Marine Biotechnology: Evidence - Based Complementary and Alternative Medicine
Marine Biotechnology: Evidence - Based Complementary and Alternative Medicine
Marine Biotechnology
Guest Editors: Song Qin, W. E. G. Müller, and Edwin L. Cooper
Marine Biotechnology
Evidence-Based Complementary
and Alternative Medicine
Marine Biotechnology
Guest Editors: Song Qin, W. E. G. Müller,
and Edwin L. Cooper
Copyright © 2011 Hindawi Publishing Corporation. All rights reserved.
This is a special issue published in volume 2011 of “Evidence-Based Complementary and Alternative Medicine.” All articles are open
access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and repro-
duction in any medium, provided the original work is properly cited.
Editorial Board
Shrikant Anant, USA Toshiaki Kogure, Japan José Luis Rı́os, Spain
Vassya Bankova, Bulgaria Alfred Längler, Germany Paolo Roberti di Sarsina, Italy
Winfried Banzer, Germany Lixing Lao, USA Julie Ryan, USA
Vernon Barnes, USA Jang-Hern Lee, Republic of Korea Bashar Saad, Palestinian Authority
Debra L. Barton, USA Myeong Soo Lee, Republic of Korea Andreas Sandner-Kiesling, Austria
Jairo Kenupp Bastos, Brazil Tat leang Lee, Singapore Adair Roberto Soares Santos, Brazil
David Baxter, New Zealand Christian Lehmann, Canada Guillermo Schmeda-Hirschmann, Chile
Alvin J. Beitz, USA Ping-Chung Leung, Hong Kong Andrew Scholey, Australia
Paolo Bellavite, Italy Xiu-Min Li, USA Dana Seidlova-Wuttke, Germany
Francesca Borrelli, Italy Chun Guang Li, Australia Senthamil R. Selvan, USA
Arndt Büssing, Germany Sabina Lim, Republic of Korea Ronald Sherman, USA
Leigh F. Callahan, USA Gerhard Litscher, Austria Kan Shimpo, Japan
Raffaele Capasso, Italy I-Min Liu, Taiwan Venil N. Sumantran, India
Il-Moo Chang, Republic of Korea Ke Liu, China Takashi Takahashi, Japan
Yunfei Chen, China John C. Longhurst, USA Toku Takahashi, USA
Kevin W. Chen, USA Iréne Lund, Sweden B. K. H. Tan, Singapore
Juei-Tang Cheng, Taiwan Gail Mahady, USA Joanna Thompson-Coon, UK
Jen-Hwey Chiu, Taiwan Francesco Marotta, Italy Mei Tian, USA
Jae Youl Cho, Republic of Korea Virginia S. Martino, Argentina K. V. Trinh, Canada
William C. Cho, Hong Kong James H. McAuley, Australia Alfredo Vannacci, Italy
Shuang-En Chuang, Taiwan Andreas Michalsen, Germany Søren Ventegodt, Denmark
Edwin L. Cooper, USA David Mischoulon, USA Carlo Ventura, Italy
Vincenzo De Feo, Italy Mark A. Moyad, USA Wagner Vilegas, Brazil
Alexandra Deters, Germany Stephen Myers, Australia Pradeep Visen, Canada
Nobuaki Egashira, Japan S. Nagini, India Dietlind Wahner-Roedler, USA
Peter Fisher, UK Vitaly Napadow, USA Shu-Ming Wang, USA
Joel J. Gagnier, Canada Isabella Neri, Italy Kenji Watanabe, Japan
Michael Goldstein, USA Martin Offenbacher, Germany Wolfgang Weidenhammer, Germany
S. H. Hong, Republic of Korea Ki-Wan Oh, Republic of Korea Jenny M. Wilkinson, Australia
Markus Horneber, Germany Y. Ohta, Japan Haruki Yamada, Japan
Ching Liang Hsieh, Taiwan Olumayokun A. Olajide, UK Nobuo Yamaguchi, Japan
Roman Huber, Germany Thomas Ostermann, Germany Hitoshi Yamashita, Japan
Angelo Antonio Izzo, Italy Bhushan Patwardhan, India Ken Yasukawa, Japan
Stefanie Joos, Germany Berit Smestad Paulsen, Norway E. Yesilada, Turkey
Z. Kain, USA Richard Pietras, USA Hong Zhang, China
Jong Yeol Kim, Republic of Korea Khalid Rahman, UK Ruixin Zhang, USA
Cheorl-Ho Kim, Republic of Korea Cheppail Ramachandran, USA Boli Zhang, China
Youn Chul Kim, Republic of Korea Cesar R. Ramos-Remus, Mexico
Yoshiyuki Kimura, Japan Ke Ren, USA
Contents
Marine Biotechnology, Song Qin, W. E. G. Müller, and Edwin L. Cooper
Volume 2011, Article ID 639140, 2 pages
Isolation and Identification of Acholeplasma sp. from the Mud Crab, Scylla serrata, Ji-Gang Chen,
Dan Lou, and Ji-Fang Yang
Volume 2011, Article ID 209406, 5 pages
Immune Efficacy of a Genetically Engineered Vaccine against Lymphocystis Disease Virus: Analysis of
Different Immunization Strategies, Fengrong Zheng, Xiuqin Sun, Xing’an Wu, Hongzhan Liu, Jiye Li,
Suqi Wu, and Jinxing Zhang
Volume 2011, Article ID 729216, 8 pages
Description of a Sulfitobacter Strain and Its Extracellular Cyclodipeptides, Cong Long, Xiao-Ling Lu,
Yun Gao, Bing-Hua Jiao, and Xiao-Yu Liu
Volume 2011, Article ID 393752, 6 pages
Bioactive Pigments from Marine Bacteria: Applications and Physiological Roles, Azamjon B. Soliev,
Kakushi Hosokawa, and Keiichi Enomoto
Volume 2011, Article ID 670349, 17 pages
Enhanced Antitumoral Activity of Extracts Derived from Cultured Udotea flabellum (Chlorophyta),
Rosa Moo-Puc, Daniel Robledo, and Yolanda Freile-Pelegrin
Volume 2011, Article ID 969275, 7 pages
Identification and Characterization of Cell Wall Proteins of a Toxic Dinoflagellate Alexandrium catenella
Using 2-D DIGE and MALDI TOF-TOF Mass Spectrometry, Da-Zhi Wang, Hong-Po Dong, Cheng Li,
Zhang-Xian Xie, Lin Lin, and Hua-Sheng Hong
Volume 2011, Article ID 984080, 11 pages
Homology-Driven Proteomics of Dinoflagellates with Unsequenced Genomes Using MALDI-TOF/TOF
and Automated De Novo Sequencing, Da-Zhi Wang, Cheng Li, Zhang-Xian Xie, Hong-Po Dong, Lin Lin,
and Hua-Sheng Hong
Volume 2011, Article ID 471020, 16 pages
Dieckol from Ecklonia cava Regulates Invasion of Human Fibrosarcoma Cells and Modulates MMP-2
and MMP-9 Expression via NF-κB Pathway, Chen Zhang, Yong Li, Zhong-Ji Qian, Sang-Hoon Lee,
Yong-Xin Li, and Se-kwon Kim
Volume 2011, Article ID 140462, 8 pages
Protective Effects of Emodin and Chrysophanol Isolated from Marine Fungus Aspergillus sp. on
Ethanol-Induced Toxicity in HepG2/CYP2E1 Cells, Zhong-Ji Qian, Chen Zhang, Yong-Xin Li,
Jae-Young Je, Se-Kwon Kim, and Won-Kyo Jung
Volume 2011, Article ID 452621, 7 pages
Purification and the Secondary Structure of Fucoidanase from Fusarium sp. LD8, Wu Qianqian,
Ma Shuang, Xiao Hourong, Zhang Min, and Cai Jingmin
Volume 2011, Article ID 196190, 8 pages
A Preliminary Study of the Microbial Resources and Their Biological Activities of the East China Sea,
Xiaoling Lu, Xiaoyu Liu, Cong Long, Guoxiang Wang, Yun Gao, Junhua Liu, and Binghua Jiao
Volume 2011, Article ID 806485, 8 pages
Impact of Intensive Land-Based Fish Culture in Qingdao, China, on the Bacterial Communities in
Surrounding Marine Waters and Sediments, Qiufen Li, Yan Zhang, David Juck, Nathalie Fortin,
and Charles W. Greer
Volume 2011, Article ID 487543, 8 pages
Pyrolytic Characteristics and Kinetics of Phragmites australis, Hui Zhao, Huaxiao Yan, Congwang Zhang,
Xiaodong Liu, Yanhui Xue, Yingyun Qiao, Yuanyu Tian, and Song Qin
Volume 2011, Article ID 408973, 6 pages
CI431, an Aqueous Compound from Ciona intestinalis L., Induces Apoptosis through a
Mitochondria-Mediated Pathway in Human Hepatocellular Carcinoma Cells, Linyou Cheng, Ming Liu,
Cuicui Wang, Haizhou Liu, Yuyan Zhang, and Xiukun Lin
Volume 2011, Article ID 292873, 9 pages
Isolation and Characterization of Adhesive Secretion from Cuvierian Tubules of Sea Cucumber
Holothuria forskåli (Echinodermata: Holothuroidea), Malgorzata Baranowska, Ute Schloßmacher,
J. Douglas McKenzie, Werner E. G. Müller, and Heinz C. Schröder
Volume 2011, Article ID 486845, 13 pages
Expression of Pigment Cell-Specific Genes in the Ontogenesis of the Sea Urchin Strongylocentrotus
intermedius, Natalya V. Ageenko, Konstantin V. Kiselev, and Nelly A. Odintsova
Volume 2011, Article ID 730356, 9 pages
Distribution and Abundance of Archaea in South China Sea Sponge Holoxea sp. and the Presence of
Ammonia-Oxidizing Archaea in Sponge Cells, Fang Liu, Minqi Han, Fengli Zhang, Baohua Zhang,
and Zhiyong Li
Volume 2011, Article ID 723696, 5 pages
The Largest Bio-Silica Structure on Earth: The Giant Basal Spicule from the Deep-Sea Glass Sponge
Monorhaphis chuni, Xiaohong Wang, Lu Gan, Klaus P. Jochum, Heinz C. Schröder, and
Werner E. G. Müller
Volume 2011, Article ID 540987, 14 pages
Polymorphism and Balancing Selection of MHC Class II DAB Gene in 7 Selective Flounder (Paralichthys
olivaceus) Families, Min Du, Song-lin Chen, You Liang, Lei Wang, Feng-tao Gao, Yang Liu,
and Xiao-Lin Liao
Volume 2011, Article ID 613629, 10 pages
Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder
(Platichthys flesus), Weiqun Lu, Aurelie Mayolle, Guoqiang Cui, Lei Luo, and Richard J. Balment
Volume 2011, Article ID 965153, 11 pages
Species Identification of Marine Fishes in China with DNA Barcoding, Junbin Zhang
Volume 2011, Article ID 978253, 10 pages
Treatment of Rheumatoid Arthritis with Marine and Botanical Oils: Influence on Serum Lipids,
Barbara C. Olendzki, Katherine Leung, Susan Van Buskirk, George Reed, and Robert B. Zurier
Volume 2011, Article ID 827286, 9 pages
Novel Lipolytic Enzymes Identified from Metagenomic Library of Deep-Sea Sediment, Jeong Ho Jeon,
Jun Tae Kim, Hyun Sook Lee, Sang-Jin Kim, Sung Gyun Kang, Sang Ho Choi, and Jung-Hyun Lee
Volume 2011, Article ID 271419, 9 pages
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 639140, 2 pages
doi:10.1155/2011/639140
Editorial
Marine Biotechnology
Copyright © 2011 Song Qin et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Modern marine biotechnology has been developing rapidly native Medicine. The term bioprospecting was introduced
since the 1980s. There are promising and exciting achieve- by Müeller and later expanded by Cooper. The prefix bio
ments in biochemistry, genetics, genomics, aquaculture, signifies life while prospecting is defined as “an expectation,
bioenergy, and other related fields, beginning with genetic a possibility, a chance of success or advancement” to explore
recombinant technology as applied to marine algae. Marine in search of something. When put together, they fit the
biotechnology clearly incorporates enormous social and kind of searches that have been explored in this issue. Com-
economic benefits, thus providing a foundation for problems pounds such as bioactive proteins (pore-forming protein
related to food as exemplified by ocean farming. Marine and tachylectin) from sponges may be used for antibacterial
biotechnology is relatively young but reveals enormously vig- activity while skeletal elements such as biosilica serve as
orous and powerful applications. These include approaches blueprints for new biomaterials applicable to biomedicine.
of marine biotechnology from genomics to marine aquacul- And since that time, other papers have emphasized the
ture and from genomic engineering to ocean farming. importance of the biosphere (both terrestrial and aquatic)
For more specific health benefits to humans, applicable as a vital store for expanding the repertoire of potential
pharmaceuticals are likely to emerge as more natural prod- products that can ultimately be of use as sources of food and
ucts are shown to be effective. This special issue is devoted pharmaceuticals.
to marine biotechnology. This issue contains 33 papers In addition to a search for marine natural products,
that pertain to our original goals and include twelve top- clearly the symposium and now the resulting issue have
ics: algal biotechnology; marine microbiology; marine drugs; underscored the need for international cooperation as we
genomics, proteomics, and metabolomics in marine biotechnol- continue to search for products with valuable applications
ogy; marine bioactive compounds; marine bioproducts; bioma-
to human health. The aim of this issue was to present
terials and nanobiotechnology; biomineralization, biomineral,
recent advances in the discovery and development of marine
and biomarker; oceans and human health; drug discovery;
natural products, which has laid the foundation for the
biotechnology and development; pharmacologic mechanisms.
For the convenience of the readers papers have generally synthesis of proteins, drugs, and other bioproducts with
been arranged according to the genus and species of the special functions. Manuscripts in this special issue covered
organism from which products have been derived. Briefly several aspects of recent developments in the vast field of
here are the descriptions: papers 1–6: bacteria; 7–13: algae; marine biotechnology. Other manuscripts highlight previous
14-15: fungi; 16–19: microbial libraries; 20–25: complex investigations but are orientated towards the more practical
higher invertebrates; 26–27: sponges; 28: crabs; 29–31: fish; concerns of application rather than simple analysis of exotic
32: humans. To round out the entire list, the final paper 33 marine animals themselves. The firm grounding of biology
focuses on metagenomic libraries. and the resulting amalgam of molecules derived from
The inspiration for this special issue has grown from early invertebrate immune systems lies at the forefront of new
contributions to Evidence-Based Complementary and Alter- scientific discovery and societal advancement.
2 Evidence-Based Complementary and Alternative Medicine
Acknowledgments
We would like to warmly acknowledge the authors for
their excellent contributions and the reviewers for their
fundamental work and patience in assisting us during peer
review. We express deep appreciation to Hanzhi Lin and Pu
Yang for their extremely valuable assistance during the entire
review process.
Song Qin
W. E. G. Müller
Edwin L. Cooper
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 209406, 5 pages
doi:10.1155/2011/209406
Research Article
Isolation and Identification of Acholeplasma sp. from
the Mud Crab, Scylla serrata
For the first time, a mollicute-like organism (MLO) was cultured from moribund mud crabs (Scylla serrata) during an outbreak
of clearwater disease in Zhejiang Province, China. The MLO displayed a fried-egg colony morphology in culture, did not possess
a cell wall, and was not retained by 0.45 μm and 0.2 μm filters. It was able to ferment glucose, sucrose, lactose, and maltose, but it
did not utilize arginine and urea. The MLO grew in the absence of bovine serum and was not susceptible to digitonin. Sequence
analysis of the 16S rRNA gene revealed that this MLO had 99% identity with Acholeplasma laidlawii PG-8A, which indicates that
the organism isolated from mud crabs is a member of the genus Acholeplasma.
data). Therefore, the gill was selected for isolation of the at 4◦ C for 2 h. After several rinses with PBS, the samples
MLO. Excised gill tissue was placed in mycoplasma liquid were post-fixed with 1% OsO4 for 1 h. Subsequently, the
medium (MLM); each 100 mL of medium contained 2.55 g tissues were dehydrated in an ethanol series and embedded
of mycoplasma broth base (Frey), 0.5 mL of 0.4% phenol in Spurr’s resin. Ultrathin sections were stained with uranyl
red, 0.2 mL of 10% thallium acetate (Sigma), 20 mL of acetate and lead citrate and observed under a transmission
mycoplasma-free FBS (Hangzhou Sijiqing Biological Engi- electron microscope (TEM).
neering Materials Co., Ltd.), 1 mL of freshly prepared yeast
extract solution, 1 mL of ampicillin solution (10 mg mL−1 ), 2.6. Biochemical Tests. The mud crab MLO’s metabolism of
and 1 mL of 10% glucose solution, and the solution was glucose, sucrose, lactose, and maltose [18, 19] was examined,
adjusted to pH 7.8. MLO solid medium (MSM) was prepared as was its hydrolysis of arginine and urea [20, 21] and its
in the same manner as described above, but it contained 1% reduction of tetrazolium chloride and methylene blue [4].
medium technical agar (Oxoid). It was supplemented with All plates and tests were incubated at 37◦ C in a humidified
mycoplasma broth base, yeast extract solution, FBS, thallium atmosphere with 5% CO2 for 7 days.
acetate, and ampicillin in the same concentrations as those
used for MLM, but it did not contain phenol red and glucose. 2.7. Sterol Requirement. The MLO’s sterol requirement was
The MLO culture procedure was designed as previ- established by testing the susceptibility of the isolates to
ously described by Ghadersohi and Owens [4] with slight digitonin and by placing the isolates in an MLM lacking
modification. Briefly, gill and gut tissue from individual serum [22].
crabs was homogenized in 3 mL of MLM at 4◦ C using a
glass tissue blender. Once a homogenous suspension was 2.8. Haemolysis and Hemadsorption. The isolated MLO was
produced, 200 μL aliquots were used to prepare a series of 10- examined for hemolytic activity and hemadsorption using
fold dilutions in MLM. Negative controls consisted of FBS sheep, chicken, and rabbit erythrocytes using previously
and other medium constituents in MLM. Inoculated tubes described methods [23].
were incubated at 37◦ C and examined daily for pH (color)
changes. Whenever the color of the medium turned from red 2.9. Filtration Studies. MLO cultures were diluted 1 : 10 in
to yellow, 300 μL of the culture medium were transferred into a liquid medium and filtered through membrane filters
a tube containing 3 mL fresh of MLM. After 6 to 7 days, 50 μL (Millipore) with pore diameters of 0.22 μm and 0.45 μm. The
from each tube with the highest dilution indicating growth numbers of colony-forming unit (CFU) per milliliter in the
was spotted onto MSM plates. The plates were incubated in filtrates were determined by plating the filtrates onto agar
a humidified atmosphere with 5% CO2 at 37◦ C for 14 days. and were compared with the numbers of CFU per milliliter
Inoculated plates were examined for the presence of colonies in an unfiltered culture dilution [24].
using a stereomicroscope (Olympus). MLO colony growth
differences in plates incubated aerobically and in 5% CO2 2.10. Reversion Experiment. Isolated MLOs were subcultured
were recorded. Cellular morphology of the organisms was eight consecutive times in liquid or solid growth medium
examined by light microscopy after application of Gram and lacking ampicillin or thallium acetate to determine whether
Giemsa stains. the organisms reverted to bacterial L forms. Agar plates and
fluid cultures of all passages were examined for alterations in
2.3. Colony Staining. To observe MLO colonies and differen- the morphology of clones and cells, respectively. In addition,
tiate between Mollicute and bacterial L-form colonies, MLO the agar colonies of each clone were stained with Dienes stain
colonies were stained with Dienes stain [17] as described and examined with low power light microscopy.
by Ghadersohi and Owens [4]. The preparation was then
examined with a microscope under low power. 2.11. Analysis of Partial 16S rRNA Gene Sequence. DNA
for phylogenetic analysis was extracted from mid-log phase
2.4. Purification Experiment. Isolated MLOs were purified cultures after five passages of a clonal MLO isolate (strain
using the single colony technique [4]. A single colony was ZJ2005) using the QIAamp DNA Mini kit (Qiagen). The
removed by cutting out a small block of agar using a sterile 16S rRNA gene was amplified using M1 and M2 primers
scalpel. The colony was transferred into a tube containing [24], cloned into the pMD18-T vector (TaKaRa), and then
3 mL of MLM and incubated for 48 h. The culture was transformed into E. coli Top 10 competent cells. Plasmid
diluted 1/10 and 1/100 in MLM, and 50 μL of each dilution DNA, which was purified using the QIAprep Spin Miniprep
were spotted onto MSM plates and incubated in a humidified kit (Qiagen), was sequenced afterwards. The obtained 16S
atmosphere containing 5% CO2 at 37◦ C for 7 days. This rRNA gene was compared to archived genetic sequences
purification procedure was repeated three times. using BLAST searches within the GenBank database [25].
Highly similar sequences were selected for phylogenetic tree
2.5. Ultramicroscopy. For ultrathin sectioning, MLOs on construction. The phylogenetic tree was constructed with the
MLM medium were pelleted by centrifugation (12 000 g for neighbor-joining method using MEGA 4.1 software [26].
10 min at 4◦ C), resuspended in 2.5% glutaraldehyde, embed-
ded in 4% Noble agar, placed on Formvar-coated copper 2.12. Experimental Infection. The pathogenesis of ZJ2005
grids for solidification, and fixed again in 2.5% glutaralde- was tested in a mud crab bioassay. ZJ2005 cultures were
hyde in phosphate buffered saline (PBS; 0.1 mol L−1 , pH 7.2) grown in 5 mL of MLM at 37◦ C for 48 h, after which a
Evidence-Based Complementary and Alternative Medicine 3
100 μm
0.05
Figure 3: Phylogenetic tree based on 16S rRNA gene sequences showing the relationship of ZJ2005 and some members of the Acholeplasma
group. Strain designations have been reported, and GenBank accession numbers are included. Bootstrap confidence level percentage values
obtained from 1000 resamplings of the dataset are shown at the nodes. (bar, distance equivalent to 5 substitution per 100 nucleotides).
experimental crabs. No mortality, clinical signs, or MLOs mud crabs is indeed a member of the genus Acholeplasma.
were found in the unaffected experimental crabs and the However, further studies are needed to precisely identify the
crabs in control group. actual species. It is closely related to A. laidlawii, but it may
represent a new species.
4. Discussion The MLO in the experimentally infected crabs did not
cause high mortality or result in clinical signs of disease,
The properties of the MLO isolated from mud crabs fulfilled which is not surprisingly because most Acholeplasma diseases
the essential criteria for Mollicutes as proposed by the Inter- are influenced by a variety of host and environmental factors.
national Committee Systematic Bacteriology Subcommittee Moreover, a virulent strain can occur naturally, and some
on Taxonomy (1995): it had a typical fried-egg colony form animals might carry Acholeplasma with no signs of disease
in culture, a polymorphic cell form, absence of a cell wall, until they are stressed [2]. However, the isolation of pure
passage through 0.45 μm and 0.2 μm filters, lack of reversion MLO from epithelium of gill and gut tissues of dead crabs
to bacteria, and resistance to ampicillin [1]. The results of suggests that the MLO might be only a cofactor for a reo-like
16S rRNA gene analysis and the biological, biochemical, virus, which was thought to be the main pathogen causing
and morphological studies indicated that the isolated MLO CD in mud crabs [34].
is a member of the genus Acholeplasma. Taxonomically,
Acholeplasma belongs to the kingdom Bacteria, division Acknowledgments
Firmicutes, class Mollicutes, order Acholeplasmatales, family This work was supported by the National Natural Science
Acholeplasmataceae, and genus Acholeplasma. There are 15 Foundation of China (no. 30800856), the Major Scientific
recognized species in this genus, including saprotrophic and Technical Project of the Ningbo Science and Technology
and pathogenic species [27–30]. Although Acholeplasma spp. Bureau in Zhejiang Province (no. 2007C11002), and a project
are widely distributed in nature and can be detected and of the Ningbo Science and Technology Bureau in Zhejiang
isolated from different plant, avian, and mammalian sources Province (no. 2010C91035).
[31–33], they have not been reported previously in aquatic
animals. Our detection of Acholeplasma in S. serrata increases References
our knowledge about the host ranges of these organisms
and should lead to further investigation of other possible [1] International Committee on Systematic Bacteriology Subcom-
aquatic hosts and to studies of possible relationships between mittee on the Taxonomy of Mollicutes, “Revised minimum
terrestrial and aquatic hosts. standards for the description of new species of the class
Mollicutes (division Tenericutes),” International Journal of
The MLO in our study had 99% identity with A. laidlawii
Systematic Bacteriology, vol. 45, no. 3, pp. 605–612, 1995.
based on 16S rRNA genes. The three most useful criteria in [2] J. W. Simecka, J. K. Davis, M. K. Davidson, S. E. Ross, C.
Acholeplasma taxonomy are the 16S rRNA gene sequence, T. Stadtlander, and G. H. Cassell, “Mycoplasma diseases of
DNA-DNA hybridization analysis, and serology. The highest animals,” in Mycoplasmas: Molecular Biology and Pathogenesis,
resolution is provided by 16S rRNA gene sequence analysis, J. Maniloff, R. McElhaney, L. Finch, and J. Baseman, Eds., pp.
which is useful for the discrimination of most species [9]. 91–394, American Society for Microbiology, Washington, DC,
Our study has shown that the organism isolated from USA, 1992.
Evidence-Based Complementary and Alternative Medicine 5
[3] H. Kirchhoff, P. Beyene, M. Fisher et al., “Mycoplasma mobile [20] M. F. Barile, “Arginine hydrolysis,” in Methods in Mycoplas-
sp. nov., a new species from fish,” International Journal of mology, S. Razin and J. G. Tully, Eds., pp. 345–349, Academic
Systematic Bacteriology, vol. 37, no. 3, pp. 192–197, 1987. Press, New York, NY, USA, 1983.
[4] A. Ghadersohi and L. Owens, “Isolation, characterisation and [21] S. Razin, “Urea hydrolysis,” in Methods in Mycoplasmology, S.
DNA analysis of Mycoplasma spp. from moribund prawns Razin and T. G. Tully, Eds., pp. 351–353, Academic Press, New
Penaeus monodon cultured in Australia,” Diseases of Aquatic York, NY, USA, 1983.
Organisms, vol. 35, no. 1, pp. 53–61, 1999. [22] J. G. Tully, “Tests for digitonin sensitivity and sterol require-
[5] R. M. Krol, W. E. Hawkins, and R. M. Overstreet, “Rickettsial ment,” in Methods in Mycoplasmology, S. Razin and J. G. Tully,
and mollicute infections in hepatopancreatic cells of cultured Eds., pp. 355–362, Academic Press, New York, NY, USA, 1983.
Pacific white shrimp (Penaeus vannamei),” Journal of Inverte- [23] R. S. Gardelia and R. A. DelGiudice, “Hemagglutination,
brate Pathology, vol. 57, no. 3, pp. 362–370, 1991. hemadsorption, and hemolysis,” in Methods in Mycoplasmol-
[6] J. F. Yang and Y. L. Wu, “Electron microscope study on ogy, S. Razin and J. G. Tully, Eds., pp. 379–384, Academic
mycoplasma-like of penaeid shrimp (Penaeus chinensis),” Press, New York, NY, USA, 1983.
Donghai Marine Science, vol. 10, no. 4, pp. 63–67, 1992. [24] H. Kirchhoff, K. Mohan, R. Schmidt et al., “Mycoplasma
[7] D. L. Choi, S. G. Sohn, M. A. Park, M. S. Heo, and T. Renault, crocodyli sp. nov., a new species from crocodiles,” International
“Detection of a mollicute-like organism in kuruma shrimp, Journal of Systematic Bacteriology, vol. 47, no. 3, pp. 742–746,
Penaeus japonicus,” Journal of Fish Pathology, vol. 9, no. 1, pp. 1997.
33–40, 1996. [25] S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D.
[8] P. F. Frelier, R. F. Sis, T. A. Bell, and D. H. Lewis, “Microscopic J. Lipman, “Basic local alignment search tool,” Journal of
and ultrastructural studies of necrotizing hepatopancreatitis Molecular Biology, vol. 215, no. 3, pp. 403–410, 1990.
in Pacific white shrimp (Penaeus vannamei) cultured in Texas,” [26] K. Tamura, J. Dudley, M. Nei, and S. Kumar, “MEGA4:
Veterinary Pathology, vol. 29, no. 4, pp. 269–277, 1992. molecular Evolutionary Genetics Analysis (MEGA) software
[9] W. Wang, B. Wen, G. E. Gasparich et al., “A spiroplasma version 4.0,” Molecular Biology and Evolution, vol. 24, no. 8,
associated with tremor disease in the Chinese mitten crab pp. 1596–1599, 2007.
(Eriocheir sinensis),” Microbiology, vol. 150, no. 9, pp. 3035– [27] C. R. Woese, J. Maniloff, and L. B. Zablen, “Phylogenetic
3040, 2004. analysis of the mycoplasmas,” Proceedings of the National
[10] J. C. Harshbarger, S. C. Chang, and S. V. Otto, “Chlamydiae Academy of Sciences of the United States of America, vol. 77, no.
(with phages), mycoplasmas, and rickettsiae in Chesapeake 1, pp. 494–498, 1980.
Bay bivalves,” Science, vol. 196, no. 4290, pp. 666–668, 1977. [28] H. Neimark and J. London, “Origins of the mycoplasmas:
[11] B. Edgerton, L. Owens, L. Harris, A. Thomas, and M. sterol-nonrequiring mycoplasmas evolved from streptococci,”
Wingfield, “A health survey of farmed redclaw crayfish, Journal of Bacteriology, vol. 150, no. 3, pp. 1259–1265, 1982.
Cherax quadricarinatus (Von Martens), in tropical Australia,” [29] J. D. Pollack, J. Banzon, K. Donelson et al., “Reduction of
Freshwater Crayfish, vol. 10, pp. 322–337, 1995. benzyl viologen distinguishes genera of the class Mollicutes,”
[12] R. Jiménez, R. Barniol, X. Romero, and M. Machuca, “A International Journal of Systematic Bacteriology, vol. 46, no. 4,
prokaryotic intracellular organism in the cuticular epithelium pp. 881–884, 1996.
of cultured crayfish, Cherax quadricarinatus (von Martens), in [30] A. F. Angulo, R. Reijgers, J. Brugman et al., “Acholeplasma vit-
Ecuador,” Journal of Fish Diseases, vol. 21, no. 5, pp. 387–390, uli sp. nov., from bovine serum and cell cultures,” International
1998. Journal of Systematic and Evolutionary Microbiology, vol. 50,
[13] R. L. Zimmer and R. M. Woollacott, “Mycoplasma-like no. 3, pp. 1125–1131, 2000.
organisms: occurrence with the larvae and adults of a marine [31] J. G. Tully, “Acholeplasmataceae,” in Bergey’s Manual of
bryozoan,” Science, vol. 220, no. 4593, pp. 208–210, 1983. Systematic Bacteriology, N. R. Krieg and J. G. Holt, Eds., pp.
[14] P. J. Boyle, J. S. Maki, and R. Mitchell, “Mollicute identified in 775–781, Williams & Wilkins, Baltimore, Md, USA, 1984.
novel association with aquatic invertebrate,” Current Microbi- [32] S. Razin, D. Yogev, and Y. Naot, “Molecular biology and
ology, vol. 15, no. 2, pp. 85–89, 1987. pathogenicity of mycoplasmas,” Microbiology and Molecular
[15] S. P. Weng, Z. X. Guo, J. J. Sun, S. M. Chan, and J. G. He, Biology Reviews, vol. 62, no. 4, pp. 1094–1156, 1998.
“A reovirus disease in cultured mud crab, Scylla serrata, in [33] R. D. Ayling, S. E. Bashiruddin, and R. A. J. Nicholas,
southern China,” Journal of Fish Diseases, vol. 30, no. 3, pp. “Mycoplasma species and related organisms isolated from
133–139, 2007. ruminants in Britain between 1990 and 2000,” Veterinary
[16] Y. Y. Li, X. A. Xia, Q. Y. Wu, W. H. Liu, and Y. S. Lin, “Infection Record, vol. 155, no. 14, pp. 413–416, 2004.
with Hematodinium sp. in mud crabs Scylla serrata cultured [34] B. J. Wadher, C. L. Henderson, R. J. Miles, and H. Varsani,
in low salinity water in southern China,” Diseases of Aquatic “A mutant of Mycoplasma mycoides subsp. mycoides lacking
Organisms, vol. 82, no. 2, pp. 145–150, 2008. the H2 O2 -producing enzyme L-α-glycerophosphate oxidase,”
[17] L. Timms, “Isolation and identification of avian mycoplasma,” FEMS Microbiology Letters, vol. 72, no. 1-2, pp. 127–130, 1990.
The Journal of Medical Laboratory Technology, vol. 24, no. 2,
pp. 79–89, 1967.
[18] B. Aluotto, R. G. Wittler, C. O. Willams, and J. E. Faber, “Stan-
dardized bacteriologic techniques for the characterization
of Mycoplasma species,” International Journal of Systematic
Bacteriology, vol. 20, no. 1, pp. 35–38, 1970.
[19] S. Razin and V. P. Cirillo, “Sugar fermentation,” in Methods in
Mycoplasmology, S. Razin and J. G. Tully, Eds., pp. 337–343,
Academic Press, New York, NY, USA, 1983.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 729216, 8 pages
doi:10.1155/2011/729216
Research Article
Immune Efficacy of a Genetically Engineered
Vaccine against Lymphocystis Disease Virus:
Analysis of Different Immunization Strategies
Correspondence should be addressed to Xiuqin Sun, xiuqin sun@fio.org.cn and Xing’an Wu, [email protected]
Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination
technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned
into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was
immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was
inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and
15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that
this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and
conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased
at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate
against LCDV in Japanese flounder.
in combination with a nucleic acid vaccine against IHNV A fifty-microliter PCR reaction mixture consisting of
[5, 6, 12]. 5 μL DNA, 0.05 nmol of each primer, 4 μL 2 mM MgCl2 ,
Studies regarding nucleic acid vaccines for fish published 2.5 units Taq DNA polymerase, 4 μL 2 nM dNTP, 5 μL PCR
in recent years have mainly focused on infectious hematopoi- buffer, and ultrapure water 26 μL was prepared. A primer
etic necrosis virus (IHNV) [8, 9, 12–16], viral hemorrhagic pair flanking the Mcp gene, the forward (5 -GAC GAA TTC
septicemia virus (VHSV) [5, 6, 12, 17–19], hirame rhab- ATG ATC GGT ATT AC-3 ), and the reverse (5 -GAC GCG
dovirus (HIRRV) [20], herpesvirus (IHV-1) [21], infectious GCC GCG AAT AAT ATT CAC T-3 ) primers were used.
pancreatic necrosis [22], red sea bream iridovirus (RSIV), Amplification was performed at 94◦ C for 4 min, followed by
and spring viraemia of carp virus [23]. However, research 28 cycles of 1 min denaturation at 94◦ C, 45 s of annealing at
regarding lymphocystis disease virus (LCDV), the causative 50◦ C, and 45 s of extension at 72◦ C, and a final extension at
agent of lymphocystis disease (LCD), a common chronic 72◦ C for 10 min.
disease among many salt and fresh water fish species, remains
limited. LCD occurs worldwide, and the rate of incidence 2.2. Construction of Gene Engineering Vaccine against Lym-
appears to be increasing [24], severely affecting the fish phocystis Disease Virus. The gene encoding ORF 0147L of the
farming industry. major capsid protein (MCP), approximately 0.6 kb in length,
We previously constructed two genetically engineered and the eukaryotic expression vector pEGFP-N2 (Invitrogen)
vaccines against LCDV for the prevention and control of were verified by EcoRI and Sal I, respectively. The 0.6 bp
LCD [25, 26] and investigated the distribution and expres- fragment was cloned into the expression vector pEGFP-N2,
sion of immune-related genes in Japanese flounder (Par- behind the cytomegalovirus promoter and yielded EGFP-
alichthys olivaceus) after immunization with the vaccines [26, N2-LCDV0.6 kb.
27]. In this study, we investigated the optimal inoculation
routes and doses for these vaccines in Japanese flounder. 2.3. Transfection of the Eukaryotic Expression Vector and Eval-
uation of Expression. Cell transfection was performed using
2. Materials and Methods Lipofectamine, in eukaryotic FEC, following the manufac-
turer’s instructions (Gibco BRL). The cells were maintained
The FG-9307 cell line from Japanese flounder gills and the at 24◦ C for 48 h after transfection. Fluorescent microscopy
flounder embryo cell (FEC) line from Japanese flounder were and RT-PCR were employed to evaluate the immediate
obtained from Dr. Shangliang Tong, Ocean University of expression of pEGFP-N2-LCDV-cn0.6 kb in the FEC line.
China and Dr. Songlin Chen, Yellow Sea Fisheries Research
Institute Chinese Academy of Fishery Sciences, respectively. 2.4. Preparation of Plasmid DNA. The recombinant plas-
The two cell lines were maintained in minimum essential mid pEGFP-N2-LCDV-cn0.6 kb was verified by digestion
medium (MEM) and Dulbecco’s modified Eagle’s medium with restriction endonucleases XhoI and BamHI and then
(DMEM), respectively. Culture medium was supplemented transformed into E. coli DH5α. The recombinant plasmid
with 15% heat-inactivated fetal bovine serum (FBS), 2 mM (DNA vaccine) was prepared on a large-scale, distilled, and
L-glutamine, 50 IU/mL penicillin, 50 mg/mL streptomycin purified by resin using the Endo Free Plasmid Kit (Promega)
(Cellgro, USA), and 1% nonessential amino acids (Cellgro, according to the manufacturer’s instructions. The DNA was
USA), buffered to pH 7.4 with 7.5% sodium bicarbonate. then suspended in PBS and stored at −20◦ C. The quality and
The fish FG-9307 and FEC lines were maintained at 22◦ C and quantity of the DNA were determined by spectrophotometry.
24◦ C, respectively.
Tumors obtained from infected fish were wiped to re-
move the connective tissue and then freeze-thawed three 2.5. Vaccination of Fish. LCDV free Japanese flounder fish,
times and centrifuged at 3000 g for 15 min. The cell suspen- approximately 15–20 cm in body length and approximately
sion was then loaded onto a 20–60% sucrose gradient and 60–80 g in body weight, were used as fish to evaluate the vac-
centrifuged at 20,000 g for 2 h. The virus was observed using cine function of plasmid DNA. The fish were obtained from
a photomicroscope, and the virus concentration was deter- a cultivation farm and kept in a tank with a flowthrough,
mined using a spectrophotometer. filtered and virus free water system at approximately 18–
LCDV was propagated in the FG-9307 cell line [28, 29]. 22◦ C with water quality monitored daily. They were fed with
The culture medium was harvested when viral cytopathic commercially available dry feed pellets corresponding to 3–
effects were apparent, and the clarified crude virus was stored 5% of total body weight, twice per day. Prior to vaccination,
at −80◦ C until use. the fish were acclimatized for 2 weeks in the laboratory.
Fish (n = 600 per group) were randomly selected and
2.1. Clone, Identification, and Sequence Analysis of 0.6 kb anaesthetized using 0.02% tricaine methanesulfonate (MS-
Fragment. Viral DNA was extracted from LCDV samples 222). Fish were injected to a depth of 8 mm into the left
following the manufacturer’s instructions (OMEGA, USA). epaxial muscle immediately anterior to the dorsal fin, using
DNA was precipitated with 100% ethanol, washed three an insulin syringe and a 29 G needle. The experimental fish
times with 70% ethanol, air dried, and suspended in 40 μL were divided into 11 groups: (1) control fish, (2) 100 μL
sterile, distilled, and autoclaved water. DNA concentration phosphate-buffered saline (pH 7.4; PBS) via intramus-
was estimated using a spectrophotometer. cular injection (i.m.), (3) 5 μg pEGFP-N2 via i.m., (4) 0.1 μg
Evidence-Based Complementary and Alternative Medicine 3
pEGFP-N2-LCDV-cn0.6 kb via i.m., (5) 5 μg pEGFP-N2- 2.7. Determination of Serum Antibody Levels. Japanese floun-
LCDV-cn0.6 kb via i.m., (6) 15 μg pEGFP-N2-LCDV- der blood samples (1 mL) were collected on days 21, 35, 56,
cn0.6 kb via i.m., (7) 100 μL PBS via hypodermic injection and 90 p.i. with a syringe from the caudal sinus of nine of
(i.h.), (8) 5 μg pEGFP-N2 via i.h., (9) 0.1 μg pEGFP-N2- the eleven groups and allowed to clot at 20◦ C for 20 min,
LCDV-cn0.6 kb via i.h., (10) 5 μg pEGFP-N2-LCDV-cn0.6 kb then 4◦ C for 12 h. Serum was obtained after centrifugation
via i.h., and (11) 15 μg pEGFP-N2-LCDV-cn0.6 kb via i.h. at 500 g to remove cell particulate matter and stored at 80◦ C
Plasmid DNA was dissolved in 100 μL of PBS. After vaccina- for further study.
tion, each group of 60 fish was kept in different tanks under The antibody responses of the fish from each group
the same experimental conditions. were evaluated for the presence of specific immunoglobulin
against LCDV using an indirect ELISA. LCDV was diluted
2.6. Lymphoproliferative Assay to a 100 μg/mL concentration in bicarbonate coating buffer
(pH 9.6) and the solution was used to coat polystyrene
2.6.1. Preparation of Blood Lymphocytes from Fish. A 0.5 mL plates with 100 μL/well. The plates were incubated at 4◦ C
blood sample was isolated from the caudal sinus of fish overnight, washed four times with wash buffer (Tris-buffered
in a sterile coequal anticoagulant in 2.5 mL of lymphoprep saline (TBS) at pH 7.4, 0.05% Tween 20), and blocked
separation medium (Solarbio, Beijing, China). The coat layer with 2% BSA in TBS for 2 h at room temperature. The
was collected, washed twice in cold RPMI-1640 medium, and blocking solution was then removed, and diluted fish serum
resuspended. The cells were then adjusted to 1 × 106 cells/mL samples (1 : 80 dilution in blocking solution) were added to
with RPMI-1640 medium supplemented with 2 mM L- individual triplicate wells at 100 μL/well. A positive control
glutamine, 10% heat-inactivated FBS, 50 IU/mL penicillin, serum sample and a diluent only sample were tested in
50 mg/mL streptomycin, and 1% nonessential amino acids. the same manner. The plates were incubated for 90 min at
37◦ C and then washed four times with wash buffer. The
2.6.2. The Preparation of Anterior Kidney, Spleen, and Hind secondary antibody solution, a protein peroxidase conjugate
Intestines Lymphocytes from Fish. Anterior kidney, spleen, (Sigma), was added at 100 μL/well at a 1 : 1500 dilution.
and hind intestines lymphocytes from fish in each control After 90 min at 37◦ C, the plates were washed four times,
and vaccination group were collected aseptically by removing and 100 μL of substrate solution (TMB Microwell peroxidase
all tissues and placing the organ in a Petri dish containing substrate; Kirkegaard & Perry Laboratories, Gaithersburg,
10 mL sterile RPMI-1640 medium (Hyclone, USA). Cells MD) was added to each well. After 20 min of incubation
were released from all tissues by mechanical disruption using at room temperature, 100 μL of stop solution (2 mol/L
a curved forceps and a metallic sieve screen (200 μm). The sulfuric acid) was added. The absorbance at 450 nm was
resulting cell suspension was washed twice in RPMI-1640 then recorded using a microplate reader (Microplate reader
medium and resuspended in 3 mL RPMI-1640 medium and Benchmark, Bio-Rad Laboratories, s.r.1. Milano, Italy). Each
centrifuged at 1500 g for 15 min. The coat layer was collected, serum sample was compared with the control wells.
washed twice in cold RPMI-1640 medium, and resuspended.
The cells were then adjusted to 1 × 106 cells/mL with RPMI- Challenge Experiment. The experimental fish were divided
1640 medium supplemented with 2 mM L-glutamine, 10% into four groups: (1) 100 μL PBS, (2) 5 μg pEGFP-N2,
heat-inactivated FBS, 50 IU/mL penicillin and 50 mg/mL (3) 5 μg pEGFP-N2-LCDV-cn0.6 kb via i.m., and (4) 5 μg
streptomycin (Cellgro), and 1% nonessential amino acids pEGFP-N2-LCDV-cn0.6 kb via i.h. After vaccination, each
(Cellgro). group was kept in a different tank under identical experimen-
tal conditions. Twenty-one days after vaccination, fish were
Lymphoproliferative Assay. Cells (500 μL) were cultured in placed in tanks and infected with LCDV. The fish were then
triplicate in 24-well plates (Corning, NY) at 22◦ C in 5% CO2 observed, and the growth of tumors was noted after one and
with 2 μL LCDV-cn (19.8 mg/mL), or no additives (negative two months.
control). The cells were cultured at 22◦ C in 5% CO2 for
48 h. After 48 h, 200 μL Thiazolyl blue (Genview) was added 2.8. Statistical Analysis. Results from ELISA and lymphopro-
to each well. The cells were incubated for a further 4 h, liferative assay data were subjected to a mixed model repeated
DMSO was then added to the wells at 500 μL/well, and the analysis of variance, and SPSS software was employed to
absorbance was measured at 570 and 600 nm using a kinetic compare the various experimental groups each day. The data
microplate reader (Molecular Devices). The Thiazolyl blue for each test was reported as the mean ± S.E.M. An overall
assay was developed as a nonradioactive lymphocyte prolifer- level of significance with P < 0.05 was accepted.
ation assay, which indirectly measures cell proliferation. The
level of proliferation is indicated by the difference between 3. Results
the specific absorbance of the oxidized form (570 nm) and
the reduced form (600 nm). The specific absorbance of 3.1. Construction and Identification of the Eukaryotic Expres-
the unstimulated cells (negative control) is subtracted from sion Vector. The DNA vaccine pEGFP-N2-LCDV-cn0.6 kb
the specific absorbance of the cells to yield a delta-specific was verified by XhoI and BamHI endonuclease restriction
absorbance. analysis to contain the desired DNA fragment and associating
4 Evidence-Based Complementary and Alternative Medicine
ATGATCGGTAATACTATTGATATGACACAACCCGTTGATTCCAATGGTCAATT
ACCTGAAGAAGTGTTAATACTTCCTTTACCTTATTTCTTTTCTCGAGATAGCG
GTATGGCTTTACCCAGCGCTGCTTTGCCTTATAATGAAATAAGATTAACTTTT
CATCTGAGAGATTGGACTGAATTATTGATCTTTCAAAATAAAAACGACTCTA
CCATCATGCCTTTGACAGCAGGCGATTTAGACTGGGGTAAACCTGATTTAA
AGGATGTGCAAGTATGGATTACTAATGTAGTAGTAACCAATGAGGAACGTC
GTTTAATGGGTACAGTACCTAGAGACATCTTGGTGGAACAGGTACAAACAG
CACCTAAACATGTATTTCAACCTCTAACTATTCCAAGTCCTAATTTTGACATC
AGATTTTCTCATGCCATTAAAATCCTTTTTTTCGGTGTGCGTAATGTTACCTA
TCAAGCTATACAATCCAATTACACCAGTTCTTCTCCTGTAATCTTTGACGGT
GGAATTGCTAGCGATTTACCGGGTATTGCTGCTGATCCTATTTCAAATGTTAC
CTTGGTTTATGAAAATAGTGCTCGTCTTAATGAAATGGGTAGTGAATAT
Figure 1: Fluorescent and optical microscopy images of cells transfected with pEGFP-N2-LCDV-cn0.6 kb and pEGFP-N2 plasmid DNA. (a)
Fluorescent microscopy image of pEGFP-N2-LCDV-cn0.6 kb; (b) fluorescent microscopy image of pEGFP-N2; (c) optical microscopy image
of pEGFP-N2-LCDV-cn0.6 kb.
0.8 0.8
0.7 0.7
0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3
0.2 0.2
0.1 0.1
0 0
Blood Head kidney Spleen Hind Blood Head kidney Spleen Hind
intestines intestines
(a) (b)
Figure 3: Proliferation of tissue lymphocytes from all groups after in vitro stimulation with LCDV. (a) Intramuscular injection; (b)
hypodermic injection. Cells were harvested on day 21 and cultured for two days. Control group (vertical bar); PBS group (horizontal bar);
5 μg pEGFP-N2 group (triangular bracket); 0.1 μg pEGFP-N2-LCDV-cn0.6 kb group (pane); 5 μg pEGFP-N2-LCDV-cn0.6 kb group (wave
bar); 15 μg pEGFP-N2-LCDV-cn0.6 kb group (dot). Results are shown as the mean ± S.E.M. of the OD450 values. Significant differences
(P < 0.05) were observed between the pEGFP-N2-LCDV-cn0.6 kb group and the no-injection groups, and the PBS and pEGFP-N2 groups.
2.5 2.5
2 2
Optical density at 450 nm
Optical density at 450 nm
1.5 1.5
1 1
0.5 0.5
0 0
21 35 56 90 21 35 56 90
(days) (days)
(a) (b)
Figure 4: Detection of LCDV-specific antibodies from the sera of DNA-vaccinated Japanese flounder collected on days 21, 35, 56, and 90
after vaccination by ELISA. (a) Intramuscular injection; (b) hypodermic injection. 15 μg pEGFP-N2-LCDV-cn0.6 kb group (plus sign); 5 μg
pEGFP-N2-LCDV-cn0.6 kb group (asterisk); 0.1 μg pEGFP-N2-LCDV-cn0.6 kb group (horizontal line); pEGFP-N2 group (triangle); PBS
group (square); no injection (block dot). Results are shown as the mean ± S.E.M. of the OD450 values.
the pEGFP-N2 or saline groups. These results indicated that were detected in all of the pEGFP-N2-LCDV-cn0.6 kb-vac-
plasmid pEGFP-N2-LCDV-cn-MCP0.6 kb has the ability to cinated fish after three weeks, and antibody levels increased
enhance specific cellular responses, with significantly greater along with the dose. Increasing concentrations of antibodies
lymphocyte responses detected among the i.m. groups com- were generated up to 35 days after vaccination, with the
pared with the i.h. groups. greatest increase observed following a booster vaccination
on day 21. Significantly greater responses were observed in
the 5 and 15 μg groups than in the 0.1 μg group, and there
3.4. Antibody Production in the Vaccinated Fish. The anti- were no significant differences between these former two
body response of each group was evaluated for the presence groups. After day 56, the concentration of antibodies began
of specific immunoglobulin against LCDV using an indirect to decline, though the fish maintained relatively high levels of
ELISA (Figure 4). Low levels of LCDV-specific antibodies antibodies until day 90. Slightly higher responses were seen
6 Evidence-Based Complementary and Alternative Medicine
among the i.h. groups than the i.m. groups on day 21, but the Table 2: The efficiency of tumor growth in the different groups of
antibody levels in the i.h. groups were lower than in the i.m. fish, one and two months after injection.
groups after 35 days, and this phenomenon persisted after 90
Hypodermic
days. pEGFP- Intramuscular
PBS injection
N2 injection
group 5 μg/fish
group 5 μg/fish group
3.5. Protection against LCDV. The protection yielded by group
recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb is shown The amount
in Table 2. One month after challenge, the efficiency of tumor with tumour 1 112 98 26 24
growth in the PBS group, the pEGFP-N2 group, and the month (fish)
pEGFP-N2-LCDV-cn0.6 kb-vaccinated groups was 22.4%, The total
19.6%, 2.6%, and 2.4%, respectively. The tumors were small amount 1 500 500 1000 1000
and mainly grew in the mouth. Two months after challenge, month (fish)
the efficiency of tumor growth in the groups listed above The efficiency
was 32.6%, 32.1%, 3.17%, and 3.21%, respectively, and the of tumour 22.4% 19.6% 2.6% 2.4%
growth
tumors were large and existed throughout the whole body,
spreading from the mouth and gills to the fins. The amount
with tumour 2 158 152 31 31
months (fish)
4. Discussion The total
amount 2 484 473 978 967
The development of genetically engineered vaccines for fish months (fish)
has been increasingly studied in recent years, and such vac- The efficiency
cines have been shown to provide protection in fish against of tumour 32.6% 32.1% 3.17% 3.21%
various intracellular pathogens, such as VHSV and IHNV growth
[5, 6]. The fact that these vaccines successfully induced a
protective immune response against intracellular pathogens
suggested that a genetically engineered vaccine against LCDV
lasted for at least 10 weeks although the number of antibody-
infection was also feasible; however, until now, this possibil-
producing cells appeared to decline rapidly [30]. In rainbow
ity had not been widely studied. In the present study, we
trout, antibodies to the VHSV G protein were detected 23
analyzed the MCP gene (01470.6-kb) of LCDV-cn, which
days after injection with a plasmid encoding the G gene, and
encodes 71696–72318 amino acids, and revealed a 0.6 kb
serum antibodies to the G protein of IHNV were detected
antigenic fragment. This fragment was cloned into the prok-
3 to 15 weeks after inoculation [5, 7]. The results of the
aryotic expression vector pCI-neo and was found to elicit
present study showed that injection of naked plasmid DNA
specific responses to polyclonal antiserum against LCDV.
containing the MCP gene induced an efficient, systemic, and
The eukaryotic expression vector pEGFP-N2, containing the
antigen-specific immune response in Japanese flounder, with
GFP gene, was used in our experiments under the control
detectable anti-LCDV antibody levels in fish 21 days after
of the CMV promoter. We demonstrated that a genetically
injection.
engineered vaccine encoding the LCDV MCP gene elicited
significant levels of protective LCDV-specific immunity, the Some differences were found in vaccine efficiency when
levels of which were dose dependent and roughly propor- comparing the three vaccine doses. Low levels of specific
tional to the amount of protection conferred. antibodies to LCDV were detected in all pEGFP-N2-LCDV-
cn0.6 kb-vaccinated fish three weeks after inoculation, and
We analyzed vaccination strategies based on two injec- the antibody level increased with the increasing dose. Signif-
tion routes, intramuscular injection and hypodermic injec- icant protective immune responses were generated following
tion, and three injection doses, 0.1, 5, and 15 μg of naked administration of the 15 and 5 μg doses, but not the 0.1 μg
circular plasmid DNA. These selected doses fall within the dose on day 21, indicating that the 5 μg dose was more ef-
range of plasmid DNA (1–50 μg) routinely used to express ficient than the 15 μg dose when considering overall protec-
foreign genes in fish muscle and were found to be adequate tion. No specific antibody responses were detected in the PBS
to induce antigen-specific immune responses in 60–80 g or pEGFP-N2 groups.
Japanese flounder. At this preliminary stage, no attempt was Although the specific immune responses varied accord-
made to evaluate the effects of intramuscular injection using ing to dose, a different effect was exhibited when the non-
different doses of DNA, which has already been detailed for specific respiratory burst was evaluated. However, in the
other fish species [1, 28–32]. Specific experiments based on present study, the induction of a respiratory burst increased
Japanese flounder biology are required to address each of after vaccination, but no difference was observed between the
these points prior to potentially applying these vaccines to control and vaccinated groups.
farmed fish. In conclusion, our results strongly suggested that both
In a previous study in goldfish, antibodies against β- humoral and cellular responses were stimulated by the vac-
galactosidase were detected as early as seven days after in- cine. These initial findings indicate the potential for the de-
jection of LacZ-encoding DNA, and the antibody response velopment of a protective vaccine against LCDV.
Evidence-Based Complementary and Alternative Medicine 7
Research Article
Description of a Sulfitobacter Strain and Its
Extracellular Cyclodipeptides
Cong Long,1, 2 Xiao-Ling Lu,1 Yun Gao,1 Bing-Hua Jiao,1 and Xiao-Yu Liu1
1 Department of Biochemistry and Molecular Biology, College of Basic Medical Sciences, Second Military Medical University,
Shanghai 200433, China
2 Department of Clinical Laboratory, First Affiliated Hospital of Yangtze University, No. 8 Hangkong Road,
Correspondence should be addressed to Bing-Hua Jiao, [email protected] and Xiao-Yu Liu, [email protected]
A marine bacterium M44 was separated from 30 m deep seawater in the East China Sea (26◦ 28.3 N 122◦ 29.0 E) in 2006.
16S rDNA gene sequence comparison showed that the strain M44 was a member of the genus Sulfitobacter and highly similar to
KMM 3554T . A series of experiments demonstrated that this strain M44 had many distinctive characteristics: its cells were gram-
negative and mesophilic; its colonies were slightly yellowish, round, convex, and smooth; and it could grow at 10–28◦ C, pH 6.0–
10.0, and in the presence of 0–12.5% (w/v) NaCl; the optimum growth conditions were 25◦ C and pH 7.0, and the optimum Na+
concentration was 2.5%. In addition, strain M44 contained 18 : 1 ω7c, 11 methyl 18 : 1 ω7c and 16 : 0 fatty acids as major fatty acids,
and the genomic DNA G+C content was 58.04 mol%. According to our results of the secondary metabolites, six cyclodipeptides
were isolated from the strain M44, which were Cyclo (Val-Leu), Cyclo (Phe-Val), Cyclo (Phe-Leu), Cyclo (Leu-Ile), Cyclo (Phe-Ile),
and Cyclo (Trp-Pro). It is the first study of secondary metabolites isolated from this genus.
0.005
Figure 1: Phylogenetic tree showing the position of strain M44 and related species based on 16S rDNA gene sequence analysis. The tree
was constructed by using the neighbour-joining method. Numbers at nodes represent percentage bootstrap support based on a neighbour-
joining analysis of 1000 resampled datasets. GenBank accession numbers are given in parentheses. Bar, 0.5% sequence divergence.
growth was determined for the culture in Zobell 2216E broth M44 was prepared by Genomic DNA Isolation kit (Watson).
(peptone 0.5%, yeast powder 0.1%, ferric phosphate 0.01%) Then, gene encoding 16S rDNA was amplified by PCR
at various pH values (4.0, 6.0, 7.0, 8.0, 9.0, and 10.0) adjusted with 16S rDNA Bacterial Identification PCR kit (TaKaRa).
with HCl or NaOH (1 mol/L). The temperature range for An ABI BigDye Terminator 3.1 cycle sequencing kit (Applied
growth was examined on Zobell 2216E agar incubated at 8, Biosystems) and an automated DNA sequencer (model ABI
10, 20, 25, 28, 30, and 37◦ C. Sodium requirement [0, 2.5, 5, 3730; Applied Biosystems) were used to sequencing the 16S
7.5, 10.0, and 12.5% (w/v) NaCl] was also investigated. Gen- rDNA gene of M44.
eral physiological tests were performed using conventional
methods. Biochemical traits were determined using API kits 2.5. Phylogenetic Analysis. The almost complete 16S rDNA
(API 20 E, API ZYMAPI 50CH; bioMérieux). The ability to gene sequence of strain M44 was submitted to GenBank to
oxidize sulfite was tested by the method of Pukall et al. [3]. search for similar sequences by using the BLAST algorithm.
The ability to oxidize thiosulfate and elemental sulfur was A phylogenetic tree was constructed by using Kimura’s two-
tested by the method of Sorokin [2]. parameter and pairwise-deletion model analysis in the pro-
gram MEGA version 3.0 [11]. The resultant tree topologies
2.3. Extraction and Analysis of Fatty Acids. Fatty acids were were evaluated by bootstrap analysis based on 1000 repli-
determined in cells grown on Zobell 2216E agar plates at cates.
28◦ C for 2-3 days. Fatty acid methyl esters were obtained
2.6. Determination of Base Composition of DNA. The G+C
from a freeze-dried biomass (approx. 10 mg) by saponifi-
content of the DNA was determined by using the method
cation, methylation, and extraction using the method of
of Mesbah et al. [12]. DNA of the strain M44 was enzymat-
Svetashev et al. [9]. The fatty acid methyl ester mixtures were
ically degraded into nucleosides. The obtained nucleoside
analyzed on an Agilent GC-6890N (FID), using an Agilent
mixtures were separated by HPLC, and the value of G+C
19091B-102 gas chromatograph column, HP-ULTRA2 Cap-
mol% was calculated based on the result of G/G+T mol %.
illary (25.0 m × 200 μm × 0.03 μm). The GC parameters were
as follows: carrier gas, ultrahigh-purity hydrogen; carrier gas 2.7. Cultivation of Sulfitobacter Sp. M44. The bacterium
flow, 0.4 mL·min−1 ; injection volume, 2 μL; column split was grown on Zobell 2216E agar medium and incubated
ratio, 100 : 1; column temperature, 170–260◦ C at 5◦ C min−1 , at 25◦ C for a day. A loopful of bacterium was inoculated
260–310◦ C at 40◦ C min−1 and keep 1.5 min (initial column into a 500 mL Erlenmeyer flask containing 150 mL of marine
temperature of 170◦ C); injection port temperature, 250◦ C; Zobell 2216E broth and incubated on a rotatory shaker at
detector temperature, 310◦ C. 130 rpm, 25◦ C, for 7 days.
2.4. Molecular Identification. According to the method 2.8. Isolation and Identification of Exocellular Cyclic Peptides.
described by Rainey et al. [10], the genomic DNA of strain The entire culture broth (60 L) was centrifugated at 4000 rpm
Evidence-Based Complementary and Alternative Medicine 3
O O O
NH NH NH
HN HN HN
O O O
Cyclo (Val-Leu) Cyclo (Phe-Val) Cyclo (Phe-Leu)
O O
O
NH NH N
HN HN
N HN
H
O O
O
Cyclo (Leu-Ile) Cyclo (Phe-Ile) Cyclo (Trp-Pro)
Table 1: Fatty acid compositions of strain M44 and related Sulfitobacter type strains.
Fatty acid 1 2 3 4 5
18 : 1 ω7c 67.01 73.7 63.9 59.9 79.1
11 methyl 18 : 1 ω7c 11.76 5 1.7 6.8 3.7
16 : 0 8.4 6.1 17.8 7 10.1
10 : 0 3 OH 5.42 6.3 3 5.7 3.4
12 : 1 3 OH 4.78 — 1.4 6.1 0
Strains: 1, M44; 2: Sulfitobacter pontiacus DSM 10014T (date from [2]); 3: Sulfitobacter dubius ATCC BAA-320T (date from [7]); 4: Sulfitobacter delicatus ATCC
BAA-321T (date from [7]); 5: Sulfitobacter donghicola DSW 25T (date from [5]); values are percentages of total fatty acids; —: not detected.
for 5 min, and the supernatant extracted 3 times with an (w/v), in which the optimum growth condition was
equal volume of ethyl acetate. The upper layer of liquid was 25◦ C, pH 7.0, and at a 2.5% NaCl concentration. The
evaporated in vacuum at 30◦ C to yield 5 g of the crude strain did not oxidize thiosulfate or elemental sulfur but
extract, which was subjected to Sephadex LH-20 gel column oxidized sulfite. Oxidase, nitrate, indole, urease, H2 S pro-
and eluted with CH3 OH to get five fractions, one of which duction, lysine decarboxylase, and ornithine decarboxy-
was subsequently rechromatographed on C18 reversed-phase lase reactions were negative, while catalase, gelatin lique-
column with a gradient of water to methanol. The fractions faction, production of arginine dihydrolase, tryptophane
obtained were further purified by reversed-phase high- desaminase, Voges-Proskauer reaction, and citric acid reac-
performance liquid chromatography (RP-HPLC) (Agilent tions were positive. Alkaline phosphatase, esterase (C4),
1100 ZORBA × 80 Å, 4.6 mm × 250 mm) using CH3 CN- esterase lipase (C8), lipase (C14), leucine arylamidase,
H2 O isocratic elution. 1 H and 13 C NMR spectra were valine arylamidase, acid phosphatase, and naphthol-AS-BI-
recorded at 600 and 300 MHz, respectively, on a Bruker phosphohydrolase were present, while cystine arylamidase,
AMX-600 spectrometer. Mass spectra were recorded on a trypsin, α-chymotrypsin, α-galactosidase, β-galactosidase,
Fisons TRIO 2000 spectrometer. β-glucuronidase, α-glucosidase, β-glucosidase, N-acetyl-β-
glucosaminidase, α-mannosidase, and α-fucosidase were
3. Results absent in assays with the API ZYM system. D-sucrose was
utilized as the sole carbon source in assays with the API 50CH
3.1. Physiological and Biochemical Properties. The colonies system. Acid was weakly produced from mannitol. The rest
were slightly yellowish, regularly round, convex and smooth, substrates were not utilized as sole carbon sources.
and about 0.8–1.0 mm in diameter after incubation for 48 h
on marine agar. No diffusible pigment was produced in the
medium. Cells were gram-negative, chemoorganotroph with 3.2. Fatty Acid Analysis. The main cellular fatty acids of
respiratory metabolism, mesophilic rod-shaped and single, the strain were 18 : 1 ω7c (67.01%), 11 methyl 18 : 1 ω7c
about 0.6–0.8 μm in diameter, and did not form endospores. (11.76%), 16 : 0 (8.40%), 10 : 0 3OH (5.42%), and 12 : 1 3OH
The growth condition was determined at 10–28◦ C, (4.78%). Minor components included 12 : 0 3OH, 17 : 1 ω8c,
pH 6.0–10.0, and the NaCl concentration was 0–12.5% 17 : 0, and 18 : 0 isomers.
4 Evidence-Based Complementary and Alternative Medicine
Table 2: Characteristics that differentiate strain M44 from phylogenetically related Sulfitobacter type strains.
Characteristic 1 2 3 4 5
Motility + + + − −
DNA G+C content (mol%) 58.04 61.7–62.5 60 63.7 56.9
NaCl range for growth (%, w/v) 0–12.5 0.5–8 1–12 1–8 1–6
Temperature range for growth (◦ C) 10–28 4–35 10–30 12–37 10–31
Oxidase − + + + ND
Nitrate reduction − + + W −
API/BIOLOG reactions:
Citrate + W + − −
Gluconate − + + + −
Lipase (C14) + + − − +
Melibiose W W + − −
D-Sucrose + ND − − −
Strains: 1: M44; 2: Sulfitobacter pontiacus DSM 10014T (date from [2]); 3: Sulfitobacter dubius ATCC BAA-320T (date from [7]); 4: Sulfitobacter delicatus ATCC
BAA-321T (date from [7]); 5: Sulfitobacter donghicola DSW 25T (date from [5]); +: Positive; W: weakly positive; −: negative; ND: no data.
3.3. Molecular Identification of Sulfitobacter M44. Phyloge- DSM 10014T and Sulfitobacter donghicola DSW 25T did not.
netic analysis (Figure 1) based on a consensus 1378-bp The details of comparison of the fatty acid compositions were
length of 16S rDNA gene sequences showed that strain M44 listed in Table 1.
was grouped with members of the genus Sulfitobacter and The results of physiological and other characteristics of
formed a distinct cluster with KMM 3554T (AY180102, 99% M44 are described in Table 2. Also included are some of the
sequence similarity) in the neighbour-joining tree. literature data for the phylogenetic relatives as judged by 16S
The G+C content of DNA was determined to be 58.04 rDNA gene sequence analysis. Most of these characteristics
mol% for strain M44. are the same, but M44 have some unique characteristics. For
example, the result of oxidase test of M44 was negative, while
3.4. Extracellular Cyclodipeptide Composition. Based on the other related strains were positive; M44 used D-Sucrose
spectrum data (1 H-NMR, 13 C-NMR, ESI-MS), six extracel- as sole carbon source, while the other strains did not use it.
lular cyclodipeptide constituents, which were Cyclo (Val- Besides, M44 have also showed some different characteristics
Leu) [13–15], Cyclo (Phe-Val) [16], Cyclo (Phe-Leu) [17], from other strains, which included motility, the ability of
Cyclo (Leu-Ile) [18], Cyclo (Phe-Ile) [17], and Cyclo (Trp- nitrate, citrate and lipase (C14) reduction, and the utilization
Pro) [19], have been identified from Sulfitobacter sp. M44 of carbon resources, and so forth. In summary, although
(Figure 2). the results of 16S rDNA sequence analysis suggest that M44
belongs to the genus of Sulfitobacter, we cannot confirm the
4. Discussion strain M44 belongs to a new Sulfitobacter species based on
the current phenotype and physiological study.
Based on the phenotypic properties and the results of phys- According to recent studies, Sulfitobacter widely exists in
iological study and molecular identification, strain M44 has coastal and open ocean environments. Several bioactivities
a great similarity to Sulfitobacter dubius and should be clas- associated with Sulfitobacter have been reported, including
sified to the genus of Sulfitobacter, inwhich many different organic sulfur cycling in the ocean [7], production of
characteristics can be determined. The fatty acid profile of sodium-channel blocking toxins [20], host chemical defense
M44 and related strains gave patterns in which 18 : 1 ω7c [21], and marine oil biodegradation [22]. Consequently, sec-
ranging from 59.9% to 79.1% predominated, but different ondary metabolites of Sulfitobacter may play important roles
compositions could be distinguished on the basis of the in marine ecosystems. However, there has been no report
remaining fatty acids. Firstly, although all these five strains on the elucidation of secondary metabolites of Sulfitobacter.
could produce 11 methyl 18 : 1 ω7c, 16 : 0 and 3-OH 10 : 0 Six cyclodipeptides were isolated from M44 according to our
fatty acids, there were some differences in the distribution of work. It is the first report on the secondary metabolites of
them. For unsaturated fatty acid, M44 produced much more this genus. A strain-termed Oceanibulbus indolifex, located in
11 methyl 18 : 1 ω7c than other related strains. For straight- the same phylogenetic branch, has been reported to produce
chain 16 : 0 fatty acid, M44 showed a certain difference cyclodipeptides as well, but structurally different from M44
when compared with Sulfitobacter dubius ATCC BAA-320T . [23]. Published data have shown that cyclodipeptides are
The percentage of 16 : 0 fatty acid produced by M44 and bioactive molecules showed a wide range of effects, such
Sulfitobacter dubius ATCC BAA-320T was 8.4% and 17.8%, as antibacterial, antitumor, and antiviral [24]. In addi-
respectively. In addition, M44, Sulfitobacter dubius ATCC tion, cyclodipeptides can act as hormones and ion carrier
BAA-320T , and Sulfitobacter delicatus ATCC BAA-321T pro- molecules [25]. Recently, some cyclodipeptides have been
duced 3-OH 12 : 1 fatty acid, whereas Sulfitobacter pontiacus identified as quorum-sensing bacterial sensors [26], which
Evidence-Based Complementary and Alternative Medicine 5
are used by gram-negative bacteria for cell-cell commu- [9] V. I. Svetashev, M. V. Vysotskii, E. P. Ivan ova, and V. V.
nication and regulating gene expression in response to Mikhailov, “Cellular fatty acids of Alteromonas species,” Sys-
population density. That means cyclodipeptides may work tematic & Applied Microbiology, vol. 18, no. 1, pp. 37–43,
through a complicated cross-talk rather than a direct action 1995.
on other cells. [10] F. A. Rainey, N. Ward-Rainey, R. M. Kroppenstedt, and E.
Generally, our work describes a Sulfitobacter strain M44 Stackebrandt, “The genus Nocardiopsis represents a phyloge-
netically coherent taxon and a distinct actinomycete lineage:
isolated from the East China Sea, which has some similarities
proposal of Nocardiopsaceae fam. nov,” International Journal
and some differences to the known Sulfitobacter strains. And of Systematic Bacteriology, vol. 46, no. 4, pp. 1088–1092,
for the first time, we isolated and identified six cyclodipep- 1996.
tides from this genus. The further study should be focused [11] S. Kumar, K. Tamura, and M. Nei, “MEGA3: integrated
on the molecular mechanism of cyclodipeptides, which may software for molecular evolutionary genetics analysis and
reveal why cyclodipeptides existed in microorganism widely. sequence alignment,” Briefings in Bioinformatics, vol. 5, no. 2,
pp. 150–163, 2004.
Conflict of Interests [12] M. Mesbah, U. Premachandran, and W. B. Whitman, “Precise
measurement of the G+C content of deoxyribonucleic acid
The authors declared that there is no conflict of interests. by high-performance liquid chromatography,” International
Journal of Systematic Bacteriology, vol. 39, pp. 159–167,
1989.
Acknowledgment [13] D. E. Nitecki, B. Halpern, and J. W. Westley, “A simple route
to sterically pure diketopiperazines,” Journal of Organic Chem-
The work was supported by the National Hi-tech R and istry, vol. 33, no. 2, pp. 864–866, 1968.
D Program (2007AA091501), (2006AA09Z416), and (2006 [14] W. Pickenhagen and P. Dietrich, “Identification of the bitter
AA09Z425). principle of Cocoa,” Helvetica Chimica Acta, vol. 58, no. 4, pp.
1078–1086, 1975.
References [15] K. Suzuki, Y. Sasaki, N. Endo, and Y. Mihara, “Acetic acid-
catalyzed diketopiperazine synthesis,” Chemical & Pharmaceu-
[1] T. A. Gulder and B. S. Moore, “Chasing the treasures of the tical Bulletin, vol. 29, no. 1, pp. 233–237, 1981.
sea—bacterial marine natural products,” Current Opinion in [16] T. Stark and T. Hofmann, “Structures, sensory activity, and
Microbiology, vol. 12, no. 3, pp. 252–260, 2009. dose/response functions of 2,5-diketopiperazines in roasted
[2] D. Y. Sorokin, “Sulfitobacter pontiacus gen. nov., sp. nov. a new cocoa nibs (Theobroma cacao),” Journal of Agricultural & Food
heterotrophic bacterium from the black sea, specialized on Chemistry, vol. 53, no. 18, pp. 7222–7231, 2005.
sulfite oxidation,” Microbiology, vol. 64, pp. 354–364, 1995. [17] M. Tullberg, M. Grøtli, and K. Luthman, “Efficient synthesis
[3] R. Pukall, D. Buntefuss, A. Frühling et al., “Sulfitobacter medi- of 2,5-diketopiperazines using microwave assisted heating,”
terraneus sp. nov., a new sulfite-oxidizing member of the α- Tetrahedron, vol. 62, no. 31, pp. 7484–7491, 2006.
