Contamination Des Poulets
Contamination Des Poulets
1
Faculté des Sciences de la Santé (FASS), Université Adam Barka d’Abéché, Tchad, BP 1173
2
Laboratoire de Biochimie, Biologie Cellulaire et Moléculaire, Microbiologie (L2BCM),
Université de N’Djaména, Tchad
3
Laboratoire de Biologie Moléculaire, d’Epidémiologie et de Surveillance des Bactéries et Virus
Transmissibles par l’Eau et les Aliments, Université Joseph Ki-ZERBO, 03 BP 7021,
Ouagadougou 03, Burkina Faso
4
Centre Hospitalo-universitaire la Référence Nationale de N’Djaména, Tchad
5
Faculté des Sciences de la Santé Humaine (FSSH), Université de N’Djaména, Tchad
*Corresponding author
ABSTRACT
214
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
215
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
A total of 808 samples were taken from patients in The production of extended-spectrum beta-
the various departments of the UHC. The samples lactamases (ESBLs) has been demonstrated by the
taken included 257 urine samples, 210 pus samples double-disc synergy technique. This test is based on
and 341 stool samples. the detection of a synergy between Ceftriaxone,
Aztreonam and Cefepime disks arranged around a
Once collected, the samples were immediately disk of amoxicillin + clavulanic acid separated by 20
transported to the laboratory for processing. to 30 mm on a plate of Müller-Hinton agar.
216
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
minutes at 13,000 g. DNA supernatants were and presented as percentage of baseline distribution.
collected in new clean and sterile Eppendorf tubes Data with a p-value less than 0.05 (95% CI) were
for PCR. considered significant.
The bla-TEM, bla-SHV and bla-CTX-M genes were During the six-month study period, 808 samples
detected by conventional PCR using the specific were taken and cultured in the laboratory
primer pairs bla-TEM-F and bla-TEM-R, bla-SHV-F bacteriology unit of the UHC. These are 210 (26%)
and bla-SHV-R and bla-CTX-MF and bla-CTX-MR pus samples, 341 (42%) stool samples and 257
(Table 1). The 20 µl reaction mix consisted of 5 µl (32%) urine samples. A total of 194 strains of E. coli
DNA, 4 µl Master mix (5x Fired Pol, Solis BioDyne were isolated from 194 positive cultures, 68 of
with 12.5 mM), 2 µl each primer, GENECUST SAS which were multiresistant either a prevalence of E.
(1 µl forward primer, 1 µl of reverse primer) and 9 coli MDR of 35% (68/194).
µl of PCR water (Solis BioDyne).
Prevalence of E. coli strains MDR depending on
The conditions under which the bla-TEM, bla-SHV the origin, type of samples and production or not
and bla-CTX-M genes were amplified are shown in of ESBLs
Table 2.
Table 3 shows that among the 68 E. coli MDR
Characterization of quinolone resistance genes isolates, the highest prevalence was observed in
urine specimens (61.8%), followed by pus
Conventional PCR was used to detect the genes specimens (23.5%) and stool specimens (14.7%).In
qnrA1 to A6, qnrB1 to B6 and qnrS1 to S6 with the relation to the various services, the distribution of
specific primer pairs Qnr AF and qnrQnrA-R, isolates of E. coli multidrug-resistant, the highest
QnrBm-F and QnrBm-R and QnrS-F and qnrQnrS-R were observed in the urology departments (n=18),
(Table 1). The 20 µl reaction mix consisted of 5 µl followed by the infectious diseases departments
DNA, 4 µl Master mix (5x Fired Pol, Solis BioDyne (n=13), emergency room (n=9) and gastroenterology
with 12.5 mM), 2 µl each primer, GENECUST SAS (n=8).
