCR4 reveals that T140 is an inverse
agonist and that AMD3100 and ALX40-4C are weak partial agonists. J. Biol. Chem. 277,
24515–24521.
Zhang, W. B., Wang, Z. X., Murray, J. L., Fujii, N., Broach, J., and Peiper, S. C. (2004).
Functional expression of CXCR4 in S. cerevisiae: Development of tools for mechanistic
and pharmacologic studies. Ernst Schering Res. Found. Workshop 45, 125–152.
Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998).
Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar
development. Nature 393, 595–599.
C H A P T E R T W E N T Y- O N E
Ubiquitination of
Chemokine Receptors
Adriano Marchese
Contents
1. Introduction 414
2. Cell Culture and Transfections 416
3. Agonist Treatment and Ubiquitination Assay 417
4. E3 Ubiquitin Ligase AIP4 Mediates Ubiquitination of CXCR4 419
References 421
Abstract
Ubiquitin modification of proteins has traditionally been linked to proteasomal
degradation, but it is now well established that it also serves nonproteasomal
functions, such as DNA repair, signal transduction and endocytic trafficking
among others. It is now emerging that G-protein–coupled receptor (GPCR)
downregulation is mediated by receptor ubiquitination. For example, agonist-
dependent ubiquitination of the chemokine receptor CXCR4 by the E3 ubiquitin
ligase AIP4 (atrophin interacting protein 4) targets CXCR4 for degradation in
lysosomes. The ubiquitin moiety on CXCR4 serves as a signal on endosomes for
entry into the degradative pathway and long-term attenuation of signaling or
downregulation. Several GPCRs have been shown to be ubiquitinated, and
ubiquitin-dependent trafficking may represent a general mechanism by which
GPCRs are targeted to lysosomes, although some GPCRs that are targeted to
lysosomes may not be directly regulated by ubiquitination. Here we describe a
simple biochemical assay that we have used to study the ubiquitination of
CXCR4 that can be easily applied to study the ubiquitination of any GPCR.
413
414 Adriano Marchese
1. Introduction
Chemokine receptors belong to the large superfamily of G-protein–
coupled receptors (GPCRs) that are coupled to heterotrimeric G proteins,
especially the Gai subfamily, through which a wide variety of intracellular
signaling pathways are activated (Busillo and Benovic, 2007). In order to
ensure that signals are of the appropriate magnitude and duration signaling is
rapidly terminated by a complex series of events giving rise to the phenom-
enon known as desensitization. Desensitization is a process whereby signal-
ing is attenuated even in the continuous presence of stimulus. Multiple
mechanisms contribute to GPCR desensitization, including, in part, the
removal of the receptor from the cell surface through a process involving
internalization, which sequesters the receptor from its stimulus (Moore
et al., 2006; Pierce et al., 2002). The mechanisms involving GPCR inter-
nalization are not completely understood but generally involve receptor
phosphorylation by G protein–coupled receptor kinases (GRKs) resulting
in arrestin binding and recruitment for internalization through clathrin-
coated pits (Drake et al., 2006; Moore et al., 2006). As is true for many
GPCRs, chemokine receptors readily undergo ligand-dependent internali-
zation into a vesicular compartment known as an early endosome. Once on
early endosomes, GPCRs are subject to an endocytic sorting event that
targets them into either a recycling pathway and/or a degradative pathway
(Hanyaloglu and von Zastrow, 2008; Marchese et al., 2008). Receptors that
enter the recycling pathway are returned to the cell surface, giving rise to
receptor resensitization where they are able to respond to further stimula-
tion. Receptors that enter the degradative pathway are targeted to lyso-
somes for proteolysis, giving rise to long-term attenuation of signaling or
downregulation. The mechanisms mediating endosomal sorting remain
poorly understood, although for some receptors it appears that sorting
into the degradative pathway is mediated by receptor ubiquitination
(Hanyaloglu and von Zastrow, 2008; Marchese et al., 2008).
