Hindawi

Evidence-Based Complementary and Alternative Medicine

Volume 2017, Article ID 2505610, 10 pages
https://doi.org/10.1155/2017/2505610

Research Article
Anti-Inflammatory Activity of the Essential Oil Citral
in Experimental Infection with Staphylococcus aureus
in a Model Air Pouch

Hellen Braga Martins,1 Nathan das Neves Selis,1 Clarissa Leal Silva e Souza,2
Flávia S. Nascimento,2 Suzi Pacheco de Carvalho,1 Lorena D’Oliveira Gusmão,2
Jannine dos Santos Nascimento,2 Anne Karoline Pereira Brito,2 Samira Itana de Souza,2
Marcio Vasconcelos de Oliveira,2 Jorge Timenetsky,3 Regiane Yatsuda,2
Ana Paula T. Uetanabaro,1 and Lucas M. Marques1,2
1
State University of Santa Cruz (UESC), Campus Soane Nazaré de Andrade, Ilhéus, BA, Brazil
2
Multidisciplinary Institute of Health, Federal University of Bahia (UFBA), Vitória da Conquista, BA, Brazil
3
Department of Microbiology, Institute of Biomedical Science, University of São Paulo (USP), São Paulo, SP, Brazil

Correspondence should be addressed to Lucas M. Marques; [email protected]

Received 4 October 2016; Accepted 27 December 2016; Published 21 February 2017

Academic Editor: Alessandra Russo

Copyright © 2017 Hellen Braga Martins et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.

This study proposes to implement an alternative and effective strategy for local treatment of disease provoked by S. aureus. For
the analysis of possible anti-inflammatory activity of essential oil, after establishing an air pouch model, 48 male mice of Balb/c
were treated, infected, and euthanized at 4 and 8 h. Thus, the total and differential white blood cells were counted in the animal’s
blood, and cytokines IL-1𝛽, IL-6, and TNF-𝛼 were titrated using ELISA in the air pouch lavage. Moreover, TNF-𝛼, IL-1𝛽, and IL-6
gene expression was analyzed through an RT-qPCR array, and S. aureus was quantified using qPCR. Our results, 𝑝 < 0.05, showed
that EOC reduced the quantity of microorganisms. The group of mice treated with essential oil citral showed a significant decrease
in TNF-𝛼 levels in tests demonstrating anti-inflammatory activity. There is no data about the mutual influence of the air pouch
model, essential oil citral, and S. aureus. Thus, considering the interaction of these variables and the anti-inflammatory activity of
the essential oil citral, we demonstrated, by alternative local treatment, a new antimicrobial agent that is not an antibiotic.

1. Introduction osteomyelitis, diarrhea, deep abscesses, and toxic shock

syndrome. It can also lead to the development of diseases
Staphylococcus aureus is among the most pathogenic species that compromise immunity, thus predisposing both healthy
of the staphylococci group, being responsible for causing and immunocompromised individuals to the emergence of
endemic and epidemic infections, and can be acquired in
infections [3].
hospitals or in the community, resulting in a high rate of
morbidity and mortality worldwide [1]. Being an oppor- To eliminate this pathogen therapeutic measures play
tunistic pathogen, 20 to 30% of S. aureus is found on the a critical role, since the host defense against S. aureus
skin and airways of the humans, being isolated from the relies mainly on innate immunological mechanisms of the
skin environment and skin microbiota, respiratory tract, and immune system. Initially, administering a broad-spectrum
other places [2]. of antibiotics is recommended. However, because of antibi-
This species may cause a host of illnesses ranging from otic resistance and the increasing prevalence of MRSA
mild skin diseases to potentially lethal diseases, including res- (methicillin-resistant Staphylococcus aureus), vancomycin
piratory infections, bacteremia, septic arthritis, endocarditis, has been increasingly used as an experimental measure [4, 5].
2 Evidence-Based Complementary and Alternative Medicine