Proteobacteria,” International Journal of Systematic Bacteriol- [18] S. M. Wang, “Cyclodipeptides from the roots of Pannax noto-
ogy, vol. 49, no. 2, pp. 513–519, 1999. ginseng,” Natural Product Research & Development, vol. 16, no.
[4] J. A. R. Park, J. W. Bae, Y. D. Nam et al., “Sulfitobacter litoralis 5, pp. 383–386, 2004.
sp. nov., a marine bacterium isolated from the east sea, Korea,” [19] V. Ivanova, U. Graefe, R. Schlegel et al., “Isolation and struc-
International Journal of Systematic & Evolutionary Microbiol- ture elucidation of tyramine and indole alkaloids from antarc-
ogy, vol. 57, no. 4, pp. 692–695, 2007. tic strain Microbispora aerata imbas-11A,” Biotechnology &
[5] J. H. Yoon, S. J. Kang, M. H. Lee, and T. K. Oh, “Description Biotechnological Equipment, vol. 17, no. 2, pp. 128–133,
of Sulfitobacter donghicola sp. nov., isolated from seawater of 2003.
the east sea in Korea, transfer of staleya guttiformis Labrenz [20] M. Vásquez, C. Grüttner, B. Möeller, and E. R. B. Moore,
et al. 2000 to the genus Sulfitobacter as Sulfitobacter guttiformis “Limited selection of sodium channel blocking toxin-pro-
comb. nov. and emended description of the genus Sulfito- ducing bacteria from paralytic shellfish toxin-contaminated
bacter,” International Journal of Systematic & Evolutionary mussels (Aulacomya ater),” Research in Microbiology, vol. 153,
Microbiology, vol. 57, no. 8, pp. 1788–1792, 2007. no. 6, pp. 333–338, 2002.
[6] J. H. Yoon, SO. J. Kang, and T. K. Oh, “Sulfitobacter marinus sp. [21] W. E. G. Müller, F. Brümmer, R. Batel, I. M. Müller, and H.
nov., isolated from seawater of the east sea in Korea,” Interna- C. Schrüder, “Molecular biodiversity case study: Porifera
tional Journal of Systematic & Evolutionary Microbiology, vol. (sponges),” Naturwissenschaften, vol. 90, no. 3, pp. 103–120,
57, no. 2, pp. 302–305, 2007. 2003.
[7] E. P. Ivanova, N. M. Gorshkova, T. Sawabe et al., “Sulfitobacter [22] O. G. Brakstad and A. G. G. L ødeng, “Microbial diversity dur-
delicatus sp. nov. and Sulfitobacter dubius sp. nov., respectively ing biodegradation of crude oil in seawater from the North
from a starfish (Stellaster equestris) and sea grass (Zostera Sea,” Microbial Ecology, vol. 49, no. 1, pp. 94–103, 2005.
marina),” International Journal of Systematic & Evolutionary [23] I. Wagner-Döbler, H. Rheims, A. Felske et al., “Oceanibulbus
Microbiology, vol. 54, no. 2, pp. 475–480, 2004. indolifex gen. nov., sp. nov., a north sea alphaproteobacterium
[8] M. Labrenz, B. J. Tindall, P. A. Lawson, M. D. Collins, P. that produces bioactive metabolites,” International Journal of
Schumann, and P. Hirsch, “Staleya guttiformis gen. nov., Systematic & Evolutionary Microbiology, vol. 54, no. 4, pp.
sp. nov. and Sulfitobacter brevis sp. nov., α-3-proteobacteria 1177–1184, 2004.
from hypersaline, heliothermal and meromictic antarctic [24] M. B. Martins and I. Carvalho, “Diketopiperazines: biological
Ekho Lake,” International Journal of Systematic & Evolutionary activity and synthesis,” Tetrahedron, vol. 63, no. 40, pp. 9923–
Microbiology, vol. 50, no. 1, pp. 303–313, 2000. 9932, 2007.
6 Evidence-Based Complementary and Alternative Medicine
Research Article
Isolation and Characterization of a Phosphate-
Solubilizing Halophilic Bacterium Kushneria sp. YCWA18
from Daqiao Saltern on the Coast of Yellow Sea of China
Phosphate-solubilizing bacteria (PSB) function in soil phosphorus cycle, increasing the bioavailability of soil phosphorus for
plants. Isolation and application of salt-tolerant or halophilic PSB will facilitate the development of saline-alkali soil-based
agriculture. A moderately halophilic bacterium was isolated from the sediment of Daqiao saltern on the eastern coast of China,
which also performs phosphate-solubilizing ability. The bacterium was assigned to genus Kushneria according to its 16S rRNA gene
sequence, and accordingly named as Kushneria sp. YCWA18. The fastest growth was observed when the culturing temperature was
28◦ C and the concentration of NaCl was 6% (w/v). It was founds that the bacterium can survive at a concentration of NaCl up to
20%. At the optimum condition, the bacterium solubilized 283.16 μg/mL phosphorus in 11 days after being inoculated in 200 mL
Ca3 (PO4 )2 containing liquid medium, and 47.52 μg/mL phosphorus in 8 days after being inoculated in 200 mL lecithin-containing
liquid medium. The growth of the bacterium was concomitant with a significant decrease of acidity of the medium.
100 |
Kushneria sinocarnis |FJ667549
97 Kushneria sp.YCWA18|GQ246216
Kushneria aurantia |AM941746
Kushneria marisflava|AF251143
100 Kushneria indalinina|AJ427627
Halomonas sp.YCSA28|FJ984862
0.01
Figure 1: Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences, showing the position of strain YCWA18 with respect to
related species.
(E 120◦ 49 12 , N 36◦ 30 00 ). Approximately 1 g sediment liquid medium was observed using bromocresol purple sup-
was suspended in 100 mL sterilized seawater and vortexed plemented with 1% of carbohydrate. Other morphological,
for 10 min. The isolates were obtained by plating a serial of physiological, and biochemical characterizations were done
10-fold dilutions of sediment suspension onto a modified as described by Mata et al. [13].
marine agar medium (2216E, one liter of seawater contains
5 g tryptone, 1 g yeast extract and 15 g agar, pH 7.5) [8] 2.3. Tests of Salt, pH, and Temperature Tolerance. NaCl
and incubating at 28◦ C for 7 days. The isolates were tolerance was determined in 2216E medium containing 0,
purified by restreaking on 2216E agar plate and microscopic 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12.5, 15, 20, 25, and 28%
confirmation. (w/v) total salts. The pH range for growth was tested at pH
The isolates were screened for their phosphorus- 2.0–11.0 in increments of pH 1.0. Growth was determined at
solubilizing ability by culturing at 28◦ C on the media sup- A600 . Growth at 0, 6, 10, 15, 20, 24, 28, 32, 37, 42, and 45◦ C
plemented either lecithin or Ca3 (PO4 )2 . When the colonies was also determined.
appeared in one week, those causing a clear phosphate-
solubilizing zone were selected out for further characteriza- 2.4. Taxonomical Assignment. DNA was extracted with the
tion. The size of phosphate-solubilizing zone was determined method of Hiraishi [14] and used as the template for the
for each colony. amplification of 16S rRNA gene with universal primers 27F
The modified Ca3 (PO4 )2 culture medium contained and 1492R [15]. The sequence obtained was aligned with
with the following ingredients (l−1 ) [9]: glucose 10 g, its orthologs retrieved from both GenBank and TYP16S
(NH4 )2 SO4 0.5 g, NaCl 30 g, KCl 0.3 g, FeSO4 ·7H2 O 0.03 g, databases. The phylogenetic assignment was performed
MnSO4 ·4H2 O 0.03 g, MgSO4 ·7H2 O 0.3 g, Ca3 (PO4 )2 10 g, using MEGA software with bootstrap percentages calculated
agar 20 g, H2 0 1000 mL, pH 7.0–7.5. The lecithin cul- with 1000 replications.
ture medium was composed of (l−1 ) [10]: glucose 10 g,
(NH4 )2 SO4 0.5 g, NaCl 30 g, KCl 0.3 g, FeSO4 ·7H2 O 0.03 g,
MnSO4 ·4H2 O 0.03 g, MgSO4 ·7H2 O 0.3 g, lecithin 0.2 g, 2.5. Determination of Phosphorus-Solubilizing Ability. The
CaCO3 5 g, yeast extract 0.4 g, agar 20 g, H2 0 1000 mL, pH bacterium was inoculated into 200 mL liquid media sup-
7.0–7.5. plemented with either Ca3 (PO4 )2 or lecithin and cultured
The ingredients were prepared and sterilized by an at 28◦ C for 12 days with continuous agitation (150 r/min).
autoclave for 20 min at 115◦ C without lecithin. Lecithin was 10 ml culture was sampled aseptically every 24 hours for
prepared by diluting in sterile water and was added to the the determination of acidity and available phosphorus. The
medium before inoculation. acidity was assayed simply by reading on a pH meter,
Bacterial isolate was freeze-stored in 2216E medium and the phosphorus availability was determined with Mo-
supplemented with 30% (v/v) glycerol at −80◦ C. blue method [16]. Optimum pH and temperature for P-
solubilization in liquid Ca3 (PO4 )2 medium were determined
following the above method.
2.2. Bacterial Characterization. The isolate was phenotyp-
ically characterized following the minimal standards for 3. Results
describing the new taxa of family Halomonadaceae recom-
mended previously [11]. Gram-staining was carried out with 3.1. Characterization of the Isolate. The closest species of the
the method described by Dussault [12]. Anaerobic growth isolate was Kushneria sinocarnis; the similarity between their
performance was determined by inoculating the semisolid 16S rRNA genes is 98.57%. As shown in Figure 1, the isolate
2216E (0.6% agar, w/v) at the bottom of tube and sealing was assigned to the clade of K. sinocarnis with 100% boot-
with 2 mL agar (2%, w/v) and 2 mL paraffin. Acidification in strap support. The isolate was named Kushneria sp. YCWA18.
Evidence-Based Complementary and Alternative Medicine 3
1.4
1.2
1.4
1.2 1
1 0.8
Λ 600
0.8
Λ 600
0.6
0.6
0.4
0.4
0.2 0.2
0 0
0
0.5
1
2
3
4
5
6
7
8
9
10
12.5
15
20
25
28
2 3 4 5 6 7 8 9 10 11
NaCl (%) (w/v) pH value
Experimental group
Experimental group Control group
Control group
(b)
(a)
Figure 2: Test of NaCl and pH tolerance of the isolate ((a): NaCl; (b): pH).
(a) (b)
Figure 3: The phosphate-solubilizing zone formed on medium containing Ca3 (PO4 )2 (a) and lecithin (b). Bar: 1 cm.
It is a Gram-negative bacterium and grows aerobically. Its slow in the first two days and then becomes fast, reaching
colony is yellow and round with a diameter between 1.2– the highest (283.16 μg/mL) in about 11 days. Lecithin
2.5 mm after growing on 2216E for 48 hours. The fastest solubilization starts to increases in 1 day, reaching the
growth is observed at 6% NaCl (w/v), 28◦ C and pH 7.0– highest 47.52 μg/mL in 8 days. It was found that the growth
8.0 (Figure 2). The isolate can survive at high concentrations of the isolate caused a significant increase of acidity in
of NaCl (up to 20%) and pH range of 4.0–10.0 (Figure 2). Ca3 (PO4 )2 containing medium. In about 4 days, the acidity
It reduces nitrate and hydrolyzes aesculin but not urea, increased from pH 7.21 to pH 4.24. In contrast, the acidity
Tween20 and Tween80. The isolate produces acid from car- decreased from pH 7.1 to pH 7.46 in lecithin-containing
bohydrates including D-fructose, α-D-glucose, D-mannose, medium.
maltose, D-sorbitol, succinamic acid, adonitol and L-alanyl-
glycine but not D-psicose, D- glucosaminic acid, and inosine.
3.4. The Influence of Temperature and Acidity on Phosphorus
3.2. Growth on Ca3 (PO4 )2 and Lecithin Containing Solid Solubilization in Ca3 (PO4 )2 -Containing Medium. As showed
Media. The isolate grows well at 28◦ C on lecithin and in Figure 5, the concentration of soluble phosphorus in
Ca3 (PO4 )2 containing solid media. In 3 days (lecithin Ca3 (PO4 )2 containing medium starts to increases in 2 days
containing medium) or 5 days (Ca3 (PO4 )2 containing when the isolate was cultured at 28◦ C and 32◦ C, reaching
medium), clear phosphate-solubilizing zone forms. In 10 the highest in 7-8 days, faster than the increment achieved
days, the phosphate-solubilizing zone expanded to the at 24◦ C. At 28◦ C, the bacterium obtained the highest
biggest (about 2.5–3.0 cm on Ca3 (PO4 )2 containing plate, solubilizing ability of Ca3 (PO4 )2 , about 283.16 μg/mL in
Figure 3(a) and about 1.7–2.0 cm on lecithin containing 200 mL Ca3 (PO4 )2 containing medium at 28◦ C, while at
medium, Figure 3(b)). 32◦ C and 24◦ C, it obtained the ability of 217.58 μg/mL, and
187 μg/mL, respectively, and it was found that phosphorus
3.3. Growth in Ca3 (PO4 )2 and Lecithin-Containing Liquid solubilization reached the maximum when the pH value of
Media. As showed in Figure 4, Ca3 (PO4 )2 solubilization is Ca3 (PO4 )2 containing medium is 7.0.
4 Evidence-Based Complementary and Alternative Medicine
8
300 7.5
P-solubilizing ability (μg/ml)
7
250
6.5
200
pH value
6
150 5.5
100 5
4.5
50
4
0 3.5
0 1 2 3 4 5 6 7 8 9 10 11 12 0 1 2 3 4 5 6 7 8 9 10 11 12
t (days) t (days)
Lecithim Ca 3 (PO4 )2 Ca 3 (PO4 )2 Ca 3 (PO4 )2 (blank)
Lecithim(blank) Ca 3 (PO4 )2 (blank) Lecithim Lecithim (blank)
(a) (b)
Figure 4: Phosphorus-solubilizing performance of the isolate ((a) P-solubilizing ability; (b) pH value of the medium).
300 300
P-solubilizing ability (μg/ml)
250 250
200 200
150 150
100 100
50 50
0 0
0 1 2 3 4 5 6 7 8 9 10 11 12 4 4.5 5 5.5 6 6.5 7 7.5 8 8.5 9
t (days) t (days)
24◦ C 32◦ C Experimental group
28◦ C Control Control group
(a) (b)
Figure 5: The influence of temperature (a) and acidity (b) on the phosphorus solubilization in Ca3 (PO4 )2 containing medium.
4. Discussions metabolin, how quickly it releases, and also its spread degree
on the medium. Therefore, observational method of P-
Phosphorus is an important limiting factor in agriculture solubilizing zone can only be used to qualitative assays [17].
production, and microbial activation seems to be an effective Phosphorus solubilization is a complex process, which
way to solve the solidified phosphorus in soil. Many bacterial is influenced by diverse factors such as nutritional richness
strains with P-solubilizing abilities have been examined in and physiological and growing status of the bacterium
previous studies, but few of them can function well at high [18]. A number of theories have been proposed to explain
NaCl concentration, and reports on isolation of halophilic the mechanism of phosphate solubilization, and the most
PSB strain have not been found yet. The result obtained in important among them are acid production theory and
this study shows that the isolate YCWA18 has a broad growth enzyme theory. According to the acid production, the process
range: it can survive at high concentrations of NaCl (up to of phosphate solubilization by PSB is due to the production
20%) and pH range of 4.0–10.0, and it can solubilize both of low molecular weight organic acids that was accompanied
inorganic phosphorus and organophosphorus, and result by the acidification of the medium [6, 19, 20], and those
also shows that its P-solubility for Ca3 (PO4 )2 is higher than organic acids can chelate the cation with their hydroxyl and
for lecithin (Figure 3). carboxyl groups [21]. The analysis of culture filtrates of PSBs
The formation of the clear zones is concerned with has shown the presence of number of organic acids such
the P-solubilization of the strain (Figure 3). It may secrete as malic, glyoxalic, succinic, fumaric, tartaric, alpha keto
some substances into surroundings in the course of growing, butyric, oxalic, citric, 2-ketogluconic, and gluconic acid [22–
which can solubilize phosphate or organophosphate. P- 24]. A decrease in the pH of the medium from the initial
solubilization result may vary depending on kinds of the value of 7.0 to a final value of 2.0 was recorded by many
Evidence-Based Complementary and Alternative Medicine 5
workers [25, 26], and in our study, the decrease of the pH [3] R. E. Beever and D. J. W. Burns, “Phosphorus uptake, storage
of Ca3 (PO4 )2 -containing medium from pH 7.21 to pH 4.24 and utilization by fungi,” Advances in Botanical Research, vol.
also supported this theory. 8, pp. 121–219, 1980.
Enzymolysis is the possible mechanism of lecithin solu- [4] H. Rodrı́guez and R. Fraga, “Phosphate solubilizing bacteria
bilization [27]. The acidity of lecithin-containing medium and their role in plant growth promotion,” Biotechnology
during culturing is a little higher than that of the control Advances, vol. 17, no. 4–5, pp. 319–359, 1999.
[5] M. H. Abd-Alla, “Phosphatases and the utilization of organic
(Figure 4(b)). We believe that phosphorus solubilization
phosphorus by Rhizobium leguminosarum biovar viceae,”
from lecithin is not through acidification. It is possible that Letters in Applied Microbiology, vol. 18, no. 5, pp. 294–296,
the increase of lecithin-containing medium during culturing 1994.
is caused by enzymes which act on lecithin and produce [6] A. H. Goldstein, “Recent progress in understanding the
choline. molecular genetics and biochemistry of calcium phosphate
The association among bacterial growth, supernatant solubilization by Gram negative bacteria,” Biological Agricul-
acidity, and the concentration of solubilized phosphorus has ture and Horticulture, vol. 12, no. 2, pp. 185–193, 1995.
been found [28]. As a well-developed strategy, microorgan- [7] X. R. Zhao and Q. M. Lin, “A review of phosphate—dissolving
isms have been recruited to transform insoluble phosphorus microorganisms,” Soil Fertilizer, vol. 3, pp. 7–11, 2001.
of mineral sources into the soluble one [29]. As a particular [8] Y. H. Hou, Q. F. Wang, J. H. Shen, J. L. Miao, and G.
case, Gram-negative bacteria mobilize insoluble phosphate Y. Li, “Molecular identification of a halotolerant bacterium
NJ82 from Antarctic Sea ice and preliminary study on its salt
very efficiently; they produce gluconic acid during the
tolerance,” Microbiology, vol. 35, no. 4, pp. 486–490, 2008.
extracellular oxidation of glucose catalyzed by quinoprotein [9] C. S. Nautiyal, “An efficient microbiological growth medium
glucose dehydrogenase [30]. Microbial phosphorus mobi- for screening phosphate solubilizing microorganisms,” FEMS
lization should be the only way of increasing plant-available Microbiology Letters, vol. 170, no. 1, pp. 265–270, 1999.
phosphorus in soil [31]. [10] S. Niewolak, “Occurrence of microorganisms in fertilized
Diverse microorganisms are able to change phosphorus lakes. II. Lecithin- mineralizing microorganisms,” Polskie
forms; however, their transforming ability may associate Archiwum Hydrobiologii, vol. 27, pp. 53–71, 1980.
with the ecological conditions including soil characteristics [11] D. R. Arahal, R. H. Vreeland, C. D. Litchfield et al., “Rec-
and vegetation. It has been found that the performance of ommended minimal standards for describing new taxa of the
phosphorus-solubilizing microorganisms is severely affected family Halomonadaceae,” International Journal of Systematic
by environmental factor, especially stress ones [32, 33]. and Evolutionary Microbiology, vol. 57, no. 10, pp. 2436–2446,
In order to obtain the bacteria with high phosphorus- 2007.
[12] H. P. Dussault, “An improved technique for staining red
solubilizing ability, it is important to use samples of
halophilic bacteria,” Journal of bacteriology, vol. 70, no. 4, pp.
environmental extremes, for example, saline-alkali soil. In 484–485, 1955.
this work, a high phosphorus-solubilizing bacterium was [13] J. A. Mata, J. Martı́nez-Cánovas, E. Quesada, and V. Béjar,
isolated from the sediment if a saltern. It can grow on “A detailed phenotypic characterisation of the type strains of
the solid media containing 20% (w/v) of sodium chloride, Halomonas species,” Systematic and Applied Microbiology, vol.
being halotolerant according to the suggested standards [34]. 25, no. 3, pp. 360–375, 2002.
The biological characteristics and factors influencing its [14] A. Hiraishi, “Direct automated sequencing of 16S rDNA
phosphate-solubilizing ability need to be studied further. amplified by polymerase chain reaction from bacterial cultures
Our trials paved an effective avenue of isolating halophilic without DNA purification,” Letters in Applied Microbiology,
and phosphorus-solubilizing bacteria from marine envi- vol. 15, no. 5, pp. 210–213, 1992.
ronment in order to promote saline-alkali soil-based [15] D. J. Lane, “16S/23S rRNA sequencing,” in Nucleic Acid
Techniques in Bacterial Systematics, pp. 115–175, John Wiley
agriculture.
and Sons, New York, NY, USA, 1991.
[16] F. S. Watanabe and S. R. Olsen, “Test of an ascorbic acid
Acknowledgment method for determining phosphorous in water and NaHCO3
extracts from soil,” Soil Science Society of America Proceedings,
This work was supported financially by National Natural vol. 29, pp. 677–678, 1965.
Science Foundation of China (41006103), Public science and [17] D. Piccini and R. Azcon, “Effect of phosphate-solubilizing
technology research funds projects of ocean (201105007-01), bacteria and vesicular-arbuscular mycorrhizal fungi on the
the National Infrastructure of Natural Resources for Science utilization of Bayovar rock phosphate by alfalfa plants using
and Technology Program of China (2004DKA30640), and a sand-vermiculite medium,” Plant and Soil, vol. 101, no. 1,
pp. 45–50, 1987.
the Scientific Research Foundation of the First Institute of
[18] I. Reyes, L. Bernier, R. R. Simard, and H. Antoun, “Effect of
Oceanography, SOA (2011G24). nitrogen source on the solubilization of different inorganic
phosphates by an isolate of Penicillium rugulosum and two UV-
References induced mutants,” FEMS Microbiology Ecology, vol. 28, no. 3,
pp. 281–290, 1999.
[1] A. H. Goldstein, “Bacterial solubilization of mineral phos- [19] M. E. Puente, Y. Bashan, C. Y. Li, and V. K. Lebsky, “Micro-
phates: historical perspectives and future prospects,” American bial populations and activities in the rhizoplane of rock-
Journal of Alternative Agriculture, vol. 1, pp. 57–65, 1986. weathering desert plants. I. Root colonization and weathering
[2] F. Scheffer and P. Schachtschabel, Lehrbuch der Bodenkunde, of igneous rocks,” Plant Biology, vol. 6, no. 5, pp. 629–642,
Ferdinand Enke Verlag, Stuttgart, Germany, 1992. 2004.
6 Evidence-Based Complementary and Alternative Medicine
Review Article
Bioactive Pigments from Marine Bacteria: Applications and
Physiological Roles
Research into natural products from the marine environment, including microorganisms, has rapidly increased over the past
two decades. Despite the enormous difficulty in isolating and harvesting marine bacteria, microbial metabolites are increasingly
attractive to science because of their broad-ranging pharmacological activities, especially those with unique color pigments. This
current review paper gives an overview of the pigmented natural compounds isolated from bacteria of marine origin, based on
accumulated data in the literature. We review the biological activities of marine compounds, including recent advances in the study
of pharmacological effects and other commercial applications, in addition to the biosynthesis and physiological roles of associated
pigments. Chemical structures of the bioactive compounds discussed are also presented.
but also for pharmacologists and clinicians. Laatsch [3] 2.1. Prodiginines. Red-pigmented prodigiosin compounds
described the isolation and description of nearly 250 marine were first isolated from the ubiquitous bacterium Serratia
bacterial metabolites versus 150 isolated from terrestrial marcescens and identified as secondary metabolites. The
bacteria between 2000 and 2005. Research into marine mi- common aromatic chemical structure of these pigmented
croorganisms and their metabolites has therefore become a compounds was first named prodiginine by Gerber [6]
major task in the search for novel pharmaceuticals. (Figure 1). Prodigiosin was the first prodiginine for which
Although many compounds show promising biological the chemical structure was determined [7]. The name
activities, it is difficult to point out any particular bioactive “prodigiosin” has been attributed to the isolation of prodi-
agent that has readily been commercialized as a medicine. giosin from Bacillus prodigiosus bacterium (later renamed
Currently, 13 natural products isolated from marine micro- Serratia marcescens) [8], which was historically famed for
organisms are being tested in different phases of clinical the mysterious “bleeding bread” report [9, 10]. Prodiginines
trials, and a large number of others are in preclinical investi- share a common pyrrolyldipyrromethene core structure
gations [4], thus highlighting the potential of marine natural and have a wide variety of biological properties, including
compounds. antibacterial, antifungal, antimalarial, antibiotic, immuno-
Despite thousands of marine bioactive compounds hav- suppressive, and anticancer activities [9, 11]. Such properties
ing been isolated and identified, in this paper, we will focus potentially make them one of the most powerful research
on the pharmacologically active pigmented compounds pro- tools in the past decade.
duced by marine microorganisms exhibiting in vitro or in There are many research reports and reviews regarding
vivo biological activities. Although pigmented compounds prodiginines and their biological activity investigations. In
produced by terrestrial bacteria are beyond the scope of this addition to the Serratia, several species of marine bacteria
review, specific examples will still be mentioned for com- of the genera Streptomyces [8], Actinomadura [8], Pseu-
parative purposes, to outline common biological activities or domonas [12], Pseudoalteromonas [13–18], and others [19]
because identical pigments were isolated from both types of have also been reported to produce prodigiosin and related
microorganisms. compounds. In particular, Alteromonas denitrificans, which
was isolated from the fjord systems off the west coast of
1.2. Marine Microorganisms and Their Bioactive Isolates. Norway [16] and later reclassified as Pseudoalteromonas deni-
Marine and terrestrial microfloras differ from each other due trificans [20], has been reported to produce cycloprodigiosin.
to the influence of their respective environmental conditions. This compound has immunosuppressive, antimalarial, and
Microorganisms living in the sea must be able to survive apoptosis-inducing activities [18, 21, 22]. Pseudoalteromonas
and grow in the water environment with low nutrition, high rubra, found in the Mediterranean coastal waters [13],
salinity, and high pressure. That is why most bacteria isolated also produces cycloprodigiosin, in addition to prodigiosins
from seawater are Gram-negative rods, as it is postulated that [14, 15]. α-Proteobacteria isolated from a marine tunicate
their outer membrane structure is evolutionarily adapted to collected in Zamboanga, Philippines, was reported to pro-
aquatic environmental factors. Marine microorganisms can duce heptyl prodigiosin. In vitro antimalarial activity against
be divided on the basis of habitat into psychrophiles (living Plasmodium falciparum 3D7 (IC50 = 0.068 mM and SI = 20)
at low temperatures), halophiles (living at high salinity), was about 20 times the in vitro cytotoxic activity against
and barophiles (living under high pressure). Although these L5178Y mouse lymphocytes [23]. In vivo experiments using
characteristics highlight the differences between marine and Plasmodium berghei-infected mice, at concentrations of
terrestrial microorganisms, it remains difficult to separate 5 mg/kg and 20 mg/kg, significantly increased their survival,
bacterial genera on the basis of habitat due to the ubiquitous while also causing sclerotic lesions at the site of injection.
presence of similar species in both environments. As such, Other bacteria reported to produce red pigments include
most bioactive compounds have been isolated from bacteria Hahella [24], Vibrio [25], Zooshikella [26], and Pseudoal-
in both environments. teromonas [17], isolated from the coasts of Korea, Tai-
Marine bacteria, however, are attractive to researchers wan, and Japan. Kim et al. [27] identified red-pigmented
because they can potentially produce compounds with prodiginines from Hahella chejuensis. Nakashima et al. also
unique biological properties [5]. Until now, marine Strep- evaluated the biological activity of similar prodiginines from
tomyces, Pseudomonas, Pseudoalteromonas, Bacillus, Vibrio, a bacterium assumed to belong to the genus Hahella [28].
and Cytophaga isolated from seawater, sediments, algae, and Red pigment-producing bacterial species have further been
marine invertebrates are known to produce bioactive agents. isolated from river water [29, 30] and even from a swimming
They are able to produce indole derivatives (quinones pool [31]. The most active prodiginine derivatives have
and violacein), alkaloids (prodiginines and tambjamines), already entered clinical trials as potential drugs against
polyenes, macrolides, peptides, and terpenoids. Examples of different cancer types [9].
bioactive-pigmented compounds isolated from marine (and Japan is surrounded by sea and has a bordering coastline
some terrestrial) bacteria are discussed below. of the Pacific Ocean in the South and the Sea of Japan in the
North and West, and is consequently rich in marine re-sour-
2. Pigments from Marine Bacteria ces. Therefore, one of the main tasks of our research group
is to investigate the marine environment and its biodiver-
Bioactive pigments from marine bacteria are summarized in sity, especially marine microorganisms and their respective
Table 1. metabolites.
Evidence-Based Complementary and Alternative Medicine 3
Previously, a total of 85 strains of bacteria were isolated cytotoxic pigment among them. Molecular investigations
by our research group from the Pacific Ocean at a depth into the cytotoxic mechanisms of these prodiginine deriva-
of 320 m off Cape Muroto in the Kochi Prefecture of Ja- tives demonstrated effects on caspase-3 activation and DNA
pan. Among them, 13 strains were found to produce a fragmentation, indicating the potential to induce apoptosis
purple pigment and one a red pigment. The red pigment- in leukemia cells.
producing bacterium was later named strain 1020R [32].
Detailed investigations have revealed that this strain is closely 2.2. Carotenes. Carotenes are polyunsaturated hydrocarbons
related to the prodigiosin-producing bacterium Pseudoal- that contain 40 carbon atoms per molecule and are exclu-
teromonas rubra and is Gram-negative with rod-shaped mor- sively synthesized by plants. They are orange photosynthetic
phology. Physicochemical investigations have revealed that pigments important for plant photosynthesis. Recently, an
the pigment produced by this strain contains at least unusual halophilic bacterium, which requires 15–25% salt
seven structurally similar prodiginine compounds. Chemical for its normal growth, was found in Santa Pola near Alicante
structures for four of these were successfully determined, and and on the Balearic island of Mallorca, Spain. It appeared
each only differed by the length of the alkyl chain attached to be red or pink due to a wide variety of isoprenoid com-
to the C-3 position of the C-ring. These compounds were pounds (phytoene, phytofluene, lycopene, and β-carotene)
further identified as prodigiosin and its analogues 2- produced by this prokaryote. Oren and Rodrı́guez-Valera
methyl-3-butyl-prodiginine, 2-methyl-3-pentyl-prodiginine [33] investigated red-pigmented saltern crystallizer ponds in
(prodigiosin), 2-methyl-3-hexyl-prodiginine, and 2-methyl- these areas of Spain and demonstrated that the pigments
3-heptyl-prodiginine. Compound cytotoxicity to U937 were carotenoid or carotenoid-like compounds produced by
leukemia cells was strongly dependent on the length of these halophilic bacteria related to the Cytophaga-Flavobacterium-
alkyl side chains, which decreased with an increase in chain Bacteroides group. Thus, it has been shown that Salinibacter
length. 2-methyl-3-butyl-prodiginine was the most potent is an important component of the microbial community
4 Evidence-Based Complementary and Alternative Medicine
OCH3 OCH3
N N
H H
NH NH
N N
OCH3 OCH3
N N
H H
NH NH
N N
C11 H23
Undecylprodigiosin Cycloprodigiosin
that contributes to the red coloration of Spanish saltern physicochemical characteristics [47]. Later, Gauthier [48]
ponds. described 16 violet-pigmented heterotrophic bacilli isolated
Astaxanthin is one of the carotenoids that have commer- from Mediterranean coastal waters and proposed the name
cial value as a food supplement for humans and as food Alteromonas luteo-violaceus for these strains. Another six
additives for animals and fish (Figure 2). A carotenoid bi- bacterial species were also isolated by Gauthier et al. [49]
osynthesis gene cluster for the production of astaxanthin has from neritic waters on the French Mediterranean coast and
been isolated from the marine bacterium Agrobacterium au- were very similar to Alteromonas species. These species pro-
rantiacum [34]. Recently, another astaxanthin-producing duced characteristic pigmentations ranging from pinkish-
marine bacterium was isolated and identified as Paracoccus beige with reddish-brown diffusible pigment, lemon yellow,
haeundaensis [35]. bright red turning carmine in old cultures, and orange to
greenish-brown. Light violet, dark violet, or almost black
2.3. Violacein. The violet pigment violacein is an indole pigments were also produced and later identified as violacein.
derivative, predominantly isolated from bacteria of the genus The strains showed antibiotic activity against Staphylococcus
Chromobacterium that inhabit the soil and water of tropical aureus [49]. Subsequently, many other reports on violacein
and subtropical areas [36]. Over the past decade, the biosyn- production have been published [50, 51].
thesis and biological activities of violacein have been exten- Several purple pigment-producing Alteromonas species
sively studied, and many scientific papers and reviews have were also isolated from Kinko Bay in Kagoshima Prefecture,
been published [37–41]. Violacein has a variety of biological Japan. One of these, Alteromonas luteoviolacea (reclassified
activities, including antiviral, antibacterial, antiulcerogenic, as Pseudoalteromonas luteoviolacea), is the only extensively
antileishmanial, and anticancer properties [36, 37, 41, 42] characterized marine bacterium ever reported that produces
(Figure 3). Use of violacein as a chemical defense against violacein [48, 52, 53]. Previously, we have also reported 13
eukaryotic predators has also been investigated [43–46]. strains of Gram-negative, rod-shaped bacteria that produce
One of the first published reports on violacein pro- a violacein-like purple pigment, which were isolated from
duction by marine bacteria was by Hamilton and Austin the Pacific Ocean at a depth of 320 m off the coast of
[47]. This bacterial strain, Chromobacterium marinum, was Cape Muroto, Kochi Prefecture, Japan [32]. Among them,
isolated from open ocean waters and produced a blue two groups of novel violacein and deoxyviolacein producing
pigment that was identified as violacein on the basis of marine bacteria were isolated and characterized in detail
Evidence-Based Complementary and Alternative Medicine 5
OH
HO
O
Astaxanthin
Figure 2: Astaxanthin.
OH
O O
HN HN
NH
HN NH HN
O O
Violacein Deoxyviolacein
[50]. Biological investigations of violacein produced by these the tested microorganisms, and methyl saphenate, a known
strains revealed potent cytotoxic effects against U937 and phenazine antibiotic. Li et al. [64] also reported the isolation
HL60 leukemia cell lines, with an IC50 value of 0.5–1 μM. The of a novel phenazine derivative with cytotoxic effects against
molecular mechanisms currently known to be involved in P388 cells, together with six previously identified com-
violacein cytotoxicity include caspases activation, chromatin pounds from the marine Bacillus sp., collected from a Pa-
condensation, and DNA fragmentation, which all contribute cific deep-sea sediment sample at a depth of 5059 m. A
to cell apoptosis. Recently, we also demonstrated that the novel phenazine derivative with antibiotic activity, identified
protein kinases actively involved in the signal transduction as 5,10-dihydrophencomycin methyl ester, along with (2-
pathway are also targeted by violacein. hydroxyphenyl)-acetamide, menaquinone MK9 (II, III, VIII,
IX-H8), and phencomycin, was isolated from an unidentified
2.4. Phenazine Compounds. Phenazines are redox-active, marine Streptomyces sp. by Pusecker et al. [65].
small nitrogen-containing aromatic compounds produced Pyocyanin and 1-hydroxyphenazine also downregulate
by a diverse range of bacterial genera, including Strepto- the ciliary beat frequency of respiratory epithelial cells by
myces (terrestrial), Pseudomonas (ubiquitous), Actinomycetes reducing cAMP and ATP, alter the calcium concentration by
(terrestrial and aquatic), Pelagibacter (aquatic), and Vibrio inhibition of plasma membrane Ca2+ -ATPase, and induce
(aquatic), under the control of quorum sensing [54, 55] death in human neutrophils [60, 61, 66]. Due to the abun-
(Figure 4). These compounds were subjected to extensive dance and biotechnological application of Pseudomonas aer-
studies due to their broad spectrum of antibiotic activities uginosa phenazines, pyocyanin and pyorubrin have also been
against other bacteria, fungi, or plant/animal tissues [56–62]. suggested as food colorant pigments [58].
Phenazine color intensity may vary among the derivatives
and range from blue, green, purple, yellow, red to even brown 2.5. Quinones. Quinones are additional colored compounds
[58, 63]. More than 6,000 phenazine derivatives have been with an aromatic ring structure that have been isolated from
identified and described during the last two centuries [59]. marine environment [67, 68] (Figure 5). Quinone derivatives
Maskey et al. [63] reported the isolation of two yellow range in color from yellow to red, exhibit antiviral, anti-
pigments from the marine Pseudonocardia sp. B6273, a mem- infective, antimicrobial, insecticidal, and anticancer activi-
ber of the Actinomycetes. Structural investigations identified ties, and have many commercial applications as natural and
the two pigments as novel phenazostatin D, inactive against artificial dyes and pigments [69, 70].
6 Evidence-Based Complementary and Alternative Medicine
H3 C OH
COOH
N N
N
N
COOCH3 COOCH3
O OH
N N
N N
CH3
1-hydroxyphenazine
Pyocyanin
COOCH3
H
N
N
H
COOCH3
Streptomyces sp. B6921 strain produced glycosylated M045 [71]. The two chlorine containing quinone derivatives
pigmented anthracycline antibiotics, including fridamycin D were shown not to have antiviral, antimicrobial, and phyto-
and two new compounds, named himalomycin A and B, toxic activities; however, they exhibited antitumor activity
each of which displayed similar levels of strong antibacterial against different human cancer cell lines. Chinikomycin A
activity against Bacillus subtilis, Streptomyces viridochromo- selectively inhibited the proliferation of mammary cancer,
genes (Tü 57), S. aureus, and Escherichia coli. This strain also melanoma, and renal cancer cell lines, while chinikomycin
produced rabelomycin, N-benzylacetamide, and N-(2 - B showed selective antitumor activity against a mammary
phenylethyl) acetamide [68]. Two novel pigmented antitu- cancer cell line [71].
mor antibiotics, chinikomycin A and B, together with manu- Other bacteria, including a marine isolate Pseudomonas
mycin A, were isolated from a marine Streptomyces sp. strain nigrifaciens (later reclassified as Alteromonas nigrifaciens),
Evidence-Based Complementary and Alternative Medicine 7
O
H
N
HN
O
NH
N
H
O
O OH
OH
H3 C
O H3 C OR1
R2 O O
R3 O
OH O O
H3 C
O
CH3 CH3
O O
H3 C O
O H3 C
O O HO
HO
a b c d
Fridamycin D: R1 = H, R2 = a, R3 = b;
Hymalomycin A: R1 = d, R2 = a, R3 = b;
Hymalomycin B: R1 = d, R2 = c, R3 = H
Cl N CH3
OH
O
O
N
H
OH
O
Chinikomycin A
Figure 5: Quinones.
8 Evidence-Based Complementary and Alternative Medicine
CH3
NH
HN
YP1 (Tambjamine)
Figure 6: Tambjamine.
produce the blue pigment indigoidine [72]. Kobayashi et al. bacterial strains described to produce melanin or melanin-
[73] isolated a new violet pigment with an alkylated indi- like pigments [83–86]. The pigment synthesized by Vibrio
goidine structure from Shewanella violacea, a deep-sea bac- cholerae was reported to be a type of allomelanin derived
terium from sediments of Ryukyu Trench at a depth of from homogentisic acid [87]. Melanin formation in V.
5110 m. This pigment was established as 5,5 -didodecylam- cholerae is a consequence of alterations in tyrosine catabolism
ino-4,4 -dihydroxy-3,3 -diazodiphenoquinone-(2,2 ) based and not from the tyrosinase-catalyzed melanin synthetic
on X-ray diffraction analysis of single crystals. It does not pathway. Cellulophaga tyrosinoxydans was reported to have
have antibiotic activity against E. coli; however, it could po- tyrosinase activity and produce a yellow pigment suggested
tentially be used as a dye because of its high stability to be a pheomelanin [88].
and low solubility. Thus, it could be suitable for industrial The most illustrative example of melanin-producing
applications. marine bacteria is the actinomycetes. This is particularly
the case for the genus Streptomyces, from which most com-
2.6. Tambjamines. It has long been noticed that marine pounds with known biological activity have been isolated
bacteria have the ability to prevent biofouling. Holmström [89]. All Streptomyces strains are reported to use tyrosi-
et al. [74] found that, amongst the marine Pseudoalteromonas nases in the synthesis of melanin pigments [90]. Another
species, P. tunicata has the widest range of antibiofouling important melanin-synthesizing bacterium is Marinomonas
activities against microorganisms, including bacteria, inver- mediterranea, which produces black eumelanin from L-
tebrate larvae, algal spores, protozoan, and fungi, and pro- tyrosine [91].
vides protection for host marine organisms. These activities
were linked to the production of unidentified yellow and 2.8. Other Pigmented Compounds. Scytonemin, a yellow-
purple pigments [75]. Recently, this yellow pigment was green pigment isolated from aquatic cyanobacteria, forms
isolated from P. tunicata and was identified as a new member when the bacteria are exposed to sunlight (Figure 7). It
of the tambjamine class of compounds [76]. protects bacteria by preventing about 85–90% of all UV-light
Tambjamines (Figure 6) are alkaloids isolated from var- from entering through the cell membrane [92]. High UV-
ious marine organisms like bryozoans, nudibranchs, and A irradiation inhibited photosynthesis and delayed cellular
ascidians [77–79]. This yellow pigment has also been isolated growth until sufficient amounts of scytonemin had been
from marine bacteria [76]. The tambjamines also exhibit produced by the cyanobacteria. Scytonemin may also have
antibiotic activity against E. coli, Staphylococcus, Vibrio an- anti-inflammatory and antiproliferative activities by inhibit-
guillarum [77], B. subtilis, and Candida albicans [80, 81] ing protein kinase Cβ (PKCβ), a well-known mediator of
and displayed cytotoxic activity against several tumor cell the inflammatory process, and polo-like protein kinase 1
lines [80]. Recently, Pinkerton et al. [80, 82] reported the (PLK1), a regulator of cell cycle progression [93]. In addition,
first total synthesis of nine tambjamines and their antimi- scytonemin inhibited phorbol-induced mouse ear edema
crobial and cytotoxic activities. All of the tested tambjamines and the proliferation of human umbilical vein endothelial
showed antibacterial, antifungal, and cytotoxic effects that cells.
contributed to cell death through apoptosis, but not necrosis. Recently, two γ-Proteobacteria strains of the genus Rhein-
These activities were, however, lesser than the positive con- heimera were isolated from the German Wadden Sea and
trol (doxorubicin) [80]. from Øresund, Denmark that produced a deep blue pigment
[94]. Structural analysis of the pigment revealed that this
2.7. Melanins. Vibrio cholerae, Shewanella colwelliana, and new compound has no similarity with any known blue
Alteromonas nigrifaciens were some of the first marine pigments, like violacein and its derivatives. Due to its blue
Evidence-Based Complementary and Alternative Medicine 9
OH
O
N
N
HO O
Scytonemin
Tryptanthrin
color and marine origin, the new pigment was named verification of specific bacterial pathways has predominantly
glaukothalin (from Greek glaukos “blue” and thalatta “sea”). been due to the antibiotic, immunosuppressive, and anti-
The ecological role and biological activities of glaukothalin cancer potential of these compounds. A brief discussion of
are currently under investigation. this topic is given next, as detailed information is further pro-
AM13,1 strain, which was identified to belong to the vided in the cited references.
Cytophaga/Flexibacteria cluster of North Sea bacteria, was Biosynthesis of bacterial prodiginines has extensively
found to produce yellow tryptanthrin, a rare compound been studied and reviewed [96, 97]. Prodigiosin biosynthesis
that had never before been found in bacteria [95]. This was proposed to originate during the enzymatic condensa-
compound was suggested to be a biocondensation product tion of 2-methyl-3-n-amyl-pyrrole (MAP) and 4-methoxy-
of anthranilic acid and isatin and exhibited a broad yet 2,2 -bipyrrole-5-carbaldehyde (MBC) precursors. Prodigi-
moderate antibiotic activity. Thus, the yellow color of the nine biosynthetic gene clusters for Serratia sp. ATCC 39006
AM13,1 colonies was potentially due to their tryptanthrin
[98], Serratia marcescens ATCC 274 [98], Hahella chejuensis
content. In another yellow cultured Hel21 strain, pigment
KCTC 2396 [27, 99], and Streptomyces coelicolor A3(2) [100]
color may be a consequence of carotenoid zeaxanthin or one
have been identified, sequenced, and expressed. Several gene
of the many vitamin K derivatives (e.g., menaquinone MK6)
[95]. clusters are involved in the biosynthetic pathway, depicted
as pig in Serratia strains, red in S. coelicolor A3(2), and
hap (numbered) in H. chejuensis KCTC 2396, with each
3. Biosynthesis of Pigments
encoding several proteins responsible for synthesis. The
Numerous reports detail the regulation and biosynthesis largest gene cluster found in S. coelicolor A3(2) consists of
of bacterial secondary metabolites. Increased research and four transcriptional units, whereas the other three clusters
10 Evidence-Based Complementary and Alternative Medicine
are strongly homologous to each other and are arranged uni- Fridamycin, hymalomycin, and chinikomycin are typical
directionally. bacterial compounds that share a quinone skeleton. How-
In Serratia strains, pigB–pigE genes were identified to ever, little information regarding the biosynthesis of these
encode proteins responsible for the biosynthesis of MAP compounds has been accumulated.
and condensation with MBC to form prodigiosin [96, 97]. Detection and identification of the entire P. tunicata gene
A common pathway of MBC biosynthesis is proposed for cluster involved in the biosynthetic pathway production of
all strains, in which proline, acetate, serine, and S-adeno- the tambjamine YP1 using recombinant E. coli was con-
sylmethionine are incorporated into the bipyrrole at the ducted by Australian researchers Burke et al. [107]. In total,
initial stage [97]. PigA, PigF, PigG, PigH, PigI, PigJ, PigM, 19 proteins encoded the Tam cluster participate in the postu-
and PigN in Serratia strains and RedE, RedI, RedM, RedN, lated biosynthetic pathway. Among them, 12 were found to
RedO, RedW, RedV, and RedX proteins in S. coelicolor A3(2) have high sequence similarity to the red proteins responsible
have been determined to participate in MBC biosynthesis for undecylprodigiosin synthesis in S. coelicolor A3(2) and
[97]. PigB, PigD, and PigE enzymes in Serratia strains were the pig proteins involved in prodigiosin biosynthesis in
proposed to be involved in the MAP biosynthesis, which Serratia sp. [107]. Such similarity in the chemical structures
requires 2-octenal as the initial precursor [97]. Monopyrroles of these two classes of compounds results in tambjamines
condense with MBC during the final step of prodigiosin having two pyrrole rings while the prodiginines have three.
and/or undecylprodigiosin biosynthesis. PigC and its homo- As is the case for the prodiginines, 4-methoxy-2,2-bipyrrole-
logues catalyze this condensation in bacteria. 5-carbaldehyde (MBC) is initially formed from proline,
Some prodiginines can also be produced when monopy- serine, and malonyl CoA in the tambjamine biosynthetic
rroles are supplied to colorless S. marcescens mutants [8]. pathway. A double bond is inserted by TamT and an amino
Addition of monopyrroles directly to a culture medium or group is transferred by TamH to dodecenoic acid activated
as a vapor across the culture surface of a colorless mutant of by AfaA, which is predicted to be an acyl-CoA synthase. The
S. marcescens resulted in the strain becoming initially pink resulting dodec-3-en-1-amine is condensed with MBC by
and later red, indicating prodiginine formation [8]. Similar TamQ to form tambjamine YP1 [107].
prodiginine biosynthesis produced by exogenously adding In addition to V. cholera, S. colwelliana, A. nigrifaciens,
MAP and MBC was observed in white strains of Serratia and C. tyrosinoxydans, melanin syntheses have also been
marcescens isolated from patients [101]. reported in M. mediterranea, which contains the tyrosinase
gene operon [108], and in an epiphytic Saccharophagus de-
The violacein biosynthesis pathway and associated bi-
gradans 2-40 bacterium [109]. While the specific details of
osynthetic enzymes have been extensively studied [38, 40,
melanin formation continue to be debated, well-defined
102], although certain reactions and intermediates are yet
biosynthetic schemes have now been proposed. Two differ-
to be elucidated. Currently, this proposed system involves an
ent biosynthetic pathways synthesize the eumelanins and
operon of five genes, vioA–vioE, which are transcriptionally
pheomelanins. Both pathways are initiated by the oxidation
regulated by a quorum-sensing mechanism that uses acyl-
of L-tyrosine to 3,4-dihydroxyphenylalanine (DOPA) and
homoserine lactones as autoinducers. At the early stationary
the subsequent creation of dopaquinone by tyrosinase. The
phase of bacterial growth, acylhomoserine lactones accumu-
latter product is transformed either to pheomelanin by com-
late in the culture medium, inducing the transcription of
bining with cystein and forming an intermediate S-cystein-
the vio genes. Therefore, violacein is considered a typical
yldopa and benzothiazine or to eumelanin with intermediate
secondary metabolite in bacteria. The first enzyme encoded
leucodopachrome, dopachrome (red), 5,6-dihydroxyindole,
by the vio gene operon, VioA, converts L-tryptophan to
5,6-indolequinone (yellow) formation [69].
indole-3-pyruvic acid imine (IPA imine), and the second
Nostoc punctiforme ATCC 29133 is the only scytonemin-
enzyme, VioB, catalyzes the reaction to convert IPA imine
producing organism whose genome has been fully sequenced
into an unidentified compound X (possibly an IPA imine
[110]. This scytonemin biosynthesis potentially involves a
dimer) [103, 104]. Compound X then undergoes successive
gene cluster consisting of 18 open reading frames (ORFs)
reactions, catalyzed by the enzymes VioE, VioD, and VioC,
(NpR1276 to NpR1259). Although, the functional roles of
to produce violacein.
all these ORFs are not yet fully determined, some intriguing
Phenazine pigment biosynthesis reportedly involves shi- hypotheses have been proposed. In particular, both tyrosine
kimic acid as a precursor and forms chorismic acid as an and tryptophan are implicated as biosynthetic precursors for
intermediate product. Two molecules of chorismic acid then scytonemin in the pigment formation pathway. NpR1275,
form phenazine-1,6-dicarboxylic acid, which is sequentially which functionally resembles leucine dehydrogenase, is
modified to create a variety of phenazine derivatives with utilized in the early stages of scytonemin synthesis in N.
different biological activities [105]. Pseudomonas aeruginosa punctiforme, thereby oxidizing tryptophan and/or tyrosine to
PAO1 has two gene clusters (phzA1B1C1D1E1F1G1 and their corresponding pyruvic acid derivative.
phzA2B2C2D2E2F2G2), with each cluster capable of pro- Alternatively, it is suggested that NpR1269, a putative
ducing phenazine-1-carboxylic acid (PCA) from chorismic prephenate dehydrogenase, generates p-hydroxyphenylpyr-
acid [106]. It is proposed that PhzM and PhzS catalyze the uvic acid, which is a derivative of tyrosine in the early path-
subsequent conversion of PCA to pyocyanin. In addition, way stages. NpR1276 uses two pyruvic acid derivatives from
PhzH is responsible for producing phenazine-1-carboxamide tryptophan and tyrosine for the synthesis of a labile β-
from PCA. ketoacid product, which is homologous to the thiamin
Evidence-Based Complementary and Alternative Medicine 11
diphosphate- (ThDP-) dependent enzyme acetolactate syn- [69, 93]. Therefore, in order to adapt to the excessive sunlight
thase. NpR1274 possibly catalyzes the intermediate cycliza- and survive under harmful UV irradiation, bacteria must
tion and decarboxylation of the β-ketoacid product to form produce these indispensable compounds. Griffiths et al.
the indole-fused cyclopentane moiety of the pigment [111]. [116] found that carotenoids, which were later suggested
Monomer precursors that are formed then undergo dimer- to be a substitute for sterols, are an important structural
ization to produce scytonemin. NpR1263, which was found component of microbial membranes [117] and may protect
to be similar to a tyrosinase in melanin biosynthesis, par- bacterial cells from photooxidation or damage caused by
ticipates in these later oxidative dimerization steps, thereby visible light irradiation.
forming scytonemin [112]. Functional roles of other ORFs Several bacterial pigments that act as antagonists by
and their putative intermediate products for the pigment exhibiting antibiotic activity against other organisms can be
production are still under investigation. considered as potent weapons for survival and effective
chemical defenses against eukaryotic predators. This class of
4. Concerns regarding the Physiological Role of bioactive agents includes almost all pigmented compounds
Pigmented Compounds commonly produced by Pseudoalteromonas, Pseudomonas,
and Streptomyces species. These compounds inhibit the set-
A number of bacterial species, including those inhabiting tlement of marine invertebrate larvae [118], the germination
the vast marine environment, produce a wide variety of of algal spores [119] and protect the host surface by in-
pigments that are important to cellular physiology and sur- terfering with bacterial colonization and biofilm formation
vival. Many of these natural metabolites were found to have [74]. They may also inhibit other organisms that compete for
antibiotic, anticancer, and immunosuppressive activities. space and nutrients.
These secondary metabolites, produced by microorganisms Such hypotheses are also supported by a number of stud-
mostly via the quorum sensing mechanism, have the ability ies that found that these bacterial compounds were active
to inhibit the growth of or even kill bacteria and other mi- against other prokaryotes and even eukaryotes [120–128].
croorganisms at very low concentrations. Due to such diverse In many studies, pigmented bacterial strains demonstrated
and promising activities against different kinds of diseases, a strong and broad range of antibiotic activities against other
these compounds can play an important role in both phar- organisms, while nonpigmented strains did not [74, 129].
maceutical and agricultural research. A clear correlation between pigment production and anti-
It still remains uncertain why these pigmented secondary bacterial activities of the two Silicibacter sp. strain TM1040
metabolites from bacteria have antibiotic and/or cytotoxic and Phaeobacter strain 27-4 grown under static conditions
activities. Although, their true physiological role is yet to was further reported by Bruhn et al. [129]. Mutant strains,
be fully discovered, there are a few reports that provide which lacked pigment production, also lost their biological
reasonable explanations by making comparisons with non- activities. Holmström et al. have also shown a close relation-
pigmented bacteria. In particular, the relationships between ship between pigmentation and inhibitory activity, whereby
pigment production and toxicity have been studied by Holm- 20 out of 22 dark pigmented bacterial strains tested displayed
ström et al. [113], who found that 90% of all dark-pigmented inhibitory activity against the settlement of two invertebrate
compounds taken from marine living surfaces showed larvae and algal spores [113].
inhibitory activity towards invertebrate larvae. Two fractions
Amongst other bacterial strains, Pseudoalteromonas has
isolated after column chromatography, one colorless and the
the most diverse antibiotic activities against alga biofouling,
other a yellowish-green color, were identified as phenazine
and the dark green pigmented P. tunicata exhibits the most
derivatives from unidentified marine Streptomycete sp. by
active and broadest range of inhibitory activity when com-
Pusecker et al. [65]. The colorless fraction was biologically
pared to other strains from this genus [74]. Two nonpig-
inactive, while the pigmented phenazine derivative showed
mented P. nigrifaciens and P. haloplanktis strains were also
highly active antibiotic properties. Previous studies have
found not to display any antibiotic activities using various
also demonstrated that marine bacterial metabolites with
bioassays [74].
antibiotic properties were always pigmented [114]. Screening
of 38 antibiotic-producing bacterial strains revealed that Blue-pigmented pyocyanin production in P. aeruginosa
all pigmented bacteria belonging to the Pseudomonas- (Pup14B) was observed by Angell et al. to be induced by
Alteromonas group displayed antibiotic activity, while non- Enterobacter species (Pup14A and KM1), and this pyocyanin
pigmented bacteria were inactive. displayed moderate antibiotic activity against E. coli and
Considering data from all reported literature, a number yeast [130]. It was experimentally demonstrated that met-
of reasonable biological functions for pigment production abolites produced by Pup14A strain are necessary for the
in bacteria have been established. In general, the pigmented production of this pigment in Pup14B strain [130]. Many
marine isolates seem to play two important roles: firstly, other reports describe synergism between bacteria and high-
they provide an adaption to environmental conditions, and, er organisms; however, this is a rare example between two
secondly, they provide defense against predators [115]. For bacterial species [131]. Such an unusual case contrasts with
instance, it has been shown that the brown colored melanin the hypothesis of the regulated biodiversity of marine bac-
pigments produced by a variety of species, as well as a yellow- teria, in which surface-associated microorganisms produce
green colored scytonemin pigment isolated from cyanobac- antimicrobial agents [74] to prevent competing microorgan-
teria, protect cells from UV irradiation and desiccation isms. The symbiosis of the two bacterial species is not yet
12 Evidence-Based Complementary and Alternative Medicine
fully understood, although both species appear to benefit the recombinant Citrobacter freundii strain, the genes of
from the pigment production. which were reconstructed from Duganella sp. B2, reached
One of the promising biological activities of marine bac- up to 1.68 g/L, making it fourfold higher than the highest
teria isolates is their cytotoxic effect against cancer cells. De- production previously reported [142]. It is anticipated that
spite many investigations, the exact molecular mechanism these methods will facilitate the production of sufficient
of this pigmented compound cytotoxicity remains undeter- quantities of many bioactive and pharmacologically impor-
mined and requires further study. For example, violacein is tant compounds obtained from bacteria of marine origin.
known to cause apoptosis in tumorous cells [41]. However, These compounds, including prodiginine and violacein, are
the pathways leading to cell death have not yet been linked to now considered as potential drug candidates for potentially
the possible effects of the pigment, which was also shown to fatal diseases such as cancer and malaria. Although further
affect signal transduction agents, such as protein kinase and improvement of culture methods and technologies for
protein phosphatase family enzymes that play crucial role in pigment production including recombinant technology is
cell differentiation and proliferation. necessary, bioactive compounds from marine bacteria may
In a study by Bromberg et al., violacein showed inhibitory potentially replace the existing drugs that have lower thera-
activity against protein phosphatases isolated from human peutic actions.
lymphocytes [132]. A similar study was also conducted by
Fürstner et al. to assess the inhibitory activity of prodigiosin 5. Conclusions
derivatives [133]. Other targets of these compounds, includ-
ing ion channels, are further being investigated [134–137]. Recently, a number of review papers have appeared in the
Unexpected problems have also arisen when investigating literature, and they give an overview of all investigations
marine environments. While the marine environment is a of the marine environment and its isolates. While previous
promising source for identifying microorganisms that can reviews have covered the biological activities of natural
produce important biologically active pigments, yields of products isolated from marine microorganisms [115, 143]
these compounds remain variable and are sometimes too and other living organisms [144, 145], our paper is the first
low to provide enough material for drug development [138] to review the importance of pigmented compounds from
or commercial applications. The main reason for such low marine origin and their potential pharmacological applica-
yields is that these compounds are secondary metabolites and tions.
production depends on the quorum sensing mechanism. Most studies investigating marine microorganisms have
Despite marine bacteria being capable of growing in the shown the efficacy and the potential clinical applications of
extremely low concentrations of nutrients that often exist in pigmented secondary metabolites in treating several diseases.
seawater, most species still require seawater or its equivalent These studies have also emphasized the effects of microbial
as a growth medium for artificial culturing. Seawater is there- metabolites as antibiotic, anticancer, and immunosuppres-
fore used for the growth of marine bacteria, or similar levels sive compounds. Despite the enormous difficulty in isolating
of sodium, potassium, and magnesium chloride are sup- and harvesting marine bacteria, significant progress has
plemented in cultures. Optimal growth and the production been achieved in this field, and investigations of bioactive
of pigments are only sustained for most bacteria when ap- compounds produced by these species are rapidly increasing.
propriate salt mixtures are used for culturing, as is the case As such, the number of compounds isolated from marine
for the prodigiosin-producing marine Pseudomonas magne- microorganisms is increasing faster when compared with
siorubra and Vibrio psychroerythrus, among other marine terrestrial species [95].
species. These bacteria grew optimally and produced red Overall, this review of pigmented marine bioactive com-
pigment when cultured in seawater or its equivalent, while pounds and their pharmacological applications highlights
pigment production by the terrestrial Serratia marcescens was the importance of discovering novel marine bacterial met-
inhibited in 3% sea salts [8]. abolites. Such compounds have a wide variety of biologically
Enhancing low pigment productivity is one of the main active properties and continue to provide promising avenues
issues facing researchers, and some solutions have already for both fundamental sciences and applied biomedical re-
been reported. It is well established that antibiotic produc- search.
tion by bacteria might be regulated both qualitatively and
quantitatively by the nature of the culture medium. In partic- References
ular, the addition of individual natural compounds to nutri-
ent media or the use of gene expression methods was found [1] A. W. Bruckner, “Life-saving products from coral reefs,”
to increase the pigment production far beyond expectations. Issues in Science and Technology, vol. 18, no. 3, p. 35, 2002.
For example, saturated fatty acids, especially peanut broth, [2] P. Hugenholtz and N. R. Pace, “Identifying microbial diver-
sity in the natural environment: a molecular phylogenetic
was found to be a better choice in increasing prodigiosin
approach,” Trends in Biotechnology, vol. 14, no. 6, pp. 190–
production by 40-fold (approximately ∼39 mg/mL) in S. 197, 1996.
marcescens [139]. [3] H. Laatsch, “Marine bacterial metabolites,” 2005, http://
Undecylprodigiosin synthesis by S. marcescens was also wwwuser.gwdg.de/∼ucoc/laatsch/Reviews Books Patents/
markedly enhanced by the addition of vegetable (soybean, R30 Marine BacterialMetabolites.pdf.
olive, and sunflower) oils (2–6% [v/v]) and amino acids to [4] A. M. S. Mayer, K. B. Glaser, C. Cuevas et al., “The odyssey
the fermentation broth [140, 141]. Violacein production by of marine pharmaceuticals: a current pipeline perspective,”
Evidence-Based Complementary and Alternative Medicine 13
Trends in Pharmacological Sciences, vol. 31, no. 6, pp. 255– obtained from Pseudoalteromonas denitrificans,” Biochemical
265, 2010. and Biophysical Research Communications, vol. 237, no. 3, pp.
[5] W. Fenical, “Chemical studies of marine bacteria: developing 543–547, 1997.
a new resource,” Chemical Reviews, vol. 93, no. 5, pp. 1673– [22] H. S. Kim, M. Hayashi, Y. Shibata et al., “Cycloprodigiosin
1683, 1993. hydrochloride obtained from Pseudoalteromonas denitrificans
[6] N. N. Gerber, “Prodigiosin-like pigments from Actinomadura is a potent antimalarial agent,” Biological and Pharmaceutical
(Nocardia) pelletieri and Actinomadura madurae,” Applied Bulletin, vol. 22, no. 5, pp. 532–534, 1999.
Microbiology, vol. 18, no. 1, pp. 1–3, 1969. [23] J. E. Lazaro, J. Nitcheu, R. Z. Predicala et al., “Heptyl prodigi-
[7] H. Rapoport and K. G. Holden, “The synthesis of prodi- osin, a bacterial metabolite, is antimalarial in vivo and non-
giosin,” Journal of the American Chemical Society, vol. 84, no. mutagenic in vitro,” Journal of Natural Toxins, vol. 11, no. 4,
4, pp. 635–642, 1962. pp. 367–377, 2002.
[8] N. N. Gerber, “Prodigiosin-like pigments,” CRC Critical [24] H. K. Lee, J. Chun, E. Y. Moon et al., “Hahella chejuensis gen.
Reviews in Microbiology, vol. 3, no. 4, pp. 469–485, 1975. nov., sp. nov., an extracellular- polysaccharide-producing
[9] N. R. Williamson, P. C. Fineran, T. Gristwood, S. R. marine bacterium,” International Journal of Systematic and
Chawrai, F. J. Leeper, and G. P. C. Salmond, “Anticancer and Evolutionary Microbiology, vol. 51, no. 2, pp. 661–666, 2001.
immunosuppressive properties of bacterial prodiginines,” [25] W. Y. Shieh, Y. W. Chen, S. M. Chaw, and H. H. Chiu,
Future Microbiology, vol. 2, no. 6, pp. 605–618, 2007. “Vibrio ruber sp. nov., a red, facultatively anaerobic, marine
[10] J. W. Bennett and R. Bentley, “Seeing red: the story of bacterium isolated from sea water,” International Journal of
prodigiosin,” Advances in Applied Microbiology, vol. 47, pp. Systematic and Evolutionary Microbiology, vol. 53, no. 2, pp.
1–32, 2000. 479–484, 2003.
[11] B. Montaner and R. Pérez-Tomás, “The prodigiosins: a new [26] H. Yi, Y. H. Chang, H. W. Oh, K. S. Bae, and J. Chun, “Zoo-
family of anticancer drugs,” Current Cancer Drug Targets, vol. shikella ganghwensis gen. nov., sp. nov., isolated from tidal flat
3, no. 1, pp. 57–65, 2003. sediments,” International Journal of Systematic and Evolution-
[12] N. M. Gandhi, J. R. Patell, J. Gandhi, N. J. De Souza, and ary Microbiology, vol. 53, no. 4, pp. 1013–1018, 2003.
H. Kohl, “Prodigiosin metabolites of a marine Pseudomonas [27] D. Kim, J. S. Lee, Y. K. Park et al., “Biosynthesis of antibiotic
species,” Marine Biology, vol. 34, no. 3, pp. 223–227, 1976. prodiginines in the marine bacterium Hahella chejuensis
[13] M. J. Gauthier, “Alteromonas rubra sp. nov., a new marine KCTC 2396,” Journal of Applied Microbiology, vol. 102, no.
antibiotic producing bacterium,” International Journal of 4, pp. 937–944, 2007.
Systematic Bacteriology, vol. 26, no. 4, pp. 459–466, 1976. [28] T. Nakashima, M. Kurachi, Y. Kato, K. Yamaguchi, and
[14] N. N. Gerber and M. J. Gauthier, “New prodigiosin-like pig- T. Oda, “Characterization of bacterium isolated from the
ment from Alteromonas rubra,” Applied and Environmental sediment at coastal area of Omura bay in Japan and several
Microbiology, vol. 37, no. 6, pp. 1176–1179, 1979. biological activities of pigment produced by this isolate,”
[15] D. Fehér, R. S. Barlow, P. S. Lorenzo, and T. K. Hemscheidt, “A Microbiology and Immunology, vol. 49, no. 5, pp. 407–415,
2-substituted prodiginine, 2-(p-hydroxybenzyl)prodigiosin, 2005.
from Pseudoalteromonas rubra,” Journal of Natural Products, [29] D. A. Austin and M. O. Moss, “Numerical taxonomy of red-
vol. 71, no. 11, pp. 1970–1972, 2008. pigmented bacteria isolated from a lowland river, with the
[16] Ø. Enger, H. Nygaard, M. Solberg, G. Schei, J. Nielsen, and description of a new taxon, Rugamonas rubra gen. nov., sp.
I. Dundas, “Characterization of Alteromonas denitrificans sp. nov.,” Journal of General Microbiology, vol. 132, no. 7, pp.
nov.,” International Journal of Systematic Bacteriology, vol. 37, 1899–1909, 1986.
no. 4, pp. 416–421, 1987. [30] M. O. Moss, “A note on a prodigiosin-producing pseu-
[17] T. Sawabe, H. Makino, M. Tatsumi et al., “Pseudoalteromonas domonad isolated from a lowland river,” Journal of Applied
bacteriolytica sp. nov., a marine bacterium that is the causa- Bacteriology, vol. 55, no. 2, pp. 373–375, 1983.
tive agent of red spot disease of Laminaria japonica,” Inter- [31] L. I. Sly and M. H. Hargreaves, “Two unusual budding bacte-
national Journal of Systematic Bacteriology, vol. 48, no. 3, pp. ria isolated from a swimming pool,” Journal of Applied Bacte-
769–774, 1998. riology, vol. 56, no. 3, pp. 479–486, 1984.
[18] C. Yamamoto, H. Takemoto, K. Kuno et al., “Cycloprodi- [32] S. Yada, M. Ohba, K. Enomoto et al., “Analysis of bacterial
giosin hydrochloride, a new H+ /Cl− symporter, induces species in the Muroto deep seawater,” Deep Ocean Water
apoptosis in human and rat hepatocellular cancer cell lines Resources, vol. 4, no. 2, pp. 47–56, 2003 (Japanese).
in vitro and inhibits the growth of hepatocellular carcinoma [33] A. Oren and F. Rodrı́guez-Valera, “The contribution of
xenografts in nude mice,” Hepatology, vol. 30, no. 4, pp. 894– halophilic Bacteria to the red coloration of saltern crystallizer
902, 1999. ponds,” Federation of European Materials Societies Microbiol-
[19] S. M. Lewis and W. A. Corpe, “Prodigiosin-producing bacte- ogy Ecology, vol. 36, no. 2-3, pp. 123–130, 2001.
ria from marine sources,” Applied Microbiology, vol. 12, no. 1, [34] N. Misawa, Y. Satomi, K. Kondo et al., “Structure and func-
pp. 13–17, 1964. tional analysis of a marine bacterial carotenoid biosynthesis
[20] G. Gauthier, M. Gauthier, and R. Christen, “Phylogenetic gene cluster and astaxanthin biosynthetic pathway proposed
analysis of the genera Alteromonas, Shewanella, and Moritella at the gene level,” Journal of Bacteriology, vol. 177, no. 22, pp.
using genes coding for small-subunit rRNA sequences and 6575–6584, 1995.
division of the genus Alteromonas into two genera, Alter- [35] J. H. Lee, Y. S. Kim, T. J. Choi, W. J. Lee, and Y. T. Kim,
omonas (emended) and Pseudoalteromonas gen. nov., and “Paracoccus haeundaensis sp. nov., a Gram-negative, halo-
proposal of twelve new species combinations,” International philic, astaxanthin-producing bacterium,” International Jour-
Journal of Systematic Bacteriology, vol. 45, no. 4, pp. 755–761, nal of Systematic and Evolutionary Microbiology, vol. 54, no.
1995. 5, pp. 1699–1702, 2004.
[21] K. Kawauchi, K. Shibutani, H. Yagisawa et al., “A pos- [36] D. Rettori and N. Durán, “Production, extraction and
sible immunosuppressant, cycloprodigiosin hydrochloride, purification of violacein: an antibiotic pigment produced by
14 Evidence-Based Complementary and Alternative Medicine
Chromobacterium violaceum,” World Journal of Microbiology [52] S. A. MacCarthy, T. Sakata, D. Kakimoto, and R. M. Johnson,
and Biotechnology, vol. 14, no. 5, pp. 685–688, 1998. “Production and isolation of purple pigment by Alteromonas
[37] N. Durán and C. F. M. Menck, “Chromobacterium violaceum: luteoviolacea,” Bulletin of the Japanese Society of Scientific
a review of pharmacological and industiral perspectives,” Fisheries, vol. 51, no. 3, pp. 479–484, 185.
Critical Reviews in Microbiology, vol. 27, no. 3, pp. 201–222, [53] N. J. Novick and M. E. Tyler, “Isolation and characterization
2001. of Pseudoalteromonas luteoviolacea strains with sheathed
[38] C. Sánchez, A. F. Braña, C. Méndez, and J. A. Salas, “Reeval- flagella,” International Journal of Systematic Bacteriology, vol.
uation of the violacein biosynthetic pathway and its relation- 35, no. 1, pp. 111–113, 1985.
ship to indolocarbazole biosynthesis,” ChemBioChem, vol. 7, [54] J. M. Turner and A. J. Messenger, “Occurrence, biochemistry
no. 8, pp. 1231–1240, 2006. and physiology of phenazine pigment production,” Advances
[39] S. Asamizu, Y. Kato, Y. Igarashi, and H. Onaka, “VioE, a in Microbial Physiology, vol. 27, no. C, pp. 211–275, 1986.
prodeoxyviolacein synthase involved in violacein biosynthe- [55] L. S. Pierson and E. A. Pierson, “Metabolism and function of
sis, is responsible for intramolecular indole rearrangement,” phenazines in bacteria: impact on the behavior of bacteria
Tetrahedron Letters, vol. 48, no. 16, pp. 2923–2926, 2007. in the environment and biotechnological process,” Applied
[40] C. J. Balibar and C. T. Walsh, “In vitro biosynthesis of Microbiology and Biotechnology, vol. 86, no. 6, pp. 1659–1670,
violacein from L-tryptophan by the enzymes VioA-E from 2010.
Chromobacterium violaceum,” Biochemistry, vol. 45, no. 51, [56] J. Gibson, A. Sood, and D. A. Hogan, “Pseudomonas aeru-
pp. 15444–15457, 2006. ginosa-Candida albicans interactions: localization and fungal
[41] N. Durán, G. Z. Justo, C. V. Ferreira, P. S. Melo, L. Cordi, and toxicity of a phenazine derivative,” Applied and Environmen-
D. Martins, “Violacein: properties and biological activities,” tal Microbiology, vol. 75, no. 2, pp. 504–513, 2009.
Biotechnology and Applied Biochemistry, vol. 48, no. 3-4, pp. [57] J. B. Laursen and J. Nielsen, “Phenazine natural products:
127–133, 2007. biosynthesis, synthetic analogues, and biological activity,”
[42] C. R. Andrighetti-Fröhner, R. V. Antonio, T. B. Creczynski- Chemical Reviews, vol. 104, no. 3, pp. 1663–1685, 2004.
