Histamine Receptor Roles in Colonic Cancer
Histamine Receptor Roles in Colonic Cancer
3 Zhongcheng Shi a,b, Robert S. Fultz b,c, Melinda A. Engevik a,b, Chunxu Gao d, Anne Hall
b,e
4 , Angela Major b, Yuko Mori-Akiyama a,b, James Versalovic a,b
a
5 Department of Pathology and Immunology, Baylor College of Medicine, Houston, TX, USA
b
6 Department of Pathology, Texas Children’s Hospital, Houston, TX, USA
c
7 Graduate Program in Integrative Molecular and Biomedical Sciences, Baylor College of Medicine,
d
9 Alkek Center for Metagenomics and Microbiome Research, Molecular Virology and Microbiology,
e
11 Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, TX, USA
12
13
15 James Versalovic, MD, PhD, Department of Pathology & Immunology, Baylor College of Medicine,
18
19
20
1
22 Abstract
23 Inflammatory bowel disease (IBD) is a well-known risk factor for the development of colorectal
24 cancer. Prior studies have demonstrated that microbial histamine can ameliorate intestinal
26 suppresses inflammation-associated colon cancer in Apcmin/+ mice. Mice were colonized with the
28 low-dose dextran sulfate sodium (DSS). Mice that were given histamine-producing L. reuteri via
29 oral gavage developed fewer colonic tumors, despite the presence of a complex mouse gut
32 antagonist significantly increased both tumor number and size. The bimodal functions of
33 histamine include pro-tumorigenic effects through H1R and anti-tumorigenic effects via H2R,
34 and these results were supported by gene expression profiling studies on tumor specimens of
35 patients with colorectal cancer. Greater ratios of gene expression of H2R (HRH2) versus H1R
36 (HRH1) were correlated with improved overall survival outcomes in patients with colorectal
38 kinases (MAPKs) and inhibited chemokine gene expression induced by H1R activation in
39 colorectal cancer cells. Moreover, the combination of a H1R antagonist and a H2R agonist
41 macrophages. Given the impact on intestinal epithelial and immune cells, simultaneous
42 modulation of H1R and H2R signaling pathways may be a promising therapeutic target for the
46 histamine may depend on the relative activity of H1R and H2R signaling pathways in the
2
47 intestinal mucosa. Our findings suggest that treatment with H1R or H2R antagonists could yield
48 opposite effects. However, by harnessing the ability to block H1R signaling while stimulating
49 H2R signaling, novel strategies for suppression of intestinal inflammation and colorectal
52 kinases
53 INTRODUCTION
54 Discovered more than 100 years ago, histamine is an important signaling compound
56 vascular tone and gastric acid secretion, inflammation, allergy, and development of cancer (14,
57 37). The pleiotropic effects of histamine are mediated by the potential activation of each of four
58 histamine receptors (H1R, H2R, H3R and H4R) present on mammalian cells. H1R, H2R and
59 H4R have been well described in human and mouse immune cells, cholangiocytes, hepatocytes,
60 and endothelial cells (17, 71), whereas H3R is primarily expressed in neurons of the central
61 nervous system (CNS) (21). Histamine influences myeloid cell differentiation (72), and H1R and
62 H4R are considered to be the two histamine receptors involved in allergic inflammation (64).
63 H2R is central in gastric acid production (8). Clearly, histamine is a biogenic amine synthesized
65 Previous studies have focused on the contrasting effects of histamine receptors with respect
66 to inflammation and immune cell signaling (35). The effects of H1R and H2R in chronic
67 inflammation and in inflammation-associated colon cancer are not fully understood. H1R
68 activation regulates downstream pathways through intracellular calcium [Ca2+]i, while H2R
69 signals through cyclic AMP (cAMP) (15). Activation of H1R and H2R has been widely shown to
70 yield opposing effects in multiple biological processes. For example, in human T-cell mediated
71 immune responses, H1R activation promotes Th1 polarization, while H2R activation suppresses
3
72 Th1 polarization (46, 61). Distinct effects of H1R and H2R activation were also evident in terms
73 of smooth muscle contraction. H1R and H2R antagonists, respectively, inhibit and exacerbate
74 histamine-induced bronchoconstriction in patients with mild asthma (53). These findings strongly
75 suggest that histamine may have opposing effects depending on the specific histamine receptor
76 that is activated.
77 In the pathogenesis of IBD, activation of MAP kinase and nuclear factor-kappa B (NF-B)
78 pathways are key events that enhance the production of pro-inflammatory cytokines, such as
79 TNF and IL-6 (5, 12). Therefore, IBD medications have been developed that target specific
80 cytokine signaling pathways (26). Histamine was detected in increased concentrations in the
81 intestinal mucosa of IBD (55) and promoted ERK phosphorylation through H1R activation in
82 human epidermal keratinocytes (45) and aortic endothelial cells (25). Although it is not clear
83 whether H1R is involved in MAP kinase activation in intestinal epithelial cells, H1R antagonists,
84 such as loratadine (56) and ketotifen (32), have been used to alleviate clinical symptoms in IBD.
85 In contrast, studies have shown that administration of the H2R antagonist, cimetidine, resulted
86 in more rapid death of mice in an intestinal infection model (24) and our previous study showed
87 that H2R activation suppressed TNBS-induced colonic inflammation in mice (20). Interestingly,
88 H2R blockers also increased the frequency of hospitalization or surgery in patients with
89 ulcerative colitis (UC) (34) as well as cancer risk, including intestinal cancers (50). Furthermore,
90 the H2R agonist, dimaprit, was reported to reduce TNF production induced by LPS in mouse
92 A link between chronic inflammation and colorectal cancer (CRC) is well recognized (4, 51,
94 gene (Hdc) knockout mice that lacked the ability to synthesize endogenous histamine and
95 yielded increased susceptibility to chemically induced colon cancer (72). Our group
96 demonstrated that L. reuteri-derived histamine suppressed tumor formation in the colons of Hdc
4
98 derived cells (16). Abrogation of H1R signaling with antagonists enhanced radio-sensitivity,
99 resulted in reduced viability of colon cancer cells. Furthermore, elevated expression of the
100 HRH1 gene has been shown to be associated with poor survival for both lung cancer and B-cell
101 lymphoma patients (70). Several other studies demonstrated that H1R activation suppressed
102 cell proliferation in prostate cancer (67), melanoma (40) and leukemia (31) cells, and promoted
103 cell migration of cervical carcinoma cells (57). Altogether, the effects of histamine receptor
104 activation seem to be tissue specific, depending on relative distributions of histamine receptors
105 in different tissue types (37). In addition to the crucial role in IBD, MAPKs are also critical
106 mediators of signal transduction in cancer development. For example, ERK activation promotes
107 intestinal tumorigenesis in ApcMin/+ mice (41) and results in increased proliferation of colon
108 cancer cells in vitro (33). By contrast, H2R activation suppressed ERK phosphorylation in
109 human monocytes (63), and promoted ERK phosphorylation in HEK293T cells (10). The precise
111 tumorigenesis through H1R and H2R signaling pathways remain to be elucidated.
112 In this study, we demonstrated that H1R signaling promoted intestinal tumor formation in vivo
113 and proliferation of colorectal cancer-derived intestinal epithelial cells. By contrast, H2R
114 signaling suppressed tumor growth in inflammation-associated colon cancer in mouse models.
115 To explore the implications in human cancer, we found that an increased ratio of HRH2 versus
116 HRH1 gene expression was associated with improved survival rates of CRC patients. We
117 attempt to delineate molecular mechanisms explaining how histamine regulates chronic
118 intestinal inflammation via different receptors, H1R and H2R, and how this deeper
119 understanding of intestinal histamine signaling may facilitate the development of new preventive
120 strategies and therapeutics in the future. New therapies aimed at blocking H1R signaling while
121 promoting H2R signaling may offer real promise as cancer therapeutic strategies.