We have shown that the CXCR4 chemokine receptor undergoes
ligand-dependent post-translational modification by ubiquitin (Marchese
and Benovic, 2001). Ubiquitin is a 76–amino-acid protein and is attached to
proteins through an ATP-dependent enzymatic process involving three
sequential enzymatic steps (Hershko and Ciechanover, 1998; Kerscher
et al., 2006; Pickart, 2001). The first step is carried out by an E1 enzyme,
or activating enzyme, that activates ubiquitin through hydrolysis of ATP
leading to the formation of a ubiquitin-adenylate intermediate before ubi-
quitin is transferred to the active-site cysteine residue of the E1 to form
a thiol ester intermediate with the C-terminal glycine residue of ubiquitin.
In the second step, ubiquitin is subsequently transferred to the active site
CXCR4 Ubiquitination 415
REFERENCES
Bhandari, D., Trejo, J., Benovic, J. L., and Marchese, A. (2007). Arrestin-2 Interacts with
the Ubiquitin-Protein Isopeptide Ligase Atrophin-interacting Protein 4 and Mediates
Endosomal Sorting of the Chemokine Receptor CXCR4. J. Biol. Chem. 282,
36971–36979.
Busillo, J. M., and Benovic, J. L. (2007). Regulation of CXCR4 signaling. Biochim. Biophys.
Acta. 1768, 952–963.
Drake, M. T., Shenoy, S. K., and Lefkowitz, R. J. (2006). Trafficking of G. protein-coupled
receptors. Circ Res. 99, 570–582.
Dunn, R., and Hicke, L. (2001). Multiple roles for Rsp5p-dependent ubiquitination at the
internalization step of endocytosis. J. Biol. Chem. 276, 25974–25981.
Hanyaloglu, A. C., and von Zastrow, M. (2008). Regulation of GPCRs by endocytic
membrane trafficking and its potential implications. Annu. Rev. Pharmacol. Toxicol. 48,
537–568.
Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu. Rev. Biochem. 67,
425–479.
Huibregtse, J. M., Scheffner, M., Beaudenon, S., and Howley, P. M. (1995). A family of
proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proc.
Natl. Acad. Sci. USA 92, 2563–2567.
Ingham, R. J., Colwill, K., Howard, C., Dettwiler, S., Lim, C. S., Yu, J., Hersi, K.,
Raaijmakers, J., Gish, G., Mbamalu, G., Taylor, L., Yeung, B., et al. (2005).
WW domains provide a platform for the assembly of multiprotein networks. Mol. Cell.
Biol. 25, 7092–7106.
Ingham, R. J., Gish, G., and Pawson, T. (2004). The Nedd4 family of E3 ubiquitin ligases:
Functional diversity within a common modular architecture. Oncogene 23, 1972–1984.
Kerscher, O., Felberbaum, R., and Hochstrasser, M. (2006). Modification of proteins by
ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell. Dev. Biol. 22, 159–180.
Li, W., Bengtson, M. H., Ulbrich, A., Matsuda, A., Reddy, V. A., Orth, A., Chanda, S. K.,
Batalov, S., and Joazeiro, C. A. (2008). Genome-wide and functional annotation of
human E3 ubiquitin ligases identifies MULAN, a mitochondrial E3 that regulates the
organelle’s dynamics and signaling. PLoS ONE 3, e1487.
Li, Y. M., Pan, Y., Wei, Y., Cheng, X., Zhou, B. P., Tan, M., Zhou, X., Xia, W.,
Hortobagyi, G. N., Yu, D., and Hung, M. C. (2004). Upregulation of CXCR4 is
essential for HER2-mediated tumor metastasis. Cancer Cell. 6, 459–469.
Marchese, A., and Benovic, J. L. (2001). Agonist-promoted ubiquitination of the
G. protein-coupled receptor CXCR4 mediates lysosomal sorting. J. Biol. Chem. 276,
45509–45512.
Marchese, A., and Benovic, J. L. (2004). Ubiquitination of G. protein-coupled receptors.
Methods Mol. Biol. 259, 299–306.
Marchese, A., Paing, M. M., Temple, B. R., and Trejo, J. (2008). G. Protein-Coupled
Receptor Sorting to Endosomes and Lysosomes. Annu. Rev. Pharmacol. Toxicol. 48,
601–629.