A promising alternative treatment for infections that anesthetized intraperitoneally with 100 uL containing keta-
should be considered is essential oils (EO), so called because mine hydrochloride (40 mg/Kg) and xylazine (10 mg/Kg).
of their composition based on lipophilic substances [6]. After 24 h, it was euthanized by increasing anesthesia fol-
Essential oils are volatile secondary metabolites, which act lowed by exsanguination, and the node of the throat, the same
through the cell wall and cell membrane, which may affect ear side used for inoculation, was removed with the aid of
bacterial structures because of their cytotoxic and therapeutic sterile surgical instruments and transferred to a falcon tube
properties, and protection against oxidation processes and containing 1 mL of medium RPMI. At the sediment, the
deterioration caused by microorganisms [7, 8]. sample was poured in a Petri dish to which 1 mL of medium
The essential oil citral (EOC) is composed of major RPMI was added further to be macerated. From the super-
constituents of monoterpenes (isomeric mixture of geranial natant, 30 𝜇L was transferred to a plate with MSA medium
and neral) and myrcene being found in a wide variety of for bacterial growth and maintained in a bacteriological oven
plants, such as the lemon balm (Melissa officinalis) in lemon at 37∘ C for 24 h.
grass or lemongrass (Cymbopogon citratus) and verbena
(Verbena officinalis) [9]. 2.2. Essential Oil Citral. In the experiments we used essential
This oil has antibacterial and antifungal activity, analgesic oil citral (EOC) provided commercially by Sigma, and the
and antispasmodic effects on uterine and intestinal tissue, dosage (40 mg/Kg) used was recommended according to the
antiparasitic action, and activity on the central nervous literature review [16–18], in which less answer variations were
system, as well as being an anxiolytic and sedative, and presented. For the test run, the citral was diluted in Tween 1%.
these therapeutic properties of the compounds are explained
by the presence of monoterpenes and myrcene. In addition 2.3. Animal. Forty-eight male BALB/c mice, free of specified
to being antibacterial, EOC acts against gram-positive and pathogens (SPF), were used at 8 weeks of age and were
gram-negative bacteria, and prolonged exposure to its use has weighing on average 30 g. The animals were kept in an
not encountered resistance, thus justifying its use [10, 11]. environment with controlled and uniform conditions, with
The high mortality rate related to staphylococcal infec- temperature of 21 ± 2∘ C and humidity of 50 ± 2%, and
tions [12], the increase in S. aureus isolates resistant to subjected to the same procedures within each group. For the
antibiotics [13], and frequent and prolonged exposure to challenge, groups of twelve animals were made, six animals
antimicrobial agents hinder the treatment of infections [14]. euthanized at the time of 4 h and six at the time of 8 h, as
Therefore, alternative strategies to prevent or treat infections follows:
caused by S. aureus, sometimes minimizing or supplementing
C: uninfected mice, but with the administration of
use of antibiotics, are necessary. Given the above background,
Tween 1%, euthanized after 4 and 8 hours
with the changes in the epidemiology of infections, increased
prevalence of resistance and significantly higher rates of CT: uninfected mice, but with the administration of
morbidity and mortality, it is necessary to develop new the essential oil citral, euthanized after 4 and 8 hours
treatment strategies for infections triggered by S. aureus [15]. S: mice infected with S. aureus and euthanized after 4
Thus, we aim to analyze the anti-inflammatory activity of and 8 hours
essential oil citral in experimental inoculation of S. aureus in S + CT: mice infected with S. aureus and treated with
an air pouch model, to provide solutions in local infections, essential oil citral and euthanized at 4 and 8 hours
promoting alternative therapeutic approaches to antibiotics
and linking to advances in biotechnology. The mice of group C were anesthetized with a 100 mL
solution containing ketamine hydrochloride (40 mg/Kg) and
2. Materials and Methods xylazine (10 mg/Kg) by intraperitoneal injection, for devel-
oping a sterile compartment called an air pouch; 3 mL of
This study was performed after approval by the Ethics sterile air was injected into the back of the animal, followed
Committee on Animal Use (CEUA) of the Multidisciplinary by 100 𝜇L Tween 1% injected into the air pouch. The mice
Institute of Health Campus Teixeira (IMS/CAT) of the Fed- of group CT were inoculated intraperitoneally at first with
eral University of Bahia, with protocol number 021/2014. 100 mL of essential oil citral and anesthetized and then for
developing the air pouch 3 mL of sterile air was injected into
2.1. Microorganism. For inflammatory induction, the refer- the back of the animal. The mice of group S were anesthetized
ence strain of Staphylococcus aureus ATCC 33591 was used. for developing an air pouch, and 3 mL of sterile air was
This microorganism is resistant to the antibiotic methicillin injected into the back of the animal. Next, the mice were
(MRSA), positive mecA, nuc positive and PVL negative challenged with an injection of 100 𝜇L of ATCC 33591 strain
(according to data from The Global Bioresource Center). into the air pouch. The inoculum was carried out by direct
Brain Heart Infusion (BHI) and mannitol salt agar (MSA) suspension, drawing from 3 to 5 colonies from the plates with
were used for activation, reactivation, and cultivation of mannitol salt medium, using a bacteriological loop. After
the strain of S. aureus, stored in a freezer at −70∘ C for this step, following protocol of CLSI (Clinical & Laboratory
subsequent inoculation in animals. For reactivation of virule- Standards Institute), one tube aliquot was removed and
nce factors of the strain, concentrated inoculum of the plated placed in quartz cuvettes for reading a spectrophotometer
bacteria was prepared with sterile saline, and an amount to obtain the inoculum, following these parameters: 0.135
of 20 𝜇L was applied on the ear of male BALB/c mice Abs (660 nm), equivalent to 1 × 108 CFU/mL (colony forming
Evidence-Based Complementary and Alternative Medicine 3

