An Analysis of Lanthanide-Controlled Transcriptional Regulatory

Candidate Sites in Methylotuvimicrobium buryatense 5GB1C

M. Claire Sarfatis, Department of Microbiology, University of Washington

Abstract
Methylotuvimicrobium buryatense 5GB1C is a methane-oxidizing bacterium with
significant potential for metabolic engineering to divert methane waste and create valuable
biomolecules. In order to engineer this organism’s metabolism, however, more must be
understood about the grammar of its genetic regulation. M. buryatense encodes two methanol
dehydrogenase enzymes. MxaF uses calcium as a cofactor while the other, XoxF, can use a
number of lanthanide metals as its cofactor. In order for this species to regulate its metabolism,
mxaF and other associated genes are downregulated in the presence of lanthanide metals. We
hypothesize that regulatory proteins must exist that bind to promoter region sequences of such
genes and respond to the presence of lanthanide metals. With the program MEME, we identified
possible binding site consensus sequences within the promoter regions of up to five genes that
are downregulated in the presence of lanthanum. After identifying candidate sequences, we
created plasmids linking the promoter regions of the mxaF methanol dehydrogenase gene and
mxaB, a regulatory protein with known involvement in the 5GB1C lanthanide switch, to xylE, a
reporter gene. We then separately created multiple point mutations in each proposed regulatory
site of these genetic constructs in order to disrupt their consensus motifs. These genetic
constructs were mated into M. buryatense 5GB1C for insertion into its chromosome. Reporter
gene assays were performed to compare the relative expressions of xylE linked to wild type and
mutant promoter sequences in the presence or absence of lanthanum. Our results indicate at least
one site that, when mutated, leads to decreased activation of PmxaF in the absence of lanthanum.
A second mutant site abolishes expression from PmxaB in the absence of lanthanum, but has no
detectable effect on PmxaF expression. This project will inform metabolic engineering strategies
to modify expression of genes in this promising organism. Future steps will involve targeted
mutation of individual bases to better define the site responsible for this identified change in
phenotype, testing of mutant candidate sites in other lanthanide-repressed promoter regions, and
pairing of these mutants with mutated regulatory proteins to further elucidate transcriptional
mechanisms.

