Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining

by
Tan, Steinbach, Kumar
What is Data?

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Collection of data objects and Attributes
their attributes

An attribute is a property or Tid Refund Marital Taxable

characteristic of an object Status Income Cheat

– Examples: eye color of a person, 1 Yes Single 125K No

temperature, etc. 2 No Married 100K No

– Attribute is also known as variable, 3 No Single 70K No

field, characteristic, 4 Yes Married 120K No
or feature Objects 5 No Divorced 95K Yes
6 No Married 60K No
A collection of attributes describe an
7 Yes Divorced 220K No
object
8 No Single 85K Yes
– Object is also known as record, point,
9 No Married 75K No
case, sample,
10 No Single 90K
entity, or instance 10
Yes

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Attribute Values

Attribute values are numbers or symbols

assigned to an attribute

Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute
values
◆ Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of

values

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 ◆ Example: Attribute values for ID and age are integers
◆ But properties of attribute values can be different
– ID has no limit but age has a maximum and minimum value
Measurement of Length
The way you measure an attribute is somewhat may not match the
attributes properties.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 Types of Attributes

There are different types of attributes

– Nominal
◆ Examples: ID numbers, eye color, zip codes
– Ordinal
◆ Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
◆ Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 ◆ Examples: temperature in Kelvin, length, time, counts

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Properties of Attribute Values

The type of an attribute depends on which of the

following properties it possesses:
– Distinctness: = 
– Order: < >
– Addition: + -
– Multiplication: */
– Nominal attribute: distinctness
– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Attribute Description Examples Operations
Type

Nominal The values of a nominal attribute are zip codes, employee mode, entropy,
just different names, i.e., nominal ID numbers, eye color, contingency
attributes provide only enough sex: {male, female} correlation, 2
information to distinguish one object test
from another. (=, )

Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,

provide enough information to {good, better, best}, rank correlation,
order objects. (<, >) grades, street numbers run tests, sign tests

Interval For interval attributes, the calendar dates, mean, standard

differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists. tests
(+, - )
Ratio For ratio variables, both differences temperature in Kelvin, geometric mean,
and ratios are meaningful. (*, /) monetary quantities, harmonic mean,
counts, age, mass, percent variation
length, electrical
current

Attribute Transformation Comments

Level

Nominal Any permutation of values If all employee ID numbers

were reassigned, would it
make any difference?
Ordinal An order preserving change of
values, i.e., new_value = An attribute encompassing
f(old_value) where f is a the notion of good, better
monotonic function. best can be represented
equally well by the values
{1, 2, 3} or by { 0.5, 1, 10}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where their
zero value is and the size of
a unit (degree).

Ratio new_value = a * old_value Length can be measured in

meters or feet.
 Discrete and Continuous Attributes
Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection
of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete attributes

Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 – Continuous attributes are typically represented as floating-point
variables.

Types of data sets

Record
– Data Matrix
– Document Data – Transaction Data

Graph
– World Wide Web
– Molecular Structures

Ordered
– Spatial Data
– Temporal Data
– Sequential Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 – Genetic Sequence Data

Important Characteristics of Structured Data

– Dimensionality
◆ Curse of Dimensionality

– Sparsity
◆ Only presence counts

– Resolution
◆ Patterns depend on the scale

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Record Data

Data that consists of a collection of records, each

of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 10 No Single 90K Yes
10

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Data Matrix

If data objects have the same fixed set of numeric

attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

Such data set can be represented by an m by n matrix,

where there are m rows, one for each object, and n
columns, one for each attribute
Projection of Projection of Distance Load Thickness
x Load y load

10.23 5.27 15.22 2.7 1.2

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 12.65 6.25 16.22 2.2 1.1

Document Data

Each document becomes a `term' vector,

– each term is a component (attribute) of the vector,
– the value of each component is the number of times the
corresponding term occurs in the document.

score

timeout
coach

pla

ball

game

lost

season
y
team

wi
Document 1 3 0 5 0 2 6 n
0 2 0 2

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

Transaction Data

A special type of record data, where

– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.
TID Items
1 Bread, Coke, Milk

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk

Graph Data

Examples: Generic graph and HTML Links

<a href="papers/[Link]#bbbb">

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 2
5 1
2
5
Data Mining </a>
<li>
<a href="papers/[Link]#aaaa">
Graph Partitioning </a>
<li>
<a href="papers/[Link]#aaaa">
Parallel Solution of Sparse Linear System of Equations </a> <li>
<a href="papers/[Link]#ffff">
N-Body Computation and Dense Linear System Solvers

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Chemical Data

Benzene Molecule: C6H6

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Ordered Data

Sequences of transactions
Items/Events

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 An element of
the sequence

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Ordered Data

Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Ordered Data

Spatio-

Temporal
Data

Average
Monthly

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Temperature of
land and ocean
Data Quality

What kinds of data quality problems?