5
123 Mice. Apcmin/+ mice were maintained under specific pathogen-free (SPF) conditions with a 12-
124 h light and 12-h dark cycle in animal facilities at Baylor College of Medicine. Two-month-old
125 male mice were randomly divided into 3 groups (n = 8-11 mice per group, 3-4 mice per cage),
126 and were gavaged with 5x109 colony forming units (CFUs) of histamine-producing L. reuteri
127 6475, histamine negative L. reuteri 6475 (inactivated hdcA and unable to convert L-histidine into
128 histamine), or control media (MRS without bacteria), daily for 7 days. Thereafter mice were
129 given two cycles of 1.5% DSS (36,000 to 50,000 molecular weight; MP Biomedicals, Solon, OH)
130 in drinking water as follows: DSS for 5 consecutive days followed by 17 days of recovery, and a
131 second cycle of DSS for 4 days followed by 18 days of recovery. During DSS treatments and
132 recovery periods, the mice received either histamine-generating L. reuteri 6475, histidine
133 decarboxylase (HdcA)-deficient L. reuteri 6475, or control media once every 3 days. At the end
134 of the second recovery period, mice were euthanized, and tumors were counted and measured
135 under a dissecting microscope by two individuals blinded to the mouse treatment groups. The
136 intestinal tissues were fixed in formalin and embedded in paraffin (FFPE) for histologic
137 evaluation. Dysplasia was counted throughout the colon on H&E stained sections.
138 To study receptor-specific effects of histamine, Apcmin/+ mice were given pyrilamine (H1R
139 antagonist, 50mg/L)(65), cimetidine (H2R antagonist, 100mg/L)(1), or omeprazole (proton pump
140 inhibitor, 10mg/L)(30) in drinking water (All drugs are fully dissolved in water at the designated
141 concentrations) starting 7 days prior to DSS treatment 1 until completion of the second recovery
142 period post-DSS treatment 2. Mice were then euthanized and processed as mentioned above.
143 All procedures were approved by the Institutional Review Board at Baylor College of Medicine.
144 Human cell lines. Human colorectal cancer-derived cell lines, including HCT116, Caco2,
145 DLD1, LS174T and HT29 (all from ATCC, Manassas VA), were grown in DMEM containing 10%
146 fetal bovine serum (Gibco Life Technologies, Carlsbad, CA) in a humidified 5% CO2 atmosphere
147 at 37°C.
6
148 L. reuteri strains. L. reuteri 6475 and the isogenic hdcA mutant strain were prepared as
149 described previously (63). Bacterial cells were cultured in MRS medium at 37°C in anaerobic
151 Antibodies, plasmids and chemicals. Antibodies are listed in Table 1. Recombinant plasmids
152 were generated for ectopic expression of histamine receptor genes. Full-length open reading
153 frames of the wild type mouse Hrh1 and Hrh2 genes were sub-cloned into the mammalian
154 expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA). The constructs were confirmed by DNA
155 sequencing. Transfections were performed with 1 μg of plasmid DNA per well (24-well plate)
156 and 2 μl of FuGENE HD transfection reagent (Roche, Indianapolis, IN). Chemicals including
157 pyrilamine maleate salt and cimetidine were purchased from Sigma-Aldrich (St Louis, MO).
158 Omeprazole was obtained from TCI America (Portland, OR). Dimaprit dihydrochloride was
159 obtained from Biotrend (Destin, FL), and 2-Pyridylethylamine dihydrochloride was purchased
162 FFPE intestinal tissue sections using a goat polyclonal anti-H1R antibody (Santa Cruz, Dallas,
163 TX). Slides were deparaffinized in xylene, hydrated with a series of washes using graded
164 alcohols, followed by antigen retrieval with Tris-EDTA buffer (pH 8.0, 1 mM EDTA, 10 mM Tris)
165 in a steamer for 30 minutes. After a wash with TBS-T (50mM Tris-Cl), slides were blocked with
166 10% goat serum for 30 minutes, and then incubated with primary antibodies in TBS-T buffer at
167 4°C overnight. Dilutions for antibodies were listed in Table 1. After washing with TBS-T, slides
168 were incubated with Alexa Fluor-conjugated secondary antibodies (Invitrogen, Carlsbad, CA) for
170 staining of cultured cells, HCT116 cells were fixed with 4% paraformaldehyde for 10 minutes
171 followed by 0.5% Triton X-100 incubation for 5 minutes, and then blocked as described above.
172 Immunofluorescence images were generated by fluorescence microscopy (Nikon Eclipse 90 Ni-
173 E). For BrdU labeling, mice were injected with 200 µl of BrdU 2 hours before killing (Invitrogen,
7
174 Carlsbad, CA) and staining was performed on FFPE sections of colon tumors using a rat anti-
175 BrdU antibody (Accurate, Westbury, NY), and then visualized with the ABC-Elite Kit using
177 Immunoblots. Lysates from HCT116 cells or tissues were obtained with RIPA lysis buffer
178 (Thermo Fisher Scientific, Waltham, MA) containing a protease inhibitor cocktail (Roche,
179 Indianapolis, IN). Supernatants containing proteins were resolved by SDS polyacrylamide gel
180 electrophoresis (SDS-PAGE) and transferred to PVDF membranes (Millipore, Billerica, MA).
181 Membranes were blocked with 5% dry milk and incubated with primary antibodies overnight at
182 4°C. After washes with TBST, membranes were incubated with horseradish peroxidase-
183 conjugated secondary antibodies for 1 hour at room temperature, and developed with ECL
184 substrate (GE Health Care, Buckinghamshire, UK). Densitometric analyses of immunoblots
186 RNA extraction and RT-qPCR analysis. Total RNA was extracted using Trizol reagent (Life
188 transcription (RT) was prepared from 1 μg of total RNA using SuperScript II reverse
189 transcription kit (Roche). Quantitative PCR analyses were then performed using Fast SYBR
190 Green (Life Technologies) and amplified on the Applied Biosystems 7900HT instrument.
191 Ribosomal RNA (18S) was used as a control. Primers were listed in Table 2. Relative levels of
192 gene expression were analyzed using the comparative CT method (2-∆∆CT method).
193 Cell viability assay. HCT116 cells (1x103/ well) were plated and cultured in a 96-well plate
194 overnight. Cells were treated with dimaprit dihydrochloride (25 μM), 2-Pyridylethylamine
195 dihydrochloride (25 μM) or both for 4 days. Cell viability was determined using a Cell Counting
196 Kit-8 (CCK-8) assay (Dojindo Molecular Technologies, Gaithersburg, MD) and the absorbance
197 was read at 450 nm using a spectrophotometer. For transfected HCT116 cells, cell viability was
8
199 Statistical analyses. Statistical analyses were performed using GraphPad Prism version
200 5.04 (GraphPad Software, San Diego, CA). All data were normally distributed and examined
201 using parametric tests. Data for tumor counts were analyzed by one-way ANOVA with a
202 Bonferroni post-hoc test. The band densities of immunoblots at different time points were
203 analyzed by two-way repeated measures ANOVA with a Bonferroni post-hoc test. The results of
204 quantitative PCR (Figs 4 and 5) and cell viability assay were analyzed by one-way ANOVA with
205 a Bonferroni post-hoc test. The results of quantitative PCR studies in Figure 2 and BrdU-positive
206 cell counts were analyzed using unpaired, two-tailed Student's T-test. Statistical test results are
207 presented as mean +/- standard deviation (SD). P values are indicated by asterisks as follows:
208 *p < 0.05, **p < 0.01 and ***p < 0.001.
209 RESULTS
211 model.
212 To test the hypothesis that histamine generating bacteria may suppress inflammation-
214 colon cancer (11, 62). In this model, chronic inflammation is induced by multiple cycles
215 of low-dose DSS treatment in drinking water with recovery phases in Apcmin/+ mice. DSS
216 treatment induced dysplastic lesions and tumors in the mouse colon and cecum. Apcmin/+
217 mice received wild-type L. reuteri, hdcA mutant L. reuteri (19), or control media via orogastric
218 gavage daily for one week prior to the initial DSS treatment of 5 days duration (Figure 1A).
219 Thereafter, mice were gavaged once per 3 days throughout the study, based on prior results,
220 demonstrating that orally administered L. reuteri remain in the mouse colon for at least two days,
221 regardless of histamine status (19). Mice that received histamine-producing L. reuteri developed
222 fewer colonic tumors (p < 0.05) and exhibited fewer dysplastic lesions (low-grade) in
9
223 comparison to those in the MRS media only group, while histamine-negative L. reuteri did not
224 suppress colonic tumor formation (Figure 1B) or intestinal dysplasia (Figure 1C, 1D). However,
225 mean tumor size was not significantly different between treatment groups (data not shown).