units/mL). The mice of S + CT group were inoculated confer high absorption. The reading was performed using a
intraperitoneally on the first time with the essential oil citral. microplate reader Vivid Vision instrument with a wavelength
After 30 minutes, they were anesthetized for developing an of 450 nm.
air pouch, by injecting 3 mL of sterile air into the back of
the animal. Later, they were challenged with an injection 2.8. Gene Expression. The gene expression of inflammatory
of 100 𝜇L of ATCC 33591 strain, with inoculum carried out markers was assessed by an RT-qPCR array methodology.
as stated in the S group. The animals were euthanized by The mRNA of the air pouch skin samples was extracted
increasing the anesthetic and exsanguination after 4 or 8 by using Trizol, following the protocol supplied by the
hours, according to experimental guidelines. Later, the same manufacturer. The obtained cDNA was performed using
were subjected to a surgical procedure to remove the blood SuperScript III Reverse Transcriptase Kit. The test gene
and wash the air pouch and the skin around the air pouch. expression SYBR PCR Master Mix (Applied Biosystems)
was conducted in custom-plates with the target genes IL-1𝛽,
2.4. Obtaining Blood and Washing Skin and Air Pouch. IL-6, and TNF-𝛼, with endogenous genes glyceraldehyde 3-
Immediately after euthanasia, blood samples from animals phosphate dehydrogenase (GAPDH) and 𝛽-actin, and genes
were collected in tubes with and without EDTA for the total MGDC control (Mouse Genomic DNA Contamination),
and differential leukocyte count. After trichotomy, the air RTC (Reverse Transcription Control), and PPC (Positive
pouch lavage was obtained by injecting 3 mL of sterile saline PCR Control). Amplification was performed in thermocycler
solution, proceeding with massage for homogenization. The StepOnePlus Software v2.3, with the following parameters
fluid obtained was stored for analysis of the cytokines. for all genes: 95∘ C for 10 minutes, followed by 40 cycles at
95∘ C for 15 seconds and 60∘ C for 1 min.
2.5. Leukocyte Count (Total and Differential). To quantify the
total leukocytes, 20 mL of blood (collected in EDTA) was 2.9. Immunohistochemistry. After processing and inclusion
mixed with 400 𝜇L of fluid diluter (TURK). After 20 min., the of samples in paraffin, histological sections with a thickness
sample was transferred to a Neubauer chamber and then the of 4 mm were used to study the immunohistochemistry.
optical microscope to perform the leukocyte count in a 40x The sections were deparaffinized through a series of “baths”
magnification. The rating differential was performed with a in xylene and alcohol. With the aim of improving the
100-leukocyte count, stained with Quick Kit Dye (Panotic) responses, one treatment stage of the blades was performed
at a 100x magnification, distinguishing them according to with citrate buffer. Endogenous peroxidase was blocked using
their type (neutrophils, monocytes, and lymphocytes). Two a solution composed of methanol and hydrogen peroxide
methods were used for counting the longitudinal and zigzag (30%). Antibodies were used specific for macrophages CD
pattern. The absolute values for each leukocyte were cal- 68 (AbD Serotec), being a marker of inflammatory response
culated based on the total leukocyte count and percentage in tissue. A biotinylated anti-mouse secondary antibody
values found in the differential count. was used (ImmPRESS Universal Reagent, Vector Laborato-
ries). Subsequently, we used the avidin-biotin complex. The
2.6. Quantification of S. aureus. The genomic DNA of the color development occurred by adding the chromogen 3,3-
samples was extracted according to the protocol for an diaminobenzidine (DAB, 3,3-diaminobenzidine, Easypath)
Invitrogen Purelink Genomic DNA Kit (Invitrogen, São on the cuts by the reaction thereof with the avidin-biotin-
Paulo, SP, Brazil). Real-time PCR was performed in duplicate, peroxidase complex. The counterstaining was conducted by
using the Applied Biosystems platform. The technique was Harris hematoxylin bath. Twelve microscopic fields were
carried out by using TaqMan probes, using an amplification analyzed with 40x magnification for counting the labeled cells
based protocol with a final volume of 25 𝜇L of reaction: in the ImageJ program.
12.5 𝜇L of Master Mix (Applied Biosystems), 1.12 𝜇L of primer
LTnucF (AAATTACATAAAGAACCTGCGACA), 1.12 𝜇L 2.10. Statistical Analysis. For analysis of cell count data,
of primer LTnucR (GAATGTCATTGGTTGACCTTTGTA) cytokines, and gene expression, GraphPad Prism 6.0 was
(20 pmoL), which are single copy genes, 0.75 𝜇L of probe used. Nonparametric tests were used: Kruskal-Wallis (when
(10 mM), 7.0 𝜇L of water, and 2.5 𝜇L of DNA. The parameters evaluating more than two groups) and Mann–Whitney
for amplification are 95∘ C-10 min, followed by 30 cycles (when evaluating two groups). Statistical differences were
(95∘ C, 15 seconds; 59∘ C, 1 min). Quantitation was performed considered significant at 𝑝 < 0.05 using a 95% confidence
using an absolute quantization technique, based on a prede- interval.
termined standard curve ranging 107 –10 microorganisms/𝜇L.
A new curve was added to each reaction, and the following 3. Results
parameters were established: 𝑟2 ≥ 0.950 and efficiency bet-
ween 95 and 105%. By means of qPCR it was possible to quantify DNA and
consequently the microbial load of S and S + CT groups in
2.7. Dosage of Cytokines. The dosage of TNF-𝛼, IL-1𝛽, and the samples of the washed air pouch being represented by the
IL-6 cytokines was determined in the washed air pouch same colony forming units (CFU)/𝜇L. Thus, in Figure 1, one
by ELISA (enzyme-linked immunosorbent assay) capture, can observe high probes (>104 and <105 CFU/𝜇L) of S. aureus;
according to the kit manufacturer guidelines (eBioscience, however, the average of the groups was greater in the group
San Diego, CA, USA), in 96-well polystyrene plates, which infected at 4 h. Compared to the treated group, this could be
4 Evidence-Based Complementary and Alternative Medicine

107
106

S. aureus (copies/mL)
105
104
103
102
101
100
S 4h S + CT 4 h S 8h S + CT 8 h

S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral

Figure 1: Quantification by qPCR of S. aureus (CFU/𝜇L) in air pouch. Groups (𝑛 = 6): S. aureus (S) and S. aureus treated with citral (S +
CT). Significant difference using 𝑝 < 0.05, Mann–Whitney test.