(1 µl forward primer, 1 µl of reverse primer) and 9
µl of ultra-pure water. The conditions used for the The ESBLs phenotype observed in the samples
amplification of qnrs genes are shown in Table 2. analyzed, a prevalence of MDR E. coli of 58.8%
(40/68) was observed. The majority of ESBLs-
Ethical considerations producing multidrug-resistant E. coli were isolated
respectively from urine (n=24), pus (n=10) and stool
The study was approved by the research committee (n=6) samples.
of the UHC laboratory of N’Djamena. The UHC
authorities authorized the authors to conduct the There was no significant difference between the
study. All biological samples were collected as part ESBLs production of the different E.coli isolated in
of the routine clinical management of patients. the biological fluids (p ˃ 0.05). In addition, in the
various departments of the UHC, the highest
Statistical analysis distribution of ESBL phenotypes were observed
respectively in the urology department (14),
Data analysis was performed using Microsoft Excel infectious diseases (6), emergency departments (5)
2016 and Statistical Software for the Social Sciences and the gastroenterology department (4). No
(SPSS™) version 20.0 (IBM, Armonk, NY, USA) significant difference was observed between the
217
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
phenotypic distribution of ESBLs in the departments families. Molecular analysis of the isolates showed
of the University Hospital at the threshold of P˃0.05 the presence of various beta-lactamase genes (Table
(Table 3). 4).
Antibiotic sensitivity test Table 4 shows that the majority of isolates of E. coli
multidrug-resistant carried the bla-CTX-M gene
During the study period, sixty-eight (68) E. coli (72.1%), while 54.4% and 16.2% carried the bla-
MDR were isolated in the N'Djamena University TEM and bla-SHV genes respectively. No
Hospital. The antimicrobial susceptibility test results significant difference between the carriage of these
of these 68 multidrug-resistant E. coli including 40 genes was observed (P>0.05).
ESBL-producing isolates have been reported in
figure 2. Forty-two (42) E coli MDR isolates from urine
samples were tested for ESBLs resistance genes.
The antibiotic resistance profile of these isolates Among these isolates, the bla-CTX-M gene was the
revealed that 47.1% (32/68) were resistant to the most prevalent (71.4%), followed by the bla-TEM
twelve (12) antibiotics tested. All of these isolates gene (54.8%), and bla-SHV (14.3%).
exhibited the extended-spectrum beta-lactamase
producing phenotype. The 8 ESBL positive strains The study of sixteen (16) E. coli MDR isolated from
also showed resistance to 5 antibiotics. Figure 2 pus samples, showed the presence of bla-CTX-M
presents the results of antibiotic susceptibility of the gene, bla-TEM gene and bla-SHV gene with a
68 MDR E. coli tested. prevalence of 75%, 50% respectively and 12.5%.
The results show that 47.1% (32/68) of the isolates Of the ten (10) E. coli MDR isolated from stool
were resistant to the twelve (12) antibiotics tested, samples, the bla-CTX-M gene was the most
51.5% (35/68) were resistant to at least three (3) prevalent (70%), followed by the bla-TEM gene
antibiotics and 1.5% (1/68) was resistant to two (2) (60%) and the bla-SHV gene (30%) respectively).
antibiotics. There is no significant difference between the
expression of these genes in the different samples
High resistance to beta-lactams (amoxicillin + studied (P ˃0.05).
clavulanic acid (92.6%), ceftriaxone (91.1%),
cefepime (83.9%), aztreonam (88.7%) and Distribution of genes according to ESBLs
imipenem (77.8 %)), macrolides (azithromycin phenotypes of strains of E. coli MDR
(91.2%)), cyclines (tetracycline (88.3%)),
quinolones (nalidixic acid (88.2%), norfloxacin The study also revealed the existence of different
(83.8%) and ciprofloxacin (79.4%)), ESBLs genes in the same strain. In fact, a double
aminoglycosides (gentamicin (79.4%)) and carriage was noted in 20.5% of the strains which
sulfonamides (trimethoprim-sulfonamide (83.8%)) simultaneously carried the TEM and CTX-M-13
were observed. genes, 6% which carried the TEM and SHV genes.