226 Across all groups, DSS-induced tumors were mostly confined to the mid-colon rather than the
227 distal colon. Although histologic differences were not observed in the adenomas among different
228 groups, mice that received histamine-producing L. reuteri had fewer dysplastic lesions,
229 indicating that bacterial histamine from the intestinal microbiome is capable of suppressing
231 H2R signaling blockade promotes colonic tumorigenesis in Apcmin/+ mice. To test
232 the effects of histamine via different histamine receptors, Apcmin/+ mice were treated with DSS
233 and either a H1R or H2R antagonist. To address the potential confounding effects of histamine
234 receptor signaling on gastric acid production, one group of mice was treated with omeprazole
235 (Figure 2A). Omeprazole suppresses gastric acid secretion via direct inhibition of proton pumps
236 in the gastric epithelium, leaving histamine receptor signaling intact (38). Mice treated with
237 pyrilamine, a H1R antagonist, developed fewer tumors both in the cecum and in the colon
238 (Figure 2B) compared to control mice, while mice treated with the H2R antagonist, cimetidine,
239 yielded a significantly increased tumor burden (Figure 2B). Treatment with omeprazole did not
240 significantly affect tumor number compared to the untreated control group. The data indicated
241 that H1R activation promotes tumor initiation and growth, while H2R activation suppresses
243 In addition to promoting cancer initiation, H2R signaling blockade with cimetidine also
244 resulted in increased tumor sizes in the cecum and in the colon (Figure 2C) in DSS treated
245 ApcMin/+ mice. This finding suggests that H2R activation suppresses tumor growth. More BrdU-
246 positive cells were visible per microscopic high-power field (HPF) in colonic tumors of
247 cimetidine-treated mice (Figure 2D), supporting the suppressive role of H2R signaling in colonic
10
248 tumor cell proliferation. These results strongly suggest that H2R antagonists could potentially
249 aggravate intestinal inflammation in IBD and may promote colonic tumorigenesis.
251 ApcMin/+ mice (41). To explore whether H2R activation inhibits ERK phosphorylation in vivo, we
252 compared ERK phosphorylation in tumors of ApcMin/+ mice treated with cimetidine by
253 immunoblot. Cimetidine treatment dramatically increased ERK phosphorylation (Figure 2E, left),
254 demonstrating that H2R blockade results in activation of the ERK signaling pathway in this
255 model of inflammation-associated colon cancer. Consequently, the increased ERK activity in
256 tumors elevated the expression of ERK-regulated genes, such as Egr1, by qPCR (Figure 2E,
257 right). EGR1 is increased in human colorectal cancer cell lines as well as in colorectal cancer
258 (29) and greater quantities of EGR1 promote CRC cell survival (43). Our study suggests that
259 cimetidine administration could promote colorectal carcinogenesis via the ERK/EGR1 signaling
260 pathway.
262 epithelial cells. To evaluate the presence of H1R in human colorectal cancer cells, dual
263 immunostaining was performed with antibodies against H1R and proliferating cell nuclear
264 antigen (PCNA), a marker of cell proliferation, in a specimen from a patient with advanced
265 (stage IV) colorectal cancer. Robust H1R signals were observed in human colorectal cancer
266 cells with prominent PCNA staining (Figure 3A). Transfection of additional copies of the mouse
267 H1R gene in human colorectal cancer-derived epithelial cells (HCT116 cells) resulted in
268 increased cellular viability, and transfection of mouse H2R gene on a plasmid-borne vector did
269 not increase viability of HCT116 cells. Excess H2R signaling was dominant over H1R signaling
270 (Hrh1+Hrh2) (Figure 3B). HCT116 cell viability was enhanced by 2-pyridylethylamine (H1RA), a
271 H1R agonist, which can be suppressed by dimaprit (H2RA), a H2R agonist (figure 3C), further
11
272 supporting contrasting roles of H1R and H2R signaling pathways in intestinal epithelial cell
273 proliferation.
275 colorectal cancer-derived cells. To test whether the activation of H1R and H2R may
276 modify ERK phosphorylation in intestinal cancer cells, we again produced plasmid-borne H1R
277 and H2R in HCT116 cells with either or both Hrh1 and Hrh2 plasmids. Upon histamine
278 treatment, H1R-overproducing HCT116 cells showed enhanced phosphorylation of JNK and
279 ERK MAP kinases (Figure 4A). Simultaneous overproduction of H2R suppressed H1R-mediated
280 activation of ERK and JNK at the 30- and 60-min time points, as measured by immunoblot
281 (Figure 4A, 4B). The activity of these constructs was confirmed by immunoblot using H1R and
282 H2R antibodies, respectively (Figure 4C). Furthermore, when treated with histamine, HCT116
283 cells showed phosphorylated ERK in nuclei exclusively within cells that produce H1R by
284 immunofluorescence (Figure 4D), while H2R overproducing cells show only sparse, if any,
286 Moreover, in H1R overproducing HCT116 cells, histamine significantly elevated quantities
287 of chemokine mRNA, including CCL20 and IL8, which were suppressed by the presence of H2R
288 (Figure 4F and 4G). These data demonstrated that H2R signaling is capable of suppressing
289 ERK signaling and chemokine gene expression induced by activation of H1R signaling in colon
294 mouse models (42, 72). Histamine suppressed TNF production via H2R activation in both
295 human PBMCs (68) and human monocytoid cells (63). IL-6 plays a key role in the development
296 of inflammation-associated colon cancer (23). Thus, we sought to determine whether H1R and
12
297 H2R signaling pathways affect LPS-induced pro-inflammatory cytokine gene expression in
298 macrophages. Quantitative PCR experiments showed that histamine (10 µM) significantly
299 suppressed both TNF and IL6 gene expression induced by LPS in both human THP-1
300 monocytoid cells and mouse RAW 264.7 macrophages (Figure 5A and B). Furthermore,
301 cytokine suppression by histamine can be blocked by H2R antagonist cimetidine (Figure 5A and
302 B), demonstrating that histamine suppresses the transcription of these two genes via H2R
303 signaling. Meanwhile, administration of H1R antagonist, pyrilamine, reduced the expression of
304 IL6, but not TNF(Figure 5A and B). These findings strongly indicate that histamine promotes IL-
305 6 expression via H1R activation and suppresses IL-6 expression via H2R signaling in human
307 Next, we examined the effects of a combination of H1R antagonist (pyrilamine) and H2R
308 agonist (dimaprit) on LPS-induced MAPK and NF-κB pathways in RAW 264.7 cells to test if
310 stimulation increased phosphorylation of p38, ERK and p65 after 30 min (light grey +) and 120
311 min (black +). In contrast, administration of histamine, dimaprit or pyrilamine reduced LPS-
312 induced ERK phosphorylation, but did not affect p65 phosphorylation. Notably, the combination
313 of pyrilamine and dimaprit resulted in the most potent suppression of LPS induced p38 and ERK
314 phosphorylation (Figure 5C, upper panel), which was quantified using Band Leader software
315 (Figure 5C, lower panels). Together, we confirmed that simultaneous inhibition and stimulation
316 of H1R and H2R signaling pathways, respectively, can effectively suppress pro-inflammatory
318 Expression of HRH1 and HRH2 is correlated with patient outcomes in human
319 colorectal cancer. To explore the roles of H1R and H2R signaling pathways in human
320 colorectal cancer, we examined if elevated expression of HRH1 or HRH2 in CRC tissue
321 specimens were associated with CRC patient outcomes using the R2 Platform (human gene
13
322 expression profiling database; http://r2.amc.nl). Analysis of the microarray dataset GSE17538
323 revealed that CRC patients with elevated HRH1 human gene expression had worse overall
324 survival than those with lower HRH1 expression (Figure 6A, left). However, elevated HRH2
325 expression was associated with an improved 10-year better survival (Figure 6A, right),
326 suggesting that H2R and H1R signaling pathways yield contrasting effects on CRC and its
327 progression. These results are consistent with results obtained with mouse models and human
329 The observation that H2R activation counteracts H1R signaling in colon cancer cells
330 suggests that the ratio of HRH2 / HRH1 gene expression may provide insight in terms of patient
331 survival. Another platform, PROGgeneV2 (human gene expression profiling database) (22),
332 allowed us to examine the correlations between the ratios of HRH2 and HRH1 gene expression
333 and the survival of stage-matched colorectal cancer patients. We found that neither HRH1 nor
334 HRH2 gene expression was a robust prognostic marker independently in this dataset
335 (GSE17536), but that patients with an elevated ratio of HRH2 to HRH1 gene expression
336 exhibited markedly improved overall survival (p = 0.035, Figure 6B). A similar tendency was
337 also observed in other datasets including GSE41258, GSE24551 and GSE29621 (data not
338 shown). Therefore, the expression ratio of two human histamine receptor genes, HRH2/HRH1,
339 can potentially be used as a prognostic marker for CRC patients. These findings were
340 consistent with our observations in the ApcMin/+ mouse model experiments.