Introduction
Methane is a gas with very high importance relative to its environmental prevalence, due
to its significance as a greenhouse gas with approximately 25 times the potency of carbon
dioxide per molecule.1 Given the recent upward trend in global temperatures due to such
greenhouse gases, understanding natural environmental pathways involving this gas is critical.
Methanotrophs are bacteria which are able to oxidize methane as a source of energy and
additionally incorporate carbon from methane into biomass for growth. These organisms are of
significant interest with regard to the offsetting of methane waste, especially as candidates for
metabolic engineering.2 Engineered methanotrophs could be used both as an offset for methane
waste that would otherwise be released into the atmosphere and as biological factories for the
production of organic molecules of interest. Research on the metabolic pathways of
methanotrophs and their genetic regulatory mechanisms is critical to this process.
Two unique enzyme families are required for the first steps of methanotrophy: methane
monooxygenases, which add oxygen to methane and yield methanol, as well as methanol
dehydrogenases, which remove hydrogen from methanol to yield formaldehyde. Formaldehyde
can then be oxidized fully to carbon dioxide for energy, or incorporated into biomolecules.
Recent discoveries regarding the involvement of lanthanide metals in this pathway further
increase the potential environmental importance of methanotrophs. Many methanotrophs possess
methanol dehydrogenases which require the presence of a lanthanide cofactor for catalysis, and
this represents the first observed biological use of these elements.3 While lanthanides are not
uncommon in the earth, mining these metals can have significant environmental impacts,
limiting their availability and increasing the price of these critical elements for many electronic
devices.4,5 Therefore, the involvement of lanthanides in methanotrophic metabolisms is of
significant interest. If the mechanisms of uptake and regulation can be characterized, these
organisms have potential as a biological reservoir of lanthanides for industrial use.
The methane to biomass metabolic pathway of our organism of interest,
Methylotuvimicrobium buryatense 5GB1C, involves two different proteins that can each serve as
the primary methane monooxygenase depending on environmental conditions: a particulate
enzyme (pMMO) that uses copper as a cofactor and is expressed in the presence of copper, as
well as a soluble enzyme (sMMO) that uses iron as a cofactor and is repressed by copper.6
Similarly, it has two methanol dehydrogenases, MxaF and XoxF.7 XoxF is the
lanthanide-dependent methanol dehydrogenase, which is up-regulated in the presence of
lanthanum, whereas MxaF utilizes a calcium cofactor and is strongly down-regulated by
lanthanides.8 This “lanthanide switch” likely increases metabolic efficiency, allowing 5GB1C to
only express mxaF in the absence of lanthanides.
In order to regulate this metabolic switch, 5GB1C must modulate the expression of many
genes. Based on RNAseq data,9 we identified six genes of interest that showed a significant
decrease in expression in the presence of lanthanum as opposed to the absence. These genes fell
primarily into three categories with regard to regulation. The first, which includes mxaF, a
methanol dehydrogenase, and mxaB, a regulatory protein that modulates its expression, have
high expression in the absence of lanthanum and almost full loss of expression in its presence.
Three others, the mxaY histidine kinase known to regulate mxaF expression,10 the TonB
dependent receptor lanA, and a particular tonB gene itself, are expressed at low levels in the
absence of lanthanum but repressed in its presence. Finally, pqqA, a peptide necessary for
production of coenzyme PQQ,11 is highly expressed in the absence of lanthanum but only
expressed about half as much when lanthanum is present. These regulatory schemes likely
require the action of one or more DNA-binding regulatory proteins for either activation of genes
in the absence of lanthanum or repression in its presence. Given that M. buryatense 5GB1C is a
non-model organism, these proteins are as of yet unknown except for MxaB, and their binding
sites on DNA are not characterized.
In order to characterize these regulatory mechanisms, we identified sequence similarities
present in the upstream promoter regions of at least five of the lanthanum-repressed genes
described above. Given that any proteins which regulate this repression in the presence of
lanthanum likely bind within this region, we expected that such sequence similarities could be
tested for their involvement in this process by knockout of consensus. This should prevent any
protein acting in these regions from binding, resulting in a change in expression level from these
promoters either in the presence or absence of lanthanum. The three identified candidate motifs
were altered by site-specific mutagenesis in the promoter regions of mxaF and mxaB. Each
mutated promoter was linked to a xylE reporter gene to test expression relative to the wild-type
sequence under the native regulatory mechanisms of 5GB1C. This process allowed the
identification of a site involved in the up-regulation of mxaF, providing new information as to a
possible regulatory protein binding site necessary for activation of this gene, and possibly others,
in the absence of lanthanum.

Methods
Identification of candidate regulatory sites
Lanthanide-repressed genes were identified by RNAseq data demonstrating relative
expression of M. buryatense 5GB1C genes in the presence and absence of lanthanum.9 To
identify possible conserved motifs within the regulatory upstream regions of these open reading
frames, we first identified the likely promoter region of each gene as the 380 or fewer
nucleotides directly upstream of the gene. In the case of other nearby genes in the upstream
direction, these promoter sequences were selected such that they stopped to exclude nearby open
reading frames. These sequences were then fed through MEME for motif elicitation, with the
specifications that motifs should have zero to one occurrence per sequence inputted, a width
between 6 and 50 nucleotides, and that only the given DNA strand be searched for motifs. After
running nine of these searches with varying combinations of seven promoter regions of interest,
three motifs were selected for their seemingly high conservation across at least five of the
inputted promoter regions. These sequences were designated sites A, B, and C.
Figure 1. Graphical representation of motif sequences of interest identified from MEME search, each given in the 5’
to 3’ direction. Positions in sequence, as numbered at the bottom of each graphic, are relative to sequences identified
to fall under each motif, rather than to any absolute position in promoter regions. Relative likelihood of finding each
nucleotide at each base position in the motif represented by size of letter, corresponding to a value in bits.