Pasa, C. R. M. Barardi, and C. M. O. Simões, “Cytotoxicity [58] S. Saha, R. Thavasi, and S. Jayalakshmi, “Phenazine pigments
and potential antiviral evaluation of violacein produced by from Pseudomonas aeruginosa and their application as an-
Chromobacterium violaceum,” Memórias do Instituto Oswaldo tibacterial agent and food colourants,” Research Journal of
Cruz, vol. 98, no. 6, pp. 843–848, 2003. Microbiology, vol. 3, no. 3, pp. 122–128, 2008.
[43] C. Matz, P. Deines, J. Boenigk et al., “Impact of violacein- [59] A. Nansathit, S. Apipattarakul, C. Phaosiri, P. Pongdontri,
producing bacteria on survival and feeding of bacterivorous S. Chanthai, and C. Ruangviriyachai, “Synthesis, isolation
nanoflagellates,” Applied and Environmental Microbiology, of phenazine derivatives and their antimicrobial activities,”
vol. 70, no. 3, pp. 1593–1599, 2004. Walailak Journal of Science and Techology, vol. 6, no. 1, pp.
[44] R. M. Brucker, R. N. Harris, C. R. Schwantes et al., 79–91, 2009.
“Amphibian Chemical defense: antifungal metabolites of the [60] H. Ran, D. J. Hassett, and G. W. Lau, “Human targets of
microsymbiont Janthinobacterium lividum on the salaman- Pseudomonas aeruginosa pyocyanin,” Proceedings of the Na-
der Plethodon cinereus,” Journal of Chemical Ecology, vol. 34, tional Academy of Sciences of the United States of America, vol.
no. 11, pp. 1422–1429, 2008. 100, no. 2, pp. 14315–14320, 2003.
[45] M. H. Becker, R. M. Brucker, C. R. Schwantes, R. N. Harris, [61] G. W. Lau, H. Ran, F. Kong, D. J. Hassett, and D. Mavrodi,
and K. P. C. Minbiole, “The bacterially produced metabolite “Pseudomonas aeruginosa pyocyanin is critical for lung
violacein is associated with survival of amphibians infected infection in mice,” Infection and Immunity, vol. 72, no. 7, pp.
with a lethal fungus,” Applied and Environmental Microbiol- 4275–4278, 2004.
ogy, vol. 75, no. 21, pp. 6635–6638, 2009. [62] M. W. Tan, S. Mahajan-Miklos, and F. M. Ausubel, “Killing
[46] R. N. Harris, R. M. Brucker, J. B. Walke et al., “Skin of Caenorhabditis elegans by Pseudomonas aeruginosa used to
microbes on frogs prevent morbidity and mortality caused model mammalian bacterial pathogenesis,” Proceedings of the
by a lethal skin fungus,” International Society for Microbial National Academy of Sciences of the United States of America,
Ecology Journal, vol. 3, no. 7, pp. 818–824, 2009. vol. 96, no. 2, pp. 715–720, 1999.
[47] R. D. Hamilton and K. E. Austin, “Physiological and cultural [63] R. P. Maskey, I. Kock, E. Helmke, and H. Laatsch, “Isolation
characteristics of Chromobacterium marinum sp. n.,” Antonie and structure determination of phenazostatin D, a new
van Leeuwenhoek, vol. 33, no. 3, pp. 257–264, 1967. phenazine from a marine actinomycete isolate Pseudonocar-
[48] M. J. Gauthier, “Morphological, physiological, and bio- dia sp. B6273,” Zeitschrift für Naturforschung, vol. 58b, no. 7,
chemical characteristics of some violet-pigmented bacteria pp. 692–694, 2003.
isolated from seawater,” Canadian Journal of Microbiology, [64] D. Li, F. Wang, X. Xiao, X. Zeng, Q. Q. Gu, and W. Zhu,
vol. 22, no. 2, pp. 138–149, 1976. “A new cytotoxic phenazine derivative from a deep sea
[49] M. J. Gauthier, J. M. Shewan, D. M. Gibson, and J. V. bacterium Bacillus sp.,” Archives of Pharmacal Research, vol.
Lee, “Taxonomic position and seasonal variations in marine 30, no. 5, pp. 552–555, 2007.
neritic environment of some gram-negative antibiotic-pro- [65] K. Pusecker, H. Laatsch, E. Helmke, and H. Weyland, “Dihy-
ducing bacteria,” Journal of General Microbiology, vol. 87, no. drophencomycin methyl ester, a new phenazine derivative
2, pp. 211–218, 1975. from a marine streptomycete,” Journal of Antibiotics, vol. 50,
[50] S. Yada, Y. Wang, Y. Zou et al., “Isolation and characterization no. 6, pp. 479–483, 1997.
of two groups of novel marine bacteria producing violacein,” [66] R. Wilson, T. Pitt, G. Taylor et al., “Pyocyanin and 1-hydrox-
Marine Biotechnology, vol. 10, no. 2, pp. 128–132, 2008. yphenazine produced by Pseudomonas aeruginosa inhibit the
[51] S. Hakvåg, E. Fjærvik, G. Klinkenberg et al., “Violacein- beating of human respiratory cilia in vitro,” Journal of Clinical
producing Collimonas sp. from the sea surface microlayer of Investigation, vol. 79, no. 1, pp. 221–229, 1987.
costal waters in Trøndelag, Norway,” Marine Drugs, vol. 7, no. [67] M. Akagawa-Matsushita, T. Itoh, Y. Katayama, H. Kuraishi,
4, pp. 576–588, 2009. and K. Yamasato, “Isoprenoid quinone composition of some
Evidence-Based Complementary and Alternative Medicine 15
marine Alteromonas, Marinomonas, Deleya, Pseudomonas synthesis in Vibrio cholerae, a Hyphomonas strain, and She-
and Shewanella species,” Journal of General Microbiology, vol. wanella colwelliana,” Applied and Environmental Microbiol-
138, no. 11, pp. 2275–2281, 1992. ogy, vol. 61, no. 4, pp. 1620–1622, 1995.
[68] R. P. Maskey, E. Helmke, and H. Laatsch, “Himalomycin A [84] C. Ruzafa, A. Sanchez-Amat, and F. Solano, “Characteriza-
and B: isolation and structure elucidation of new fridamycin tion of the melanogenic system in Vibrio cholerae, ATCC
type antibiotics from a marine Streptomyces isolate,” Journal 14035,” Pigment Cell Research, vol. 8, no. 3, pp. 147–152,
of Antibiotics, vol. 56, no. 11, pp. 942–949, 2003. 1995.
[69] P. Z. Margalith, Pigment Microbiology, Chapman & Hall, [85] E. P. Ivanova, E. A. Kiprianova, V. V. Mikhailov et al., “Char-
London, UK, 1992. acterization and identification of marine Alteromonas nigri-
[70] J. Koyama, “Anti-infective quinone derivatives of recent pat- faciens strains and emendation of the description,” Interna-
ents,” Recent Patents on Anti-Infective Drug Discovery, vol. 1, tional Journal of Systematic Bacteriology, vol. 46, no. 1, pp.
no. 1, pp. 113–125, 2006. 223–228, 1996.
[71] F. Li, R. P. Maskey, S. Qin et al., “Chinikomycin A and [86] W. C. Fuqua and R. M. Weiner, “The melA gene is essential
B: isolation, structure elucidation and biological activity for melanin biosynthesis in the marine bacterium Shewanella
of novel antibiotics from a marine Streptomyces sp. isolate colwelliana,” Journal of General Microbiology, vol. 139, no. 5,
M045,” Journal of Natural Products, vol. 68, no. 3, pp. 349– pp. 1105–1114, 1993.
353, 2005. [87] A. Sanchez-Amat, C. Ruzafa, and F. Solano, “Comparative
[72] C. F. Norton and G. E. Jones, “A marine isolate of Pseudo- tyrosine degradation in Vibrio cholerae strains. The strain
monas nigrifacience. II. Characterization of its blue pigment,” ATCC 14035 as a prokaryotic melanogenic model of ho-
Archiv für Mikrobiologie, vol. 64, no. 4, pp. 369–376, 1969. mogentisate-releasing cell,” Comparative Biochemistry and
[73] H. Kobayashi, Y. Nogi, and K. Horikoshi, “New violet 3,3- Physiology—Part B, vol. 119, no. 3, pp. 557–562, 1998.
bipyridyl pigment purified from deep-sea microorganism [88] H. Y. Kahng, B. S. Chung, D. H. Lee, J. S. Jung, J. H. Park,
Shewanella violacea DSS12,” Extremophiles, vol. 11, no. 2, pp. and C. O. Jeon, “Cellulophaga tyrosinoxydans sp. nov., a
245–250, 2007. tyrosinase-producing bacterium isolated from seawater,”
[74] C. Holmström, S. Egan, A. Franks, S. McCloy, and S. Kjel- International Journal of Systematic and Evolutionary Micro-
leberg, “Antifouling activities expressed by marine surface biology, vol. 59, no. 4, pp. 654–657, 2009.
associated Pseudoalteromonas species,” Federation of Euro- [89] W. Fenical and P. R. Jensen, “Marine microorganisms: a new
pean Materials Societies Microbiology Ecology, vol. 41, no. 1, biomedical resource,” in Marine Biotechnology, D. H. Attaway
pp. 47–58, 2002. and O. R. Zaborsky, Eds., pp. 419–457, Plenum Press, New
[75] S. Egan, S. James, C. Holmström, and S. Kjelleberg, “Cor- York, NY, USA, 1993.
relation between pigmentation and antifouling compounds
[90] H. Claus and H. Decker, “Bacterial tyrosinases,” Systematic
produced by Pseudoalteromonas tunicate,” Environmental Mi-
and Applied Microbiology, vol. 29, no. 1, pp. 3–14, 2006.
crobiology, vol. 4, no. 8, pp. 433–442, 2002.
[91] F. Solano, E. Garcı́a, E. P. de Egea, and A. Sanchez-Amat,
[76] A. Franks, P. Haywood, C. Holmström, S. Egan, S. Kjelleberg,
“Isolation and characterization of strain MMB-1 (CECT
and N. Kumar, “Isolation and structure elucidation of a novel
4803), a novel melanogenic marine bacterium,” Applied and
yellow pigment from the marine bacterium Pseudoalteromo-
Environmental Microbiology, vol. 63, no. 9, pp. 3499–3506,
nas tunicata,” Molecules, vol. 10, no. 10, pp. 1286–1291, 2005.
1997.
[77] B. Carté and D. J. Faulkner, “Defensive metabolites from
three nembrothid nudibranchs,” Journal of Organic Chem- [92] P. J. Proteau, W. H. Gerwick, F. Garcia-Pichel, and R. Casten-
istry, vol. 48, no. 14, pp. 2314–2318, 1983. holz, “The structure of scytonemin, an ultraviolet sunscreen
[78] N. Lindquist and W. Fenical, “New tambjamines class alka- pigment from the sheaths of cyanobacteria,” Experientia, vol.
loids from the marine ascidian Atapozoa sp. and its nudi- 49, no. 9, pp. 825–829, 1993.
branch predators. Origin of the tambjamines in Atapozoa,” [93] C. S. Stevenson, E. A. Capper, A. K. Roshak et al., “Scyton-
Experientia, vol. 47, no. 5, pp. 504–506, 1991. emin—a marine natural product inhibitor of kinases key
[79] A. J. Blackman and C. P. Li, “New tambjamine alkaloids from in hyperproliferative inflammatory diseases,” Inflammation
the marine bryozoan Bugula dentate,” Australian Journal of Research, vol. 51, no. 2, pp. 112–114, 2002.
Chemistry, vol. 47, no. 8, pp. 1625–1629, 1994. [94] H.-P. Grossart, M. Thorwest, I. Plitzko, T. Brinkhoff, M.
[80] D. M. Pinkerton, M. G. Banwell, M. J. Garson et al., “Antimi- Simon, and A. Zeeck, “Production of a blue pigment (glauko-
crobial and cytotoxic activities of synthetically derived tamb- thalin) by marine Rheinheimera spp.,” International Journal of
jamines C and E-J, BE-18591, and a related alkaloid from the Microbiology, vol. 2009, Article ID 701735, 7 pages, 2009.
marine bacterium Pseudoalteromonas tunicata,” Chemistry & [95] I. Wagner-Döbler, W. Beil, S. Lang, M. Meiners, and H.
Biodiversity, vol. 7, no. 5, pp. 1311–1324, 2010. Laatsch, “Integrated approach to explore the potential of
[81] A. C. Granato, J. H. H. L. de Oliveira, M. H. R. Seleghim marine microorganisms for the production of bioactive met-
et al., “Produtos naturais da ascidia Botrylloides giganteum, abolites,” Advances in Biochemical Engineering/Biotechnology,
das esponjas Verongula gigantea, Ircinia felix, Cliona delitrix e vol. 74, pp. 207–238, 2002.
do nudibrânquio Tambja eliora, da costa do Brasil,” Quimica [96] N. R. Williamson, H. T. Simonsen, R. A. A. Ahmed et al.,
Nova, vol. 28, no. 2, pp. 192–198, 2005. “Biosynthesis of the red antibiotic, prodigiosin, in Serratia:
[82] D. M. Pinkerton, M. G. Banwell, and A. C. Willis, “Total identification of a novel 2-methyl-3-n-amylpyrrole (MAP)
syntheses of tambjamines C, E, F, G, H, I and J, BE-18591, assembly pathway, definition of the terminal condensing
and a related alkaloid from the marine bacterium Pseudoal- enzyme, and implications for undecylprodigiosin biosynthe-
teromonas tunicata,” Organic Letters, vol. 9, no. 24, pp. 5127– sis in Streptomyces,” Molecular Microbiology, vol. 56, no. 4, pp.
5130, 2007. 971–989, 2005.
[83] S. I. Kotob, S. L. Coon, E. J. Quintero, and R. M. Weiner, [97] N. R. Williamson, P. C. Fineran, F. J. Leeper, and G. P.
“Homogentisic acid is the primary precursor of melanin C. Salmond, “The biosynthesis and regulation of bacterial
16 Evidence-Based Complementary and Alternative Medicine
prodiginines,” Nature Reviews Microbiology, vol. 4, no. 12, pp. Journal of the American Chemical Society, vol. 130, no. 46, pp.
887–899, 2006. 15260–15261, 2008.
[98] A. K. P. Harris, N. R. Williamson, H. Slater et al., “The Serra- [113] C. Holmström, S. James, S. Egan, and S. Kjelleberg, “Inhi-
tia gene cluster encoding biosynthesis of the red antibiotic, bition of common fouling organisms by pigmented marine
prodigiosin, shows species- and strain-dependent genome bacterial isolates with special reference to the role of pig-
context variation,” Microbiology, vol. 150, no. 11, pp. 3547– mented bacteria,” Biofouling, vol. 10, no. 1–3, pp. 251–259,
3560, 2004. 1996.
[99] H. Jeong, J. H. Yim, C. Lee et al., “Genomic blueprint of [114] M. L. Lemos, A. E. Toranzo, and J. L. Barja, “Antibiotic activ-
Hahella chejuensis, a marine microbe producing an algicidal ity of epiphytic bacteria isolated from intertidal seaweeds,”
agent,” Nucleic Acids Research, vol. 33, no. 22, pp. 7066–7073, Microbial Ecology, vol. 11, no. 2, pp. 149–163, 1985.
2005. [115] I. Bhatnagar and S. K. Kim, “Immense essence of excellence:
[100] A. M. Cerdeño, M. J. Bibb, and G. L. Challis, “Analysis marine microbial bioactive compounds,” Marine Drugs, vol.
of the prodiginine biosynthesis gene cluster of Streptomyces 8, no. 10, pp. 2673–2701, 2010.
coelicolor A3(2): new mechanisms for chain initiation and [116] M. Griffiths, W. R. Sistrom, G. Cohen-Bazire, and R. Y.
termination in modular multienzymes,” Chemistry and Biol- Stanier, “Function of carotenoids in photosynthesis,” Nature,
ogy, vol. 8, no. 8, pp. 817–829, 2001. vol. 176, no. 4495, pp. 1211–1214, 1955.
[101] M.-J. Ding and R. P. Williams, “Biosynthesis of prodigiosin [117] S. Rottem and O. Markowitz, “Carotenoids act as reinforcers
by white strains of Serratia marcescens isolated from patients,” of the Acholeplasma laidlawii lipid bilayer,” Journal of Bacte-
Journal of Clinical Microbiology, vol. 17, no. 3, pp. 476–480, riology, vol. 140, no. 3, pp. 944–948, 1979.
1983. [118] C. Holmström, D. Rittschof, and S. Kjelleberg, “Inhibition of
[102] K. Shinoda, T. Hasegawa, H. Sato et al., “Biosynthesis of vio- settlement by larvae of Balanus amphitrite and Ciona intesti-
lacein: a genuine intermediate, protoviolaceinic acid, pro- nalis by a surface-colonizing marine bacterium,” Applied and
duced by VioABDE, and insight into VioC function,” Chem- Environmental Microbiology, vol. 58, no. 7, pp. 2111–2115,
ical Communications, no. 40, pp. 4140–4142, 2007. 1992.
[103] S. Hirano, S. Asamizu, H. Onaka, Y. Shiro, and S. Nagano, [119] S. Egan, S. James, C. Holmström, and S. Kjelleberg, “Inhi-
“Crystal structure of VioE, a key player in the construction bition of algal spore germination by the marine bacterium
of the molecular skeleton of violacein,” Journal of Biological Pseudoalteromonas tunicata,” Federation of European Microbi-
Chemistry, vol. 283, no. 10, pp. 6459–6466, 2008. ological Societies Microbiology Ecology, vol. 35, no. 1, pp. 67–
[104] K. S. Ryan, C. J. Balibar, K. E. Turo, C. T. Walsh, and 73, 2001.
C. L. Drennan, “The violacein biosynthetic enzyme VioE [120] S. Egan, T. Thomas, C. Holmström, and S. Kjelleberg, “Phy-
shares a fold with lipoprotein transporter proteins,” Journal logenetic relationship and antifouling activity of bacterial
of Biological Chemistry, vol. 283, no. 10, pp. 6467–6475, 2008. epiphytes from the marine alga Ulva lactuca,” Environmental
[105] G. S. Byng, D. C. Eustice, and R. A. Jensen, “Biosynthesis Microbiology, vol. 2, no. 3, pp. 343–347, 2000.
of phenazine pigments in mutant and wild-type cultures of [121] R. J. Andersen, M. S. Wolfe, and D. J. Faulkner, “Autotoxic
Pseudomonas aeruginosa,” Journal of Bacteriology, vol. 138, antibiotic production by a marine Chromobacterium,” Ma-
no. 3, pp. 846–852, 1979. rine Biology, vol. 27, no. 4, pp. 281–285, 1974.
[106] D. V. Mavrodi, R. F. Bonsall, S. M. Delaney, M. J. Soule, G. [122] M. J. Gauthier and G. N. Flatau, “Antibacterial activity of
Phillips, and L. S. Thomashow, “Functional analysis of genes marine violet-pigmented Alteromonas with special reference
for biosynthesis of pyocyanin and phenazine-1-carboxamide to the production of brominated compounds,” Canadian
from Pseudomonas aeruginosa PAO1,” Journal of Bacteriology, Journal of Microbiology, vol. 22, no. 11, pp. 1612–1619, 1976.
vol. 183, no. 21, pp. 6454–6465, 2001. [123] C. Holmström and S. Kjelleberg, “The effect of external
[107] C. Burke, T. Thomas, S. Egan, and S. Kjelleberg, “The use of biological factors on settlement of marine invertebrates and
functional genomics for the identification of a gene cluster new antifouling technology,” Biofouling, vol. 8, no. 2, pp.
encoding for the biosynthesis of an antifungal tambjamine in 147–160, 1994.
the marine bacterium Pseudoalteromonas tunicate,” Environ- [124] C. Holmström, P. Steinberg, V. Christov, G. Christie, and S.
mental Microbiology, vol. 9, no. 3, pp. 814–818, 2007. Kjelleberg, “Bacteria immobilised in gels: improved method-
[108] D. López-Serrano, F. Solano, and A. Sanchez-Amat, “Iden- ologies for antifouling and biocontrol applications,” Biofoul-
tification of an operon involved in tyrosinase activity and ing, vol. 15, no. 1–3, pp. 109–117, 2000.
melanin synthesis in Marinomonas mediterranea,” Gene, vol. [125] I. Imai, Y. Ishida, K. Sakaguchi, and Y. Hata, “Algicidal marine
342, no. 1, pp. 179–187, 2004. bacteria isolated from northern Hiroshima Bay, Japan,”
[109] S. K. Kelley, V. E. Coyne, D. D. Sledjeski, W. C. Fuqua, and R. Fisheries Science, vol. 61, no. 4, pp. 628–636, 1995.
M. Weiner, “Identification of a tyrosinase from a periphytic [126] C. Lovejoy, J. P. Bowman, and G. M. Hallegraeff, “Algicidal
marine bacterium,” Federation of European Materials Societies effects of a novel marine Pseudoalteromonas isolate (class
Microbiology Letters, vol. 67, no. 3, pp. 275–279, 1990. Proteobacteria, gamma subdivision) on harmful algal bloom
[110] T. Soule, V. Stout, W. D. Swingley, J. C. Meeks, and F. species of the genera Chattonella, Gymnodinium, and Het-
Garcia-Pichel, “Molecular genetics and genomic analysis of erosigma,” Applied and Environmental Microbiology, vol. 64,
scytonemin biosynthesis in Nostoc punctiforme ATCC 29133,” no. 8, pp. 2806–2813, 1998.
Journal of Bacteriology, vol. 189, no. 12, pp. 4465–4472, 2007. [127] J. S. Maki, D. Rittschof, and R. Mitchell, “Inhibition of larval
[111] E. P. Balskus and C. T. Walsh, “An enzymatic cyclopen- barnacle attachment to bacterial films: an investigation of
tyl[b]indole formation involved in scytonemin biosynthesis,” physical properties,” Microbial Ecology, vol. 23, no. 1, pp. 97–
Journal of the American Chemical Society, vol. 131, no. 41, pp. 106, 1992.
14648–14649, 2009. [128] S. A. Mary, S. V. Mary, D. Rittschof, and R. Nagabhushanam,
[112] E. P. Balskus and C. T. Walsh, “Investigating the initial steps “Bacterial-barnacle interaction: potential of using juncellins
in the biosynthesis of cyanobacterial sunscreen scytonemin,” and antibiotics to alter structure of bacterial communities,”
Evidence-Based Complementary and Alternative Medicine 17
Journal of Chemical Ecology, vol. 19, no. 10, pp. 2155–2167, [145] R. K. Jha and X. Zi-Rong, “Biomedical compounds from
1993. marine organisms,” Marine Drugs, vol. 2, no. 3, pp. 123–146,
[129] J. B. Bruhn, L. Gram, and R. Belas, “Production of antibac- 2004.
terial compounds and biofilm formation by Roseobacter spe-
cies are influenced by culture conditions,” Applied and Envi-
ronmental Microbiology, vol. 73, no. 2, pp. 442–450, 2007.
[130] S. Angell, B. J. Bench, H. Williams, and C. M. H. Watanabe,
“Pyocyanin isolated from a marine microbial population:
synergistic production between two distinct bacterial species
and mode of action,” Chemistry & Biology, vol. 13, no. 12, pp.
1349–1359, 2006.
[131] H. B. Bode, “No need to be pure: mix the cultures!,” Chemis-
try and Biology, vol. 13, no. 12, pp. 1245–1246, 2006.
[132] N. Bromberg, G. Z. Justo, M. Haun, N. Durán, and C. V. Fer-
reira, “Violacein cytotoxicity on human blood lymphocytes
and effect on phosphatases,” Journal of Enzyme Inhibition and
Medicinal Chemistry, vol. 20, no. 5, pp. 449–454, 2005.
[133] A. Fürstner, K. Reinecke, H. Prinz, and H. Waldmann, “The
core structures of roseophilin and the prodigiosin alkaloids
define a new class of protein tyrosine phosphatase inhibitors,”
ChemBioChem, vol. 5, no. 11, pp. 1575–1579, 2004.
[134] T. Sato, H. Konno, Y. Tanaka et al., “Prodigiosins as a new
group of H+ /Cl− symporters that uncouple proton translo-
cators,” Journal of Biological Chemistry, vol. 273, no. 34, pp.
21455–21462, 1998.
[135] S. Ohkuma, T. Sato, M. Okamoto et al., “Prodigiosins uncou-
ple lysosomal vacuolar-type ATPase through promotion of
H+ /Cl− symport,” Biochemical Journal, vol. 334, no. 3, pp.
731–741, 1998.
[136] J. L. Seganish and J. T. Davis, “Prodigiosin is a chloride
carrier that can function as an anion exchanger,” Chemical
Communications, no. 46, pp. 5781–5783, 2005.
[137] K. Kawauchi, K. Tobiume, K. Iwashita et al., “Cycloprodi-
giosin hydrochloride activates the Ras-PI3K-Akt pathway
and suppresses protein synthesis inhibition-induced apopto-
sis in PC12 cells,” Bioscience, Biotechnology and Biochemistry,
vol. 72, no. 6, pp. 1564–1570, 2008.
[138] D. S. Bhakuni and D. S. Rawat, Bioactive Marine Natural
Products, Springer, New York, NY, USA, 2005.
[139] A. V. Giri, N. Anandkumar, G. Muthukumaran, and G. Pen-
nathur, “A novel medium for the enhanced cell growth and
production of prodigiosin from Serratia marcescens isolated
from soil,” BMC Microbiology, vol. 4, no. 11, pp. 1–10, 2004.
[140] Y.-H. Wei and W. C. Chen, “Enhanced production of
prodigiosin-like pigment from Serratia marcescens SMΔR by
medium improvement and oil-supplementation strategies,”
Journal of Bioscience and Bioengineering, vol. 99, no. 6, pp.
616–622, 2005.
[141] Y.-H. Wei, W.-J. Yu, and W.-C. Chen, “Enhanced unde-
cylprodigiosin production from Serratia marcescens SS-1
by medium formulation and amino-acid supplementation,”
Journal of Bioscience and Bioengineering, vol. 100, no. 4, pp.
466–471, 2005.
[142] P. X. Jiang, H. S. Wang, C. Zhang, K. Lou, and X. H. Xing,
“Reconstruction of the violacein biosynthetic pathway from
Duganella sp. B2 in different heterologous hosts,” Applied
Microbiology and Biotechnology, vol. 86, no. 4, pp. 1077–1088,
2010.
[143] A. Debbab, A. H. Aly, W. H. Lin, and P. Proksch, “Bioactive
compounds from marine bacteria and fungi,” Microbial
Biotechnology, vol. 3, no. 5, pp. 544–563, 2010.
[144] J. W. Blunt, B.-R. Copp, W. P. Hu, M. H. G. Munro, P. T.
Northcote, and M. R. Prinsep, “Marine natural products,”
Natural Product Reports, vol. 26, no. 2, pp. 170–244, 2009.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 824104, 7 pages
doi:10.1155/2011/824104
Research Article
Bacillus amyloliquefaciens G1: A Potential Antagonistic
Bacterium against Eel-Pathogenic Aeromonas hydrophila
Haipeng Cao,1 Shan He,2 Ruopeng Wei,3 Marek Diong,1 and Liqun Lu1
1 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources of Ministry of Education,
Aquatic Pathogen Collection Center of Ministry of Agriculture, Shanghai Ocean University, Shanghai 201306, China
2 Education Department, Shanghai Normal University, Shanghai 200235, China
3 Technology Department, Shanxi Veterinary Drug and Feed Engineering Technology Research Center, Yuncheng 044000, China
Recent studies have revealed that the use of probiotics is an alternative to control marine aeromonas. However, few probiotics
are available against Aeromonas hydrophila infections in eels. In the present study, a potential antagonistic strain G1 against the
eel-pathogenic A. hydrophila was isolated from sediment underlying brackish water. Its extracellular products with antibacterial
activities were shown to be stable under wide range of pH, temperature, and proteinase K. It was initially identified as Bacillus
amyloliquefaciens using API identification kits and confirmed to be B. amyloliquefaciens strain (GenBank accession number
DQ422953) by phylogenetic analysis. In addition, it was shown to be safe for mammalians, had a wide anti-A. hydrophila spectrum,
and exhibited significant effects on inhibiting the growth of the eel-pathogenic A. hydrophila both in vitro and in vivo. To the best
of our knowledge, this is the first report on a promising antagonistic Bacillus amyloliquefaciens strain from brackish water sediment
against eel-pathogenic A. hydrophila.
lawn cell plates. Zones of inhibition were recorded on A. purified water. Mice were examined daily and any signs of
hydrophila lawn culture plates. disease and mortality were recorded up to 14 days. The 50%
lethal dose (LD50 ) was determined according to Mittal et al.
2.5.3. Thermal Stability Assay. The analysis on the thermal [17].
stability of ECPs was examined as described by Lee et al.
[16]. Briefly, the 10 mg of ECPs was treated independently at 2.9. In Vivo Protection Test. Ninety Anguilla anguilla (L.),
20, 40, 60, 80, and 100◦ C for 30 min. Then each treatment weighing 90–100 g each, were allowed to acclimatize for 7
sample was applied to A. hydrophila strain ZN1 lawn cell days and were randomly placed in three 200 L tanks (10
plates. Zones of inhibition were recorded on A. hydrophila fish per tank, three tank per group) for the three treatments
lawn culture plates. (the control, low cell density, and high cell density groups)
described below. The tanks used recycled brackish water
2.5.4. Enzyme Stability Assay. The 10 mg of ECPs was digest- that was kept at 28◦ C throughout the experiment. The
ed with 15 μL of proteinase K (974 U/mL) (Shanghai Sangon isolate’s suspension was prepared as mentioned above and
Biological Engineering Technology and Services Co. Ltd.) at its cell densities were determined. Under sterile conditions,
30◦ C for 2 h. Then the processed sample was applied to A. the isolate was manually incorporated into commercial dry
hydrophila strain ZN1 lawn cell plates. Zones of inhibition pellets at rates of 3 × 107 and 3 × 109 cfu/g in feed for low
were recorded on A. hydrophila lawn culture plates. and high cell densities of the isolate diets, respectively. Fish
fed only commercial dry pellets served as a control. Fish
2.6. In Vitro Pathogen Growth Inhibition Assay. The assay was were fed approximately 1% of body weight once a day. Two
carried out in twelve 250 mL glass flask supplied with 98 mL weeks after feeding, all the fish were bath-challenged with
of brackish water NB medium, and each treatment consisted skin scarification through exposure to A. hydrophila strain
of three flasks. In each flask, 1 mL of the isolate’s suspen- ZN1 with a final cell density of 109 cfu/mL as recommended
sion with a final cell density of 103 cfu/mL, 104 cfu/mL, by Schadich and Cole [18]. Briefly, all the fish were skin
105 cfu/mL, and 1 mL of the A. hydrophila suspension with a scarified, the skin scarified fish in the low cell density and
final cell density of 103 cfu/mL were independently inoculat- high cell density groups were exposed to the suspension
ed in 98 mL of brackish water NB medium, then the mixtures of A. hydrophila strain ZN1 overnight, while the skin
were incubated at 30◦ C with shaking at 200 rpm. The control scarified fish were exposed individually to brackish water
group consisted of A. hydrophila strain only. Cell growth of only. After the bacterial exposure, the fish were returned to
A. hydrophila was measured using brackish water RS medium their living containers. Dead fish were immediately removed
(Beijing Land Bridge Technology Co. Ltd.) at 24 h intervals. for pathogen isolation as described by Bucke [19], and
mortalities were recorded each day for 14 days following the
immersion challenge.
2.7. Antagonistic Spectrum Assay. Eight pathogenic strains of
A. hydrophila (ATCC7966, X1, S1, T3, R402L, RK1119, 706C,
and 40142G) were obtained from National Collection Centre 2.10. Statistical Analysis. Data were presented as the mean ±
for Aquatic Pathogens, China. The antagonistic spectrum of standard deviation (SD) for the indicated number of inde-
the isolate was checked against the eight pathogenic A. pendently performed experiments. P < 0.05 was considered
hydrophila strains by the paper disc method [13]. The antag- statistically significant using one-way analysis of variance.
onistic activity against A. hydrophila strain ZN1 was served as
the control. Zones of inhibition were observed and recorded 3. Results
on A. hydrophila lawn culture plates after two days of incu-
bation at 30◦ C. 3.1. Isolation of Marine Antagonistic Strains. A total of 45
bacteria were isolated from the brackish water sediment sam-
2.8. Virulence Assay. Hemolytic activity assay was carried ples. Only one isolate, named G1, was found to exhibit strong
out with brackish water rabbit blood agar (RBA) plates antagonistic activity to the eel-pathogenic A. hydrophila
(Sinopharm Chemical Reagent Co., Ltd.) at 30◦ C for 2 days. strain ZN1, displaying inhibition zones of 15 mm (data
Virulence was further assayed in mice. Briefly, four-week- not shown). According to Lategan et al. [20], zones of
old female BALB/c mice, weighing 20 g each, were obtained inhibition >12 mm against A. hydrophila were considered as
from Laboratory Animal Centre of Second Military Medical susceptibility to the isolates. Thus, isolate G1 was chosen for
University, Shanghai. Mice were lightly anesthetized with further study.
Halothane (Sinopharm Chemical Reagent Co., Ltd.) in a
glass desiccator and challenged with the isolate’s suspension 3.2. Characterization and Identification. The API identifica-
prepared as mentioned above. The isolate’s suspension was tion kits identified isolate G1 as Bacillus amyloliquefaciens
orally administered at the final cell density of 105 , 106 , 107 , (data not shown), and it showed an identity of 94% with
108 , and 109 cfu/g through a micropipette fitted with a fine the type strain ATCC23350 in phenotypic characterization.
micropipette tip and thin flexible tube. The control mice Isolate G1 and the type strain ATCC23350 were found
were orally administered with the autoclaved brackish water both positive for glycerin, L-Arabinose, D-Ribose, D-Xylose,
NB medium. Ten mice were tested in each dilution. The mice D-Galactose, D-Glukose, D-Fructose, D-Mannose, inosi-
were housed in cages at 20–25◦ C, fed with the pellet feed and tol, D-Mannitol, D-Sorbitol, Methyl-αD-Glucopyranoside,
4 Evidence-Based Complementary and Alternative Medicine
0.0005
amygdalin, arbutin, esculin, salicin, D-Cellobiose, D-Mal- retained over the wide pH range of 5.0 to 9.0 against A.
tose, D-Lactose, D-Melibiose, D-Saccharose, D-Trehalose, hydrophila strain ZN1, and it was also thermally stable at up
D-Melezitose, D-Raffinose, amidon, glycogen, and gentio- to 100◦ C for 30 min, both showing no significant difference
biose. However, there were some differences between isolate between the inhibition zones (data not shown). In addition,
G1 and the type strain ATCC23350. For example, in contrast the antagonistic activity of the ECPs was still retained with
to the type strain ATCC23350, isolate G1 was unable to proteinase K treatment, forming a clear zone on the A.
ferment inulin. hydrophila lawn culture plate (data not shown). The results
The 1.5 kb 16S rRNA sequence of isolate G1 was sub- indicated that the antagonistic substance in the ECPs was sta-
mitted to GenBank database with the accession number ble under wide range of pH, temperature, and proteinase K.
HM245965. Similarities between the 16S rRNA sequence of
isolate G1 and those of B. amyloliquefaciens strains in 3.4. In Vitro Growth Inhibition Effect. The in vitro effect
the GenBank database were 99.0%, which proved the ini- of isolate G1 on the growth inhibition of A. hydrophila
tial identification. The constructed phylogenetic tree using strain ZN1 was shown in Figure 2. The cell density of A.
neighbor-joining method further demonstrated that isolate hydrophila was significantly lower than that in the control
G1 was closely related to the B. amyloliquefaciens strain (Gen- when isolate G1 was inoculated at the final cell density of
Bank accession number DQ422953) (Figure 1). The identifi- 103 to 105 cfu/mL, and the logarithms of the cell density of
cation result from phylogenetic analysis was consistent with A. hydrophila were, respectively, reduced by 32.65%, 47.28%,
that found through API identification kits. and 59.49% after the incubation of 96 h, compared with the
control group. The result indicated that isolate G1 could be
3.3. Physicochemical Properties of the Extracellular Products. used for exclusion of A. hydrophila.
The ECPs were obtained from the supernatant (pH 8.5)
of isolate G1 with ethyl acetate. The ECPs could inhibit 3.5. Antagonistic Activity against Aeromonas hydrophila
the growth of the eel-pathogenic A. hydrophila, creating the Strains. The antagonistic activity against the eight pathogen-
clear inhibition zone on the A. hydrophila lawn culture plate ic A. hydrophila strains was shown in Figure 3. The result
(data not shown). The antagonistic activity of the ECPs was indicated that isolate G1 had highly antagonistic activity
Evidence-Based Complementary and Alternative Medicine 5
10 60
9
50
Logarithm of cell density
40
6
5 30
4
3 20
2
1 10
0
0 24 48 72 96 0
Incubation time (h) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
−10 Day after challenge
A C
B D Control
Figure 2: Inhibitory effect of srain G1 at the final cell density of Low cell density
103 cfu/mL (A), 104 cfu/mL (B), 105 cfu/mL (C), and 0 cfu/mL (D) High cell density
on the growth of the eel-pathogenic A. hydrophila. Figure 4: Protective effect of srain G1 on Anguilla anguilla (L.)
under the eel-pathogenic A. hydrophila challenge trial.
25
S1
X1
ZN1
T3
R402L
RK1119
706C
40142G
A. hydrophila strain ZN1 (data not shown), and the inhibi- K, and its safety to the mammalian system, supported this
tory activity of the ECPs was not significantly affected under strain as a promising probiotic for the biocontrol of A.
wide range of pH, temperature, and proteinase K. Relevant hydrophila infections in A. anguilla (L.).
studies indicated that the antagonistic action responsible
for the inhibition of bacterial pathogens such as Erwinia Acknowledgments
amylovora, Ralstonia solanacearum was due to difficidin,
bacilysin, or a 29 kDa fusion protein of the LCI gene [21, This work has been financially supported by Key Laboratory
22]. The production of antibiotic substance by isolate G1 of Aquatic Genetic Resources and Utilization of Ministry
might be one of these important inhibiting agents. To clarify of Agriculture, China, the earmarked fund for Modern
this, further characterization of the inhibitory component of Agro-industry Technology Research System and the Program
isolate G1 would be necessary. In addition, the inhibitory for Professor of Special Appointment (Eastern Scholar) at
activity of the ECPs of isolate G1 even after treatment Shanghai Institutions of Higher Learning.
at high temperatures (data not shown) and proteinase K
(data not shown) suggested the stability of the antagonistic References
component. Similar observations were also recorded by Hu
et al. [22], who reported that the antibacterial activity of [1] W. C. Lee, Y. H. Chen, and I. C. Liao, “The competitiveness of
the active fractions of B. amyloliquefaciens isolate Bg-C31 the eel aquaculture in Taiwan, Japan, and China,” Aquaculture,
was not affected at 100◦ C and proteinase K. The property vol. 221, no. 1–4, pp. 115–124, 2003.
[2] B. S. Dezfuli, C. Szekely, G. Giovinazzo, K. Hills, and L. Giari,
of thermal stability would be useful during industrial level
“Inflammatory response to parasitic helminths in the digestive
production. tract of Anguilla anguilla (L.),” Aquaculture, vol. 296, no. 1-2,
For application of isolate G1 as a probiotic during routine pp. 1–6, 2009.
hatchery operations and natural A. hydrophila infections, the [3] H. Daskalov, “The importance of Aeromonas hydrophila in
data on the effect of inhibiting the growth of A. hydrophila food safety,” Food Control, vol. 17, no. 6, pp. 474–483, 2006.
were essential. The present study indicated that isolate G1 [4] H. P. Fan, “New diseases and control techniques in the eel
could significantly reduce the cell density of A. hydrophila farming,” Scientific Fish Farming, vol. 7, pp. 49–50, 2007.
by 32.65%, 47.28%, and 59.49% after the inoculation at the [5] R. Harikrishnan, C. Balasundaram, and M. Heo, “Effect of
final cell density of 103 to 105 cfu/mL, respectively (Figure 2), probiotics enriched diet on Paralichthys olivaceus infected
and produced a maximum inhibition zone with 18.5 mm with lymphocystis disease virus (LCDV),” Fish & Shellfish
on A. hydrophila lawn culture plates (Figure 3). In a related Immunology, vol. 29, pp. 868–874, 2010.
[6] M. A. A. Al-Fatimi, W. D. Jülich, R. Jansen, and U. Lindequist,
study on the antibacterial activity of Bacillus sp., Bacillus
“Bioactive components of the traditionally used mushroom
subtilis strain P73 and strain P72 only exhibited a maximum Podaxis pistillaris,” Evidence-Based Complementary and Alter-
inhibition zone with 14.5 mm on A. hydrophila lawn culture native Medicine, vol. 3, no. 1, pp. 87–92, 2006.
plates [23]. Therefore, isolate G1 might be considered as a [7] J. L. Balcázar, I. Blas, I. R. Ruiz-Zarzuela, D. Cunningham, D.
stronger antagonistic bacterium. Vendrell, and J. L. Múzquiz, “The role of probiotics in aqua-
In order to be considered as a probiotic for application, culture,” Veterinary Microbiology, vol. 114, no. 3-4, pp. 173–
the candidate strain had to be evaluated for its pathogenicity 186, 2006.
to a mammalian system and protective effect [24]. The [8] S. Das, L. R. Ward, and C. Burke, “Prospects of using marine
present study showed that isolate G1 could not form any actinobacteria as probiotics in aquaculture,” Applied Microbi-
hemolytic rings on the RBA plates (data not shown), and the ology and Biotechnology, vol. 81, no. 3, pp. 419–429, 2008.
LD50 value to BALB/c mice exceeded 109 cfu/g. As described [9] H. Sugita, Y. Hirose, N. Matsuo, and Y. Deguchi, “Production
of the antibacterial substance by Bacillus sp. strain NM 12,
by Cutting [25], the Bacillus strain was regarded as no infec-
an intestinal bacterium of Japanese coastal fish,” Aquaculture,
tivity or toxicity when its oral LD50 value to mice is above 4.7
vol. 165, no. 3-4, pp. 269–280, 1998.
× 108 cfu/g. Thus, isolate G1 was evaluated as a safe strain. [10] Y. Sun, H. Yang, R. Ma, and W. Lin, “Probiotic applications
Supplementation of Saccharomyces cerevisiae has been used of two dominant gut Bacillus strains with antagonistic activity
to control Aeromonas hydrophila infection in Oreochromis improved the growth performance and immune responses of
niloticus (L.) [26], but no relevant data are available about grouper epinephelus coioides,” Fish and Shellfish Immunology,
antagonistic bacteria against A. hydrophila infection in eels. vol. 29, pp. 803–809, 2010.
The present study indicated that supplementation of isolate [11] B. K. Das, S. K. Samal, B. R. Samantaray, S. Sethi, P. Pattnaik,
G1 could significantly reduce the cumulative mortality and B. K. Mishra, “Antagonistic activity of cellular compo-
of Anguilla anguilla (L.) challenged with A. hydrophila nents of Pseudomonas species against Aeromonas hydrophila,”
(Figure 4), confirming the protective effect of isolate G1 Aquaculture, vol. 253, pp. 17–24, 2006.
against A. hydrophila infection in eels. [12] H. Gong, T. L. Lin, C. A. Xu, X. P. Zhang, and X. L.
Yang, “Purification of aerolysin of Aeromonas hydrophila by
In conclusion, the unique characteristics of B. amyloliq-
affinity chromatography and analysis of its hemolytic activity,”
uefaciens G1, such as the antibacterial property towards a Chinese Journal of Zoonoses , vol. 25, no. 5, pp. 422–426, 2009.
wide spectrum of pathogenic A. hydrophila strains, the sig- [13] K. K. Vijayan, I. S. Bright Singh, N. S. Jayaprakash et al.,
nificant growth inhibition effect on the eel-pathogenic A. “A brackishwater isolate of pseudomonas PS-102, a potential
hydrophila, the protective effect against A. hydrophila infec- antagonistic bacterium against pathogenic vibrios in penaeid
tion in Anguilla anguilla (L.), resistance of its extracellular and non-penaeid rearing systems,” Aquaculture, vol. 251,
products to a wide range of pH, temperatures, and proteinase no. 2–4, pp. 192–200, 2006.
Evidence-Based Complementary and Alternative Medicine 7
Research Article
Enhanced Antitumoral Activity of Extracts Derived from
Cultured Udotea flabellum (Chlorophyta)
Very few studies have been performed to evaluate the effect of culture conditions on the production or activity of active metabolites
in algae. Previous studies suggest that the synthesis of bioactive compounds is strongly influenced by irradiance level. To investigate
whether the antiproliferative activity of Udotea flabellum extracts is modified after cultivation, this green alga was cultured under
four photon flux densities (PFD) for 30 days. After 10, 20, and 30 days, algae were extracted with dichloromethane: methanol and
screened for antiproliferative activity against four human cancer cell lines (laryngeal—Hep-2, cervix—HeLa, cervix squamous—
SiHa and nasopharynx—KB) by SRB assay. Lipid and phenol content were evaluated by standardized methods on algae organic
extracts. After 10 days of cultivation, organic U. flabellum extracts showed a significant increase in antiproliferative activity on Hela
and SiHa cells when compared to noncultured algae extracts. Extracts obtained after 10 and 20 days of culture were active on KB
and Hep-2 cells. Total phenol and polyunsaturated fatty acid content in organic extracts changed with cultivation time but not by
irradiance treatment. Extracts from U. flabellum obtained after 10 and 20 days of culture have been selected for fractionation and
isolation of active compounds.
A C
2. Materials and Methods B D
2.1. Alga Collection and Culture Conditions. Udotea flabellum Figure 1: Photon flux density during cultivation of U. flabellum.
(J. Ellis and Solander) M. A. Howe were collected along (A) full sunlight (100 %), (B) 75 % sunlight, (C) 50 % sunlight, and
the YUC Peninsula coast, Mexico, stored in plastic bags and (D) 0 % sunlight. Asterisk indicates significant differences.
chilled in ice during transport to the Cinvestav Marine Sta-
tion at Telchac, Yucatan, Mexico. Algae were cultivated under
four light treatments: full (100%) sunlight, 75% sunlight, sulforhodamine B (SRB) and trichloroacetic acid (TCA)
50% sunlight, and 0% sunlight, designated treatment A, B, were obtained from Sigma.
C, and D, respectively. Agricultural greenhouse shade net
was used in order to obtain variable light intensities in the 2.4. Cell Culture. The following cell lines were used for the
culture system. Light intensity varied over cultivation time: antiproliferative assays: normal Mardin-Darbin cell kidney
during the first 10 days, the photon flux density (PFD) in full (MDCK), and four human carcinoma cells, namely, laryn-
sunlight and 75% sunlight treatments were not significantly geal (Hep-2), cervix (HeLa), cervix squamous (SiHa) and
different (one-way ANOVA, F[3, 36] = 68.21, P < 0.0001; nasopharynx (KB). The cells were grown in DMEM media
post hoc Tukey’s test P < 0.0001) at 55 ± 12.9 and 65 ± supplemented with 10% v/v fetal bovine serum (FBS) with
12.5 μmol photon m−2 s−1 , respectively, while 50, and 0% 100 U mg mL−1 of PS. Cell lines were maintained at 37◦ C in
treatments received 60, and 3% of incident PFD, respectively a 5% CO2 atmosphere with 95% humidity, and the culture
(42 ± 12.0 and 2 ± 0.7 μmol photon m−2 s−1 ). After 20 and medium was changed once every 5 days.
30 days of cultivation, a similar trend was registered, with
the 75% treatment receiving 75–100% of incident PFD and 2.5. Cytotoxicity Assay. The cytotoxicity assay was performed
the 50% treatment receiving 42–52%; the 0% treatment only according to Rahman et al. [16], where 1.5 × 104 viable
received 2% of incident PFD (Figure 1). cells from each cell line were seeded in a 96-well plate
and incubated for 24 to 48 h. When cells reached >80 %
2.2. Preparation of Extracts. Freshly collected samples of the confluence, the medium was replaced and the cells were
wild material were lyophilized and ground into powder to treated with the organic extracts dissolved in dimethyl
perform plant extraction protocols and analytical methods; sulfoxide (DMSO at a maximum concentration of 0.05%)
this material was considered as a control before cultivation at 6.25, 12.5, 25, and 50 μg mL−1 . After 72 h of incubation,
(time 0). Entire plants (n = 15) were taken from each 10 μL of MTT solution (5 mg mL−1 ) was added to each well
culture treatment—A, B, C, and D—at 10, 20, and 30 days and incubated at 37◦ C for 4 h. The medium was removed and
into the experimental period to perform organic extraction formazan, generated by the activity of dehydrogenases, was
and analysis. Lyophilized samples (20 g) were exhaustively dissolved in acidified isopropanol (0.4 N HCl). The amount
extracted with 200 mL of dichloromethane: methanol (7 : 3) of MTT-formazan generated is directly proportional to the
by maceration for 24 h at room temperature. These extracts number of living cells and was determined by measuring
were filtered and concentrated to dryness in vacuum at 40◦ C the optical density (OD) at 540 nm using a Bio-assay reader
and stored at −20◦ C until required. Every extract was labeled (BioRad, USA). Untreated cells were used as a negative
according to culture conditions: light intensity (A, B, C, or control. The concentration of the organic extract that killed
D) and time (10, 20, and 30 days). 50% of the cells (CC50 ) was calculated with GraphPad-
PRISM 4.00 software. All determinations were performed in
2.3. Chemicals. Dulbecco’s Modified Eagle’s Medium triplicate.
(DMEM), heat-inactivated fetal bovine serum (FBS) and
penicillin and streptomycin (PS) were purchased from 2.6. Antiproliferative Assay. For the antiproliferative assay, we
Gibco, USA. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tet- used sulforhodamine B (SRB), a colorimetric assay which
razolium bromide (MTT), Dimethyl sulfoxide (DMSO), estimates cell number by staining total cellular protein with
Evidence-Based Complementary and Alternative Medicine 3
the SRB dye, in order to assess cell growth inhibition [16]. were carried out in duplicate, and the results expressed as
This method used the same conditions as the cytotoxic assay percentages of algae extract dry weight (% dry wt).
except that the medium was replaced with DMEM 10% FBS
to induce cellular proliferation during extract treatments. 2.9. Statistical Analysis. Data were analyzed with GraphPad
After 48 h incubation, the medium was discarded and cells 4.0 Software Inc. (San Diego, Calif, USA). The dose-response
were fixed with 100 μL of ice-cold 40% TCA. Thereafter, the curves (variable slope) were fitted with the algorithm: Y =
cells were incubated at 4◦ C for 1 h and the plates were washed Emin + [(Emax Emin )/(1 + 10(Log ED50 − Log D) Hill slope)].
five times with cold water. The excess water was drained off Statistical analysis was performed with parametric tests
and the plates were left to dry; 50 μL of SRB stain (10 mg w/v because variances were homogeneous between groups. An
in 1% acetic acid) was added to each well for 30 min. Finally, unpaired Student’s t-test (two-tailed) was applied when only
the plates were washed with 50 mL of 1% acetic acid and two groups were compared. A one-way ANOVA followed by
rinsed four times until dye adhering to the cells was observed. post hoc Dunnett’s test was used to assess the differences
The OD was measured at 540 nm using a microplate reader when three or more groups were simultaneously compared.
(model 450, Bio-Rad, USA). Untreated cells were used as Values in text and figures are expressed as means ± SD.
a negative control. Docetaxel, a clinically well-established
antimitotic chemotherapy medication was used as a positive
control of antiproliferative activity. The IC50 value, that is, 3. Results
the concentration of organic extract that produced a 50% 3.1. Antiproliferative Activity. The antiproliferative activity
reduction in the surviving fraction, was calculated using of U. flabellum extracts on the growth of four cancer cells
GraphPad-PRISM 4.00 software. MDCK cell line was used in vitro are summarized in Table 1. The organic extract of
to evaluate the selective index (SI) of U. flabellum extracts. SI wild U. flabellum collected (time 0) showed antiprolifera-
is defined as the ratio of cytotoxic to antiproliferative activity. tive activity (IC50 ) on SiHa (276.2 ± 1.9 μg mL−1 ), HeLa
All determinations were performed in triplicate. (296.6 ± 0.9 μg mL−1 ), Hep-2 (52.9 ± 1.0 μg mL−1 ), and KB
(47.8 ± 1.2 μg mL−1 ). After10 and 20 days of cultivation, the
2.7. Phenolic Content. Total phenolic content of the algal antiproliferative activity of the U. flabellum extracts on the
extracts was determined spectrophotometrically using Folin- SiHa cell line significantly improved when compared with
Ciocalteu reagent [17]. First, 20 mg of the dry extract non cultured U. flabellum extracts (IC50 276.2 μg mL−1 ), with
was diluted with methanol (3 mL). Aliquots of the diluted a reduction of 85–95% after 10 days and 63–77% after 20
extracts (0.1 mL) were transferred into the test tubes; 2.9 mL days of cultivation. The antiproliferative activity of extracts
of distilled water and 0.5 mL of Folin-Ciocalteu reagent on the HeLa cell line had the same tendency, with a 70–
were added. After 10 min, 1.5 mL of 20% sodium carbonate 90% reduction of the non cultured U. flabellum extracts IC50 ;
solution was added, mixed thoroughly and allowed to stand whereas extracts obtained after 30 days of culture increased
at room temperature in the dark for 1 h. Absorbance was IC50 by approximately 78–185% and 40–95% on the SiHa
measured at 725 nm and total phenolic content (expressed and HeLa cell lines, respectively. For the Hep-2 and KB cell
as % of dry weight) was calculated based on a standard curve lines U. flabellum extracts only showed a 36–69% and 40–
of phloroglucinol. 51% reduction of IC50 after 10 days of cultivation.
In general, U. flabellum extracts obtained after cultivation
2.8. Lipid Content. Total lipids were determined according to showed improved SI on cancer cells, particularly the extracts
a previously reported method [18]. The algae extract (20 mg) from culture treatment A (10 days), which showed the
was homogenized with a mixture of H2 O, methanol and highest selectivity index ranging from 6–28 and 8–20 on the
chloroform (1 : 1 : 9 v/v). The chloroform layer containing SiHa and Hep-2 cell lines, respectively (Table 2).
dissolved lipids was collected, dried with nitrogen, and
saponified with 1.2 M NaOH. Fatty acids were converted 3.2. Phenol and Lipid Content. U. flabellum extracts before
to methyl esters with 0.6 mL of 10 M HCl and 1 mL of cultivation (time 0) showed a total phenol content of 1.7 ±
12% boron trichloride in methanol at 80◦ C for 60 min. 0.2% dry wt. U. flabellum extracts increased phenolic content
After methylation, 1 mL of hexane: diethylether (1 : 1) and by 100% for all treatments after 10 and 20 days of cultivation
3 mL of 0.3 M NaOH were added, and the resultant mixture (Figure 2(a)). Lipid and fatty acid content in U. flabellum
was dried with nitrogen and recovered with hexane. The extracts varied in relation to time and light availability
total content of fatty acid methyl esters was analyzed (Figure 2(b)). U. flabellum extracts before cultivation (time
by gas chromatography (Hewlett Packard 6890 Plus with 0) showed a total lipid content of 46.4 ± 1.5%, increasing
Supelco SP2560 bis-cyanopropyl polysiloxane capillary col- by 60 and 70% after 20 and 30 days of cultivation with-
umn 100 m × 0.25 mm × 0.25 μm internal diameter). The out light. GC analysis revealed that saturated fatty acids
column temperature programming was set from 140 (5 min) (SAFA) were dominant (58.6%) while monounsaturated
to 240◦ C (20 min) at a rate of 4◦ C min−1 . Injector and fatty acid (MUFA) and polyunsaturated fatty acid (PUFA)
detector temperature was 260◦ C. Helium was used as the were present at 14.2% and 27.1%, respectively (Figure 2(c)).
carrier gas at a flow rate of 1.1 mL min−1 . Fatty acid In general, after cultivation SAFA content decreased by
methyl esters were identified by comparing their retention 6–19% in relation to the control while MUFA content
times with those of standard samples. The lipid analyses remained similar throughout time and cultivation treatment.
4 Evidence-Based Complementary and Alternative Medicine
Table 1: Growth inhibition (IC50 ) of U. flabellum extracts on cancer cell lines (P ≤ 0.001).
Table 2: Cytotoxicity (CC50 ) of U. flabellum extracts on normal cell line and selective index (SI) for each cancer cell line.
SI
Time (Irradiance treatment) CC50 MDCK Cells
SiHa HeLa Hep-2 KB
Time = 0 297.9±11.2
Day = 10
A 322.3 ± 8.9 10 6.5 19.4 13.7
B 272.6 ± 4.1 6.4 7.0 14.5 9.3
C 286.6 ± 5.1 28 5.3 17.1 8.8
D 276.9 ± 5.8 21 4.3 8.2 9.6
Day = 20
A 358.2 ± 2.9 3.6 7.9 5.0 2.6
B 323.3 ± 4.6 4.3 9.2 5.4 2.3
C 375.9 ± 6.7 5.8 5.5 5.0 3.2
D 386.1 ± 7.1 6.0 5.0 4.2 3.4
Day = 30
A 528.4 ± 10.2 1.0 1.0 5.4 5.0
B 436.3 ± 9.6 0.5 6.7 4.3 4.0
C 524.8 ± 8.6 0.6 0.9 5.7 4.2
D 424.4 ± 7.8 0.7 0.8 4.0 3.3
CC50 : mean concentration that killed 50% of cells; SI = ratio of cytotoxic to antiproliferative activity.
Evidence-Based Complementary and Alternative Medicine 5
300 175
250 150
Phenol content (% control)
0 0
10 20 30 10 20 30
Time (days) Time (days)
A C A C
B D B D
(a) (b)
125 (days)
10 20 30
Fatty acid composition (%)
100
75
50
25
0
Control A B C D A B C D A B C D
SAFA
MUFA
PUFA
(c)
Figure 2: Phenol and lipid content of Udotea flabellum extracts. (a) Total phenol content expressed as a percentage of the control (%), (b)
lipid content in organic extracts expressed as a percentage of the control (%), (c) fatty acid composition in organic extracts expressed in %
dry weight (d wt) over the culture period. Each symbol is the mean±SD of three assays, normalized with the control extract collected at the
same time and place without culture treatment. Time when the samples were collected from the culture tank: 10, 20, and 30 days.
On the other hand, PUFA content increased 3–15% in order to consider a crude extract promising for further
plants subjected to culture treatments when compared to the purification is <30 μg mL−1 [19]. Considering the above-
control. The predominant SAFA was palmitic acid (16 : 0), mentioned criterion, after 10 days of cultivation all U.
while in the MUFA fraction palmitoleic acid (C16 : 1) and flabellum extracts increased their activity against SiHa, Hep-2
oleic acid (C18 : 1) predominated. and KB cells.
U. flabellum extracts increased phenolic content by 100%
4. Discussion for all treatments after 10 and 20 days of cultivation. In
this study, the inhibition of cancer cell proliferation by
Under experimental culture conditions the biological activity U. flabellum extracts could not be explained solely by the
of the U. flabellum organic extracts improved, showing an concentration of polyphenolic compounds. This suggests
increased inhibitory effect with a reduction in the initial that other phytochemicals may play a major role in the
IC50 , thus improving the effect of culture conditions on antiproliferative activity of U. flabellum extracts. Previous
biological activity (Figure 3). U. flabellum extracts obtained studies on tropical green algae of the family Udoteaceae have
after cultivation also improved SI on cancer cells, par- isolated sesquiterpenoids and diterpenoids with biological
ticularly on the SiHa and Hep-2 cell lines. According to activity [20] and udoteatrial hydrate with moderate antimi-
the American National Cancer Institute, the IC50 limit in crobial activity against Staphylococcus aureus [21].
6 Evidence-Based Complementary and Alternative Medicine
Acknowledgments
Lipid content
This work was supported by SEP-CONACYT 53687. Cinves-
Phenol content
tav financed a postdoctoral fellowship for R. Moo-Puc. The
authors thank C. Chávez Quintal and M. L. Zaldivar Romero
for technical assistance during analysis.
Research Article
Biosynthesis and Immobilization of
Biofunctional Allophycocyanin
Correspondence should be addressed to Peng Jiang, [email protected] and Song Qin, [email protected]
The holo-allophycocyanin-α subunit, which has various reported pharmacological uses, was biosynthesized with both Strep-
II-tag and His-tag at the N-terminal in Escherichia coli. The streptavidin-binding ability resulting from the Strep II-tag was
confirmed by Western blot. Additionally, the metal-chelating ability deriving from the His-tag not only facilitated its purification by
immobilized metal-ion affinity chromatography but also promoted its immobilization on Zn (II)-decorated silica-coated magnetic
nanoparticles. The holo-allophycocyanin-α subunit with streptavidin-binding ability was thereby immobilized on magnetic
nanoparticles. Magnetic nanoparticles are promising as drug delivery vehicles for targeting and locating at tumors. Thus, based on
genetic engineering and nanotechnology, we provide a potential strategy to facilitate the biomodification and targeted delivery of
pharmacological proteins.
T7 promoter-1
T7 promoter-1
his-strepII-apcA
T7 promoter-2
lacI 1 T7 promoter-2 lacI 1
ho1 cpcS-1
pCDFDuet-1 pRSFDuet-1
Spe Kan
(a) (b)
[26–29]. Thus, it is possible for magnetic nanoparticles to 2.2. Expression and Purification of the Recombinant Proteins.
be utilized in the immobilization and delivery of His-tagged The pCDFDuet-his-strepII-apcA-ho1-pcyA and pRSFDeut-
proteins. cpcS-cpcU expression vectors were cotransformed into
In this work, based on both genetic engineering and Escherichia coli BL21. The transformants were selected by
nanotechnology, we developed a potential strategy to facil- 50 μg/mL spectinomycin and 50 μg/mL kanamycin. A single
itate the biomodification and targeted delivery of pharma- colony of the transformed Escherichia coli BL21 was cultured
cological proteins. Zn (II)-decorated silica-coated magnetic in 5 mL of LB medium at 37◦ C overnight. The bacterial
nanoparticles (ZnSiMNPs) were prepared and characterized culture was then transferred into 400 mL of LB and cultured
as protein carriers, while cyanobacterial allophycocyanin at 37◦ C. When the OD600 reached 0.6∼0.8, the culture was
(APC), a unique and inexpensive pigment protein with induced with 0.5 mM isopropyl β-D-thiogalactoside at 28◦ C.
various pharmacological uses, was chosen as a model protein. Bacteria were harvested after 8 h induction and stored at
This biliprotein was biosynthesized with both His-tag and −20◦ C before use.
Strep-II-tag at the N-terminal in Escherichia coli. Finally, the To obtain the recombinant proteins, ultrasonicated bac-
protein was immobilized via the His-tag on ZnSiMNPs and teria supernatant was passed through a Ni2+ -NTA affinity
its streptavidin-binding ability was confirmed. column (GE Healthcare Bio-Sciences). The retained protein
on the column was eluted by 50 mM sodium phosphate
2. Materials and Methods and 300 mM imidazole, pH 7.4. The pooled elution was
loaded onto a Sephadex G-25 size-exclusion column to
2.1. Construction of Expression Vectors. In general, standard eliminate imidazole. The protein fraction was collected and
procedures were used for DNA manipulation. All genes for concentrated and analyzed by UV-visible and fluorescence
biosynthesis of holo-APC-α subunit were PCR-amplified spectroscopy.
from Synechocystis sp. PCC6803 with specific primers. The
primers used to amplify the strepII-apcA gene were 5 AAG- 2.3. Western Blotting Analysis. Western hybridization was
GATCCGAGTAACTGGTCACACCCACAATTCGAGAAA- performed with streptavidin-derivatized horseradish peroxi-
ATGAGTATCGTCACGAA3 and 5 GCGAGCTCCTAG- dase to detect the bioaffinity of the holo-APC-α with tags. A
CTCATTTTTCCGAT3 . The other primers were similar to molecular weight marker, a whole bacterial culture extract,
those described previously [3]. As shown by the schemes in and the protein solution purified above were run side by
Figure 1, the strepII-apcA gene was fused to a His-tag and side on the gel in duplicate. After running, the gel was cut
denoted as his-strepII-apcA for apo-APC-α with a His-Strep- in half. One half was stained with Coomassie brilliant blue
II-tag at the N-terminal. The ho1 and pcyA genes for the and the other was transferred to nitrocellulose following
biosynthesis of PCB were ligated into the pCDFDeut-1 vector the kit manufacturer’s instructions. This nitrocellulose was
(Novagen), and the cpcS and cpcU genes for PCB attachment then incubated in TBS (25 mM Tris-HCl, 138 mM NaCl, and
to apoproteins were ligated into the pRSFDeut-1 vector 2.68 mM KCl, pH 7.4) plus 0.05% polyoxyethylenesorbitan
(Novagen). The final plasmid constructs were sequenced to monolaurate (Tween 20) and 3% BSA for 1 h at room
check their veracity. temperature. After a brief rinse with the same buffer without
Evidence-Based Complementary and Alternative Medicine 3
1 2 3 4 5 6 0.7
72 0.6
0.5
Absorption
55 0.4
43 0.3
(kDa)
0.2
0.1
34
0
250 350 450 550 650
26
Wavelength (nm)
17
(a)
Figure 2: SDS-PAGE analyses indicate the expression of His-Strep-
II-holo-APC-α and its bioaffinity. Lanes from 1 to 3 were stained 1000
by Coomassie brilliant blue: 1: marker; 2: whole protein in bacteria
Fluorescence intensity
800
extract; 3: purified protein. Lanes 4 to 6 show the results for western
blotting: 4: marker; 5: whole protein in bacteria extract; 6: purified 600
protein.
400
(a) (b)
Figure 4: TEM images of the smooth surface of SiMNPs (a) and the semishell of ZnSiMNPs (b). Bars: 50 nm.
4. Discussion
Based on genetic engineering and nanotechnology, this
study demonstrated a potential strategy to facilitate the
biomodification and targeted delivery of pharmacologi-
cal proteins. This strategy is represented schematically in
Figure 6. Cyanobacterial allophycocyanin, a unique and
inexpensive pigment protein with various pharmacological
uses, was chosen as a model protein. This research reports,
(b) for the first time, the recombinant construction of holo-
APC-α with both a His-tag and a Strep-II-tag. This recom-
Figure 5: Fluorescence microscopy images of His-Strep-II-holo- binant protein had similar spectral properties to native
APC-α laden ZnSiMNPs after hybridization with streptavidin- holo-APC-α and showed streptavidin-binding capability due
FITC: excited by green (a) or blue (b) light, confirming the surface to the fusion of the Strep-II-tag. In addition, the metal-
immobilization of holo-APC-α and the retentive streptavidin- chelating ability derived from the His-tag not only facilitated
binding ability of proteins loaded onto the nanoparticles. Bars:
its purification but also promoted its immobilization on
1 μm.
ZnSiMNPs. Together with the results of electrophoresis,
Western blotting, and spectral analysis, we concluded that
smooth, while ZnSiMNPs were evidently decorated with 3– holo-APC-α engineered with a His-tag and a Strep-II-tag
5 nm nanoparticles, which had the appearance of a semishell. was successfully biosynthesized. This recombinant protein
This semishell appearance was similar to the decoration of could be immobilized on ZnSiMNPs and modified with
Evidence-Based Complementary and Alternative Medicine 5
Streptavidin-binding ability
Strep II-Tag
His-Tag
Metal-chelating ability Recombinant allophycocyanin
Allophycocyanin
Decoration
Zn(II) Biofunctional allophycocyanin on nanoparticles
Figure 6: Schemes for potential strategies to facilitate biomodification of nanoparticles and targeted delivery of pharmacological proteins.
streptavidin without chemical manipulation. Furthermore, [8] E. A. Lissi, M. Pizarro, A. Aspee, and C. Romay, “Kinetics of
the utilization of magnetic nanoparticles as drug delivery phycocyanine bilin groups destruction by peroxyl radicals,”
carriers is promising for targeting delivery to tumor sites. Free Radical Biology and Medicine, vol. 28, no. 7, pp. 1051–
1055, 2000.
[9] V. B. Bhat and K. M. Madyastha, “Scavenging of peroxynitrite
Acknowledgments by phycocyanin and phycocyanobilin from Spirulina platensis:
protection against oxidative damage to DNA,” Biochemical and
This work was supported by the National High Tech- Biophysical Research Communications, vol. 285, no. 2, pp. 262–
nology Research and Development Program of China 266, 2001.
(2009AA10Z106), Promotive Research Fund for Excellent [10] B. Ge, Z. Tang, F. Zhao, Y. Ren, Y. Yang, and S. Qin,
Young and Middle-aged Scientists of Shandong Province “Scale-up of fermentation and purification of recombinant
(2010BSB02009), Major State Basic Research Development allophycocyanin over-expressed in Escherichia coli,” Process
Program (2011CB200902), and the Public Science and Tech- Biochemistry, vol. 40, no. 10, pp. 3190–3195, 2005.
nology Research Funds Projects of Ocean (200905021-3). [11] X. Y. Guan, W. J. Zhang, X. W. Zhang et al., “A potent anti-
oxidant property: fluorescent recombinant α-phycocyanin of
Spirulina,” Journal of Applied Microbiology, vol. 106, no. 4, pp.
References 1093–1100, 2009.
[12] I. C. Hu, T. R. Lee, H. F. Lin, C. C. Chiueh, and P. C. Lyu,
[1] R. MacColl, “Cyanobacterial phycobilisomes,” Journal of “Biosynthesis of fluorescent allophycocyanin α-subunits by
Structural Biology, vol. 124, no. 2-3, pp. 311–334, 1998. autocatalytic bilin attachment,” Biochemistry, vol. 45, no. 23,
[2] W. A. Samsonoff and R. MacColl, “Biliproteins and phycobil- pp. 7092–7099, 2006.
isomes from cyanobacteria and red algae at the extremes of [13] W. Zhang, X. Guan, Y. Yang et al., “Biosynthesis of fluorescent
habitat,” Archives of Microbiology, vol. 176, no. 6, pp. 400–405, allophycocyanin α-subunits by autocatalysis in Escherichia
2001. coli,” Biotechnology and Applied Biochemistry, vol. 52, no. 2, pp.
[3] L. N. Liu, X. L. Chen, Y. Z. Zhang, and B. C. Zhou, “Char- 135–140, 2009.
acterization, structure and function of linker polypeptides in [14] T. G. M. Schmidt, J. Koepke, R. Frank, and A. Skerra,
phycobilisomes of cyanobacteria and red algae: an overview,” “Molecular interaction between the strep-lag affinity peptide
Biochimica et Biophysica Acta, vol. 1708, no. 2, pp. 133–142, and its cognate target, streptavidin,” Journal of Molecular
2005. Biology, vol. 255, no. 5, pp. 753–766, 1996.
[4] N. Tandeau de Marsac, “Phycobiliproteins and phycobili- [15] A. D. Keefe, D. S. Wilson, B. Seelig, and J. W. Szostak, “One-
somes: the early observations,” Photosynthesis Research, vol. step purification of recombinant proteins using a nanomolar-
76, no. 1-3, pp. 197–205, 2003. affinity streptavidin-binding peptide, the SBP-tag,” Protein
[5] A. McGregor, M. Klartag, L. David, and N. Adir, “Allophy- Expression and Purification, vol. 23, no. 3, pp. 440–446, 2001.
cocyanin trimer stability and functionality are primarily due [16] Y. A. Cai, J. T. Murphy, G. J. Wedemayer, and A. N.
to polar enhanced hydrophobicity of the phycocyanobilin Glazer, “Recombinant phycobiliprotiens: recombinant C-phy-
binding pocket,” Journal of Molecular Biology, vol. 384, no. 2, cocyanins equipped with affinity tags, oligomerization, and
pp. 406–421, 2008. biospecific recognition domains,” Analytical Biochemistry, vol.
[6] R. MacColl, “Allophycocyanin and energy transfer,” Biochim- 290, no. 2, pp. 186–204, 2001.
ica et Biophysica Acta, vol. 1657, no. 2-3, pp. 73–81, 2004. [17] R. Janknecht, G. de Martynoff, J. Lou, R. A. Hipskind,
[7] S. R. Shih, K. N. Tsai, Y. S. Li, C. C. Chueh, and E. C. A. Nordheim, and H. G. Stunnenberg, “Rapid and efficient
Chan, “Inhibition of enterovirus 71-induced apoptosis by purification of native histidine-tagged protein expressed by
allophycocyanin isolated from a blue-green alga Spirulina recombinant vaccinia virus,” Proceedings of the National
platensis,” Journal of Medical Virology, vol. 70, no. 1, pp. 119– Academy of Sciences of the United States of America, vol. 88, no.
125, 2003. 20, pp. 8972–8976, 1991.
6 Evidence-Based Complementary and Alternative Medicine
Research Article
Hypoglycemic Properties of Oxovanadium (IV) Coordination
Compounds with Carboxymethyl-Carrageenan and
Carboxymethyl-Chitosan in Alloxan-Induced Diabetic Mice
Hongyu Zhang,1, 2 Yuetao Yi,1, 3 Dawei Feng,1 Yipeng Wang,1 and Song Qin1, 3
1 Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences, Yantai 264003, China
2 Graduate School of Chinese Academy of Sciences, Beijing 100049, China
3 Biological Resources Laboratory, Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences, Yantai, 264003, China
Correspondence should be addressed to Yuetao Yi, [email protected] and Song Qin, [email protected]
In order to avoid low absorption, incorporation, and undesirable side effects of inorganic oxovanadium compounds, the
antidiabetic activities of organic oxovanadium (IV) compounds in alloxan-induced diabetic mice were investigated. Vanadyl
carboxymethyl carrageenan (VOCCA) and vanadyl carboxymethyl chitosan (VOCCH) were synthesized and administrated
through intragastric administration in different doses for 20 days in alloxan-induced diabetic mice. Glibenclamide was
administrated as the positive control. Our results showed that low-dose group, middle-dose group, and high-dose group of
VOCCA and VOCCH could significantly reduce the levels of blood glucose (P < 0.05) compared with untreated group, but not
in normal mice. Besides, high-dose groups of VOCCA and VOCCH exhibited more significant hypoglycemic activities (P < 0.01).