341 In our studies, H1R promoted tumorigenesis in murine colon tumors and elevated HRH1
342 expression was correlated with a relatively poor survival of CRC patients. In addition, increased
343 HRH1 expression was also correlated with poor prognosis in pancreatic cancer (GSE21501,
344 data not shown). These data strongly indicate that H1R function is cell and tissue type specific.
345 Besides colorectal cancer, we also compared the expression patterns of HRH1 and HRH2
346 across 15 different human cancers using the R2 platform. Different cancers displayed different
14
347 expression ratios of HRH1 or HRH2. For example, HRH1 mRNA quantities were greater than
348 HRH2 in esophageal cancer, whereas the quantities of HRH2 mRNA were greater than that of
349 HRH1 in chronic lymphocytic leukemia (CLL) (data not shown), suggesting that histamine
350 receptor signaling pathways may act similarly in neoplasms of the gastrointestinal tract and
352 DISCUSSION
353 Gut microbe-derived histamine can suppress colon cancer in a mammalian host, and the
354 impact of microbial histamine on the development of colonic neoplasms depends on the relative
355 balance between H1R and H2R signaling pathways. In our mouse model studies, H2R signaling
357 gut inflammation and colonic carcinogenesis. In human colon cancer-derived cells and immune
358 cells, H2R signaling counteracted H1R-mediated MAPK activation, and MAPK activation
359 contributes to the development of chronic intestinal inflammation and cancer. These findings in
360 human cell culture and mouse models are consistent with patient outcomes based on gene
361 expression profiles in human CRC, whereby elevated HRH1 and reduced HRH2 gene
362 expression were correlated with worse patient outcomes. Together, the data suggest that the
363 ratio of HRH2/HRH1 expression in human tissue could represent a new prognostic biomarker
364 for IBD and CRC, and such insight could point the way to new disease preventive and
366 Intestinal epithelial cells secrete pro-inflammatory chemokines, including IL-8 and CCL20,
367 to recruit immune cells to local sites of antigen presentation or injury and elicit inflammation. We
368 demonstrate that histamine elevates expression of both IL8 and CCL20 through H1R/MAP
369 kinases in intestinal epithelial cells, such as ERK and JNK, and that these effects were reversed
370 by H2R activation. Prior studies showed that histamine promotes IL-8 expression through H1R
371 signaling in human bronchial epithelial cells (3). We have extended this observation to intestinal
15
372 epithelial cells which may include both H1R and H2R signaling pathways to maintain intestinal
373 homeostasis. Tilting towards increased H1R (relative to H2R) signaling may promote chemokine
374 production and induce inflammation. Consistent with our results, R2 database analysis showed
375 elevated HRH1 gene expression in the IBD mucosa (data not shown). In addition, several
376 previous studies reported increased pro-inflammatory cytokines, such as IL-8 and CCL20 in the
378 In the inflamed gut mucosa, infiltrating immune cells are a major source of cytokines, in
379 which IL-6 is a key contributor to the development of IBD and inflammation-associated CRC (6).
380 We show that LPS-induced IL6 expression was elevated via H1R signaling and suppressed via
381 H2R signaling by histamine in human monocytes and mouse macrophages. Our findings agree
382 with those of other studies, where it has been shown that histamine suppresses LPS driven pro-
383 inflammatory cytokine secretion (TNF, IL-12, CXCL10) in dendritic cells (DC) (18) and in
384 peritoneal macrophages via H2R signaling in mice (44). Our results suggest that long-term use
385 of H2R blockers might promote colonic tumor initiation in IBD. In contrast, H1R antagonists
386 (conventional antihistamines) and H2R agonists may suppress inflammation by potently
387 suppressing LPS-induced p38 MAPK activation in macrophages. The p38 MAPK pathway is a
388 key signaling pathway in chronic inflammation and cancer development (73). In IBD, activation
389 of p38 signaling results in elevated TNF expression (69) and in mouse models of colon cancer;
390 inactivation of p38 MAPK signaling significantly suppressed colon tumor development (9).
391 Therefore, a combination of a H2R agonist and a H1R antagonist may effectively suppress p38
392 MAPK and represent a promising new preventative or therapeutic approach for IBD and CRC.
393 In clinical trials, CNI-1493, a non-selective p38 and JNK inhibitor, significantly improved severe
394 Crohn's disease in a small cohort study, suggesting that p38 could be a potential target in IBD
395 treatment (28). However, a larger cohort study using a specific p38 inhibitor, BIRB 796, failed to
396 treat active Crohn’s disease, due to serious adverse events (59). The p38 signaling pathway
16
397 may be targeted with microbiome-based treatment strategies, possibly reducing adverse effects
399 The role (s) of histamine on the prevention or development of human cancers remains
400 controversial. For example, histamine increased cell proliferation in human hepatocellular
401 carcinoma and melanoma by acting as an autocrine or paracrine growth factor (7, 39), while a
402 different study showed that histamine suppressed cell proliferation in pancreatic cancer (13). In
403 considering histamine’s specific effects, allergic diseases may affect cancer risk. Several
404 studies showed that a history of allergies yielded an inverse correlation with disease risk
405 including particular human cancers (2, 27, 54). In a large-scale prospective study in women,
406 those with a history of allergic disease including allergic rhinitis and asthma, had a significantly
407 lower incidence of colorectal cancer (54). A history of allergies or other atopic conditions and
408 glioma susceptibility were found to be inversely correlated (2). In addition, a large-scale
410 cancer among those who had a prior history of allergies (27). The concomitant use of
411 antihistamines which suppress H1R signaling may be useful for treatment of allergic disease
412 and prevention of specific human cancers based on our findings. Meanwhile, allergy may be a
413 risk factor for lymphatic-hematopoietic malignancies, prostate and breast cancers (48, 49). In
414 different types of allergic diseases, histamine may induce or exacerbate allergic reactions,
415 mainly through H1R and H4R. Locally manipulating the balance of H1R and H2R signaling
416 could be an ideal strategy to leverage the ability to modulate cancer treatment. Furthermore, the
417 net effect of H2R signaling on human colon tumors may depend on the microenvironment of the
418 tumors. A recent study demonstrated that cimetidine treatment promoted tumor growth in
419 orthotopically implanted human colon tumors in nude mice, while cimetidine treatment
420 suppressed tumor growth when implanted subcutaneously (1, 58). This finding shed light on the
421 role of the tumor microenvironment affecting tumor growth. Therefore, treatment with H1R or
422 H2R antagonists may differentially influence primary and metastatic tumors in cancer patients.
17
423 Mammalian microbiome science is providing opportunities for scientists to interrogate known
424 and new signaling pathways for possible contributions to cancer outcomes. Our studies with
425 microbial histamine extend the literature on a metabolite known for more than a century, but a
426 new “microbiome lens” enables investigators to examine histamine receptor signaling as a
427 communication link between gut microbes and mammals. As a result of these investigations, we
428 can target specific human genes and signaling pathways using thousands of data points from
429 databases linking cancer gene expression profiles and patient survival data (e.g. R2 and
430 PROGgene). By exploring H1R and H2R signaling pathways using this approach, we detected
431 an association between the higher ratio of H2R/H1R gene expression and longer survival in
432 colorectal cancer. Such findings establish a direction for future studies in patients and may
433 contribute to the development of molecular diagnostics using tissue-based gene expression.
434 New therapeutics could be developed by combining strategies for blocking H1R signaling and
435 promoting H2R signaling, in combination with compounds targeting other signaling pathways.
436 Finally, such combination strategies could be used to prevent colorectal cancer in at-risk patient
437 populations.
438 GRANTS
439 This work was supported by the NIH, including Texas Medical Center Digestive Disease
440 Center grant P30 DK56338, National Cancer Institute grant U01 CA170930 (J.V.), and
442 DISCLOSURES
443 Conflicts of interest, financial or otherwise, are declared by the authors. J.V. served on the
444 medical advisory board of Diversigen Inc. J.V. also served on the scientific advisory boards of
18
447 Z.S., Y.M.A. and J.V. conceived and designed research; Z.S., R.S.F., M.A.E., C.G., A.H. and
448 A.M. performed experiments; Z.S. and Y.M.A. analyzed data; Z.S. and Y.M.A. interpreted
449 results of experiments; Z.S. prepared figures; Z.S. and Y.M.A. drafted manuscript; Z.S., Y.M.A.
450 and J.V. revised manuscript; Y.M.A. and J.V. approved final version of manuscript.