Mutation of promoter sequences and construction of insertion plasmids

Bases were selected for mutation in sites A, B, and C based on the relative position
weight (signifying likely importance) in the MEME-generated motifs. Site B bases were
additionally selected to alter only the second half of the palindromic sequence. Plasmid
constructs were designed with mutations of each of the three motif sites in both the PmxaF and
PmxaB regions, with these promoters then being linked to xylE. Primers were designed to insert
site-specific mutations of highly conserved purines in each motif to the alternate purine, with the
same done for pyrimidines. These primers were then used with iProof High-Fidelity Polymerase
to amplify both the insert region and vector backbone of pFC31 for PmxaF-xylE and pFC67 for
PmxaB-xylE, introducing the intended mutations into one candidate site at a time within each of
these promoters. A DpnI digest of each PCR product was then performed with 1 uL DpnI from
NEB, 1.5 uL DNA, 1.5 uL CutSmart buffer, and 11 uL dH2O at 37℃ for 30 minutes to ensure
that only the PCR product rather than the template plasmids remained. These plasmid fragments
were then assembled using NEB Gibson Master Mix according to manufacturer instructions.

Table 1. Mutation schemes for PmxaF and PmxaB

PmxaF

MEME Site Site A Site B Site C

Wild Type Sequence CCGACATTATGCG CTTGATCAAG GCGCTGCCCTCTATGAAT

Mutant Sequence TTAATACTGCGTG CTTGACCGAA ATATTATTCTCTACGAAT

Distance from start codon 21 bases 80 bases 104 bases

PmxaB

MEME Site Site A Site B Site C

Wild Type Sequence CCGACATCATTCC CTTGATCAAG GCGCGGCCCCCTATTGAT

Mutant Sequence TTAATACCGCTTC CTTGACCGAA ATATGATTCCCTACTGAT

Distance from start codon 28 bases 228 bases 267 bases

Table 2. Primers used in this study

Primer Sequence (5’→3’)

Primers used in all plasmids
CS133_insert_R CGACAACCTGCACATAGTGATTCTGGTCGCGC
CS134_vector_F CGACCAGAATCACTATGTGCAGGTTGTCGGTG
AP161_pVK100seq_oriT_R
3 CGAACTGCGAGGCAAACACC
JG224_knockin_F GCAAGCCAGATTGTCGTGCT
JG224_knockin_R GCTTTCATGGTAGTGACGATAAG
pMCS38 PmxaF site A mutation
CS112_mxaF_A_mutant_F CGTTAAtACTGCGtGAAAAATCAATCTGGAGGAAT
CS113_mxaF_A_mutant_R TCCAGATTGATTTTTCaCGCAGTaTTAACGCGGCCCCCTATTGATT
CS136_mxaF_A_confirm_F CCGCGTTAAtACTGCGtG
pMCS39 PmxaF site B mutation
CS114_mxaF_B_mutant_F ATGCGCcttgaCCGAACTAAGCCGGTTGTAACAACAA
CS115_mxaF_B_mutant_R TTCGGtcaagGCGCATAACGAATCATTCATAG
CS137_mxaF_B_confirm_F GTTATGCGCcttgaCCGAA
pMCS40 PmxaF site C mutation
CS116_mxaF_C_mutant_F TGATTACCGTCCGTATATTATTCTCTACGAATGATTCGTTATGCGCCTTG
CS117_mxaF_C_mutant_R ACGAATCATTCGTAGAGAATAATATACGGACGGTAATCATACGGAA
CS138_mxaF_C_confirm_F GATTACCGTCCGTATATTATTCTCTAC
pMCS41 PmxaB site A mutation
CS118_mxaB_A_mutant_F TTGCCGTTAAATATTTAAtACCGCTtCCGGTTTAATTGTATGGAGAAG
CS119_mxaB_A_mutant_R CGGaAGCGGTaTTAAATATTTAACGGCAAAGCCATGG
CS139_mxaB_A_confirm_F TGCCGTTAAATATTTAAtACCGCTtC
pMCS42 PmxaB site B mutation
CS120_mxaB_B_mutant_F GGCTTAGcttgaCCGAAGCGCATAACGAATCATTCATAGAG
CS121_mxaB_B_mutant_R CGCTTCGGtcaagCTAAGCCGGTTGTAACAACAAAC
CS140_mxaB_B_confirm_F GGCTTAGcttgaCCGAAG
pMCS43 PmxaB site C mutation
CS122_mxaB_C_mutant_F TGTCGATATGATTCCCTACTGATTGCGGTGTTTGTTGTTAC
CS123_mxaB_C_mutant_R AACACCGCAATCAGTAGGGAATCATATCGACATTATGCGAAAAATCAATCTG
CS141_mxaB_C_confirm_F ATGTCGATATGATTCCCTACTGAT