After treated with VOCCH, the oral glucose tolerance of high-dose group of VOCCH was improved compared with model control
group (P < 0.05).
present study was performed to investigate the antidiabetic in tap water to the concentration of 5% (w/v) every day and
properties of these two new vanadyl complexes in alloxan- kept at 4◦ C.
induced diabetic mice.
2.3. Vanadium Content Determination. 7AS-986 (G) Atomic
Absorption Spectrometry was applied to determine the
2. Materials and Methods content of vanadium of the complex according to the
2.1. Materials and Equipments. K-carrageenin and chitosan standard method of the instruction.
with a deacetylation degree of 95.3% were purchased
from Qingdao Baicheng Biochemical Corp (China), their 2.4. Maximal Tolerant Dose (MTD) Determination of
viscosity-average molecular weights were 3.77 × 105 and VOCCA. The result of preliminary acute toxicity test showed
2.0 × 105 , respectively. Isopropanol, glucose, alloxan, and no death of mouse. Afterwards, the Maximal Tolerant Dose
vanadyl sulfate hydrate (VOSO4 ·xH2 O, x = 3 to 5) were (MTD) test was carried out. Twenty normal mice weighing
purchased from the Sigma-Aldrich Chemical Co. Gliben- 20 ± 2 g were fasted for 24 h, then VOCCA (5%, 0.8 mL) was
clamide was purchased from Pacific pharmaceutical technol- administered intragastrically three times a day for two weeks.
ogy group. Ethanol, sodium hydroxide, and other reagents After two weeks, the maximum tolerated dose was calculated
were purchased from Sinopharm Co. Kunming mice were according to the formula:
provided by experimental animal center, Kunming. The IR
the dose of intragastric administration × 3
spectra were measured on a JASCO-4100FT-IR spectrometer MTD = . (1)
with KBr disks. The content of vanadium is measured on body weight of rat
7AS-986 (G) Atomic Absorption Spectrometer. Chemicals
and solvents were reagent grade. 2.5. Construction of Diabetic Mouse Model. Male mice weigh-
ing 20–24 g were used for animal model construction. Mice
were fasted for 24 h and then intraperitoneally injected
2.2. Synthesis of VOCCA and VOCCH. K-carrageenin (chi- alloxan (160 mg/kg). Five days after alloxan injection, the
tosan) (50 g) was added into 750 mL isopropanol and stirred mice were fasted for 6 h and blood samples were obtained
for 30 min. 40 mL sodium hydroxide solution (mass fraction from tail vein of the mice. The blood glucose levels were
is 50%) was slowly dropped into the mixture (25 min) and measured by the glucose oxidase method. The alloxan-
stirred for 3 h. Then 60 g monochloroacetic acid was added injected mice with the blood glucose level between 10 and
into the mixture for 5 times in 30 min, and the system 20 mmol/L were considered as diabetic mice.
temperature was kept at 60◦ C for 4 h. After incubating for
4 h, the temperature was lowered to 25◦ C and the pH was 2.6. Glucose-Lowering Test. Normal mice and diabetic mice
adjusted to 7.0. The mixture was then concentrated with were randomly divided into 6 groups (10 mice per group).
ethanol three times in volume of the mother liquid. After Normal control group: normal mice; model control group:
filtration, washing, drying, and smashing, the carboxymethyl diabetic mice treated with tap water; glibenclamide control
carrageenin and carboxymethyl chitosan were obtained. group: diabetic mice treated with 0.2 g/kg glibenclamide;
Ashing method [21] was applied to calculate the SD low-dose group: diabetic mice treated with 0.3125 g/kg
of carboxymethyl groups of carboxymethyl carrageenin and VOCCH and 0.6250 g/kg VOCCA; middle-dose group: dia-
carboxymethyl chitosan. Carboxymethyl carrageenin and betic mice treated with 0.6250 g/kg VOCCH and 1.250 g/kg
carboxymethyl chitosan were vacuum dried at 60◦ C to con- VOCCA; high-dose group: diabetic mice treated with
stant mass; carboxymethyl carrageenin and carboxymethyl 1.2500 g/kg VOCCH and 2.500 g/kg VOCCA. The samples
chitosan were heated and scorched at 700◦ C for 15–20 min. above were administered intragastrically for 20 days.
The residues were Na2 O, leached with 50 mL HCl solution
(0.1 moI/L), heated, and followed by residual titration with
0.1 mol/L standard NaOH. The SD of carboxymethyl groups 2.7. Oral Glucose Tolerance Test (OGTT) of VOCCH. After
of carboxymethyl carrageenin and carboxymethyl chitosan the VOCCH was administered intragastrically in both nor-
were calculated as the formula discussed by Wang and Ye. mal and alloxan-induced diabetic mice for 20 days, oral
Vanadyl carboxymethyl carrageenin (chitosan) (the SD glucose tolerance test was executed. Glucose loaded with the
of carboxymethyl carrageenin and carboxymethyl chitosan single dose of 2.5 g/kg was intragastrically administered to
were 47.3% and 84.9%, resp.) was prepared by mixing mice fasted for 6 h, and the blood glucose level was checked
various amounts of VOSO4 with carboxymethyl carrageenin at 0, 0.5, 2 h.
(the mass ratio of V to carboxymethyl carrageenin (chitosan)
was 1%) solutions under magnetic stirring for 24 h at room 2.8. Blood Sample Collection. The blood samples were
temperature. Ethanol four times in volume of the mother obtained from tail vein of mice. Firstly, the tail of mouse was
liquid was added to the solution to complete precipitation put into hot water (50◦ C) for several minutes and cleaned,
of vanadyl carboxymethyl carrageenin (chitosan) complex. then the tail tip was cut for 1-2 mm long and blood sample
The resulting precipitate was washed with ethanol and dried was obtained.
under a vacuum condition at room temperature, and white
solid vanadyl carboxymethyl carrageenin and carboxymethyl 2.9. Statistical Analysis. All data were expressed as the mean
chitosan were obtained. VOCCA and VOCCH were dissolved ± SD. Statistical analysis was performed by one-way analysis
Evidence-Based Complementary and Alternative Medicine 3
120 130
100
100
T (%)
T (%)
449.47 cm−1
50
1416.46 cm−1
2918.74 cm−1
1379.82 cm−1
50
2879.2 cm−1
509.12 cm−1
3379.64 cm−1
660.5 cm−1
705.82 cm−1
1599.66 cm−1
1083.8 cm−1
3371.92 cm−1
1070.3 cm−1
607.47 cm−1
1596.777 cm−1
1320.04 cm−1
1644.98 cm−1
1324.86 cm−1
1421.28 cm−1
0 0
4000 3000 2000 1000 400 4000 3000 2000 1000 400
Wavenumber (cm−1 ) Wavenumber (cm−1 )
Figure 1: FT-IR spectra of chitosan. Figure 3: FT-IR spectra of vanadyl carboxymethyl chitosan.
160 160
150 150
100
100
T (%)
T (%)
974.84 cm−1
1372.1 cm−1
−1
481.15 cm−1
848.53 cm−1
2918.74 cm−1
734.75−cm
2962.13 cm−1
1234.22 cm−1
701.96 cm −11
1421.28 cm−1
664.36 cm
1090.55 cm−1
50
704.86 cm−1
472.47 cm−1
606.5 cm−1
1066.44 cm−1
926.63 cm−1
1634.38 cm−1
3408.57 cm−1
1603.52 cm−1
1154.19 cm−1
598.79 cm−1
50
3409.53 cm−1
1321 cm−1
0 20
4000 3000 2000 1000 400 4000 3000 2000 1000 400
Wavenumber (cm−1 ) Wavenumber (cm−1 )
150
45
2018.14 cm−1
415.59 cm−1
40
100
35
1427.07 cm−1
1255.43 cm−1
848.53 cm−1
524.54 cm−1
1067.41 cm−1
50
699.07 cm−1
2958.27 cm−1
1610.27 cm−1
597.83 cm−1
3452.92 cm−1
1332.57 cm−1
928.56 cm−1
30
20
4000 3000 2000 1000 400
Wavenumber (cm−1 ) 25
100 control group, (B): model control group, (C): glibenclamide control
group, (D): low dose group, (E): middle dose group, (F): high dose
930.49 cm−1
group.
2965.02 cm−1
697.14 cm−1
1331.61 cm−1
600.72 cm−1
50
−1
449.33 cm−1
848.53 cm−1
1424.17 cm
1256.4 cm−1
3453.88 cm−1
1604.48 cm−1
1072.23 cm−1
0 1 2 3
Time (week)
4. Discussion
A D
B E Insulin-mimetic properties of vanadium salts and vanadium
C F compounds have been widely reported in both type 1 and
Figure 8: Impacts of intragastric VOCCH administration on body
type 2 diabetic animal models [23–25]. Inorganic vanadium
weight in both normal and alloxan-diabetic mice; (A): normal compounds have already been known to be effective in
control group, (B): model control group, (C): glibenclamide control treatment of diabetic hyperglycemia, but the side effects,
group, (D): low-dose group, (E): middle-dose group, (F): high-dose such as vomiting, diarrhea, hepatic, and renal toxicity limit
group. their application [26, 27]. Organic vanadium coordination
compounds have been proved with better absorption effi-
ciency in gastrointestinal tract [28]. In this study, high doses
35 of VOCCH and VOCCA exhibited antidiabetic activity at
significantly lower intake levels of elemental vanadium com-
30 pared to glibenclamide. Vomiting and diarrhea, the major
side effects of vanadium compounds, were not observed.
Blood glucose (mmol/L)
Insulin Acknowledgments
This work was supported by the Knowledge Innovation Pro-
gram of the Chinese Academy of Sciences (KZCX2-YW-225),
the Science & Technology Development Plan of Shandong
α α Province (2010GSF10208), and the CAS/SAFEA Interna-
β β
tional Partnership Program for Creative Research Teams.
References
[1] H. Sakurai, “A new concept: the use of vanadium complexes
ATP in the treatment of diabetes mellitus,” Chemical Record, vol. 2,
Tyrosine no. 4, pp. 237–248, 2002.
Tyr Tyr Tyr
kinase [2] H. Sakurai and H. Yasui, “Structure-activity relationship
P domains of insulinomimetic vanadyl-picolinate complexes in ciew of
their clinical use,” Journal of Trace Elements in Experimental
Medicine, vol. 16, no. 4, pp. 269–280, 2003.
P [3] B. Mukherjee, B. Patra, S. Mahapatra, P. Banerjee, A. Tiwari,
De latio
ph TPas CH
os - n
135–143, 2004.
VO TPa
e
C A
Intracellular
P
antioxidative systems,” Archives of Medical Research, vol. 38, [29] K. H. Thompson, J. Lichter, C. LeBel, M. C. Scaife, J. H.
no. 3, pp. 276–283, 2007. McNeill, and C. Orvig, “Vanadium treatment of type 2 dia-
[15] R. Shukla and R. R. Bhonde, “Adipogenic action of vanadium: betes: a view to the future,” Journal of Inorganic Biochemistry,
a new dimension in treating diabetes,” BioMetals, vol. 21, no. vol. 103, no. 4, pp. 554–558, 2009.
2, pp. 205–210, 2008. [30] H. Sakurai, Y. Yoshikawa, and H. Yasui, “Current state for
[16] J. J. Smee, J. A. Epps, K. Ooms et al., “Chloro-substituted the development of metallopharmaceutics and anti-diabetic
dipicolinate vanadium complexes: synthesis, solution, solid- metal complexes,” Chemical Society Reviews, vol. 37, no. 11,
state, and insulin-enhancing properties,” Journal of Inorganic pp. 2383–2392, 2008.
Biochemistry, vol. 103, no. 4, pp. 575–584, 2009. [31] B. A. Reul, S. S. Amin, J. P. Buchet, L. N. Ongemba, D. C.
[17] A. B. Goldfine, D. C. Simonson, F. Folli, M. E. Patti, and C. R. Crans, and S. M. Brichard, “Effects of vanadium complexes
Kahn, “Metabolic effects of sodium metavanadate in humans with organic ligands on glucose metabolism: a comparison
with insulin-dependent and noninsulin-dependent diabetes study in diabetic rats,” British Journal of Pharmacology, vol.
mellitus in vivo and in vitro studies,” Journal of Clinical 126, no. 2, pp. 467–477, 1999.
Endocrinology and Metabolism, vol. 80, no. 11, pp. 3311–3320, [32] P. Buglyo, D. C. Crans, E. M. Nagy et al., “Aqueous chemistry
1995. of the vanadiumIII (VIII ) and the VIII −dipicolinate systems
[18] N. Cohen, M. Halberstam, P. Shlimovich et al., “Oral vanadyl and a comparison of the effect of three oxidation states of
sulfate improves hepatic and peripheral insulin sensitivity vanadium compounds on diabetic hyperglycemia in rats,”
in patients with non-insulin-dependent diabetes mellitus,” Inorganic Chemistry, vol. 44, no. 15, pp. 5416–542, 2005.
Journal of Clinical Investigation, vol. 95, no. 6, pp. 2501–2509, [33] J. Y. Guo, C. C. Han, and Y. M. Liu, “A contemporary treat-
1995. ment approach to both diabetes and depression by cordyceps
[19] M. Halberstam, N. Cohen, P. Shlimovich, L. Rossetti, and H. sinensis: rich in vanadium,” Evidence-Based Complementary
Shamoon, “Oral vanadyl sulfate improves insulin sensitivity in and Alternative Medicine, vol. 7, no. 3, pp. 387–389, 2010.
NIDDM but not in obese nondiabetic subjects,” Diabetes, vol.
45, no. 5, pp. 659–666, 1996.
[20] K. Cusi, S. Cukier, R. A. DeFronzo, M. Torres, F. M. Puchulu,
and J. C. Redondo, “Vanadyl sulfate improves hepatic and
muscle insulin sensitivity in type 2 diabetes,” Journal of Clinical
Endocrinology and Metabolism, vol. 86, no. 3, pp. 1410–1417,
2001.
[21] Z. M. Wang and X. Y. Ye, “Ashing method to determine
the degree of carboxymethyl subsititution degrees of car-
boxymethyl chitosan,” Fenxihuaxue, vol. 22, pp. 1121–1124,
1994.
[22] M. Li, J. J. Smee, W. J. Ding, and D. C. Crans, “Anti-
diabetic effects of sodium 4-amino-2,6-dipicolinatodioxova-
nadium(V) dihydrate in streptozotocin-induced diabetic rats,”
Journal of Inorganic Biochemistry, vol. 103, no. 4, pp. 585–589,
2009.
[23] S. Mohammad, A. Taha, R. N. K. Bamezai, and N. Z. Baquer,
“Modulation of glucose transporter (GLUT4) by vanadate and
Trigonella in alloxan-diabetic rats,” Life Sciences, vol. 78, no. 8,
pp. 820–824, 2006.
[24] W. J. Ding, T. Hasegawa, H. Hosaka, D. Peng, K. Taka-
hashi, and Y. Seko, “Effect of long-term treatment with
vanadate in drinking water on KK mice with genetic non-
insulin-dependent diabetes mellitus,” Biological Trace Element
Research, vol. 80, no. 2, pp. 159–174, 2001.
[25] L. H. Gao, W. P. Liu, B. L. Wang et al., “Effects of
bis(α-furancarboxylato)oxovanadium(IV) on non-diabetic
and streptozotocin-diabetic rats,” Clinica Chimica Acta, vol.
368, no. 1-2, pp. 173–178, 2006.
[26] P. Leopardi, P. Villani, E. Cordelli, E. Siniscalchi, E. Veschetti,
and R. Crebelli, “Assessment of the in vivo genotoxicity of
vanadate: analysis of micronuclei and DNA damage induced
in mice by oral exposure,” Toxicology Letters, vol. 158, no. 1,
pp. 39–49, 2005.
[27] G. B. Garcia, M. E. Biancardi, and A. D. Quiroga, “Vanadium
(V)-induced neurotoxicity in the rat central nervous system:
a histo-immunohistochemical study,” Drug and Chemical
Toxicology, vol. 28, no. 3, pp. 329–344, 2005.
[28] A. K. Srivastava, “Anti-diabetic and toxic effects of vanadium
compounds,” Molecular and Cellular Biochemistry, vol. 206,
no. 1-2, pp. 177–182, 2000.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 658906, 7 pages
doi:10.1155/2011/658906
Research Article
Changes of Photosynthetic Behaviors in Kappaphycus alvarezii
Infected by Epiphyte
Epiphytic filamentous algae (EFA) were noted as a serious problem to reduce the production and quality of K. alvarezii. The
morphological studies revealed that the main epiphyte on K. alvarezii was Neosiphonia savatieri in China. Though the harmful
effects of EFA on the production of K. alvarezii have been reported, the detailed mechanism of the N. savatieri in limiting the
production of K. alvarezii has not been studied yet. The present paper studied the effects of N. savatieri infection on photosynthetic
behaviors in K. alvarezii by detecting chlorophyll fluorescence transient in vivo. The results revealed that damage of oxygen-
evolving complex (OEC), decrease of active reaction centers (RCs), and the plastoquinone (PQ) pool as well as significant reduction
in the performance indexes (PI) of PSII were caused by the infection of N. savatieri. The influence of N. savatieri on photosynthetic
activity of K. alvarezii should be one of the important reasons to reduce the production of K. alvarezii infected by N. savatieri.
K. alvarezii by using continuously Chl a fluorescence, which The maximum quantum yield of primary photochem-
were recorded in vivo with high time resolution and analyzed istry is ϕPO ≡ TRO /ABS = [1 − (FO /Fm )]; the probability
according to JIP-test. that a trapped exciton moves an electron into the electron
transport chain beyond QA − is ψO ≡ ETO /TRO = (1 −
VJ ); the quantum yield for electron transport is ϕEO ≡
2. Materials and Methods ETO /ABS = [1 − (FO /Fm )] × ψO .
2.1. Materials. Both infected and healthy green K. alvarezii The specific energy fluxes (per QA -reducing PSII reaction
were collected from Lian Bay, Hainan province, China center (RC)) for the energy absorbed is ABS/RC = MO ×
(18◦ 27 N, 110◦ 5 E). Detritus on the materials were cleaned (1/VJ ) × (1/ϕPO ); the energy trapped is TRO /RC = MO ×
by seawater. Sections and dominant epiphytes was removed (1/VJ ); the electron transported is ETO /RC = MO × (1/VJ ) ×
by a razor blade and then transferred to microscope slides. ψO ; and the energy dissipated is DIO /RC = (ABS/RC) −
Slides were viewed at 100x magnification under optical (TRO /RC).
microscope. Images were taken using an attached Cannon Phenomenological energy fluxes (per excited cross-
digital camera to investigate the morphological characters of section (CS)) for absorption (ABS/CS), trapping (TRO /CS),
epiphyte. electron transport (ETO /CS), and dissipation (DIO /CS) were
EFA-infected green K. alvarezii were precleaned with a calculated by the following equations: ABS/CSO ≈ FO (at
soft brush to remove all the epiphytes and contaminants and t = t0 ); ABS/CSm ≈ Fm (at t = tFm ); TRO /CSO = ϕPO ×
then were brought to our laboratory beside the bay accom- (ABS/CSO ) (at t = t0 ); TRO /CSm = ϕPO × (ABS/CSm ) (at t =
panied with the healthy ones to carry out the physiological tFm ); ETO /CSO = ϕEO × (ABS/CSO ) (at t = t0 ); ETO /CSm =
studies. ϕEO × (ABS/CSm ) (at t = tFm ); DIO /CSO = (ABS/CSO ) −
(TRO /CSO ) (at t = 0); DIO /CSm = (ABS/CSm ) − (TRO /CSm )
2.2. Chl a Fluorescence Measurement. Algal thalli, about (at t = tFm ).
3-4 mm in diameter and 3 cm in length, were selected, The density of reaction centers per exited cross-section
respectively, from infected and healthy green K. alvarezii. was computed by the equations below: RC/CSO = ϕPO ×
Each thallus was transferred into one capped transparent (VJ /MO ) × (ABS/CSO ) (at t = 0); RC/CSm = ϕPO × (VJ /MO ) ×
glass vial filled with seawater, and subsequently the vial (ABS/CSm ) (at t = tFm ).
was incubated at room temperature in darkness for 15 min. The performance indexes for absorption (PIABS ) and
Chl a fluorescence of dark-adapted sample was measured per excited cross-section (PICS ) were calculated as follows:
by a plant efficiency analyzer (Handy PEA, Hansatech PIABS ≡ (RC/ABS) × [ϕPO /(1 − ϕPO )] × [ψO /(1 − ψO )];
UK) and a single vial adapter for liquid-phase samples PICSO ≡ (RC/CSO ) × [ϕPO /(1 − ϕPO )] × [ψO /(1 − ψO )] (at
(HPEA/LPA2 Hansatech, UK). Red light of 650 nm wave- t = t0 ); PICSm ≡ (RC/CSm ) × [ϕPO /(1 − ϕPO )] × [ψO /(1 − ψO )]
length (1500 μmol m−2 s−1 ) was continuously provided for (at t = tFm ).
1 s. The fluorescence transients were recorded in a time
span from 10 μs to 1 s. For the first 300 μs, fluorescence was 2.4. Chlorophyll a Measurement. Cleaned algal thalli, 3-4 mm
sampled at 10 μs intervals. The time resolution of digitization in diameter and 0.5 g fresh weight, were selected, respectively,
was then switched to slower acquisition rates as the kinetics from infected and healthy green K. alvarezii. The thalli
of the fluorescence signal slow. Each group of experiments were homogenized in 5 mL of 95% ethanol for 15 min then
was done for four times. were centrifuged at 1000 rpm for 5 min. After centrifugation,
4 mL supernatant was transferred into a colorimetric tube
2.3. Analysis of OJIP Chl a Fluorescence Induction Transient. and diluted to 25 mL with 95% ethanol. Absorbance was
Each transient was analyzed according to JIP-test [15–18] measured by 722 s spectrophotometer (Shanghai precision
by utilizing the following data: the minimal fluorescence & scientific instrument CO., LTD) at 665 nm and 649 nm.
intensity (FO ) when all RCs are open, the maximal fluores- Each group of experiments was done for 3 times. Pigment
cence intensity (Fm ), assuming that excitation intensity is concentration was calculated according to Wintermans and
high enough to close all the RCs of PSII, and the fluorescence de Mots [19],
intensities at times 300 μs (FK ), 2 ms (FJ ), and 30 ms (FI ).
Based on the above data, the following parameters were then Chl a μg/g
calculated: the relative variable fluorescence intensity at the dilution rate
J-step, VJ ≡ (FJ − FO )/(Fm − FO ); the relative variable fluo- = (13.7OD665 nm − 5.76OD649 nm ) × .
0.5 g
rescence intensity at the K-step, VK ≡ (FK − FO )/(Fm − FO );
(1)
the approximated initial slope of the fluorescence transient,
MO ≡ 4(FK − FO )/(Fm − FO ); the total complementary area
tF
above the O-J-I-P transient, Area = 0 m (Fm − Ft )dt. 2.5. Phycobiliprotein Measurement. Cleaned algal thalli,
The normalized total complementary area above the 3-4 mm in diameter and 0.5 g fresh weight, were selected,
O-J-I-P transient (reflecting single-turnover QA reduction respectively, from infected and healthy green K. alvarezii. The
events) is Sm ≡ (Area)/(Fm − FO ); the times of QA have thalli were chopped into 3 mm3 and then homogenized in
been reduced to QA − in the time span from t0 to tFm , N ≡ 3 mL of 10 mM CaCl2 solution, which was stocked in 4◦ C for
Sm × MO × (1/VJ ). 12 hours prior to the experiment, for 15 min. Subsequently,
Evidence-Based Complementary and Alternative Medicine 3
the homogenized solution was transferred into a colorimet- are broadly ovoid or napiform with 200–350 μm × 200–
ric tube then diluted to 25 mL with 10 mM CaCl2 . After that, 300 μm in size. Spermatangia are produced on a lateral of
the colorimetric tubes were incubated at 4◦ C in dark for 48 fertile trichoblasts that issues from the suprabasal segment.
hours. Absorbance of the supernatant at 562 nm, 615 nm, Mature spermatangial branches are conical with 130–200 μm
and 652 nm was measured by 722 s spectrophotometer. Each × 45–60 μm in size. They have a one-celled sterile suprabasal
group of experiments was done for 3 times. Phycobiliproteins segment and the basal segment embedded in the parental
were calculated according to Venkataraman [20] as below: branch (Figure 1(f)).
Rhizoids cut off from the pericentral cells of the lower
segments, the production of lateral branch in a spiral
Phycocyanin (PC) mg/g
arrangement, three-celled carpogonial branches, spermatan-
(OD615 nm − 0.474OD652 nm ) dilution rate (2) gial trichoblasts with a sterile lateral, and spiralled tetraspo-
= × , rangia found in the epiphyte ally it with Neosiphonia
5.34 0.5 g
than Polysiphonia [21]. In addition to these features, the
Phycoerythrin (PE) mg/g morphology and size of the main axes, tetrasporangia,
carpogonial, and spermatangial all ally it with N. savatieri
(OD562 nm − 2.41PC − 0.849APC) dilution rate than N. apiculata [22, 23]. Therefore, based on the results
= × ,
9.62 0.5 g above the dominant EFA in Lian Bay, Hainan province,
(3) China are N. savatieri.
Allophycocyanin (APC) mg/g
(4) 3.2. Fast Chl a Fluorescence Kinetics, O-JIP. Figure 2 showed
(OD562 nm − 0.208OD615 nm ) dilution rate the fast Chl a fluorescence induction kinetics of both the
= × ,
5.09 0.5 g healthy and the infected K. alvarezii. When the thalli of K.
alvarezii are exposed to saturating actinic light, the Chl a
Phycobiliprotein (PEP) mg/g = PC + APC + PE. (5)
fluorescence curves start from the initial FO intensity and
increase to a peak (P or Fm ). When the curves were plotted
2.6. Statistics. Statistical analyses were performed using on logarithmic scale, two intermediate steps FJ (about 2 ms)
SPSS 13.0 software (SPSS Inc., Chicago, USA). Independent and FI (about 30 ms) can be found between FO and Fm .
sample t-test at P < 0.05 was used to test the significant To visualize the comparative effects of N. savatieri infection
differences between the infected and the healthy controls. on each step, the curves were replotted as relative variable
fluorescence, Vt = (Ft − FO )/(Fm − FO ) in the insert chart
of Figure 2. Based on the insert chart in Figure 2, certain
3. Results increases in the peaks at K-, J-, and I-steps were found in the
3.1. Dominant Epiphytes on the K. alvarezii. The dominant N. savatieri-infected K. alvarezii compared with the healthy
epiphytes are brownish red and rigid and have percurrent seaweed.
main axes that reach 2–15 mm. The epiphyte thalli grow
on the surface of K. alvarezii solitarily and close to each 3.3. Donor and Acceptor Side of PSII Reaction Center. Increase
other in the peak season (Figure 1(a)). A basal attachment amplitude in K-step was used as a specific indicator of
system of the axis is at first composed of a primary rhizoid damage to the oxygen-evolving complex (OEC) [12, 17, 24,
only (Figure 1(b)), and later forms a tuft of rhizoids by 25]. The amplitude in the K-step of K. alvarezii, expressed
the production of secondary rhizoids that cut off from as the ratio VK , was shown in Table 1. An obvious increase
the pericentral cells of lower segments (Figure 1(c)). The in VK was observed in N. savatieri-infected K. alvarezii,
primary rhizoid often penetrates through the outer cortical which reflected that the OEC of host was at least partly
cells of K. alvarezii to medullary layer (Figure 1(b)). The damaged. Meanwhile, the number of RCs per excited cross-
main axes are 60–250 μm in diameter, with segment length section (RC/CSO or RC/CSm ) was reduced in K. alvarezii
0.5–1.0-fold of diameters. The axes abruptly taper at the after N. savatieri infection. VJ was used as an indicator of the
apices. Each vegetative segment consists of 4 pericentral proportion of active reaction centers (RCs) [12, 15, 17]. The
cells and lacks cortical cells. The axis produces vegetative increase of VJ (Table 1) further indicated that the number
trichoblasts or first-order branches from each segment in of active RCs in the N. savatieri-infected seaweed obviously
a spiral manner. Tetrasporangia are formed in the distal decreased.
segments, one per segment, in a spiral manner. Mature The approximated initial slope of the fluorescence tran-
tetrasporangia are 90–110 μm in diameter and protuber- sient (MO ), a profile of the maximal reduction rate of
ant (Figure 1(d)). Procarpial trichoblasts replace vegetative QA , increased by 89.5% in N. savatieri-infected K. alvarezii
trichoblasts or lateral branches and appear on the distal (Table 1). However, the normalized total complementary
portion of branches. Each procarpial trichoblast produces area above the O-J-I-P transient (Sm ), the energy needed to
a single procarp on the suprabasal segment. The procarp reduce all the QA , decreased by 29.5% (Table 1). The increase
consists of a three-celled carpogonial branch and initials in MO and decrease in Sm was one indicator of the decrease in
of two sterile groups, one two-celled and lateral, and the the plastoquinone (PQ) pool [12, 15, 17, 25]. Therefore, the
other one-celled and basal (Figure 1(e)). Mature cystocarps changes of the MO and Sm in K. alvarezzi, after N. savatieri
4 Evidence-Based Complementary and Alternative Medicine
1 cm 100 μm 100 μm
Figure 1: Epiphytes on the K. alvarezii. (a) Epiphytes on the surface of K. alvarezii. (b) Epiphyte on the transverse section of K. alvarezii and
a single primary rhizoid penetrate through the outer cortical cells to inner cortical cells. (c) Epiphyte on the transverse section of K. alvarezii
and a tuft of secondary rhizoids that are cut off from the pericentral cells of lower segments, (d) tetrasporangial branches of epiphyte, (e)
broadly ovoid cystocarp of epiphyte, and (f) spermatangial branches of epiphyte.
Table 1: Profiles reflecting the donor and acceptor side of PSII in the healthy and infected K. alvarezii.
VK ∗ RC/CSO RC/CSm VJ ∗ MO ∗ Sm ∗ N
Healthy 0.14 ± 0.03 299 ± 61 695 ± 150 0.49 ± 0.08 0.57 ± 0.11 23.73 ± 2.29 27.52 ± 2.08
Infected 0.27 ± 0.06 259 ± 30 606 ± 70 0.61 ± 0.07 1.08 ± 0.26 16.73 ± 4.54 28.25 ± 3.59
RV 1.929 0.866 0.872 1.245 1.895 0.705 1.027
Values present mean ± SE of four replicates, ∗ indicates significant differences at P < 0.05 between the healthy and infected K. alvarezii, and RV indicates the
relative value of infected sample to the healthy sample.
infection showed the plastoquinone (PQ) pool of the host the N. savatieri-infected K. alvarezii did not change so
decreased. What is more, N ≡ Sm × MO × (1/VJ ), the significantly. Therefore, most of the energy trapped was
negligible change (2.7%) in the turnover number of QA (N) not used for photosynthesis but dissipated by the reaction
were induced by the integrated effects of changes in MO , VJ , centers.
and Sm . Similarly, the energy distribution was further expressed
3.4. Energy Distribution via PSII Reaction Center. After N. via excited cross-section. Regardless of Chl a fluorescence
savatieri infection, the energy fluxes via PSII reaction centers at tFO or tFm , the phenomenological energy fluxes per
(RCs) in K. alvarezii significantly changed. The light energy excited cross section (CS) for absorption (ABS/CS), trapping
for absorption (ABS/RC) and trapping (TRO /RC) in N. (TRO /CS), and dissipation (DIO /CS) in K. alvarezii increased
savatieri infected K. alvarezii-increased by 49.5% and 50% by 27% (Table 3) after N. savatieri infection. The increase
(Table 2). However, the specific energy fluxes (per QA - in the DIO /CS acted as a counterbalance to the increase
reducing PSII reaction center (RC)) for the energy dissipated of TRO /CS. Therefore, the change of electron transport
(DIO /RC) increased significantly (Table 2), and the energy per excited cross section (ETO /CS) in K. alvarezzii after N.
for electron transported per reaction center (ETO /RC) in savatieri infection was negligible (Table 3).
Evidence-Based Complementary and Alternative Medicine 5
Table 2: Profiles reflecting energy flux per reaction center in the healthy and infected K. alvarezii.
Table 3: Profiles reflecting energy flux per excited cross section in the healthy and infected K. alvarezii.
0.6 Healthy
The above results indicated a relative decrease in the light
500 0.3 K
energy absorbed per pigment.
0
0 0.01 0.1 1 10 100 1000
Time (ms) 4. Discussion
0
0.001 0.01 0.1 1 10 100 1000 The changes in PSII performance of the photosynthetic
Time (ms) apparatus caused by environmental stress or senescence
Figure 2: Changes of the fluorescence kinetics, O-J-I-P, plotted on have been explored widely by applying the chlorophyll
logarithmic time scale from 10 μs to 1 s of N. savatieri-infected K. fluorescence technique in higher plants [8, 26–31]. However,
alvarezii (the original data without any normalization). In the insert there is not detailed knowledge on the influence of epiphyte
chart, a relative variable fluorescence, Vt = (Ft − FO )/(Fm − FO ) from on the photosynthetic activity of its host. In the present study,
10 μs to 1 s, is shown. Values present mean of four replicates. we have demonstrated the response of PSII of K. alvarezii
to N. savatieri infection. The Chl a fluorescence transient
recorded with high time resolution was analyzed by the JIP-
3.5. Performance Indexes (PI) and Quantum Yields. The test in order to quantify the PSII behaviors in K. alvarezii after
probability that trapped exciton moves an electron into the
N. savatieri infection.
electron transport chain beyond QA − (ψO ), and the quantum
yield for electron transport (ϕEO ) decreased by 23.5% and ϕPO changed slightly; however, PI decreased significantly
24.1% in N. savatieri-infected K. alvarezii comparing with in N. savatieri-infected K. alvarezii. The PI was calculated
the healthy control (Table 4). No significant changes in from three components, which depend on the reaction
the maximum quantum yield of primary photochemistry center density, the trapping efficiency, and the electron
(ϕPO ) were found in the infected K. alvarezii compared transport efficiency. The above changes of PI showed that
with the control. However, the comprehensive performance photosynthesis in the infected K. alvarezii was inhibited
indexes (PI) significantly decreased (Table 4). The average which could partly explain the phenomenon of stunted,
PIABS , PICSO , and PICSm in N. savatieri-infected K. alvarezii rough, and poorly branched carrageenan producing seaweed
decreased by 57.7%, 44%, and 42.9%, respectively, compared arisen by epiphyte infection [7]. Moreover, our results proved
with the healthy control (Table 4). that PI is more sensitive to environmental change than ϕPO
6 Evidence-Based Complementary and Alternative Medicine
Table 4: Performance indexes (PI) and quantum yields in the healthy and epiphyte-infected K. alvarezii.
and correlates well with plant vigor and performance again of oxygen during the nighttime. In addition, the epiphyte
that agrees with the research by Hermans et al. [32]. N. savatieri competed with host K. alvarezii for absorbing
Chlorophyll and phycobiliprotein content in N. savatieri- nutrients (N, P, CO2 , and other mineral elements). Most
infected K. alvarezii was increased to 156% and 230% of the nutrients dissolving in the water body were first
(Table 5). Therefore, the energy fluxes for absorption and filtered by N. savatieri before reaching to K. alvarezii, and
trapping in N. savatieri-infected K. alvarezii were increased so nutrient deficiency inevitably occurred in K. alvarezii
(Tables 2 and 3). However, the negligible changes of ETO /CS after EFA infection. Dense N. savatieri were severe stress
(Table 3) and ϕPO (Table 4) indicated that the trapped energy for the metabolism of K. alvarezii by shading, high O2
was not efficiently used for electron transport. The damage concentrations in the light, anoxic conditions in the dark,
of OEC, decrease in RC number, and reduction of PQ pool and competition of nutrients. Therefore, heavy decay in K.
could further explain why the light trapped in N. savatieri- alvarezii was usually found when the seaweed was infected by
infected K. alvarezii was not sufficiently consumed timely for N. savatieri.
photosynthesis. In conclusion, the dominant EFA on K. alvarezii in Lian
The side impacts of epiphyte on K. alvarezii growth were Bay, Hainan province were N. savatieri. Damage of OECs,
not only limited to photochemical reactions. Largo et al. [33] decrease of active RCs and the PQ pool and significant
reported that light intensity of less than 50 μmoL photon m−2 reduction in the performance indexes (PI) of PSII were
could induce the decay of K. alvarezii. N. savatieri occupied caused by the infection of N. savatieri although the seaweed
the outsurface of K. alvarezii and shielded the host from acclimated itself to the low-light condition by increasing its
getting enough light. Moreover, both N. savatieri and K. photosynthetic pigments to absorb more light energy. The
alvarezii all belonged to Rhodophyta species and owned influence of N. savatieri on photosynthetic activity of K.
similar types of photosynthetic pigments that aggravated the alvarezii was one of the important reasons to reduce the
competition of light absorption between them. The competi- production of K. alvarezii.
tion between N. savatieri and K. alvarezii seriously decreased
the ambient light. However, the infected K. alvarezii tried
to acclimate itself to the low-light conditions by increas-
Acknowledgments
ing its photosynthetic pigments, especially phycobiliprotein The authors wish to thank Mr. Zhaoliang Zheng from
(Table 5). Unfortunately, the adaptive regulation seemed to Lingshui Haotian Company for the provision of algae.
be meaningless for EFA-infected K. alvarezii because of This work was supported by the National Natural Science
the decrease in active RC number, damage of OEC, and Foundation of China (30771639), Special Project for Marine
reduction of PQ pool as mentioned above. Glenn and Doty Public Welfare Industry (200705010).
[34] reported that culture of K. alvarezii required high levels
of water motion provided by strong and consistent trade
winds. N. savatieri, covered on the surface of K. alvarezii, References
were bound to reduce the water motion nearby the K.
[1] M. S. Doty and V. B. Alvarez, “Status, problem, advances and
alvarezii as well as the materials exchange between K. alvarezii economics of Eucheuma farms,” Marine Technology Society
and external environment. Therefore, the production of Journal, vol. 9, no. 4, pp. 30–35, 1975.
oxygen by the photosynthesis of N. savatieri and K. alvarezii [2] E. Ask and V. Azanza, “Advances in cultivation technology of
was easy to cause the surplus of oxygen during the daytime. commercial eucheumatoid species: a review with suggestions
Moreover, the consumption of oxygen by the respiration of for future research,” Aquaculture, vol. 206, no. 3-4, pp. 257–
N. savatieri and K. alvarezii was easy to cause the insufficiency 277, 2002.
Evidence-Based Complementary and Alternative Medicine 7
[3] H. S. Parker, “The culture of the red algal genus Eucheuma in [19] J. F. G. M. Wintermans and A. de Mots, “Spectrophotometric
the Philippines,” Aquaculture, vol. 3, no. 4, pp. 425–439, 1974. characteristics of chlorophylls a and b and their phenophytins
[4] A. Q. Hurtado, A. T. Critchley, A. Trespoey, and G. B. Lhon- in ethanol,” Biochimica et Biophysica Acta, vol. 109, no. 2, pp.
neur, “Occurrence of Polysiphonia epiphytes in Kappaphycus 448–453, 1965.
farms at Calaguas Is., Camarines Norte, Phillippines,” Journal [20] L. V. Venkataraman, Bluegreen Alga Spirulina, Department of
of Applied Phycology, vol. 18, no. 3–5, pp. 301–306, 2006. Science and Technology, New Delhi, India, 1983.
[5] C. S. Vairappan, “Seasonal occurrences of epiphytic algae on [21] M. S. Kim and I. K. Lee, “Neosiphonia flavimarina gen. et sp.
the commercially cultivated red alga Kappaphycus alvarezii nov. with a taxonomic reassessment of the genus Polysiphonia
(Solieriaceae, Gigartinales, Rhodophyta),” Journal of Applied (Rhodomelaceae, Rhodophyta),” Phycological Research, vol.
Phycology, vol. 18, no. 3–5, pp. 611–617, 2006. 47, no. 4, pp. 271–281, 1999.
[6] C. S. Vairappan, C. S. Chung, A. Q. Hurtado, F. E. Soya, G. [22] M. Masuda, T. Abe, S. Kawaguchi, and S. M. Phang, “Taxo-
B. Lhonneur, and A. Critchley, “Distribution and symptoms nomic notes on marine algae from Malaysia. VI. Five species
of epiphyte infection in major carrageenophyte-producing of ceramiales (Rhodophyceae),” Botanica Marina, vol. 44, no.
farms,” Journal of Applied Phycology, vol. 2, no. 5, pp. 27–33, 5, pp. 467–477, 2001.
2009. [23] M. Tani, Y. Yamagishi, M. Masuda, K. Kogame, S. Kawaguchi,
[7] E. Ask, Cottonii and Spinosum Cultivation Handbook, FMC and S. M. Phang, “Taxonomic notes on marine algae from
Food Ingredients Division, Philadelphia, Pa, USA, 1999. Malaysia. IX. Four species of rhodophyceae, with the descrip-
[8] K. J. Appenroth, J. Stöckel, A. Srivastava, and R. J. Strasser, tion of chondria decidua sp. nov,” Botanica Marina, vol. 46,
“Multiple effects of chromate on the photosynthetic apparatus no. 1, pp. 24–35, 2003.
of Spirodela polyrhiza as probed by OJIP chlorophyll a [24] B. Guissé, A. Srivastava, and R. J. Strasser, “The polyphasic rise
fluorescence measurements,” Environmental Pollution, vol. of the chlorophyll a fluorescence (O-K-J-I-P) in heat stressed
115, no. 1, pp. 49–64, 2001. leaves,” Archives des Sciences Genève, vol. 48, pp. 147–160,
[9] G. H. Krause and E. Weis, “Chlorophyll fluorescence and 1995.
photosynthesis: the basics,” Annual Review of Plant Physiology [25] B. J. Strasser, “Donor side capacity of photosystem II probed
and Plant Molecular Biology, vol. 42, no. 1, pp. 313–349, 1991. by chlorophyll a fluorescence transients,” Photosynthesis
Research, vol. 52, no. 2, pp. 147–155, 1997.
[10] Govindjee, “Sixty-three years since Kautsky: chlorophyll a
[26] J. Dai, H. Gao, Y. Dai, and Q. Zou, “Changes in activity of
fluorescence,” Australian Journal of Plant Physiology, vol. 22,
energy dissipating mechanisms in wheat flag leaves during
no. 2, pp. 131–160, 1995.
senescence,” Plant Biology, vol. 6, no. 2, pp. 171–177, 2004.
[11] D. Lazar, “Chlorophyll a fluorescence induction,” Biochimica
[27] C. D. Jiang, H. Y. Gao, and Q. Zou, “Changes of donor and
et Biophysica Acta, vol. 1412, pp. 1–28, 1999.
acceptor side in photosystem 2 complex induced by iron defi-
[12] R. J. Strasser, M. Tsimilli-Michael, and A. Srivastava, “Analysis ciency in attached soybean and maize leaves,” Photosynthetica,
of the chlorophyll a fluorescence transient,” in Chlorophyll a vol. 41, no. 2, pp. 267–271, 2003.
Fluorescence: A Signature of Photosynthesis, G. C. Papageorgiou [28] C. Lu and J. Zhang, “Changes in photosystem II function
and Govindjee, Eds., pp. 321–362, Springer, Rotterdam, The during senescence of wheat leaves,” Physiologia Plantarum, vol.
Netherlands, 2004. 104, no. 2, pp. 239–247, 1998.
[13] A. Srivastava and R. J. Strasser, “Constructive and destructive [29] C. M. Lu, N. W. Qiu, B. S. Wang, and J. H. Zhang, “Salinity
actions of light on the photosynthetic apparatus,” Journal of treatment shows no effects on photosystem II photochemistry,
Scientific and Industrial Research, vol. 56, no. 3, pp. 133–148, but increases the resistance of photosystem II to heat stress in
1997. halophyte Suaeda salsa,” Journal of Experimental Botany, vol.
[14] A. J. Clark, W. Landolt, J. B. Bucher, and R. J. Strasser, “Beech 54, no. 383, pp. 851–860, 2003.
(Fagus sylvatica) response to ozone exposure assessed with a [30] E. H. Murchie, Y. Z. Chen, S. Hubbart, S. B. Peng, and P.
chlorophyll a fluorescence performance index,” Environmental Horton, “Interactions between senescence and leaf orientation
Pollution, vol. 109, no. 3, pp. 501–507, 2000. determine in situ patterns of photosynthesis and photoinhibi-
[15] B. J. Strasser and R. J. Strasser, “Measuring fast fluorescence tion in field-grown rice,” Plant Physiology, vol. 119, no. 2, pp.
transients to address environmental questions: the JIP test,” 553–563, 1999.
in Photosynthesis: From Light to Biosphere, P. Mathis, Ed., pp. [31] L. B. Thach, A. Shapcott, S. Schmidt, and C. Critchley,
977–980, Kluwer Academic, Dodrecht, The Netherlands, 1995. “The OJIP fast fluorescence rise characterizes Graptophyllum
[16] A. Srivastava and R. J. Strasser, “Greening of peas: parallel species and their stress responses,” Photosynthesis Research,
measurements of 77 K emission spectra, OJIP chlorophyll a vol. 94, no. 2-3, pp. 423–436, 2007.
fluorescence transient, period four oscillation of the initial [32] C. Hermans, M. Smeyers, R. M. Rodriguez, M. Eyletters, R.
fluorescence level, delayed light emission, and P700,” Photo- Strasser, and J. P. Delhaye, “Quality assessment of urban’s
synthetica, vol. 37, no. 3, pp. 365–392, 1999. trees: a comparative study of physiological characterisation,
[17] B. J. Strasse, A. Srivastava, and M. Tsimilli-Michael, “The airborne imaging and on site fluorescence monitoring by the
fluorescence transient as a tool to characterize and screen OJIP-test,” Journal of Plant Physiology, vol. 160, no. 1, pp. 81–
photosynthetic samples,” in Probing Photosynthesis: Mecha- 90, 2003.
nism, Regulation and Adaptation, M. Yunus, U. Pathre, and P. [33] D. B. Largo, K. Fukami, T. Nishijima, and M. Ohno,
Mohanty, Eds., pp. 445–483, Taylor and Francis, London, UK, “Laboratory-induced development of the ice-ice disease of the
2000. farmed red algae Kappaphycus alvarezii and Eucheuma den-
[18] R. J. Strasser and M. Tsimilli-Michael, “Structure function ticulatum (Solieriaceae, Gigartinales, Rhodophyta),” Journal of
relationship in the photosynthetic apparatus: a biophysical Applied Phycology, vol. 7, no. 6, pp. 539–543, 1995.
approach,” in Biophysical Processes in Living Systems, P. Pardha [34] E. P. Glenn and M. S. Doty, “Water motion affects the growth
Saradhi, Ed., pp. 271–303, Science Publishers, Enfield, NH, rates of Kappaphycus alvarezii and related red seaweeds,”
USA, 2001. Aquaculture, vol. 108, no. 3-4, pp. 233–246, 1992.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 984080, 11 pages
doi:10.1155/2011/984080
Research Article
Identification and Characterization of Cell Wall Proteins of
a Toxic Dinoflagellate Alexandrium catenella Using 2-D DIGE
and MALDI TOF-TOF Mass Spectrometry
Da-Zhi Wang, Hong-Po Dong, Cheng Li, Zhang-Xian Xie, Lin Lin, and Hua-Sheng Hong
State Key Laboratory of Marine Environmental Science, Environmental Science Research Centre, Xiamen University,
Xiamen 361005, China
The cell wall is an important subcellular component of dinoflagellate cells with regard to various aspects of cell surface-associated
ecophysiology, but the full range of cell wall proteins (CWPs) and their functions remain to be elucidated. This study identified
and characterized CWPs of a toxic dinoflagellate, Alexandrium catenella, using a combination of 2D fluorescence difference gel
electrophoresis (DIGE) and MALDI TOF-TOF mass spectrometry approaches. Using sequential extraction and temperature
shock methods, sequentially extracted CWPs and protoplast proteins, respectively, were separated from A. catenella. From the
comparison between sequentially extracted CWPs labeled with Cy3 and protoplast proteins labeled with Cy5, 120 CWPs were
confidently identified in the 2D DIGE gel. These proteins gave positive identification of protein orthologues in the protein database
using de novo sequence analysis and homology-based search. The majority of the prominent CWPs identified were hypothetical
or putative proteins with unknown function or no annotation, while cell wall modification enzymes, cell wall structural proteins,
transporter/binding proteins, and signaling and defense proteins were tentatively identified in agreement with the expected role of
the extracellular matrix in cell physiology. This work represents the first attempt to investigate dinoflagellate CWPs and provides a
potential tool for future comprehensive characterization of dinoflagellate CWPs and elucidation of their physiological functions.
Amphiesma
Thecal plate
4’ 1’ 1”
Pellicular layer
5”
6”
Cytoplasm
Outer plate membrane
Outermost membrane
Thecal vesicle
Cytoplasmic membrane 5 μm
(a) (b)
Figure 1: Schematic diagram of the amphiesma of a typical thecate dinoflagellate based on Morrill and Loeblich (1984). (a) Structure of
the amphiesma, including a continuous outermost membrane, an outer plate membrane, a single-membrane bounded thecal vesicle, and
a cytoplasmic membrane. Inside this vesicle, a number of cellulosic thecal plates are subtended by a pellicular layer. (b) Scanning electron
micrograph of A. catenella, with the continuous outermost membrane obvious on the cell surface.
to cell-cell recognition. The cell wall of dinoflagellates is a [26, 30]. However, these methods led to a loss of solubility
subcellular component of substantial interest with regard of the proteins due to the multiple additions of large
to various aspects of cell surface associated ecophysiology. hydrophobic groups, and, moreover, these methods only
However, there are few experimental data available for the address CSPs and not the CWPs.
cell wall of dinoflagellates compared with other organisms Global techniques such as proteomics provide effective
due to the lack of the whole genome. So far, only a lim- strategies and tools for profiling and identifying proteins
ited number of cell wall proteins (CWPs) and enzymes of dinoflagellates [34–38]. In contrast to conventional bio-
have been identified and characterized at the biochemical chemical approaches that address one or a few specific
and functional level, and neither the mechanism of their proteins at a time, proteomic techniques allow simultaneous
functions nor their locations have been elucidated [26– isolation and identification of hundreds to thousands of
30]. A few studies indicate that cell wall-associated proteins proteins in one sample. Fluorescence difference gel elec-
and their activities are known to be induced or increased trophoresis (DIGE) technology is a newly developed 2D gel-
by factors limiting the growth of these members of the based approach that employs three fluorescent succinimidyl
eukaryotic phytoplankton, because they may enhance cell esters, termed CyDyes, to differentially label proteins prior
scavenging of nutrients. Moreover, dinoflagellate CWPs may to electrophoretic separation [39]. Because of the sensitivity
also be involved in signaling pathways [16]. Clearly, the and extended linear dynamic range of these dyes, this tech-
cell wall presents an important site of interaction between nique facilitates not only quantification over a comparatively
algal cells and their environment. In light of this, a better wide dynamic range with high accuracy, but also enables
understanding of dinoflagellate CWPs composition may help relative quantification with reference to an internal standard,
to reveal various physiological activities on the cell wall as thereby also facilitating the analysis of an adequate set of
well as in the blooming mechanism of dinoflagellates. biological replicates in order to obtain the most significant
Study of CWPs has often relied on the methods used for data on protein regulation. This technique is recently applied
their isolation from the cell wall of dinoflagellates. However, for identifying biomarkers, designing novel drug targets, and
at present, there is no ideal method for the isolation of monitoring therapeutic processes [40–43].
CWPs although many studies have been devoted to various In this study, we present a newly developed method
membrane proteins. One of the current strategies is to extract for the identification and characterization of CWPs from
CWPs from whole cells using a sequential extraction method A. catenella DH01, an HAB-causing dinoflagellate species
[31–33]. However, this approach causes the cells to break widely spread in the coastal waters of China[44]. By
during the long chemical extraction, and this results in comparing sequentially extracted CWPs labeled with Cy3
potential cross-contamination of the CWPs [32]. Specific and protoplast proteins labeled with Cy5, 120 CWPs were
labeling methods, for example, biotinylation or the use of confidently identified on the 2D DIGE gel, and the majority
the radioisotope Na125I, are also developed to recognize and gave positive identification of protein orthologues in the
isolate the cell surface proteins (CSPs) from dinoflagellates protein database by de novo sequence analysis and database
Evidence-Based Complementary and Alternative Medicine 3
searching (MS-BLAST). The goal of this study was to size filter (Whatman) and washed three times with sterilized
establish an efficient and reliable method to identify CWPs sea water to avoid contamination by the cell walls. 1 mL
from dinoflagellates and to characterize putative proteins in Trizol reagent was added to the protoplast pellet collected
order to provide a foundation for future investigation of the using centrifugation, and it was subjected to sonication on
functions and expression of CWPs in A. catenella as well as ice. Subsequently, 200 μL of chloroform was added to the
other dinoflagellates. cell lysate before shaking it vigorously for 15 s. The mixture
was allowed to stand for 5 min at room temperature before
2. Materials and Methods being centrifuged at 12000 × g for 15 min at 4◦ C. The top
pale-yellow or colorless layer was removed, and 300 μL of
2.1. Organism and Culture Conditions. A. catenella DH01 ethanol was added to resuspend the reddish bottom layer
was provided by the Culture Collection Center of Marine and this mixture centrifuged at 2000 × g for 5 min at 4◦ C.
Bacteria and Algae of the State Key Laboratory of Marine The supernatant was transferred to a new tube and 1.5 mL of
Environmental Science, Xiamen University, China. A unial- isopropanol was added. The mixture was allowed to stand
gal isolate was routinely maintained in K medium [45] at for at least 20 min for precipitation of proteins at room
20◦ C under a 10 : 14 h light: dark photoperiod at a light temperature. It was then centrifuged at 14000 × g for 10 min
intensity of approximately 100 μmol photons m−2 s−1 pro- at 4◦ C, and the pellet obtained was briefly washed with 95%
vided using fluorescent lamps. The cells for the experiments ethanol before being allowed to air dry. 500 μL of rehydration
were grown in 5,000 mL flasks containing 4,000 mL of K buffer with 7 M urea, 2 M thiourea and 4% W/V CHAPS was
medium, and the culture conditions were the same as above. added to solubilize the protein pellet before loading onto the
The K medium did not contain any protein. Approximately first dimension isoelectric focusing (IEF).
2 × 107 cells of A. catenella in their exponential growth phase
were collected with centrifugation at 3,000 × g for 30 minutes 2.4. Minimal Labeling of Proteins Using Fluorescent Dye.
at 4◦ C. The cell pellets were rinsed twice with precooled Sequentially extracted CWPs and protoplast proteins were
sterilized seawater to avoid any carryover of culture medium subjected to minimal labeling using the fluorescent dyes
and extracellular proteins and were used for the extraction of Cy3 and Cy5 according to the manufacturer’s instructions.
CWPs and protoplast proteins. Aliquots of 50 μg of each sample were separately labeled.
Briefly, stock cyanine dyes (14 nmol/μL) were diluted in
2.2. Preparation of Sequentially Extracted CWPs. For CWP freshly prepared DMF to 400 pmol/μL and 8 pmol dye was
extraction, the cell pellets were sequentially extracted with added per 1 μg of protein in the cell lysate. The sample was
0.2 M CaCl2 , 50 mM CDTA in 50 mM sodium acetate (pH vortexed, briefly centrifuged, and left on ice for 30 min in
6.5), 2 mM DTT, and 1 M NaCl at 4◦ C for 30 min each, the dark. No primary amines, DTT, or carrier ampholytes
and finally to 0.2 M borate (pH 7.5) at room temperature were included in the lysis buffer as such components could
for 30 min, with gentle vortexing. The extracts were pooled potentially react with the N-hydroxy succinimide ester group
together and precipitated with three volumes of ice-cold 20% of the cyanine dyes. The labeling reaction was quenched
TCA (v/v) in acetone overnight at −20◦ C and centrifuged at by adding 1 μL of 10 mML-lysine per 400 pmol of dye. The
20,000 g for 30 min at 4◦ C (Hettich ROTINA 38R Refriger- sequentially extracted CWPs and protoplast proteins were
ated Centrifuges, Germany). The supernatant was discarded, labeled with Cy3and Cy5, respectively. Thereafter, the Cy3-
and the precipitate was washed twice with ice-cold 90% and Cy5-labeled samples were mixed at a ratio of 1 : 1
acetone (v/v) containing 20 mM DTT and then twice with (equating to 100 μg of total protein) and prepared for IEF.
ice-cold 100% acetone. The protein obtained was air-dried
to remove residual acetone and subsequently dissolved in 2.5. Two-Dimensional Gel Electrophoresis. For 2D DIGE, the
50 μL rehydration buffer (pH 8.5) containing 7 M urea, 2 M labeling protein samples were mixed with a rehydration
thiourea, 4% CHAPS (w/v), and 30 mM Tris and then stored buffer (7 M urea, 2 M thiourea, 4% w/v CHAPS, 1% DTT,
at −80◦ C for proteomic analysis. This protein sample was and 0.5% v/v IPG) before loading onto IPG strips with
termed sequentially extracted CWPs. a linear pH gradient from 4–7 (Immobiline Drystrip, GE
Healthcare Life Science, Piscataway, US). The sample was
2.3. Preparation of Protoplast Proteins. 1 × 107 cells were subjected to IEF using an IPGphor III system with 24 cm
resuspended in sterilized sea water and maintained at 4◦ C IPG strips and the following protocol: 6 h at 40 V (active
for one and a half hours then at 20◦ C for 10 min. After rehydration), 6 h at 100 V, 0.5 h at 500 V, 1 h at 1000 V, 1 h
this treatment, the cell walls became detached from the at 2000 V, 1.5 h at 10000 V, and 6 h at 10000 V for 60000 Vh.
protoplasts without the cell being broken (Figure 2). The The minimal Vh applied was 60000 units. Subsequently, the
suspension was centrifuged at 4,000 g for 30 min at 4◦ C. After immobilized pH gradient strips were equilibrated for 15 min
removing the supernatant, the pellet was separated into two in reducing buffer containing 6 M urea, 2% SDS, 50 mM
layers, cell walls in the upper layer and protoplasts in the Tris-Cl (pH 8.8), 30% glycerol, and 1% DTT, followed
lower layer (Figure 2(e)). The cell wall layer was introduced by equilibration for 15 min in alkylation buffer containing
to a membrane filter of 5 μM diameter pore size (Whatman) 6 M urea, 2% SDS, 50 mM Tris-Cl (pH 8.8), 30% glycerol,
with a pipette and gently washed three times with sterilized and 2.5% iodoacetamide. Second-dimension SDS-PAGE gels
sea water to avoid contamination by extracellular proteins. (12.5%) were run on a GE Ettan DALT six at 0.5 w/gel for 1 h
The protoplasts were removed on a 10 μM diameter pore and then at 17 w/gel for 6 h.
4 Evidence-Based Complementary and Alternative Medicine
(d) (e)
Figure 2: Preparation of protoplasts of A. catenella DH01 using the temperature shock method. (a), (b), and (c) are photographs of the
intact cell, the protoplast and the cell wall of A. catenella DH01 under the light microscope. (d) A mixture of cell walls (white arrow) and
protoplasts (black arrow). (e) Concentrated cell walls (white arrow) and protoplasts (black arrow). (The magnitude was 10 × 20).
2.6. Gel Scanning, Digitizing, and Data Analysis. The resul- thiosulfate and 30 mM potassium ferricyanide until the gel
tant analytical gels were scanned using a Typhoon 9400 pieces became white. They were then rinsed three times in
scanner (Amersham 4 Biosciences/GE Healthcare). The Milli-Q water, shrunk with 100% acetonitrile for 15 min, and
specific excitation and emission wavelengths for each of the air-dried at room temperature for 30 min. All gel pieces were
fluorescent dyes were recommended by the manufacturer. incubated with 12.5 ng/μL sequencing grade trypsin (Roche
Gel images were scanned at a resolution of 100 μm and Molecular Biochemicals) in 20 mM NH4 HCO3 overnight
preprocessed using ImageQuant software (version 5.2, Amer- at 37◦ C. After digestion, 1 μL of supernatant was pipetted
sham Biosciences/GE Healthcare). Cropped gel images were and spotted on the target plate then air-dried at room
analyzed using DeCyder 2D software (version 6.5, Amersham temperature. 1 μL of matrix (4-hydroxy–cyanocinnamic acid
Biosciences/GE Healthcare). The differential in-gel analysis in 30% CAN, 0.1% TFA) was laid over the samples on the
(DIA) algorithm detected overlapping spots on a combined target plate until they dried completely.
image derived from merging individual images from the two
samples tagged by Cy3 and Cy5. Protein spots which were 2.8. Mass Spectrometric Analysis. MALDI-TOF mass spec-
identified as CWPs between the sequentially extracted CWPs trometry and tandem TOF/TOF mass spectrometry were
and protoplast proteins were marked for spot excision and carried out with a 4800 Plus MALDI TOF-TOF Analyzer
subsequent protein identification using MALDI TOF-TOF. (Applied Biosystems, Foster City, USA) equipped with
a neodymium: yttrium-aluminum-garnet laser. The laser
2.7. In-Gel Digestion. 120 CWPs identified using 2D DIGE wavelength and the repetition rate were 355 nm and 200 Hz.
were manually excised from the prepared silver stained 2-DE The MS spectra were processed using the Peak Explorer
gels (Figure 4), and the silver-stained gel pieces were rinsed (Applied Biosystems) software allowing nonredundant and
once with MilliQ water and destained in 100 mM sodium fully automated selection of precursors for tandem mass
Evidence-Based Complementary and Alternative Medicine 5
96
resolution. In the TOF1 stage, all ions were accelerated to
1 kV under conditions promoting metastable fragmentation.
The peak detection criteria used were an S/N of 10 and a local
noise window width of 250 (m/z).
66 67
68
69 70
1 2 3 4 78910 11 12
96 for similarity searches using the MS-BLAST algorithms [46].
71 19
I1415
73 75
74 78 81
16 6 13
5 22 17
21 18
The MS-BLAST searches were conducted at the Heidelberg
72
83
80 76
77
30
20
3132 34
23 2425
server (http://dove.embl-heidelberg.de/Blast2/msblast.html)
84 79 35 26 27 28 36
88 9091
IV 82
8685 93V 92 94
95
37 38
33 41
44
29
against the NCBI nonredundant database using standard set-
98 39 40
89
VI
87
114
96
47 42 43
4645
48 50 II
51
52 tings with no taxonomic restriction. All sequences obtained
99 97
101 100
49
55 54 53
from an MS/MS spectrum were spaced with the minus
105
102 103 104
107
106 56
57 symbol (−) and were merged into a single string, and
108
63
64
submitted to an MS BLAST search as reported above. The
59 58
61 65 MS-BLAST search results were considered significant if
111
112 109 60 62 the resulting scores were higher than the threshold score
113
110
8 indicated in the MS-BLAST scoring scheme.
pI 4 7 3. Results
Figure 4: Representative 2-DE gel of CWPs from an A. catenella
DH01 sample stained with silver. The proteins were resolved in
3.1. Identification of CWPs Using 2D DIGE. In this study,
4–7 linear pH gradient (Immobiline DryStrips; 240 × 3 × 0.5) two protein fractions were obtained from A. catenella: one
and 12.5% SDS-PAGE (2400 × 2000 × 1 mm). 120 CWPs were fraction was sequentially extracted CWPs prepared using a
separated and identified (indicated by arrows) from A. catenella sequential chemical extraction method, a traditional plant
DH01. CWP preparation method; the other was protoplast proteins
prepared using a temperature shock method. The former
was labeled with Cy3 and the latter with Cy5, and then,
spectrometry (MS/MS) acquisition. At least 2000 laser shots they were pooled together to run 2D DIGE. An overview
were typically accumulated in the MS mode, whereas in of the fluorescent DIGE images of the sequentially extracted
the MS/MS mode spectra from up to 5000 laser shots were CWPs and protoplast proteins of A. catenella, and the
acquired and averaged. The peak detection criteria used overlaying of these two images are shown in Figure 3.
were a minimum S/N of 10, a local noise window width The differentially expressed proteins were evaluated using
mass/charge (m/z) of 250 and a minimum full-width half- DeCyder 2D software. This software identifies protein spots
maximum (bins) of 2.9. The mass spectra were internally and compares the spot intensities for up to three samples
calibrated using porcine trypsin autolytic products (m/z run simultaneously on a single 2-DE gel. Figure 3 shows
842.51, 1045.564, and 2211.104 Da) resulting in mass errors qualitative comparisons of sequentially extracted CWPs and
of less than 30 ppm. A maximum of the five strongest protoplast proteins run on a single gel. Overlaying the
precursor ions per protein spot were chosen for MS/MS images allowed direct comparison of the two. Green spots
analysis. The following monoisotopic precursor selection were sequentially extracted CWPs; red spots were protoplast
criteria were used for MS/MS: minimum S/N filter of 50, proteins; yellow spots were the same proteins presented in
6 Evidence-Based Complementary and Alternative Medicine
both sequentially extracted CWPs and protoplast proteins. proteins [31]. However, we found that the extracts became
Using DIA software analysis, 120 candidate protein spots red during the extraction process and a few broken cells
were identified as CWPs (green spots) in the CyDye staining were also observed under the microscope (data not shown),
gel, and the majority of these CWPs was separated in the indicating that cytosolic proteins might have been released
apparent molecular mass range of 14–50 kDa, and they had during extraction and so contaminated the CWPs. Contin-
pI ranges of 4.0–7.0. uous extraction with chemical regents might also increase
the permeability of the cell wall (theca) membrane and
3.2. Categorization of the A. catenella CWPs. To further protoplast membrane which would have led to the leakage
characterize the samples, 120 confidently identified CWPs of intracellular proteins and subsequently contamination of
of A. catenella DH01 were excised from the silver-staining the CWPs. A study on cell wall proteomics of a green alga,
gels (Figure 4) and trypsinized, before subjection to MALDI- Haematococcus pluvialis, demonstrates that the sequential
TOF-TOF MS analysis. By searching against the NCBI extraction method results in contamination of CWPs with
nonredundant database using the MASCOT algorithm, intracellular proteins [32]. Several intracellular proteins,
no CWPs could be identified which were able to meet RuBisco small subunit orthologue, and ATP synthase-chain
statistical significance. This is not surprising, however, orthologue were found in the SDS-PAGE of the CWPs,
since no dinoflagellate genome has been established at although the contamination was relatively minor. Thus, the
present. Furthermore, de novo sequencing and MS-BLAST sequential extraction method is not a reliable approach for
similarity searches were used for protein identification. A the extraction of CWPs for a cell wall proteomic study
total of 42 proteins were identified, most of which were of dinoflagellates, and so, our study used the 2D DIGE
associated with cell wall modifying enzymes, cell wall struc- method to identify CWPs by combining the sequential
ture, transport/binding, signaling, and defense (Table 1). extraction method with the protoplast preparation method.
Among them, 15 proteins were putative cell wall-modifying The sequentially extracted CWPs were labeled by Cy3,
enzymes, including four hydrolases, two dehydratases, two while the protoplast proteins were labeled by Cy5. By
dehydrogenases, four oxidoreductases, two acyltransferases, comparing the differential expressed proteins to exclude
and one protease. These proteins are involved in various overlayed proteins run on a single gel, the contamination
physiological processes on the cell wall during cell growth of the intracellular proteins resulting from broken cells was
and development. Three putative proteins, D-alanyl-D- excluded, and the CWPs were confidently identified. This
alanine ligase A, UDP-glucose 4-epimerase and penicillin- approach provided a reliable and efficient tool to prepare and
binding protein (PBP) were possibly involved in cell wall identify the CWPs of dinoflagellates.
construction. Transport/binding proteins, and lipoprotein
represented another major group of proteins present in the 4.2. Functions of CWPs in A. catenella . In this study, 42
cell wall. Of these, three belonged to ATP-binding cassette proteins associated with cell wall-modifying enzymes, cell
(ABC) family, three were other types of transport/binding wall structure, transport/binding, signaling, and defense
proteins, and the other was lipoprotein. These proteins were tentatively identified from A. catenella using de novo
were involved in transporting various substrates across the sequencing and MS-BLAST similarity searches. These pro-
cell wall membranes. The signaling proteins were another teins reflected their roles in cell wall physiology.
important component in CWPs of A. catenella, four of them It is known that several reactions (hydrolysis, transgly-
were receptors, one was a binding protein, and two were cosylation, transacylation, and redox reactions) are catalyzed
other signal proteins. Five proteins related to cell defense by cell wall-modifying enzymes [47, 48]. In our study, 15
were identified, they were polymorphic membrane protein putative cell wall-modifying enzymes were identified from
B/C family (PMP), dihydropteroate synthase (DHPS), Vpu the A. catenella cell wall, including hydrolases, dehydratases,
protein, FmtA-like protein, and SPAC328.04 protein. dehydrogenases, oxidoreductases, acyltransferases, and pro-
In addition to the above proteins, several other proteins tease. Hydrolases are classified as EC 3 in the EC number
such as At2g46420/F11C10.11, CG2962, hypothetical mem- classification of enzymes and catalyze the hydrolysis of
brane protein, and PB407L were also characterized amongst various chemical bonds, for example, carbon-nitrogen, ester,
the CWPs of A. catenella, which reflects the roles of CWPs in and peptide. Various hydrolases are reported in bacteria and
cell surface physiology and in interactions between cell and higher plant cell walls and play important roles in fruit
environment. ripening and tissue softening of plants as well as bacterial ger-
mination, vegetative growth, and sporulation [49, 50]. How-
4. Discussion ever, little information is available concerning dinoflagellates.
In our study, four hydrolases, the carbon-nitrogen family,
4.1. Isolation and Identification of CWPs. In this study, competence protein comA, BH3453 protein, and probable
we prepared CWPs using a sequential extraction method. transmembrane protein, were identified from A. catenella
The cells were extracted first with CaCl2 , then sequentially cell walls. Two of them are involved in breaking carbon-
with CDTA, DTT, borate, and NaCl, which can efficiently nitrogen bonds and appear to be involved in the reduction
extract weak bound, strongly ionically bound, and pectin- of organic nitrogen compounds and ammonia production.
bound proteins as well as glycoproteins. This method was Aside from these hydrolase proteins, a protease, methionine
successfully used to extract CWPs from suspension-cultured aminopeptidase (MAP), was identified from the cell wall.
cells of plant species and did not cause contamination of the MAP is responsible for the removal of the amino-terminal
Evidence-Based Complementary and Alternative Medicine 7
(initiator) methionine from nascent eukaryotic cytosolic a crucial role in the selection of the division site in eubacteria,
and cytoplasmic prokaryotic proteins if the penultimate chloroplasts, and probably Archaea and cooperates with
amino acid is small and uncharged. The occurrence of MinC to form a division inhibitor at the cell division site
protease in cell walls is reported in bacteria, green algae, that is topologically regulated by MinE. Recently, MinD has
and higher plants. In a green alga, H. pluvialis, six putative been found in four green algae, and the overexpression of
proteases are identified and are postulated to be involved in MinD results in the MinCD complex binding all cell division
processing and/or turnover of CWPs during cell growth and sites and inhibiting cell division and leads to a long and
development [32]. nonseptate filamentous cell [52]. Moreover, MinD affects
Two dehydratases, mannonate dehydratase and enolase, the diameters of cells. Since in dinoflagellates with a theca
were identified from the A. catenella cell wall. Mannonate (amphiesma) little is known about the cell wall biogenesis
dehydratase belongs to the family of lyases, specifically the and dynamics, identification of MinD suggested that this
hydrolases, which cleave carbon-oxygen bonds and partici- protein might act as a mediator to regulate cell wall growth
pate in pentose and glucuronate interconversions. Enolase, and cell size when exposed to environmental stresses.
also known as phosphopyruvate dehydratase, is a metal- Seven putative transport/binding proteins and lipopro-
loenzyme responsible for the catalysis of 2-phosphoglycerate tein represented another major group of proteins present
to phosphoenolpyruvate, the ninth and penultimate step in the cell wall of A. catenella. ABC family proteins are
of glycolysis. The two enzymes may exert a role in energy transmembrane proteins that utilize the energy of ATP
provision for cell wall formation. hydrolysis to carry out various biological processes including
A number of oxidoreductases were identified amongst translocation of various substrates across membranes, and
the CWPs of A. catenella, including Gll1094 protein, 5, nontransport-related processes such as translation of RNA
10-methylenetetrahydrofolate reductase, tyrosinase, and and DNA repair. They transport a wide variety of sub-
gamma-glutamyl phosphate reductase. Aside from these strates across extra- and intracellular membranes, including
proteins, two dehydrogenases (ethanol dehydrogenase and metabolic products, lipids and sterols, and drugs. Recently,
acyl-CoA dehydrogenase) were also detected in A. catenella. six ATP-binding cassette transporters are identified in the
Acyl-CoA dehydrogenase catalyzes the initial step in each cell wall of H. pluvialis [32]. In Synechocystis, ABC-type
cycle of fatty acid β-oxidation and results in the introduction transporters represent the most abundant transporters in
of a trans double bond between C2 and C3 of the acyl- the periplasmic space that are involved in the uptake of
CoA thioester substrate. Recently, several oxidoreductases, inorganic nutrients [33]. These studies indicate that ATP-
such as peroxidase, peptide Met (O) reductase 3, cytokinin binding cassette transporters might play important roles in
oxidase, thioredoxin H-type 5, and UDP-Nacetylmuramate- the nutrient transport of dinoflagellates. Aside from these
dehydrogenase, are identified in H. pluvialis cell wall extract proteins, outer membrane lipoprotein OMP 16, similar
[32]. It is suggested that oxidoreductases might cause reduc- to uniprot P40548 and calcium channel alpha-1 subunit
tion of cell wall extensibility by forming bridges across phe- homolog, were also identified in the CWPs of A. catenella,
nolic residues and adjacent CWPs or polysaccharides [51]. and these proteins played important roles in protein bind-
Two acyltransferases, phosphotransacetylase and 8- ing, lipid anchor, and calcium binding of the cell walls.
amino-7-oxononanoate synthase, were found in A. catenella. Interestingly, luciferin-binding protein, a protein involved
These two enzymes belong to the family of transferases, in the bioluminescence reaction, was identified from the
specifically the acyltransferase transferring groups rather CWPs of A. catenella. It is interesting to note that most of
than the aminoacyl groups. The former participates in the proteins described above were previously found to be
taurine and hypotaurine metabolism, pyruvate metabolism, associated with the plasma membrane. This suggests that
and propanoate metabolism, while the latter participates in potential direct physical connections may occur between the
biotin metabolism. Both of them might play important roles plasma membrane and the cell wall and/or interactions at the
in the formation and stability maintenance of the cell wall. plasma-cell wall interface [53].