451 REFERENCES
452 1. Adams WJ, Lawson JA, and Morris DL. Cimetidine inhibits in vivo growth of human colon
453 cancer and reverses histamine stimulated in vitro and in vivo growth. Gut 35: 1632-1636,
454 1994.
455 2. Amirian ES, Zhou R, Wrensch MR, Olson SH, Scheurer ME, Il'yasova D, Lachance D,
456 Armstrong GN, McCoy LS, Lau CC, Claus EB, Barnholtz-Sloan JS, Schildkraut J, Ali-
457 Osman F, Sadetzki S, Johansen C, Houlston RS, Jenkins RB, Bernstein JL, Merrell RT,
458 Davis FG, Lai R, Shete S, Amos CI, Melin BS, and Bondy ML. Approaching a Scientific
459 Consensus on the Association between Allergies and Glioma Risk: A Report from the
460 Glioma International Case-Control Study. Cancer Epidemiol Biomarkers Prev 25: 282-290,
461 2016.
462 3. Aoki Y, Qiu D, Zhao GH, and Kao PN. Leukotriene B4 mediates histamine induction of NF-
463 kappaB and IL-8 in human bronchial epithelial cells. The American journal of physiology 274:
464 L1030-1039, 1998.
465 4. Asquith M and Powrie F. An innately dangerous balancing act: intestinal homeostasis,
466 inflammation, and colitis-associated cancer. The Journal of experimental medicine 207:
467 1573-1577, 2010.
468 5. Atreya I, Atreya R, and Neurath MF. NF-kappaB in inflammatory bowel disease. J Intern
469 Med 263: 591-596, 2008.
470 6. Atreya R and Neurath MF. Involvement of IL-6 in the pathogenesis of inflammatory bowel
471 disease and colon cancer. Clin Rev Allergy Immunol 28: 187-196, 2005.
472 7. Blaya B, Nicolau-Galmes F, Jangi SM, Ortega-Martinez I, Alonso-Tejerina E, Burgos-
473 Bretones J, Perez-Yarza G, Asumendi A, and Boyano MD. Histamine and histamine
474 receptor antagonists in cancer biology. Inflamm Allergy Drug Targets 9: 146-157, 2010.
475 8. Brimblecombe RW, Duncan WA, Durant GJ, Emmett JC, Ganellin CR, Leslie GB, and
476 Parsons ME. Characterization and development of cimetidine as a histamine H2-receptor
477 antagonist. Gastroenterology 74: 339-347, 1978.
478 9. Chiacchiera F, Matrone A, Ferrari E, Ingravallo G, Lo Sasso G, Murzilli S, Petruzzelli M,
479 Salvatore L, Moschetta A, and Simone C. p38alpha blockade inhibits colorectal cancer
480 growth in vivo by inducing a switch from HIF1alpha- to FoxO-dependent transcription. Cell
481 death and differentiation 16: 1203-1214, 2009.
482 10. Cianchi F, Cortesini C, Schiavone N, Perna F, Magnelli L, Fanti E, Bani D, Messerini L,
483 Fabbroni V, Perigli G, Capaccioli S, and Masini E. The role of cyclooxygenase-2 in
484 mediating the effects of histamine on cell proliferation and vascular endothelial growth factor
485 production in colorectal cancer. Clinical cancer research : an official journal of the American
486 Association for Cancer Research 11: 6807-6815, 2005.
487 11. Cooper HS, Everley L, Chang WC, Pfeiffer G, Lee B, Murthy S, and Clapper ML. The
488 role of mutant Apc in the development of dysplasia and cancer in the mouse model of
489 dextran sulfate sodium-induced colitis. Gastroenterology 121: 1407-1416, 2001.
490 12. Coskun M, Olsen J, Seidelin JB, and Nielsen OH. MAP kinases in inflammatory bowel
491 disease. Clin Chim Acta 412: 513-520, 2011.
19
492 13. Cricco G, Martin G, Medina V, Nunez M, Mohamad N, Croci M, Crescenti E, Bergoc R,
493 and Rivera E. Histamine inhibits cell proliferation and modulates the expression of Bcl-2
494 family proteins via the H2 receptor in human pancreatic cancer cells. Anticancer research 26:
495 4443-4450, 2006.
496 14. Dy M and Schneider E. Histamine-cytokine connection in immunity and hematopoiesis.
497 Cytokine & growth factor reviews 15: 393-410, 2004.
498 15. Esbenshade TA, Kang CH, Krueger KM, Miller TR, Witte DG, Roch JM, Masters JN,
499 and Hancock AA. Differential activation of dual signaling responses by human H1 and H2
500 histamine receptors. Journal of receptor and signal transduction research 23: 17-31, 2003.
501 16. Francis H, DeMorrow S, Venter J, Onori P, White M, Gaudio E, Francis T, Greene JF,
502 Jr., Tran S, Meininger CJ, and Alpini G. Inhibition of histidine decarboxylase ablates the
503 autocrine tumorigenic effects of histamine in human cholangiocarcinoma. Gut 61: 753-764,
504 2012.
505 17. Francis H, Meng F, Gaudio E, and Alpini G. Histamine regulation of biliary proliferation. J
506 Hepatol 56: 1204-1206, 2012.
507 18. Frei R, Ferstl R, Konieczna P, Ziegler M, Simon T, Rugeles TM, Mailand S, Watanabe T,
508 Lauener R, Akdis CA, and O'Mahony L. Histamine receptor 2 modifies dendritic cell
509 responses to microbial ligands. The Journal of allergy and clinical immunology 132: 194-204,
510 2013.
511 19. Gao C, Ganesh BP, Shi Z, Shah RR, Fultz R, Major A, Venable S, Lugo M, Hoch K,
512 Chen X, Haag A, Wang TC, and Versalovic J. Gut Microbe-Mediated Suppression of
513 Inflammation-Associated Colon Carcinogenesis by Luminal Histamine Production. The
514 American journal of pathology 187: 2323-2336, 2017.
515 20. Gao C, Major A, Rendon D, Lugo M, Jackson V, Shi Z, Mori-Akiyama Y, and Versalovic
516 J. Histamine H2 Receptor-Mediated Suppression of Intestinal Inflammation by Probiotic
517 Lactobacillus reuteri. mBio 6: e01358-01315, 2015.
518 21. Gemkow MJ, Davenport AJ, Harich S, Ellenbroek BA, Cesura A, and Hallett D. The
519 histamine H3 receptor as a therapeutic drug target for CNS disorders. Drug discovery today
520 14: 509-515, 2009.
521 22. Goswami CP and Nakshatri H. PROGgeneV2: enhancements on the existing database.
522 BMC cancer 14: 970, 2014.
523 23. Grivennikov S, Karin E, Terzic J, Mucida D, Yu GY, Vallabhapurapu S, Scheller J,
524 Rose-John S, Cheroutre H, Eckmann L, and Karin M. IL-6 and Stat3 are required for
525 survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer
526 cell 15: 103-113, 2009.
527 24. Handley SA, Dube PH, and Miller VL. Histamine signaling through the H(2) receptor in the
528 Peyer's patch is important for controlling Yersinia enterocolitica infection. Proceedings of the
529 National Academy of Sciences of the United States of America 103: 9268-9273, 2006.
530 25. Hao F, Tan M, Xu X, and Cui MZ. Histamine induces Egr-1 expression in human aortic
531 endothelial cells via the H1 receptor-mediated protein kinase Cdelta-dependent ERK
532 activation pathway. The Journal of biological chemistry 283: 26928-26936, 2008.
533 26. Hollenbach E, Neumann M, Vieth M, Roessner A, Malfertheiner P, and Naumann M.
534 Inhibition of p38 MAP kinase- and RICK/NF-kappaB-signaling suppresses inflammatory
535 bowel disease. FASEB journal : official publication of the Federation of American Societies
536 for Experimental Biology 18: 1550-1552, 2004.
537 27. Holly EA, Eberle CA, and Bracci PM. Prior history of allergies and pancreatic cancer in the
538 San Francisco Bay area. Am J Epidemiol 158: 432-441, 2003.
539 28. Hommes D, van den Blink B, Plasse T, Bartelsman J, Xu C, Macpherson B, Tytgat G,
540 Peppelenbosch M, and Van Deventer S. Inhibition of stress-activated MAP kinases
541 induces clinical improvement in moderate to severe Crohn's disease. Gastroenterology 122:
542 7-14, 2002.