15000
Blood leukocytes (mm3 )

10000

5000

0
S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

CT 8 h

S + CT 8 h

C 8h

C: Tween 1%
CT: essential oil citral l
S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral

Figure 2: Quantification of total leukocytes in the blood of Balb/c after 4- and 8-hour inoculation. Groups (𝑛 = 6) inoculated with Tween
1% (C), citral (CT), S. aureus (S), and S. aureus treated with citral (S + CT), in an experiment lasting 4 and 8 h. Significant difference using
𝑝 < 0.05, Kruskal-Wallis test.

an indication that the EOC had a positive effect in reducing monocytes, and lymphocytes, there were statistically signifi-
the microorganism analyzed. cant differences (𝑝 < 0.05) in these hematological parameters
In order to analyze the air pouch model in mice, leukocyte between the control and treated groups. Differences were
counts of all the animals were done after euthanasia. The observed in the neutrophil groups C and S; C and S + CT; S
group intraperitoneally inoculated with the EOC induced and CT. Differences were observed for lymphocytes in groups
quantitative alterations in leukocytes in peripheral blood. The C and S; C and S + CT in the study time. However, comparing
evaluation of the total count showed significant differences the S group to the S + CT group only in regard to monocytes
(𝑝 < 0.05) at 4 h in the group administered with Tween (Figure 3), significant differences can be seen at 4 h and 8 h of
1% (C) or EOC (CT) compared to the infected group (S) or infection.
infected and treated group (S + CT); see Figure 2. However, Among endogenous mediators, cytokines play an impor-
there were no differences in the total number of leukocytes in tant role in the host response, and in the dosage of TNF-
the S to S + CT groups in the two days of analysis. 𝛼, IL-1𝛽, and IL-6 markers in the lavage, it was possible to
To evaluate the relative quantities of different types of assess inflammatory responses in groups. Thus, in Figure 4,
leukocytes in peripheral blood leukocytes, differential count- we can notice significant differences for the three cytokines,
ing was performed. Regarding the number of neutrophils, 𝑝 < 0.05. However, the group of infected mice compared with
Evidence-Based Complementary and Alternative Medicine 5

10000 8000

8000
6000
Neutrophils (mm3 )

Monocytes (mm3 )
6000
4000
4000

2000
2000

0 0

S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h
S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h
C: Tween 1% C: Tween 1%
CT: essential oil citral l CT: essential oil citral l
S: Staphylococcus aureus S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral S + CT: S. aureus + essential oil citral
(a) (b)
8000
Lymphocytes (mm3 )

6000

4000

2000

0
S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h

C: Tween 1%
CT: essential oil citral l
S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral
(c)

Figure 3: Number of neutrophils (a), monocytes (b), and lymphocytes (c) in the blood of Balb/c mice after 4- and 8-hour inoculation. Groups
(𝑛 = 6) inoculated with Tween 1% (C), citral (CT), S. aureus (S), and S. aureus treated with citral (S + CT), in an experiment lasting 4 and 8 h.
Significant difference using 𝑝 < 0.05, Kruskal-Wallis test.

the infected and treated group with the EOC in the time of 4 h immunohistochemistry. There was a response variation bet-
showed a significant decrease in IL-6 and TNF-𝛼 levels. IL-1𝛽 ween the groups of infected mice compared to the infected
levels decreased in groups S and S + CT at 4 h; however, the and treated group with the EOC, or the group that received
data was not statistically significant. the EOC, the time of 4 h, with significant differences, 𝑝 < 0.05
Analysis of the expression of TNF-𝛼, IL-1𝛽, and IL-6 (Figure 6).
genes showed less variation among the different treatments,
where statistical significance was observed between the three 4. Discussion
genes, 𝑝 < 0.05. However, evaluating the inflammatory
state induced in the group infected with S. aureus against In infections, an appropriate response is an important aspect
the infected group and treated with EOC, differences can be that will distinguish whether the host will be cured or not.
observed only for the TNF-𝛼 gene at 4 h, 𝑝 < 0.05 (Figure 5). The use of biologically active natural products has been
The expression of antibody CD 68 was seen in the brow- increasing in recent decades, becoming an alternative for
nish color marking of macrophages, being evaluated by treating various infections. However, scientific evidences on
6 Evidence-Based Complementary and Alternative Medicine

150 500

400
100
IL-1𝛽 (pg/mL)

IL-6 (pg/mL)
300

200
50
100

0 0

S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h
S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h
C: Tween 1% C: Tween 1%
CT: essential oil citral l CT: essential oil citral l
S: Staphylococcus aureus S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral S + CT: S. aureus + essential oil citral

20

15
TNF-𝛼 (pg/mL)

10

0
S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h

C: Tween 1%
CT: essential oil citral l
S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral

Figure 4: Levels of cytokines IL-6, IL-1𝛽, and TNF-𝛼 in air pouch from Balb/c mice after 4 and 8 hours’ inoculation. Groups (𝑛 = 6) inoculated
with Tween 1% (C), citral (CT), S. aureus (S) and S. aureus treated with citral (S + CT), in an experiment lasting 4 and 8 h. Significant
difference using 𝑝 < 0.05, Kruskal-Wallis test.