Insertion of mutant promoters into M. buryatense 5GB1C

Mutant plasmids were electroporated into E. coli Top10 electrocompetent cells with a 2.5
kV pulse and recovered in 1 mL LB at 37°C with shaking for 40 minutes. After recovery, 10 and
100 uL aliquots were plated onto LB with 50 ug/mL kanamycin and incubated overnight at
37°C. Resistant colonies were screened by colony PCR for the presence of the mutant plasmid
using primer AP161 and the confirmation primer for each individual plasmid. Isolates containing
mutant plasmids were grown in 5 mL LB with 50 ug/mL kanamycin overnight at 37℃ with
shaking, and the plasmids were purified out of these cells by QIAGEN Plasmid MiniPrep
according to manufacturer protocol. The xylE and promoter regions of these isolated plasmids
were sequenced by the Sanger method (Genewiz, Seattle, WA) to confirm the intended mutations
were present and that no other mutations had occurred.
 Each plasmid was inserted into an E. coli S17-1 donor strain (λpir) by heat shock.
Transformants were grown overnight at 37℃. M. buryatense 5GB1C was grown overnight on
NMS2 mating plates at 30℃ in a 25% methane atmosphere.12 The following day, equal S17-1
donor biomass was added to 5GB1C on mating plates. This biomass was incubated for 2 days at
30℃ with methane. Mixed biomass was transferred onto NMS2 plates with 50 ug/mL
kanamycin and incubated for 4 days, after which the transformant colonies were transferred to
NMS2 plates with kanamycin and 50 ug/mL rifamycin, to purify M. buryatense from the E. coli
plasmid donor. Colonies from NMS2 with kanamycin and rifamycin were plated on NMS2 to
allow loopout of the plasmid vector from the genome of M. buryatense strains, and, after 4 days
of incubation, these colonies were subsequently plated onto NMS2 with 2.5% sucrose to select
for loopout. Resistant colonies on NMS2 with sucrose after 4 days of incubation were picked
onto both NMS2 and NMS2 with kanamycin to identify kanamycin-sensitive loopout
candidates.12 These candidates were then analyzed by PCR with primers JG224 and JG225 using
biomass as the DNA template to identify isolates with the desired insertion present.

Figure 2. Graphical scheme of xylE under control of chosen promoter, in this case PmxaF. In wild type 5GB1C,
both PmxaF and PmxaB are repressed in the presence of lanthanum. By inserting constructs with each mutant
promoter linked to xylE into the genome of this organism, native regulatory mechanisms should be able to modulate
xylE expression as they would either mxaF or mxaB, assuming the necessary binding sites are present. This allows
for the testing of mutant promoter expression without requiring any changes to mxaF or mxaB expression within
mutants.