How can we detect problems with the data?
What can we do about these problems?

Examples of data quality problems:

– Noise and outliers
– missing values
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 – duplicate data
Noise

Noise refers to modification of original values

– Examples: distortion of a person’s voice when talking
on a poor phone and “snow” on television screen

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Two Sine Waves Two Sine Waves + Noise

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Outliers

Outliers are data objects with characteristics that

are considerably different than most of the other
data objects in the data set

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Missing Values

Reasons for missing values

– Information is not collected
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 (e. g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e. g., annual income is not applicable to children)

Handling missing values

– Eliminate Data Objects
– Estimate Missing Values
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their
probabilities)

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Duplicate Data

Data set may include data objects that are

duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeous
sources

Examples:
– Same person with multiple email addresses

Data cleaning
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 – Process of dealing with duplicate data issues
Data Preprocessing

Aggregation
Sampling
Dimensionality Reduction
Feature subset selection
Feature creation
Discretization and Binarization
Attribute Transformation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Aggregation

Combining two or more attributes (or objects) into

a single attribute (or object)

Purpose
– Data reduction
◆ Reduce the number of attributes or objects
– Change of scale
◆ Cities aggregated into regions, states, countries, etc

– More “stable” data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 ◆ Aggregated data tends to have less variability

Aggregation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of Average

Monthly Precipitation Yearly Precipitation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Sampling
Sampling is the main technique employed for data
selection.
– It is often used for both the preliminary investigation of the data
and the final data analysis.

Statisticians sample because obtaining the entire set of data

of interest is too expensive or time consuming.

Sampling is used in data mining because processing the

entire set of data of interest is too expensive or time
consuming.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Sampling …

The key principle for effective sampling is the

following:
– using a sample will work almost as well as using the
entire data sets, if the sample is representative

– A sample is representative if it has approximately the

same property (of interest) as the original set of data
Types of Sampling
Simple Random Sampling
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 – There is an equal probability of selecting any particular item

Sampling without replacement

– As each item is selected, it is removed from the population

Sampling with replacement

– Objects are not removed from the population as they are selected
for the sample.
◆ In sampling with replacement, the same object can be picked up more
than once

Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Sample Size

8000 points 2000 Points 500 Points

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

Sample Size
What sample size is necessary to get at least one object
from each of 10 groups.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 Curse of
Dimensionality
When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

Definitions of density and

distance between points, which is critical for clustering and

outlier detection, become less meaningful
• Randomly generate 500 points
• Compute difference between max and min distance between any pair of points

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Dimensionality Reduction
Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by
data mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

Techniques
– Principle Component Analysis
– Singular Value Decomposition
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 – Others: supervised and non-linear techniques
Dimensionality Reduction: PCA

Goal is to find a projection that captures the

largest amount of variation in data
x2

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 x1

Dimensionality Reduction: PCA

Find the eigenvectors of the covariance matrix

The eigenvectors define the new space

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 x2

x1

Dimensionality Reduction: ISOMAP

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 By: Tenenbaum, de Silva,
Langford (2000)

Construct a neighbourhood graph

For each pair of points in the graph, compute the
shortest path distances – geodesic distances
Dimensionality Reduction: PCA
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 Dimensions = 206Dimensions = 80160142

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Feature Subset Selection

Another way to reduce dimensionality of data

Redundant features
– duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid

Irrelevant features

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 – contain no information that is useful for the data mining
task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
Feature Subset Selection

Techniques:
– Brute-force approch:
◆Try all possible feature subsets as input to data mining algorithm
– Embedded approaches:
◆ Feature selection occurs naturally as part of the data mining
algorithm

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 – Filter approaches:
◆ Features are selected before data mining algorithm is run
– Wrapper approaches:
◆ Use the data mining algorithm as a black box to find best
subset of attributes

Feature Creation

Create new attributes that can capture the

important information in a data set much more
efficiently than the original attributes

Three general methodologies:

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 – Feature Extraction
◆ domain-specific
– Mapping Data to New Space – Feature
Construction
◆ combining features

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Fourier transform
Wavelet transform

Two Sine Waves Two Sine Waves + Noise Frequency

Mapping Data to a New Space

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Discretization Using Class Labels
Entropy based approach

3 categories for both x and y 5 categories for both x and y

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Discretization Without Using Class Labels

Data Equal interval width

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Equal frequency K-means

Attribute Transformation

A function that maps the entire set of values of a

given attribute to a new set of replacement values
such that each old value can be identified with one
of the new values
– Simple functions: xk, log(x), ex, |x|

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 – Standardization and Normalization