20
543 29. Hong Y, Ho KS, Eu KW, and Cheah PY. A susceptibility gene set for early onset colorectal
544 cancer that integrates diverse signaling pathways: implication for tumorigenesis. Clinical
545 cancer research : an official journal of the American Association for Cancer Research 13:
546 1107-1114, 2007.
547 30. Ishiguro T, Ishiguro M, Ishiguro R, and Iwai S. Cotreatment with dichloroacetate and
548 omeprazole exhibits a synergistic antiproliferative effect on malignant tumors. Oncol Lett 3:
549 726-728, 2012.
550 31. Jangi SM, Asumendi A, Arlucea J, Nieto N, Perez-Yarza G, Morales MC, de la Fuente-
551 Pinedo M, and Boyano MD. Apoptosis of human T-cell acute lymphoblastic leukemia cells
552 by diphenhydramine, an H1 histamine receptor antagonist. Oncology research 14: 363-372,
553 2004.
554 32. Jones NL, Roifman CM, Griffiths AM, and Sherman P. Ketotifen therapy for acute
555 ulcerative colitis in children: a pilot study. Digestive diseases and sciences 43: 609-615,
556 1998.
557 33. Joseph EW, Pratilas CA, Poulikakos PI, Tadi M, Wang W, Taylor BS, Halilovic E,
558 Persaud Y, Xing F, Viale A, Tsai J, Chapman PB, Bollag G, Solit DB, and Rosen N. The
559 RAF inhibitor PLX4032 inhibits ERK signaling and tumor cell proliferation in a V600E BRAF-
560 selective manner. Proceedings of the National Academy of Sciences of the United States of
561 America 107: 14903-14908, 2010.
562 34.Juillerat P, Schneeweiss S, Cook EF, Ananthakrishnan AN, Mogun H, and Korzenik JR.
563 Drugs that inhibit gastric acid secretion may alter the course of inflammatory bowel disease.
564 Alimentary pharmacology & therapeutics 36: 239-247, 2012.
565 35. Jutel M, Watanabe T, Klunker S, Akdis M, Thomet OA, Malolepszy J, Zak-Nejmark T,
566 Koga R, Kobayashi T, Blaser K, and Akdis CA. Histamine regulates T-cell and antibody
567 responses by differential expression of H1 and H2 receptors. Nature 413: 420-425, 2001.
568 36. Kaser A, Ludwiczek O, Holzmann S, Moschen AR, Weiss G, Enrich B, Graziadei I,
569 Dunzendorfer S, Wiedermann CJ, Murzl E, Grasl E, Jasarevic Z, Romani N, Offner FA,
570 and Tilg H. Increased expression of CCL20 in human inflammatory bowel disease. Journal
571 of clinical immunology 24: 74-85, 2004.
572 37. Kennedy L, Hodges K, Meng F, Alpini G, and Francis H. Histamine and histamine
573 receptor regulation of gastrointestinal cancers. Transl Gastrointest Cancer 1: 215-227, 2012.
574 38. La Morte WW, Hingston SJ, and Wise WE. pH-dependent activity of H1- and H2-histamine
575 receptors in guinea-pig gallbladder. The Journal of pharmacology and experimental
576 therapeutics 217: 638-644, 1981.
577 39. Lampiasi N, Azzolina A, Montalto G, and Cervello M. Histamine and spontaneously
578 released mast cell granules affect the cell growth of human hepatocellular carcinoma cells.
579 Exp Mol Med 39: 284-294, 2007.
580 40. Lazar-Molnar E, Hegyesi H, Pallinger E, Kovacs P, Toth S, Fitzsimons C, Cricco G,
581 Martin G, Bergoc R, Darvas Z, Rivera ES, and Falus A. Inhibition of human primary
582 melanoma cell proliferation by histamine is enhanced by interleukin-6. European journal of
583 clinical investigation 32: 743-749, 2002.
584 41. Lee SH, Hu LL, Gonzalez-Navajas J, Seo GS, Shen C, Brick J, Herdman S, Varki N,
585 Corr M, Lee J, and Raz E. ERK activation drives intestinal tumorigenesis in Apc(min/+)
586 mice. Nature medicine 16: 665-670, 2010.
587 42. Liu L, Li YH, Niu YB, Sun Y, Guo ZJ, Li Q, Li C, Feng J, Cao SS, and Mei QB. An apple
588 oligogalactan prevents against inflammation and carcinogenesis by targeting LPS/TLR4/NF-
589 kappaB pathway in a mouse model of colitis-associated colon cancer. Carcinogenesis 31:
590 1822-1832, 2010.
591 43. Mahalingam D, Natoni A, Keane M, Samali A, and Szegezdi E. Early growth response-1
592 is a regulator of DR5-induced apoptosis in colon cancer cells. British journal of cancer 102:
593 754-764, 2010.
21
594 44.Masaki T, Chiba S, Tatsukawa H, Noguchi H, Kakuma T, Endo M, Seike M, Watanabe T,
595 and Yoshimatsu H. The role of histamine H1 receptor and H2 receptor in LPS-induced liver
596 injury. FASEB journal : official publication of the Federation of American Societies for
597 Experimental Biology 19: 1245-1252, 2005.
598 45. Matsubara M, Tamura T, Ohmori K, and Hasegawa K. Histamine H1 receptor antagonist
599 blocks histamine-induced proinflammatory cytokine production through inhibition of Ca2+-
600 dependent protein kinase C, Raf/MEK/ERK and IKK/I kappa B/NF-kappa B signal cascades.
601 Biochemical pharmacology 69: 433-449, 2005.
602 46. Mazzoni A, Young HA, Spitzer JH, Visintin A, and Segal DM. Histamine regulates
603 cytokine production in maturing dendritic cells, resulting in altered T cell polarization. The
604 Journal of clinical investigation 108: 1865-1873, 2001.
605 47. Mazzucchelli L, Hauser C, Zgraggen K, Wagner H, Hess M, Laissue JA, and Mueller C.
606 Expression of interleukin-8 gene in inflammatory bowel disease is related to the histological
607 grade of active inflammation. The American journal of pathology 144: 997-1007, 1994.
608 48. McWhorter WP. Allergy and risk of cancer. A prospective study using NHANESI followup
609 data. Cancer 62: 451-455, 1988.
610 49. Mills PK, Beeson WL, Fraser GE, and Phillips RL. Allergy and cancer: organ site-specific
611 results from the Adventist Health Study. Am J Epidemiol 136: 287-295, 1992.
612 50. Moller H, Lindvig K, Klefter R, Mosbech J, and Moller Jensen O. Cancer occurrence in a
613 cohort of patients treated with cimetidine. Gut 30: 1558-1562, 1989.
614 51. Munkholm P. Review article: the incidence and prevalence of colorectal cancer in
615 inflammatory bowel disease. Alimentary pharmacology & therapeutics 18 Suppl 2: 1-5, 2003.
616 52. Nakamura T, Ueno Y, Goda Y, Nakamura A, Shinjo K, and Nagahisa A. Efficacy of a
617 selective histamine H2 receptor agonist, dimaprit, in experimental models of endotoxin
618 shock and hepatitis in mice. European journal of pharmacology 322: 83-89, 1997.
619 53. Nathan RA, Segall N, and Schocket AL. A comparison of the actions of H1 and H2
620 antihistamines on histamine-induced bronchoconstriction and cutaneous wheal response in
621 asthmatic patients. The Journal of allergy and clinical immunology 67: 171-177, 1981.
622 54. Prizment AE, Folsom AR, Cerhan JR, Flood A, Ross JA, and Anderson KE. History of
623 allergy and reduced incidence of colorectal cancer, Iowa Women's Health Study. Cancer
624 Epidemiol Biomarkers Prev 16: 2357-2362, 2007.
625 55. Raithel M, Matek M, Baenkler HW, Jorde W, and Hahn EG. Mucosal histamine content
626 and histamine secretion in Crohn's disease, ulcerative colitis and allergic enteropathy.
627 International archives of allergy and immunology 108: 127-133, 1995.
628 56. Raithel M, Nagel A, Zopf Y, deRossi T, Stengel C, Hagel A, Kressel J, Hahn EG, and
629 Konturek P. Plasma histamine levels (H) during adjunctive H1-receptor antagonist
630 treatment with loratadine in patients with active inflammatory bowel disease (IBD).
631 Inflammation research : official journal of the European Histamine Research Society [et al]
632 59 Suppl 2: S257-258, 2010.
633 57. Rudolph MI, Boza Y, Yefi R, Luza S, Andrews E, Penissi A, Garrido P, and Rojas IG.