Three putative proteins identified in this study were The signaling proteins are another important component
possibly involved in cell wall construction. PBP is the in plant cell walls, which regulate various biological processes
primary enzyme involved in cell wall biosynthesis including occurring in the cell wall, such as signal transduction, cell
muramoylpentapeptide carboxypeptidase, peptide synthe- shape and size regulation, stress response, and defense.
ses, transpeptidases, and hexosyltransferases. In bacteria, Melanocortin 4 receptor and G-protein receptor are two
PBP is involved in the final stage of the synthesis of peptido- transmembrane receptors that sense molecules outside the
glycan, the major component of bacterial cell walls. Occur- cell and activate inside signal transduction pathways and,
rence of the three proteins suggested that the cell wall of ultimately, cellular responses. G protein-coupled receptors
dinoflagellates may contain components similar to bacterial are found only in eukaryotes. Translocon-associated protein
peptidoglycan, which can form a strong and rigid lattice-like beta and tyrosine kinase negative regulator Cb1 are a signal
structure. Recently, three proteins associated with cell wall sequence receptor and a cell surface receptor linked to sig-
construction, S-layer protein, cellulose synthase, and 1UDP- nal transduction, respectively. Guanine nucleotide-binding
N-acetylmuramoyl-alanine-D-glutamateligas, were identi- proteins are glycoproteins anchored on the cytoplasmic cell
fied from a green alga H. pluvialis [32]. Moreover, cell membrane. They are mediators for many cellular processes,
division inhibitor MinD, a peripheral protein, was identified including signal transduction, protein transport, growth
in our study. MinD is a ubiquitous ATPase that plays regulation, and polypeptide chain elongation. They are also
Evidence-Based Complementary and Alternative Medicine 9
known as GTP-binding proteins and GTPases. Almost all were separated from cytosolic proteins using the 2D DIGE
members of this super family of proteins act as a molecular method. This method has the potential to become a
switch, which is on when GTP is bound and off when reliable complement to other methods currently used in
GDP is bound. CG34393 was involved in regulation of studies of dinoflagellate CWPs. As a preliminary study,
small GTPase-mediated signal transduction. Our study also 120 CWPs were recognized, and 42 were characterized, such
found one light signal transduction protein, Cg1 protein, as cell wall-modifying enzymes, cell wall structural proteins,
which is a light induced protein and regarded as a possible transport/binding proteins, signaling, and defense proteins.
member of a light signal transduction chain in parsley [54], More insights can be expected; for example, the rapid
indicating that Cg1 protein might function as a light-driven analysis of many CWPs as well as the characterization
proton pump and take advantage of light energy directly as of the proteomic changes occurring at the cell wall in
proteorhodopsin in A. catenella. response to environmental stresses are expected to facilitate
Proteins related to cell defense were also identified in the identification of new surface-exposed targets, and this
cell wall of A. catenella. PMP is a bacterial outer membrane can certainly improve our understanding of the relationship
protein which might play important roles in the growth and between cells and environmental variations.
development of Chlamydia pneumoniae [55]. DHPS, which
has been found in bacteria, is a key enzyme in producing
dihydropteroate. In the lower eukaryote Pneumocystis carinii,
Acknowledgments
DHPS is the C-terminal domain of a multifunctional This work was partially supported by research grants from
folate synthesis enzyme [56]. Finding DHPS in A. catenella the Specialized Research Fund for the Doctoral Program of
suggested that this protein might have originated from the Higher Education (no. 20070384014), the National Natural
symbiotic bacteria which are hosted on the surface of A. Science Foundation of China (nos. 40776068 and 40876059),
catenella cells. Vpu protein and FmtA-like protein are two the Ministry of Science and Technology of the People’s
important proteins which play important roles in resisting Republic of China (Project no. 2010CB428703), the Excellent
bacteria and viruses. Group and the Program for New Century Excellent Talents
in University to D.-Z. Wang. Professor John Hodgkiss is
thanked for his help in polishing the English in this paper.
4.3. Protein Identification Using De Novo Analysis and Data-
base Searching. De novo analysis coupled with database
searching is regarded as a powerful proteomic technique References
for protein identification, particularly for species with an
[1] F. J. R. Taylor, The Biology of Dinoflagellates, Black Well
unknown or incomplete genome [57–59]. Comparative Scientific Publications, Oxford, UK, 1987.
genomic and proteomic studies have demonstrated that the [2] M. Kodama, “Ecobiology, classification, and origin,” in
amino acid sequence of proteins is significantly conserved Seafood and Freshwater Toxins: Pharmacology, Physiology and
across species boundaries. The conserved nature of many Detection, L. M. Botana, Ed., pp. 125–151, Marcel Dekker, New
biosynthetic, metabolic, and regulatory pathways in different York, NY, USA, 2000.
organisms was the basis for earlier studies of cross-species [3] G. M. Hallegraeff, “Harmful algal blooms: a global overview,”
protein identification for species whose genome sequence in Manual on Harmful Marine Microalgae, G. M. Hallegraeff,
were unknown or incomplete. Molecular information on cell D. M. Anderson, and A. D. Cembella, Eds., pp. 25–49,
wall biogenesis and dynamics of dinoflagellates is totally lack- Imprimerie Landais, Paris, France, 2005.
ing due to the lack of a dinoflagellate genome at the present. [4] D. M. Anderson, A. D. Cembella, and G. M. Hallegraeff,
Physiological Ecology of Harmful Blooms, Springer, Berlin
For example, not a single CWP has been identified from
Heidelberg, Germany, 1998.
dinoflagellates. In this study, approximately two thirds of the [5] A. R. Loeblich, “The amphiesma or dinoflagellate cell cover-
tested protein spots failed to be characterized in the protein ing,” in Proceedings of the North American Paleont. Convention,
databases, which might be caused by the low sequence Chicago, pp. 867–929, Allen Press, Lawrence, Kan, USA, 1969.
homology matching for unambiguous protein identification [6] A. R. Loeblich and L. A. Loeblich, “Dinoflagellates: structure
across species boundaries. Studies have shown that amino of the amphiesma and re-analysis of thecal plate patterns,”
acid residue substitutions occur in many positions of a Hydrobiologia, vol. 123, no. 2, pp. 177–179, 1985.
specific protein across species boundaries resulting from [7] D. J. Scanlan, N. H. Mann, and N. G. Carr, “The response
evolutionary divergence as well as numerous posttransla- of the picoplanktonic marine cyanobacterium Synechococcus
tional modifications, for example, phosphorylation, glyco- species WH7803 to phosphate starvation involves a protein
sylation, and acetylation, which might reduce or diminish homologous to the periplasmic phosphate-binding protein of
the probability or efficiency of cross-species identification. Escherichia coli,” Molecular Microbiology, vol. 10, no. 1, pp.
181–191, 1993.
In addition, low abundance and limited number of CWP
[8] B. Song and B. B. Ward, “Molecular cloning and char-
sequences present in the available databases might further acterization of high-affinity nitrate transporters in marine
contribute to the limitations of the technique. phytoplankton,” Journal of Phycology, vol. 43, no. 3, pp. 542–
In summary, our study provided a newly developed 552, 2007.
method for identifying and characterizing CWPs from A. [9] Y. Tamai, A. Toh-e, and Y. Oshima, “Regulation of inorganic
catenella. By combining the sequential extraction method for phosphate transport systems in Saccharomyces cerevisiae,”
CWPs and the protoplast preparation method, the CWPs Journal of Bacteriology, vol. 164, no. 2, pp. 964–968, 1985.
10 Evidence-Based Complementary and Alternative Medicine
[10] H. M. ElBerry, M. L. Majumdar, T. S. Cunningham, R. A. [26] B. Palenik and J. A. Koke, “Characterization of a nitrogen-
Sumrada, and T. G. Cooper, “Regulation of the urea active regulated protein identified by cell surface biotinylation of a
transporter gene (DUR3) in Saccharomyces cerevisiae,” Journal marine phytoplankton,” Applied and Environmental Microbi-
of Bacteriology, vol. 175, no. 15, pp. 4688–4698, 1993. ology, vol. 61, no. 9, pp. 3311–3315, 1995.
[11] M. T. Maldonado and N. M. Price, “Reduction and transport [27] S. T. Dyhrman and B. Palenik, “The identification and
of organically bound iron by Thalassiosira oceanica (Bacillar- purification of a cell-surface alkaline phosphatase from the
iophyceae),” Journal of Phycology, vol. 37, no. 2, pp. 298–309, dinoflagellate Prorocentrum minimum (Dinophyceae),” Jour-
2001. nal of Phycology, vol. 33, no. 4, pp. 602–612, 1997.
[12] C. C. Chung, S. P. Hwang, and J. Chang, “Identification of [28] D. K. Stoecker and D. E. Gustafson, “Cell-surface proteolytic
a high-affinity phosphate transporter gene in a Prasinophyte activity of photosynthetic dinoflagellates,” Aquatic Microbial
alga, Tetraselmis chui, and its expression under nutrient Ecology, vol. 30, no. 2, pp. 175–183, 2003.
limitation,” Applied and Environmental Microbiology, vol. 69, [29] S. T. Dyhrman, “Ectoenzymes in Prorocentrum minimum,”
no. 2, pp. 754–759, 2003. Harmful Algae, vol. 4, no. 3, pp. 619–627, 2005.
[13] M. Hildebrand, “Cloning and functional characterization [30] T. Bertomeu, J. W. Hastings, and D. Morse, “Vectorial labeling
of ammonium transporters from the marine diatom Cylin- of dinoflagellate cell surface proteins,” Journal of Phycology,
drotheca fusiformis (Bacillariophyceae),” Journal of Phycology, vol. 39, no. 6, pp. 1254–1260, 2003.
vol. 41, no. 1, pp. 105–113, 2005. [31] D. Robertson, G. P. Mitchell, J. S. Gilroy, C. Gerrish, G. P.
[14] A. E. Allen, “Beyond sequence homology: redundant ammo- Bolwell, and A. R. Slabas, “Differential extraction and protein
nium transporters in a marine diatom are not functionally sequencing reveals major differences in patterns of primary
equivalent,” Journal of Phycology, vol. 41, no. 1, pp. 4–6, 2005. cell wall proteins from plants,” Journal of Biological Chemistry,
[15] A. K. Davis, M. Hildebrand, and B. Palenik, “A stress- vol. 272, no. 25, pp. 15841–15848, 1997.
induced protein associated with the girdle band region of the [32] S. B. Wang, Q. Hu, M. Sommerfeld, and F. Chen, “Cell
diatom Thalassiosira pseudonana (Bacillariophyta),” Journal of wall proteomics of the green alga Haematococcus pluvialis
Phycology, vol. 41, no. 3, pp. 577–589, 2005. (Chlorophyceae),” Proteomics, vol. 4, no. 3, pp. 692–708, 2004.
[16] C. M. West, P. Zhang, A. C. McGlynn, and L. Kaplan,
[33] F. Huang, E. Hedman, C. Funk, T. Kieselbach, W. P. Schroder,
“Outside-in signaling of cellulose synthesis by a spore coat
and B. Norling, “Isolation of outer membrane of Synechocystis
protein in Dictyostelium,” Eukaryotic Cell, vol. 1, no. 2, pp.
sp. PCC 6803 and its proteomic characterization,” Molecular
281–292, 2002.
and Cellular Proteomics, vol. 3, no. 6, pp. 586–595, 2004.
[17] D. M. Landry, T. Gaasterland, and B. P. Palenik, “Molecular
[34] L. L. Chan, S. C. L. Lo, and I. J. Hodgkiss, “Proteomic study
characterization of a phosphate-regulated cell-surface protein
of a model causative agent of harmful red tide, Prorocentrum
from the coccolithophorid, Emiliania huxleyi (Prymnesio-
triestinum I: optimization of sample preparation method-
phyceae),” Journal of Phycology, vol. 42, no. 4, pp. 814–821,
ologies for analyzing with two-dimensional electrophoresis,”
2006.
Proteomics, vol. 2, no. 9, pp. 1169–1186, 2002.
[18] B. Palenik and F. M. M. Morel, “Amino acid utilization by
marine phytoplankton: a novel mechanism,” Limnology and [35] L. L. Chan, I. J. Hodgkiss, and S. C. L. Lo, “Proteomic
Oceanography, vol. 35, no. 2, pp. 260–269, 1990. study of a model causative agent of harmful algal blooms,
[19] B. Palenik and F. M. M. Morel, “Comparison of cell-surface Prorocentrum triestinum II: the use of differentially expressed
L-amino acid oxidases from several marine phytoplankton,” protein profiles under different growth phases and growth
Marine Ecology Progress Series, vol. 29, pp. 195–201, 1990. conditions for bloom prediction,” Proteomics, vol. 4, no. 10,
[20] B. Palenik and F. M. M. Morel, “Amine oxidases of marine pp. 3214–3226, 2004.
phytoplankton,” Applied and Environmental Microbiology, vol. [36] L. L. Chan, I. J. Hodgkiss, S. H. Lu, and S. C. L. Lo, “Use of 2-
57, no. 8, pp. 2440–2443, 1991. DE electrophoresis proteome reference maps of dinoflagellates
[21] A. Strojsova, J. Vrba, J. Nedoma, and K. Simek, “Extracellular for species recognition of causative agents of harmful algal
phosphatase activity of freshwater phytoplankton exposed blooms,” Proteomics, vol. 4, no. 1, pp. 180–192, 2004.
to different in situ phosphorus concentrations,” Marine and [37] L. L. Chan, I. J. Hodgkiss, P. K. Lam et al., “Use of two-
Freshwater Research, vol. 56, no. 4, pp. 417–424, 2005. dimensional gel electrophoresis to differentiate morphos-
[22] S. T. Dyhrman and B. Palenik, “Characterization of ectoen- pecies of Alexandrium minutum, a paralytic shellfish poison-
zyme activity and phosphate-regulated proteins in the coccol- ing toxin-producing dinoflagellate of harmful algal blooms,”
ithophorid Emiliania huxleyi,” Journal of Plankton Research, Proteomics, vol. 5, no. 6, pp. 1580–1593, 2005.
vol. 25, no. 10, pp. 1215–1225, 2003. [38] L. L. Chan, W. H. Sit, P. K. S. Lam et al., “Identification and
[23] J. K. Middlemiss, A. M. Anderson, C. W. Stratilo, and H. G. characterization of a ”biomarker of toxicity” from the pro-
Weger, “Oxygen consumption associated with ferric reductase teome of the paralytic shellfish toxin-producing dinoflagellate
activity and iron uptake by iron-limited cells of Chlorella Alexandrium tamarense (Dinophyceae),” Proteomics, vol. 6, no.
kessleri (Chlorophyceae),” Journal of Phycology, vol. 37, no. 3, 2, pp. 654–666, 2006.
pp. 393–399, 2001. [39] N. B. Larbi and C. Jefferies, “2D-DIGE: comparative pro-
[24] Y. Xu, T. M. Wahlund, L. Feng, Y. Shaked, and F. M. M. teomics of cellular signalling pathways,” Methods in Molecular
Morel, “A novel alkaline phosphatase in the coccolithophore Biology, vol. 517, pp. 105–132, 2009.
Emiliania huxleyi (Prymnesiophyceae) and its regulation by [40] H. L. Huang, T. Stasyk, S. Morandell et al., “Biomarker
phosphorus,” Journal of Phycology, vol. 42, no. 4, pp. 835–844, discovery in breast cancer serum using 2-D differential
2006. gel electrophoresis/MALDI-TOF/TOF and data validation by
[25] A. E. Gau, A. Heindl, A. Nodop, U. Kahmann, and E. K. routine clinical assays,” Electrophoresis, vol. 27, no. 8, pp. 1641–
Pistorius, “L-amino acid oxidases with specificity for basic L- 1650, 2006.
amino acids in cyanobacteria,” Journal of Biosciences, vol. 62, [41] Y. Fan, T. B. Murphy, J. C. Byrne, L. Brennan, J. M. Fitzpatrick,
no. 3-4, pp. 273–284, 2007. and R. W. G. Watson, “Applying random forests to identify
Evidence-Based Complementary and Alternative Medicine 11
biomarker panels in serum 2D-DIGE data for the detection [58] N. S. Tannu and S. E. Hemby, “De novo protein sequence
and staging of prostate cancer,” Journal of Proteome Research, analysis of Macaca mulatta,” BMC Genomics, vol. 8, article 270,
vol. 10, no. 3, pp. 1361–1373, 2011. 2007.
[42] T. Kondo, “Tissue proteomics for cancer biomarker develop- [59] B. Samyn, K. Sergeant, S. Memmi, G. Debyser, B. Devreese,
ment—laser microdissection and 2D-DIGE,” Journal of Bio- and J. Van Beeumen, “MALDI-TOF/TOF de novo sequence
chemistry and Molecular Biology Reports, vol. 41, no. 9, pp. analysis of 2-D PAGE-separated proteins from Halorhodospira
626–634, 2008. halophila, a bacterium with unsequenced genome,” Elec-
[43] R. Kramer and D. Cohen, “Functional genomics to new drug trophoresis, vol. 27, no. 13, pp. 2702–2711, 2006.
targets,” Nature Reviews Drug Discovery, vol. 3, no. 11, pp.
965–972, 2004.
[44] D. Z. Wang, S. G. Zhang, H. F. Gu, L. L. Chan, and H. S.
Hong, “Paralytic shellfish toxin profiles and toxin variability
of the genus Alexandrium (Dinophyceae) isolated from the
Southeast China Sea,” Toxicon, vol. 48, no. 2, pp. 138–151,
2006.
[45] M. D. Keller, R. C. Selvin, W. Claus, and R. R. L. Guillard,
“Media for the culture of oceanic ultraphytoplankton,” Journal
of Phycology, vol. 23, pp. 633–638, 1987.
[46] D. Z. Wang, C. Li, Z. X. Xie, P. D. Dong, L. Lin, and H. S.
Hong, “Homology-driven proteomics of dinoflagellates with
unsequenced genome by MALDI-TOF/TOF and automated de
novo sequencing,” eCAM. In press.
[47] D. J. Cosgrove, “Enzymes and other agents that enhance cell
wall extensibility,” Annual Review of Plant Biology, vol. 50, pp.
391–417, 1999.
[48] S. C. Fry, “Polysaccharide-modifying enzymes in the plant cell
wall,” Annual Review of Plant Physiology and Plant Molecular
Biology, vol. 46, pp. 497–520, 1995.
[49] J. J. Gumucio and J. D. Ostrow, “Brown pigment gallstones: the
role of bacterial hydrolases and another missed opportunity,”
Hepatology, vol. 13, no. 3, pp. 607–609, 1991.
[50] Z. Minic, “Physiological roles of plant glycoside hydrolases,”
Planta, vol. 227, no. 4, pp. 723–740, 2008.
[51] S. H. Kim, J. R. Shinkle, and S. J. Roux, “Phytochrome induces
changes in the immunodetectable level of a wall peroxidase
that precede growth changes in maize seedlings,” Proceedings
of the National Academy of Sciences of the United States of
America, vol. 86, no. 24, pp. 9866–9870, 1989.
[52] W. Z. Liu, Y. Hu, R. J. Zhang et al., “Transfer of a eubacteria-
type cell division site-determining factor CrMinD gene to
the nucleus from the chloroplast genome in Chlamydomonas
reinhardtii,” Chinese Science Bulletin, vol. 52, no. 18, pp. 2514–
2521, 2007.
[53] B. D. Kohorn, “Plasma membrane-cell wall contacts,” Plant
Physiology, vol. 124, no. 1, pp. 31–38, 2000.
[54] O. C. Silva, “CG-1, a parsley light-induced DNA-binding
protein,” Plant Molecular Biology, vol. 25, no. 5, pp. 921–924,
1994.
[55] J. Grimwood, L. Olinger, and R. S. Stephens, “Expression
of Chlamydia pneumoniae polymorphic membrane protein
family genes,” Infection and Immunity, vol. 69, no. 4, pp. 2383–
2389, 2001.
[56] F. Volpe, M. Dyer, J. G. Scaife, G. Darby, D. K. Stammers, and
C. J. Delves, “The multifunctional folic acid synthesis fas gene
of Pneumocystis carinii appears to encode dihydropteroate syn-
thase and hydroxymethyldihydropterin pyrophosphokinase,”
Gene, vol. 112, no. 2, pp. 213–218, 1992.
[57] A. L. Yergey, J. R. Coorssen, P. S. Backlund et al., “De novo
sequencing of peptides using MALDI/TOF-TOF,” Journal of
the American Society for Mass Spectrometry, vol. 13, no. 7, pp.
784–791, 2002.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 471020, 16 pages
doi:10.1155/2011/471020
Research Article
Homology-Driven Proteomics of Dinoflagellates with
Unsequenced Genomes Using MALDI-TOF/TOF and Automated
De Novo Sequencing
Da-Zhi Wang, Cheng Li, Zhang-Xian Xie, Hong-Po Dong, Lin Lin, and Hua-Sheng Hong
State Key Laboratory of Marine Environmental Science/Environmental Science Research Center, Xiamen University,
Xiamen 361005, China
This study developed a multilayered, gel-based, and underivatized strategy for de novo protein sequence analysis of unsequenced
dinoflagellates using a MALDI-TOF/TOF mass spectrometer with the assistance of DeNovo Explorer software. MASCOT was
applied as the first layer screen to identify either known or unknown proteins sharing identical peptides presented in a database.
Once the confident identifications were removed after searching against the NCBInr database, the remainder was searched
against the dinoflagellate expressed sequence tag database. In the last layer, those borderline and nonconfident hits were further
subjected to de novo interpretation using DeNovo Explorer software. The de novo sequences passing a reliability filter were
subsequently submitted to nonredundant MS-BLAST search. Using this layer identification method, 216 protein spots representing
158 unique proteins out of 220 selected protein spots from Alexandrium tamarense, a dinoflagellate with unsequenced genome,
were confidently or tentatively identified by database searching. These proteins were involved in various intracellular physiological
activities. This study is the first effort to develop a completely automated approach to identify proteins from unsequenced
dinoflagellate databases and establishes a preliminary protein database for various physiological studies of dinoflagellates in the
future.
Proteins are the actual “machinery” that brings about A. tamarense thereby facilitating the use of this HAB model
cell growth, proliferation, and homeostasis, and it is logical, in various studies.
therefore, that the study of proteins should help uncover in
broad terms the various mechanisms involved in the bio-
logical activities of dinoflagellates. Global techniques such as
2. Materials and Methods
proteomics provide effective strategies and tools for profiling 2.1. Organism and Growth Conditions. The strain of
and identifying dinoflagellate proteins, and, in contrast to A. tamarense was provided by the Culture Collection Center
conventional biochemical approaches that addressed one or of Marine Bacteria and Algae of the State Key Laboratory of
a few specific proteins at a time, the proteomic techniques Marine Environmental Science, Xiamen University, China.
allow simultaneous isolation and identification of hundreds The unialgal isolate was routinely maintained in K medium
to thousands of proteins in one sample. In the past few [29] at 20◦ C under a 14 : 10 h light : dark photoperiod at a
years, the proteomic approach has been applied to the study light intensity of approximately 100 μmoL photons m−2 s−1
of dinoflagellates, and a few important proteins have been provided by fluorescent lamps. The cells for the experiments
discovered or identified [16–18]. However, only 3,578 and were grown in 5,000 mL flasks containing 4,000 mL of K
2,621 dinoflagellate proteins are annotated in the NCBI medium, the culture conditions were the same as above.
and UniProtKB (December, 2010), respectively. The highly The K-medium did not contain any protein. Approximately
uncharacterized nature of the dinoflagellate proteome makes 2 × 107 cells of A. tamarense in the middle exponential
it difficult to identify proteins, demonstrate differential growth phase were collected by centrifugation at 3,000 ×g
regulation of proteins, and investigate their posttranslational for 30 minutes at 4◦ C. The cell pellets were rinsed twice
modifications. The lack of a genome limits the use of with precooled sterilized seawater to avoid any carryover of
dinoflagellates for proteomic studies which rely on database culture medium and extracellular proteins, ready for protein
searches for protein identification. Recently, with the fast extraction.
development of MALDI-TOF-TOF MS technology, this
limitation has been overcome to some extent using a de novo
sequencing strategy, in which partial or complete amino acid 2.2. Protein Extraction and Determination. Protein extrac-
sequences are obtained using either manual or automated tion was performed according to the method developed by
de novo peptide sequence analysis. This approach has been Lee and Lo [30]. Briefly, 1 mL Trizol reagent was added to
successfully applied in recent studies with incomplete- or the cell pellet and subjected to sonication (a total of 2 min
nongenome organisms in order to characterize their proteins with short pulses of 3–5 s) on ice. Lysis of cells was confirmed
[19–23]. using light microscope. Subsequently, 200 μL of chloroform
Alexandrium is a widely distributed dinoflagellate genus was added to the cell lysate before shaking vigorously for
in many coastal regions around the world. It is well known 15 s. The mixture was allowed to stand for 5 min at room
that many species from this genus can produce potent temperature before being centrifuged at 12,000 ×g for 15 min
neurotoxins which cause PSPs through the consumption at 4◦ C The top pale yellow or colorless layer was removed,
of shellfish contaminated by toxins [24, 25]. The losses in and then 300 μL of ethanol was added to resuspend the
mariculture and the threats to human life due to exposure to reddish bottom layer, and the mixture centrifuged at 2,000
PSPs have been documented increasingly and have become ×g for 5 min at 4◦ C. The supernatant was transferred to a
economic and public health concerns around the world. new tube, and 2 mL of isopropanol was added. The mixture
Recently, many efforts have been devoted to establish the was allowed to stand for at least 1 hr for precipitation of
expressed sequence tag (EST) library of Alexandrium and proteins at −20◦ C. It was then centrifuged at 14,000 ×g
other dinoflagellate species, which provides a powerful tool for 30 min at 4◦ C. The pellet obtained was briefly washed
to predict protein families and to develop expression systems with 95% ethanol before being allowed to air dry. 30 μL of
for new proteins and their functions [26–28]. Our study rehydration buffer (7 M urea, 2 M thiourea, 4% w/v CHAPS,
selected A. tamarense as the model dinoflagellate species, and 1% DTT, and 0.5% v/v IPG) was added to solubilize the
a layered method combining MALDI-TOF-TOF MS with protein pellet. Protein quantification in the urea-containing
de novo sequence analysis and stringent homology-based protein samples was performed using a 2D Quant kit (GE
searching tools was employed to identify the proteins. A Healthcare, USA).
highly specific and stringent MASCOT search was applied as
the first layer to identify proteins with identical peptides in 2.3. 2-DE and Analysis. Exactly 400 μg of protein sample was
the present database; the remainder were searched against a mixed with a rehydration buffer (7 M urea, 2 M thiourea,
dinoflagellate EST database combined with BLASTX analy- 4% w/v CHAPS, 1% DTT, and 0.5% v/v IPG) before being
sis. In the last layer, those borderline and nonconfident hits loaded onto IPG strips with a linear pH gradient of 4–7
were subjected to automated de novo sequencing and homol- (Immobiline Drystrip, pH 4–7, GE Healthcare Life Science,
ogy searches using the homology-based search algorithm, Piscataway, USA). The sample was subjected to isoelectric
MS-BLAST. Using this strategy, 158 unique proteins in 220 focusing using an IPGphor III system with 24 cm IPG strips
selected protein spots were identified from A. tamarense, following the manner: 6 h at 40 V (active rehydration),
and these proteins were involved in various physiological 6 h at 100 V, 0.5 h at 500 V, 1 h at 1,000 V, 1 h at 2,000 V,
activities. The current study validated a robust method 1.5 h at 10,000 V, and 60,000 Vh at 10,000 V. The minimal
to characterize proteins from an unsequenced database of Vh applied was at least 60,000 units. Subsequently, the
Evidence-Based Complementary and Alternative Medicine 3
immobilized pH gradient strips were equilibrated for 15 min exclusion list used to generate the peptide mass list for the
in reducing buffer containing 6 M urea, 2% SDS, 50 mM database search.
Tris-Cl (pH 8.8), 30% glycerol, and 1% DTT, followed by
equilibration for 15 min in alkylation buffer containing 6 M
urea, 2% SDS, 50 mM Tris-Cl (pH 8.8), 30% glycerol, and 2.6. De Novo Sequencing. The Applied Biosystem DeNovo
2.5% iodoacetamide. Two-dimension SDS-PAGE (2-DE) gels Explorer software (AB SCIEX) was used for automated de
(12.5%) were run in an EttanDalt system (GE Healthcare) novo sequencing followed by manual confirmation of most
at 1 w/gel for 30 min and then at 15 w/gel for 6 h. The 2-DE sequences generated. Those nonconfident fits were submit-
gels were visualized using Coomassie Blue (CBB) staining ted to de novo sequencing analysis. The de novo sequencing
and digitized using a gel documentation system on a GS- parameters were set as follows: trypsin as the protease with
670 Imaging Densitometer from Bio-Rad (USA) with 2-DE one maximum missed cleavage allowed, the error tolerance
electrophoretogram-matching software. of a parent- and fragment-mass was 0.08 u, deconvolute
the charge state in the spectra to generate a spectrum in
which each monoisotopic peak becomes singly charged,
2.4. In-Gel Trypsin Digestion. Two hundred and twenty
carbamidomethylation of cysteine as fixed modification and
protein spots were manually excised from preparative CBB
methionine oxidation as variable modification. The most
stained 2-DE gels (Figure 2). CBB-stained gel pieces were
abundant peptide fragments “b-ions and y-ions”, the less
washed with MilliQ water for 10 min, destained three times
abundant peptide fragments “a-ions”, the neutral losses of
in 200 μL of 25 mM NH4 HCO3 in 50% acetonitrile (ACN)
water and ammonia for b-ions and y-ions, as well as the
for 20 min at 37◦ C, and then incubated in 200 μL of 100%
immonium ions were used to deduce confident and complete
ACN at room temperature with occasional vortexing, until
peptide sequences de novo from MS/MS spectra. Each
the gel pieces became white and shrunken. They were then
MS/MS spectrum produced ten peptide sequence candidates,
air dried at room temperature for 30 min. All gel pieces were
and each peptide sequence had a score associated with it
incubated with 12.5 ng/μL sequencing-grade trypsin (Roche
that indicated how much of the total ion abundance in the
Molecular Biochemicals) in 10 mM NH4 HCO3 overnight
MS/MS spectrum was accounted for by the typical fragment
at 37◦ C. After digestion, the supernatants were discarded.
ions that can be calculated for the particular sequence; the
Peptides were extracted from the gel pieces first into 50%
closer the score was to 100, the greater the likelihood that all
ACN, 0.1% trifluoroacetic acid, and then into 100% ACN.
or most of the sequence generated by the DeNovo Explorer
All extracts were pooled and dried completely by SpeedVac.
was corrected. In order to minimize randomness, only those
Peptide mixtures were redissolved in 0.1% TFA, and 1 μL of
peptides with a score higher than 50 were considered in this
peptide solution was mixed with 1 μL of matrix (α-cyano-
study.
4-hydroxycinnamic acid (CHCA) in 30% ACN, 0.1% TFA)
before spotting on the target plate.
2.7. Database Searches. A combined MS and MS/MS search
2.5. Mass Spectrometric Analysis. Mass spectrometry analyses was first performed against the NCBI database with no
were conducted using an AB SCIEX MALDI TOF-TOF taxonomic restriction (updated December, 2010, contain-
5800 Analyzer (AB SCIEX, Shanghai, China) equipped ing 4,607,655 entries) using an in-house MASCOT server
with a neodymium: yttrium-aluminum-garnet laser (laser (Version 2.2). The raw MS and MS/MS spectra were
wavelength was 349 nm), in reflection positive-ion mode. processed using GPS Explorer software (Version 3.5, Applied
With CHCA as the matrix, TFA for an ionization auxiliary Biosystems, USA) with the following criteria: MS peak
reagent, and calibrated with Sequenzyme peptide standard filtering mass range, 850–4,000 Da; minimum signal-to-
kit (AB SCIEX), the MS spectra were processed using noise ratio, 10; peak density filter, 50 peaks per 200 Da;
TOF/TOF Series Explorer software (AB SCIEX) allowing maximum number of peaks, 65; MS/MS peak filtering-mass
nonredundant and fully automated selection of precursors range, 60–200 Da. The searches were conducted using the
for MS/MS acquisition. At least 1,000 laser shots were following setting: one missed cleavage, P < 0.05 significance
typically accumulated with a laser pulse rate of 400 Hz in threshold, 50 ppm peptide mass tolerance, 0.25 Da fragment
the MS mode, whereas in the MS/MS mode spectra up to mass tolerance peptide mass tolerance of 50 ppm, MS/MS
2,000 laser shots were acquired and averaged with a pulse ion tolerance of 0.1 Da, carbamidomethylation of cysteine
rate of 1,000 Hz. Peptides were fragmented with collision- as fixed modification, and methionine oxidation as variable
induced decomposition (CID) with an energy of 1 kV. For modification. For a protein scores confidence interval (C.I.)
CID experiments, ambient air was used as collision gas below 95%, the MS/MS spectra were subjected to similarity
with medium pressure of 10−6 Torr. The 20 most intense searches against the dinoflagellate EST database (down-
precursors per spot were selected with a minimum signal- loaded from NCBI, updated December, 2010, containing
to-noise (S/N) ratio of 50 and were fragmented in the CID 171,550 entries) using the BLASTX algorithm [31]. The
mode. The peak detection criteria used were a minimum similarities were considered to be significant when the total
S/N of 10, a local noise window width mass/charge (m/z) ion C.I. % was ≥95, and the E value was below e−20 .
of 200 and a minimum full-width half-maximum (bins) of Nonetheless, the remaining hits were further identified using
2.9. The contaminant m/z peaks originating from human de novo sequencing and homology-based search as previously
keratin, trypsin autodigestion, or matrix were included in the described [32].
4 Evidence-Based Complementary and Alternative Medicine
Tentative match by
No match or unknown proteins
identity to another species
Figure 1: Multilayered protein identification workflow. After MASCOT search against the NCBI database, confident hits were identified
with at least two peptides and protein scores above the minimum C.I. of 95%. Cross-species hits matching one peptide or protein scores
below C.I. 95% were considered as borderline and were subjected to similarity searches against the dinoflagellate EST database using the
BLASTx algorithm. The sequence similarities were considered to be significant if total ions score C.I. was ≥95% and the E value was ≤e−20
at the amino acid sequence level. Nonconfident hits were interpreted using DeNovo Explorer software and MS-BLAST searches. Only HSPs
with a score of 62 or above were considered confident.
De novo generated peptide sequences were used for to MASCOT search against the NCBI database with no
homology searches using the MS BLAST algorithm. The taxonomic restriction. If the database entries were matched
MS-BLAST searches were conducted via the Washington with at least two peptides and the protein scores taken from
University server (http://genetics.bwh.harvard.edu/msblast/ MS combined MS/MS search had a minimum C.I. of 95%,
disclaimer ms.html) against the NCBI nonredundant the protein hits were regarded as confident identifications.
database using standard settings with no taxonomic Cross-species hits matching one peptide or protein scores
restriction. All sequences obtained from a MS/MS spectrum below a C.I. of 95% were considered as low-confidence
were spaced with the minus symbol (−) and were merged identifications, and the MS/MS spectra were subjected to
into a single string and submitted to an MS-BLAST search as similarity searches against the dinoflagellate EST database.
reported before [33, 34]. The MS-BLAST search results were The sequences were then subjected to similarity searches
regarded as significant if the resulting scores were higher against the NCBI nonredundant protein database (nr) using
than the threshold score indicated in the MS-BLAST scoring the BLASTX algorithm [31]. If the total ions score C.I. was
scheme. However, only high-scoring segment pairs (HSSPs) above 95% and the E value was below e−20 at the amino
with a score of 62 or above were considered. The clusters of acid sequence level, the sequence similarities were considered
orthologous groups [35] databases were used to infer the to be significant. In the last layer, those nonconfident hits
functional classification of the proteins identified. were sequenced using de novo sequencing software to obtain
candidate sequences and submitted to MS-BLAST searches.
In the homology-based search, the statistical significance
3. Results of hits was evaluated according to the MS BLAST scoring
3.1. The Workflow of Protein Identification. The multilayered scheme. Only HSSPs with a score of 62 or above were
workflow integrated mass spectra processing with conven- considered to be confident [36, 37].
tional and homology-based searches is outlined in Figure 1.
Briefly, the MS and MS/MS spectra of each protein spot 3.2. Protein Identification Using Mascot and Dinoflagellate
obtained from MALDI-TOF-TOF MS were first submitted EST Searches. The protein extract from A. catenella was
Evidence-Based Complementary and Alternative Medicine 5
M.W kDa
96
PI 4–7
Figure 2: Representative 2-DE gel of an A. tamarense protein sample stained with CCB. The proteins were resolved in a linear 4–7 pH
gradient (Immobiline DryStrips) and 12.5% SDS-PAGE.
separated using 2-DE and visualized using the modified which was regarded as the borderline. A large proportion
CBB stain method. An average of about 880 protein spots of the identified proteins showed a high level of similarity
was detected in the 2-DE gel (Figure 2). Among them, 220 to the proteins of dinoflagellates (49.0%), nondinoflagellate
representing low, moderate, and high abundance intracel- algae (8.7%), and other species of organisms (42.3%)
lular proteins were randomly excised from the 2-DE gel (Figure 5(a)).
and were in-gel digested using trypsin after destaining the The remaining 116 protein spots with low protein scores
gel plugs. The peptide fragments extracted from the gel (<C.I 95%) as well as those proteins with one MS/MS hit
plugs were subjected to tandem mass spectrometry using the were subjected to search against the EST database about
AB SCIEX MALDI-TOF/TOF 5800 System. Tandem mass dinoflagellate sequences, combining with BLASTX analysis.
spectra excluding contaminant peaks from human keratin, With a stringent cut-off E value of e−20 or less and a total
trypsin autodigestion, or matrix were directly submitted for ion C.I. % of ≥95, a total of 72 sequence similarities were
database searching (GPS Explore: MASCOT) for protein confidently identified in A. tamarense (Supplemental file
characterization using the NCBInr database with or without 1). A large proportion of the identified proteins showed a
all known posttranslational modifications. Out of the 220 high level of similarity to dinoflagellate proteins (59.7%),
protein spots, 104 were identified statistically as cross- nondinoflagellate algae (11.1%), and other species of organ-
species matches yielding positive characterization and high isms (29.2%) (Figure 5(b)). The rest of the protein spots
matching score in MASCOT searches and accounted for a with nonconfident hits were subsequently identified using a
half of the totally identified proteins (see Supplemental file 1 combination of de novo sequencing and MS-BLAST searches.
available online at doi:10.1155/2011/471020). Among them
were 100 protein spots with two or more MS/MS significant 3.3. Protein Identification Using De Novo Sequencing and
hits, and four protein spots with one MS/MS significant hit MS-BLAST Searches. Typically, the 20 most intense peaks
6 Evidence-Based Complementary and Alternative Medicine
in the PMF were selected for MS/MS analysis. The tandem search query and analyzed using the MS BLAST algorithm.
mass spectra were analyzed using DeNovo Explorer software The results were chosen according to the number of
to generate amino acid sequences and deconvoluted to HSSPs from different MS/MS spectra [37], and phylogenetic
minimize the error in de novo sequencing. DeNovo Explorer closeness to dinoflagellates was also considered. Using this
works in the same way as PEAKS: briefly, the algorithm strategy, 40 protein spots out of 44 protein spots were
first computes a y-ion matching score and a b-ion matching tentatively identified, 32 of them obtaining two or more
score at each mass value according to the peaks around it. HSSP significant hits and eight only one. However, four
If there are no peaks around a mass value, a penalty value protein spots could not obtain positive identification and
is assigned. The algorithm then efficiently computes many were assigned to unknown proteins (Supplemental file 1).
amino acid sequences, and each candidate peptide sequence A large proportion of the identified proteins showed a high
is assigned a score that indicates the degree of matching of the level of similarity to proteins of dinoflagellates (15.0%), non-
peaks and the intensity of the peaks between the theoretical dinoflagellate algae (2.5%) and other species of organisms
fragmentation spectrum and the fragmentation spectrum (82.5%) (Figure 5(c)).
that corresponds to the peaks in the peak list. The scores
in the Denovo Explorer are calculated based on the percent
3.4. Validation of MASCOT Cross-Species Identifications
peak intensity match of the fragments between the actual
with Borderline Statistical Confidence. Cross-species iden-
data and the candidate peptide. These candidate sequences
tification of proteins by matching identical peptides in
are further evaluated by a more accurate scoring function,
known homologous proteins is a conventional proteomic
which also considers other ion types such as immonium ions
methodology. However, such identification often results in
and internal cleavage ions [32].
borderline statistical confidence due to the relatively rare
In most spots, 100 to 200 amino acid sequences, with
peptides and only a few peptide sequences matching. Here,
a length varying between seven and 37 amino acids, were
we demonstrate how de novo sequencing and MS BLAST
obtained de novo. In this study, the de novo sequencing
searches provided independent validation of borderline
selects the most abundant peptide fragments “b-ions” and
cross-species MASCOT hits [39]. The MS BLAST scoring
“y-ions”, less abundant peptide fragments “a-ions”, and the
scheme and its validation are described elsewhere [37].
neutral losses of water and ammonia for b-ions and y-ions
In spot 187 of the above sample of A. tamarense proteins,
as well as immonium ions to generate confident peptide
a MASCOT search identified a plausible homologue of the
sequences de novo from MS/MS spectra. Figure 3 shows the
chloroplast light harvesting complex protein from another
MS spectrum of the in-gel tryptic peptide mixture of spot
algal species, Heterocapsa triquetra. However, this identifica-
124, and displays the fragmentation pattern of a precursor
tion relied upon a single exactly matching peptide, and, in
ion with m/z of 1755.6631 from spot 124 and the b-, y-,
line with current proteomics guidelines [40], it should be
a-, and immonium ions as well as the neutral losses of
considered as borderline. To validate this hit, the MS/MS
water and ammonia for y-ions and b-ions (Figure 4(a)). Ten
spectrum was then interpreted de novo (Figures 6(a1) and
possible peptide sequences for this precursor were deduced
6(b)), and the top ten candidate sequences were linked in
from DeNovo Explorer de novo sequencing and are listed
a string and submitted to MS BLAST search (Figure 6(e)),
in the order according to their scores in Figure 4(b). The
which produced a statistically confident hit from A. carterae
peptide sequence candidate with the highest score for this
to the overlapping sequence stretch in a related database
precursor was “NNHDENVGAVIVGFDR” deduced from
entry. It should be noted that peptide sequences of the
DeNovo Explorer de novo sequencing. A similar analysis was
MASCOT hit and de novo candidates differed in their length
performed on the other selected protein spots.
of amino acid sequence, and, currently, it is not possible
The de novo deduced peptide sequences were used
to judge which peptide sequence was correct, since the full
to identify the proteins using sequence similarity search-
sequence of the A. tamarense protein remains unknown.
ing. Several database searching tools have been developed
The two proteins from the MASCOT hit and MS BLAST
that accommodate the specific requirements of MS/MS
search were homologous. However, this did not affect the
sequencing [27, 38]. In our study, the homology-based data
confidence of the MS BLAST hit assignment, which relies
search approach MS-BLAST was used. This is the most
upon an independent scoring scheme that only considers the
popular database search approach for identifying unknown
local similarity of sequence stretches aligned within the HSP.
proteins using sequence similarity to homologous proteins
In regard to spot 214, the MASCOT hit and the result of
available in a database. The redundant, degenerate, and
MS BLAST search using de novo candidates were identical
partially inaccurate peptide sequences obtained by de novo
using validated methods [36] (Figures 6(a2), 6(a3), 6(c)
interpretation of MS/MS spectra are assembled into a single
and 6(e)). Additionally, MS BLAST searches also revealed
searching string in arbitrary order [33, 37]. The quality of the
one new peptide (precursor MW 2480.3132) from a protein
results is dependent on the number of peptides sequenced
already matched by MASCOT (spot 214) thus improving the
and the accuracy of the sequence information entered, as well
sequence coverage and confidence of identification.
as database completeness and species-to-species sequence
variability for the peptides entered. It is also possible to enter
a part of the sequence as a mass, along with a tolerance factor. 3.5. Functional Categorization of the Proteins Identified
The de novo derived sequence information from each from A. tamarense. Using the multilayer, stringent, and
protein spot with nonconfident hits was combined in one homology-similarity database searching strategy, 216 protein
Evidence-Based Complementary and Alternative Medicine 7
930.38
100 1E + 4
90
80
70
877.41
60
1755.66
50
40
1275.55 2214.89
867.32 1882.72
30 1261.5
1845.87 2230.97
1041.45
20 1295.46
2389.01 2603.02
1585.63 2067.89
882.43 1045.44 1396.64 1838.68 2010.81
10 2619.02
934.42 1769.68 2457.02 2770.04
1166.54 1506.66 2022.77 2210.85 2608.02
1325.57 1678.65 1860.73 2377.94 2881.14 3101.16 3307.42 3473.54
0
849 1481.8 2114.6 2747.4 3380.2 4013
Mass (m/z)
(a)
1275.6
100
3216.1
90
80
70
60
50
40
1527.74
175.11 1146.57
30
823.32
724.25
494.21
20 951.38 1050.45
593.28 706.36
1129.54 1581.75 1739.89
10 366.15 481.17 805.4 880.35 1390.66
112.08 290.12 576.25 1262.62 1599.78 1725.05
43.68 214.11 359.11 440.25 515.22 685.29 779.29 863.349923.38 1024.521112.54 1399.74
0
9 378.2 747.4 1116.6 1485.8 1855
Mass (m/z)
(b)
Figure 3: Peptide mass fingerprint and MS/MS spectrum (peptide 1755.6631) derived from spot 124 in Figure 2.
spots (representing 158 unique proteins) were identified amino acid sequence. It is known that a large number of
from A. tamarense out of the 220 protein spots isolated. isoforms are caused by single-nucleotide polymorphisms or
The remaining four protein spots did not give positive SNPs, small genetic differences between alleles of the same
identification and were assigned to unknown proteins. The gene. Currently, we cannot determine whether these isoforms
NCBI accession number, protein name, protein score and are physiologically relevant, but the existence of multiple
C.I. %, total ion score and C.I. %, number of unique isoforms opens new areas for understanding gene functions
peptides and total spectra used in the identification; and in dinoflagellates.
the theoretical MW and isoelectric point of the proteins Based on the functional categories established [28], 158
identified are listed in the Web Appendix. unique proteins were classified into 23 groups (Figure 7).
It should be pointed out that many of the proteins Among the unique proteins identified, 21.6% were involved
identified presented multiple isoforms in 2-DE gel with in photosynthesis, 6.4% were in glycolysis, 6.4% in amino
different PI and MW values, thus forming a train of spots acid metabolism, 5.7% in other enzymatic processes, 5.7%
horizontally or scattering on the 2-DE gel. For example, four were transporters, and 5.1% were involved in stress response
isoforms of ribulose-1,5-bisphosphate carboxylase oxygenase or as chaperones. Other proteins, accounting for small
(RuBisCO), CR1, CR2, CR3, and CR4 were identified in 2- number of the total, were related to protein synthe-
DE gel with different PI values, but they matched the same sis and degradation (4.5%), cell structure and motility
8 Evidence-Based Complementary and Alternative Medicine
45000
R D F G V I V A G V N E D H N N
y
b 40000 N N H D E N V G A V I V G F D R
a N N H D E N V G A V I V G F D R
35000
y12[1275.60]
30000
25000
Intensity
20000
15000
y14[1527.74]
10000 y11[1146.57]
10000 y11[1146.57]
b7[823.32]
b9[951.38] b10[1050.45]
b9-H2O, y9[933.46]
0
750 800 850 900 950 1000 1050 1100 1150
(a)
Precursor ion1755.6631
Rank Sequence Score
1 NNHDENVGAVIVGFDR 84.1073
2 NNHDENVGAVLRFDR 81.1464
3 PMHDENVGAVLRFDR 81.1464
4 VEHDENVGAVPDGFDR 79.9413
5 PMHDNEVGAVLRFDR 72.6614
6 NNHDNEVGAVLRFDR 72.6614
7 NNHDENVLNLRFDR 72.6604
8 PMHDENVLNLRFDR 72.6604
9 VEHDTAAVGAVPDGFDR 71.3905
10 VEHDENVGPWRFDR 69.196
(b)
Figure 4: De novo analysis of an unknown protein from A. tamarense. (a) The x- and y-axes show the mass-to-charge (m/z) ratio and the
% abundance of the precursor ion fragments (m/z of 1755.6631), respectively. The MS/MS spectrum was analyzed using DeNovo Explorer
software to generate “NNHDENVGAVIVGFDR”, and (b) the table details ten peptide sequence candidates for this precursor deduced from
DeNovo Explorer de novo sequencing.
Evidence-Based Complementary and Alternative Medicine 9
15%
29.2%
2.5%
42.3%
49%
59.7%
11.1%
82.5%
8.7%
Figure 5: Taxonomic group distribution of proteins from A. tamarense. (a) Proteins identified using MASCOT search against the NCBInr
database, (b) proteins identified against the dinoflagellate EST database, and (c) proteins identified with de novo and MS-BLAST search.
(3.8%), the TCA cycle (3.8%), protein modification and developed and successfully applied to identify proteins in
folding (3.8%), antioxidant activities (2.5%), carbohydrate organisms with unsequenced genomes [34].
metabolism (2.5%), nucleotide metabolism (2.5%), tran- De novo sequencing analysis is a newly developed strategy
scription (1.9%), the glyoxylate cycle (1.3%), the cell cycle for protein identification from incomplete- or nongenome
and division (1.3%), intracellular trafficking (1.3%), DNA organisms, which is regarded as the only alternative choice
replication and repair (0.6%), lipid metabolism (0.6%), the for the study of organisms with incomplete databases or
electron transport chain (0.6%) and signaling (0.6%). Other databases not included in the public domain [20, 50–52].
functional and unknown function proteins accounted for This approach has been successfully applied in recent studies
4.5% and 13.4% of the total protein, respectively. with incomplete- or nongenome organisms in order to
characterize their proteins [19–23]. In this way, partial or
complete amino acid sequences are obtained using either
4. Discussion manual or automated de novo peptide sequence analysis.
Manual protein sequencing can yield exact amino acid
4.1. Protein Identification Strategy for Genome-Unsequenced sequences without ambiguity via Edman degradation, but
Dinoflagellates. Dinoflagellates are not only the major this procedure is time consuming and laborious. Moreover,
causative agents of worldwide HABs but also are the pro- its sensitivity is lower than mass spectrometry, and it is halted
ducers of various potent biotoxin. However, a worldwide lack by the presence of blocked amino acids. Several automated
of available genetic information limits our understanding of software tools have been developed to deduce the amino acid
HABs and consequently our ability to monitor, mitigate and sequences from an MS/MS spectrum [53–55], which consists
prevent them. Proteomics provides effective strategies and of a ladder of peaks for y-ions (ions containing a C-terminus)
tools for profiling and identifying dinoflagellate proteins in and b-ions (ions containing an N-terminus). Interpretation
order to elucidate the biochemical and molecular mecha- of MS/MS spectra relies on calculating the mass differences
nisms of bloom formation and toxin biosynthesis. Contem- between adjacent fragment ion peaks of y-series or b-series,
porary proteomics requires prompt and confident protein which are common in tryptic peptides. De novo sequencing
identification of proteins of interest. A sequence similarity enables the analysis of quality MS/MS spectra which fail
search is a powerful tool for the identification of proteins to generate protein identifications after database searches,
from organisms with unsequenced genomes [33, 42–46]. In which is the case for the majority of dinoflagellate proteins.
the past few years, various sequence similarity search engines, In the present study, a multilayer, stringent and sequence
such as MS-BLAST [33], FASTS [43], CIDentify [41], MS- similarity database searching strategy combining MALDI-
Homology [47], and OpenSea [48], have been developed TOF-TOF MS with de novo sequence analysis and strin-
and successfully applied in various proteomic studies. Partial gent homology-based searching tools was developed, which
sequence tags or complete peptide sequences were deduced provided a rapid and reliable means to identify proteins
directly from MS/MS spectra with no recourse to database in A. tamarense with an unsequenced database. This data
resources [49] and then searched against a database in interpretation pipeline has no need for chemical deriva-
an error-tolerant fashion. In this way, even proteins with tization or isotopic labeling of analyzed peptides or for
only marginal sequence similarity to reference database repetitive MALDI-FOF-TOF analysis under specific settings,
entries could be identified [42, 45, 46]. Recently, a layered and is applicable to all two dimensional gel-based proteomic
manner combining LS-MS/MS analysis with stringent data approaches for studying dinoflagellates. Moreover, it might
processing and sequence similarity database search was also have important implications for proteomics in fully
10 Evidence-Based Complementary and Alternative Medicine
×104
Spectrum label: F3_23-Precursor: 3237.6235 Peptide sequence: VM∗ ESEIGVKEPLGM∗ VSDPIGISSDGDAAVM∗ R Score: 83.35
b 20
y14[404.78]
18
16
14
Intensity
12
10
8
6 y7[735.37]
4 y5[563.31]
2 y12[1194.6] y21[2120.06]
×104 ×104
Spectrum Label: E23_9-Precursor: 957.5391 Peptide sequence: KVAELANGR Score: 82.42 Spectrum label: E23_12-Precursor: 2480.3132 Peptide sequence: NNPAPGDYGWKPPLLATDDVVLK Score: 80.29
14 Precursor 957.5391 of spot 214 (a2) 40 Precursor 2480.3132 of spot 214 (a3)
K V A E L A N G R N N P A A G D Y G W K P P L L A T D D V V L K
b 13 b
35
12 y9(957.54)
y12[1280.78]
11 30
10
Intensity
9 25
Intensity
8
20
7
6 15
5 b19[2022.96]
4 10
3 y16[1814.99]
2 y2[232.17]
b4, ELAN[428.24] y5[530.33] 5 y13[1408.87]
b18[1907.95]
y19[2084.07]
y21[2252.19]
804.4
y3-NH3 [329.19]
y1[175.14] y4[417.26] a5, y5-NH3[513.32] y9-NH3 [940.52] 953.7 823.46 972.51 1262.72 y15[1651.94]
b11-NH3 , y11[1183.69] y14[1594.91]
1 R, b1[129.13]
b3, LAN[299.2] y3[346.22] a4, y4-NH3 , ELAN[400.23]
AEL, ELA[314.21] a4-NH3 [383.21] b5[541.32] b6[612.33] y7[730.38] 827.41 931.62
b12[1297.65] b14[1507.78]
b15[1620.85]
b17[1792.9] 2352.17
0 100 200 300 400 500 600 700 800 900 0 400 800 1200 1600 2000 2400
Mass Mass
(a)
Figure 6: Continued.
Evidence-Based Complementary and Alternative Medicine 11
0 30 60 90
110
gi|53748880|dbj|BAD52
Local hits (HSPs)
Query: 14 APGDYGWKPPLLATDD 29
APGD GWKPP LATDD
Sbjct: 43 APGDCGWKPPVLATDD 58
Query: 3 AELANGR 9
AELANGR
Sbjct: 67 AELANGR 73
(e)
Figure 6: De novo sequencing and an MS-BLAST search validated a borderline hit produced using the MASCOT search. (a) The x- and
y-axes show the mass-to-charge (m/z) ratio and the % abundance of the precursor ion fragments, respectively. The MS/MS spectrum was
analyzed using DeNovo Explorer software to generate peptide (precursor 957.5391, 2480.3132, and 3237.6235) sequence candidates, (b) the
table details ten peptide sequence candidates for the precursor 3237.6235 deduced from de novo sequencing, (c) the file corresponding to
the spectrum in a2 and a3 and their de novo interpretation produced two candidate sequences with the quality score, and (d) and (e) the
peptide sequence candidates from (b) and (c) were merged into an MS-BLAST query, and the search hit the same protein from A. tamarense.
According to the MS-BLAST scoring scheme, the hits were confident.
12 Evidence-Based Complementary and Alternative Medicine
Unknown 13.4%
Transcription 1.9%
Other function 4.5%
Nucleotide metabolism
2.5%
Carbohydrate metabolic TCA cycle 3.8%
2.5% Intracellular trafficking
Antioxidant 2.5% 1.3%
Signaling 0.6%
Protein modification and
folding 3.8% Amino acid metabolism
Cell cycle and division 6.4%
1.3%
Protein synthesis and Electron transport chain
degradation 4.5% 0.6%
Transporter 5.7%
Figure 7: GO functional classification of the proteins identified in A. tamarense. The functional categories were defined according to Taylor
and Johnson [41].
sequenced organisms, as it validates borderline hits produced in A. tamarense. GAPDH is an enzyme that catalyzes the
by conventional database searches and has the potential for sixth step of glycolysis and thus serves to break down
unbiased screening for PTMs, sequence polymorphism and glucose for energy and carbon molecules. In addition to this
unrecognized splicing variants. function, GAPDH has recently been implicated in several
nonmetabolic processes, including transcription activation,
initiation of apoptosis and ER to Golgi vesicle shuttling.
4.2. Protein Functions of Dinoflagellates. A. tamarense is Sequences coding for this enzyme has also been reported
an autotrophic microalgae which uses CO2 and light as amongst the highest expressed in the EST libraries of other
carbon and light sources. This study identified various light- dinoflagellates such as A. catenella [27], L. polyedrum [56],
harvesting proteins, chloroplast light-harvesting complex A. tamarense [26], K. brevis [57], and A. fundyense [58].
proteins, chl a- or c-binding proteins, and peridinin-chl Another transferase enzyme, chloroplast phosphoglycerate
a-binding proteins, which have been reported in many kinase involved in glycolysis, was identified. It transfers
dinoflagellate species at the transcriptional level [27]. a phosphate group from 1,3-biphosphoglycerate to ADP,
RuBisCO is the most abundant protein on earth and triggers forming ATP and 3-phosphoglycerate. Beside these pro-
reactions to make the carbohydrates, proteins, and fats used teins, a number of proteins involved in the light phase
to sustain all forms of life. In our study, four isoforms of of photosynthesis, such as chloroplast ferredoxin-NADP
RuBisCO (spots CR1, CR2, CR3, and CR4) were identified (+) reductase, photosystems I subunit VII, cytochrome
abundantly in A. tamarense. Beside these isoforms, RuBisCO b6, PsbV, and chloroplast ATP synthase gamma-subunit,
large subunits were also found in A. tamarense. RuBisCO were identified in A. tamarense. Two proteins involved in
has also been found widely in many dinoflagellate species. chlorophyll synthesis, geranylgeranyl reductase, and plastid
Moreover, several other proteins involved in the Calvin cycle, fructose-1,6-bisphosphate aldolase class II protein precursor
that is, chloroplast transketolase, ribulose-5-phosphate 3- were also identified.
epimerase, chloroplast phosphoribulokinase, ribulose bis- Protein synthesis is a complex biological process, includ-
phosphate carboxylase were also identified in A. tamarense ing amino acid elongation, protein folding, posttranslational
these proteins are involved in various processes of the Calvin modification, and protein degradation. Our study identi-
cycle and participate in carbon fixation. Glyceraldehyde- fied translational initiation inhibitor, peptidase, ribosomal
3-phosphate dehydrogenase (GAPDH) was another major protein, elongation factor, calretulin, protease, proteasome,
component of the proteins identified. Nine spots (spots and other protein-synthesis-related proteins in A. tamarense.
51, 60, 63, 68, 71, 82, 85, 86, and 146) were identified These proteins participate in amino acid elongation, protein
as GAPDH, and they presented different cellular locations modification, folding, and degradation in A. tamarense
Evidence-Based Complementary and Alternative Medicine 13
cells. Moreover, two proteins (signal peptidase I and ADP- is essential for DNA damage checkpoint control. Another
ribosylation factor-like 2) involved in intracellular trafficking cell cycle regulation protein, DNA polymerase, was also
were also identified in A. tamarense. These two proteins identified in this study which plays an important role in DNA
participate in the proteolytic processing of proteins or replication and repair in eukaryotes.
folding of tubulin peptides. Three transcriptional proteins, pseudouridine synthase,
Seven proteins involved in amino acid metabolism were ATP-dependent helicase, and hypoxia-inducible factor 1
identified in A. tamarense, that is, methionine S-adenosyl alpha inhibitor were identified from A. tamarense. These
transferase, S-adenosyl-homocysteine hydrolase-like protein, proteins play critical roles in maintaining the structure and
adenylyl sulfate kinase, glutamine synthetase, glutamate integrity of DNA or RNA.
semialdehyde synthase, adenosylhomocysteinase, and ketol- A. tamarense is a motile organism with two flagella
acid reductoisomerase. These proteins participate in the which propel the cells through the water. In our study, actin,
biosynthesis and conversion of various amino acids in tubulin, and flagellin were identified from A. tamarense.
dinoflagellate cells. Actin and tubulin being two major components of flagella
Glycolysis is thought to be the archetype of a universal and cilia in protists including dinoflagellates, while flagellin is
metabolic pathway that converts glucose C6 H12 O6 , into a protein forming the filament in the bacterial flagellum. The
pyruvate, CH3 COCOO− and H+ . The free energy released presence of theses proteins indicated that they play important
in this process is used to form the high-energy compounds roles in the cell structure and motility of A. tamarense.
ATP and NADH. It occurs, with variations, in nearly all
Stress proteins and antioxidant enzymes have been
organisms, both aerobic and anaerobic. In this study, six pro-
identified in dinoflagellate species [59]. In our study, two
teins involved in different steps of glycolysis were identified;
antioxidative enzymes, copper/zinc superoxide dismutase
they were enolase, fructose bisphosphate aldolase, GAPDH,
and superoxide dismutase, and two antioxidant proteins,
phosphoglucomutase, phosphoglycerate kinase, and triose-
peroxiredoxin V protein and a conserved hypothetical pro-
phosphate isomerase.
tein, were identified in A. tamarense. Heat shock proteins
Four proteins, peptidoglycan interpeptide bridge forma-
(HSPs) are highly regulated proteins that are involved in
tion enzyme, alcohol dehydrogenase GroES domain protein,
normal cellular activity and are upregulated when the cell is
glucose-methanol-choline oxidoreductase, and a predicted
exposed to stress such as heat or excess ROS production. This
protein were identified in A. tamarense. These proteins might
study identified three HSPs, HSP60, 70 and 90, and one HSP
be involved in cell wall formation, peptidoglycan synthesis, as
chaperone, GroEL-like chaperone, ATPase in A. tamarense. A
glucose oxidase, and other functions.
previous study demonstrates HSP 60, together with Mn SOD
In eukaryotic cells, the citric acid cycle (TCA) is part
and Fe SOD in a dinoflagellate species, Karenia brevis, and
of a metabolic pathway involved in the chemical conversion
these play an important role in the survival of this species.
of carbohydrates fats, and proteins into carbon dioxide
and water to generate a form of usable energy. Our study Beside the above functional groups, numerous proteins
identified six proteins involved in the TCA cycle, that is, involved in transcription, the electron transport chain,
malate dehydrogenase, and its precursor, dihydrolipoamide nucleotide metabolism, signaling, and lipid metabolism
acetyltransferase, isocitrate dehydrogenase and two hypo- together with some other functional proteins were also
thetical proteins. Furthermore, two proteins, phosphogly- identified from A. tamarense. It should be emphasized
colate phosphatase precursor and isocitrate lyase, involved that most of the proteins identified in the present study
in the glyoxylate cycle, were also identified, and these have been predicted at transcriptional levels in various
two proteins participate in glyoxylate and dicarboxylate dinoflagellates [60, 61], which further demonstrated that
metabolism. the protein identifying method developed in this study was
Five ATPase regulating cation and calcium transports rapid and reliable, although some proteins were identified
were identified in A. tamarense. ATPases are a class of with unknown functions. In future, more effort should be
enzymes that catalyze the decomposition of adenosine devoted to both transcriptomic and genomic studies of
triphosphate (ATP) into adenosine diphosphate (ADP) and a dinoflagellates, which will facilitate protein identification,
free phosphate ion. This dephosphorylation reaction releases and to proteomic studies which will aid in gaining an
energy, which the enzyme (in most cases) is harnessed to understanding of HABs and the subsequent monitoring,
drive other chemical reactions that would not otherwise mitigation, and prevention of HABs.
occur. Some such enzymes are transmembrane ATPases In summary, the current study was undertaken to delin-
which move solutes across the membrane, typically against eate a proteomics scale methodology to identify proteins
their concentration gradient. Three other hypothetical trans- from dinoflagellates. Using this methodology, 116 out of
port proteins were also identified in our study, but their the 220 excised protein spots, representing high, moderate,
functions were not well known. and low abundant proteins, gave positive identification. Most
Little is known concerning the cell cycle regulation of them have been predicted at the transcriptional level or
of dinoflagellate cells although a few cyclin-like proteins have been identified from various dinoflagellate species and
have been found in some dinoflagellate species. Our study play important roles in the various physiological activities of
identified two cell cycle regulating proteins, cell division dinoflagellates. Nevertheless, the present results provided the
protein FtsZ, and DNA damage checkpoint protein rad24. first preliminary proteomic profile and 2-DE gel reference
The former is the key protein in cell division while the latter map of A. tamarense and will form the basis of future
14 Evidence-Based Complementary and Alternative Medicine
proteomics scale studies using the unsequenced database of [10] T. J. Smayda, “Novel and nuisance phytoplankton blooms
A. tamarense. in the sea: evidence for a global epidemic,” in Toxic Marine
Phytoplankton, E. Graneli, B. Sundstrøm, L. Edler, and D. M.
Anderson, Eds., pp. 29–40, Elsevier, New York, NY, USA, 1990.
5. Supporting Information [11] J. D. Hackett, D. M. Anderson, D. L. Erdner, and D.
Bhattacharya, “Dinoflagellates: a remarkable evolutionary
List of all peptide sequences deduced from each MS/MS spec- experiment,” American Journal of Botany, vol. 91, no. 10, pp.
trum using DeNovo Explorer software de novo sequencing. 1523–1534, 2004.
[12] P. J. Rizzo, “The enigma of the dinoflagellate chromosome,”
Acknowledgments Journal of Eukaryotic Microbiology, vol. 38, no. 3, pp. 246–252,
1991.
The authors thank Professor John Hodgkiss from the [13] T. C. LaJeunesse, G. Lambert, R. A. Andersen, M. A. Coffroth,
University of Hong Kong for his help with English. They and D. W. Galbraith, “Symbiodinium (Pyrrhophyta) genome
also thank Drs. Yong-Ming Xie and Li-Hai Guo from AB sizes (DNA content) ARE smallest among dinoflagellates,”
Journal of Phycology, vol. 41, no. 4, pp. 880–886, 2005.
SCIEX Company (Shanghai, China) for their assistance
[14] D. L. Spector, “Dinoflagellate nuclei,” in Dinoflagellates, pp.
during mass spectrometric analysis. This work was partially 107–147, Academic Press, New York, NY, USA, 1984.
supported by research grants from the National Natural [15] F. G. Plwnley, “Marine algal toxins: biochemistry, genetics, and
Science Foundation of China (40776068, 40876059, and molecular biology,” Limnology and Oceanography, vol. 42, no.
40821063), the Ministry of Science and Technology of the 5, pp. 1252–1264, 1997.
People’s Republic of China (Project No. 2010CB428703), the [16] L. L. Chan, I. J. Hodgkiss, J. M. F. Wan et al., “Proteomic
Excellent Group, and the Program for New Century Excellent study of a model causative agent of harmful algal blooms,
Talents in University to D.-Z. Wang. Prorocentrum triestinum II: the use of differentially expressed
protein profiles under different growth phases and growth
conditions for bloom prediction,” Proteomics, vol. 4, no. 10,
References pp. 3214–3226, 2004.
[17] L. L. Chan, I. J. Hodgkiss, P. K. S. Lam et al., “Use of
[1] M. O. Soyer-Gobillard, “Dinoflagellates,” in Encyclopedia of
two-dimensional gel electrophoresis to differentiate mor-
Microbiology, S. Moselio, Ed., pp. 617–633, Academic Press,
phospecies of Alexandrium minutum, a paralytic shellfish
New York, NY, USA, 2009.
poisoning toxin-producing dinoflagellate of harmful algal
[2] G. M. Hallegraeff, “Harmful algal blooms: a global review,” in blooms,” Proteomics, vol. 5, no. 6, pp. 1580–1593, 2005.
Manual on Harmful Marine Microalgae, G. M. Hallegraeff, D. [18] L. L. Chan, W. H. Sit, P. K. S. Lam et al., “Identification and
M. Anderson, and A. D. Cembella, Eds., pp. 25–49, UNESCO, characterization of a “biomarker of toxicity“ from the pro-
Landais, France, 2005. teome of the paralytic shellfish toxin-producing dinoflagellate
[3] F. M. VanDolah, “Diversity of marine and freshwater algal Alexandrium tamarense (Dinophyceae),” Proteomics, vol. 6,
toxins,” in Seafood and Freshwater Toxins: Pharmacology, no. 2, pp. 654–666, 2006.
Physiology, and Detection, L. M. Botana, Ed., pp. 19–44, CRC [19] D. F. Hunt, R. A. Henderson, J. Shabanowitz et al., “Character-
Press, New York, NY, USA, 2000. ization of peptides bound to the class I MHC molecule HLA-
[4] J. P. Quod and J. Turquet, “Ciguatera in Reunion Island (SW A2.1 by mass spectrometry,” Science, vol. 255, no. 5049, pp.
Indian Ocean): epidemiology and clinical patterns,” Toxicon, 1261–1263, 1992.
vol. 34, no. 7, pp. 779–785, 1996. [20] M. Getie, C. E. Schmelzer, and R. H. Neubert, “Characteriza-
[5] J. R. Geraci, D. M. Anderson, R. J. Timperi et al., “Hump- tion of peptides resulting from digestion of human skin elastin
back whales (Megaptera novaeangliae) fatally poisoned by with elastase,” Proteins, vol. 61, no. 3, pp. 649–657, 2005.
dinoflagellate toxin,” Canadian Journal of Fisheries and Aquatic [21] A. L. Yergey, J. R. Coorssen, P. S. Backlund et al., “De novo
Sciences, vol. 46, pp. 1895–1898, 1989. sequencing of peptides using MALDI/TOF-TOF,” Journal of
the American Society for Mass Spectrometry, vol. 13, no. 7, pp.
[6] J. H. Landsberg and K. A. Steidinger, “A historical review
784–791, 2002.
of red tide events caused by Gymnodinium breve as related
[22] N. S. Tannu and S. E. Hemby, “De novo protein sequence
to mass mortalities of the endangered manatee (Trichechus
analysis of Macaca mulatta,” BMC Genomics, vol. 8, no. 1,
manatus latirostris) in Florida, USA,” in Proceedings of the
article 270, 2007.
Eighth International Conference on Harmful Algae, B. Reguera,
[23] B. Samyn, K. Sergeant, S. Memmi, G. Debyser, B. Devreese,
J. Blanco, M. Fernandez, and T. Wyatt, Eds., pp. 97–100,
and J. Van Beeumen, “MALDI-TOF/TOF de novo sequence
Xunta de Galicia and IOC of UNESCO Publishers, Santiago
analysis of 2-D PAGE-separated proteins from Halorhodospira
de Compostela, Spain, 1997.
halophila, a bacterium with unsequenced genome,” Elec-
[7] C. A. Scholin, F. Gulland, G. J. Doucette et al., “Mortality of sea trophoresis, vol. 27, no. 13, pp. 2702–2711, 2006.
lions along the central California coast linked to a toxic diatom [24] D. M. Anderson and D. L. Garrison, “The ecology and
bloom,” Nature, vol. 403, no. 6765, pp. 80–84, 2000. oceanography of harmful algal blooms: preface,” American
[8] L. J. Flewelling, J. P. Naar, J. P. Abbott et al., “Red tides and Society of Limnology and Oceanography, vol. 42, pp. 1007–
marine mammal mortalities,” Nature, vol. 435, no. 7043, pp. 1009, 1997.
755–756, 2005. [25] A. D. Cembella, “Ecophysiology and metabolism of paralytic
[9] D. M. Anderson, “Toxic algal blooms and red tides: a global shellfish toxins in marine microalgae,” in Physiological Ecology
perspective,” in Red Tides: Biology, Environmental Science, and of Harmful Algal Blooms, A. D. Anderson, D. M. Cembella, and
Toxicology, D. M. Okaichi, T. Anderson, and T. Nemoto, Eds., G. M. Hallegraeff, Eds., pp. 381–403, Springer, New York, NY,
pp. 11–16, Elsevier, New York, NY, USA, 1989. USA, 1998.