17.6% of the strains carried 3 genes at the same time
Global characterization of extended-spectrum β- (TEM, SHV and CTX-M). Table 5 shows that all the
lactamase genes twenty-four (24) urinary isolates presenting an
ESBL phenotype were positive for the bla-CTX-M
A total of 68 MDR E coli were the subject of gene (100%), 63% for the bla-TEM gene and 21%
molecular characterization in this study. All strains for the bla-SHV gene. For the sixteen E coli MDR
with an ESBLs phenotype (40) were also positive in isolates positive for ESBLs production, a prevalence
the molecular screen for common ESBLs gene of 90% for the bla-CTX-M gene, 60% for the bla-
218
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
TEM gene and 20% for the SHV gene was Table 6 shows that the qnrs genes were present in
observed. Of the six (6) ESBL isolates positive by 60% (41/68) of the strains studied. The results
phenotypic method, 66.7% were positive for the bla- showed that 36 isolates (52.9%) of E. coli MDR
CTX-M gene and 66.7% for the bla-TEM gene. carry the qnrA1-like gene to A6, 36 isolates (52.9%)
None of the isolates were positive for bla-SHV carry the qnrB1-like gene to B6, and 2 isolates
genes. (2.9%) carry the qnrS1-like gene for S6.
Furthermore, the coexistence of bla-TEM and bla- Indeed, 24 strains out of the 41 strains carrying qnr
CTX-M genes was observed in stool, pus, and urine genes, i.e. 58.5% (24/41), were positive for ESBLs
samples with a prevalence of 40% (4/10), 25% phenotypes. Moreover, among all the strains
(4/16), and 14.3% (6/42) respectively. While bla- carrying the qnrs genes, 87.8% (36/41) were
TEM + bla-SHV genes were detected in 20%, resistant to at least one antibiotic belonging to the
6.25%, and 2.4% in stool, pus, and urine samples, quinolone family such as nalidixic acid (NA),
respectively. The coexistence of three ESBLs genes ciprofloxacin (CIP) and norfloxacin (NOR). These
belonging to the bla-TEM + bla-SHV gene cluster strains also co-expressed the qnr and ESBLs genes;
was observed in 30%, 50%, 18.8% and 14.3%. of which 6 isolates expressed the CTX-M gene, 5
isolates expressed the TEM gene and 1 isolate
Distribution of ESBLs genes according to clinical expressed the SHV gene.
services
Double carriage of ESBLs genes was observed in 18
The distribution of ESBLs genes observed in the
isolates that expressed TEM + CTX-M genes and 2
different departments of the UHC is presented in
isolates expressed SHV + CTX-M genes. 9 isolates
Table 6.The latter shows that, in this study, the
simultaneously expressed three ESBL genes (TEM
highest overall ESBLs gene carriage was observed
+ SHV + CTX-M). A correlation was observed
in the urology department 26.5% (n=18) followed
between qnrS gene carriage and quinolone
by the infectious diseases department 22.1% (n=15),
resistance (P < 0.05).
the emergency room 13.2%(n=9), gastroenterology
and emergencies 11.8% (n=8), otolaryngology
Distribution of qnrs genes according to
service 7.4% (n=5), surgery service 5.9% (n=4),
susceptibility to ciprofloxacin
Hematology 4.4% (n=3), cardiology 2.2% (n=2),
diabetology 2.2% (n=2) and internal medicine 2.2%
The distribution of qnrs genes according to the
(n=2) services (Table 5). No significant difference
susceptibility of isolates to ciprofloxacin is
was observed between the presence of these genes in
presented in Table 7. Table 7 shows the distribution
the departments of the UHC (P> 0.05).
of qnrS genes according to ciprofloxacin
Profile of ESBLs genes amplified by PCR susceptibility. Indeed, 75.6% (31/41) of
ciprofloxacin-resistant strains carried at least one
The genes identified by the PCR method using qnr gene. Whereas, 24% (10/41) of the ciprofloxacin
specific primers i.e. TEM, SHV and CTX-M on sensitive strains had a qnr gene. There is a
agarose gel are shown in Figures A, B and C. significant difference between the resistance of the
isolates to ciprofloxacin and the carriage of the qnrs
Prevalence of quinolone genes genes (p<0.05).