422 Adriano Marchese
Marchese, A., Raiborg, C., Santini, F., Keen, J. H., Stenmark, H., and Benovic, J. L. (2003).
The E3 ubiquitin ligase AIP4 mediates ubiquitination and sorting of the G. protein-
coupled receptor CXCR4. Dev. Cell. 5, 709–722.
Meiser, A., Mueller, A., Wise, E. L., McDonagh, E. M., Petit, S. J., Saran, N., Clark, P. C.,
Williams, T. J., and Pease, J. E. (2008). The chemokine receptor CXCR3 is degraded
following internalization and is replenished at the cell surface by de novo synthesis of
receptor. J. Immunol. 180, 6713–6724.
Moore, C. A., Milano, S. K., and Benovic, J. L. (2006). Regulation of Receptor Trafficking
by GRKs and Arrestins. Annu. Rev. Physiol. 69, 451–482.
Nijman, S. M., Luna-Vargas, M. P., Velds, A., Brummelkamp, T. R., Dirac, A. M.,
Sixma, T. K., and Bernards, R. (2005). A genomic and functional inventory of
deubiquitinating enzymes. Cell 123, 773–786.
Pickart, C. M. (2001). Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70, 503–533.
Pierce, K. L., Premont, R. T., and Lefkowitz, R. J. (2002). Seven-transmembrane receptors.
Nat. Rev. Mol. Cell. Biol. 3, 639–650.
Shenoy, S. K., Xiao, K., Venkataramanan, V., Snyder, P. M., Freedman, N. J., and
Weissman, A. M. (2008). Nedd4 Mediates Agonist-dependent Ubiquitination, Lyso-
somal Targeting, and Degradation of the {beta}2-Adrenergic Receptor. J. Biol. Chem.
283, 22166–22176.
Zaitseva, M., Romantseva, T., Manischewitz, J., Wang, J., Goucher, D., and Golding, H.
(2005). Increased CXCR4-dependent HIV-1 fusion in activated T cells: Role of CD4/
CXCR4 association. J. Leukoc Biol. 78, 1306–1317.
Author Index
423
424 Author Index
Luckow, B., 359, 362, 364 Mann, M., 332, 333, 342
Lüdeke, S., 265 Manning, B. D., 128
Lue, H., 60 Manning, G., 332
Luescher, I., 388, 390 Mansfield, R., 17, 19, 33, 34
Luini, W., 291 Mantovani, A., 4, 105, 106, 107, 117,
Lukens, J. N., 63, 317 231, 232, 233, 235, 236, 237, 238,
Luna-Vargas, M. P., 415 239, 240, 241, 246, 291
Lundin, L. G., 60 Many, A., 59
Luo, Y., 239 Mao, A., 269, 270
Luske, A., 165, 166 Mao, H. C., 69
Lusso, P., 359 Marantz, Y., 267, 269
Luster, A. D., 60, 61, 185, 188 Marburger, T. B., 69
Luther, M. A., 63, 359, 360 Marcenaro, E., 291
Luther, S. A., 198 March, C. J., 178
Lynch, D. M., 165 March, M., 364
Lyons, B. L., 78 Marchese, A., 60, 69, 360, 413, 414, 415, 416,
417, 419, 420
M Marco, E., 105
Marcus, R. E., 65
Ma, Q., 60 Marfella, R., 291
Macartney, M., 17, 19, 20, 22, 24, 26, 29, 30, 33, Margalit, R., 59
36, 39, 40, 46 Margulies, B. J., 154
Macauley, C., 209, 213 Mariage-Samson, R., 118
MacCoss, M. J., 342 Marincola, F. M., 80
Macdonald, G. A., 291 Markey, S. P., 342
MacDonald, R., 388, 390 Marmon, S., 361, 401
MacDougald, O. A., 292 Marrelli, S., 291
Macek, B., 342 Marsh, M., 63, 154, 159, 357, 359, 360, 361,
Macen, J. L., 174, 175, 176, 211 362, 364, 365, 367, 368, 371, 373, 375
Macfarland, R., 67 Marti, W., 175