effectiveness and mechanisms of action for these derivatives S. aureus and that subinhibitoryconcentrations (0.05 mg mL−1 )
are limited, hence, delaying their use in clinical practice [19]. significantly inhibit the formation of biofilm, being consid-
The air pouch tissue is composed of different cell lineages, ered an important antimicrobial agent [22]. It is believed
macrophages, and fibroblasts initially, similar to a synovial that the essential oils target different molecular targets for
cavity, allowing analysis of the inflammatory response, simi- antibiotics, being active against pathogens often resistant
lar to human joint inflammation in rheumatoid arthritis [20]. to conventional therapy [20]. Other studies report that
In the present study, analyzing bacterial load, it was some essential oils may contain substances that more easily
observed that the EOC had a positive effect, since the load penetrate the lipid layer, as differences in the bacterial cell wall
of S. aureus was reduced in the inflammatory environment structures allow or prevent entry of substances in bacteria
when treated on both study days. However, few data report [23].
the action of EOC on microorganisms in a model air pouch. During inflammatory processes, some mononuclear cells
Studies assessing ginger oils, lemongrass (has high citral and polymorphonuclear immune system are recruited to the
content), mint, pepper, and rosemary against a strain of S. site of infection and can initiate an inflammatory response
aureus have reported bactericidal effects of these oils after [24]. Regarding the profile of total leukocytes in peripheral
24 h [21]. It was observed that the EOC does not induce the blood, we found no differences between the S and S + CT
development of resistance to antibiotics or components of groups. However, increases were observed in the number of
Evidence-Based Complementary and Alternative Medicine 7

80 15
Relative expression (2−ddct )

Relative expression (2−ddct )

60
10
IL-1𝛽/𝛽-actin

IL-6 /𝛽-actin
40

5
20

0 0
S 4h

S + CT 4 h

S 4h

S + CT 4 h
C 4h

CT 4 h

C 4h

CT 4 h
S 8h

S 8h
C 8h

CT 8 h

S + CT 8 h

C 8h

CT 8 h

S + CT 8 h
C: Tween 1% C: Tween 1%
CT: essential oil citral l CT: essential oil citral l
S: Staphylococcus aureus S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral S + CT: S. aureus + essential oil citral
20
)
−ddct

15
TNF-𝛼/𝛽-actin
Relative expression (2

10

0
S 4h

S + CT 4 h
C 4h

CT 4 h

S 8h
C 8h

CT 8 h

S + CT 8 h

C: Tween 1%
CT: essential oil citral l
S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral

Figure 5: Gene expression of IL-1𝛽, IL-6 and TNF-𝛼 in air pouch from Balb/c mice after 4 and 8 hours’ inoculation. Groups (𝑛 = 6) inoculated
with Tween 1% (C), citral (CT), S. aureus (S) and S. aureus treated with citral (S + CT), in an experiment lasting 4 and 8 h. Significant
difference using 𝑝 < 0.05, Kruskal-Wallis test.

cells in C and CT groups. This increase can be influenced by of neutrophils to the site of inflammation, NOD2 and TLR2
many factors and cannot be solely related to bacterial action, [29]. In the present study, groups C, CT, and S + CT had a
since the air pouch induction causes stress in the animals with higher migration of neutrophils compared to group S. When
consequent release of catecholamines and cortisol, which infection occurs, several chemoattractant factors are released
may lead to an increase in the blood rate of leucocytes and can be recognized by receptors on the surface of neu-
[25]. The differential counts of leukocytes (lymphocytes, trophils, resulting in a strong chemoattractant response that
neutrophils, and monocytes) showed differences in the two can stimulate and activate a cascade of intracellular signaling,
times of the experiment. Although there were no differences providing neutrophil migration to the inflammatory site [30].
observed between the groups S and S + CT compared to The air pouch model, the local reaction at the infection
neutrophils, they are among the major cell types elevated site, has as its trigger a localized inflammatory response,
in the bloodstream after a bacterial infection, part of the wherein the release of cytokines can occur so that they
first line of defense [26]. Different studies with S. aureus eradicate infection [28]. In this study, the analysis of the
demonstrate an increase of neutrophils in the peripheral washed air pouch was observed for all three cytokines
blood after challenge [27, 28], unlike the data found in the studied, showing a reduction in the levels when the animals
two experiments in this study. Two receptors are involved were treated with EOC. The anti-inflammatory activity of this
in the assembly of the inflammatory response and migration oil was described [31], demonstrating that it has the property
8 Evidence-Based Complementary and Alternative Medicine

15

Macrophages/fields
10

S 4h

S + CT 4 h

S 8h
C 4h

CT 4 h

C 8h

CT 8 h

S + CT 8 h
C: Tween 1%
CT: essential oil citral l
S: Staphylococcus aureus
S + CT: S. aureus + essential oil citral
(a)
Group C 4 h Group S 4 h Group S + CT 4 h

(b)

Figure 6: Immunolocalization of macrophages in air pouch from Balb/c mice after 4- and 8-hour inoculation. (a) Number of macrophages
per field. Groups (𝑛 = 6): Tween 1% (C), citral (CT), S. aureus (S), and S. aureus treated with citral (S + CT). Significant difference with
𝑝 < 0.05, Kruskal-Wallis test. (b) Representative photomicrographs of immunolocalization of macrophages. Original magnification ×400.