Concerning the search for the three quinolone Profile of qnrs genes amplified by PCR
resistance genes of the qnrA, qnrB and qnrS type of
this study, their carriage by the isolates of E. coli The qnrs genes identified by the PCR method using
MDR is represented in table 6. specific primers i.e. qnrB1 to B6, qnrS1 to S6 and
219
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
qnrA1 to A6 on agarose gel are shown in Figures A, samples collected, reflecting the average level of
B and C. hygiene or even a greater sensitivity to our method
of analysis. These results should draw the attention
The main objective of our study was to assess the of the nursing staff to the observation of hygiene
prevalence of isolates of multiresistant ESBL- measures in the hospital environment.
producing E. coli and determine the carriage of
ESBLs and quinolone resistance genes circulating at Lucet et al., (1999) showed that it is possible to
the CHU-RN in Chad. effectively control situations in which ESBLs are
epidemic or hyper-endemic by the correct
The isolates of E. coli in this study were identification of pathogens, hand hygiene, isolation
distinguished by a high carriage of resistance genes of patients, wearing of gloves and blouses.
to major antibiotics such as beta-lactams,
quinolones, macrolides and aminoglycosides This study showed that ESBL-producing E. coli
commonly used to treat enterobacterial infections. were isolated from different types of clinical
samples. Thus, it was found that urine samples had
Thus, the study showed that of the 68 E.coli MDR the highest ESBLs carriage (62%), followed by pus
isolated, 58.8% (40/68) were ESBLs producers. (56%) and stool (50%) samples. Similar results were
These results show a high prevalence of ESBLs; this obtained in Ouagadougou in Burkina Faso (62.4%)
explains the high rate of resistance to antibiotics (Kpoda et al., 2017) in urine samples.
ordinarily used to treat enterobacteria infections in
the CHU-RN of N'Djamena. Moreover, this carriage remains weak compared to
the results obtained by Fody et al., (2017) in Niger;
In Chad, Ouchar et al., (2019), reported somewhat 26.7%, 26.3% and 25% respectively in urine, pus
similar results to our study. Indeed, their study and stool. This difference in carriage of ESBL-
focused on three hospitals in the city of N'Djamena producing E. coli in clinical samples could be
where 94 strains of ESBL-producing explained by the more variable number of samples.
Enterobacteriaceae were isolated and of which E.
coli was the predominant species with a frequency However, high levels of isolate ESBL-producing E.
of 63.83% (n = 60).A similar prevalence was also coli in the urology department (35%) and in the
found in some African countries such as Iran (58%) urine samples (62%) observed in this study could be
(Pourakbari et al., 2019), Burkina Faso (62.6%) elucidated by the nature of the samples from the
(Kpoda et al., 2017) among children admitted to the patients studied, the length of stay in the hospital,
Saint Camille Hospital and in France (76%) the invasive procedures and devices (catheters,
(Holstein et al., 2010) at Bretonneau Hospital. probes, intubation, etc.) and long-term exposure of
patients to antibiotics as reported by Rodríguez-
However, other authors have revealed high Baño et al., (2010) on the one hand and the
proportions of ESBL-producing E. coli. Dembele et combined therapy of aminoglycosides and
al., (2020) and Diagne et al., (2018) reported a cephalosporins in the treatment of urinary tract
proportion of 100% carriage of ESBL-producing infections at the CHU-RN (Cattoir, 2007b) on the
E.coli respectively in rural areas of Burkina Faso other hand.
and patients seen at Fann Hospital in Senegal.
It should be noted that if the current practices of lack
This large variation in the carriage of ESBLs of systematic monitoring of ESBLs and the absence
observed could testify to an increase in the of an ESBLs control program in the CHU-RN
frequency of ESBLs within our university hospital continue, a rapid increase in the prevalence of
center, or difference in the type is the number of ESBLs can be observed in the years to come.
220
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
Target genes Primers Sequences of primers sens,antisens (5' → 3') Size (pb) References
blaTEM TEM-F ATAAAATTCTTGAAGACGAAA 1080 Mabilat et al.,
TEM-R GACAGTTACCAATGCTTAATC (1990) ; [56]
blaSHV SHV-F TTATCTCCCTGTTAGCCACC 795 [56]
SHV-R GATTTGCTGATTTCGCTCGG
blaCTX-M CTX-M-F GTTACAATGTGTGAGAAGCAG 1041 Jouini.(2007)
CTX-M-R CCGTTTCCGCTATTACAAAC
qnrB1 to qnrB6 QnrB-F GGMATHGAAATTCGCCACTGa 264 Cattoir et al.,
b
QnrB-R TTTGCYGYYCGCCAGTCGAA (2007a)
qnrS1 to qnrS6 QnrS-F GCAAGTTCATTGAACAGGGT 428 Cattoir et al.,
QnrS-R TCTAAACCGTCGAGTTCGGCG (2007b)
qnrA1 to qnrA6 QnrA-F AGAGGATTTCTCACGCCAGG 580 Cattoir et al.,
QnrA-R TGCCAGGCACAGATCTTGAC (2007b)
NB:aM = A ou C;aH = A ou C ou T; bY =C ou T.