Table 3. Strains and plasmids used in this study

Strain or Description Reference

Plasmid

M. buryatense strains

5GB1C Variant of M. buryatense 5GB1 cured of native plasmid 12

FC31 5GB1C EQU24_01645::PmxaF-xylE 10

FC67 5GB1C EQU24_01645::PmxaB-xylE This work

CS27 5GB1C EQU24_01645::PmxaF site A mutant -xylE This work

CS28 5GB1C EQU24_01645::PmxaF site B mutant-xylE This work

CS29 5GB1C EQU24_01645::PmxaF site C mutant-xylE This work

CS30 5GB1C EQU24_01645::PmxaB site A mutant -xylE This work

CS31 5GB1C EQU24_01645::PmxaB site B mutant-xylE This work

CS32 5GB1C EQU24_01645::PmxaB site C mutant-xylE This work

Plasmids

pFC30 Chromosomal insertion vector at EQU24_01645 containing 10

PmxaF-xylE; Kanr

pFC41 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaB-xylE; Kanr

pMCS38 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaF site A mutant -xylE; Kanr

pMCS39 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaF site B mutant-xylE; Kanr

pMCS40 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaF site C mutant-xylE; Kanr

pMCS41 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaB site A mutant -xylE; Kanr

pMCS42 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaB site B mutant-xylE; Kanr

pMCS43 Chromosomal insertion vector at EQU24_01645 containing This work

PmxaB site C mutant-xylE; Kanr
XylE reporter assay
Cells were grown to an OD600 between 0.45 and 0.9 in 5 mL NMS2 medium
(corresponding to mid- to late-exponential phase), containing 1 uM of lanthanum if applicable,
and subsequently normalized to an OD600 of 0.5 in 50 mM Tris-HCl, pH 7.5. For each isolate, 90
uL of this suspension was added to one well of an assay plate to obtain a total concentration of 1
mM catechol. Activity of the XylE catechol-2,3-dioxygenase in each isolate was assayed by
observing rate of change in absorbance of light at 375 nm over 10 minutes by use of a
SpectraMax 190 plate reader (Molecular Devices).

Results
Mutation of MEME Site C modifies expression scheme of PmxaF

Figure 3. Results from assays of xylE expression in wild type and mutant PmxaF-xylE strains in the absence of
lanthanum or presence of 1 uM lanthanum. In the absence of lanthanum, site A and B mutants show similar
expression to wild type PmxaF isolates, whereas mutation of site C results in lowered expression of xylE. All three
mutant isolates display repression in the presence of lanthanum, as in wild type. Reporter assays were performed in
triplicate.

XylE reporter constructs with mutant promoters were successfully created (Fig. 1) and
tested as summarized in Fig. 2. Assays of PmxaF-xylE mutant isolates in the absence of
lanthanum displayed high expression of XylE under control of PmxaF wild type as expected,
with expression from the site A and B mutants similarly being activated to a high degree. No
change in expression phenotype seems to have been attained by mutating either of these two
sites. However, the mutation of MEME site C in PmxaF reduced expression of XylE by more
than half (Fig. 3), displaying a clear involvement of this site in the regulatory scheme of PmxaF
when no lanthanum is present. This involvement implies that site C is used in some capacity as a
binding site for an activator protein that increases expression from PmxaF when 5GB1C is
grown in the absence of lanthanum. Whatever would otherwise bind to this site seems to have
been rendered unable to activate the promoter by the point mutations in this construct, resulting
in significant deactivation of PmxaF as compared to wild type activity from this promoter.