MacGrath, M., 66 Martin, A. P., 128, 193, 198, 200, 201, 204
Mack, M., 210, 212, 359, 360, 361, 362, 364, Martin, D., 125, 128, 138, 141, 143
367, 371 Martin, R. P., 59
Maddon, P. J., 401 Martin, S. R., 401
Magerus, A., 59 Martinez, A. C., 60
Maggio, G., 128 Martinez, M. A., 359
Magid, M., 59 Martinez de la Torre, Y., 232, 233, 238, 247
Maguer-Satta, V., 78 Martinez-Mayorga, K., 273
Mahabaleshwar, H., 60 Martinez-Munoz, L., 60
Mahad, D., 92 Martini, L., 162
Mahad, D. J., 92 Marullo, S., 361
Mahalingam, M., 265 Maruyama, M., 66
Maher, D., 67 Masilamani, S., 341
Mahmoud, N. G., 28 Massague, J., 401
Maier, P., 80 Massardi, L., 291
Mailman, R. B., 264, 271 Massardi, M. L., 237, 239, 240, 291
Majmudar, A., 92 Masuda, T., 290
Majorana, A., 291 Mathieu, C., 201
Maki, T., 197 Mathys, S., 165
Malech, H. L., 63 Matloubian, M., 198
Malhotra, M., 291 Matsubara, A., 65, 76, 77
Malim, M. H., 63 Matsuchima, K., 400
Manders, P. M., 92 Matsuda, A., 419
Mandrup, S., 292 Matsushima, K., 60, 201, 358, 400
Manfra, D. J., 128, 153, 196, 198, 203, 204 Matsuura, H., 270
Manfredi, J. P., 402, 408 Matsuyama, T., 290
Mangada, J., 78 Matthiesen, R., 342
Manischewitz, J., 416 Mattison, K., 153, 165
438 Author Index
Simas, J. P., 174, 175, 176, 179, 194, Soto, H., 401
195, 198, 204 Sousa, S. F., 270
Simmons, G., 359, 361, 362, 364 Sozzani, S., 60, 63, 106, 107, 117, 201, 237, 239,
Simmons, P. J., 58, 60, 63 240, 291, 317
Simone, J., 381 Spaltro, J., 294, 296
Simpson, C. V., 237, 240, 261 Speck, S. H., 174, 175, 176, 194
Sims, O. L., 379 Spedding, M., 264, 271
Sinal, C. J., 289, 290, 291, 302, 304, 305, 306 Spiegel, A., 60, 78
Singh, R., 184, 188, 211, 212 Spiegelman, B. M., 291, 292
Sinzger, C., 166 Spira, T. J., 127
Sireci, G., 235, 239 Spits, H., 69
Sironi, M., 237, 239, 240, 291 Spodsberg, N., 291
Sitkoff, D., 266 Spradling, A. C., 58
Sixma, T. K., 415 Sprague, G. F., Jr., 402
Skolnick, J., 270 Springer, M. S., 157, 361
Skrabanek, L., 273 Springer, T. A., 60, 400
Slot, J. W., 374 Srour, E., 73
Smailbegovic, A., 210, 212 Stahl, R. A., 48
Smit, M. J., 151, 152, 153, 154, 155, 156, 160, Stallone, G., 128
162, 163, 164, 165 Stangassinger, M., 359, 361, 362, 364
Smith, A. L., 68 Stauber, R. H., 360
Smith, C. A., 174 Staugaitis, S. M., 92
Smith, D., 40 Stebler, J., 401
Smith, E., 67 Steen, H., 332, 333
Smith, G. L., 174, 175, 176, 178, 179, 181 Steensma, R. W., 33
Smith, L., 226 Stehouwer, C. D., 291
Smith, M. J., 154, 156 Stein, A., 67
Smith, P., 153, 165 Stein, E. J., 92
Smith, R. D., 342 Stein, J. V., 316
Smith, T. D., 174 Steinbach, P. A., 384
Smith, V. P., 174, 175, 176, 179, 184, 185, 188, Steinmetz, O. M., 48
194, 195 Stenkamp, R. E., 44, 264, 400
Smith-Burchnell, C., 19, 20, 22, 24, 26, 29, 30, Stenling, R., 107, 108, 117
33, 40, 43, 44, 46 Stenmark, H., 360, 415, 416, 417, 419, 420
Smits, R. A., 162 Sternweis, P. C., 136