Table.2 Conditions for amplification of beta lactamases and quinolones resistance genes
Champagne cork
221
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
Origin Effective Services MDR E. coli E. coli BLSEs E. coli not BLSEs
Stool 14,7 (n=10) Gastro 11,8 (n=8) 5,9 (n=4) 5,9 (n=4)
ID 2,9 (n=2) 2,9 (n=2) 0
Urine 61,8 (n=42) Uro 26,5 (n=18) 20,6 (n=14) 5,9 (n=4)
Hemato 4,4 (n=3) 2,9 (n=2) 1,5 (n=1)
ID 14,7 (n=10) 2,9 (n=2) 11,8 (n=8)
Cardio 2,9 (n=2) 1,5 (n=1) 1,5 (n=1)
PU 13,2 (n=9) 7,4 (n=5) 5,9 (n=4)
Pus 23,5 (n=16) Surgery 5,9 (n=4) 1,5 (n=1) 4,4 (n=3)
Diabetes 2,9 (n=2) 2,9 (n=2) 0
Int Med 2,9 (n=2) 2,9 (n=2) 0
ID 4,4 (n=3) 2,9 (n=2) 1,5 (n=1)
ORL 7,4 (n=5) 4,4 (n=3) 2,9 (n=2)
Total 100 (n=68) 10 100 (n=68) 58,8 (n=40) 41,2 (n=28)
Legend: Uro= Urology; Cardio= Cardiology; Diabetes= Diabetology; Hemato= Hematology; Med Int= Internal Medicine; ID=
Infectious Diseases; ORL= Otorhinolaryngology; ER= Emergency room, Gastro=gastrology.
Table.5 Distribution of ESBLs genes according to the clinical origin of the samples
222
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
R: Resistance percentage (%), S: Sensitivity percentage (%), I: Intermediate percentage; Gentamicin: GEN, Aztreonam: AZT,
Imipenem: IPM, Amoxicillin–clavulanic-acid: AMC, Sulfamethoxazole–trimethoprim: SXT, Ceftriaxon: CTR, Ciprofloxacin:
CIP, Nalidixic acid: NA, Tetracycline: TE, Norfloxacin: NOR, Cefepime: CEF ,Azithromycin:AZM
223
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
M 1 2 3 4 5 6 7 CN 8 9 10 11 12 13
A
1080 PB
500 PB
100 PB
B M CN 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
795 PB
500 PB
100 PB
C M 1 2 3 4 5 6 7 8 9 10 CN
1041 PB
500 PB
100 PB
A:PCR amplification of the bla-TEM gene (1080bp). Legend: M = 100 bp ladder molecular weight marker; CN = negative control,
from 1 to 13 samples tested for the TEM gene; 1, 3 to 13 = positive samples; 2 = negative sample.
B:PCR amplification of the bla-SHV (795bp) gene. Legend: M = 100 bp ladder molecular weight marker; CN = negative control,
from 3, 6, 7, 15, 16 and 17 samples tested positive for the SHVgene; 1, 2, 4, 5 and 8 to 14 = negative samples
C:PCR amplification of the blaCTX-M gene (1041bp). Legend: M = 100 bp ladder molecular weight marker; CN = negative
control, from 1, 2, 4, 5 and 10 samples tested positive for the CTX-M gene; 3, 6, 8 and 9 = negative samples.
224
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
A M 1 2 3 4 5 6 7 8 9 10 11 12 13
500 PB
264 PB
100 PB
CN 1 2 3 4 5 6 7 8 9 M
500 pB
428 pB
100 PB
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 CN
580 PB
500 PB
100 PB
A :PCR amplification of qnrB1 toqnrB6 genes (264 bp). Legend: M = 100 bp ladder molecular weight marker; 1 to 13 samples
tested positive for qnrB1 to qnrB6 genes.