634 The influence of mast cell mediators on migration of SW756 cervical carcinoma cells.
635 Journal of pharmacological sciences 106: 208-218, 2008.
636 58. Sasson AR, Gamagami R, An Z, Wang X, Moossa AR, and Hoffman RM. Cimetidine: an
637 inhibitor or promoter of tumor growth? International journal of cancer 81: 835-838, 1999.
638 59. Schreiber S, Feagan B, D'Haens G, Colombel JF, Geboes K, Yurcov M, Isakov V,
639 Golovenko O, Bernstein CN, Ludwig D, Winter T, Meier U, Yong C, Steffgen J, and
640 Group BS. Oral p38 mitogen-activated protein kinase inhibition with BIRB 796 for active
641 Crohn's disease: a randomized, double-blind, placebo-controlled trial. Clinical
642 gastroenterology and hepatology : the official clinical practice journal of the American
643 Gastroenterological Association 4: 325-334, 2006.
22
644 60. Smolinska S, Groeger D, Perez NR, Schiavi E, Ferstl R, Frei R, Konieczna P, Akdis CA,
645 Jutel M, and O'Mahony L. Histamine Receptor 2 is Required to Suppress Innate Immune
646 Responses to Bacterial Ligands in Patients with Inflammatory Bowel Disease. Inflammatory
647 bowel diseases 22: 1575-1586, 2016.
648 61. Smolinska S, Jutel M, Crameri R, and O'Mahony L. Histamine and gut mucosal immune
649 regulation. Allergy 69: 273-281, 2014.
650 62. Tanaka T. Development of an inflammation-associated colorectal cancer model and its
651 application for research on carcinogenesis and chemoprevention. International journal of
652 inflammation 2012: 658786, 2012.
653 63. Thomas CM, Hong T, van Pijkeren JP, Hemarajata P, Trinh DV, Hu W, Britton RA,
654 Kalkum M, and Versalovic J. Histamine derived from probiotic Lactobacillus reuteri
655 suppresses TNF via modulation of PKA and ERK signaling. PloS one 7: e31951, 2012.
656 64. Thurmond RL, Gelfand EW, and Dunford PJ. The role of histamine H1 and H4 receptors
657 in allergic inflammation: the search for new antihistamines. Nat Rev Drug Discov 7: 41-53,
658 2008.
659 65. Tunis MC, Dawicki W, Carson KR, Wang J, and Marshall JS. Mast cells and IgE
660 activation do not alter the development of oral tolerance in a murine model. The Journal of
661 allergy and clinical immunology 130: 705-715 e701, 2012.
662 66. Ullman TA and Itzkowitz SH. Intestinal inflammation and cancer. Gastroenterology 140:
663 1807-1816, 2011.
664 67. Valencia S, Hernandez-Angeles A, Soria-Jasso LE, and Arias-Montano JA. Histamine
665 H(1) receptor activation inhibits the proliferation of human prostatic adenocarcinoma DU-145
666 cells. The Prostate 48: 179-187, 2001.
667 68. Vannier E, Miller LC, and Dinarello CA. Histamine suppresses gene expression and
668 synthesis of tumor necrosis factor alpha via histamine H2 receptors. The Journal of
669 experimental medicine 174: 281-284, 1991.
670 69. Waetzig GH, Seegert D, Rosenstiel P, Nikolaus S, and Schreiber S. p38 mitogen-
671 activated protein kinase is activated and linked to TNF-alpha signaling in inflammatory
672 bowel disease. Journal of immunology 168: 5342-5351, 2002.
673 70. Wang M, Wei X, Shi L, Chen B, Zhao G, and Yang H. Integrative genomic analyses of the
674 histamine H1 receptor and its role in cancer prediction. Int J Mol Med 33: 1019-1026, 2014.
675 71. Yamada S, Guo X, Wang KY, Tanimoto A, and Sasaguri Y. Novel function of histamine
676 signaling via histamine receptors in cholesterol and bile acid metabolism: Histamine H2
677 receptor protects against nonalcoholic fatty liver disease. Pathol Int 66: 376-385, 2016.
678 72. Yang XD, Ai W, Asfaha S, Bhagat G, Friedman RA, Jin G, Park H, Shykind B, Diacovo
679 TG, Falus A, and Wang TC. Histamine deficiency promotes inflammation-associated
680 carcinogenesis through reduced myeloid maturation and accumulation of CD11b+Ly6G+
681 immature myeloid cells. Nature medicine 17: 87-95, 2011.
682 73. Zou X and Blank M. Targeting p38 MAP kinase signaling in cancer through post-
683 translational modifications. Cancer letters 384: 19-26, 2017.
685 Figure 1. L. reuteri derived histamine suppresses colonic tumorigenesis in ApcMin/+ mice.
686 (A) Study design for the experiments shown in panels B, C and D. Blue arrows indicate oral
687 gavage and red arrow indicates the time of euthanasia. (B) Apcmin/+ mice were gavaged with
688 histamine-producing L. reuteri 6475 (n=11), L. reuteri 6475 hdcA M (n=8) or MRS media control
23
689 (n=10) during DSS-induced tumorigenesis, and total tumor numbers in colons were counted
690 under a dissecting microscope. (C) Dysplastic lesions were counted on H&E stained sections
691 throughout the colons of mice treated with L. reuteri 6475 (n=5), L. reuteri 6475 hdcA M (n=6) or
692 MRS media control (n=6). (D) Representative images of H&E staining (upper: 40X; lower: 200X)
693 of colon sections from Apcmin/+ mice gavaged with L. reuteri 6475, L. reuteri 6475 hdcA M and
694 MRS medium control. Statistical comparisons were performed using GraphPad Prism software.
695 Data were analyzed using one-way ANOVA followed by with a Bonferroni post-hoc test. P
697 Figure 2. H1R and H2R signaling pathways play opposing roles in tumorigenesis of
698 colonic cancer in ApcMin/+ mouse model. (A) Study design for all the experiments in Figure 2.
699 (B) Apcmin/+ mice were given 50 µM pyrilamine (n=6), 100 µM cimetidine (n=7), 10 µM
700 omeprazole (n=6) or water control (n=9) during DSS treatment. No bacteria were given to those
701 mice. Tumors in cecum and in colon were counted and measured after the second post-DSS
702 recovery period. In Apcmin/+ mice treated with cimetidine, tumors in cecum and in colon were
703 measured under a dissecting microscope (C). (D) BrdU staining was performed on sections of
704 colon tumors from cimetidine-treated and control mice (left). The percentages of BrdU positive
705 cells were calculated from six fields per mouse (n=3) (right). (E) Proteins were extracted from
706 DSS-induced colon tumors of Apcmin/+ mice treated with or without cimetidine, and ERK
707 phosphorylation was detected by immunoblot (E, left). RT-qPCR was performed using RNA
708 from DSS-induced tumors to determine the relative expression of Egr1 (E, right). Statistical
709 comparisons were performed using GraphPad Prism software. Data of panel B were analyzed
710 using one-way ANOVA followed with a Bonferroni post-hoc test. Data of panel C were analyzed
711 by two-way repeated measures ANOVA with a Bonferroni post-hoc test. Data of panel D
712 and E were analyzed using unpaired, two-tailed Student's T-test. Data are presented as
713 mean ± SD and P values are indicated by asterisks: *p < 0.05, **p < 0.01.
24
714 Figure 3. H1R signaling stimulates and H2R signaling suppresses cell proliferation. (A)
715 Double immunostaining was performed on a FFPE section of a colorectal cancer specimen with
716 H1R and PCNA antibodies. (B) HCT116 cells were transfected with empty plasmid vector,
717 TOPO-Hrh1 only (Hrh1), TOPO-Hrh2 only (Hrh2), TOPO-Hrh2 plus TOPO-Hrh1 (Hrh1+Hrh2).
718 Twenty-four hours post-transfection, cells were treated with 100 nM histamine for 4 days. Cell
719 viability was determined by the CCK8 assay and is depicted in the bar graph. Relative
720 abundances of transfected HCT116 cells were pictured after crystal violet staining (right). (C)
721 HCT116 cells were treated with 25 μM 2-Pyridylethylamine (H1R agonist, designated as H1RA),
722 25 μM dimaprit (H2R agonist, designated as H2RA) or a combination of agonists. Cell viability
723 was determined by CCK8 assay after 4-day treatment. Data for panels B and C resulted from a
724 single experiment in triplicate, and similar results were obtained in two independent experiments.