Evidence-Based Complementary and Alternative Medicine 15
[26] J. D. Hackett, T. E. Scheetz, H. S. Yoon et al., “Insights [42] S. Sunyaev, A. J. Liska, A. Golod, A. Shevchenko, and A.
into a dinoflagellate genome through expressed sequence tag Shevchenko, “MultiTag: multiple error-tolerant sequence tag
analysis,” BMC Genomics, vol. 6, no. 1, p. 80, 2005. search for the sequence-similarity identification of proteins by
[27] P. Uribe, D. Fuentes, J. Valdés et al., “Preparation and mass spectrometry,” Analytical Chemistry, vol. 75, no. 6, pp.
analysis of an expressed sequence tag library from the toxic 1307–1315, 2003.
dinoflagellate Alexandrium catenella,” Marine Biotechnology, [43] A. Mackey, T. Haystead, and W. Pearson, “Getting more from
vol. 10, no. 6, pp. 692–700, 2008. less,” Molecular & Cellular Proteomics, vol. 1, no. 2, pp. 139–
[28] E. Toulza, M. S. Shin, G. Blanc et al., “Gene expression in 147, 2002.
proliferating cells of the dinoflagellate alexandrium catenella [44] L. Huang, R. J. Jacob, S. C. H. Pegg et al., “Functional
(Dinophyceae),” Applied and Environmental Microbiology, vol. assignment of the 20S proteasome from Trypanosoma brucei
76, no. 13, pp. 4521–4529, 2010. using mass spectrometry and new bioinformatics approaches,”
[29] M. D. Keller, R. C. Selvin, W. Claus, and R. R. L. Guillard, Journal of Biological Chemistry, vol. 276, no. 30, pp. 28327–
“Media for the culture of oceanic ultraphytoplankton,” Journal 28339, 2001.
of Phycology, vol. 23, no. 4, pp. 633–638, 1987. [45] A. Frank, S. Tanner, V. Bafna, and P. Pevzner, “Peptide
[30] F. W. F. Lee and S. C. L. Lo, “The use of Trizol reagent sequence tags for fast database search in mass-spectrometry,”
(phenol/guanidine isothiocyanate) for producing high quality Journal of Proteome Research, vol. 4, no. 4, pp. 1287–1295,
two-dimensional gel electrophoretograms (2-DE) of dinoflag- 2005.
ellates,” Journal of Microbiological Methods, vol. 73, no. 1, pp. [46] D. L. Tabb, C. Narasimhan, M. B. Strader, and R. L. Hettich,
26–32, 2008. “DBDigger: reorganized proteomic database identification
[31] S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. that improves flexibility and speed,” Analytical Chemistry, vol.
J. Lipman, “Basic local alignment search tool,” Journal of 77, no. 8, pp. 2464–2474, 2005.
Molecular Biology, vol. 215, no. 3, pp. 403–410, 1990. [47] R. J. Chalkley, P. R. Baker, L. Huang et al., “Comprehensive
[32] V. Dančı́k, T. A. Addona, K. R. Clauser, J. E. Vath, and P. analysis of a multidimensional liquid chromatography mass
A. Pevzner, “De novo peptide sequencing via tandem mass spectrometry dataset acquired on a quadrupole selecting,
spectrometry,” Journal of Computational Biology, vol. 6, no. 3- quadrupole collision Cell, time-of-flight mass spectrometer,”
4, pp. 327–342, 1999. Molecular & Cellular Proteomics, vol. 4, no. 8, pp. 1194–1204,
[33] A. Shevchenko, S. Sunyaev, A. Loboda et al., “Charting 2005.
the proteomes of organisms with unsequenced genomes by [48] B. O. Searle, S. Dasari, M. Turner et al., “High-throughput
MALDI-quadrupole time-of-flight mass spectrometry and identification of proteins and unanticipated sequence modi-
BLAST homology searching,” Analytical Chemistry, vol. 73, no. fications using a mass-based alignment algorithm for MS/MS
9, pp. 1917–1926, 2001. de novo sequencing results,” Analytical Chemistry, vol. 76, no.
[34] P. Waridel, A. Frank, H. Thomas et al., “Sequence similarity- 8, pp. 2220–2230, 2004.
driven proteomics in organisms with unknown genomes by
[49] K. G. Standing, “Peptide and protein de novo sequencing by
LC-MS/MS and automated de novo sequencing,” Proteomics,
mass spectrometry,” Current Opinion in Structural Biology, vol.
vol. 7, no. 14, pp. 2318–2329, 2007.
13, no. 5, pp. 595–601, 2003.
[35] R. L. Tatusov, N. D. Fedorova, J. D. Jackson et al., “The
[50] C. Xu and B. Ma, “Software for computational peptide
COG database: an updated version includes eukaryotes,” BMC
identification from MS-MS data,” Drug Discovery Today, vol.
Bioinformatics, vol. 4, pp. 1–14, 2003.
11, no. 13-14, pp. 595–600, 2006.
[36] P. Waridel, A. Frank, H. Thomas et al., “Sequence similarity-
driven proteomics in organisms with unknown genomes by [51] G. W. Birrell, S. Earl, P. P. Masci et al., “Molecular diversity
LC-MS/MS and automated de novo sequencing,” Proteomics, in venom from the Australian Brown Snake,” Molecular &
vol. 7, no. 14, pp. 2318–2329, 2007. Cellular Proteomics, vol. 5, no. 2, pp. 379–389, 2006.
[37] B. Habermann, J. Oegema, S. Sunyaev, and A. Shevchenko, [52] C. E. H. Schmelzer, M. Getie, and R. H. H. Neubert,
“The power and the limitations of cross-species protein iden- “Mass spectrometric characterization of human skin elastin
tification by mass spectrometry-driven sequence similarity peptides produced by proteolytic digestion with pepsin and
searches,” Molecular & Cellular Proteomics, vol. 3, no. 3, pp. thermitase,” Journal of Chromatography A, vol. 1083, no. 1-2,
238–249, 2004. pp. 120–126, 2005.
[38] A. J. Liska and A. Shevchenko, “Expanding the organismal [53] B. Ma, K. Zhang, C. Hendrie et al., “PEAKS: powerful
scope of proteomics: cross-species protein identification by software for peptide de novo sequencing by tandem mass
mass spectrometry and its implications,” Proteomics, vol. 3, no. spectrometry,” Rapid Communications in Mass Spectrometry,
1, pp. 19–28, 2003. vol. 17, no. 20, pp. 2337–2342, 2003.
[39] N. Wielsch, H. Thomas, V. Surendranath et al., “Rapid vali- [54] A. Frank and P. Pevzner, “PepNovo: de novo peptide sequenc-
dation of protein identifications with the borderline statistical ing via probabilistic network modeling,” Analytical Chemistry,
confidence via de novo sequencing and MS BLAST searches,” vol. 77, no. 4, pp. 964–973, 2005.
Journal of Proteome Research, vol. 5, no. 9, pp. 2448–2456, [55] B. Fischer, V. Roth, F. Roos et al., “NovoHMM: a hidden
2006. Markov model for de novo peptide sequencing,” Analytical
[40] S. Carr, R. Aebersold, M. Baldwin, A. Burlingame, K. Clauser, Chemistry, vol. 77, no. 22, pp. 7265–7273, 2005.
and A. Nesvizhskii, “The need for guidelines in publication of [56] T. R. Bachvaroff, G. T. Concepcion, C. R. Rogers, E. M. Her-
peptide and protein identification data,” Molecular & Cellular man, and C. F. Delwiche, “Dinoflagellate expressed sequence
Proteomics, vol. 3, no. 6, pp. 531–532, 2004. tag data indicate massive transfer of chloroplast genes to the
[41] J. A. Taylor and R. S. Johnson, “Sequence database searches via nuclear genome,” Protist, vol. 155, no. 1, pp. 65–78, 2004.
de Novo peptide sequencing by tandem mass spectrometry,” [57] K. B. Lidie, J. C. Ryan, M. Barbier, and F. M. Van Dolah, “Gene
Rapid Communications in Mass Spectrometry, vol. 11, no. 9, expression in Florida red tide dinoflagellate Karenia brevis:
pp. 1067–1075, 1997. analysis of an expressed sequence tag library and development
16 Evidence-Based Complementary and Alternative Medicine
Research Article
Dieckol from Ecklonia cava Regulates Invasion of
Human Fibrosarcoma Cells and Modulates MMP-2 and
MMP-9 Expression via NF-κB Pathway
Chen Zhang,1, 2 Yong Li,3, 4 Zhong-Ji Qian,3 Sang-Hoon Lee,3 Yong-Xin Li,1
and Se-kwon Kim1, 3
1 Department of Chemistry, Pukyong National University, Busan 608-737, Republic of Korea
2 Key Laboratory of Molecular Enzymology and Enzyme Engineering of Ministry Education, College of Life Science, Jilin University,
Changchun 130021, China
3 Marine Bioprocess Research Center, Pukyong National University, Busan 608-737, Republic of Korea
4 School of Pharmaceutical Sciences, Changchun University of Chinese Medicine, Changchun 130117, China
The matrix metalloproteinase (MMP) family is involved in the breakdown of extracellular matrix in normal physiological
processes, as well as in the disease processes such as arthritis and cancer metastasis. In the present study, dieckol was obtained
with high yield from marine brown alga Ecklonia cava (EC), and its effect was assessed on the expression of MMP-2 and -9 and
morphological changes in human fibrosarcoma cell line (HT1080). Dieckol inhibited the expression of MMP-2 and -9 in a dose-
dependent manner and also suppressed the cell invasion and the cytomorphology in 3D culture system on HT1080 cells. Moreover,
dieckol may influence nuclear factor kappa B (NF-κB) pathway without obvious influence on activator protein-1 (AP-1) pathway
and tissue inhibitor of metalloproteinases (TIMPs). In conclusion, dieckol could significantly suppress MMP-2 and -9 expression
and alter cytomorphology of HT1080 cell line via NF-κB pathway.
36 h 0 μM 36 h 5 μM 36 h 10 μM
120
Relative invasiveness
100
(% 0 (μM) dieckol )
80 ∗
60
40 ∗∗
20 ∗∗
0
0 5 10 50 100
36 h 50 μM 36 h 100 μM
Dieckol concentration (μM)
(a)
24 h 0 μM 24 h 5 μM 24 h 10 μM
24 h 50 μM 24 h 100 μM
(b)
Figure 3: Effect of dieckol on invasion in HT1080 cells. (a) Microphotographs of filters of the Matrigel chamber invasion assay. Inset
(a) represents the conclusive data of cellular invasion. (b) Dieckol Effect on the morphology of HT1080 cells in three-dimensional (3D)
cultures system. The data presented are mean ± SD of three independent experiments. Values are compared with the 0 μM dieckol, which
are significant at ∗ P < 0.05 and ∗∗ P < 0.01.
used in the cell invasion and the subsequent experiments. To HT1080 cells, same density of cells were seeded into 3D colla-
investigate whether dieckol inhibits tumor invasion, Matrigel gen gel with various final concentrations of the dieckol. After
invasion assays were performed for dieckol-treated HT1080 36 h, the control (without dieckol) stretched out in the gel
cells. It was observed that dieckol treatment reduced the cell and formed many branched and elongated structures in type
invasion, and 100 μM of dieckol concentration significantly I collagen matrix (Figure 3(b)). In contrast, the branches
blocked tumor invasion (Figure 3(a)) [13, 17]. were reduced in the cells treated with 5 μM concentration
of dieckol. As the concentration increased to 100 μM, these
branches disappeared and cells changed to spherical shape.
3.3. Effects of Dieckol on the 3D Culture in HT1080 Cell Line.
To investigate the effect of dieckol on the 3D culture system of
Evidence-Based Complementary and Alternative Medicine 5
140
120
100
100
Dieckol (μM)
Relative intensity (%)
80
5 10 50 100
PMA − + + + + + ∗
∗
60
MMP-9 ∗
40 ∗
MMP-2
20
GAPDH
0
0 0 5 10 50 100
− + + + + +
PMA (10 ng/mL)
(b)
180
160
140
Dieckol (μM)
Relative intensity (%)
120
5 10 50 100
−
100
PMA + + + + +
80
MMP-9
60 ∗
∗ ∗
MMP-2 ∗
40 ∗
20
β-actin
0
0 0 5 10 50 100
− + + + + +
PMA (10 ng/mL)
MMP-9
MMP-2
(c)
Figure 4: Effects of dieckol on the MMP expression. (a) Expression of MMP-2, -9 in dieckol-treated HT1080 cells by gelatin zymography.
(b) mRNA transcription levels of MMP-2, -9 in HT1080 cells by RT-PCR analysis. (c) MMP-2, -9 protein expressions in the dieckol-treated
HT1080 cells by western blot analysis. The columns presented in (a), (b), and (c) were the representative of three independent experiments.
∗
, P < 0.05, Compared with the 0 μM dieckol with PMA 10 ng/mL.
6 Evidence-Based Complementary and Alternative Medicine
Dieckol (μM) 3.5. Effects of Dieckol Influenced AP-1, NF-κB, and IκB
0 5 10 50 100 Expressions on HT1080 Cell Line. Western blot studies were
PMA + + + + + carried out to assay the downregulation effects of dieckol on
NF-κB(p65) the possible mechanism of expression of activator protein-
(nucleus) 1 (AP-1) and nuclear factor-kappa B (NF-κB). Meanwhile,
the tissue inhibitor of metalloproteinases (TIMP) was been
NF-κB(p50) checked by western blot. As shown in Figure 5(b), dieckol
(nucleus)
did not exhibit a clear influence of activator protein-1
(AP-1) (c-jun) expression and mitogen-activated protein
p-IκB-α
kinase (MAPK) (ERK, JNK, p38), which mediated the AP-
1. The NF-κB transcription family proteins consist of several
β-actin protein subunits, and it was clear that the level of NF-κB (p65
and p50) was decreased in a dose-dependent manner. The
(a) p-IκB-α expression was increased significantly, when treated
Dieckol (μM) with high concentration of dieckol (100 μM) (Figure 5(a)).
0 5 10 50 100 As observed in Figure 5(c), there is no distinct change in
PMA + + + + + the expressions of TIMP-1 and TIMP-2 when treated with
p-ERK1/2 different concentrations of dieckol.
p-JNK 4. Discussion
MMPs, a family of zinc-dependent endopeptidases, partic-
p-p38
ipate in many physiological and pathological processes. An
c-jun imbalance between the inhibition and activation of MMPs
(nucleus) is related to some diseases such as osteoarthritis, rheuma-
toid arthritis, tumor metastasis, cardiovascular diseases and
β-actin
congestive heart failure [18–20]. Finding MMP inhibitors
(b) (MMPIs) for treatment of these prevalent diseases has been
an important aspect of present day cancer research [21].
Dieckol (μM)
MMPIs regulate MMPs at several biochemical pathways, but
0 5 10 50 100 most of them directly inhibit the activity of enzyme. Till
PMA + + + + + now, MMPIs entering clinical trial are only of synthetic
TIMP-1 origin (organic compounds) and have failed to enter the
pharmaceutical market owing to their side effects [22]. The
TIMP-2
search for novel and natural compounds has led to the
discovery of oceans as the treasure house of substances with
amazing pharmacological potential. Therefore, discovering
β-actin
the ideal MMPIs from marine natural sources is feasible and
(c)
more advantageous [23].
Ecklonia cava (a marine alga), one of the marine floral
Figure 5: Effect of dieckol on the NF-κB and AP-1 cell signaling members, produces dieckol which has been well studied
pathway and TIMP-1, -2 expressions in HT1080 cells. (a) Nucleus previously to inhibit the expression of various MMPs [12,
NF-κB (p65 and p50) and IκB (p-IκB-α) protein expressions in the 24]. In this study, dieckol did not show any cytotoxic effect on
dieckol treated HT1080 cells. (b) (c-jun), MAPK pathway (ERK, HT1080 cells at the concentrations below 200 μM. However,
JNK, p38). (c) Western blot analysis of TIMP-1 and TIMP-2. dieckol influenced the cell mobility as measured by transwell
invasion assay; it also suppressed HT1080 cells crossing the
matrix gel in a dose-dependent manner. In addition, we have
3.4. Effects of Dieckol on the MMP-2, -9 Transcription and
examined the effect of dieckol on the organization of HT1080
Expression Levels in HT1080 Cell Line. Gelatin zymography
cells in a 3D culture environment. In vivo, cells experience
analysis was performed, for investigating whether dieckol
a 3D environment and are surrounded by other cells and
could inhibit protein levels of MMP-2 and MMP-9. As shown
ECM. The traditional 2D monolayer culture system cannot
in Figure 4(a), protein expressions for MMP-2 and MMP-9
emulate the complexities of the 3D tissue microenvironment
were significantly inhibited by dieckol in a dose-dependent
and will always represent a suboptimal milieu for studying
manner. In addition, results from the RT-PCR and western
physiological ECM interactions with connective tissue cells
blot revealed that the expression of MMP-2 and -9 was inhib-
[25, 26]. MMPs also affect cell morphology in 3D culture
ited at transcription levels by dieckol, more or less similar
environment. MMPs cleave the matrix proteins fibronectin,
manner with zymography analysis (Figures 4(b) and 4(c)).
vitronectin, and collagen I into smaller fragments. The
cleaved ECM fragments then facilitate and accelerate cancer
Evidence-Based Complementary and Alternative Medicine 7
cell adhesion and invasion [15]. HT1080 cells formed the linkages (ether linkage) among phloroglucinals donate more
stellate structures in the 3D culture environment, and these free anions to attract responsible receptors.
structures migrated into the collagen matrix cleaving the
ECM with the help of the MMPs. However, dieckol treatment 5. Conclusion
significantly reduced the number and length of stellate
structures. The cultured HT1080 cells were treated with Dieckol was isolated from an edible marine brown alga
dieckol with selected concentrations (0–200 μM) and the Ecklonia cava has been characterized according to the MS and
expression of MMP-2, -9 was induced by PMA. Several NMR data. It acts as an inhibitor of MMP-2, -9 expressions
studies have shown that PMA can induce expression of by the downregulation of NF-κB pathway without significant
MMP-2, -9 [27]. Dieckol inhibited the expression of MMP- influence on AP-1, MAPK pathway. Furthermore, the modu-
2, -9 in a dose-dependent manner, according to the results of lation of MMP-2 and -9 expressions could be one reason for
RT-PCR, western blot and zymography assays. the suppression of invasiveness and 3D culturing of HT1080
AP-1 and NF-κB are major transcription factors that cell line. Hence, this study suggested that dieckol could be an
regulate MMP-2, -9 expression [28–30]. Members of the effective candidate for the suppression of cancer invasion.
MAPK superfamily (ERK1/2, JNKs, and p38 kinase) are
known to regulate AP-1 transactivation by increasing the Acknowledgment
level of AP-1 components or altering the phosphorylation
of their subunits (c-jun, c-fos) and then regulate MMPs This paper was supported by a grant from Marine Bioprocess
expression and activity in various cell types [31]. NF-κB, in Research Center of the Marine Biotechnology program
its inactive form, it is sequestered in the cytoplasm, bound by funded by the Ministry of Land, Transport and Maritime,
members of the inhibitor of kappa B (IκB) family of inhibitor Republic of Korea.
proteins (including IκBa, IκBb, IκBg, and IκBe). Various
stimuli that activate NF-κB result in phosphorylation of IκB,
is followed by its ubiquitination and subsequent degradation
References
[32, 33]. Dieckol suppress NF-κB (p65 and p50) expression [1] A. H. Baker, D. R. Edwards, and G. Murphy, “Metallopro-
in a dose-dependent manner. However, dieckol did not teinase inhibitors: biological actions and therapeutic opportu-
show any clear effect on AP-1 and ERK1/2, JNKs, and p38 nities,” Journal of Cell Science, vol. 115, no. 19, pp. 3719–3727,
kinase expressions. It has been found that p-IκB-α expression 2002.
increased when treated with high concentration of dieckol [2] S. Tanimura, R. Kadomoto, T. Tanaka, Y. J. Zhang, I. Kouno,
(100 μM), but not in low concentration [34]. It may suggest and M. Kohno, “Suppression of tumor cell invasiveness by
hydrolyzable tannins (plant polyphenols) via the inhibition
that the inhibitor of kappa B family could be upregulated
of matrix metalloproteinase-2/-9 activity,” Biochemical and
by high concentration of dieckol, and this may be another Biophysical Research Communications, vol. 330, no. 4, pp.
reason for NF-κB suppression by dieckol. Western blot 1306–1313, 2005.
resulted from TIMP-1 and TIMP-2 depicted that TIMP have [3] L. J. McCawley and L. M. Matrisian, “Matrix metallopro-
not been influenced by different concentrations of dieckol. It teinases: multifunctional contributors to tumor progression,”
is indicating that inhibition of MMP-2, -9 activity by dieckol Molecular Medicine Today, vol. 6, no. 4, pp. 149–156, 2000.
is not because of the TIMP at the test concentrations. [4] R. A. Ashley, “Clinical trials of a matrix metalloproteinase
At the promoter site of MMP-2 and -9 genes, several inhibitor in human periodontal disease,” Annals of the New
York Academy of Sciences, vol. 878, pp. 335–346, 1999.
putative binding sites for transcription factors are present, [5] H. S. Kang, H. Y. Chung, J. Y. Kim, B. W. Son, H. A. Jung, and J.
which regulate gene expression. This promoter contains an S. Choi, “Inhibitory phlorotannins from the edible brown alga
AP-1 binding consensus site at −79 upstream from the starter Ecklonia stolonifera on total reactive oxygen species (ROS)
site and further upstream, there is a cluster of regulatory generation,” Archives of Pharmacal Research, vol. 27, no. 2, pp.
elements including another AP-1 binding site called AP-2 194–198, 2004.
and NF-κB binding site [35]. It is commonly known that [6] S. Das, A. Banerji, E. Frei, and A. Chatterjee, “Rapid expression
MMP-9 transcription is mainly regulated via AP-1 [36, 37]. and activation of MMP-2 and MMP-9 upon exposure of
In addition to this, under some inflammatory and other human breast cancer cells (MCF-7) to fibronectin in serum
pathology conditions, MMP-2, -9 transcription can be reg- free medium,” Life Sciences, vol. 82, no. 9-10, pp. 467–476,
2008.
ulated via NF-κB signaling pathways. Interestingly, dieckol [7] J. Westermarck and V. M. Kähäri, “Regulation of matrix met-
inhibited NF-κB expression with a similar dose-dependent alloproteinase expression in tumor invasion,” FASEB Journal,
manner as observed for MMP-2, -9 expressions. However, it vol. 13, no. 8, pp. 781–792, 1999.
did not significantly influence the expression of AP-1. This [8] Q. T. Le, Y. Li, Z. J. Qian, M. M. Kim, and S. K. Kim,
mode of action may be contributed to the unique chemical “Inhibitory effects of polyphenols isolated from marine alga
structure of dieckol [38–40]. The reasons could be discussed Ecklonia cava on histamine release,” Process Biochemistry, vol.
based on the structural features of the isolated dieckol and 44, no. 2, pp. 168–176, 2009.
[9] J. D. McChesney, S. K. Venkataraman, and J. T. Henri, “Plant
the structure-activity relationship could be described due to
natural products: back to the future or into extinction?”
its unique skeleton. For example, the number of hydroxyl Phytochemistry, vol. 68, no. 14, pp. 2015–2022, 2007.
groups present in its chemical structure probably plays an [10] M. Artan, Y. Li, F. Karadeniz, S. H. Lee, M. M. Kim, and
important role because of the higher polymerization of S. K. Kim, “Anti-HIV-1 activity of phloroglucinol derivative,
phloroglucinal units and on the other hand, the O-bridge 6,6 -bieckol, from Ecklonia cava,” Bioorganic and Medicinal
8 Evidence-Based Complementary and Alternative Medicine
Chemistry, vol. 16, no. 17, pp. 7921–7926, 2008. pro-matrix metalloproteinase-2 through receptor tyrosine
[11] A. John and G. Tuszynski, “The role of matrix metallo- kinases/phosphatidylinositol 3-kinase/NF-κB pathway,” Jour-
proteinases in tumor angiogenesis and tumor metastasis,” nal of Biological Chemistry, vol. 277, no. 33, pp. 30271–30282,
Pathology and Oncology Research, vol. 7, no. 1, pp. 14–23, 2001. 2002.
[12] M. M. Kim, Q. V. Ta, E. Mendis et al., “Phlorotannins [28] Z. Xie, M. Singh, and K. Singh, “Differential regulation of
in Ecklonia cava extract inhibit matrix metalloproteinase matrix metalloproteinase-2 and -9 expression and activity in
activity,” Life Sciences, vol. 79, no. 15, pp. 1436–1443, 2006. adult rat cardiac fibroblasts in response to interleukin-1β,”
[13] S. Pasco, B. Brassart, L. Ramont, F. X. Maquart, and J. C. Journal of Biological Chemistry, vol. 279, no. 38, pp. 39513–
Monboisse, “Control of melanoma cell invasion by type IV 39519, 2004.
collagen,” Cancer Detection and Prevention, vol. 29, no. 3, pp. [29] J. Westermarck and V. M. Kähäri, “Regulation of matrix met-
260–266, 2005. alloproteinase expression in tumor invasion,” FASEB Journal,
[14] K. B. Hotary, E. D. Allen, P. C. Brooks, N. S. Datta, vol. 13, no. 8, pp. 781–792, 1999.
M. W. Long, and S. J. Weiss, “Membrane type I matrix [30] Q. Huang, H. M. Shen, and C. N. Ong, “Inhibitory effect of
metalloproteinase usurps tumor growth control imposed by emodin on tumor invasion through suppression of activator
the three-dimensional extracellular matrix,” Cell, vol. 114, no. protein-1 and nuclear factor-κB,” Biochemical Pharmacology,
1, pp. 33–45, 2003. vol. 68, no. 2, pp. 361–371, 2004.
[15] T. Frisk, S. Rydholm, T. Liebmann, H. Andersson Svahn, G. [31] U. H. Jin, S. J. Suh, W. C. Hyen et al., “Tanshinone IIA from
Stemme, and H. Brismar, “A microfluidic device for parallel 3- Salvia miltiorrhiza BUNGE inhibits human aortic smooth
D cell cultures in asymmetric environments,” Electrophoresis, muscle cell migration and MMP-9 activity through AKT
vol. 28, no. 24, pp. 4705–4712, 2007. signaling pathway,” Journal of Cellular Biochemistry, vol. 104,
[16] M. M. Bradford, “A rapid and sensitive method for the no. 1, pp. 15–26, 2008.
quantitation of microgram quantities of protein utilizing the [32] S. Ghosh and D. Baltimore, “Activation in vitro of NF-κB by
principle of protein dye binding,” Analytical Biochemistry, vol. phosphorylation of its inhibitor IκB,” Nature, vol. 344, no.
72, no. 1-2, pp. 248–254, 1976. 6267, pp. 678–682, 1990.
[17] K. J. Lee, J. Y. Kim, J. H. Choi et al., “Inhibition of tumor [33] T. Henkel, T. Machleidt, I. Alkalay, M. Kronke, Y. Ben-Neriah,
invasion and metastasis by aqueous extract of the radix of and P. A. Baeuerle, “Rapid proteolysis of IκB-α is necessary for
Platycodon grandiflorum,” Food and Chemical Toxicology, vol. activation of transcription factor NF-κb,” Nature, vol. 365, no.
44, no. 11, pp. 1890–1896, 2006. 6442, pp. 182–185, 1993.
[18] F. G. Spinale, M. L. Coker, S. R. Krombach et al., “Matrix [34] P. Wisniewski, A. Ellert-Miklaszewska, A. Kwiatkowska, and
metalloproteinase inhibition during the development of con- B. Kaminska, “Non-apoptotic Fas signaling regulates invasive-
gestive heart failure: effects on left ventricular dimensions and ness of glioma cells and modulates MMP-2 activity via NFκB-
function,” Circulation Research, vol. 85, no. 4, pp. 364–376, TIMP-2 pathway,” Cellular Signalling, vol. 22, no. 2, pp. 212–
1999. 220, 2010.
[19] Y. Yoshihara, H. Nakamura, K. Obata et al., “Matrix metal- [35] S. K. Moon, H. M. Kim, and C. H. Kim, “PTEN induces G1 cell
loproteinases and tissue inhibitors of metalloproteinases in cycle arrest and inhibits MMP-9 expression via the regulation
synovial fluids from patients with rheumatoid arthritis or of NF-κB and AP-1 in vascular smooth muscle cells,” Archives
osteoarthritis,” Annals of the Rheumatic Diseases, vol. 59, no. of Biochemistry and Biophysics, vol. 421, no. 2, pp. 267–276,
6, pp. 455–461, 2000. 2004.
[20] G. P. Stricklin and H. G. Welgus, “Human skin fibroblasts [36] J. S. Shim, E. J. Choi, C. W. Lee, H. S. Kim, and J. K. Hwang,
collagenase inhibitor. Purification and biochemical character- “Matrix metalloproteinase-1 inhibitory activity of kaempferia
ization,” Journal of Biological Chemistry, vol. 258, no. 20, pp. pandurata roxb,” Journal of Medicinal Food, vol. 12, no. 3, pp.
12252–12258, 1983. 601–607, 2009.
[21] C. Zhang and S. K. Kim, “Matrix metalloproteinase inhibitors [37] C. Yan, H. Wang, and D. D. Boyd, “KiSS-1 represses 92-kDa
(MMPIs) from marine natural products: the current situation type IV collagenase expression by down-regulating NF-κB
and future prospects,” Marine Drugs, vol. 7, no. 2, pp. 71–84, binding to the promoter as a consequence of IκBα-induced
2009. block of p65/p50 nuclear translocation,” Journal of Biological
[22] C. M. Overall and C. López-Otı́n, “Strategies for MMP Chemistry, vol. 276, no. 2, pp. 1164–1172, 2001.
inhibition in cancer: innovations for the post-trial era,” Nature [38] J. Lee, E. Jung, J. Lee et al., “Emodin inhibits TNF α-induced
Reviews Cancer, vol. 2, no. 9, pp. 657–672, 2002. MMP-1 expression through suppression of activator protein-1
[23] A. M. S. Mayer and K. R. Gustafson, “Marine pharmacology (AP-1),” Life Sciences, vol. 79, no. 26, pp. 2480–2485, 2006.
in 2000: antitumor and cytotoxic compounds,” International [39] N. Matsunaga, Y. Chikaraishi, M. Shimazawa, S. Yokota,
Journal of Cancer, vol. 105, no. 3, pp. 291–299, 2003. and H. Hara, “Vaccinium myrtillus (bilberry) extracts reduce
[24] S. O. Kim and Y. H. Choi, “The ethyl alcohol extract of angiogenesis in vitro and in vivo,” Evidence-Based Complemen-
Hizikia fusiforme inhibits matrix metalloproteinase activity tary and Alternative Medicine, vol. 7, no. 1, pp. 47–56, 2010.
and regulates tight junction related protein expression in [40] E. L. Cooper, “Drug discovery, CAM and natural products,”
Hep3B human hepatocarcinoma cells,” Journal of Medicinal Evidence-Based Complementary and Alternative Medicine, vol.
Food, vol. 13, no. 1, pp. 31–38, 2010. 1, no. 3, pp. 215–217, 2004.
[25] D. B. Edelman and E. W. Keefer, “A cultural renaissance:
in vitro cell biology embraces three-dimensional context,”
Experimental Neurology, vol. 192, no. 1, pp. 1–6, 2005.
[26] E. Cukierman, R. Pankov, D. R. Stevens, and K. M. Yamada,
“Taking cell-matrix adhesions to the third dimension,” Science,
vol. 294, no. 5547, pp. 1708–1712, 2001.
[27] S. O. Yoon, S. J. Park, S. Y. Yoon, C. H. Yun, and
A. S. Chung, “Sustained production of H2O2 activates
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 452621, 7 pages
doi:10.1155/2011/452621
Research Article
Protective Effects of Emodin and Chrysophanol Isolated from
Marine Fungus Aspergillus sp. on Ethanol-Induced Toxicity in
HepG2/CYP2E1 Cells
Alcohol-induced liver injury progresses from fatty infiltration followed by a harmful cause of inflammation leading to an irre-
versible damage. In this study, two compounds (emodin and chrysophanol) isolated from marine fungus Aspergillus sp. were
examined for their protective effects against ethanol-induced toxicity in vitro. Ethanol-induced HepG2/CYP2E1 cells were treated
with the compounds at various concentrations, and the results showed that there was a dose-dependent decrease of gamma-glu-
tamyl transpeptidase (GGT) activity and increase of glutathione (GSH) in the culture media with an increase in cell viability.
Furthermore, the protective effects of the compounds were evaluated by protein expression levels of GGT, GSH, and CYP2E1
using Western blot. Among the compounds, emodin addressed to the ethanol-induced cytotoxicity more effectively compared
to the chrysophanol. It could be suggested that emodin isolated from this genus would be a potential candidate for attenuating
ethanol induced liver damage for further industrial applications such as functional food and pharmaceutical developments.
Cytotoxic levels of the compound cultured cells were NaCl, 1.5 mM MgCl2 , 2 mM phenylmethylsulfonyl fluoride,
measured using MTT assay [14]. The HepG2/CYP2E1 cells 80 μg mL−1 leupeptin, 3 mM NaF, and 1 mM DTT at 4◦ C
were grown in 48-well plates at a density of 1 × 104 cells for 30 min. Total protein was extracted, and 100 μg mL−1 of
well−1 . After 24 h, cells were washed with fresh medium protein were separated using a 10% SDS-polyacrylamide gel
and treated with different concentrations of compound. and 5% stacking gels and transferred onto a nitrocellulose
After incubation for 48 h, the cells were rewashed and incu- membrane (Amersham Pharmacia Biotech., England, UK).
bated with 100 μL of MTT (1 mg mL−1 ) for 4 h at 37◦ C. The membrane was blocked for 1.5 h at 37◦ C using TBS-T
Finally, 100 μL of DMSO were added to solubilize the buffer containing 0.1% Tween-20 and 3% BSA. After washing
formed formazan crystals, and the amount of formazan crys- the membrane with TBS-T twice, the blots were incubated
tal was determined by measuring the absorbance at 540 nm for 1 hr with suitable antibodies at 25◦ C. The respective pro-
using a multidetection microplate reader (GENios micro- teins were detected with a chemiluminescent ECL assay kit
plate reader, Tecan Austria GmbH, Austria). The data were (Amersham Pharmacia Biosciences, NJ, USA) according to
expressed as means of at least three independent experi- the manufacturer’s instructions. The western blot bands were
ments. Each value was expressed as the mean ± S.D triplicate visualized using a LAS-3000 system and quantified by Multi-
experiments. Gauge V3.0 software (Fujifilm Life Science, Tokyo, Japan).
3.2. GGT Assay. GGT activity was assayed colorimetrically 3.5. Statistical Analysis. Each value was expressed as means ±
on a microtiter plate using gamma-glutamyl-p-nitroanilide S.E.M (n = 3). The statistical significance of differences was
as an artificial substrate. The assay is based on the GGT analyzed by Student’s t-test using SPSS (Chicago, IL, USA).
catalysed breakdown of artificial substrate gamma-glutamyl-
p-nitroanilide to p-nitroaniline which further reacts with
nitrite and naphthylethylene diamine to form a red chromo- 4. Results
genic compound [15]. Briefly, a 20 μL aliquot of conditioned 4.1. Cytotoxic Effects of Ethanol and Compound (Emodin
cell culture media was added to 180 μL of the assay mix- and Chrysophanol on HepG2/CYP2E1 Cells and Ethanol In-
ture consisting of 185 mM Tris-Cl (pH 8.2), 2 mM gamma- duced HepG2/CYP2E1 Cells). The study first examined the
glutamyl-p-nitroanilide, 20 mM glycylglycine, 0.8 mM cytotoxicity of different concentrations of ethanol on HeG2
NaNO2 , and 3.2 mM naphthylethylene diamine. The assay and HeG2/CYP2E1 cell lines. The cells were treated with 0.1–
was also run using the assay mixture without the substrate, 2.0 M ethanol for 48 h and subjected to MTT assay to assess
gamma-glutamyl-p-nitroanilide, to correct for any potential cell viability. As shown in Figure 2(a), the cells appeared to
interference by the compound. After incubating the plate be quite resistant to ethanol up to 0.1 M but 2.0 M ethanol
at 37◦ C for 60 min, the reaction was stopped by addition induced a severe loss of cell viability. Therefore, based on
of 40 μL of 1.0 N HCl. The red chromogen formation was this viability data, the tested concentration of ethanol was
estimated at 520 nm using a multiwell scanning spectropho- 1.0 M, and HepG2/CYP2E1 cell lines can be transfected with
tometer and corrected for the value obtained from the assay human CYP2E1 cDNA; so we selected HeG2/CYP2E1 cell
mixture devoid of the substrate. line for further experiments. The cytotoxic effects of emodin
and chrysophanol on HepG2/CYP2E1 cells were determined
3.3. Determination of Intracellular GSH Contents. The cells by MTT assay. As shown in Figure 2(b), both emodin and
were ruptured in 100 μL of 5% metaphosphoric acid and cen- chrysophanol exhibited no significant effects of cell prolif-
trifuged at 10,000 ×g for 15 min to obtain clear supernatants. eration at the tested concentrations (10–100 μM) after treat-
The supernatants were used for the determination of total ment for 48 h. Based on this viability data, the tested con-
GSH by the enzymatic recycling method using DTNB [16]. centrations of emodin and chrysophanol were selected in the
The assay was carried out on a microtiter plate. The reaction range of 10–100 μM for investigating the protective effects on
mixture (100 μL) consisted of 143 mM NaPO4 (pH 7.5), ethanol-induced cytotoxicity.
6.3 mM EDTA, 0.6 mM DTNB, 0.25 mM NADPH, 0.25 U The HepG2/CYP2E1 cells were pretreated with com-
mL−1 GSH reductase, and 2.0 μL compound. The plate was pound at various concentrations (10–100 μM) for 1 h prior
incubated at 37◦ C for 60 min, and the formation of 2-nitro- to the treatment with 1.0 M ethanol for 48 h. The cells were
5-thiobenzoic acid was monitored by absorbance at 415 nm then subjected to cell viability test. As expected (Figure 3),
and converted to GSH concentration using a calibration ethanol treat cell death (23.5% cell survival); however, the
curve with known amounts of GSH. effect was almost completely abrogated when the cells were
cotreated with emodin, chrysophanol together with eth-
3.4. Western Blot Analysis. Western blotting was performed anol (1.0 M) (emodin, 78.2% at 100 μM; chrysophanol,
according to standard procedures. Briefly, cells were cultured 72.1% at 100 μM cell survival), suggesting that emodin and
at a density of 1 × 104 cells mL−1 in 6-well plate culture dishes chrysophanol have protective effect against ethanol-induced
with serum-free medium. After incubation for 48 h, the cells cytotoxicity in HepG2/CYP2E1 cells.
were treated with different concentrations of compound for
1 h and then treated with 1.0 M ethanol for 48 h with serum- 4.2. Effect of Emodin and Chrysophanol on Ethanol-Induced
free medium. Cells were lysed in lysis buffer containing GGT and GSH Depletion in HepG2/CYP2E1 Cells. Serum
50 mM Tris-HCl (pH 8.0), 0.4% Nonidet P-40, 120 mM gamma-glutamyltransferase (GGT) appeared to attenuate
4 Evidence-Based Complementary and Alternative Medicine
100 120
HepG2/CYP2E1 cells
100
80
Relative cell viability (%)
20
20
0 0
0.1 1 2 10 20 50 100
Ethanol concentrations (M) Concentration (μM)
Figure 2: (a) Cytocompatibility of different concentrations (0.1–2 M) of ethanol on HeG2 and HeG2/CYP2E1 cells. (b) Cytocompatibility
of emodin and chrysophanol on HepG2/CYP2E1 cells. Different concentrations of compounds were applied to the cells for 48 h, and cell
viability was assessed by MTT assay as described in the text. Results are means ± standard error of three independent experiments.
120 120
HepG2/CYP2E1 cells HepG2/CYP2E1 cells
Relative GGT activity (control (%))
100 100
Relative cell viability (%)
80 80
60
60
40
40
20
20
0
Blank Control 10 20 50 100 0
Ethanol (1 M) Blank Control 10 20 50 100
− + + + + +
Ethanol (1 M) − + + + + +
Blank Emodin
Control Blank Emodin
Chrysophanol
Control Chrysophanol
Figure 3: Effects of emodin and chrysophanol on the ethanol-
induced cytotoxicity. The HepG2/CYP2E1 cells pretreated with Figure 4: Constituents on the ethanol-induced GGT release. The
compound at various concentrations for 1 h prior to the treatment HepG2/CYP2E1 cells pretreated with emodin and chrysophanol
with 1.0 M ethanol for 48 h. The cells were then subjected to cell at various concentrations for 1 h prior to the treatment with
viability test. Results are means ± standard error of three inde- 1.0 M ethanol for 48 h. The culture media were used for GGT
pendent experiments. assay. Results are means ± standard error of three independent
experiments.
100 Ethanol (1 M) − + + + + + + +
GGT
80
CYP2E1
60
GSH
40
β-actin
20
(a)
0 120
Blank Control 10 20 50 100
Ethanol (1 M) − + + + + + 100
Blank Emodin
in great demand if intracellular GSH is depleted by ethanol They were found to rule the biological effect of such sys-
toxicity [22]. However, GGT expression or activation may tems. Therefore it could be suggested that structure-activity
not lead to a restoration of intracellular GSH because the re- relationships (SARs) mainly depend on the number of phe-
action products of GGT could potentially induce oxidative nolic ring substituents and phenyl ether linkages. The pro-
stress [23]. tecting effect of emodin with three hydroxyl groups was
GSH, the most abundant antioxidant in cells, plays a ma- stronger than that of chrysophanol containing two hydroxyl
jor role in the defense against oxidative stress-induced cellu- group-substituted compounds on ethanol-induce cytotoxic-
lar injury and is essential for the maintenance of intracellular ity. Emodin is a natural anthraqinone compound, that is, an
redox balance [2]. Neuman et al. [24] reported a dramatic active component of the dried root of Rhei Rhizoma (Rheum
decrease in mitochondrial GSH in isolated hepatocytes palmatum, Daehwang in Korean) and is also present in many
exposed to alcohol. Ethanol increased ROS production, de- herbs and vegetables including cabbage, lettuce, beans, and
creased GSH, and increased lipid peroxidation [25]. Incu- peas [30]. Emodin is known to have immunosuppressive
bation of HepG2 cells with ethanol induced oxidative stress effect, hepatoprotective effect, antiinflammatory, antimicro-
and leaves the cells vulnerable to further injury by ROS. The bial, antiviral, anticancer and wound healing properties [31].
results showed that the levels of GSH in HepG2 cells ex- It could be suggested that emodin from this genus would
posed to ethanol were significantly lower than GSH levels be more potential candidate for attenuating ethanol-induced
in nontreated cells. And also the data showed that the GSH liver damage for further industrial applications such as in
levels decreased in ethanol-induced HepG2 cells while it functional foods and pharmaceuticals.
increased in compounds (emodin and chrysophanol) treated
cells. A dose-dependent GSH elevation was observed in com-
pounds-treated cells after 48 h exposure to ethanol. There-
6. Conclusion
fore, it is evident that compound treatment can relieve etha- In conclusion, our study demonstrated that emodin and
nol-induced cellular injury in HepG2/CYP2E1 cells which chrysophanol isolated from marine fungus Aspergillus sp.
causes imbalance of cellular antioxidative system due to incu- are attenuating the ethanol-induced cytotoxicity of HepG2/
bation with ethanol. The cytoprotective effects of emodin CYP2E1 cells. Moreover, the ethanol-induced cytotoxicity
and chrysophanol are thus likely to be associated with these could be attenuated by inhibition of GGT activity and
enzymes. CYP2E1 protein expression and providing increased levels
CYP2E1 could be induced by a broad variety of chemi- of intracellular GSH. Therefore, it suggests that emodin and
cals, such as ethanol. Ethanol increases the activity of cyto- chrysophanol may provide a novel strategy for attenuating
chrome P450 2E1 (CYP2E1), which can metabolize alcohol ethanol-induced liver damage.
and generate ROS [26, 27]. The CYP2E1 constitutes the
microsomal ethanol oxidizing system, which is inducible by
higher amounts of ethanol and other xenobiotics. Ethanol Acknowledgment
can also be metabolized by catalase and more selectively by
This study was supported by research funds from Chosun
cytochrome P-450 2E1 (CYP2E1) [28]. Acetaldehyde is the
University 2011.
first oxidation product of ethanol. Due to high reactivity
it is responsible for many aspects of alcohol-related liver
injury. In a recent study CYP2E1 activity, cellular GSH and References
GGT levels were chosen to assess hepatocyte damage caused
by ethanol exposure [29]. Due to the complicated nature [1] M. F. Fleming, L. B. Manwell, K. L. Barry, and K. Johnson, “At-
of ethanol toxicity, various strategies have been suggested risk drinking in an HMO primary care sample: prevalence and
health policy implications,” American Journal of Public Health,
to protect cells from it. They include inhibition of ethanol
vol. 88, no. 1, pp. 90–93, 1998.
metabolism leading to the production of toxic metabolites [2] A. Dey and A. I. Cederbaum, “Alcohol and oxidative liver
such as acetaldehyde and inhibition of ROS production from injury,” Hepatology, vol. 43, no. 2, pp. S63–S74, 2006.
nitric oxide synthases, NADPH oxidase, and mitochondrial [3] E. Albano, “Alcohol, oxidative stress and free radical damage,”
electron transport [4]. GGT catalyses extracellular GSH Proceedings of the Nutrition Society, vol. 65, no. 3, pp. 278–290,
breakdown and produces the metabolites used for GSH 2006.
synthesis inside the cells. Thus GGT activity might be in great [4] O. R. Koch, G. Pani, S. Borrello et al., “Oxidative stress and
demand if intracellular GSH is depleted by ethanol toxicity. antioxidant defenses in ethanol-induced cell injury,” Molecular
Recently, marine microorganisms have been well known Aspects of Medicine, vol. 25, no. 1-2, pp. 191–198, 2004.
as an important source to produce naturally bioactive sec- [5] R. K. Dhiman and Y. K. Chawla, “Herbal medicines for liver
ondary metabolites including phenols and polyphenols with diseases,” Digestive Diseases and Sciences, vol. 50, no. 10, pp.
1807–1812, 2005.
unique linkages (ether and/or phenyl). In our results, emodin
[6] B. J. Xu, Y. N. Zheng, and C. K. Sung, “Natural medicines for
attenuated the ethanol cytotoxicity effectively compared to alcoholism treatment: a review,” Drug and Alcohol Review, vol.
the chrysophanol. The active focus of emodin and chryso- 24, no. 6, pp. 525–536, 2005.
phanol components is ascribed to the phenolic hydroxyl [7] D. Wu and A. I. Cederbaum, “Ethanol cytotoxicity to a
groups attached to the ring structure. The structural diversity transfected HepG2 cell line expressing human cytochrome
in each compound is determined by the number and the P4502E1,” The Journal of Biological Chemistry, vol. 271, no. 39,
arrangement of hydroxyl groups and by the methyl groups. pp. 23914–23919, 1996.
Evidence-Based Complementary and Alternative Medicine 7
[8] K. M. Conigrave, P. Davies, P. Haber, and J. B. Whitfield, [25] I. Kurose, H. Higuchi, S. Kato, S. Miura, and H. Ishii,
“Traditional markers of excessive alcohol use,” Addiction, vol. “Ethanol-induced oxidative stress in the liver,” Alcoholism:
98, no. 2, pp. 31–43, 2003. Clinical and Experimental Research, vol. 20, no. 1, pp. 77–85,
[9] H. Zhang, H. Jay Forman, and J. Choi, “γ-glutamyl transpepti- 1996.
dase in glutathione biosynthesis,” Methods in Enzymology, vol. [26] E. Albano, P. Clot, M. Morimoto, A. Tomasi, M. Ingelman-
401, article 28, pp. 468–483, 2005. Sundberg, and S. W. French, “Role of cytochrome P4502E1-
[10] D. J. Faulkner, “Marine natural products,” Natural Product dependent formation of hydroxyethyl free radical in the
Reports, vol. 19, no. 1, pp. 1–48, 2002. development of liver damage in rats intragastrically fed with
[11] T. S. Bugni and C. M. Ireland, “Marine-derived fungi: a ethanol,” Hepatology, vol. 23, no. 1, pp. 155–163, 1996.
chemically and biologically diverse group of microorganisms,” [27] J. M. Jimenez-Lopez and A. I. Cederbaum, “Green tea
Natural Product Reports, vol. 21, no. 1, pp. 143–163, 2004. polyphenol epigallocatechin-3-gallate protects HepG2 cells
[12] W. E. Timberlake and M. A. Marshall, “Genetic engineering of against CYP2E1-dependent toxicity,” Free Radical Biology and
filamentous fungi,” Science, vol. 244, no. 4910, pp. 1313–1317, Medicine, vol. 36, no. 3, pp. 359–370, 2004.
1989. [28] A. I. Cederbaum, D. Wu, M. Mari, and J. Bai, “CYP2E1-
[13] Y. H. Lee, J. N. Ho, M. S. Dong et al., “Transfected HepG2 cells dependent toxicity and oxidative stress in HepG2 cells,” Free
for evaluation of catechin effects on alcohol-induced CYP2E1 Radical Biology and Medicine, vol. 31, no. 12, pp. 1539–1543,
cytotoxicity,” Journal of Microbiology and Biotechnology, vol. 2001.
15, no. 6, pp. 1310–1316, 2005. [29] I. L. Sang, J. K. Hyo, and Y. C. Boo, “Effect of green tea and (-)-
[14] F. Denizot and R. Lang, “Rapid colorimetric assay for cell epigallocatechin gallate on ethanol-induced toxicity in HepG2
growth and survival—modifications to the tetrazolium dye cells,” Phytotherapy Research, vol. 22, no. 5, pp. 669–674, 2008.
procedure giving improved sensitivity and reliability,” Journal [30] Q. Huang, G. Lu, H. M. Shen, M. C. M. Chung, and N.
of Immunological Methods, vol. 89, no. 2, pp. 271–277, 1986. O. Choon, “Anti-cancer properties of anthraquinones from
[15] P. J. M. J. Kok, B. Seidel, H. C. Holtkamp, and J. Huisman, rhubarb,” Medicinal Research Reviews, vol. 27, no. 5, pp. 609–
“A new procedure for the visualization of multiple forms 630, 2007.
of gamma-glutamyl transferase (GGT). Results in normals, [31] T. Tang, L. Yin, J. Yang, and G. Shan, “Emodin, an anthra-
patients receiving enzyme-inducing drugs and patients having quinone derivative from Rheum officinale Baill, enhances
liver parenchymal lesions,” Clinica Chimica Acta, vol. 90, no. cutaneous wound healing in rats,” European Journal of Phar-
3, pp. 209–216, 1978. macology, vol. 567, no. 3, pp. 177–185, 2007.
[16] M. E. Anderson, “Determination of glutathione and glu-
tathione disulfide in biological samples,” Methods in Enzymol-
ogy, vol. 113, pp. 548–555, 1985.
[17] C. F. Lima, M. Fernandes-Ferreira, and C. Pereira-Wilson,
“Phenolic compounds protect HepG2 cells from oxidative
damage: relevance of glutathione levels,” Life Sciences, vol. 79,
no. 21, pp. 2056–2068, 2006.
[18] D. Wu and A. I. Cederbaum, “Ethanol-induced apoptosis
to stable HepG2 cell lines expressing human cytochrome P-
4502E1,” Alcoholism: Clinical and Experimental Research, vol.
23, no. 1, pp. 67–76, 1999.
[19] T. R. Banciu, H. Weidenfeld, E. Marcoane, and L. Berinde,
“Serum gama-glutamyltranspeptidase assay in the detection
of alcohol consumers and in the early and stadial diagnosis
of alcoholic liver disease,” Medecine Interne, vol. 21, no. 1, pp.
23–29, 1983.
[20] J. B. Whitfield, “Gamma glutamyl transferase,” Critical Re-
views in Clinical Laboratory Sciences, vol. 38, no. 4, pp. 263–
355, 2001.
[21] D. H. Lee, R. Blomhoff, and D. R. Jacobs, “Is serum gamma
glutamyltransferase a marker of oxidative stress?” Free Radical
Research, vol. 38, no. 6, pp. 535–539, 2004.
[22] S. J. Chinta, J. M. Kumar, H. Zhang, H. J. Forman, and
J. K. Andersen, “Up-regulation of γ-glutamyl transpeptidase
activity following glutathione depletion has a compensatory
rather than an inhibitory effect on mitochondrial complex
I activity: implications for Parkinson’s disease,” Free Radical
Biology and Medicine, vol. 40, no. 9, pp. 1557–1563, 2006.
[23] A. Paolicchi, R. Tongiani, P. Tonarelli, M. Comporti, and A.
Pompella, “Gamma-glutamyl transpeptidase-dependent lipid
peroxidation in isolated hepatocytes and HepG2 hepatoma
cells,” Free Radical Biology and Medicine, vol. 22, no. 5, pp.
853–860, 1997.
[24] M. G. Neuman, N. H. Shear, S. Bellentani, and C. Tiribelli,
“Role of cytokines in ethanol-induced cytotoxicity in vitro in
Hep G2 cells,” Gastroenterology, vol. 115, no. 1, pp. 157–166,
1998.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 196190, 8 pages
doi:10.1155/2011/196190
Research Article
Purification and the Secondary Structure of
Fucoidanase from Fusarium sp. LD8
The fucoidanase from Fusarium sp. (LD8) was obtained by solid-state fermentation. The fermented solid medium was extracted
by citric acid buffer, and the extracts were precipitated by acetone and purified by Sephadex G-100 successively. The results showed
that the specific fucoidanase activity of purified enzyme was 22.7-fold than that of the crude enzyme. The recovery of the enzyme
was 23.9%. The purified enzyme gave a single band on SDS-PAGE gel, and the molecular weight of fucoidanase was about 64 kDa.
The isoelectric point of the enzyme was 4.5. The enzyme properties were also studied. The results showed that the optimum
temperature and pH were 60◦ C and 6.0, respectively; the temperature of half inactivation was 50◦ C, and the most stable pH for
the enzyme was 6.0. KM , and the Vmax of the enzyme was 8.9 mg·L−1 and 2.02 mg·min−1 ·mL−1 by using fucoidan from Fucus
vesiculosus as substrate. The compositions of the secondary structure of fucoidanase were estimated by FTIR, the second derivative
spectra, and the curve-fitting analysis of the amide I bands in their spectra. The results showed that β-sheet was the dominant
component (58.6%) and α-helix was the least (12%); the content of β-turn and random coil were 15.39% and 14.5%, respectively.
2.2. Microorganism. The marine fungus LD8 was isolated with gentle stirring. Insoluble material was obtained by cen-
from sand of North Sea in German which was identified as trifugation at 15,000 g for 0.5 h. The precipitate was dissolved
Fusarium sp. (LD8), and it could be used for the synthesis of in pH 6.0, 0.02 mol·L−1 citric acid-citric sodium buffer and
fucoidanase. Solid-state medium for LD8 consisted of 7.5 g was centrifuged at 15,000 g for 0.5 h, and the clear solution
wheat bran, 0.5 g kelp powder, 0.1 g glucose, 0.04 g NaNO3 , was collected for use. The enzyme solution was concentrated
and 7.5 mL artificial sea water in 250 mL flasks [27]. to about 10 mL by low-temperature vacuum concentration
and then loaded to Sephadex G-100 column (2.5 × 100 cm),
2.3. Chemical Analysis. The protein concentration was deter- which has been balanced well with 0.1 mol·L−1 citric acid-
mined by the Bradford method [30]. citric sodium buffer. The enzyme was eluted at room
temperature at the flow rate of 0.33 mL·min−1 ; fractions
were collected at 20 min intervals. The fractions with the
2.4. Enzyme Assay highest enzymatic activity were pooled, concentrated by low-
temperature vacuum concentration to 10 mL, dialyzed in
2.4.1. Fucoidanase Activity. Fucoidanase activity was mea- deionized water, lyophilized, and stored at −18◦ C.
sured by the dinitrosalicylic acid technique [31] to estimate SDS-PAGE was performed to identify the purity of the
the release of reducing sugars at 540 nm as follows: a purified enzyme and calculate the Mw of the proteins in the
mixture consisting of 1 mL substrate solution (1% fucoidan gel. SDS-PAGE was 7% (w/v) polyacrylamide gel containing
(w/v) from Fucus vesiculosus dissolved with 0.02 mol·L−1 10% (w/v) SDS; molecular markers were myosin (220 kDa),
citric acid-sodium citric buffer, pH 6.0) and 0.1 mL enzyme α-2 macroglobulin (170 kDa), β-galactosidase (116 kDa),
solution (crude extract or pure enzyme) was incubated at transferrin (76 kDa), and glutamic dehydrogenase (53 kDa),
50◦ C for 10 min, using inactivated enzyme solution as blank respectively. The protein was stained by Coomassie bright
CK. Using fucose as standard, the calibration curve function blue R-250.
was y = 1.611x (x: the quantity of fucose, mg; y: the
absorbance at 540 nm, R2 = 0.9983).
One unit (IU) of fucoidanase activity is defined as the 2.6. Characteristics of the Purified Enzyme. Isoelectrofocusing
amount of enzyme that releases 1 μmol of fucose per minute was performed on gel rods. The electrode solutions were
under the assay conditions. 2% (w/v) sodium hydroxide solution at the cathode and 5%
(v/v) phosphoric acid solution at the anode. Each gel was
focused in 100 V, 2 mA for 2 h, followed by 150–160 V, 4 mA
2.4.2. Fucosidase Activity. Fucosidase activity was mea- for 5 h, which allowed for a sharp focalisation of fucoidanase.
sured under the following conditions: the reaction mixture Following isoelectric focusing, the gels were cut into 0.5 cm
contained 1 mL substrate solution (1% ρ-nitrophenyl-α- for measuring pH and enzyme activity. The protein was
L-fucoside (w/v) dissolved with 0.02 mol·L−1 citric acid- stained by 0.5% amino black (w/v).
sodium citric buffer, pH 6.0) and 0.1 mL enzyme solution The pH relative activity of the fucoidanase was deter-
(purified enzyme) was incubated at 40◦ C for 2 h. One unit mined by detecting the fucoidanase activity over a pH range
(IU) of fucosidase activity is defined as the amount of of 3–8 with three kinds of buffer solutions (50 mmol·L−1
enzyme that releases 1 μmol of ρ-nitrophenyl per minute sodium citrate buffer, 50 mmol·L−1 sodium phosphate
under the assay conditions. buffer, 50 mmol·L−1 sodium carbonate buffer) at 50◦ C.
The pH stability of the enzyme was studied by detecting
2.4.3. Amylase Assay. The reaction mixture containing 1 mL the residual activity after the enzyme being incubated for
of 2% soluble starch (w/v) in acetate buffer (pH 5.5) and 3 h at room temperature under different pH value. To
1 mL of enzyme solution was incubated with shaking at 40◦ C obtain optimal reactive temperature, a mixture consisting
for 30 min. The reaction was stopped by boiling water for of 1 mL substrate solution (1% fucoidan (w/v) from Fucus
5 min, and after centrifugation the released reducing sugar vesiculosus dissolved with 0.02 mol·L−1 citric acid-sodium
was measured by the dinitrosalicylic acid method [31]. One citric buffer, pH 6.0) and 0.1 mL enzyme solution was
unit (IU) of amylase activity is defined as the amount of incubated at different temperatures for 10 min. For thermal
enzyme that liberated 1 μmol reducing sugar (as glucose) per stability study, 0.1 mL of enzyme solution was incubated at
min under the assay conditions. temperature range from 30 to 80◦ C for 1 h, then cooled
rapidly in ice bath for 5 min, and then removed to 25◦ C. The
residual enzyme activity was detected at 50◦ C for 10 min.
2.5. Extraction, Purification, and Purity Identification of Fu-
The substrate specificity of the enzyme was examined
coidanase. The LD8 was cultivated at 28◦ C for 48 h on the
by using different fucoidan from Fucus vesiculosus and
solid-state medium in 250 mL flask.
Laminaria sp. as substrates. Michaelis constants (KM ) and
All the following steps were accomplished at 4◦ C except
maximum reaction velocities (Vmax ) were calculated by the
being indicated specifically.
double-reciprocal plot method of Lineweaver and Burk [32].
50 g fermented culture medium was extracted with citric
acid-citric sodium buffer (pH 6.0) for 0.5 h. After being fil-
trated through six-layer carbasus, the filtrate was centrifuged 2.7. FTIR Assessment of the Secondary Structure of
at 15,000 g for 0.5 h, and then ice-cold acetone was added Fucoidanase. Infrared spectra were recorded on a MAGNA-
to the supernatant to a final concentration of 66.7% (v/v) IR750 Fourier transform spectrometer (INCOLET
Evidence-Based Complementary and Alternative Medicine 3
2.5
had been obtained. The molecular mass of the fucoidanase
0.15 was about 64 kDa by SDS-PAGE (Figure 3) which was dif-
2
E1 ferent from that of Dendryphiella arenaria TM94 (180 kDa).
1.5
0.1
Molecular markers used were myosin (220 kDa), α-2
macroglobulin (170 kDa), β-galactosidase (116 kDa), trans-
1 ferrin (76 kDa), and glutamic dehydrogenase (53 kDa),
0.05 respectively.
0.5
INSTRVMENTW, USA). For the spectrum range from 3.4. Effect of Temperature on Fucoidanase Activity and Stabil-
1500∼2200 cm−1 , 32 scans were collected at a spectral resolu- ity. The optimum temperature for maximal activity of the
tion of 4 cm−1 . Pure fucoidanase (10 mg) was mixed with fucoidanase was 60◦ C at pH 6.0 (Figure 5(a)). At 30◦ C the
100 mg of dried potassium bromide (KBr). Water vapor was activity of fucoidanase decreased to 12.5%, while at 80◦ C
purged from sample room. The spectrum of the amide I band to 18.75%. The result showed that the optimal temperature
of fucoidanase was obtained, and self-deconvolution and of fucoidanase from TM94 was higher than that of the
curve-fitting methods were used to analyze the secondary fucoidanase in Vibrio sp. N-5, whose optimum temperature
structure of the fucoidanase. was 40◦ C [33].
The residual activity of fucoidanase was examined after
preincubating it at different temperatures for 1 hr, and the
3. Result temperature at which enzyme lost half activity was 50◦ C
(Figure 5(b)). It was completely inactivated at above 80◦ C.
3.1. Purification of Fucoidanase. Two protein peaks (E1 and The temperature of lost half activity is different from those
E2) were observed. E2 peak showed fucoidanase activities of Vibrio sp. N-5 and Dendryphiella arenaria TM94. The
(Figure 1) whose purity had been detected by SDS-PAGE enzyme of Dendryphiella arenaria TM94 and Vibrio sp.
(see below). The crude enzyme extraction was purified by N-5 showed that their optimal temperature of half lost
66.7% acetone precipitation and Sephadex G-100 gel chro- inactivation was at 56◦ C and 40◦ C, respectively [33].
matography (Table 1). The purification fold of fucoidanase
activity of 1 mg protein was enhanced from 1-fold to
3.5. Determination of KM , Vmax and Affinity for Fucoidanase.
23.9-folds while recovery rate was decreased from 100% The kinetic parameters of fucoidanase were examined using
to 22.7%. The fractions with higher fucoidanase activity Fucus vesiculosus fucoidan and Laminaria sp. fucoidan
(tube no. 65 to 87) were pooled and concentrated to as substrates. The KM values of the enzyme deter-
10 mL. To exclude the reducing carbohydrates from carbon mined by Lineweaver-Burk method were 8.9 mg·L−1 and
sources used for cultivation (starch, kelp polysaccharides), 10.9 mg·mL−1 , respectively. At the same time, the Vmax
fucoidanase-related enzymes such as fucosidase and amylase values for both substrates were 2.02 mg·min−1 ·mL−1 and
activity of purified protein were determined, but there is no 2.06 mg·min−1 ·mL−1 , respectively. The enzyme showed
fucosidase or amylase activity (Table 2). higher affinity to fucoidan from Fucus vesiculosus.
3.2. Determination of Isoelectric Point and Molecular Mass 3.6. The Second Structure of Fucoidanase. The original IR
of Fucoidanase. The result exhibited that the purified spectrum for the fucoidanase was showed in Figure 6. The
4 Evidence-Based Complementary and Alternative Medicine
Purification step Total protein (mg) Total activity (IU) Specific activity (IU·mg−1 ) Purification (fold) Yield (100%)
Crude enzyme 11668.43 127.96 0.011 1 100
Acetone precipitation 509.23 80.43 0.16 14.5 62.8
Sephadex G-100 120.43 30.64 0.25 22.7 23.9
8
7
6
5 y = 0.5143x + 3.6169 1.7 cm
pH value
4 R2 = 0.9297 Fucoidanase
3
2
1
0
0 1 2 3 4 5 6 7
(cm)
(a) (b)
Figure 2: Determination of isoelectric point of the fucoidanase (a) R f value of the pH; (b) R f of the purified fucoidanase on original
isoelectric focusing gel isoelectrofocusing was performed on gel rods. The electrode solutions were 2% (w/v) sodium hydroxide solution at
the cathode and 5% (v/v) phosphoric acid solution at the anode. Each gel was focused in 100 V, 2 mA for 2 h, followed by 150–160 V, 4 mA
for 5 h. Following isoelectric focusing, the gels were cut into 0.5 cm for measuring pH and enzyme activity. The protein was stained by 0.5%
amino black.
5.4
220 5.2
170
116 5.1
(kD)
76 5
log Mw
Fucoidanase
53 y = −2.7101x + 5.4037
4.9
R2 = 0.9842
4.8
4.7
4.6
4.5
0 0.05 0.1 0.15 0.2 0.25 0.3
Rf
(a) (b)
Figure 3: Determination of the Mw of the fucoidanase by SDS-PAGE. Picture of electrophoresis of fucoidanase: lane 1 is Mw marker; lane
2 is the fucoidanase; (b) standard curve and Mw function of the Mw marker SDS-PAGE was conducted using discontinuous electrophoresis
method with Phastsystem, 5.5% (w/v) polyacrylamide, pH 8.3, 250 V, 10 mA, in the concentration gel with 7.0% polyacrylamide (w/v),
250 V, 30 mA, in the separation gel. Protein was stained with Coomassie brilliant blue R-250. Molecular markers used were (220 kDa), α-2
macroglobulin (170 kDa), β-galactosidase (116 kDa), transferring (76 kDa), and glutamic dehydrogenase (53 kDa).
3 3
Remaining fucoidanase activity (IU·mL−1 )
2.5 2.5
Fucoidanase activity (IU·mL−1 )
2 2
1.5 1.5
1 1
0.5 0.5
0 0
3 4 5 6 7 8 9 3 4 5 6 7 8 9 10
pH pH
(a) (b)
Figure 4: Effects of pH on fucoidanase activity (a) and stability. (b) Effects of pH on fucoidanase activity was determined under the following
method: 1.0 mL substrate solution (pH 3–8) in buffer solutions (50 mmol·L−1 sodium citrate buffer, 50 mmol·L−1 sodium phosphate buffer,
50 mmol·L−1 sodium carbonate buffer) was added to 0.1 mL enzyme solution and then was incubated at 50◦ C for 10 min. The pH stability
of the enzyme was determined by assaying the residual activity after incubating enzyme for 3 h at the room temperature at different pH levels
ranging from 3 to 9. Residual fucoidanase activity was determined by adding 0.1 mL enzyme solution to 1.0 mL of substrate solution (citric
acid-citric sodium buffer, pH 6.0) and then was incubated at 50◦ C for 10 min.
and marine fungi Dendryphiella arenaria TM94 (50◦ C). The A decrease of the β-turn structure and an increase of α-
temperature of half inactivation of LD8 fucoidanase was helix of amide I region had been observed when treated
50◦ C, while that of bacteria Vibrio sp. N-5 was 65◦ C [33]. temperature was below 60◦ C. While treated temperature was
Effects of temperature on the secondary structure of LD8 above 60◦ C, the contents of α-helix, β-sheet, random coil,
fucoidanase were studied by Gaussian fitting to the decon- and β-turn had no changes. The above result was consistent
voluted spectra of fucoidanase at amide I kregion [36, 37]. with our conclusion that the optimal enzyme reaction tem-
6 Evidence-Based Complementary and Alternative Medicine
2
1.5
1.5
1
1
0.5 0.5
0 0
30 40 50 60 70 80 90 30 40 50 60 70 80 90
(◦C) (◦C)
(a) (b)
Figure 5: Effects of temperature on fucoidanase activity (a) and stability. (b) Effects of temperature on fucoidanase activity was obtained
by the following method: adding 0.1 mL of enzyme solution to 1.0 mL of substrate solution (citric acid-citric sodium buffer, pH 6.0), then
incubating for 10 min at different temperatures from 30◦ C to 80◦ C, respectively. Temperature on stability of the fucoidanase was determined
by assaying the residual activity under the following method: 0.1 mL of enzyme solution was incubated at 30 to 80◦ C for 1 h, rapidly cooled
in an ice bath for 5 min, and then removed to 25◦ C. When the sample reached 25◦ C, 1.0 mL of substrate solution was added, and the residual
enzyme activity was determined and expressed relative to the maximum activity.
References
Acknowledgments
[1] S. D. Anastyuk, N. M. Shevchenko, E. L. Nazarenko et al.,
This work was supported by funds from Anhui Provincial “Structural analysis of a highly sulfated fucan from the brown
Nature Science Foundation (no. 03043104), Anhui Provin- alga Laminaria cichorioides by tandem MALDI and ESI mass
Evidence-Based Complementary and Alternative Medicine 7
spectrometry,” Carbohydrate Research, vol. 345, no. 15, pp. [17] S. Furukawa, T Fujikawa, D. Koga, and A. Ide, “Production
2206–2207, 2010. of fucoidan-degrading enzymes, fucoidanase, and fucoidan
[2] J. Wang, Q. Zhang, Z. Zhang, H. Zhang, and X. Niu, sulfatase by Vibrio sp. N-5,” Nippon Suisan Gakkaishi, vol. 58,
“Structural studies on a novel fucogalactan sulfate extracted pp. 1499–1503, 1992 (Japanese).
from the brown seaweed Laminaria japonica,” International [18] I. Y. Bakunina, O. I. Nedashkovskaya, S. A. Alekseeva et al.,
Journal of Biological Macromolecules, vol. 47, no. 2, pp. 126– “Degradation of fucoidan by the marine proteobacterium
131, 2010. Pseudoalteromonas citrea,” Mikrobiologiya, vol. 71, pp. 41–47,
[3] M. I. Bilan, A. A. Grachev, A. S. Shashkov, N. E. Nifantiev, and 2002.
A. I. Usov, “Structure of a fucoidan from the brown seaweed [19] T. Sakai, H. Kimura, and I. Kato, “A marine strain of
Fucus serratus L,” Carbohydrate Research, vol. 341, no. 2, pp. Flavobacteriaceae utilizes brown seaweed fucoidan,” Marine
238–245, 2006. Biotechnology, vol. 4, no. 4, pp. 399–405, 2002.
[4] S. D. Anastyuk, N. M. Shevchenko, E. L. Nazarenko, P. S. [20] T. Sakai, K. Ishizuka, and I. Kato, “Isolation and character-
Dmitrenok, and T. N. Zvyagintseva, “Structural analysis of a ization of a fucoidan-degrading marine bacterium,” Marine
fucoidan from the brown alga Fucus evanescens by MALDI- Biotechnology, vol. 5, no. 5, pp. 409–416, 2003.
TOF and tandem ESI mass spectrometry,” Carbohydrate [21] T. Sakai, K. Ishizuka, K. Shimanaka, K. Ikai, and I. Kato,
Research, vol. 344, no. 6, pp. 779–787, 2009. “Structures of oligosaccharides derived from Cladosiphon
[5] M. I. Bilan, A. A. Grachev, N. E. Ustuzhanina, A. S. Shashkov, okamuranus fucoidan by digestion with marine bacterial
N. E. Nifantiev, and A. I. Usov, “A highly regular fraction enzymes,” Marine Biotechnology, vol. 5, no. 6, pp. 536–544,
of a fucoidan from the brown seaweed Fucus distichus L,” 2003.
Carbohydrate Research, vol. 339, no. 3, pp. 511–517, 2004. [22] T. Sakai, H. Kimura, and I. Kato, “Purification of sulfated
[6] I. R. L. Albuquerque, K. C. S. Queiroz, L. G. Alves, E. A. Santos, fucoglucuronomannan lyase from bacterial strain of Fucobac-
E. L. Leite, and H. A. O. Rocha, “Heterofucans from Dictyota ter marina and study of appropriate conditions for its enzyme
menstrualis have anticoagulant activity,” Brazilian Journal of digestion,” Marine Biotechnology, vol. 5, no. 4, pp. 380–387,
Medical and Biological Research, vol. 37, no. 2, pp. 167–171, 2003.
2004. [23] P. Wang, J. Cai, S. Qin et al., “Fermentation of marine
[7] P. A. S. Mourão, “Use of sulfated fucans as anticoagulant and bacterium Bacillus sp. H-TP2 for fucoidanase and enzyme
antithrombotic agents: future perspectives,” Current Pharma- properties,” Food and Fermentation Industry, vol. 30, pp. 13–
ceutical Design, vol. 10, no. 9, pp. 967–981, 2004. 15, 2004 (Chinese).
[8] W. J. Kim, Y. K. Koo, M. K. Jung et al., “Anticoagulating activ- [24] A. M. Urvantseva, I. Y. Bakunina, O. I. Nedashkovskaya, S.
ities of low-molecular weight fuco-oligosaccharides prepared B. Kim, and T. N. Zvyagintseva, “Distribution of intracellular
by enzymatic digestion of fucoidan from the sporophyll of fucoidan hydrolases among marine bacteria of the family
Korean Undaria pinnatifida,” Archives of Pharmacal Research, Flavobacteriaceae,” Applied Biochemistry and Microbiology,
vol. 33, no. 1, pp. 125–131, 2010. vol. 42, no. 5, pp. 484–491, 2006.
[9] T. Nishino, T. Yamauchi, M. Horie, T. Nagumo, and H. Suzuki, [25] V. Descamps, S. Colin, M. Lahaye et al., “Isolation and culture
“Effects of a fucoidan on the activation of plasminogen by u- of a marine bacterium degrading the sulfated fucans from
PA and t-PA,” Thrombosis Research, vol. 99, no. 6, pp. 623–634, marine brown algae,” Marine Biotechnology, vol. 8, no. 1, pp.