B:PCR amplification of qnrS1 to qnrS6 genes (428bp). Legend: M = 100bp ladder molecular weight marker; CN = negative
control, from 1 to 9 samples tested positive for the qnrS1 to qnr S6 gene.
C :PCR amplification of genes from E.coliqnrA1 to qnrA6 (580bp). Legend: M = 100bp ladder molecular weight marker; CN =
negative control, from 1 and 14 samples tested positive for qnrA1 to qnrA6 genes; 2 to 13 = negative samples.
This situation will result in increased infection The resistance phenotypes of all the ESBL E.coli
treatment costs and treatment failures. The European isolates studied were very diverse depending on the
Antimicrobial Resistance Surveillance Network antibiotic family (fig2). Thus, 47.1% (32/68) of the
reports that extended-spectrum β-lactamases isolates were resistant to all the antibiotics tested (El
(ESBLs) are of great clinical importance as they bouamri et al., 2015). In addition to their strong
represent the main cause of multiple antibiotic resistance to beta-lactams, there was resistance to
resistance in Enterobacteriaceae (Inserm, 2020). other families of antibiotics commonly used in
225
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
CHU-RN such as macrolides, quinolones, The high carriage of the blaCTX-M gene in this
fluoroquinolones, cyclins and aminoglycosides. study (72.1%) confirms its increasing prevalence
Similar observations have been made for beta- among clinical strains of E. coli MDR as reported in
lactams, quinolones, fluoroquinolones, numerous studies. Moreover, the high level of the
sulfonamides, cycles and aminoglycosides in Chad blaTEM gene (54.4%) may be due to its presence in
by Ouchar et al., (2019) and by Linefiene et al., highly mobile genetic elements that promote its
(2017) and for beta-lactams, fluoroquinolones and horizontal spread among bacteria worldwide (Daoud
sulfonamides in Benin (Anago et al., 2015) in et al., 2015). This prevalence also explains the
hospitals. strong resistance of the isolates to antibiotics
(Cattoir, 2007b; Canton and Coque, 2006) observed
The high and variable resistance rates of MDR E. in this study.
coli to widely prescribed antimicrobials in Chad
observed in this study could be explained by the Our study showed that 16.2% of E. coli MDR
uncontrolled and inappropriate use of antimicrobials isolates carried the blaSHV gene. Results
(distribution without a prescription, self-medication, inconsistent with those reported by Fody et al.,
etc.), to the availability of certain antimicrobial (2018) in Niger, Mensah et al., (2016) in Ghana and
molecules in galenic form tablets and capsules (beta- Udomsantisuk et al., (2011) in Thailand, where none
lactams) on the one hand and non-compliance with of the isolates of E. coli harboring the blaSHV gene
regulations, sale, use of antibiotics in livestock was observed. This difference could be due to the
sectors (Ministry of Public Health, 2018; Yandai et types of sampling and the different geographical
al., 2014) and prescription of antibiotics with areas.
antagonistic effect of 'somewhere else. This
worrying observation corroborates the high carriage The study showed that of the 68 strains analyzed, 41
(58.8%) of ESBLs phenotype observed in this study. carried the qnrS genes, i.e. a prevalence of 60%, of
which 36 possess the qnrB1 to B6 gene (i.e. 52.9%),
In this study, the CTX-M gene was mainly present in 36 other strains have the qnrS1 to qnrS6 gene
E. coli MDR strains with a carriage rate of 72.1%. (52.9%) and 2 isolates carry the gene qnrA1 to A6
Then come in second and third position the TEM (2.9%). A predominance of qnrB and qnrS type
and SHV genes with 54.4% and 16.2% respectively. genes was observed. However, no qnrA gene was
detected by Abbasi and Ranjbar. (2018) in Iran.