of inhibiting production of in vivo and in vitro IL-1𝛽 and IL- Thus, it is believed that the EOC has anti-inflammatory
6 in mice peritoneal macrophages, as confirmed by findings abilities, since it enhances TNF-𝛼 as a target for the preven-
in this study in relation to IL-6. According to the literature, tion of inflammatory events induced by chemicals. Although
mice inoculated with carrageenan, the treatment with oral few studies can be found in the literature on the influence of
doses of 50–300 mg/Kg of essential oil obtained from Myrcia monoterpene compounds in modulating gene expression of
ovata plant, rich in EOC, demonstrated a significant effect TNF-𝛼, there are reports that citral oil inhibits an increase
in reducing pain and inflammation [23]. Regarding the data in TNF-𝛼 levels in RAW 264.7 cells that are stimulated
obtained in the washing with the inflammatory mediators of with lipopolysaccharide (LPS) [33]. In the same way, it was
the air pouch tissue, this result may have occurred due to the observed in the literature that the EOC at concentrations of 50
mechanism of action, since the pharmacological effect of the and 100 𝜇g/mL reduced the TNF-𝛼 relative expression com-
most relevant EOC is caused by inhibition of TRPV1, TRPV3, pared to treatment with LPS [34]. Authors analyzing alveolar
TRPA1, and TRPM8 after activation of these receptors. This macrophages observed that treatment with citral oil in mice
inhibition occurs only in initially activated receptors and is with lung injury induced by LPS inhibited TNF-𝛼, IL-1𝛽, and
irreversible and calcium-independent [32]. IL-6 levels both in vivo and in vitro, demonstrating that the
Analyzing the expression of TNF-𝛼, IL-1𝛽, and IL-6 gene, EOC can inhibit a possible inflammatory response [18]. It was
we can observe significant differences for the three genes. also demonstrated that the alcoholic extract of lemongrass,
However, evaluating the S and S + T groups, only in the time which has as major compound citral, reduced the generation
of 4 h there were no significant difference levels of TNF-𝛼. of TNF-𝛼 in bronchoalveolar macrophages stimulated with
Evidence-Based Complementary and Alternative Medicine 9

LPS, enhancing the anti-inflammatory potential of citral and Acknowledgments

indicating that modulation of the COX-2 and TNF-𝛼 genes
can be one of the mechanisms involved in such activity [35]. This study was supported by Fundação de Amparo a Pesquisa
The dosage of inflammatory markers by ELISA compared do Estado da Bahia (RED0016/2014). The authors thank
to gene expression showed differences in results, particularly AcademicEnglishSolutions.com for revising the English.
IL-6 and IL-1𝛽. This could happen through a change in the
amount of cytokines, due to the expression or not of a gene
regulated by a site-specific methylation. The immunological
References
response may be compromised by epigenetic mechanisms, [1] S. H. M. Rooijakkers, K. P. M. van Kessel, and J. A. G. van
including gene silencing by methylation in the promoter Strijp, “Staphylococcal innate immune evasion,” Trends in
region and blocking gene transcription [36]. In addition, the Microbiology, vol. 13, no. 12, pp. 596–601, 2005.
EOC may cause possible interference in the expression of [2] H. K. Kim, V. Thammavongsa, O. Schneewind, and D. Missi-
these genes. In the line RAW 264.7 mice macrophages stimu- akas, “Recurrent infections and immune evasion strategies of
lated with LPS, citral inhibited the phosphorylation interac- Staphylococcus aureus,” Current Opinion in Microbiology, vol.
tion with inhibitory proteins kB (IkB), blocking translocation 15, no. 1, pp. 92–99, 2012.
of the p50 and p65 subunits of NF-kB and leading to a [3] H. F. L. Wertheim, D. C. Melles, M. C. Vos et al., “The role
low expression of inducing enzyme nitric oxide synthetase of nasal carriage in Staphylococcus aureus infections,” Lancet
(iNOS) [37]. Infectious Diseases, vol. 5, no. 12, pp. 751–762, 2005.
This study also demonstrated a relationship between the [4] A. M. Bernard and G. R. Bernard, “The immune response:
production of cytokines and bacterial load, since the lower targets for the treatment of severe sepsis,” International Journal
bacterial load in animals treated seems to be related to lower of Inflammation, vol. 2012, Article ID 697592, 9 pages, 2012.