2000. 27–39, 2006.
[10] D. J. Schaeffer and V. S. Krylov, “Anti-HIV activity of extracts [26] K. Wu, Q. Wu, J. Yan et al., “Production of fucoidanase
and compounds from algae and cyanobacteria,” Ecotoxicology from the marine fungus Dendryphiella arenaria TM94 by solid
and Environmental Safety, vol. 45, no. 3, pp. 208–227, 2000. substrate fermentation,” ESMB, vol. 5, pp. 12–14, 2002.
[11] H. Maruyama, H. Tamauchi, M. Hashimoto, and T. Nakano, [27] Q. Wu, J. Cai, K. Wu, and S. Qin, “Solid state fermentation of
“Antitumor activity and immune response of Mekabu fucoidanase of marine fungus LD8. Marine Sciences,” Marine
fucoidan extracted from Sporophyll of Undaria pinnatifida,” Sciences, vol. 28, pp. 23–27, 2004 (Chinese).
In Vivo, vol. 17, no. 3, pp. 245–249, 2003. [28] R. M. R. Jasso, C. N. A. Gonzalez, L. Pastrana, and J. A.
[12] T. Nishino, C. Nishioka, H. Ura, and T. Nagumo, “Isolation Teixeira, “Identification and evaluation of fungal strains with
and partial characterization of a novel amino sugar-containing fucoidan degradation potential,” in Proceedings of the 10th
fucan sulfate from commercial Fucus vesiculosus fucoidan,” International Chemical and Biological Engineering Conference
Carbohydrate Research, vol. 255, pp. 213–224, 1994. (CHEMPOR ’08), pp. 2106–2109, Braga, Portugal, September
[13] L. Chevolot, A. Foucault, F. Chaubet et al., “Further data 2008.
on the structure of brown seaweed fucans: relationships with [29] T. Sakai, T. Kawai, and I. Kato, “Isolation and characterization
anticoagulant activity,” Carbohydrate Research, vol. 319, no. 1– of a fucoidan-degrading marine bacterial strain and its
4, pp. 154–165, 1999. fucoidanase,” Marine Biotechnology, vol. 6, no. 4, pp. 335–346,
[14] T. Fujikawa, K. Koyabu, and M. Wada, “Enzymes in hep- 2004.
atopancreas of abalone active on fucoidan(1), Crude enzyme [30] M. M. Bradford, “A rapid and sensitive method for the
and unabsorbed fraction on CM-cellulose,” Nippon Nogeika- quantitation of microgram quantities of protein utilizing the
gaku Kaishi, vol. 53, pp. 87–95, 1979 (Japanese). principle of protein dye binding,” Analytical Biochemistry, vol.
[15] K. Kitamura, M. Masaru, and T. Yasui, “Enzymic degradation 72, no. 1-2, pp. 248–254, 1976.
of fucoidan by fucoidanase from the hepatopancreas of [31] G. L. Miller, “Use of dinitrosalicylic acid reagent for determi-
Patinopecten yessoensis,” Bioscience, Biotechnology, and Bio- nation of reducing sugar,” Analytical Chemistry, vol. 31, no. 3,
chemistry, vol. 56, pp. 490–494, 1992. pp. 426–428, 1959.
[16] W. Yaphe and K. Morgan, “Enzymic hydrolysis of fucoidin [32] H. Lineweaver and D. Burk, “The determination of enzyme
by Pseudomonas atlantica and pseudomonas carrageenovora,” dissociation constants,” Journal of the American Chemical
Nature, vol. 183, no. 4663, pp. 761–762, 1959. Society, vol. 56, no. 3, pp. 658–666, 1934.
8 Evidence-Based Complementary and Alternative Medicine
Research Article
A Preliminary Study of the Microbial Resources and
Their Biological Activities of the East China Sea
Xiaoling Lu, Xiaoyu Liu, Cong Long, Guoxiang Wang, Yun Gao, Junhua Liu, and Binghua Jiao
Department of Biochemistry and Molecular Biology, College of Basic Medical Sciences, Second Military Medical University,
Shanghai 200433, China
East China Sea is one of the four sea areas in China, which possesses peculiar ecological environment and many kinds of
living creatures, especially the microorganisms. We established the East China Sea microorganism library (during 2006–2010)
for the first time, which stored about 30000 strains that covered most kinds of the species. In this paper, 395 pure strains of
East China Sea microorganism library which belong to 33 different genera were mainly introduced. Sulfitobacter, Halomonas,
Bacillus, Pseudoalteromonas, and Idiomarina were the most dominant species. On the large-scale biological activity screening of
the 395 strains, 100 strains possess different biological activities based on different screening models, of which 11.4% strains
have antibacterial activities, 15.9% have cytotoxicity activities, and 6.1% have antioxidation activities. Besides, the secondary
metabolites of 6 strains with strong biological activities were studied systematically; diketopiperazines and macrocyclic lactones are
the active secondary metabolites. The species and the biological activity of microorganisms diversity, the abundant structure type
of the secondary metabolites, and their bioactivities all indicate that East China Sea is a potent marine microorganisms-derived
developing resource for drug discovery.
mainly exist in the deep-sea ecosystem. Overall, the East method [6] using HepG2, HL-60, SMMC 7721, MCF, P388,
China Sea has great potential for drug development because S180, and SW1990 cell lines. In MTT assay, the cell lines were
of its rich and unique microbial resources. grown in RPMI-1640 supplemented with 10% fetal bovine
In order to discover the bioactive secondary metabolites serum (FBS) under a humidified atmosphere of 5% CO2
of the microorganisms from the East China Sea, it is essential and 95% air at 37◦ C. Cell suspension (90 μL) at a density
to do the large-scale survey of the microbial resources of 5 × 104 cell/mL was plated in 96-well microtiter plates
of East China Sea. In this paper, we mainly reported the and incubated for 24 h under the mentioned condition. The
marine microorganisms, their biological activities such as supernatants (10 μL) of cultured broth was added to each
antimicrobial, antitumor, antioxidant activities, and some well and further incubated for additional 72 h in the same
secondary metabolites of the strains with biological activities condition. Then, 10 μL of MTT solution (5 mg/mL in IPMI-
in the East China Sea. 1640 medium) was added to each well and incubated for
4 h. The old medium (110 μL) containing MTT in 96-well
2. Materials and Methods microtiter plates was gently replaced by DMSO and pipetted
to dissolve any formazan crystals. Absorbance was then
2.1. Sampling. The sea water and sea sediment samples were determined on a Spectra Max Plus plate reader at 540 nm.
collected in 2006 at a depth of 30 m in the East China Sea In this part, actinomycin D was used as the positive control,
(27◦ 15 50 N120◦ 45 22 E ∼ 31◦ 24 7 N122◦ 40 48 E), normal saline was used as negative control, and 10% DMSO
and we totally obtained 100 sea sediment sample and 122 solution was used as blank control.
sea water sample, which were all stored in refrigerator at
−80◦ C. Weigh 5 g sea sediment, add 45 mL sterile artificial 2.3.3. Assay of Antioxidant Activities. Seed culture (50 mL) of
water, shake and mix fully, and stand settlement. Sterile all strains was inoculated into Erlenmeyer flask (2000 mL)
sea water and the supernatant of the sea sediment were containing the liquid medium (500 mL) and cultured on a
progressively diluted with sterilized artificial seawater step by rotary shaker (150 rpm) at 28◦ C for 5 days. The fermented
step into 10−1 , 10−2 , 10−3 , 10−4 , and 10−5 . Take 0.2 mL every whole broth was centrifugated at 12000 rpm for 5 min and
gradient diluent and spread them into different medium separated from supernatant and thallus. The supernatant
plates, incubate at 25◦ C for 7–14 days, and then pick the was extracted with ethyl acetate for 3 times, and the
single colony according to the differences of the sample combined extracts were evaporated in vacuum at 30◦ C to
and the morphological of the strains. Streak plate method dryness to yield the crude extract, which was dissolved at a
combined with the microscope observation is used during concentration of 1 mg/mL in methanol for further analyses.
the separation process. All these pure strains were now The DPPH assay was evaluated according to the method
conserved by freezing at −80◦ C and at 4◦ C in our laboratory. described by Hu and Kitts [7] with a little modify. Briefly,
crude extract in methanol solution (0.3 mL) mixed with
2.2. Determination of 16S rRNA Sequence. According to the 0.06 mmol/L DPPH (0.5 mL) dissolving in ethanol solution
method described by Rainey et al. [5], the genomic RNAs and stood at room temperature in the dark for 20 min when
of all the pure strains were prepared by Genomic RNA the absorbance at 517 nm was taken. Capacity of free-radical
Isolation kit (Watson). Then, gene encoding 16S rRNA was scavenging was evaluated by the inhibition percentage,
amplified by PCR with 16S rRNA Bacterial Identification calculated from the following equation: Inh% = [(Acontrol −
PCR kit (TaKaRa). An ABI BigDye and Terminator 3.1 cycle Asample )/Acontrol ] × 100, where Acontrol = absorbance of
sequencing kit (Applied Biosystems) and an automated RNA 0.06 mmol/L DPPH (0.5 mL) with methanol (0.3 mL),
sequencer (model ABI 3730; Applied Biosystems) were used Asample = absorbance of 0.06 mmol/L DPPH (0.5 mL) with
to determine 16S rRNA gene sequence. sample solution (0.3 mL).
The ABTS assay was evaluated according to the method
2.3. Activity Assays of Kajal and Paulraj [8] with a little modify. Briefly, a stock
solution of ABTS radical cation was prepared by dissolving
2.3.1. Assay of Antibacterial Activities. All strains were respec- ABTS (0.25 mmol/L, 5 mL in water) with potassium persul-
tively inoculated in tubes containing 5 mL corresponding fate (2 mmol/L, 88 mL). The reaction mixture was diluted
liquid medium and cultured on a rotary shaker (150 rpm) to 25 times volume with EtOH and left to stand at room
at 28◦ C for 3 ∼ 5 days. The fermented broth was filtered temperature overnight (13 h) in the dark. The ABTS assay
through cheese cloth to separate the supernatant and thallus. was started by mixing the diluted ABTS solution (0.9 mL)
Antibacterial activity of all the supernatants was evaluated with crude extract in methanol solution (0.1 mL) and stood
by zone of inhibition using the agar well diffusion assay. The at room temperature in the dark for 20 min when the
indicator strains are B. subtilis (ATCC 6633), E. coli (ATCC absorbance at 734 nm was taken. Capacity of free-radical
25922), and S. aureus (ATCC 25923). In this part, ampicillin scavenging was evaluated by the inhibition percentage,
and blank medium were used as the positive and negative calculated from the following equation; Inh% = [(Acontrol −
control, respectively. Asample )/Acontrol ] × 100, where Acontrol = absorbance of diluted
ABTS solution (0.9 mL) with methanol (0.1 mL), Asample =
2.3.2. Assay of Cytotoxic Activities. The entire supernatants of absorbance of diluted ABTS solution (0.9 mL) with sample
cultured broth were prepared as described above. Cytotoxic solution (0.1 mL). Quercetin was used as positive control in
activities of these supernatants were evaluated by MTT the two tests.
Evidence-Based Complementary and Alternative Medicine 3
2.4. Fermentation of the Pure Cultured Strains. The strains among of which most strains belong to the Bacillus, Sulfi-
F81612, F201721, F8712, F321122, F121122, and M44 have tobacter, and Pseudoalteromonas (Table 2). The antibacterial
been isolated from sea sediment and sea water of East China activities of marine Bacillus mainly focused on the killing
Sea, respectively. They were all isolated on F1 medium with S.aureus and B.subtilis, while the Sulfitobacter mainly showed
incubation at 28◦ C. F1 Medium: Glucose (6 g), peptone (5 g), the strong activities of killing S.aureus, and Pseudoal-
and yeast extract (1 g) were dissolved in artificial seawater teromonas mainly showed the strong activities of killing
(1 L). A statistical methodology, combining Plackett-Burman E.coli.
design (PBD) with response surface methodology (RSM), 3.3. Cytotoxic Activities. The tested pure isolated microor-
was applied to optimize the biological activity of the strains ganisms exhibited good cytotoxicity activities to several cell
in the fermentation [9]. Each strain was fermented as follows: lines, like HepG2, Hela, MCF, and SMMC 7721. It means not
40 2 L Erlenmeyer flasks each containing 700 mL F1 medium all the strains are susceptible to all the tested cell lines, which
(set to the pH 6.5 before sterilization) were inoculated and signifies the differences between the genus and the strains. 63
grown for 4 ∼ 7 days at 28◦ C while shaking at 90 rpm. strains of the tested pure isolated microorganisms exhibited
cytotoxicity, among of which most strains were sensitive to
2.5. Isolation of the Secondary Metabolites. The 6 entire cul-
the HepG2 cell line and their inhibitory ratio mostly exceed
ture broths were all centrifugated at 12000 rpm for 15 min-
20% (Table 3).
utes, respectively, got the supernatants. The each supernatant
Most strains of Sulfitobacter, Pseudoalteromonas, and
was extracted with ethyl acetate for 3 times. The combined
Halomonas exhibited good cytotoxic activities. For example,
extracts were evaporated in vacuum at 30◦ C to dryness to
Sulfitobacter sp. is the common species of pure cultured
yield crude extract. Then, the each crude extract was sub-
strains. In this species, most strains show good cytotoxic
jected to Sephadex LH-20 and silica gel column, middle-
activities to HepG2 cell line (Figure 1). About 25% strains
pressure LC with the gradient elution, and chromatographed
of this species possess strong cytotoxicity activities, whose
on preparative HPLC columns repeatedly, which yielded
inhibitory ratios exceed 30%, while the inhibitory ratios of
many secondary metabolites.
another 30% strains exceed 25%. Thus, it can be seen that
Sulfitobacter sp. is the potential ones which may produce
3. Results cytotoxic secondary metabolites.
3.1. Taxonomy of the Studied Pure Strains. The 16S rRNA 3.4. Antioxidant Activities. The antioxidant activity of the
gene sequence has been determined for a large number pure cultured strains was determined by the method of
of strains. GenBank, the largest databank of nucleotide spectrophotometry DPPH· radical scavenging assay and
sequences, has over 20 million deposited sequences, of which ABTS·+ radical cation decolorization assay. We screened
over 90,000 are of 16S rRNA gene. This means that there 395 fermented liquid extract of strains, among of which
are many previously deposited sequences against which to 24 strains show antioxidant activity using the DPPH·
compare the sequence of an unknown strain [10]. 16S rRNA radical scavenging assay, while 30 strains exhibit antioxidant
sequences of 416 pure strains have been determined. After activity using the ABTS+· radical cation decolorization assay
blasting with the GenBank sequences, it is known that a (Figures 2 and 3). In the DPPH· assay, inhibitory ratio of
total of 395 strains can be determined their taxonomic status the 11 strains exceed 40%, and 3 strains exceed 90%. In
(Table 1). 395 strains belong to 33 different genera, which the ABTS·+ assay, inhibitory ratio of the 10 strains exceed
Sulfitobacter, Halomonas, Bacillus, Pseudoalteromonas, and 40%, among of which strain F7 has the highest inhibitory
Idiomarina were the most dominant species. ration 98.97%. It can be seen that strains F19, F12, and F23
all exhibit good antioxidant activity in the both methods,
3.2. Antibacterial Activities. 45 strains of the tested pure which deduce that these 3 strains may have 2 antioxidant
isolated microorganisms exhibited antibacterial activities, mechanisms at least.
4 Evidence-Based Complementary and Alternative Medicine
3.5. The Study of the Secondary Metabolites of the Strains. In to 3 species which is Bacillus, Pseudoalteromonas, and
our screening program for bioactive principles from marine Sulfitobacter. From the isolated secondary metabolites, it
microorganisms, we pick up 6 strains (F81612, F201721, is known that: (1) the main type of the metabolites of
F8712, F321122, F121122, and M44) of different genus with these species is cyclopeptide, especially cyclodipeptide, (2)
strong biological activities to study their bioactive secondary some strains have the common secondary metabolites, for
metabolites (Table 4, Figure 4). These 6 strains mainly belong example, macrolactins, cylco(Phe-Ile), cylco(Pro-Ile), and
Evidence-Based Complementary and Alternative Medicine 5
Inhibitory ratio(%)
100
80
60 which 52% strains belong to the actinomycete, 15% belong
to the fungus, and 33% are bacteria. Firstly, we picked up 416
40
isolated bacteria according to their different morphologic
20 and cultural characteristics to further study their taxonomy,
0 biological activities, and secondary metabolites.
Strains Based on the morphologic and cultural characteristics
of the strains, firstly, it is known that majority of them
F11 F7 M23 F13 S66 belong to the Gram-negative bacteria. Secondly, more than
F12 F27 F1 F15 S67 85% strains must be cultured in the medium with different
M44 M50 F4 F18 S68
S61
concentrations of NaCl, the concentrations of NaCl which
F19 M31 F7 M32
F23 M49 F10 S57 range from 2.5% to 15%. Thirdly, it is shown that these
strains only need simple nutritional requirements, most
Figure 2: 24 strains with best antioxidant activity in DPPH· of which possess extracellular enzymes and do not use
assay. All the cultured broths of the strains were tested at a fixed sugar as carbon source and so on. Besides, 395 strains
concentration 375 μg/mL. Each experiment was repeated 3 times, can be determined their taxonomic status, which belong to
and the inhibitory ratio was the average of the 3 results. 33 different genera, and Sulfitobacter, Halomonas, Bacillus,
Pseudoalteromonas, and Idiomarina were the most dominant
cyclo (Pro-Leu) et al., and (3) the secondary metabolites species.
isolated from different strains signify the different metabolite In the recent years, there are many studies about the bio-
mechanisms between the genus and the strains. logical activities of the secondary metabolites isolated from
From the secondary metabolites of our finding, another the marine microorganisms, and these studies mainly focus
important kind of the metabolites is macrolide. In 2007, on the antibacterial, cytotoxic, antioxidation, and antiviral,
our group found a new macrolactin named macrolactin Q immunosuppressant activities [13]. In our screening pro-
which was isolated from a marine Bacillus subtilis [11, 12], gram for bioactive principles from marine microorganisms,
and besides, we also isolated macrolactin A and macrolactin it is essential to study the biological activities of the marine
B from the same marine Bacillus subtilis. Macrolactin Q, microorganisms producing the bioactive secondary metabo-
macrolactin A and macrolactin B all exhibited antimicrobial lites. We mainly studied the activity screening of marine
activity, macrolactin Q showing stronger antibacterial activ- microorganisms referring to the antimicrobial, cytotoxicity,
ity against E. coli than S. aureus and B. subtilis. Macrolactin and antioxidant activities.
Q inhibited bacterial growth against E.coli with a MIC of On the large-scale activity screening of the 395 strains,
0.2 μg/mL, while inhibiting weaker bacterial growth against 100 strains possess different biological activities, of which
S. aureus and B. subtilis with a MIC of 0.7 μg/mL and 45 strains have antibacterial activities, 63 strains have cyto-
100 μg/mL, respectively. toxicity activities, and 24 strains have antioxidant activities.
By this screening, we found that the microorganisms of
4. Discussion East China Sea have a wide range of biological activities,
including antibacterial activities, cytotoxicity activities, and
According to the different sampling points and the different antioxidant activities, which possess the good potential for
characteristics (morphous, sizes, and colours) of the pure the development and utilization. It is good for us to further
strains, we totally obtained about 30000 pure strains, of develop the medicinal microbial use of East China Sea on the
6 Evidence-Based Complementary and Alternative Medicine
OH OH
OH OH
O O
OH OH
O O
O O HO O O
HO
HO HO
HO
HO HO
Macrolactin A
Macrolactin B ∗ Macrolactin Q
O
H
O
N NH
N
HN H
O O
Cyclo(Pro-Leu) Cyclo(Pro-Leu)
Figure 4: The new secondary metabolites and the compounds with the good biological activities isolated from the strain F201721, F81612,
F8712, F321122, F121122, and M44.
foundation of the biological activity screening of the isolated logical role in antifouling [25, 26], antifungal [27] and an-
pure strains. tibacterial [16]. For example, cyclo (D-Pro-D-Phe) was pre-
In our screening program for bioactive principles from viously found in marine bacteria associated with Pecten
marine microorganisms, diketopiperazine and macrolide maximus and proved to exhibit bioactivity against Vibrio
are the two important bioactive secondary metabolites. anguillarum [16], and meanwhile, it was also proved to
Diketopiperazines (DKPs), the smallest cyclic peptides, have have antifouling activity [28]. Cyclo (L-Pro-L-Phe) and
been isolated from marine microorganisms (bacteria, fungi, cyclo-(L-Pro-L-Leu), isolated from the bacterium Alcaligenes
and actinomycete) [14–17] or the microorganisms associated faecalis A72, showed moderate inhibitory activity against S.
with sponge [18–20]. As cyclic peptide derivatives, DKPs aureus [29]. Therefore, the diketopiperazines, which were
have been considered as cell-cell signalling compounds. isolated from the microorganisms of East China Sea, may
Some L, L-diketopiperazines have recently been known as
show many kinds of biological activities, which indicated the
quorum-sensing bacterial sensors [21, 22], which are used
biological activities of the microorganisms.
by Gram-negative bacteria for cell-cell communication and
regulating gene expression in response to population density. Macrolactins are a group of 24-membered lactones
For example, cyclo (L-Pro-L-Phe) and cyclo (L-Pro-L-Leu) with potent antibacterial or other activities, most of which
are capable of activating or antagonizing LuxR-mediated were derived from the second metabolites of the marine
quorum-sensing system of bacteria [23, 24]. Therefore, the microorganisms, while several of them were also produced
diketopiperazines, which were produced by many species by some soil microorganisms as well. There were total
of the microorganisms, suggest a probable role of these 22 isolated macrolactins reported, since the first one was
compounds in bacterial-bacterial interaction. isolated in 1989. Our group found a new macrolactin named
Besides, DKPs represent an important class of biolog- macrolactin Q, which possesses strong antibacterial activity
ically active natural products, which play an important eco- against E. coli than S. aureus
Evidence-Based Complementary and Alternative Medicine 7
Review Article
Genome-Based Studies of Marine Microorganisms to
Maximize the Diversity of Natural Products Discovery for
Medical Treatments
Xin-Qing Zhao
School of Life Science and Biotechnology, Dalian University of Technology, Linggong Road 2, Dalian 116024, China
Marine microorganisms are rich source for natural products which play important roles in pharmaceutical industry. Over the
past decade, genome-based studies of marine microorganisms have unveiled the tremendous diversity of the producers of natural
products and also contributed to the efficiency of harness the strain diversity and chemical diversity, as well as the genetic diversity
of marine microorganisms for the rapid discovery and generation of new natural products. In the meantime, genomic information
retrieved from marine symbiotic microorganisms can also be employed for the discovery of new medical molecules from yet-
unculturable microorganisms. In this paper, the recent progress in the genomic research of marine microorganisms is reviewed;
new tools of genome mining as well as the advance in the activation of orphan pathways and metagenomic studies are summarized.
Genome-based research of marine microorganisms will maximize the biodiscovery process and solve the problems of supply and
sustainability of drug molecules for medical treatments.
product screening and development is to improve the diver- that comparing to the studies on terrestrial species and
sity and the size of natural product library for new drug dis- strains, genomic studies of marine-derived microorganisms
covery. In this paper, the recent progress in the genomic re- are still well performed, the knowledge accumulated from the
search for natural compound discovery is summarized, with terrestrial microorganisms can be used also in the marine-
the focus on the important roles of genetic diversity deduced derived strains. Actinobacteria are major producers of var-
from genome mining on new drug discovery. ious useful antibiotics and antitumor agents. In the below
section, I gave some examples on the investigations on
the genomes of some model or natural-product-producing
2. Genomic Sequencing of Natural-Product- strains, which will shed light on their marine-derived coun-
Producing Microorganisms terparts.
Streptomyces is the largest genus of actinobacteria, and,
Genomic sequencing of microorganisms in the recent years species of streptomycetes are major producers of antibiotics
has unveiled unprecedented insights into the biosynthetic which have wide range of utilities in medical treatments and
potential of microbial cells, and thus the discovery of natural agricultural applications. The first genomic sequencing of
products has entered into the new postgenomic era. The the model streptomycete, Streptomyces coelicolor A3 [2], was
genomic sequencing data of various living organisms have reported in 2002 [24], and the genome contains about 31
been accumulating rapidly in recent years. According to the biosynthetic gene clusters that were predicted to contribute
Genomes On Line Database (GOLD), there are 5831 genome to the biosynthesis of secondary metabolites, which are the
sequencing projects registered in GOLD, while according to major source of bioactive natural products. Surprisingly,
the last update (April 11, 2011), 10298 genome projects are only half a dozen of these secondary metabolites in S. coeli-
documented currently in GOLD (http://www.genomeson- color have by that time been identified, which implies that
line.org), of which 1674 complete genomes are regis- microbial cells can produce much larger chemical diversity
tered. And in the mean time, 204 archaeal, 6087 bac- than previously anticipated. Later on, the genome sequence
terial, and 2003 eukaryal genome projects are ongoing, which of S. avermitilis was also reported [25], followed by the
are double of those reported in 2009 [18]. The same case is blooming uncover of genomic sequences of various antibi-
the genome project numbers in 2009 comparing with those otic producers [26–31].
in 2007 [19]. Genome sequencing projects supported by the The genome sequence of the first seawater-requiring
Gordon and Betty Moore Foundation resulted in the release marine actinomycete, Salinispora tropica, was reported [26].
of about 150 marine bacterial genomes [20]. Draft or com- Bioinformatics analysis revealed that this marine bacterial
plete genomic sequences of more than 35 marine cyanobac- species owns a large proportion of genes (about 9.9%) re-
terial strains of six different species have been released, and sponsible for natural product biosynthesis, while the cor-
some gene clusters for polyketide and nonribosomal peptide responding numbers in S. coelicolor and S. avermitilis are
biosynthesis were identified [21]. It can be anticipated that 4.5% and 6%, respectively [32]. The genome of S. tropica
more marine microbial genomic sequences will be available contains amazingly large size of genes (516 Kb) dedicated
in the near future, and more relevance of natural product bi- to polyketide synthase (PKS) and/or nonribosomal peptide
osynthesis to the microbial genomes will be disclosed. For in- synthetase (NRPS) biosynthesis, which are megasynthases
stance, the genomes of marine Nocardiopsis sp. strain TFS65- that are responsible for many active natural product biosyn-
07 and marine-derived fungus strain Aspergillus sp. MF297-2 thesis and are especially popular tools for combinational bi-
were reported to be sequenced, and studies on the biosyn- osynthesis [33–35]. The majority of the gene loci are novel,
thesis of thiopeptide antibiotic TP-1161 and prenylated in- indicating that S. tropica has great potential to produce
dole alkaloids, stephacidin and notoamide metabolites, were novel natural products and that the biosynthetic potential
subsequently guided by the bioinformatics analysis of gene of this species, like that of many other actinomycetes that
clusters located in these genomes [22, 23]. Despite the fact were genomically sequenced, is considerably greater than
Evidence-Based Complementary and Alternative Medicine 3
H O
N N
N N
O
O O O
O NH N
NH HN NH
O
O
Soblidotin Plinabulin
(a) (b)
OH
O O
O O O
OH
O
H
O O
O
OH NH
OH
O HO
O
O O
O
CI Me
O
Bryostatin Salinosporamide A
(c) (d)
CH3
S
H N
OCH3
CH3
H H
Curacin A
(e)
that has been observed by cultivation and chemical analysis ing is increasingly challenged by repeated discovery of known
[26], which provided basis for mining of these novel genetic compounds, as well as the limitation of available assay meth-
sources for new natural products. ods. Therefore, new techniques are needed to maximize the
diversity of natural products for the discovery of new ther-
3. Important Roles of Genetic apeutic agents, not only to increase the efficacy and decrease
Studies to Maximize the Diversity for the toxicity, but also to combat the emergence of drug resist-
Natural Product Discovery ance.
The development of genomic sequencing techniques as
Although natural products from marine microorganisms well as the bioinformatics tools in recent years has profound
have already widened the spectrum of chemical diversity, in- influence on the discovery of new drugs. Nowadays it is much
creasing the diversity of natural compounds is still the pre- easier to have the genome of the interested organisms se-
requisite for HTS to get enough new hits for drug discov- quenced, especially for relatively small genomes of micro-
ery. And in the meantime, the classical activity-based screen- organisms. The availability of genomic sequences and the
4 Evidence-Based Complementary and Alternative Medicine
Recombinant
diversity
Mutational biosynthesis
Combinational biosynthesis
Natural
diversity Maximized
diversity
Genetic
diversity Genome sequencing for
Strain
diversity structure prediction and target
Chemical isolation of compounds
diversity Identification of novel
Isolation of novel
species enzymes for biocatalysis
Figure 2: Important tools to maximize the diversity for new drug discovery.
subsequent genome mining of microorganisms have pro- therefore, a lot of efforts have to be made to test different
vided new insights in the biosynthetic potential of the cells, media and cultivation parameters; (2) the bioassay-based
and thus the studies of marine natural products have entered screening results in the rediscovery of known compounds
into the new postgenomic era. There is an increasing trend from the screening of natural products; (3) the elucidation
to expand the studies on the chemical diversity of natural of complex structures; (4) the isolation of the natural pro-
products from bioassay-based screening to genetic diversity ducts is hampered by low production yields and complex
studies, from the studies of natural diversity to creation and purification procedures.
utilization of recombinant diversity (e.g., to use genetic tools In the recent years, more and more studies have focused
to produce new “unnatural” natural products), and in the on the “from genetics-to-chemistry” route for natural prod-
meantime, it is well accepted that the chemical diversity and uct research, that is, to use gene-based screening strategy to
genetic diversity not only exist in different microbial species, study the biosynthetic potential of the microbial strains, fol-
but also exist in the different strains in one species [36]. lowed by molecular cloning experiments and chemical puri-
Therefore, the chemical diversity for useful natural products fications [38, 39]. A good example is the studies on the
can be maximized by the integration of genomic research identification of active halogenated compounds from 550
and genetic engineering with the efforts of chemists. The randomly selected actinomycetes based on the conserved se-
important strategies to maximize biodiversity of marine nat- quences from diverse halogenase genes. Using this “genome-
ural products are illustrated in Figure 2, and will be depicted based” strategy, novel halogenase genes were identified and
in detail in the following sections. novel halometabolites were isolated by the cloning of related
gene cluster in heterologous host [38]. We used the same
strategy to screen the marine actinobacteria strain library
4. “Gene-to-Compound” Procedure in our lab and isolated a gene cluster putatively involved
for Genome-Based Screening of in the biosynthesis of glycopeptide antibiotics. Furthermore,
Natural Products the genomic sequence of a new marine-derived Streptomyces
sp. S187 was obtained, and bioinformatics analysis guided
It has been observed that the genetic elements responsible for the identification of the gene cluster responsible for a new
the biosynthesis of many, if not all, secondary metabolites are glycopeptide antibiotic (unpublished data). Genome scan-
clustered in the bacterial or fungal genomes to form gene ning is another successful approach, in which the random
clusters, which include the genes encoding biosynthetic en- genome sequence tags (GSTs) prepared from the genomic
zymes, as well as genes responsible for regulation and re- DNA library are screened using degenerate primers to iden-
sistance [37]. This genetic feature has not only greatly facil- tify the gene cluster, and the products of the gene cluster
itated the molecular cloning and characterization of the bio- can be subsequently searched using various genomics-guid-
synthetic genes, but has also provided basis for the generation ed strategies [40, 41], which will be detailed in the fol-
of novel compounds through combinational biosynthesis. lowing section. Using this “gene-to-compound” strategy,
Traditionally, to identify and isolate the gene cluster for screening of a large strain library can be rapidly focused on
natural product biosynthesis, knowledge on the chemical small group of strains with high possibility to produce new
structures of the compounds must be obtained prior to the compounds. However, the success of this strategy is depen-
genetic studies. However, this “compound-to-gene” route is dent on multifaceted factors, including the selection of target
facing challenges in that (1) the cultivation media and con- genes for genome-based screening, the design of suitable
ditions have great impact on the searching of the chemicals; degenerate primers, the quality of template DNA (especially
Evidence-Based Complementary and Alternative Medicine 5
OMe OMe OH
CH3 O
OH O
H2 C N
H
CH3
O
CH3 CH3
CH3 HO
OH
HO MeO
H
O N
OMe
O OH
O O O
OH O
Psymberin Theopederin A
(a) (b)
Figure 5: Structures of antitumor agents psymberin and theopederins A studied in metagenomic analysis.
Marine Marine
microorganisms environmental DNA
(eDNA)
Figure 6: Combination of genome mining with classical activity-based screening for natural product discovery, generation, and
hyperproduction.
which unveiled 148 previously unknown bacterial phylotypes dependent approach is termed metagenomics. During the
and 1.2 million previously unknown genes. However, the past decade, many successful metagenomic studies have been
majority of the marine symbionts and 99% of the microbial reported. Onnamides and theopederins are antitumor pol-
population in environment are difficult to grow or are slow- yketides produced by an uncultured Pseudomonas sp. sym-
ly growing as pure culture. To fully access the valuable biont of marine sponge Theonella swinhoei. Biosynthesis
chemical diversity and explore the biosynthetic potential genes of onnamides and theopederins were isolated from the
of all the microbial communities, the environmental DNA metagenome of the marine sponge, and bioinformatics anal-
(eDNA) is extracted directly from a given environment, and ysis of the biosynthetic genes strongly indicated a prokaryotic
packed into vectors, following by transformation to various origin, suggesting that these potent antitumor agents may be
hosts, including E. coli and Streptomyces lividans. Clone produced by the symbiotic bacteria [65]. An entire putative
libraries are produced independently of the host cultivation gene cluster responsible for the biosynthesis of bryostatin,
or fermentation and then subjected to sequence-based which has been evaluated for the treatment of various
screening or function-based screening. This cultivation-in- leukemias, ovarian cancers, and prostate cancers, has been
8 Evidence-Based Complementary and Alternative Medicine
implicated to be produced by a symbiotic bacteria, Candi- have revealed tremendous capability of marine microor-
datus Endobugula sertula from the marine bryozoan [66]. ganisms to produce active natural products as therapeutic
In another study, gene cluster for the biosynthesis of potent agents. Studies on the biosynthetic machinery and regulatory
antitumor agent psymberin was isolated from the metage- mechanisms of natural product biosynthesis will greatly
nomic library of marine sponge Psammocinia aff. Bulbosa maximize the diversity exploration of marine natural prod-
[67]. Combining with the research development in heterolo- ucts. Nowadays the diversity studies of natural products have
gous expression [68], active compounds can be produced in been shift from pure chemical analysis to the combination of
large quantities by overexpressing the biosynthetic gene clus- genetic manipulations and chemical synthesis, and the di-
ters isolated from metagenomic libraries in the heterologous versity of natural products can be further enlarged by ge-
hosts, which will solve the supply and sustainability problem netic engineering of biosynthetic genes. Genomic research
of the precious compounds produced by marine symbionts of marine microorganisms will have great impact on the
and the yet “unculturable” marine microorganisms.
discovery of novel natural products for medical treatments
The structures of some compounds studied by metage-
and will contribute to efficient drug discovery from marine
nomic analysis were presented in Figure 5.
environment.
Trends in Pharmacological Sciences, vol. 31, no. 6, pp. 255–265, the stephacidin and notoamide anticancer agents in a marine-
2010. derived Aspergillus sp,” Journal of the American Chemical
[9] F. A. Villa and L. Gerwick, “Marine natural product drug Society, vol. 132, no. 36, pp. 12733–12740, 2010.
discovery: leads for treatment of inflammation, cancer, infec- [24] S. D. Bentley, K. F. Chater, A. M. Cerdeño-Tárraga et al.,
tions, and neurological disorders,” Immunopharmacology and “Complete genome sequence of the model actinomycete
Immunotoxicology, vol. 32, no. 2, pp. 228–237, 2010. Streptomyces coelicolor A3(2),” Nature, vol. 417, no. 6885, pp.
[10] A. L. Waters, R. T. Hill, A. R. Place, and M. T. Hamann, 141–147, 2002.
“The expanding role of marine microbes in pharmaceutical [25] H. Ikeda, J. Ishikawa, A. Hanamoto et al., “Complete genome
development,” Current Opinion in Biotechnology, vol. 21, no. sequence and comparative analysis of the industrial microor-
6, pp. 780–786, 2010. ganism Streptomyces avermitilis,” Nature Biotechnology, vol. 21,
[11] T. L. Simmons, E. Andrianasolo, K. McPhail, P. Flatt, and W. no. 5, pp. 526–531, 2003.
H. Gerwick, “Marine natural products as anticancer drugs,” [26] M. Oliynyk, M. Samborskyy, J. B. Lester et al., “Complete
Molecular Cancer Therapeutics, vol. 4, no. 2, pp. 333–342, genome sequence of the erythromycin-producing bacterium
2005. Saccharopolyspora erythraea NRRL23338,” Nature Biotechnol-
[12] H. Luesch, R. E. Moore, V. J. Paul, S. L. Mooberry, and T. H. ogy, vol. 25, no. 4, pp. 447–453, 2007.
Corbett, “Isolation of dolastatin 10 from the marine cyanobac- [27] D. W. Udwary, L. Zeigler, R. N. Asolkar et al., “Genome
terium Symploca species VP642 and total stereochemistry and sequencing reveals complex secondary metabolome in the
biological evaluation of its analogue symplostatin 1,” Journal marine actinomycete Salinispora tropica,” Proceedings of the
of Natural Products, vol. 64, no. 7, pp. 907–910, 2001. National Academy of Sciences of the United States of America,
[13] W. Fenical, P. R. Jensen, and X. C. Cheng, “Halimide, a vol. 104, no. 25, pp. 10376–10381, 2007.
cytotoxic marine natural product, and derivatives thereof,” [28] Y. Ohnishi, J. Ishikawa, H. Hara et al., “Genome sequence
WO/1999/048889, The Regents of the University of California, of the streptomycin-producing microorganism Streptomyces
September 1999. griseus IFO 13350,” Journal of Bacteriology, vol. 190, no. 11,
[14] S. K. Davidson, S. W. Allen, G. E. Lim, C. M. Anderson, and pp. 4050–4060, 2008.
M. G. Haygood, “Evidence for the biosynthesis of bryostatins [29] X. J. Wang, Y. J. Yan, B. Zhang et al., “Genome sequence of the
by the bacterial symbiont “Candidatus Endobugula sertula” milbemycin-producing bacterium Streptomyces bingchenggen-
of the bryozoan Bugula neritina,” Applied and Environmental sis,” Journal of Bacteriology, vol. 192, no. 17, pp. 4526–4527,
Microbiology, vol. 67, no. 10, pp. 4531–4537, 2001. 2010.
[15] R. H. Feling, G. O. Buchanan, T. J. Mincer, C. A. Kauffman, P. [30] J. Y. Song, H. Jeong, D. S. Yu et al., “Draft genome sequence of
R. Jensen, and W. Fenical, “Salinosporamide A: a highly cyto- Streptomyces clavuligerus NRRL 3585, a producer of diverse
toxic proteasome inhibitor from a novel microbial source, a secondary metabolites,” Journal of Bacteriology, vol. 192, no.
marine bacterium of the new genus Salinospora,” Angewandte 23, pp. 6317–6318, 2010.
Chemie International Edition, vol. 42, no. 3, pp. 355–357, 2003. [31] N. Ichikawa, A. Oguchi, H. Ikeda et al., “Genome sequence of
[16] W. H. Gerwick, L. T. Tan, and N. Sitachitta, “Nitrogen- kitasatospora setae NBRC 14216T: an evolutionary snapshot
containing metabolites from marine cyanobacteria,” in The of the family Streptomycetaceae,” DNA Research, vol. 17, no. 6,
Alkaloids: Chemistry and Biology, G. A. Cordell, Ed., vol. 57, pp. 393–406, 2010.
pp. 75–184, Academic Press, San Diego, Calif, USA, 2001. [32] M. Nett, H. Ikeda, and B. S. Moore, “Genomic basis for natural
[17] M. E. Rateb and R. Ebel, “Secondary metabolites of fungi from product biosynthetic diversity in the actinomycetes,” Natural
marine habitats,” Natural Product Reports, vol. 28, no. 2, pp. Product Reports, vol. 26, no. 11, pp. 1362–1384, 2009.
290–344, 2011. [33] D. E. Cane, C. T. Walsh, and C. Khosla, “Harnessing the bio-
[18] K. Liolios, I. A. Chen, K. Mavromatis et al., “The Genomes synthetic code: combinations, permutations, and mutations,”
On Line Database (GOLD) in 2009: status of genomic and Science, vol. 282, no. 5386, pp. 63–68, 1998.
metagenomic projects and their associated metadata,” Nucleic [34] H. G. Floss, “Combinatorial biosynthesis-potential and prob-
Acids Research, vol. 38, no. 1, pp. D346–D354, 2009. lems,” Journal of Biotechnology, vol. 124, no. 1, pp. 242–257,
[19] K. Liolios, K. Mavromatis, N. Tavernarakis, and N. C. Kyrpi- 2006.
des, “The Genomes On Line Database (GOLD) in 2007: status [35] L. Du, C. Sánchez, and B. Shen, “Hybrid peptide-polyketide
of genomic and metagenomic projects and their associated natural products: biosynthesis and prospects toward engineer-
metadata,” Nucleic Acids Research, vol. 36, no. 1, pp. D475– ing novel molecules,” Metabolic Engineering, vol. 3, no. 1, pp.
D479, 2008. 78–95, 2001.
[20] Moore, “Microbial Genome Sequencing Project,” http:// [36] P. R. Jensen, P. G. Williams, D.-C. Oh, L. Zeigler, and W.
camera.calit2.net/microgenome. Fenical, “Species-specific secondary metabolite production in
[21] A. C. Jones, E. A. Monroe, E. B. Eisman, L. Gerwick, D. marine actinomycetes of the genus Salinispora,” Applied and
H. Sherman, and W. H. Gerwick, “The unique mechanistic Environmental Microbiology, vol. 73, no. 4, pp. 1146–1152,
transformations involved in the biosynthesis of modular nat- 2007.
ural products from marine cyanobacteria,” Natural Product [37] J. F. Martin, “Clusters of genes for the biosynthesis of anti-
Reports, vol. 27, no. 7, pp. 1048–1065, 2010. biotics: regulatory genes and overproduction of pharmaceuti-
[22] K. Engelhardt, K. F. Degnes, and S. B. Zotchev, “Isolation and cals,” Journal of Industrial Microbiology, vol. 9, no. 2, pp. 73–90,
characterization of the gene cluster for biosynthesis of the 1992.
thiopeptide antibiotic TP-1161,” Applied and Environmental [38] A. Hornung, M. Bertazzo, A. Dziarnowski et al., “A genomic
Microbiology, vol. 76, no. 21, pp. 7093–7101, 2010. screening approach to the structure-guided identification of
[23] Y. Ding, J. R. de Wet, J. Cavalcoli et al., “Genome-based drug candidates from natural sources,” ChemBioChem, vol. 8,
characterization of two prenylation steps in the assembly of no. 7, pp. 757–766, 2007.
10 Evidence-Based Complementary and Alternative Medicine
[39] T. Toyomasu, A. Kaneko, T. Tokiwano et al., “Biosynthetic [55] L. C. Blasiak and J. Clardy, “Discovery of 3-formyl-tyrosine
gene-based secondary metabolite screening: a new diterpene, metabolites from Pseudoalteromonas tunicata through heterol-
methyl phomopsenonate, from the fungus Phomopsis amyg- ogous expression,” Journal of the American Chemical Society,
dali,” Journal of Organic Chemistry, vol. 74, no. 4, pp. 1541– vol. 132, no. 3, pp. 926–927, 2010.
1548, 2009. [56] S. Bergmann, J. Schümann, K. Scherlach, C. Lange, A. A.
[40] E. Zazopoulos, K. Huang, A. Staffa et al., “A genomics-guided Brakhage, and C. Hertweck, “Genomics-driven discovery of
approach for discovering and expressing cryptic metabolic PKS-NRPS hybrid metabolites from Aspergillus nidulans,”
pathways,” Nature Biotechnology, vol. 21, no. 2, pp. 187–190, Nature Chemical Biology, vol. 3, no. 4, pp. 213–217, 2007.
2003. [57] M. Gottelt, S. Kol, J. P. Gomez-Escribano, M. Bibb, and E.
[41] L. C. Foulston and M. J. Bibb, “Microbisporicin gene cluster Takano, “Deletion of a regulatory gene within the cpk gene
reveals unusual features of lantibiotic biosynthesis in actino- cluster reveals novel antibacterial activity in Streptomyces
mycetes,” Proceedings of the National Academy of Sciences of the coelicolor A3(2),” Microbiology, vol. 156, no. 8, pp. 2343–2353,
United States of America, vol. 107, no. 30, pp. 13461–13466, 2010.
2010. [58] H. Gross, V. O. Stockwell, M. D. Henkels, B. Nowak-Thom-
[42] I. Borodina, J. Siebring, J. Zhang et al., “Antibiotic overpro- pson, J. E. Loper, and W. H. Gerwick, “The genomisotopic
duction in Streptomyces coelicolor A3(2) mediated by phos- approach: a systematic method to isolate products of orphan
phofructokinase deletion,” Journal of Biological Chemistry, vol. biosynthetic gene clusters,” Chemistry and Biology, vol. 14, no.
283, no. 37, pp. 25186–25199, 2008. 1, pp. 53–63, 2007.
[59] A. L. McClerren, L. E. Cooper, C. Quan, P. P. Thomas, N. L.
[43] I. Borodina, P. Krabben, and J. Nielsen, “Genome-scale
Kelleher, and W. A. van der Donk, “Discovery and in vitro
analysis of Streptomyces coelicolor A3(2) metabolism,” Genome
biosynthesis of haloduracin, a two-component lantibiotic,”
Research, vol. 15, no. 6, pp. 820–829, 2005.
Proceedings of the National Academy of Sciences of the United
[44] M. Castro-Melchor, S. Charaniya, G. Karypis, E. Takano, and States of America, vol. 103, no. 46, pp. 17243–17248, 2006.
W. S. Hu, “Genome-wide inference of regulatory networks in [60] P. D. Schloss and J. Handelsman, “Metagenomics for studying
Streptomyces coelicolor,” BMC Genomics, vol. 11, no. 1, article unculturable microorganisms: cutting the Gordian knot,”
578, 2010. Genome Biology, vol. 6, no. 8, article 229, 2005.
[45] S. G. van Lanen and B. Shen, “Microbial genomics for the [61] S. F. Brady, L. Simmons, J. H. Kim, and E. W. Schmidt,
improvement of natural product discovery,” Current Opinion “Metagenomic approaches to natural products from free-
in Microbiology, vol. 9, no. 3, pp. 252–260, 2006. living and symbiotic organisms,” Natural Product Reports, vol.
[46] H. Gross, “Strategies to unravel the function of orphan 26, no. 11, pp. 1488–1503, 2009.
biosynthesis pathways: recent examples and future prospects,” [62] A. Uria and J. Piel, “Cultivation-independent approaches
Applied Microbiology and Biotechnology, vol. 75, no. 2, pp. 267– to investigate the chemistry of marine symbiotic bacteria,”
277, 2007. Phytochemistry Reviews, vol. 8, no. 2, pp. 401–414, 2009.
[47] J. B. McAlpine, “Advances in the understanding and use of the [63] C. Gurgui and J. Piel, “Metagenomic approaches to identify
genomic base of microbial secondary metabolite biosynthesis and isolate bioactive natural products from microbiota of
for the discovery of new natural products,” Journal of Natural marine sponges,” Methods in Molecular Biology, vol. 668, pp.
Products, vol. 72, no. 3, pp. 566–572, 2009. 247–264, 2010.
[48] H. Gross, “Genomic mining—a concept for the discovery of [64] J. C. Venter, K. Remington, J. F. Heidelberg et al., “Envi-
new bioactive natural products,” Current Opinion in Drug ronmental genome shotgun sequencing of the Sargasso Sea,”
Discovery and Development, vol. 12, no. 2, pp. 207–219, 2009. Science, vol. 304, no. 5667, pp. 66–74, 2004.
[49] J. E. Velásquez and W. A. van der Donk, “Genome mining for [65] J. Piel, D. Hui, G. Wen et al., “Antitumor polyketide biosynthe-
ribosomally synthesized natural products,” Current Opinion in sis by an uncultivated bacterial symbiont of the marine sponge
Chemical Biology, 2010. Theonella swinhoei,” Proceedings of the National Academy of
Sciences of the United States of America, vol. 101, no. 46, pp.
[50] A. L. Lane and B. S. Moore, “A sea of biosynthesis: marine
16222–16227, 2004.
natural products meet the molecular age,” Natural Product
[66] S. Sudek, N. B. Lopanik, L. E. Waggoner et al., “Identification
Reports, vol. 28, no. 2, pp. 411–428, 2011.
of the putative bryostatin polyketide synthase gene clus-
[51] J. E. Velásquez and W. A. van der Donk, “Genome mining for ter from “Candidatus Endobugula sertula”, the uncultivated
ribosomally synthesized natural products,” Current Opinion in microbial symbiont of the marine bryozoan Bugula neritina,”
Chemical Biology, vol. 15, pp. 11–12, 2010. Journal of Natural Products, vol. 70, no. 1, pp. 67–74, 2007.
[52] A. S. Eustáquio, S. J. Nam, K. Penn et al., “The discovery of [67] K. M. Fisch, C. Gurgui, N. Heycke et al., “Polyketide assembly
salinosporamide K from the marine bacterium “Salinispora lines of uncultivated sponge symbionts from structure-based
pacifica” by Genome mining gives insight into pathway gene targeting,” Nature Chemical Biology, vol. 5, no. 7, pp. 494–
evolution,” ChemBioChem, vol. 12, no. 1, pp. 61–64, 2011. 501, 2009.
[53] S. Lautru, R. J. Deeth, L. M. Bailey, and G. L. Challis, [68] H. Zhang, B. A. Boghigian, J. Armando, and B. A. Pfeifer,
“Discovery of a new peptide natural product by Streptomyces “Methods and options for the heterologous production of
coelicolor genome mining,” Nature Chemical Biology, vol. 1, no. complex natural products,” Natural Product Reports, vol. 28,
5, pp. 265–269, 2005. no. 1, pp. 125–151, 2011.
[54] C. Corre, L. Song, S. O’Rourke, K. F. Chater, and G. L. Challis, [69] F. O. Glöckner and I. Joint, “Marine microbial genomics
“2-Alkyl-4-hydroxymethylfuran-3-carboxylic acids, antibiotic in Europe: current status and perspectives: minireview,”
production inducers discovered by Streptomyces coelicolor Microbial Biotechnology, vol. 3, no. 5, pp. 523–530, 2010.
genome mining,” Proceedings of the National Academy of [70] A. Starcevic, J. Zucko, J. Simunkovic, P. F. Long, J. Cullum, and
Sciences of the United States of America, vol. 105, no. 45, pp. D. Hranueli, “ClustScan: an integrated program package for
17510–17515, 2008. the semi-automatic annotation of modular biosynthetic gene
Evidence-Based Complementary and Alternative Medicine 11
Research Article
Impact of Intensive Land-Based Fish Culture in Qingdao,
China, on the Bacterial Communities in Surrounding Marine
Waters and Sediments
Qiufen Li,1 Yan Zhang,1 David Juck,2 Nathalie Fortin,2 and Charles W. Greer2
1 Yellow
Sea Fishery Research Institute, Chinese Academy of Fishery Science, 106 Nanjing Road, Shandong, Qingdao 266071, China
2 BiotechnologyResearch Institute, National Research Council of Canada, 6100 Royalmount Avenue,
Montreal, Québec, Canada H4P 2R2
The impact of intensive land-based fish culture in Qingdao, China, on the bacterial communities in surrounding marine
environment was analyzed. Culture-based studies showed that the highest counts of heterotrophic, ammonium-oxidizing,
nitrifying, and nitrate-reducing bacteria were found in fish ponds and the effluent channel, with lower counts in the adjacent
marine area and the lowest counts in the samples taken from 500 m off the effluent channel. Denaturing gradient gel electrophoresis
(DGGE) analysis was used to assess total bacterial diversity. Fewer bands were observed from the samples taken from near the
effluent channel compared with more distant sediment samples, suggesting that excess nutrients from the aquaculture facility
may be reducing the diversity of bacterial communities in nearby sediments. Phylogenetic analysis of the sequenced DGGE
bands indicated that the bacteria community of fish-culture-associated environments was mainly composed of Flavobacteriaceae,
gamma- and deltaproteobacteria, including genera Gelidibacter, Psychroserpen, Lacinutrix, and Croceimarina.
in 1993. Since then, DGGE has been widely used in microbial DNA extraction buffer (100 mM Tris-HCl, 100 mM EDTA,
diversity analyses of different ecoenvironments, such as 100 mM Na3 PO4 , 1.5 M NaCl, pH 8.0) were added to the
explosive-polluted soil [10], estuary [11], scallop early stage tubes. The samples were incubated on shaking inoculators
environment [12], shrimp guts [13], and the offshore cage for 1 h at 30◦ C, and another 1 h at 37◦ C after 20 μL proteinase
fish farms [6]. However, it has never been utilized to K (100 mg/mL) was added, followed by 5∼15 min at 85◦ C
examine the microbes in land-based fish-culture-associated with 100 μL 20% SDS. Subsequently, samples were then
environment. In this study, bacterial community compo- centrifuged at 4,100 g for 15 min. One-second volume of
sition of the environment associated with intensive land- 7.5 M ammonium acetate was added to the supernatants,
based marine fish culture was investigated through culture- followed by incubation on ice for 15 min. Thereafter, tubes
dependent and culture-independent approaches, with the were centrifuged at 4◦ C and 9, 400 g for 15 min, and the
aim to characterize the bacteria compositions of associated supernatants were treated with cold 2-propanol overnight
environment and to evaluate the effect of intensive fish at −20◦ C. Pellets were raised with 70% and 95% ethanol,
culture on the bacteria community in nearby sea areas. respectively. DNA was finally resuspended in sterilized
distilled water. The crude DNA extract was purified with
polyvinylpolypyrrolidone (PVPP) and sephacryl S-400 spin
2. Materials and Methods columns as described by Elliott [2] to remove PCR inhibitors,
2.1. Description of Sites and Sampling. The intensive land- such as humid acid. Untreated and treated DNA were
based fish-culturing farm is located in the suburb of compared by electrophoresis 0.7% agarose gel at 60 V for
Qingdao, China. It is a newly developed industry and mainly 2 h and visualized on a MultiImage light Cabinet (Alpha
raises turbot (Scophthalmus maximus) and Japanese flounder Innotech Corporation, France).
(Paralichthys olivaceus) with natural and underground sea
water. Most of the untreated effluent is discharged into the 2.4. Amplification of 16S rDNA. The bacterial universal
nearby Aoshan Bay. The samples were collected from the primers, U341 and U758, were used to amplify a 418 bp
fish farming ponds, effluent channel, polluted sea areas 10 m fragment corresponding to position 341 to 758 bp of
off the effluent channel end, and unpolluted sea area 500 m Escherichia coli 16S rDNA sequence [9]. To stabilize the
off the channel end. Triplicate samples were collected with melting behavior of the amplified fragments in the DGGE
sterilized containers from each site, each including 2 L of reaction, the forward primer contained a GC-clamp [10].
sea water and 50 g of sediment, and were transferred to the Sequences of the U341 and U758 were as follows: U341:
laboratory on ice in time. Subsamples were then treated for 5-GCGGGCGGGGCGGGGGGCACGGGGGGCGCCGGC-
bacteria cultivation. The remaining samples were stored at GGGCGGGGCGGGGGCCTACGGGAGGCAGCAG-3 ;
−20◦ C for molecular analysis. U758: 5 -CTACCAGG GTATCTAATCC-3 . For optimum
DGGE result, different PCR conditions were tested. The
2.2. Detection of Bacteria Groups with Different Physiological optimum PCR reaction was carried out in a 50 μL volume,
Functions. The sediment and water samples were serially including 5 μL of genomic DNA as the template, 5 μL 10 ×
diluted 10-fold with sterilized sea water, and 0.1 mL aliquots PCR buffer, 25 pmol of each primer, 200 μM of each
of the dilution were spread onto Zobell’s 2216E medium dNTP, 1 mM MgCl2 , and 2.5 units of Taq polymerase
for heterotrophic bacteria and other appropriate media for (Amersham Biosciences, Piscataway, USA). Before adding
ammonia oxidizing bacteria and nitrifying bacteria [8]. Taq polymerase, samples were denatured at 96◦ C for 5 min,
Colonies on the plates were counted after 2-3 days incubation followed by a touchdown PCR protocol [15] in which the
at 28◦ C. annealing temperature was set to 65◦ C and decreased by
Sulfate and nitrate reducing bacteria were detected with 1◦ C every cycle until it reached 55◦ C. Each cycle included
“Most Probable Number” method as described previously denaturation at 94◦ C for 1 min, anneal for 1 min, and
[6, 14]. Briefly, aliquots of 1 mL series dilution were added extension at 72◦ C for 3 min. Twenty additional cycles were
into series 10 mL of media. Triplicate tubes were prepared carried out with annealing at 55◦ C. Finally, 5 μL of each
for each dilution. Cultures were detected after 7 days of PCR product was loaded onto a 1.4% agarose gel with a
incubation at 28◦ C for nitrate reducing bacteria and 14 days 100 bp DNA ladder (MBI Fermentas, Amherst, USA). Bands
for sulfate reducing bacteria. The population size of bacteria were visualized with SYBR safe dye in the MultiImage light
was calculated by referring to the table, according to the tubes cabinet.
with positive outcomes at each dilution. The three counting
results for each sampling site were averaged, and the standard 2.5. DGGE Analysis of Amplified DNA. DGGE was per-
deviations (STDEV) were shown. formed on the Decode Universal Mutation Detection System
(Bio-Rad Inc., Mississauga, Canada) as described by the
2.3. Extraction of Genomic DNA of Bacteria. Genomic DNA manufacturer. The separation was carried out on an 8%
was extracted using the chemical-enzymatic lyses protocol (W/V) acrylamide gel in 1X TAE (40 mM Tris-acetate, pH
[15] with a few modifications. Briefly, the membrane for 8.0; 1 mM Na2 DETA) containing a linear gradient from
water sample or 10 g of each sediment sample with 5 25% to 65% denaturant (100% denaturant consisted of
mL of sterilized distilled water were vortexed at maximum 7 M urea and 40% formamide) as described by Muyzer
speed for 5 min, then 1 mL lysozyme (100 mg/mL) and 4 mL et al. [9]. To avoid disturbance of the gradient during comb
Evidence-Based Complementary and Alternative Medicine 3
Table 1: Population size of various bacteria groups in sediment and water samples.
F6 J2
H7
3.2. Genomic DNA of Bacteria Isolated from Fish-Culture- F7
H8
Associated Environments. The size of obtained Genomic K8
F8 I3
bacterial DNA fragment was about 23 kb. The extracts G1
F9
became colorless from brown, and their electrophoresis G2 I4 K10
Table 2: The Shannon index of the bacteria in the water and sedi- composed of Flavobacteria, Gammaproteobacteria and Del-
ment samples shown by DGGE bands. taproteobacteria. Among them, Flavobacteria showed strong
dominance, and it covered genera Gelidibacter, Psychroser-
Sample no. 1 2 3 4 5 6
pen, Lacinutrix, Croceimarina, Actibacter, Maribacter, Wino-
Shannon index 1.25 1.27 1.37 1.46 1.15 1.19 gradskyella, Zobellia, Formosa, and Polaribacter. The two pro-
teobacteria groups ranted a small part of the total popu-
lation. Some of these species had not been cultured inde-
1 pendently, such as I4 and K7. For individual environment,
0.9
Aquaculture DGGE
Table 3: Closest BLAST match for 16S rRNA genes of bacteria in fish-culture-associated environments.
evenness in species distribution was observed from sediment sediment, since sulfate is a favored terminal electron acceptor
samples in polluted sea areas than that in unpolluted sea in this environment [24], though the number of bacteria
areas, with Shannon index 1.37 and 1.46, respectively. These detected was very low through culture-dependent methods
observations proposed that intensive land-based fish-culture in this paper. Genus Formosa (K1) was found both in
effluent have produced significant impact on the bacteria the effluent channel water and native sea water, and it
community, leading to reduction in bacterial diversity. was a heterotrophic, gram-negative, motile, aerobic, and
Furthermore, both of the studies were carried out shortly brown alga-degrading bacterial group [25, 26], indicating its
after the development of fish culture. With a longer culturing commitment to the marine environment.
time, it is reasonable to believe that the impact would be Many of the main bacteria groups, such as Aeromon-
much more significant. Asami et al. [18] also reported that adaceae, Pseudomonadaceae, and Vibrionaceae detected as
intensive shellfish aquaculture accelerated sulfur cycle in pathogens of farmed fish with traditional culture-depended
the beneath coastal marine sediment [17]. Moreover, the methods, were not detected by molecular methods in this
bacterial community was decided by the habitat rather than paper, suggesting that pathogenic bacteria might not be
by its geographic location [19]. Namely, the impact of fish- dominant in the whole community. So, the bacterial com-
culture effluent to the bacterial communities may occur position is still far more complex than we could imagine.
by changing the chemical and physical conditions of their Further study is necessary to determine whether and how
habitat, besides importing bacteria from effluent. long the aquaculture could change the composition and
One of the dominant phylotype (K8) found in the fish destroy balance of bacterial communities in its nearby sea
culture effluent and polluted sea water area belonged to area.
the genus, Pseudoalteromonas of Gammaproteobacteria. This
genus had a widespread distribution in the marine envi- 5. Conclusion
ronment [20]. It was reported that Pseudoalteromonas had
both deleterious and beneficial effects on marine eukaryotes In the present paper, the impact of intensive land-based fish
[21–23]. The dominant phylotype (I3) in the sediment culture in Qingdao, China, on the bacterial communities
of unpolluted sea area was similar to Desulfuromonas sp., in surrounding marine environment was analyzed through
a sulfate-reducing bacterium in Delta-proteobacteria family. culture-based and molecular-based approaches. The result of
It was not surprising to find sulfate reducers in the marine culture-based studies showed that counts of heterotrophic,
Evidence-Based Complementary and Alternative Medicine 7
0.05
Figure 5: Phylogenetic tree of the sequences of 16S rDNA fragments separated by DGGE showed the classification positions of the bacteria
and the phylogenetic relationship between each other. Reference sequences are shown with their respective Genbank accession numbers. The
tree was built by MEGA bootstrap 1000 using neighbor joining.
[6] B. A. Yoza, R. M. Harada, C. C. Nihous, Q. X. Li, and S. M. agent of red spot disease of Laminaria japonica,” International
Masutani, “Impact of mariculture on microbial diversity in Journal of Systematic Bacteriology, vol. 48, no. 3, pp. 769–774,
sediments near open ocean farming of Polydactylus sexfilis,” 1998.
Ecological Indicators, vol. 7, no. 1, pp. 108–122, 2007. [22] A. P. Negri, N. S. Webster, R. T. Hill, and A. J. Heyward,
[7] R. I. Amann, W. Ludwig, and K. H. Schleifer, “Phylogenetic “Metamorphosis of broadcast spawning corals in response to
identification and in situ detection of individual microbial bacteria isolated from crustose algae,” Marine Ecology Progress
cells without cultivation,” Microbiological Reviews, vol. 59, no. Series, vol. 223, pp. 121–131, 2001.
1, pp. 143–169, 1995. [23] B. Migue and M. P. Combarro, “Bacteria associated with sar-
[8] Q. Li, B. Chen, K. Qu et al., “Variation of bacteria numbers dine (Sardinapil chardus) eggs in a natural environment (Ria
in fish-shrimp mix-culturing ecosystem,” Chinese Journal of de Vigo, Galicia, north western Spain),” FEMS Microbiology
Applied Ecology, vol. 13, no. 6, pp. 731–734, 2002. Ecology, vol. 44, no. 3, pp. 329–334, 2003.
[9] G. Muyzer, E. C. Waal, and A. G. Uitterlinden, “Profiling [24] J. P. Gray and R. P. Herwig, “Phylogenetic analysis of the
of complex microbial populations by denaturing gradient bacterial communities in marine sediments,” Applied and
gel electrophoresis analysis of polymerase chain reaction- Environmental Microbiology, vol. 62, no. 11, pp. 4049–4059,
amplified genes coding for 16S rRNA,” Applied and Environ- 1996.
mental Microbiology, vol. 59, no. 3, pp. 695–700, 1993. [25] E. P. vanova, Y. V. Alexeeva, S. Flavier et al., “Formosa algae
[10] D. Juck, B. T. Driscoll, T. C. Charles, and C. W. Greer, “Effect gen. nov., sp. nov., a novel member of the family Flavobacte-
of experimental contamination with the explosive hexahydro- riaceae,” International Journal of Systematic and Evolutionary
1,3,5-trinitro-1,3,5-triazine on soil bacterial communities,” Microbiology, vol. 54, no. 3, pp. 705–711, 2004.
FEMS Microbiology Ecology, vol. 43, no. 2, pp. 255–262, 2003. [26] O. I. Nedashkovskaya, S. B. Kim, M. Vancanneyt et al., “For-
[11] T. E. Freitag, L. Chang, and J. I. Presser, “Changes in mosa agariphila sp. nov., a budding bacterium of the family
the community structure and activity of β-proteobacterial Flavobacteriaceae isolated from marine environments, and
ammonia-oxidizing sediment bacteria along a freshwater- emended description of the genus Formosa,” International
marine gradient,” Environmental Microbiology, vol. 8, no. 4, Journal of Systematic and Evolutionary Microbiology, vol. 56,
pp. 684–696, 2006. no. 1, pp. 161–167, 2006.
[12] R. Sandaa, T. Magnesen, L. Torkildsen, and O. Bergh, “Char-
acterisation of the bacterial community associated with early
stages of great scallop (Pecten maximus), using denaturing
gradient gel electrophoresis (DGGE),” Systematic and Applied
Microbiology, vol. 26, no. 2, pp. 302–311, 2003.
[13] P. Luo, C. Hu, Z. Xie et al., “PCR-DGGE analysis of bacterial
community composition in brackish water Litopenaeus van-
namei system,” Journal of Tropical Oceanography, vol. 25, no.
2, pp. 49–50, 2006.
[14] S. Chen, W. Bao, B. Li et al., “Pollution situation of Rushan
Bay and analysis of heterotrophic microorganisms,” Journal of
Ocean College of Shandong , vol. 17, no. 4, pp. 86–94, 1987.
[15] N. Fortin, D. Beaumier, K. Lee, and C. W. Greer, “Soil washing
improves the recovery of total community DNA from polluted
and high organic content sediments,” Journal of Microbiologi-
cal Methods, vol. 56, no. 2, pp. 181–191, 2004.
[16] K. J. Purdy, D. B. Nedwell, and T. M. Embley, “Analysis
of the sulfate-reducing bacterial and methanogenic archaeal
populations in contrasting antarctic sediments,” Applied and
Environmental Microbiology, vol. 69, no. 6, pp. 3181–3191,
2003.
[17] H. Cai, Y. Sun, and X. Zhang, “Environmental impact of cage
aquaculture and the aquaculture environmental capacity in
Xiangshan Harbor,” Techniques and Equipment for Environ-
mental Pollution Control, vol. 7, no. 11, pp. 71–76, 2006.
[18] H. Asami, M. Aida, and K. Watanabe, “Accelerated sulfur cycle
in coastal marine sediment beneath areas of intensive shellfish
aquaculture,” Applied and Environmental Microbiology, vol. 71,
no. 6, pp. 2925–2933, 2005.
[19] T. Staufenberger, V. Thiel, J. Wiese, and J. F. Imhoff, “Phylo-
genetic analysis of bacteria associated with Laminaria saccha-
rina,” FEMS Microbiology Ecology, vol. 64, no. 1, pp. 65–77,
2008.
[20] T. L. Skovhus, C. Holmstrom, S. Kjelleberg, and I. Dahllof,
“Molecular investigation of the distribution, abundance and
diversity of the genus Pseudoalteromonas in marine samples,”
FEMS Microbiology Ecology, vol. 61, no. 2, pp. 348–361, 2007.
[21] T. Sawabe, H. Makino, M. Tatsumi et al., “Pseudoalteromonas
bacteriolytica sp. nov., a marine bacterium that is the causative
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 408973, 6 pages
doi:10.1155/2011/408973
Research Article
Pyrolytic Characteristics and Kinetics of Phragmites australis
Hui Zhao,1, 2, 3, 4 Huaxiao Yan,1 Congwang Zhang,1, 4 Xiaodong Liu,1 Yanhui Xue,1
Yingyun Qiao,1, 4 Yuanyu Tian,1, 4 and Song Qin2, 5
1 College of Chemical and Environmental Engineering, Shandong University of Science and Technology,
Qingdao, Shandong 266510, China
2 Institute of Oceanology, Chinese Academy of Sciences, Qingdao, Shandong 266071, China
3 Graduate University, Chinese Academy of Sciences, Beijing 100049, China
4 Shandong Provincial Key Laboratory of Low-Carbon Energy Chemical Engineering, Qingdao 266510, China
5 Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences, Yantai, Shandong 264003, China
Correspondence should be addressed to Hui Zhao, [email protected] and Song Qin, [email protected]
The pyrolytic kinetics of Phragmites australis was investigated using thermogravimetric analysis (TGA) method with linear
temperature programming process under an inert atmosphere. Kinetic expressions for the degradation rate in devolatilization
and combustion steps have been obtained for P. australis with Dollimore method. The values of apparent activation energy, the
most probable mechanism functions, and the corresponding preexponential factor were determined. The results show that the
model agrees well with the experimental data and provide useful information for the design of pyrolytic processing system using
P. australis as feedstock to produce biofuel.
P. australis samples according to national standard GB212-91 Table 1: Proximate analysis, ultimate analysis, and component
(China) and element analyzer (Elementar Analysensysteme analysis of P. australis (/%wt).
GmbH vario EL cube), respectively. In addition, cellulose,
Parameter P. australis
hemicelluloses, and lignin contents were analyzed according
to methods from the literature [13]. The results were Proximate analysisa (wt.%, ad. Basis)
summarized in Table 1. All tests were carried out in triplicate. Moisture 5.89 ± 0.03
Ash 12.32 ± 1.12
2.3. Pyrolysis of the Samples. Thermogravimetric analyses Volatile matter 70.01 ± 2.40
were carried out using a thermal analyzer (TGA/DSC1/ Fix carbonc 11.78
1600LF, METTLER TOLEDO Co., Switzerland). 10 mg of Ultimate analysisb (wt.%, daf. Basis)
initial sample was pyrolyzed under a nitrogen flow rate of Carbon 42.78 ± 1.53
50 cm3 /min with a heating rate of 25◦ C/min. The weight loss Hydrogen 5.17 ± 0.02
and calorific changes in response to temperature were then Oxygenc 50.511
recorded and used to plot the thermogravimetric analysis Nitrogen 1.31 ± 0.02
(TGA), derivative thermogravimetric analysis (DTG), and Sulfur 0.229 ± 0.01
differential scanning calorimetric (DSC) curves. All experi- C/H 8.31 ± 0.31
ments were replicated three times.
C/N 32.57 ± 1.55
Component analysis (wt.%, daf. Basis)
2.4. The Kinetic Parameters of the Samples.
Hemicellulose 30.68 ± 3.15
dα Lignin 20.34 ± 1.56
= κ f (α), (1) Cellulose 43.05 ± 3.98
dt a
Dry-free basis; b Dry ash-free basis; c Calculated by difference.
where α is the conversion rate and is defined as
m0 − m
α= , (2) Both of (5) and (6) are called Harcourt-Fission model
m0 − m∞
of integral. m and B were constructed with deducing
κ is the velocity constant, and f (α) is the mechanism function coefficients of least-square method
with different relative coefficient
lgκi = lgC + mlgTi . (8)
T = T0 + βt, (3)
With a given value of lgTi, the constants C, m, lgκi can be
where β is the heating rate and T0 is the initial temperature. determined
The reaction rate constant, κ, can be described by the E
following expression: ln κi = ln A − . (9)
RTi
κ = CT m . (4) Substituting the value of ln κi back into (9) in conjunction
with 1/T allows lnA and E to be calculated [14].
By separation of variables and integration,
All plots were generated and the lines were fitted using
α the Origin 8.0 software.
dα C C
G(α) = = = T m+1 + D
0 f (α) β TT T m dT β(m + 1)
0
(5) 3. Results and Discussion
D=0
m+1 m+1
= BT + D BT . 3.1. Characterization of Materials. The results of proximate,
ultimate, and component analysis of P. australis samples
The expression of G(α) corresponding to each one of the are summarized in Table 1, which is in the same order of
mechanisms considered is also shown in Table 2 magnitude as energy crops. The comparison with other
terrestrial materials shows a higher amount of ash and
lgG(αi ) = lgB + (m + 1)lgTi . (6) cellulose. The volatile matter and lignin contents of P.
australis are lower, respectively, while the sulfur content of
This equation is used to estimate the most correct
the samples is approximately equal [15].
reaction mechanism function G(α). According to the plotting
lgG(αi) versus lgTi and a linear regression, if the mechanism
studied conforms to certain G(α) function, the slope of the 3.2. Characteristics of the Thermal Degradation Process.
straight line should be equal to −1.00000 and the linear Three stages in the pyrolytic process of P. australis are in
correlation coefficient R2 is high accordance with the conclusion of oxidative pyrolysis curves
of energy crops followed the usual shape for lignocellulosic
C materials [16–19]. The first stage (I) occurred as the
B= . (7)
β(m + 1) temperature increased from 50 to 240◦ C, losing cellular water
Evidence-Based Complementary and Alternative Medicine 3
Table 2: Algebraic expressions of functions G(α) and f (α) and mechanisms [23, 24].
and the external water bound by surface tension. While the as the temperature increased from 318 to 500◦ C with
second stage (II), occurring as the temperature increased a maximum weight loss point at 346◦ C. The third stage (III)
from 240 to 500◦ C was the devolatilization stage, during occurred as the temperature increased from 500 to 800◦ C
which the main pyrolytic process occurred and most of the with the residuals, the carbonaceous matters in the solid,
organic materials are decomposed accompanied by various slowly decomposed, resulting in the formation of a loose
volatile components released gradually, resulting in a large porous residual. A slight continued loss of weight is shown
weight loss which is more than 50% of total volatiles and in the weight loss curve. P. australis is composed of many
formation of the main pyrolytic production. Specifically, polysaccharides that have low polymerization. Moreover, the
stage II was composed of two zones for P. australis due to inorganic salts in P. australis presented a catalytic effect [20].
the different thermal stability of the components with zone I These findings indicate that the beginning of the decom-
occurring as the temperature increased from 240 to 318◦ C position occurs at a higher temperature for the samples
which is a strong peak in the rate of weight loss curve, evaluated in this study than for other terrestrial biomass with
at which the rate of weight loss attains maximum with a a high content of cellulose (straws and grasses) or lignin
maximum weight loss point at 288◦ C and zone II occurred (woody biomass).