Mutation of MEME Site A knocks out P mxaB expression

Figure 4. Results from assays of xylE expression in wild type and mutant PmxaB-xylE strains in the absence of
lanthanum or presence of 1 uM lanthanum. In the absence of lanthanum, mutation of site A completely knocks out
XylE activity, and site B mutants demonstrate similar expression to wild type PmxaB isolates. Mutation of site C
seems to result in slightly lowered expression of xylE, but these results are inconsistent among isolates and are only
barely statistically significant. All three mutant isolates display repression in the presence of lanthanum, as in wild
type. Reporter assays were performed in triplicate.
 In assays of xylE under the control of PmxaB wild type and mutant isolates, mutants of
MEME sites B and C displayed mostly inconsequential results. The isolates with site B mutated
were expressed much the same as wild type PmxaB, and, while some reduction in expression of
site C mutants as opposed to wild type can be observed, the change is not consistent enough
among isolates or statistically distinct enough from wild type to be considered noteworthy.
However, the mutation of MEME site A in P mxaB had a very significant impact on expression
from this promoter, abolishing it entirely. No XylE activity was observed in PmxaB-xylE isolates
with site A mutated, and if this change is indeed the result of some protein that binds to the wild
type site A sequence, this hypothetical protein can be assumed to be critical to expression from
this promoter.

All mutants display wild-type response to lanthanum

Little to no expression was observed in all six mutants tested in the presence of
lanthanum (Fig. 3 and 4), indicating that mutation of any one of the three identified candidate
motifs in PmxaF or PmxaB was not sufficient to allow for derepression of these promoters. This
indicates that a hypothetical binding site necessary for regulating the lanthanum-dependent
repression of these genes was not identified in this study.

Discussion
Given that mutation of site C in PmxaF reduced expression of xylE in the absence of
lanthanum but exhibited no derepression in the presence of lanthanum, this site seems to be the
necessary for the binding of a protein that acts in the absence of lanthanum to increase
expression of mxaF. One such protein, MxaB, is already known, but the difference in expression
observed between wild type PmxaF and the site C mutant is not at the level of change in
expression of mxaF when mxaB is inactive due to knockout. Whereas the site C mutant PmxaF
had slightly under half the expression of wild type, mxaB knockout mutants had 1000 times less
expression of mxaF than in wild type 5GB1C.8 This site could therefore either be only partially
responsible for the activity of MxaB in regulating mxaF or it may be a binding site for an as yet
unknown regulatory protein involved in the lanthanide switch in 5GB1C. Regardless, future
steps for this project will involve mutating each base changed for our mutant site C individually
in order to identify which bases in this sequence define the motif and lead to this change in
expression from the mxaF promoter region.
The full lack of expression, even in the absence of lanthanum, for the Site A mutant in
PmxaB could indicate that this site is part of the previously unknown promoter of mxaB. This site
lies 28 bases upstream of the transcriptional start site of mxaB; if the promoter that was
inactivated corresponds to the typical prokaryotic scheme involving two sites, one 35 and one 10
bases upstream of the transcriptional start site, these mutations likely knocked out the -10 region
of this promoter. Further analysis of this region will be necessary to identify a promoter sequence
more specifically, but the knockout of expression from PmxaB with mutation of MEME site A
provides a starting point for future continuation of this search.
All six of the tested mutants exhibited a wild type response to the presence of lanthanum,
indicating that disruption of each of these motifs alone was insufficient to prevent activity of
native lanthanide repression mechanisms. The existence of similarities in sequence does not in
and of itself indicate that some similar process must occur at each of the sites identified. The
possibility does exist that similarities in sequence in the identified motifs were coincidental, and
that no regulatory proteins bind at sites A or B in the mxaF and mxaB promoters. However, given
that 5GB1C is a non-model organism with genetic regulatory processes that remain largely
unknown, it is possible that these sites have some importance in conditions we failed to test for.
While no change in XylE activity was observed in these mutants compared to the wild-type of
each promoter region in the presence or absence of lanthanum, future discoveries may indicate
that these sites are of regulatory importance in processes besides the lanthanide switch.
Overall, while the results of this study did not identify clear binding sites for
lanthanum-dependent repressor proteins, the discoveries made by this project increased the
knowledge base of the genetic grammar of M. buryatense 5GB1C. Further work in this organism
can be expected to have a continued focus on mechanisms of metabolic control, specifically
regarding the involvement of lanthanum, given its significant industrial and environmental
potential.

