St. Peter’s College c. RNA is single strand.

Sabayle St., Iligan City d. RNA and DNA have the same 5-C sugar.
Telephone No. (063) 222-2660 local 113
Email Address: [email protected] science 10 9. Messenger RNA (mRNA) is formed from DNA. This process is called __________.
A.Y: 2022 – 2023 3rd Periodical Exam
April 19-20, 2023 a. duplication c. replication
BASIC EDUCATION DEPARTMENT b. transcription d. translation

Name: _________________________________ Score: _____/ 10. The three nitrogenous bases carried by tRNA is called __________.
Grade & Section: ________________________ a. codon c. code
b. anticodon d. genes
Test I. Multiple Choice: Encircle the letter that corresponds to your answer.

1. Each unit of a nucleic acid consists of sugar, attached phosphate group, and a Test II. Identification: Identify what is being describe in each statement. Write your
base called __________. answer on the space provided before the number.
a. histone c. nucleotide
b. nucleolus d. nucleosome ____________1. He was the first to identify the genetic information of living organisms.
____________2. It is the basic unit of nucleic acid.
2. DNA is made up of a phosphate group, an organic base, and a __________.
a. fat c. protein ____________3.
b. molecule of ATP d. sugar Discovered the double helix structure of the DNA.
____________4.
3. In DNA, guanine always pairs with __________. ____________5. A bond creating amino acids as polypeptide chain.
a. adenine c. guanine ____________6. It is made from the DNA code in the nucleus.
b. cytosine d. thymine
____________7. Three nitrogenous bases that codes for amino acid is called _______.
4. Which base pairs are found in DNA? ____________8. The protein factory of the cell.
a. A-C and T-G c. A-G and C-T
b. A-T and C-G d. A-U and C-G ____________9. The process of making proteins by the cell.
____________10. An event where shape of a protein is changed and it stops working.
5. Which of the following would not occur during complementary base pairing?
a. A-T c. C-G
b. A-U d. U-G Test III. True or False: Write FACT if the statement states fact. If false, change the
underlined word/s to make the statement correct.
6. If one side of a DNA molecule contains the following sequence of nucleotides, ____________1. The three types of RNA molecules have different function in making
AGTCCG, the complementary sequence on the other side would be: proteins.
a. AGTCCG c. GCCTGA ____________2. During translation, DNA and RNA are involved.
b. CTGAAT d. TCAGGC
____________3. In protein synthesis, the entire DNA code is being copied and used
7. The base found in RNA nucleotides but not in DNA nucleotides is __________. during translation.
a. adenine c. guanine ____________4. In the process of transcription, DNA double helix unwinds and
b. cytosine d. uracil separates at a certain point.
____________5. RNA polymerase uses the double helix strand as template or
8. All of the following are true about RNA except __________. model in protein synthesis.
a. RNA can leave the nucleus.
b. RNA contains uracil in place of thymine.
Test IV. Crossword Puzzle: Use the clues/descriptions below to fill in the crossword Test VI. Protein synthesis. Transcribe and translate the following codons to specific
puzzle with the correct words. proteins. Write the first three letters ONLY for proteins.

1. DNA: TACTGATCGACCCCCATAATGAAAATC
mRNA: ___________________________________
Amino acid: ______________________________

2. DNA: TACCGCTCCGCCGTCGACAATACCACT
mRNA: _____________________________________
Amino acid: ________________________________

Across
2. It carries amino acid from cytoplasm.
5. Leaving the nucleus, where does mRNA strands go?
7. Causes protein denaturation.
9. Single-ringed smaller molecules
10. Transcription takes place.

Down
1. Step in protein synthesis that occurs in the nucleus.
3. The five Carbon sugar of RNA.
4. Reads mRNA
6. Double-ringed larger molecules.
8. Three bases on tRNA that complements mRNA.

Test V. Essay: Answer the following briefly.

1. What is the role of the following in the DNA extraction process?

2. What does DNA from the banana look like?