IL-6, IL-1𝛽, and TNF-𝛼 expression in washed air pouch and [5] M. R. N. Celes, C. M. Prado, and M. A. Rossi, “Sepsis: going to
TNF-𝛼 of gene expression. Regarding the effectiveness in the heart of the matter,” Pathobiology, vol. 80, no. 2, pp. 70–86,
times of treatment chosen, it seems that with 4 h the EOC had 2012.
better action; however, little is known about the performance [6] L. Ding, H. Jing, B. Qin et al., “Regulation of cell division and
of this oil in animals, and more studies need to be conducted. growth in roots of Lactuca sativa L. Seedlings by the ent-kaurene
A study on the stability of the major constituents of the diterpenoid rabdosin B,” Journal of Chemical Ecology, vol. 36,
essential oil of lemongrass, rich mainly in citral and myrcene, no. 5, pp. 553–563, 2010.
reported a significant variation in the degradation of these [7] F. Bakkali, S. Averbeck, D. Averbeck, and M. Idaomar, “Bio-
compounds in relation to temperature and time; however, the logical effects of essential oils—a review,” Food and Chemical
interaction between the variants was not significant for citral Toxicology, vol. 46, no. 2, pp. 446–475, 2008.
[38]. [8] G. Singh, S. Maurya, M. P. deLampasona, and C. A. N. Catalan,
Thus, our results showed that the use of the essential oil “A comparison of chemical, antioxidant and antimicrobial
citral in the local therapy of infectious diseases triggered by studies of cinnamon leaf and bark volatile oils, oleoresins and
S. aureus showed positive action. However, the existence of their constituents,” Food and Chemical Toxicology, vol. 45, no. 9,
a harmful action or interference in the physiology and/or pp. 1650–1661, 2007.
structures of bacterial cells of this natural product and [9] N. Dudai, Y. Weinstein, M. Krup, T. Rabinski, and R. Ofir,
its bioavailability when used in living beings are not well “Citral is a new inducer of caspase-3 in tumor cell lines,” Planta
understood. Given the above information and grounded in Medica, vol. 71, no. 5, pp. 484–488, 2005.
the literature, this was the first study to assess the joint [10] R. Irkin and M. Korukluoglu, “Effectiveness of cymbopogon
influence of the air pouch model, essential oil citral, and S. citratus l. essential oil to inhibit the growth of some filamentous
aureus, since the EOC appears to be a potential therapeutic fungi and yeasts,” Journal of Medicinal Food, vol. 12, no. 1, pp.
agent for treating local infections triggered by S. aureus. 193–197, 2009.
In conclusion, the treatment with essential oil citral in the [11] A. K. Tyagi and A. Malik, “Liquid and vapour-phase antifungal
infection triggered by S. aureus led to a reduction of some activities of selected essential oils against candida albicans:
features of acute inflammation, including the number of microscopic observations and chemical characterization of
monocytes. The TNF-𝛼 cytokine has proved to be a more cymbopogon citratus,” BMC Complementary and Alternative
sensitive biomarker, in ELISA and RT-qPCR array. By reduc- Medicine, vol. 10, article 65, 2010.
ing TNF-𝛼 concentration, EOC promoted the reduction of [12] K. B. Laupland, T. Ross, and D. B. Gregson, “Staphylococcus aur-
transcription of genes related to proinflammatory cytokines. eus bloodstream infections: risk factors, outcomes, and the
influence of methicillin resistance in Calgary, Canada, 2000–
The action of the EOC seems to have a better response in
2006,” Journal of Infectious Diseases, vol. 198, no. 3, pp. 336–343,
a period of 4 h; thus, this suggests that the EOC can act as 2008.
a modulator of the immune system by decreasing cellular
[13] G. Sakoulas and R. C. Moellering Jr., “Increasing antibiotic resis-
migration and the production of proinflammatory cytokines tance among methicillin-resistant Staphylococcus aureus
following infection with S. aureus. strains,” Clinical Infectious Diseases, vol. 46, supplement 5, pp.
S360–S367, 2008.
Competing Interests [14] A. Tegnell, K. Grabowska, A. Jacobsson, M. Andersson, J.
Giesecke, and L. Öhman, “Study of developed resistance due
The authors declare that there are no competing interests to antibiotic treatment of coagulase-negative Staphylococci,”
regarding the publication of this paper. Microbial Drug Resistance, vol. 9, no. 1, pp. 1–6, 2003.
10 Evidence-Based Complementary and Alternative Medicine