Similarity and Dissimilarity

Similarity
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 – Often falls in the range [0,1]
Dissimilarity
– Numerical measure of how different are two data
objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
Similarity/Dissimilarity for Simple Attributes

p and q are the attribute values for two data objects.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 Euclidean Distance

Euclidean Distance

n 2
dist = (pk −qk)
k=1
Where n is the number of dimensions (attributes) and pk and
qk are, respectively, the kth attributes (components) or data
objects p and q.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Standardization is necessary, if scales differ.
Euclidean Distance

3 point x y
p1
p1 0 2
2
p3 p4
p2 2 0
1 p3 3 1
p2 p4 5 1
0
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Distance Matrix
Minkowski Distance

Minkowski Distance is a generalization of Euclidean

Distance
1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 dist = ( n | pk −qk |r)r
k=1
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the kth attributes
(components) or data objects p and q.
Minkowski Distance: Examples

r = 1. City block (Manhattan, taxicab, L1 norm) distance.

– A common example of this is the Hamming distance, which is just the
number of bits that are different between two binary vectors

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 r = 2. Euclidean distance

norm, L
r → . “supremum” (Lmax  norm) distance.
– This is the maximum difference between any component of the vectors

Do not confuse r with n, i.e., all these distances are

defined for all numbers of dimensions.
Minkowski Distance
point x L1 p1 p2 p3 p4
p1 0 p1 0 4 4 6
p2 2 p2 4 0 2 4
p3 3 p3 4 2 0 2
p4 5 p4 6 4 2 0

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 L2 p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Distance Matrix

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Mahalanobis Distance

−1
mahalanobis(p,q) = (p−q) (p−q)T
 is the covariance matrix of
the input data X

1 n

 j,k = n i=1 (Xij −X j )(Xik −X k

) −1

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Mahalanobis Distance
Covariance Matrix:

0.3 0.2
 = 0.2 0.3
C  

B A: (0.5, 0.5)
B: (0, 1)
A C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Common Properties of a Distance

Distances, such as the Euclidean distance, have

some well known properties.
1. d(p, q)  0 for all p and q and d(p, q) = 0 only if p = q.
(Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r)  d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 A distance that satisfies these properties is a
metric

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Common Properties of a Similarity

Similarities, also have some well known

properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.

2. s(p, q) = s(q, p) for all p and q. (Symmetry)

where s(p, q) is the similarity between points (data

objects), p and q.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Similarity Between Binary Vectors
Common situation is that objects, p and q, have only
binary attributes
Compute similarities using the following quantities
M01 = the number of attributes where p was 0 and q was 1
M10 = the number of attributes where p was 1 and q was 0
M00 = the number of attributes where p was 0 and q was 0
M11 = the number of attributes where p was 1 and q was 1

Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes
= (M11 + M00) / (M01 + M10 + M11 + M00)

J = number of 11 matches / number of not-both-zero attributes values

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 = (M11) / (M01 + M10 + M11)

SMC versus Jaccard: Example

p= 1000000000 q
= 0000001001

M01 = 2 (the number of attributes where p was 0 and q was 1)

M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)
SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) / (2+1+0+7) = 0.7

J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 Cosine Similarity
If d1and d are
2 two document vectors, then
cos( d1, d2 ) = (d1 • d2) / ||d1|| ||d2|| , where • indicates

vector dot product and || d || is the length of vector d.

Example:

d1 = 3 2 0 5 0 0 0 2 0 0 d2 =
1000000102

d1 • d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5

||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481

||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.245

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 d,d
cos( 1 2 ) = .3150

Extended Jaccard Coefficient (Tanimoto)

Variation of Jaccard for continuous or count

attributes
– Reduces to Jaccard for binary attributes

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Correlation

Correlation measures the linear relationship

between objects
To compute correlation, we standardize data
objects, p and q, and then take their dot product

pk = (pk − mean(p))/std(p) qk = (qk −

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 mean(q))/std(q) correlation(p,q) =

p•q

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Visually Evaluating Correlation

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Scatter plots
showing the
similarity from
–1 to 1.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 General Approach for Combining Similarities

Sometimes attributes are of many different

types, but an overall similarity is needed.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Using Weights to Combine Similarities

May not want to treat all attributes the same.

– Use weights wk which are between 0 and 1 and sum to
1.

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Density

Density-based clustering require a notion of

density

Examples:
– Euclidean density
◆ Euclidean density = number of points per unit volume

– Probability density

– Graph-based density
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
 Euclidean Density – Cell-based

Simplest approach is to divide region into a

number of rectangular cells of equal volume and
define density as # of points the cell contains

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›

 Euclidean Density – Center-based

Euclidean density is the number of points within a

specified radius of the point
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›