725 Data were analyzed by one-way ANOVA with a Bonferroni post-hoc test. Data are presented as
726 mean ± SD and P values are indicated by asterisks: *p < 0.05, **p < 0.01 and ***p < 0.001.
727 Figure 4. H2R signaling suppresses MAPK signaling pathways induced by H1R activation.
728 (A) HCT116 cells were transfected with empty Vector, TOPO-Hrh1, TOPO-Hrh2 or TOPO-Hrh1
729 together with TOPO-Hrh2, and treated with histamine (10µM) for 0, 15, 30, 60 and 120 minutes.
730 Immunoblotting was performed for phosphorylated JNK (p-JNK), phosphorylated ERK (p-ERK),
731 phosphorylated p38 (p-p38) and -actin. The results are representative of three independent
732 experiments (biological triplicates). (B) All bands of immunoblots were quantified using Band
733 Leader software and the density of each band was normalized relative to that of -actin. The
734 relative density at 0 minutes in control cells was designated as 1 (y-axis). The relative density
735 was calculated from biological triplicates. (C) Immunoblotting was performed to verify H1R and
736 H2R overexpression in HCT116 cells. (D) Double immunostaining of H1R (green) and p-ERK
737 was performed on Hrh1 overexpressing HCT116 cells treated with histamine (10 µM) for 1 hr.
738 DAPI was used to visualize nuclei (blue). (E) Phosphorylated ERK was not detected in Hrh2
25
739 overexpressing HCT116 cells treated with histamine (10 µM) for 1 hr. (F, G) HCT116 cells were
740 transfected with empty vector, TOPO-Hrh1, TOPO-Hrh2 or TOPO-Hrh1 plus TOPO-Hrh2, were
741 then treated with 10 µM histamine for 6 hours. The relative expression of CCL20 (F) and IL-8 (G)
742 was determined by RT-qPCR. Data of panel B are analyzed by two-way repeated measures
743 ANOVA with a Bonferroni post-hoc test. The experiments (F and G) were performed three times,
744 each with three technical replicates. Data are presented as mean ± SD (n = 3) from one
745 representative experiment and analyzed by one-way ANOVA with a Bonferroni post-hoc test,
746 and P values are indicated by asterisks: *p < 0.05, **p < 0.01 and ***p < 0.001.
747 Figure 5. H1R and H2R signaling pathways differentially affect cytokine gene expression
748 induced by LPS in macrophages. RAW 264.7 cells (A) or THP-1 cells (B) were treated with
749 100 ng/ml LPS, LPS together with 10μM histamine, LPS plus histamine together with 100 μM
750 pyrilamine or 100 μM cimetidine (CIM) for 6 hours. Then IL-6 and TNF expression were
751 determined by RT-qPCR. (C) RAW 264.7 cells were treated with 100 ng/ml LPS, 10 μM
753 and 120 (dark +) minutes, and the expression of p-p38, p-ERK, p-p65 and -actin was
754 determined by immunoblot (upper panel). The signals (immunoblot bands) generated following
755 exposure to LPS, dimaprit and pyrilamine are highlighted in the rectangle with dashed line
756 borders. The experiments (A and B) were performed three times, each with three biological
757 replicates. Data were analyzed by one-way ANOVA with a Bonferroni post-hoc test. Data are
758 presented as mean ± SD from one representative experiment. The relative densities were
759 calculated from the quantified signals (immunoblot bands) of three independent experiments
760 using Band Leader software (lower panel). Data were analyzed using two-way repeated
761 measures ANOVA with a Bonferroni post-hoc test. Data are presented as mean ± SD (n = 3),
762 and P values are indicated by asterisks: *p < 0.05, **p < 0.01 and ***p < 0.001.
26
763 Figure 6. Expression of HRH1 and HRH2 genes are inversely correlated with survival of
764 CRC patients. The correlations between gene expression patterns of HRH1 or HRH2 (A) in
765 human CRC tissues and the Kaplan-Meier overall survival-based outcomes were analyzed
766 using the R2 platform (database, n = 232, GSE17538). Raw p values were shown in the figure.
767 (B) Correlations of HRH1, HRH2 and the HRH2/HRH1 gene expression ratio with the overall
768 survival of colorectal cancer patients (n = 174, GSE17536) were analyzed using PROGgeneV2
770
27
A
DSS DSS
7 days 5 days 17 4 18
days days days
Oral gavage Euthanasia
B Colon C
40 10
10
40 * *
adenomas/mouse
* 88
*
Dysplastic lesion
dysplasia/mouse
30
30
number
66
20
20
44
Tumor
10
10
colon
22
0 0
MRS L. reuteri L. reuteri hdcA MRS L. reuteri L. reuteri hdcA
Figure 1
Euthanasia
A
pyrilamine, cimetidine, omeprazole, or control drinking water
DSS DSS
7 days 5 days 17 days 4 days 18 days
B 40 Cecum 60 Colon
** *
Tumor number
Tumor number
30
40
20 *
20
10
C Cecum Colon
14 Ctrl Cimetidine 18 Ctrl Cimetidine
Tumor number/mouse
Tumor number/mouse
12 16
14
10 12
8 10
6 8
6
4
4
2 2
0 0
≤1mm 2mm 3mm 4mm 5mm 6mm ≥7mm ≤1mm 2mm 3mm 4mm 5mm 6mm ≥7mm
E Egr1
D **
Relative mRNA expression
2
BrdU staining
30
25 p-ERK
1.5
20
15 Total 1
10 ERK
5 0.5
0 0
E-actin
Figure 2
A H1R/PCNA/DAPI H1R/PCNA/DAPI H1R PCNA
CRC (Stage IV)
B C ** *
0.5 *** *** Ctrl Hrh1 0.4
Absorbance (450nm)
Absorbance (450nm)
0.4 0.3
0.3
** 0.2
0.2
Hrh2 Hrh1+Hrh2
0.1 0.1
0
0
Figure 3
A Ctrl Hrh1 Hrh2 Hrh1+Hrh2
0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 min
p-JNK
p-ERK
p-p38
E-actin
* *
p-JNK ** p-ERK * p-p38
6 3 3
4 2 2
2 1 1
0 0 0
Ctrl Hrh1 Hrh2 Hrh1+Hrh2 Ctrl Hrh1 Hrh2 Hrh1+Hrh2 Ctrl Hrh1 Hrh2 Hrh1+Hrh2
H1R
H2R
E-actin D E
F G
*
Relative mRNA expression
5 IL8
25 CCL20
** ***
20 4
15 3
10 2
5 1
0 0
Hrh1 - - + + - - + + Hrh1 - - + + - - + +
Hrh2 - - - - + + + + Hrh2 - - - - + + + +
Histamine - + - + - + - + Histamine - + - + - + - + Figure 4
A RAW 264.7 C RAW 264.7
- + + + + + + + + + + LPS
Relative mRNA expression
120 IL6
E-actin
10 + 30min
*
**
Relative density(fold)
8
B THP-1 Ctrl
6
LPS
***
Relative mRNA expression
450 LPS+PY
10 400 2 LPS+DIM
8 *** 350 LPS+PY+DIM
300 0
6 250 p-p38 p-ERK p-p65
* 200 + 120min
4 150
Relative density(fold)
10
2 100 Ctrl
50 LPS
0 0 LPS+HIS
5
LPS+PY
LPS+DIM
LPS+PY+DIM
0
p-p38 p-ERK p-p65
Figure 5
A R2 platform
HRH1 HRH2
Overall survival
Overall survival
p = 0.0095 p = 0.00072
0 24 48 72 96 120 0 24 48 72 96 120
Follow up in months Follow up in months
B PROGgene platform
HRH1 HRH2 HRH2/HRH1
1.0 1.0 1.0
High (n = 87) High (n = 87) High (n = 87)
Overall survival
Overall survival
Figure 6
Antibody Clone number or
Company catalog number Applications and dilutions
name
H1R Santa Cruz P-20 Fluorescent staining: 1:200; Immunoblot: 1:500
Table 1
Gene
Forward (5’-3’) Reverse (5’-3’) Applications
name
HRH1 CACACTGAACCCCCTCATCT ATTTTGTTGCATCCCCTCAG qPCR
CCL20 CCA AGA GTT TGC TCC TGG CT TGC TTG CTG CTT CTG ATT CG qPCR
IL8 CAC CGG AAG GAA CCA TCT CA GGA AGG CTG CCA AGA GAG C qPCR
IL6 GTA TGA ACA ACG ATG ATG CAC TTG ATG GTA CTC CAG AAG ACC AGA GGA qPCR
Table 2