Indeed, as our study shows, other work had shown
that the CTX-M gene was the most widespread and The qnrs gene carriage obtained in this study is
dominant gene throughout the world. The latter had slightly higher than that in Nigeria (11%) Onanuga
been reported in Iran (88%) (Pourakbari et al., et al., (2019) and Niger (7%) Aïssatou et al., (2017),
2019); in Brazil (90.32%) (Dexheimer et al., 2015) respectively for qnrA and qnrB. On the other hand,
and in France (96.4%) (Holstein et al., 2010). the qnrS carriage rate (82%) found by Aïssatou et
Studies carried out in Senegal by Diagne et al., al., (2017) is superior to ours. Furthermore, the
(2018) on 32 strains of E. coli producing ESBL had coexistence of two qnrs genes was detected in this
shown that 90.62% of the strains had the CTX-M study with a prevalence of 75.6% (31/41) of qnrB1
gene, followed respectively by the TEM (28%) and to B6 + qnrS1 to S6 and 2.4% (1/41) of qnrA1 to A6
SHV (3.12%) genes. Similar results were observed + qnrB1 to B6genes. The concurrent presence of
in India (CTX-M: 87.5%, TEM: 68.4% and SHV: three (3) qnrS genes in one isolate was not detected
3.1%) (Nisha et al., 2017) and Brazil (CTX-M: 90, in this study.
32%, TEM: 70.96% and SHV: 56.45%) (Dexheimer
et al., 2015). In Chad, Ouchar et al., (2019) obtained The present study results showed that 36 (87.8%) of
97% of the genes from CTX-M. the strains harboring the qnrS genes were resistant to
226
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
at least one antibiotic belonging to the quinolone resistant bacteria in bacteriology laboratories and
and fluoroquinolone family such as nalidixic acid care units and better management of antibiotic
(NA), ciprofloxacin (CIP) and norfloxacin (NOR), consumption are necessary to prevent, monitor,
of which 24 (58.5%) presented the ESBL phenotype. reduce and control transmission and promote
A correlation was observed between the presence of success in the treatment of these bacterial infections.
qnr genes and the resistance to quinolones of E. coli
MDR isolated (P <0.05). These results are similar to Conflict of interest
those observed by Onanuga et al., (2019) and
Ogbolu et al., (2011) in Nigeria and Namboodiri et We declare that there is no conflict of interest.
al., (2011) in Ghana. These different results clearly
explain that the accumulation of mutations within Acknowledgments
the genes coding for the DNA gyrase and
topoisomerase IV enzymes (the main targets of these We would like to thank the Laboratory of the
antibiotics) remains the main mechanism for the UHCof N'Djamena (Chad), the Laboratory of
acquisition of resistance to fluoroquinolones in E. Molecular Biology, Epidemiology and Surveillance
coli. (Muylaert and Mainil, 2013; Drlica and of Bacteria and Viruses Transmitted by Water and
Hooper, 2003). Food,JosephkiZERBO University, Ouagadougou
(Burkina Faso), the Laboratory of Biochemistry,
In fact, multiple mutations are generally necessary Cellular and Molecular Biology, Microbiology
to determine a clinical level of resistance to (L2BCM), University of N'Djamena (Chad), Adam
quinolones because wild E. coli are very sensitive to Barka University of Abéché (Chad) and the
these molecules (Hooper, 1999). The acquisition of University of N'Djamena (Chad).
qnrs genes by ESBL-producing strains sensitive to
quinolones could lead to the selection of References
ciprofloxacin and strains resistant to cephalosporins
and an increase in resistance to fluoroquinolones Abbasi H. and Ranjbar R. (2018).The prevalence of
(Salah et al., 2019). The presence of these genes in quinolone resistance genes of A, B, S in
patients is of concern, due to the potential spread of Escherichia coli strains isolated from three
plasmids which may compromise therapeutic major hospitals in Tehran, Iran, Cent
options and therefore a public health concern. European J Urol. 71: 129-133.
https://doi.org/10.5173/ceju.2018.1539
The global spread of beta-lactam resistance has Aissatou M, Diagbouga S, Nadembèga C, Dabiré A
become a major public health problem. In Chad, M, Salah F, Obiri-Yeboah D, Soubéiga1 S T,
resistance to beta-lactams in Enterobacteriaceae, in Ouattara A K, Zohoncon T, Djigma F,
particular E coli, is constantly increasing. This study Langendorf C and Simporé J. (2017).
showed that there is a high incidence of ESBLs and Quinolone Resistance (qnr) genes in Fecal
quinolone resistance genes among clinical isolates Carriage of Extended Spectrum Beta-
of E.coli isolated in the bacteriology laboratory of Lactamases producing Enterobacteria
the UHC of N'Djamena. Several strains containing isolated from Children in Niger; Current
more than one ESBLs determinant and quinolone Research in Microbiology and
resistance genes were detected. Biotechnology; 1(5): 953-957.