References
1. Forster P, Ramaswamy V, Artaxo P, Berntsen T, Betts R, Fahey DW, Haywood J, Lean J, Lowe DC, Myhre

G, Nganga J, Prinn R, Raga G, Schulz M, Van Dorlan R, 2007. Changes in atmospheric constituents and in
 radiative forcing, p 129 –234. In Solomon S et al. (ed), Climate change 2007: the physical science basis.

Contribution of Working Group I to the fourth assessment report of the Intergovernmental Panel on Climate

Change. Cambridge University Press, Cambridge, United Kingdom.

2. Fei Q, Guarnieri MT, Tao L, Laurens LM, Dowe N, Pienkos PT. 2014. Bioconversion of natural gas to

liquid fuel: opportunities and challenges. Biotechnol Adv 32:596–614.

https://doi:10.1016/j.biotechadv.2014.03.011.

3. Chistoserdova L. 2016. Lanthanides: new life metals?. World J Microbiol Biotechnol 32:1–7.

https://doi.org/10.1007/s11274-016-2088-2.

4. Martinez-Gomez NC, Vu HN, Skovran E. 2016. Lanthanide chemistry: from coordination in chemical

complexes shaping our technology to coordination in enzymes shaping bacterial metabolism. Inorg Chem

55:10083–10089. https://doi.org/10.1021/acs.inorgchem.6b00919.

5. Nancharaiah YV, Mohan VS, Lens PNL. 2016. Biological and bioelectrochemical recovery of critical and

scarce metals. Trends Biotechnol 34: 137–155. https://doi.org/10.1016/j.tibtech.2015.11.003.

6. Semrau JD, DiSpirito AA, Yoon S. 2010. Methanotrophs and copper. FEMS Microbiol Rev 34:496–531.

https://doi.org/10.1111/j.1574-6976.2010.00212.x.

7. Groom J, Ford S, Pesesky M, Lidstrom M. 2019. Methylomicrobium buryatense strain 5GB1C

chromosome, complete genome. NCBI Nucleotide Database.

8. Chu F, Lidstrom ME. 2016. XoxF acts as the predominant methanol dehydrogenase in the type I

methanotroph Methylomicrobium buryatense. J Bacteriol 198:1317–1325.

https://doi.org/10.1128/JB.00959-15.

9. Groom JD, Ford SM, Pesesky MW, Lidstrom ME. (2019) A Mutagenic Screen Identifies a

TonB-Dependent Receptor Required for the Lanthanide Metal Switch in the Type I Methanotroph

“Methylotuvimicrobium buryatense” 5GB1C. J. Bacteriol. 201. https://doi.org/10.1128/JB.00120-19.

10. Chu F, Beck D, Lidstrom ME. 2016. MxaY regulates the lanthanide-mediated methanol dehydrogenase

switch in Methylomicrobium buryatense. PeerJ 4:e2435. https://doi.org/10.7717/peerj.2435.

11. Keltjens JT, Pol A, Reimann J, Op den Camp HJ. PQQ-dependent methanol dehydrogenases: rare-earth

elements make a difference. Appl Microbiol Biotechnol. 2014;98(14):6163-83.

https://doi.org/10.1007/s00253-014-5766-8
12. Puri AW, Owen S, Chu F, Chavkin T, Beck DAC, Kalyuzhnaya MG, Lidstrom ME. 2015. Genetic tools for

the industrially promising methanotroph Methylomicrobium buryatense. Appl Environ Microbiol

81:1775–1781. https://doi.org/10.1128/AEM.03795-14.