Smolak, P. J., 174 Stevens, M. J., 273
Smolka, M. B., 335, 340, 341, 342, 343 Stevens, R. C., 264, 400
Smrcka, A. V., 136 Stewart, C. A., 174, 175, 176, 179, 194, 195
Snyder, D., 67 Stiff, P. J., 67
Snyder, P. M., 416, 421 Stine, J. T., 359
Snyderman, R., 60 Stinson, V. L., 290
Sobolik-Delmaire, T., 210, 317, 318, 319 Stockdale, M., 24, 40, 43, 44, 46
Sodek, J., 118 Stocker, S., 142
Soderberg-Naucler, C., 152, 153, 165 Stockerl-Goldstein, K. E., 68
Sodhi, A., 127, 128, 131, 132, 134, 135, 137, 138, Stockschlader, M., 67
140, 141, 143 Stoebenau-Haggarty, B., 361
Sodroski, J., 51, 60, 400 Storb, R., 65
Sohngen, D., 67 Stordeur, P., 291
Sole, J., 290, 291 Storelli, S., 156
Solinas, G., 4 Storey, J. D., 342
Soloway, M. S., 119 Strange, P. G., 21, 28, 30
Somlo, G., 67 Streblow, D. N., 153, 156, 165
Song, S. H., 292 Stremler, M., 327, 328
Song, T., 342 Strieter, R. M., 4, 92, 118
Srensen, T., 92 Strittmatter, E. F., 342
Srensen, T. L., 92 Strizki, J. M., 29, 30, 33
Soresina, R., 63, 317 Stroncek, D. F., 80
Soria, G., 3, 4 Stropes, M. P., 154, 155
446 Author Index
Tolner, B., 226 Vaidehi, N., 263, 267, 269, 270, 272,
Toner, M., 327 273, 274, 285
Topf, M., 267 Vainchenker, W., 69, 77
Torok-Storb, B., 159 Vakili, J., 361
Torrance, D., 174 Vally, H., 165
Torre, Y., 232, 233, 238 Vamosi, G., 380
Tosolini, M., 107, 117 van Berkel, V., 174, 175, 176, 194
Towers, P., 180 Vance, P. J., 361
Trabanino, R., 267, 269, 270, 272, 285 van Cleef, K. W., 165
Trabanino, R. J., 270 van Dam, C. M., 162
Tran, P. B., 92 Van Dam, J. G., 165
Tran, T., 63, 359, 360 Van Damme, J., 4, 237
Trapp, B. D., 92 Vandercappellen, J., 4
Trebst, C., 92 van der Lelie, H., 73
Trebst, D., 92 Vanderplasschen, A., 174, 178, 180
Trejo, J., 69, 414, 417 van der Ryst, E., 17
Tremblay, C., 33 van der Schoot, C. E., 73
Trent, J. O., 237, 238 Vanderwinden, J. M., 361
Tricot, G., 65 van de Water, B., 332
Trifilio, S. M., 59 Van de Water, L., 327
Trkola, A., 21, 45, 46 van Dongen, G. A., 153, 162, 163
Troost, D., 92 van Heteren, J., 154
Trowbridge, I. S., 371 van Heteren, J. T., 92
Trujillo, J., 317 Van Meter, M. J., 92
Trumpp, A., 58 van Os, R. P., 65, 73
Tsai, S., 317 van Walsum, M., 153, 162, 163
Tsai, T. W., 66 Van Zant, G., 61, 66
Tsamis, F., 21, 45, 46 Varma, A., 127, 135
Tsien, R. Y., 384 Varmus, H. E., 131
Tsuji, K., 78 Varty, G., 33
Tsukada, N., 333, 334 Vassart, G., 17, 291, 361
Tsung, K., 175 Vassileva, G., 128, 198
Tubo, R., 10 Vecchi, A., 107, 232, 233, 235, 236, 237, 238,
Tucky, B., 92 239, 240, 291
Tulone, C., 165 Velds, A., 415
Turner, J. E., 48 Vellenga, E., 61, 66
Turner, P., 213 Venherle, S. J., 165
Tyldesley, R., 291 Venkataramanan, V., 416, 421
Tyrberg, B., 200 Verani, A., 359
VerBerkmoes, N. C., 342
U Verhaegent, M., 353
Uberbacher, E., 342 Verhasselt, V., 291
Uchida, S., 290 Verheij, M. H., 160
Ueda, Y., 317 Vermi, W., 291
Ueki, K., 290 Verola, O., 63, 317
Ueyama, Y., 78 Versnel, M. A., 201