Ambler R P, Coulson A F, Frere J M, Ghuysen J M,
These determinants are at the origin of strains Joris B, Forsman M, Levesque R C, Tiraby
resistant to most beta-lactams and quinolones and G, and Waley S G A. (1991). Standard
challenge conventional treatments. Given these numbering scheme for the class A β-
results, regular and active monitoring of multi- lactamases; Biochem J. 27 (6): 269–270.
227
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
228
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
229
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
230
Int.J.Curr.Microbiol.App.Sci (2023) 12(02): 214-231
https://doi.org/10.4103/0974-777X.68531. 002.
Rodríguez-Baño J, Picón E, Gijón P, Hernández J R, Tansawai U, Timothy R W, Niumsup P R. (2019).
Ruíz M, Peña C. (2010). Community-onset Exrended spectrum β-lactamase-producing
bacteremia due to extended-spectrum β- Escherichia coli among backyard poultry
lactamase-producing Escherichia coli: risk farmrs, and environments in Thailand;
factors and prognosis; Clin Infect Dis, Poultry Sciences Association; 98(6):2622-
50(1):40-8. PubMed Google Scholar. 2631. https://doi.org/10.3382/ps/pez009.
https://doi.org/10.1086/649537. Udomsantisuk N, Nunthapisud P, Tirawatanapong
Salah F D, Soubeiga S T, Ouattara A K, Sadji A Y, T, Dansuputra M. (2011). Molecular
Metuor-Dabire A, Obiri-Yeboah D, Banla- characterization of extended-spectrum beta-
Kere A, Karou S, and Simpore J. (2019). lactamase among clinical isolates
Distribution of quinolone resistance gene Escherichia coli and Klebsiella pneumonia;
(qnr) inESBL-producing Escherichia coli 94(12): 1504-12.
and Klebsiella spp. in Lomé, Togo; 8:104. Veenemans J, Overdevest I T, Snelders E,
https://doi.org/10.1186/s13756-019-0552-0. Willemsen I, Hendriks Y, Adesokan A.
Schito G C, Naber K G, Botto H, Palou J, Mazzei T, (2014). Next-generation sequencing for
Gualco L. (2009). The ARESC study: an typing and detection of resistance genes:
international survey on the antimicrobial performance of a new commercial method
resistance of pathogens involved in during an outbreak of extended-spectrum-
uncomplicated urinary tract infections; Int J beta-lactamase-producing Escherichia coli; J
Antimicrob Agents; 34:407–13. ClinMicrobiol ; 52:2454–60.
https://doi.org/10.1016/j.ijantimicag.2009.04 https://doi.org/10.1128/JCM.00313-14.
.012 Yandaï F H, Zongo C, Moussa A M, Bessimbaye N,
Spanu, T., Luzzaro F, Perilli M, Amicosante G, Tapsoba F, Savadogo A, Barro N,
Toniolo A, and Fadda G. (2002). Occurrence Ndoutamia, G. & Traoré A S. (2014).
of extended-spectrum beta-lactamases in Prevalence and antimicrobial susceptibility
members of the family Enterobacteriaceae in of faecal carriage of Extended-Spectrum β-
Italy: implications for resistance to beta- lactamase (ESBL) producing Escherichia
lactams and other antimicrobial drugs; coli at the “Hôpital de la Mère et de
Antimicrob. Agents Chemother. 46:196–202. l’Enfant” in N’Djamena, Chad., Scientific
https://doi.org/101128/AAC.46.1.1966202.2 Journal of Microbiology, 3, 25-31.
Abba Hamadou, BA Ban-bo, kuan A Traoré, Jean BienvenueOuoba, G Kadidja, Marguerite Edith M.
Nikiema, Evariste Bako, SCBouda, SAM Mahamat, N Bessimbaye and Nicolas Barro. 2023.
Characterization of Quinolone Resistance and ESBLs Genes Produced by Escherichia coli Isolated at the
UHC-the National Reference in N'Djamena-Chad. Int.J.Curr.Microbiol.App.Sci. 12(02): 214-231.
doi: https://doi.org/10.20546/ijcmas.2023.1202.021
231