[15] C. K. Naber, “Future strategies for treating Staphylococcus [32] S. C. Stotz, J. Vriens, D. Martyn, J. Clardy, and D. E. Clapham,
aureus bloodstream infections,” Clinical Microbiology and Infec- “Citral sensing by Transient [corrected] receptor potential
tion, vol. 14, no. 2, pp. 26–34, 2008. channels in dorsal root ganglion neurons,” PLoS ONE, vol. 3,
[16] M. N. Boukhatem, M. A. Ferhat, A. Kameli, F. Saidi, and H. T. no. 5, p. e2082, 2082.
Kebir, “Lemon grass (cymbopogon citratus) essential oil as a [33] C.-T. Lin, C.-J. Chen, T.-Y. Lin, J. C. Tung, and S.-Y. Wang, “Anti-
potent anti-inflammatory and antifungal drugs,” Libyan Journal inflammation activity of fruit essential oil from Cinnamomum
of Medicine, vol. 9, 2014. insularimontanum Hayata,” Bioresource Technology, vol. 99, no.
[17] M. I. Ortiz, M. P. González-Garcı́a, H. A. Ponce-Monter, G. 18, pp. 8783–8787, 2008.
Castañeda-Hernández, and P. Aguilar-Robles, “Synergistic eff- [34] M. de Paula Porto, G. N. da Silva, B. C. O. Luperini et al., “Citral
ect of the interaction between naproxen and citral on inflam- and eugenol modulate DNA damage and pro-inflammatory
mation in rats,” Phytomedicine, vol. 18, no. 1, pp. 74–79, 2010. mediator genes in murine peritoneal macrophages,” Molecular
[18] Y. Shen, Z. Sun, and X. Guo, “Citral inhibits lipopolysaccharide- Biology Reports, vol. 41, no. 11, pp. 7043–7051, 2014.
induced acute lung injury by activating PPAR-𝛾,” European [35] M. Tiwari, U. N. Dwivedi, and P. Kakkar, “Suppression of
Journal of Pharmacology, vol. 747, pp. 45–51, 2015. oxidative stress and pro-inflammatory mediators by Cymbo-
[19] S. Kar Mahapatra, S. Bhattacharjee, S. P. Chakraborty, S. Maju- pogon citratus D. Stapf extract in lipopolysaccharide stimulated
mdar, and S. Roy, “Alteration of immune functions and Th1/Th2 murine alveolar macrophages,” Food and Chemical Toxicology,
cytokine balance in nicotine-induced murine macrophages: vol. 48, no. 10, pp. 2913–2919, 2010.
immunomodulatory role of eugenol and N-acetylcysteine,” [36] S. B. Baylin, “DNA methylation and gene silencing in cancer,”
International Immunopharmacology, vol. 11, no. 4, pp. 485–495, Nature Clinical Practice Oncology, vol. 2, supplement 1, pp. S4–
2011. S11, 2005.
[20] D. B. Duarte, M. R. Vasko, and J. C. Fehrenbacher, “Models of [37] H. J. Lee, H. S. Jeong, D. J. Kim, Y. H. Noh, D. Y. Yuk, and J. T.
inflammation: carrageenan air pouch,” in Current Protocols in Hong, “Inhibitory effect of citral on NO production by supp-
Pharmacology, chapter 5, unit 5.6, 2012. ression of iNOS expression and NF-𝜅B activation in RAW264.7
[21] L. N. Barbosa, I. S. Probst, B. F. M. T. Andrade et al., “In vitro cells,” Archives of Pharmacal Research, vol. 31, no. 3, pp. 342–349,
antibacterial and chemical properties of essential oils includ- 2008.
ing native plants from Brazil against pathogenic and resistant [38] G. F. Santoro, M. G. Cardoso, L. G. L. Guimarães, J. M. Freire,
bacteria,” Journal of Oleo Science, vol. 64, no. 3, pp. 289–298, and M. J. Soares, “Anti-proliferative effect of the essential oil of
2015. Cymbopogon citratus (DC) Stapf (lemongrass) on intracellular
[22] J. Apolónio, M. L. Faleiro, M. G. Miguel, and L. Neto, “No induc- amastigotes, bloodstream trypomastigotes and culture epimas-
tion of antimicrobial resistance in Staphylococcus aureus and tigotes of Trypanosoma cruzi (Protozoa: Kinetoplastida),” Para-
Listeria monocytogenes during continuous exposure to eugenol sitology, vol. 134, no. 11, pp. 1649–1656, 2007.
and citral,” FEMS Microbiology Letters, vol. 354, no. 2, pp. 92–
101, 2014.
[23] G. C. A. M. Dos Santos, G. A. M. Gomes, G. M. A. Gonçalves
et al., “Essential oil from Myrcia ovata: chemical composition,
antinociceptive and anti-inflammatory properties in mice,”
Planta medica, vol. 80, no. 17, pp. 1588–1596, 2014.
[24] J. K. Kundu and Y.-J. Surh, “Inflammation: gearing the journey
to cancer,” Mutation Research—Reviews in Mutation Research,
vol. 659, no. 1-2, pp. 15–30, 2008.
[25] R. J. Benschop, M. Rodriguez-Feuerhahn, and M. Schedlowski,
“Catecholamine-induced leukocytosis: early observations, cur-
rent research, and future directions,” Brain, Behavior, and
Immunity, vol. 10, no. 2, pp. 77–91, 1996.
[26] J. S. Cho, Y. Guo, R. I. Ramos et al., “Neutrophil-derived IL-
1𝛽 is sufficient for abscess formation in immunity against Sta-
phylococcus aureus in mice,” PLoS Pathogens, vol. 8, no. 11,
Article ID e1003047, 2012.
[27] R. A. Proctor, “Is there a future for a Staphylococcus aureus vac-
cine?” Vaccine, vol. 30, no. 19, pp. 2921–2927, 2012.
[28] K. M. Rigby and F. R. DeLeo, “Neutrophils in innate host defe-
nse against Staphylococcus aureus infections,” Seminars in Imm-
unopathology, vol. 34, no. 2, pp. 237–259, 2012.
[29] H. Wang, G. Yu, H. Yu et al., “Characterization of TLR2,
NOD2, and related cytokines in mammary glands infected
by Staphylococcus aureus in a rat model,” Acta Veterinaria
Scandinavica, vol. 57, no. 1, article 25, 2015.
[30] T. J. Foster, “Immune evasion by staphylococci,” Nature Reviews
Microbiology, vol. 3, no. 12, pp. 948–958, 2005.
[31] T. F. Bachiega and J. M. Sforcin, “Lemongrass and citral effect
on cytokines production by murine macrophages,” Journal of
Ethnopharmacology, vol. 137, no. 1, pp. 909–913, 2011.
 MEDIATORS of

INFLAMMATION

The Scientific Gastroenterology Journal of

World Journal
Hindawi Publishing Corporation
Research and Practice
Hindawi Publishing Corporation
Hindawi Publishing Corporation
Diabetes Research
Hindawi Publishing Corporation
Disease Markers
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal of International Journal of

Immunology Research
Hindawi Publishing Corporation
Endocrinology
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Submit your manuscripts at

https://www.hindawi.com

BioMed
PPAR Research
Hindawi Publishing Corporation
Research International
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal of
Obesity

Evidence-Based
Journal of Stem Cells Complementary and Journal of
Ophthalmology
Hindawi Publishing Corporation
International
Hindawi Publishing Corporation
Alternative Medicine
Hindawi Publishing Corporation Hindawi Publishing Corporation
Oncology
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Parkinson’s
Disease

Computational and
Mathematical Methods
in Medicine
Behavioural
Neurology
AIDS
Research and Treatment
Oxidative Medicine and
Cellular Longevity
Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014