Ulbrich, A., 419 Vervecken, W., 226
Unger, R. H., 290 Verzijl, D., 153, 156, 160, 162, 163, 165
Unutmaz, D., 361, 401 Vesole, D., 65
Upton, C., 211 Victor, S. M., 307
Urban, J. D., 264, 271 Vieira, J., 153, 159, 165
Urdal, D. L., 178 Viejo-Borbolla, A., 173, 193
Uy, G. L., 59, 63, 67, 68 Vij, R., 68, 69, 80
Vilardaga, J. P., 381
V Villa, C., 264
Vincent, L., 128
Vago, L., 232, 233, 238 Vink, C., 165
Vaida, B., 165 Virelizier, J. L., 60, 153, 159, 401
448 Author Index
A fluorescence measurement, 23
materials, 50
Adipokine overview, 19, 22
chemerin, see Chemerin cytomegalovirus-encoded G protein-coupled
functional overview, 290 receptor signaling assay, 160
AIP4, see Atrophin-interacting protein–4 CCL3, colorectal cancer expression studies,
Akt, activation assay via Kaposi’s 112, 114, 117
sarcoma-associated herpesvirus-encoded CCL4, colorectal cancer expression studies,
G protein-coupled receptor, 137–138 112, 114, 117
Atrophin-interacting protein–4, CXCR4 CCR1, ligand docking modeling of small
ubiquitin ligase activity, 419–421 molecule binding, 270–271
CCR5
B antagonists, 20–22
Bacterial artificial chromosome mutagenesis, antiviral assays
cytomegalovirus-encoded G antagonist resistance assay, 42–43
protein-coupled receptor, 165–167 human immunodeficiency virus stock
Biacore, see Surface plasmon resonance expansion and storage, 42
Breast cancer materials, 51
chemokine transfection in human cell lines primary cell preparation
cell culture, 8 monocyte-derived macrophages, 41
cell preparation, 7–8 peripheral blood lymphocytes, 40–41
chemokine quantification, 9 reverse transcriptase assay, 41–42
materials, 6–7 calcium signaling assay
microporation overview, 5–6 cell culture and transfection, 22–23
technique, 8 data analysis, 23
xenograft models dye preparation and loading, 23
human cell lines, 9–10 fluorescence measurement, 23
primary tumor formation using T47D cells materials, 50
inoculation, 12 overview, 19, 22
materials, 11 cell lines for expression, 362–363
mouse handling, 11 cognate ligands, 22
overview, 10 cyclic AMP response element-luciferase
tumor cell preparation, 11–12 reporter gene assay
tumor growth and survival assays, 12 data interpretation, 32–33
pulmonary metastasis model using luminescence measurement, 32
MDA-MB–231 cells materials, 51
inoculation, 14 plate preparation, 32
materials, 12–13 principles, 30–31
metastasis formation assay, 14–15 transient transfection, 31–32
mouse handling, 14 degradation assays
tumor cell preparation, 14 immunofluorescence microscopy, 370–371
Western blot, 369–370
C detection techniques, 360–362
endocytosis
Calcium flux electron microscopy
CCR5 signaling assay cell surface replicas of whole-mount
cell culture and transfection, 22–23 preparations, 372–372
data analysis, 23 immuno-gold labeling of cryosections,
dye preparation and loading, 23 374–375
451
452 Subject Index