4 Evidence-Based Complementary and Alternative Medicine
100 0 8
6
−0.2
80 4
288◦ C
lgG(αi )
60 0
−0.6 −2
346◦ C −4
40
−0.8 −6
I II III −8
20 −1
50 150 250 350 450 550 650 750 −10
T (◦ C) −12
2.71 2.72 2.73 2.74 2.75 2.76 2.77
Figure 1: TG-DTG curves of P. australis. lgT
−10
I II III
3.3. Kinetic Analysis of the Pyrolysis Process. The most
−15
probable mechanism function with integral form can be
expressed by G(α3 ) = (1 − α)1/2 − 1,
−20
n n n
n i=1 lgG(αi )lgTi − i=1 lgTi i=1 lgG(αi )
−25 m+1= n ,
100 200 300 400 500 600 700 800 n i=1 Ti 2 − ni=1 Ti ni=1 Ti
T (◦ C) (10)
n n n n
i=1 Ti G(αi ) i=1 Ti − i=1 G(αi) i=1 Ti
2
Value lgB = n n n ,
i=1 Ti i=1 Ti − n i=1 Ti
2
−8
Acknowledgments
This research was supported by the National Natural Science
−9 Foundation of China (21076117), CAS International part-
nership program “Typical environment processes and their
−10
effects on resources”, Outstanding young scholar fellowship
lnk
Research Article
CI431, an Aqueous Compound from Ciona intestinalis L.,
Induces Apoptosis through a Mitochondria-Mediated Pathway in
Human Hepatocellular Carcinoma Cells
Linyou Cheng,1, 2 Ming Liu,1 Cuicui Wang,1, 2 Haizhou Liu,1, 3 Yuyan Zhang,1, 3
and Xiukun Lin1
1 Instituteof Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
2 Graduate University, Chinese Academy of Sciences, Beijing 100049, China
3 College of Chemical Engineering, Qingdao University of Science and Technology, Qingdao 266042, China
In the present studies, a novel compound with potent anti-tumor activity from Ciona intestinalis L. was purified by acetone
fractionation, ultrafiltration, gel chromatography and High Performance Liquid Chromatography. The molecular weight of the
highly purified compound, designated CI431, was 431Da as determined by HPLC-MS analysis. CI431 exhibited significant
cytotoxicity to several cancer cell types. However, only a slight inhibitory effect was found when treating the benign human
liver cell line BEL-7702 with the compound. To explore its mechanism against hepatocellular carcinoma, BEL-7402 cells were
treated with CI431 in vitro. We found that CI431 induced apoptotic death in BEL-7402 cells in a dose- and time-dependent
manner. Cell cycle analysis demonstrated that CI431 caused cell cycle arrest at the G2/M phase, and a sub-G1 peak appeared after
24 h. The mitochondrial-mediated pathway was implicated in this CI431-induced apoptosis as evidenced by the disruption of
mitochondrial membrane potential. The results suggest that the CI431 induces apoptosis in BEL-7402 human hepatoma cells by
intrinsic mitochondrial pathway.
2 1
1.8 0.9
1.6 0.8
1.4 0.7
1.2 0.6
1 0.5
6
0.8 0.4
45 7 8 9
0.6 4 0.3 3 10
2
0.4 2 0.2 11
3 12 13 js
0.2 1 5 6 0.1
12:31
29:01
07:01
08:11
31:23
04:41
05:51
17:14
33:44
19:35
36:05
14:52
24:18
21:57
00:00
01:10
02:20
03:30
09:22
10:32
11:42
26:40
(a) (b)
800 5 7
700
600
500
(mAU)
400 8
300
200 3
100 1 2 4 6 9 10
0
0 5 10 15 20 25 30 35
Quaternary pump: %B
MWD E: signal = 280, 16, reference = 360, 100
MWD D: signal = 214, 16, reference = 360, 100
MWD B: signal = 230, 16, reference = 360, 100
(c)
Figure 1: Elution patterns on column chromatography. The fraction of acetone precipitation was applied to Sephadex G25 column (a).
The active fraction from Sephadex G25 chromatography was applied to P2 column (b). The active fraction from P2 was further purified by
high-performance liquid chromatography (c). The arrow indicates the active component during the purification.
[13–15]. Its incidence has been increasing over the past 2. Subjects and Methods
few decades in some areas such as Europe, USA, and East
Asia [16, 17]. Despite the high mortality and frequency 2.1. Materials. Ciona intestinalis L. was obtained from the
of this cancer, surgical resection is an available option for Xunshan Fishery Company of Rongcheng, China. The an-
only a small proportion of patients because metastases are imals were identified by professor Fuhua-li at Institute of
often present when the cancer is discovered. In addition, Oceanology, Chinese Academy of Sciences. The human he-
because of the inherent chemotherapy-resistant nature of patocellular cancer BEL-7402, human colorectal cancer
HCC, systemic cytotoxic chemotherapy agents are minimally HCT116, human cervical cancer Hela cells as well as human
effective at improving patient survival [18]. Thus, novel lung adenocarcinoma A549, breast cancer MCF-7, and
strategies and agents, which have greater targeting on HCC human benign liver cell BEL-7702 cells were obtained from
but lower toxicity for normal liver cells, are seen as a direction American Type Culture Collection.
of enormous potential.
Previous studies have shown that several agents derived
from Ascidiae can induce the apoptosis of many cancer cells 2.2. Extraction and Purification of the Compound from Ciona
[5]. However, Ciona intestinalis L., a selected species in the intestinalis L. Briefly, 50 kg fresh C. intestinalis were smashed
present study, has not been studied for its anticancer effects. and incubated at 70◦ C for 30 min and were then centrifuged
Therefore, we attempted to investigate the growth-inhib- at 8,000 rpm for 30 min. Next, the supernatants were added
itory and apoptotic effects of components from Ciona to 3 volumes of acetone at 4◦ C for 12 h and were cen-
intestinalis L. against human liver cancer cells. A bioguid- trifuged at 10,000 rpm for 30 min once more. The acetone
ed isolation was performed to purify the active components supernatants were collected and then were disposed through
from the species. We found that a component, CI431, was a a 5 kDa ultrafiltration membrane (Millipore, USA). The
potent inhibitor against human hepatoma Bel-7402 cells and residue with size <5 kDa was lyophilized and dissolved in
may be developed as a novel class of anticancer agents. a small amount of distilled water. The prepared extraction
Evidence-Based Complementary and Alternative Medicine 3
Figure 3: Morphological analysis of BEL-7402 cells induced by CI431. BEL-7402 cells were grown on poly-L-lysine-coated coverslips for
24 h to allow firm attachment and treated with 50 μg/mL CI431 for certain time intervals. Cells were fixed on coverslips coated with gold and
analyzed by using the KYKY-2800B SEM. The cells were untreated (a) or treated with CI431 for 12 (b), 18 (c), and 24 h (d). The untreated
BEL-7402 cells showed a normal smooth surface. In contrast, the cells treated with CI431 became rounded, and the surface of the cell
membrane was markedly disrupted (Scale bar = 10 μm).
CI431 200 μL, prewarmed incubation buffer containing a pool of antitumor agents as previously described. The frac-
0.2 μL MitoCapture was added to each well and plates were tion obtained after acetone precipitation was concentrated
incubated for 15 min at 37◦ C in a 5% CO2 incubator. Then, through a 5 kDa ultrafiltration membrane. The fraction of
cells were analyzed by a fluorescence spectrophotometer (F- acetone precipitation solution, which contained several ma-
4500, HITACHI). jor compounds below 5 kDa, showed strong inhibitory ac-
tivity against several tumor cell lines.
2.9. Statistical Analysis. All experiments were done three The fraction of acetone precipitation compounds was
times in triplicate (n = 9), and the results were expressed applied to a Sephadex-G25 column and eluted with distilled
as means ± SD (standard deviation). A one-way analysis water (Figure 1(a)). The active fractions were further puri-
of variance (ANOVA) and the Duncan test were used for fied by P2 column (Figure 1(b)). After gel chromatography,
multiple comparisons (SPSS program, ver 10.0). the active components were submitted to reverse-phase chro-
matography using a C18 column, and purified to homo-
3. Results geneity (Figure 1(c)). The purified agent, designated CI431,
was revealed as a single MW by MS.
3.1. Extraction and Purification of the Compound from Ciona
intestinalis L. In order to isolate novel antitumor agents 3.2. Assessment of Cytotoxicity. MTT assays were performed
from Ciona intestinalis L., we developed a purification to investigate the effects of CI431 on the proliferation of
protocol involving heat-inactivation, acetone precipitation, sixcell lines. As shown in Figure 2, CI431 (over 50 μg/mL)
ultrafiltration concentration, gel filtration, and reverse-phase had a significant growth-inhibiting effect on the five cancer
chromatography HPCL. Briefly, acetone precipitation, and cell lines and a slight growth-inhibiting effect on the benign
ultrafiltration concentration were carried out to obtain liver BEL-7702 cell line. Results indicated that CI431 had
Evidence-Based Complementary and Alternative Medicine 5
(a) (b)
(c)
Figure 4: DAPI staining assay. The cells BEL-7402 were grown on poly-L-lysine-coated coverslips in 6-well plates and treated with CI431.
After incubation for 24, the cells were stained with DAPI and then observed under the fluorescence microscopy. BEL-7401 cells in the
control medium were stained homogeneously with DAPI (a), whereas treatment with CI431 led to marked chromatin condensation and
nuclear fragmentation together with the appearance of small structures like apoptotic bodies. These observations indicated that the cells
treated with CI431 entered apoptosis (b, c).
a significant grow-inhibiting effect on the five cell lines in and the surface of the cell membrane was markedly dis-
a time-dependent manner (data not shown) and in a dose- rupted.
dependent manner (Figure 2). Among these cell lines, the
BEL-7402 cells were much more sensitive than the other cell 3.4. DAPI (4 -6-diamidino-2-phenylindole) Staining. We
lines. From this result, BEL-7402 cells were chosen for the characterized the changes in the nuclear morphology by
subsequent experiments. staining with DAPI. BEL-7401 cells in the control medium
were stained homogeneously with DAPI, whereas treatment
3.3. CI431-Induced Morphological Changes of BEL-7402 Cells. with CI431 led to marked chromatin condensation and
The morphologic changes of the cell membrane were nuclear fragmentation together with the appearance of small
clearly visualized by SEM. Remarkable alterations of the structures like apoptotic bodies, a biochemical hallmark of
cell membrane of BEL-7402 cells were observed after CI431 apoptosis. The sizes of CI431-treated BEL-7402 cells in-
treatment. The architecture of untreated BEL-7402 cells creased as compared with those of untreated cells. Double
displayed a typical polygon shape (Figure 3(a)). However, the nucleated cells or giant multinucleated cells can be easily
morphology of the cells started to change after incubation found. These observations indicated that the cells treated
with CI431. The cells detached from the substratum, became with CI431 entered apoptosis (Figure 4).
spindle shape (Figure 3(b)), and separated from each other
after exposure to CI431 for 12 h. Membrane bulge and de- 3.5. CI431 Induces Apoptosis and G2/S Phase Arrest in
tachment from cytoplasmic inclusion were observed in 18 h BEL-7402 Cells. To gain an insight into the antiprolif-
and 24 h after CI431 treatment (Figures 3(c) and 3(d)). The eration mechanism of CI431, the cell cycle distribution
untreated BEL-7402 cells showed a normal smooth surface. of CI431-treated cells was determined by flow cytometry
In contrast, the cells treated with CI431 became rounded, analysis. The results showed that CI431 significantly induced
6 Evidence-Based Complementary and Alternative Medicine
1024 1024
Events
Events
0 0
0 0
Empty Empty
(a) (b)
1024
Events
Events
0 0
0 0
Empty Empty
(c) (d)
Figure 5: Effect of CI431 on cell cycle distribution. BEL-7402 cells were seeded at 3 x 104 /cm2 in 10-cm dishes and treated with CI431 at 20
(b), 40 (c) or 80 μg/mL, respectively or without treatment (a). After incubation for 24 h, cells were collected and the DNAs were stained by PI,
while the RNAs were removed by digestion with RNase A. The DNA contents of the cells were determined with the FACSCalibur cytometer.
The results showed that CI431 significantly induced a G2 /S phase arrest with a decrease in G0 /G1 phase population at 20, 40, and 80 μg/mL,
while a dramatic increase of sub-G1 phase (hypodiploid cells) was observed at doses higher than 80 μg/mL.
a G2 /S phase arrest with a decrease in G0 /G1 phase popu- ratio is 0.61 ± 0.07 (blank), 1.92 ± 0.19 (20 μg/mL), 5.08 ±
lation at 20, 40, and 80 μg/mL, while a dramatic increase 0.45 (40 μg/mL), and 8.28 ± 0.61 (80 μg/mL), respectively,
of sub-G1 phase (hypodiploid cells) was observed at doses indicating disruption of mitochondrial function.
higher than 80 μg/mL (Figure 5).
4. Discussion
3.6. Mitochondrial-Membrane Potential (Δψm). To investi-
gate the involvement of the mitochondrial pathway, depolar- Over 17,000 biologically active compounds have been iden-
ization of the mitochondrion was analyzed by loading with tified from marine sources, mainly isolated from sessile an-
JC-1. BEL-7402 were exposed to CI431 at doses of 20, 40, imals, such as sponges, tunicates, corals, mollusks, and bry-
and 80 μg/mL for 24 h, and the ratio of green fluorescence ozoans [3, 4]. Many of these substances are potent cytotoxins
intensity to red fluorescence intensity was used for quantita- that are of great interest for anticancer drug development.
tive analysis of the disruption of Δψm. As shown in Figure 6, The discovery of new marine drug candidates is a highly
after treatment with CI431, Δψm began to decrease, and the efficient process due to the availability of sophisticated
Evidence-Based Complementary and Alternative Medicine 7
120 (EM)
1600 98 (EM)
1500 6000
1400
1300 5000
1200
1100
1000 4000
900
800
3000
700
600
500 2000
400
300
1000
200
100
0 0
500 550 600 550 600
(a) (b)
120 (EM)
6000 120 (EM)
4000
5000
3000
4000
3000 2000
2000
1000
1000
0 0
500 550 600 500 550 600
(c) (d)
Figure 6: Cytofluorometric analysis of Δψm BEL-7402 cells were seeded in 12-well plates at a density of 3 × 105 cells/mL and treated
with CI431 at doses of 20, 40, and 80 μg/mL for 24 h. After treatment with CI431 200 μL pre-warmed incubation buffer containing 0.2 μL
MitoCapture was added to each well and plates were incubated for 15 min at 37◦ C in a 5% CO2 incubator. Then, cells were analyzed by a
Fluorescence Spectrophotometer (F-4500, HITACHI, Japan). After treatment with CI431, Δψm began to decrease, and the ratio of green
fluorescence intensity to red fluorescence intensity was 0.61 ± 0.07 (blank, a), 1.92 ± 0.19 (20 μg/mL, b), 5.08 ± 0.45 (40 μLgmL, c) and
8.28 ± 0.61 (80 μg/mL, d), respectively, indicating disruption of mitochondrial function.
screening, dereplication, and characterization techniques. In We used the MTT assay to test the cytotoxic effects of
this study, we describe a novel protocol which allows ef- CI431 and found that CI431 exhibited potent cytotoxicity
ficient and rapid purification of low-molecular weight against various types of cancer cell lines in a dose- and
marine drug candidates with antitumor activity from Ciona time-dependent manner but inhibited the viability of Bel-
intestinalis L. We have utilized for their isolation a combina- 7702, human benign liver cells, very slightly. That CI431 has
tion ofvspace.5pt extraction/purification procedures, includ- opposite effects on tumor cells and normal cells is intriguing.
ing heating, acetone fractionation, gel chromatography and This shows that CI431 may have little toxicity for normal liver
high performance liquid chromatography. The proposed cells. When the cells were stained with different concentra-
protocol resulted in obtaining homogeneous preparations tions of CI431 for 48 h, marked morphological changes were
of one compound from Ciona intestinalis L. with MW of clearly observed, including chromatin condensation, nuclear
431 Da, which exhibited strong antitumor activity. The MW and cytoplasmic fragmentation, and apoptotic body appear-
identity of the purified compound was determined by mass ance. Further studies using PI staining and flow cytometry
spectrometry. analysis showed that CI431 significantly induced a G2/S
8 Evidence-Based Complementary and Alternative Medicine
phase arrest with a decrease in G0/G1 phase population, and [4] M. D. Lebar, J. L. Heimbegner, and B. J. Baker, “Cold-water
17.3% hypodiploid cells were observed when the dose up to marine natural products,” Natural Product Reports, vol. 24, no.
60 μg/mL. Considering figures of apoptosis bodies obtained 4, pp. 774–797, 2007.
from staining with DAPI and 17.3% hypodiploid BEL- [5] K. L. Rinehart, “Antitumor compounds from tunicates,”
7402 cells reserved from flow cytometry, we concluded that Medicinal Research Reviews, vol. 20, no. 1, pp. 1–27, 2000.
[6] D. J. Newman and G. M. Cragg, “Advanced preclinical and
CI431 could induce the apoptosis of BEL-7402 cell lines. In
clinical trials of natural products and related compounds from
addition, marked mitochondrial-membrane-potential chan-
marine sources,” Current Medicinal Chemistry, vol. 11, no. 13,
ges were clearly observed especially after treatment with pp. 1693–1713, 2004.
0.1 mg/mL of CI431 for 24 h. Loss of mitochondrial-mem- [7] K. L. Rinehart, J. B. Gloer, J. C. Carter, S. A. Mizsak, and T. A.
brane potential (ΔΨm) is an early event in apoptosis. It Scahill, “Structures of the didemnins, antiviral and cytotoxic
indicated that maybe CI431 induced BEL-7402 cell apoptosis depsipeptides from a Caribbean tunicate,” Journal of the
through a mitochondria-mediated apoptosis pathway. American Chemical Society, vol. 103, no. 7, pp. 1857–1859,
1981.
[8] J. L. Urdiales, P. Morata, I. N. de Castro, and F. Sánchez-
5. Conclusion Jiménez, “Antiproliferative effect of dehydrodidemnin B
(DDB), a depsipeptide isolated from Mediterranean tuni-
This study describes for the first time an efficient method cates,” Cancer Letters, vol. 102, no. 1-2, pp. 31–37, 1996.
for the purification of a kind of antitumor compound from [9] M. C. Edler, A. M. Fernandez, P. Lassota, C. M. Ireland,
Ciona intestinalis L. It could effectively induce apoptosis in and L. R. Barrows, “Inhibition of tubulin polymerization by
HCC cell lines, mediated through a disruption of mitochon- vitilevuamide, a bicyclic marine peptide, at a site distinct from
drial membrane potential. Our results suggest that CI431 colchicine, the vinca alkaloids, and dolastatin 10,” Biochemical
is a promising drug candidate for the treatment of HCC. Pharmacology, vol. 63, no. 4, pp. 707–715, 2002.
However, the specific mechanism of the apoptosis-inducing [10] N. Lindquist, W. Fenical, G. D. Van Duyne, and J. Clardy,
effect of CI431 has not yet been elucidated. The effective and “Isolation and structure determination of diazonamides A and
powerful components in this extracted compound need to be B, unusual cytotoxic metabolites from the marine ascidian
further characterized. Because some secondary metabolites Diazona chinensis,” Journal of the American Chemical Society,
are generated in organisms just in a very short period of their vol. 113, no. 6, pp. 2303–2304, 1991.
[11] K. Rinehart, T. G. Holt, N. L. Fregeau et al., “Ecyeinascidin
life cycles, and some target chemicals are in low concntration,
729, 743, 759A, and 770: potent antutumor agents from
how to obtain enough chemicals for structure analyzing and the Caribbean tunicate Ecteinascidia turbinata,” Journal of
preclinical testing has become a crucial problem in marine Organic Chemistry, vol. 55, no. 15, pp. 4512–4515, 1990.
medicine research. In this study, the yield rate of CI431 from [12] M. Zhang, H. Zhang, C. Sun et al., “Targeted constitutive
Ciona intestinalis L. was extremely low. In order to elucidate activation of signal transducer and activator of transcription
its structural formula, more samples should be collected, 3 in human hepatocellular carcinoma cells by cucurbitacin B,”
isolated, and purified. Cancer Chemotherapy and Pharmacology, vol. 63, no. 4, pp.
635–642, 2009.
[13] M. A. Avila, C. Berasain, B. Sangro, and J. Prieto, “New ther-
Acknowledgments apies for hepatocellular carcinoma,” Oncogene, vol. 25, no. 27,
pp. 3866–3884, 2006.
This study was supported by 863 High Technology Project [14] J. Martin and J. F. Dufour, “Tumor suppressor and hepato-
(no. 2007AA091403 and 2007AA09Z408) from the Chinese cellular carcinoma,” World Journal of Gastroenterology, vol. 14,
Ministry of Science and Innovative Drug Development no. 11, pp. 1720–1733, 2008.
Projects of China (2009ZX09103-661 and 2009ZX09102). [15] N. J. Gusani, Y. Jiang, E. T. Kimchi, K. F. Staveley-O’Carroll, H.
The authors are grateful to Dr. Chunguang Wang at the Cheng, and J. A. Ajani, “New pharmacological developments
College of Life Science and Technology, Tongji University for in the treatment of hepatocellular cancer,” Drugs, vol. 69, no.
her careful review of the study, and also to all members of the 18, pp. 2533–2540, 2009.
laboratory for their continuous technical advice and helpful [16] A. I. Gomaa, S. A. Khan, M. B. Toledano, I. Waked, and S. D.
discussion. They would also like to thank Dr. Fred Bogott at Taylor-Robinson, “Hepatocellular carcinoma: epidemiology,
risk factors and pathogenesis,” World Journal of Gastroenterol-
the Austin Medical Center, Austin of Minnesota, USA, for his
ogy, vol. 14, no. 27, pp. 4300–4308, 2008.
excellent English editing of the manuscript. [17] T. Wang, W. Huang, and T. Chen, “Baclofen, a GABAB
receptor agonist, inhibits human hepatocellular carcinoma cell
References growth in vitro and in vivo,” Life Sciences, vol. 82, no. 9-10, pp.
536–541, 2008.
[1] J. W. Blunt, B. R. Copp, W. P. Hu, M. H. G. Munro, P. T. [18] M. Thomas, “Molecular targeted therapy for hepatocellular
Northcote, and M. R. Prinsep, “Marine natural products,” carcinoma,” Journal of Gastroenterology, vol. 44, no. 19, pp.
Natural Product Reports, vol. 26, no. 2, pp. 170–244, 2009. 136–141, 2009.
[2] J. W. Blunt, B. R. Copp, W. Hu, M. H. G. Munro, P. T. [19] Q. J. He, B. Yang, Y. J. Lou, and R. Y. Fang, “Contrages-
Northcote, and M. R. Prinsep, “Marine natural products,” tazol (DL111-IT) inhibits proliferation of human androgen-
Natural Product Reports, vol. 25, no. 1, pp. 35–94, 2008. independent prostate cancer cell line PC3 in vitro and in vivo,”
[3] D. J. Newman and G. M. Cragg, “Marine natural products and Asian Journal of Andrology, vol. 7, no. 4, pp. 389–393, 2005.
related compounds in clinical and advanced preclinical trials,” [20] H. L. Xu, Y. Inagaki, F. S. Wang, N. Kokudo, M. Nakata,
Journal of Natural Products, vol. 67, no. 8, pp. 1216–1238, 2004. and W. Tang, “Effect of benzyl-N-acetyl-α-galactosaminide
Evidence-Based Complementary and Alternative Medicine 9
Research Article
Isolation and Characterization of
Adhesive Secretion from Cuvierian Tubules of Sea Cucumber
Holothuria forskali (Echinodermata: Holothuroidea)
The sea cucumber Holothuria forskåli possesses a specialized system called Cuvierian tubules. During mechanical stimulation white
filaments (tubules) are expelled and become sticky upon contact with any object. We isolated a protein with adhesive properties
from protein extracts of Cuvierian tubules from H. forskåli. This protein was identified by antibodies against recombinant
precollagen D which is located in the byssal threads of the mussel Mytilus galloprovincialis. To find out the optimal procedure
for extraction and purification, the identified protein was isolated by several methods, including electroelution, binding to glass
beads, immunoprecipitation, and gel filtration. Antibodies raised against the isolated protein were used for localization of the
adhesive protein in Cuvierian tubules. Immunostaining and immunogold electron microscopical studies revealed the strongest
immunoreactivity in the mesothelium; this tissue layer is involved in adhesion. Adhesion of Cuvierian tubule extracts was measured
on the surface of various materials. The extracted protein showed the strongest adhesion to Teflon surface. Increased adhesion was
observed in the presence of potassium and EDTA, while cadmium caused a decrease in adhesion. Addition of antibodies and
trypsin abolished the adhesive properties of the extract.
Antibodies raised against the material that remained on (rabbit) that had been raised against precollagen D from
the substratum after detachment of the tubule have been mussel M. galloprovincialis (PoAb-pCD). The dilution of
used to detect and localize tubule protein(s) [5]. the antiserum was 1 : 1000. The membrane was washed
Also the adhesion of mussels has been thoroughly inves- three times in TBS-T and then incubated for 1 h with anti-
tigated. After isolation of the first adhesive protein, Mepf- rabbit IgG (whole molecule) alkaline phosphatase (Sigma-
1, which contains DOPA (3,4-dihydroxy-l-phenylalanine), Aldrich, Taufkirchen, Germany). After washing, proteins
ten further proteins have been isolated [7]. One of them were visualized using 5-bromo-4-chloro-3-indolyl phos-
is precollagen D which possesses a central collagen domain phate-p-toluidine salt (BCIP) and p-nitrotetrazolium blue
flanked by two fibroin-like domains with sequences similar chloride (NBT) (Roth, Karlsruhe, Germany).
to spider silk fibroin. This protein is found in spiders’ drag
line [15] and also in the silkworm Bomyx mori [16]. A
2.4. Isolation of Adhesive Protein by Electroelution. The pro-
similar protein has been found in sea urchin [17]. Using
tein band from the electrophoresis gel which reacted with
antibodies raised against recombinant precollagen D from
antibodies against precollagen D was cut from the gel and
the mussel Mytilus galloprovincialis, we could identify a
electroeluted using a Model 422 Electro-Eluter (Bio-Rad,
protein with adhesive properties in sea cucumber Cuvierian
Munich, Germany). The purity of the obtained protein
tubule extracts.
was checked by SDS-PAGE and Western blot analysis and
concentration was estimated by 2-D Quant kit (Amersham
2. Materials and Methods Biosciences, Freiburg, Germany).
2.2. Extraction of Cuvierian Tubules. Cuvierian tubules were 2.6. Collection of Adhesive Proteins. Glass beads (1 g) with
dried by lyophilization and ground in a mortar containing a size of 2 mm (Elring-Klinger Kunststofftechnik GmbH
liquid nitrogen. Dried material (2 g) was stirred with 50 mL Grossostheim-Ringheim, Germany) were washed with 4 M
of buffer (4 M urea, 0.5 M Tris-HCl, pH 7.5) overnight at urea buffer (containing 0.5 M Tris-HCl, pH 7.5) and added
4◦ C. The homogenate was then centrifuged at 14,000 ×g for to each of four tubes containing the same amount of protein
15 min. The supernatant was collected, filtered through 2- (500 μg) but various concentrations of urea (1 M, 2 M, and
μm filter (Centrifugal Filter Devices Microcon, Millipore, 3 M). The tubes with the glass beads were incubated under
Schwalbach, Germany) and dialyzed overnight against 5 l of shaking for 2 h and vortexed every 10 min. The supernatants
distilled water which was changed every 3 h. To concentrate were then discarded and the beads were washed with 0.05 M
the sample, the dialysate was centrifuged (4.000 ×g) in a Tris-HCl pH 7.5 (1 mL) by shaking and vortexing. The
concentration tube (50 mL) using a centrifugal concentrator washing step was repeated three times. The buffer was then
(Amicon, Millipore, Schwalbach, Germany) until 1 mL of removed and 50 μL of sample buffer (4-times concentrated;
extract was obtained. 100 mM Tris-HCl, pH 6.8, 2% SDS, 5% ß-mercaptoethanol,
15% glycerol, 0.006% bromophenol blue) was added to each
tube. The glass beads were then boiled and shaken for 15 min
2.3. SDS-PAGE and Western Blot Analysis. Extract from Cu-
at 95◦ C in a thermomixer. Thereafter the supernatants were
verian tubules was concentrated with Ready Prep 2-D Clean-
collected and 40 μL each were taken for loading onto two
up Kit (Bio-Rad, Munich, Germany). The concentrated
12% SDS PAGE gels. One gel was stained with Gel Code
protein was dissolved in loading buffer (Roti-Load, Roth,
Blue Reagent and destained with water, then scanned with
Karlsruhe, Germany), boiled for 5 min and subjected to
an Odyssey Scanner using the Odyssey v.1.2 software to
electrophoresis in a 12% polyacrylamide gel containing
quantify the protein bands. The proteins of the second
0.1% sodium dodecyl sulfate (SDS-PAGE). After protein
gel were transferred to PVDF membrane and incubated
separation the gel was washed with distilled water for 15 min
with antibody against adhesive protein and developed using
and then stained with Gel Code Blue Reagent (Pierce, Bonn,
anti-rabbit IgG (whole molecule) alkaline phosphatase and
Germany).
visualized with NBT and BCIP.
For Western blot analysis, proteins were transferred
from the gels to PVDF membranes (Millipore, Schwal-
bach, Germany) using a Trans-Blot SD system (Bio-Rad, 2.7. Immunoprecipitation. For immunoprecipitation of the
Munich, Germany). The membranes were blocked with adhesive protein, the Seize × Immunoprecipitation Kit
Blocking reagent (Roche, Mannheim, Germany), then rinsed (Pierce, Bonn, Germany) was used; 50 μL of polyclonal
in TBS-T (20 mM Tris-HCl pH 7.6, 137 mM NaCl, 0.1% antibody against adhesive protein from Cuvierian tubules
Tween-20) and incubated for 1 h with polyclonal antibodies (PoAb-Ctub) and 250 μL of Cuvierian tubule extract were
Evidence-Based Complementary and Alternative Medicine 3
applied. Results were checked by SDS PAGE and Western 2.9.4. Methylene Blue and Azure B. A mixture of 1% azure
blotting. and 1% methylene blue was used. Before staining sections
were warmed up to 70◦ C. A drop of the stain was put on the
2.8. Gel Filtration. Sephadex G50 (Pharmacia Fine Chem- sections. After drying (60◦ C), unbound stain was washed out
icals, Uppsala, Sweden) was used for preparation of a gel with distilled water. Slides were then dried, mounted with
filtration column (1 cm × 15 cm). Calibration of the column DPX, and sealed with nail polish.
was performed using a mixture of bovine serum albumin
(BSA), silk fibroin, and carbonic anhydrase. The retention 2.10. Immunohistochemistry. Sections were kept overnight
time of each sample was recorded. The presence of the in 4% BSA in PBS. After washing with PBS, samples were
protein in each fraction was checked by the Bradford assay incubated with polyclonal antibody against adhesive pro-
[19]. tein from Cuvierian tubules (PoAb-Ctub; dilution 1 : 100).
Before loading the extract, the column was washed with Sections with antibody were kept in a humid chamber
4 M urea buffer. One milliliter of the 4 M urea extract of the at room temperature for 2 h. After washing in PBS (2 ×
Cuvierian tubules was loaded onto the column. Protein was 10 min), sections were incubated with Cy3-conjugated goat
eluted using 4 M urea. Forty 500-μL fractions were collected. anti-rabbit IgG (Dianova, Hamburg, Germany) (diluted
The protein concentration in each fraction was assayed using 1 : 100) in the dark at 37◦ C for 120 min. After additional
the Bradford assay. Protein-containing fractions were loaded washing (2 × 10 min) in PBS, staining with DAPI (4 -
onto a 12% SDS PAGE gel. The gel was stained with Gel 6-diamidino-2-phenylindole; Sigma-Aldrich, Taufkirchen,
Code Blue Reagent, destained with water, and scanned with Germany) for 30 min was performed to highlight the nuclei.
an Odyssey scanner. After washing and mounting with the Gel/Mount (Flu-
orescent mounting medium, Dako, Hamburg, Germany),
sections were inspected for immunofluorescence using an
2.9. Histology Olympus AHBT3 light microscope. Preimmune serum was
used as a negative control.
2.9.1. Preparation of Tissue Sections. Cuvierian tubule tis-
sue was fixed in 2% paraformaldehyde in PBS pH 7.4
overnight. After washing in PBS buffer (pH 7.4) containing 2.11. Transmission Electron Microscopy. Electron immuno-
6.8% sucrose at 4◦ C overnight, dehydration was performed gold labeling was performed with Cuvierian tubule samples
in 100% acetone. During the first 5 minutes acetone treated with 0.1% glutaraldehyde/3% paraformaldehyde in
was renewed several times. The last portion of acetone phosphate buffer, pH 7.4 for 3 h at room temperature. The
was left overnight. Infiltration of the samples was done material was dehydrated in ethanol and embedded in LR-
using Technovit 8100 (Heraeus Kulzer, Hanau, Germany) White resin. Sections (60-nm thick) were cut and blocked
according to the instructions of the manufacturer. After with bovine serum albumin in PBS and then incubated
hardening, 3–10 μm thick sections were prepared using a with the primary antibody against adhesive protein from
rotary microtome. Slices were mounted on silane-coated Cuvierian tubules (PoAb-Ctub; 1 : 1,000 for 12 h at 4◦ C). In
slides (Sigma, Taufkirchen, Germany) for histology and im- controls, preimmune serum was used. After three washes
munohistochemistry. with PBS, 1% BSA, sections were incubated with a 1 : 100
dilution of the secondary antibody (1.4-nm nanogold anti-
rabbit IgG; diluted 1 : 200) for 2 h. Sections were rinsed in
2.9.2. Hematoxylin and Eosin Staining. After washing in PBS PBS, treated with glutaraldehyde in PBS, washed, and dried.
and in distilled water, tissue sections on slides were stained Subsequently, enhancement of immunocomplex detection
in hematoxylin solution for 5 min. After staining slides were was performed with silver as described by Danscher [20].
washed in tap water for 25 min and in distilled water for The samples were transferred onto coated copper grids and
5 min. Sections were stained in eosin for 1 min. After washing analyzed using a Tecnai 12 microscope (FEI Electron Optics,
in distilled water, sections were dehydrated with increasing Eindhoven, Netherlands).
concentrations of isopropanol (75–100%) for 1 min each.
Before mounting, slides were washed in detergent Roti Clear
2.12. Measurement of Adhesion. To measure adhesion, the
(Roth, Karlsruhe, Germany). Slides were mounted in DPX
instrument shown in Figure 1 was used. This instrument
(Sigma, Taufkirchen, Germany), covered with cover slips,
was based on a laboratory balance, modified by adding two
and sealed with nail polish. blocks to it (made from either Teflon, iron, gelatine, glass,
or silicone). The upper block was attached to one beam
2.9.3. Cason’s Trichrome. Sections on slides were washed of the balance, while the lower block was attached to a
in PBS for 5 min, then placed in staining solution (1% movable platform. Adhesion was measured as follows: a drop
orange G, 1.5% acid fuchsine, 0.5% aniline blue, and 1% of measuring liquid (10 μL) was put on the block and stuck
phosphotungstic acid) for 5 min. After staining sections to the second block hanging from the beam. In this position,
were washed in water for 5 min, dehydrated in solutions the drop of measuring liquid was incubated for 15 min at
containing increasing concentration of ethanol, cleared in room temperature. To determine the adhesion of the liquid,
detergent (Roti Clear), mounted with DPX, and sealed with standard masses were added until the two blocks separated
nail polish. when the adhesion of the liquid failed. The amount of
4 Evidence-Based Complementary and Alternative Medicine
Figure 1: Scheme of equipment used for measurement of adhesion. (a) Application of the sample between two blocks; the upper block is
attached to one of the beams of a laboratory balance, while the lower block is fixed. (b) Attachment of both blocks via the adhesive protein
containing sample. (c) Addition of standard weights until both blocks become separated to determine the adhesive forces of the sample.
weights put on, to release the block and liquid was equivalent a special collagen, found in the byssal thread, which is
to the adhesion forces between them. involved in tension-bearing. After reaction with the antibody
the membrane showed a strong band (Figure 2, lane B)
2.13. Statistics. Statistical evaluation of the data was per- with one of the Cuvierian tubule proteins of a size 18 kDa.
formed as described [21]. In further experiments this protein was recognized as the
protein involved in adhesion.
3. Results
3.3. Isolation of Identified Protein
3.1. Extraction of Cuvierian Tubules. Several buffers were
used for the extraction of protein from Cuvierian tubules. 3.3.1. Electroelution. The next step after the identification
Protein solubilization was improved in basic rather than of the adhesive protein was its isolation. The band with a
acidic buffers. Urea, SDS, and reducing buffers increased molecular mass of 18 kDa was cut out from the gel and elec-
the extraction of tubule adhesive proteins. The amounts of troeluted. The purity of the eluted protein was determined by
protein extracted using various buffers were compared by SDS PAGE and Western blot analysis (Figure 2, lane C). The
SDS PAGE analysis. The best results were obtained using 4 M isolated protein was injected into a rabbit and after 4 weeks,
urea, 0.5 M Tris-HCl pH 7.5 (Figure 2, lane A), and sample the specific antibody designated PoAb-Ctub was obtained.
loading buffer (100 mM Tris-HCl, pH 6.8, 2% SDS, 5% ß-
mercaptoethanol, 15% glycerol, 0.006% bromophenol blue; 3.3.2. Neutralization of Antibody. Western blot analysis of
results not shown). To improve visualization of the protein the crude extract of Cuvierian tubules using the PoAb-Ctub
the extract shown in lane A was purified by the Ready Prep antibody revealed a strong reaction with several proteins of
2-D Clean-up kit. Other buffers like 150 mM NaCl, 1.5% the extract even in the presence of optimized concentrations
NP40 , 0.1% SDS, 0.1% DOC, 50 mM Tris-HCl pH 8 buffer or of antibody and extract (not shown).
0.5 M NaCl, 5 mM Tris-HCl pH 7.5, 7 mM Na2 SO4, 0.4 mM The antibody was neutralized by incubation with
NaHCO3, 20 mM EDTA buffer solubilized less protein (not Cuvierian tubule extract for 1-2 hours. After binding, the
shown). The 4 M urea buffer was used for further analysis resulting mixture was applied onto the membrane of the
because the composition of the sample loading buffer (see Western blot. If the mixture contained an excess of specific
above) might interfere with further tests. antibodies, they would bind to the antigen on the membrane.
SDS PAGE analysis of the purified Cuvierian tubule The maximum increase in specificity of the antibody was
extract showed the presence of a wide size range of proteins observed after dilution to 1 : 1000 and addition of extract
(Figure 2, lane A). At this stage it was not possible to at a ratio of 1 : 5 (Figure 2, lane E). The Western blot
recognise which protein could be involved in adhesion. To showed two proteins which reacted with the antibody, one
get information about the conformation and possible dim- with a molecular mass of 18 kDa and the other of 36 kDa.
erization/oligomerization of the proteins, the extract was Cuvierian tubule extract incubated with preimmune serum
run on a seminative gel (Figure 2, lane F). This method against the adhesive protein gave no reaction (Figure 2, lane
yielded a lower number of protein bands, indicating that D). We hypothesized that the upper protein band in lane
some proteins might have been present as dimers/oligomers. E may represent a dimer of the lower protein band. In
order to verify this, a native gel was run (Figure 2, lane F).
3.2. Identification of Adhesive Protein in Cuvierian Tubules. After transfer of the protein, the membrane was incubated
An antibody (PoAb-pCD; polyclonal antibody number with the antibody against the adhesive protein. The results
N374) against a mussel byssus protein (recombinant pre- revealed the presence of only one band most likely caused
collagen D from M. galloprovincialis) was used to identify by dimer formation of the adhesive protein (Figure 2, lane
adhesive protein(s) of Cuvierian tubules. Precollagen D is G).
Evidence-Based Complementary and Alternative Medicine 5
M A B C D E F G
75 75
50 50
37 36 37
25
25
20
18 20 20 kDa
18 kDa
15
15
10
10
Figure 2: Analysis and identification of adhesive protein in
Cuvierian tubule extract from sea cucumber H. forskåli. Proteins
(a) (b)
were analyzed by 12% SDS PAGE and Western blotting. Gels
were stained with Gel Code Blue Reagent. (A) Cuvierian tubule Figure 3: Western blot analysis of adhesive protein from Cuvierian
extract (4 M urea, 0.5 M Tris-HCl pH 7.5) purified with Ready tubule extract, purified by immunoprecipitation. The blot was
Prep 2-D Clean up kit. (B) Western blot of Cuvierian tubule developed using antibodies against adhesive protein from H.
extract, incubated with antibody against precollagen D (1 : 1000 forskåli (PoAb-Ctub) and anti-rabbit IgG alkaline phosphatase
dilution) and developed with anti-rabbit IgG alkaline phosphatase. secondary antibody. (a) Adhesive protein incubated with antibody
(C) Western blot detection of adhesive protein from H. forskåli, against adhesive protein from H. forskåli. (b) Protein from mussels
isolated by electroelution, using antibody against precollagen D (precollagen D), incubated with antibody against adhesive protein
of mussel M. galloprovincialis (1 : 1000 dilution) (positive control). from Cuvierian tubules. Numbers to the left indicate molecular
(D) Western blot of Cuvierian tubule extract incubated with masses of marker proteins in kDa.
preimmune serum. (E) Western blot of Cuvierian tubule extract
incubated with antibodies against isolated (electroeluted) adhesive
protein from H. forskåli (dilution 1 : 1000); the serum was purified
by treatment with Cuvierian tubule extract (dilution 1 : 10) at a The presence of adhesive protein was observed in
ratio of 1 : 5. (F) Cuvierian tubule extract, separated on seminative fractions 6 to 8 (Figure 4). The strongest adhesion was
gel. (G) Western blot of Cuvierian tubule extract, separated on found in fraction 7 (Figure 4(b)) where the concentration of
seminative gel (dilution of antibody, 1 : 1000); the serum was adhesive protein was the highest (Figure 4(a)). Fractions 7
purified by treatment with Cuvierian tubule extract (dilution 1 : 10) and 8 contained a higher degree of contamination by high-
at a ratio of 1 : 10. M: Molecular mass markers. Arrowheads: molecular-mass proteins. Relative molecular masses were
adhesive protein (18 kDa) and dimer (36 kDa). determined using the equation: log M = M0 − (6.062 − 5.00 ·
d) (Ve /V0 ) (M, molecular mass; d, density of the swollen gel;
Ve , elution volume; V0 , void volume) [22]. For the column
3.3.3. Immunoprecipitation. Because the amount of adhesive used in the experiment shown in Figure 4, the equation is as
protein obtained by electroelution was low and the buffer follows: log M = 5.189 − 0.712 (Ve /V0 ) (see also [23]).
used for elution of the protein could complicate further
analysis, other methods for isolation of the protein were 3.3.5. Collection of Adhesive Proteins. Adhesive proteins may
employed. Immunoprecipitation is based on the interaction adhere to various surfaces. In this experiment adhesion to
between a protein and its specific antibody, separation of the glass surface was used to isolate the H. forskåli protein
formed immune complex with Protein A, and subsequent from crude extract. Glass beads were incubated with protein
Western blot analysis (Figure 3, lane (a)). extract containing the adhesive protein. After removing the
In a parallel experiment, extract from mussels M. gallo- extract and incubation of the glass beads with nondenaturing
provincialis was applied on the immunocolumn with anti- buffer, adhesive protein remained bound on the beads. To
body against the adhesive protein from Cuvierian tubules. remove the protein from the glass surface, the beads were
The result revealed a weak band at 20 kDa (Figure 3, lane boiled with electrophoresis sample buffer and loaded onto
(b)). 12% SDS PAGE. Relative band intensities corresponding
to the adhesive protein were estimated using the Odyssey
3.3.4. Gel Filtration. Gel filtration chromatography (Sephad- software. Proteins were transferred to PVDV membrane
ex G-50) was used for separation of the proteins based on and analyzed by Western blot using the antibody against
their size. The fractions collected were assayed using the adhesive protein from Cuvierian tubules. The Western blots
Bradford assay to detect the presence of protein. Protein- confirmed that the 18-kDa protein was the dominant
containing fractions were analyzed by SDS PAGE and protein harvested by using the glass beads procedure (not
measured for adhesion. shown). Results after testing adhesion in the presence of
6 Evidence-Based Complementary and Alternative Medicine
M CT AP 6 7 8 9 10 11 600
75
15 300
200
10
100
(a)
9 0
1 2 3
8 ∗∗∗
Concentration of urea (M)
7 ∗∗
Figure 5: Binding of adhesive protein from Cuvierian tubule extract
6 to glass beads in the presence of various concentrations of urea.
Adhesion (a.u.)
∗
Glass beads (size, 2 mm) were incubated with adhesive protein
5 extract in the presence of various concentrations of urea (1 M,
∗
4 2 M, and 3 M; containing 0.5 M Tris-HCl, pH 7.5), as described in
Materials and Methods. After washing, the glass beads were boiled
3 in SDS sample buffer and the released protein was analyzed by
2
12% SDS PAGE. The gel was stained with Gel Code Blue Reagent.
Relative band intensities corresponding to the adhesive protein were
1 determined by scanning of the gel using an Odyssey Scanner and
applying the Odyssey v.1.2 software to quantify the protein bands.
0
Buffer 6 7 8 9 10 11
Fraction
(b)
of Cuvierian tubules, mesothelium was stained red, and the
Figure 4: Analysis of fractions of gel filtration chromatography inner connective tissue was stained blue (Figures 6(a) and
of Cuvierian tubule extract. (a) 15% SDS PAGE. CT: extract of 6(b)).
Cuvierian tubules in 4 M urea, 0.5 M Tris-HCl buffer pH 7.5.
AP: adhesive protein obtained by electroelution from Cuvierian 3.4.2. Hematoxylin and Eosin. Hematoxylin stains nuclei
tubule extract (positive control). 6–11: fractions with highest blue-purple. Eosin can be used to stain cytoplasm, collagen,
concentration of protein according to Bradford assay. M, Molecular and muscle fibers. In sections stained with hematoxylin
mass markers. Arrowhead: adhesive protein (18 kDa). (b) Adhesive
and eosin, it was possible to observe the inner connective
activity, given in arbitrary units ± SD (n = 3), of fractions 6–
11 compared to control (0.5 M urea buffer). Numbers to the left tissue layer stained red (eosin), while in the mesothelium the
indicate molecular masses of marker proteins in kDa. Level of granular cells were stained purple (Figures 6(c) and 6(d)).
significance: ∗ P < 0.05; ∗∗ P < 0.01; ∗∗∗ P < 0.001.
3.4.3. Methylene Blue and Azure B. Methylene blue is used
to visualize intracellular metachromatic granules. Azure,
a methylated thiazine dye, is a metachromatic basic dye
various concentrations of urea revealed that a decrease in ranging from green (chromosomes) and blue (nuclei and
urea concentration of the extract resulted in an increased cytoplasmic ribosomes) to red colour (deposits containing
adhesion of the protein (Figure 5). mucopolysaccharides).
Sections stained with methylene blue and azure B showed
3.4. Histology. Cuvierian tubules were stained with Cason’s the presence of blue mesothelium and red inner connective
trichrome, hematoxylin, and eosin, and methylene blue and tissue, while granular cells were stained dark (Figures 6(e)
azure to study their structure. Staining with these dyes and 6(f)).
showed that the quiescent tubules of H. forskåli consist of an
outer mesothelium and an inner epithelium encompassing 3.5. Immunostaining. The localization of adhesive protein in
a thick connective tissue layer. The mesothelium is made of Cuvierian tubules of H. forskåli was studied by immunoflu-
two cell layers, an upper layer of adluminal cells and a lower orescence microscopy. The tubule wall is made up of an
layer of granular cells. outer mesothelium and an inner epithelium encompassing
a thick connective tissue sheath [5]. The mesothelium is the
3.4.1. Cason’s Trichrome. This stain visualizes various organ- tissue layer involved in adhesion. Antibodies raised against
elles like nuclei (stained red) and collagen (blue). In sections the adhesive protein were used to localize the protein in the
Evidence-Based Complementary and Alternative Medicine 7
ic
ic
200 μm 50 μm
(a) (b)
gc
50 μm 20 μm
(c) (d)
gc
ic
500 μm 100 μm
m
(e) (f)
Figure 6: Sections of Cuvierian tubules stained with Cason’s trichrome (a, b), hematoxylin and eosin (c, d), and methylene blue and azure
B (e, f). m: mesothelium; ic: inner connective tissue; gc: granular cells.
sections. The strongest immunoreactivity was found in the 3.6. Immunogold Electron Microscopy. Transmission elec-
mesothelium, which was extensively labelled (Figure 7(a)). tron microscopy showed a strong immunoreactivity in
The sections were counterstained with DAPI (Figures 7(b) the mesothelium layer and in vacuole cells (darker areas
and 7(d)) which stains the nuclei. Preimmune serum was indicated by arrows in Figure 8(a)). Preimmune serum did
used as a negative control (Figure 7(c)). not show any immunoreactivity (Figure 8(b)).
8 Evidence-Based Complementary and Alternative Medicine
200 μm
(a) (b)
200 μm
(c) (d)
Figure 7: Immunohistological identification of adhesive protein in sections of Cuvierian tubules. (a, b) Sections of Cuvierian tubules stained
with antibody against adhesive protein (PoAb-Ctub; 1 : 100 dilution (a) and counterstained with DAPI (b)). (c, d) Sections of Cuvierian
tubules stained with preimmune serum (1 : 100; (c)) and counterstained with DAPI (d). Cy3-conjugated goat anti-rabbit IgG was used as
secondary antibody. m: mesothelium.
5 μm 5 μm
(a) (b)
Figure 8: Immunocytochemical localization of adhesive protein in Cuvierian tubules. (a) Sections of Cuvierian tubules incubated with
antibody against adhesive protein from Cuvierian tubules (PoAb-Ctub). (b) Sections of Cuvierian tubules incubated with preimmune serum.
Nanogold-labeled anti-rabbit IgG was used as secondary antibody. Arrows: nanogold particles; m: mesothelium.
Evidence-Based Complementary and Alternative Medicine 9
1200 1000
∗∗∗
900
1000 ∗∗
800 ∗∗
800 ∗∗
Adhesion (a.u.)
700
Adhesion (a.u.)
600
600
500
400
400
200 300
200 ∗
0
4 M urea
4 M extract
2 M urea
2 M extract
1 M urea
1 M extract
0.5 M urea
0.5 M extract
0.2 M urea
0.2 M extract
0.1 M urea
0.1 M extract
0.08 M urea
0.08 M extract
100
0
Extract K100 K50 Ca Zn Cd EDTA
6
1000
5
900 4
Adhesion (a.u.)
Adhesion (a.u.)
3
800
2
700
1
600
0 0.5 1 1.5 2 0
0.5 M urea 0.5 M extract Extract + antibody
log (concentration of protein)
Figure 10: Correlation between various concentrations of protein Figure 12: Neutralization of adhesion of H. forskåli extract by
in logarithmic scale and adhesion (standard curve). The highest antibody (PoAb-Ctub). Results are given in arbitrary units ± SD
concentration measured was 100 μg/mL of protein. Results are given (n = 3).
in arbitrary units ± SD (n = 3).
3.7. Adhesion of Cuvierian Tubule Extract to Various Surfaces at which the highest adhesion was observed). Dilution of
protein caused a decrease in adhesion (Figure 10).
3.7.1. Teflon. Cuvierian tubules were extracted with 4 M
urea, 0.5 M Tris-HCl pH 7.5. Adhesion was measured after
3.7.2. Glass Surface. Cuvierian tubule extract in 4 M urea,
dilution of the extract to various urea concentrations. As a
0.5 M Tris-HCl pH 7.5 buffer was diluted to various con-
reference, buffers with the same concentration of urea were
centrations and adhesion to glass blocks was measured. The
used. The strongest adhesion to Teflon blocks was obtained at
strongest adhesion was observed at 1 M urea concentration
a dilution of extract to 0.5 M urea (767 arbitrary units, after
subtraction of adhesion measured with buffer alone [control of the Cuvierian tubule extract (366 arbitrary units, after
value]; 0.125 mg/mL of protein) (Figure 9). Higher or lower subtraction of control value; 0.25 mg/mL of protein).
concentrations of urea resulted in lower adhesion.
In control experiments, no adhesive properties of BSA 3.7.3. Iron Surface. Extract of Cuvierian tubules was
(1 mg/mL) in various urea solutions were observed. diluted to various concentrations of urea and adhesion
A standard curve was obtained with a logarithmic was measured using two iron blocks. Strong interference
dilution of 0.5 M urea extract (the concentration of urea of the extraction buffer was observed in almost all urea
10 Evidence-Based Complementary and Alternative Medicine
concentrations. The strongest adhesion was observed with H. forskåli. Using antibodies against recombinant precolla-
1 M urea extract (350 arbitrary units, after subtraction of gen D, we could identify a protein involved in adhesion in H.
control value; 0.25 mg/mL of protein). forskåli.
The first task was homogenization of Cuvierian tubules
3.7.4. Silicone Surface. Adhesion of various concentrations which are highly insoluble [5]. In order to solubilize the
of Cuvierian tubule extract was measured using two silicone material several buffers were used. Basic, strong denaturing
blocks. The strongest adhesion was observed at a concentra- buffers like 4 M urea, 0.5 M Tris-HCl pH 7.5 gave best results,
tion of 1 M and 0.5 M urea (316 and 250 arbitrary units, after but some nonsolubilized material still remained. We did not
subtraction of control value; 0.25 mg/mL and 0.125 mg/mL use buffers containing SDS like DeMoor et al. [5] because
of protein). SDS might interfere with further experiments.
After extraction we had to prove the presence of adhesive
3.7.5. Gelatine Surface. Adhesion of various concentrations proteins in the solubilized material. One proof to confirm
of Cuvierian tubules extract was measured using blocks the presence of adhesive proteins was the use of glass beads
covered with gelatine. Measurement was interfered by buffer to isolate adhesive protein. Only proteins with adhesive
which also showed strong adhesion. The highest adhesion properties will remain on the beads after several washing
of the extract was observed with 2 M urea extract (400 cycles. Second, measurement of adhesion of the extract was
arbitrary units, after subtraction of control value; 0.5 mg/mL used as a test for the presence of adhesive protein as well.
of protein). From these experiments we obtained convincing evidence
that the protein which we identified is indeed an adhesive
protein.
3.8. Effect of Metal Ions and EDTA on Adhesion. The adhesive The reason why Cuvierian tubules are so poorly soluble
forces of Cuvierian tubule extract were measured in the was not investigated in this study. Aggregation of proteins
presence of K+ (100 mM and 50 mM), Ca2+ (5 mM), Zn2+ may be due to the formation of cross-links between proteins
(5 mM), Cd2+ (5 mM), and EDTA (10 mM). The results composing the adhesive [5] like di-DOPA in mussels [33, 34]
revealed a positive effect on adhesion by potassium and and disulfide bonds in barnacles [26, 35]. However, by using
EDTA and a negative effect by cadmium (Figure 11). Zinc the buffer advised by Kamino et al. [26] for barnacles,
did not cause a significant change of adhesion. solubilization was not improved, which may suggest that
other cross-links are involved in tubule adhesive aggregation.
3.9. Effect of Antibody. Adhesion could be neutralized by Electrophoretic analysis of tubule print material from
addition of antibody (PoAb-Ctub). Adhesion of neutralized Cuvierian tubules done by DeMoor et al. [5] revealed ten
extract decreased in comparison to the nontreated extract in different proteins in the range from 17–220 kDa. In our
the absence of antibody (Figure 12). The results indicate that experiments, several proteins in the range from 10–220 kDa
the antibody binds to the adhesive protein and inhibits the were detected in Cuvierian tubule extract. In seminative
adhesion. gels, a reduced number of bands was observed, indicating
Adhesion could also be abolished by treatment of the the presence of conformational oligomers of some of the
Cuvierian tubule extract with trypsin solution (not shown). proteins or the presence of dimers.
After identification, isolation of the protein was a chal-
4. Discussion and Conclusions lenging task. Adhesive proteins from Holothuroidea have
not been isolated so far. In this work several methods were
Investigation of marine adhesives is a challenging task tested which had previously been applied for isolation of
because of their very poor solubility in water [5, 24]. Studies nonadhesive protein [23, 36, 37] to get a high quality and
on adhesive proteins from invertebrates hitherto mainly quantity of the adhesive protein. Electroelution was found
concerned the characterization of permanent adhesives from to produce the highest quantity of the protein, which then
organisms like mussels and barnacles (e.g., [25, 26]). Great allowed its use for the production of antibodies.
success has been obtained in mussels, where ten proteins are The antibody obtained was used in a further isolation
currently known to be involved in adhesion and nine have method, immunoprecipitation. From all the methods of
been actually isolated [7, 27]. Approaches to their biotech- isolation, electroelution and gel filtration were found the
nological and biomedical exploitation have been started [28– most useful for other applications.
31]. One of the ten proteins that have been identified to Using various staining methods, the composition of
be involved in mussel adhesion is precollagen D that has Cuvierian tubules was analyzed. From sections stained with
been found in the distal thread of mussels, which is flanked Cason’s trichrome it is possible to conclude that Cuvierian
by a silk-fibroin domain [32]. The adhesives employed by tubules mainly contain collagen. In the mesothelium, cyto-
echinoderms are, in contrast, poorly understood. Studies plasm of adluminal cell was observed. By staining with
on the adhesive secretion from Cuvierian tubules mainly hematoxylin and eosin, it was possible to observe collagen
focused on histological characterization (e.g., [14]); bio- which is stained red (eosin). Immunostaining of the sections
chemical studies have been performed by Flammang et al. [2] of Cuvierian tubules with antibodies against adhesive protein
and DeMoor et al. [5]. from Cuvierian tubules confirmed that the mesothelium
In our approach, we combined the wide knowledge is the tissue layer responsible for adhesion as reported by
on mussel adhesives and the poorly understood model of DeMoor et al. [5].
Evidence-Based Complementary and Alternative Medicine 11
To localize more precisely the adhesive protein in the disulfide bonds, possibly resulting in the protein losing its
Cuvierian tubules, immunogold labelling and transmission structure and adhesive properties [42]. EDTA is a chelating
electron microscopy studies were performed. The antisera agent which is widely used to sequester di- and trivalent
were strongly immunoreactive in the mesothelium and metal ions; it is possible that it chelates some cations which
vacuole, confirming previous studies showing that the are involved in adhesion. Potassium affects the solubility
adhesive is located in this layer. There was no labelling of amino acids in aqueous electrolyte solutions [43] which
with the preimmune sera, confirming that the observed could cause better solubilization of the adhesive protein and
immunoreaction is genuinely between a specific antibody increase its adhesive properties, or make protein refold and
and antigen. groups responsible for adhesion more suitable for adhesion.
Measurement of adhesion of Cuvierian tubules has pre- Ionic strength could be involved in increasing adhesion as
viously been studied under various conditions [8, 9, 38], but well.
measurement of the adhesive strength of Cuvierian tubules The adhesive properties of Cuvierian tubule extract could
extract and isolated protein has not been done. A protein be neutralized by addition of the antibodies against the
which can adhere to different surfaces underwater and at low adhesive protein, most likely because of the binding of the
temperature could have a great potential for application in antibodies to epitopes on the protein molecule that are
technology and in antifouling. Therefore, various tests on involved in adhesion or by sterical interference with the
the adhesion properties of the isolated protein/extract were adhesion between the protein and the surface. Neutralization
performed. of the adhesive protein by trypsin or antibodies could
Dalsin et al. [39] and Lee et al. [40] found that mussels be useful in designing antifouling compounds. Knowledge
can adhere to any organic or inorganic surfaces. In our about blocking adhesion can be helpful to understand
experiments with Cuvierian tubule extracts from H. forskåli adhesive processes and their inhibition if necessary.
not all surfaces were suitable for adhesion. The best results The isolation of the adhesive protein will facilitate the
were obtained with Teflon [poly(tetrafluoroethylene)], a identification of the gene encoding this molecule, which may
hydrophobic polymer. There was a very low adhesion of be used to produce the recombinant protein. This study
the extraction buffer and strong adhesion of the extract. By could help to develop new water-resistant adhesive proteins
measuring adhesion in various dilutions of Cuvierian tubule for (bio)technical and biomedical applications.
extract it was possible to find the urea concentration with
the highest adhesion of the adhesive protein and to develop
a standard curve for the extract. The highest adhesion was Acknowledgments
obtained with 0.5 M urea extract; this result is in line with This work was supported by grants from the European Com-
our previous results [8] showing that urea has an impact on mission (Marie Curie Research Training Network BIOCAPI-
adhesion. TAL and project BIO-LITHO) and the Bundesministerium
The finding that Teflon shows strong adhesion is thought für Bildung und Forschung Germany (Project: Center of
to be caused by the fact that the adhesive protein is quite Excellence BIOTECmarin).
hydrophobic (hence its insolubility) and will tend to displace
water from the Teflon, resulting in a force (from the water
molecules) that will resist water being pulled into the space References
between the two Teflon blocks and hence producing a “bond”
where in consequence water is moving to its lowest possible [1] P. Flammang, “Adhesion in echinoderms,” in Echinoderm
energy state. Studies, M. Jangoux and J. M. Lawrence, Eds., vol. 5, pp. 1–60,
Measurement of adhesion on silicone surface gave similar Balkema, Rotterdam, The Netherlands, 1996.
[2] P. Flammang, J. Ribesse, and M. Jangoux, “Biomechanics of
results to Teflon but adhesion in the presence of buffer
adhesion in sea cucumber Cuvierian tubules (Echinodermata,
alone could be observed. Silicone surface is rougher than Holothuroidea),” Integrative and Comparative Biology, vol. 42,
Teflon surface, perhaps resulting in a higher bonding energy no. 6, pp. 1107–1115, 2002.
between the surfaces compared to that of Teflon for both [3] D. VandenSpiegel, M. Jangoux, and P. Flammang, “Maintain-
extract and buffer only. ing the line of defense: regeneration of Cuvierian tubules in
The other tested surfaces (glass, iron, and gelatine) the sea cucumber Holothuria forskali (Echinodermata, Hol-
showed strong adhesion in the presence of buffer only, othuroidea),” Biological Bulletin, vol. 198, no. 1, pp. 34–49,
which prevented them from being used as suitable surfaces 2000.
for measuring adhesion mediated by the Cuvierian tubule [4] J. F. Hamel and A. Mercier, “Cuvierian tubules in tropical
extract. holothurians: usefulness and efficiency as a defence mecha-
Comparing Teflon and glass it is possible to conclude that nism,” Marine and Freshwater Behaviour and Physiology, vol.
33, no. 2, pp. 115–139, 2000.
adhesion depends on the surface. If the surface is hydropho-
[5] S. DeMoor, J. H. Waite, M. Jangoux, and P. Flammang,
bic (Teflon) adhesion is strong and there is no interference “Characterization of the adhesive from Cuvierian tubules
of buffer; when surface is hydrophilic (glass) [41] interaction of the sea cucumber Holothuria forskali (Echinodermata,
between buffer and surface could be observed. Holothuroidea),” Marine Biotechnology, vol. 5, no. 1, pp. 45–
Studies on the effect of cations and EDTA on adhesion 57, 2003.
revealed that cadmium inhibited adhesion, while EDTA [6] P. Flammang, R. Santos, and D. Haesaerts, “Echinoderm
and potassium increased it. Cadmium inhibits formation of adhesive secretions: from experimental characterization to
12 Evidence-Based Complementary and Alternative Medicine
biotechnological applications,” in Progress in Molecular and [23] W. E. Müller, W. Hanske, A. Maidhof, and R. K. Zahn,
Subcellular Biology, Marine Molecular Biotechnology, Echin- “Influence of apurinic acid on programmed synthesis in
odermata, V. Matranga, Ed., pp. 201–220, Springer, Berlin, different in vitro systems,” Cancer Research, vol. 33, no. 10, pp.
Germany, 2005. 2330–2337, 1973.
[7] H. G. Silverman and F. F. Roberto, “Understanding marine [24] J. H. Waite, “Nature’s underwater adhesive specialist,” Interna-
mussel adhesion,” Marine Biotechnology, vol. 9, no. 6, pp. 661– tional Journal of Adhesion and Adhesives, vol. 7, no. 1, pp. 9–14,
681, 2007. 1987.
[8] W. E. G. Müller, R. K. Zahn, and K. Schmidt, “The adhesive [25] S. W. Taylor and J. H. Waite, “Marine adhesives: from molec-
behaviour in Cuvierian tubules of Holothuria forskåli: bio- ular dissection to application,” in Protein-Based Materials,
chemical and biophysical investigations,” Cytobiologie, vol. 5, K. McGrath and D. Kaplan, Eds., pp. 217–248, Birkhäuser,
pp. 335–351, 1972. Boston, Mass, USA.
[9] R. K. Zahn, W. E. G. Müller, and M. Michaelis, “Sticking [26] K. Kamino, K. Inoue, T. Maruyama, N. Takamatsu, S.
mechanisms in adhesive organs from a Holothuria,” Research Harayama, and Y. Shizuri, “Barnacle cement proteins. Impor-
in Molecular Biology, vol. 2, pp. 47–88, 1973. tance of disulfide bonds in their insolubility,” Journal of
[10] C. Semper, “1. Holothurien,” in Reisen im Archipel der Philip- Biological Chemistry, vol. 275, no. 35, pp. 27360–27365, 2000.
pinen. 2. Wissenschaftliche Resultate, Wilhelm Engelmann, [27] J. H. Waite and X. Qin, “Polyphosphoprotein from the
Leipzig, Germany, 1868. adhesive pads of Mytilus edulis,” Biochemistry, vol. 40, no. 9,
[11] M. Jourdan, “Recherches sur l’histologie des holothuries,” pp. 2887–2893, 2001.
Annales du Musée d’Histoire Naturelle de Marseille, vol. 1, pp. [28] T. J. Deming, “Mussel byssus and biomolecular materials,”
1–64, 1883. Current Opinion in Chemical Biology, vol. 3, no. 1, pp. 100–
[12] E. Hérouard, “Recherches sur les holothuries des côtes de 105, 1999.
France,” Archives de Zoologie Expérimentale et Générale, vol. 7, [29] J. H. Waite, “Reverse engineering of bioadhesion in marine
pp. 535–704, 1889. mussels,” Annals of the New York Academy of Sciences, vol. 875,
[13] W. E. G. Müller, R. K. Zahn, and K. Schmidt, “Morphologie pp. 301–309, 1999.
und Funktion der Cuvier’schen Organe von Holothuria forskåli [30] A. Nishida, K. Ohkawa, I. Ueda, and H. Yamamoto, “Green
delle chiaje (Echinodermata: Holothuriodea: Aspidochirota: mussel Perna viridis L.: attachment behaviour and preparation
Holothuriidae),” Zeitschrift für Wissenschaftliche Zoologie, vol. of antifouling surfaces,” Biomolecular Engineering, vol. 20, no.
181, pp. 219–231, 1970. 4–6, pp. 381–387, 2003.
[14] D. VandenSpiegel and M. Jangoux, “Cuvierian tubules of the
[31] N. Holten-Andersen and J. H. Waite, “Mussel-designed pro-
holothuroid Holothuria forskali (Echinodermata): a morpho-
tective coatings for compliant substrates,” Journal of Dental
functional study,” Marine Biology, vol. 96, no. 2, pp. 263–275,
Research, vol. 87, no. 8, pp. 701–709, 2008.
1987.
[32] J. H. Waite, X. X. Qin, and K. J. Coyne, “The peculiar collagens
[15] J. M. Gosline, P. A. Guerette, C. S. Ortlepp, and K. N. Savage,
of mussel byssus,” Matrix Biology, vol. 17, no. 2, pp. 93–106,
“The mechanical design of spider silks: from fibroin sequence
1998.
to mechanical function,” Journal of Experimental Biology, vol.
202, no. 23, pp. 3295–3303, 1999. [33] L. M. McDowell, L. A. Burzio, J. H. Waite, and J. Schaefer,
“Rotational echo double resonance detection of cross-links
[16] T. Chirila, Z. Barnard, Zainuddin, D. G. Harkin, I. R. Schwab,
formed in mussel byssus under high-flow stress,” Journal of
and L. W. Hirst, “Bombyx mori silk fibroin membranes as
Biological Chemistry, vol. 274, no. 29, pp. 20293–20295, 1999.
potential substrata for epithelial constructs used in the man-
agement of ocular surface disorders,” Tissue Engineering—Part [34] L. A. Burzio and J. H. Waite, “Cross-linking in adhesive quino-
A, vol. 14, no. 7, pp. 1203–1211, 2008. proteins: studies with model decapeptides,” Biochemistry, vol.
[17] W. R. Pearson and J. F. Morrow, “Discrete-length repeated 39, no. 36, pp. 11147–11153, 2000.
sequences in eukaryotic genomes,” Proceedings of the National [35] M. J. Naldrett and D. L. Kaplan, “Characterization of barnacle
Academy of Sciences of the United States of America, vol. 78, no. (Balanus eburneus and B. cenatus) adhesive proteins,” Marine
7 I, pp. 4016–4020, 1981. Biology, vol. 127, no. 4, pp. 629–635, 1997.
[18] J. Schütze, A. Skorokhod, I. M. Müller, and W. E. G. [36] E. Jacobs and A. Clad, “Electroelution of fixed and stained
Müller, “Molecular evolution of the metazoan extracellular membrane proteins from preparative sodium dodecyl sulfate-
matrix: cloning and expression of structural proteins from polyacrylamide gels into a membrane trap,” Analytical Bio-
the demosponges Suberites domuncula and Geodia cydonium,” chemistry, vol. 154, no. 2, pp. 583–589, 1986.
Journal of Molecular Evolution, vol. 53, no. 4-5, pp. 402–415, [37] C. D. Bavington, R. Lever, B. Mulloy et al., “Anti-adhesive
2001. glycoproteins in echinoderm mucus secretions,” Comparative
[19] M. M. Bradford, “A rapid and sensitive method for the Biochemistry and Physiology Part B, vol. 139, no. 4, pp. 607–
quantitation of microgram quantities of protein utilizing the 617, 2004.
principle of protein dye binding,” Analytical Biochemistry, vol. [38] P. Flammang, “The glue of sea cucumber Cuvierian tubules: a
72, no. 1-2, pp. 248–254, 1976. novel marine bioadhesive,” IFREMER Actes de Colloques, vol.
[20] G. Danscher, “Light and electron microscopic localization of 36, pp. 176–185, 2003.
silver in biological tissue,” Histochemistry, vol. 71, no. 2, pp. [39] J. L. Dalsin, B. H. Hu, B. P. Lee, and P. B. Messersmith, “Mussel
177–186, 1981. adhesive protein mimetic polymers for the preparation of
[21] R. E. Welch, “Stepwise multiple comparison procedures,” nonfouling surfaces,” Journal of the American Chemical Society,
Journal of the American Statistical Association, vol. 72, pp. 566– vol. 125, no. 14, pp. 4253–4258, 2003.
575, 1977. [40] H. Lee, B. P. Lee, and P. B. Messersmith, “A reversible wet/dry
[22] H. Determann, Gel Chromatography, Springer, New York, NY, adhesive inspired by mussels and geckos,” Nature, vol. 448, no.
USA, 1969. 7151, pp. 338–341, 2007.
Evidence-Based Complementary and Alternative Medicine 13
Research Article
Comparative Cytogenetics Analysis of Chlamys farreri,
Patinopecten yessoensis, and Argopecten irradians with C0t -1
DNA by Fluorescence In Situ Hybridization
Li-Ping Hu, Wen-Cong Shang, Yan Sun, Shan Wang, Xiao-Liang Ren,
Xiao-Ting Huang, and Zhen-Min Bao
Key Laboratory of Marine Genetics and Breeding (MGB), College of Marine Life Sciences, Ocean University of China,
Ministry of Education, Qingdao 266003, China
The chromosomes of Chlamys farreri, Patinopecten yessoensis, and Argopecten irradians were studied by FISH using C. farreri C0 t-1
DNA probes. The results showed that C0 t-1 DNA signals spread on all chromosomes in the three scallops, whereas signal density
and intensity were different strikingly. Clustering brighter signals presented in the centromeric and telomeric regions of most
C. farreri chromosomes, and in the centromeric or pericentromeric regions of several P. yessoensis chromosomes. Comparative
analysis of the mapping indicated a relatively higher homology in the repetitive DNA sequences of the genome between C. farreri
and P. yessoensis than that between C. farreri and A. irradians. In addition, FISH showed that the distribution of C0 t-1 DNA
clustering signals in C. farreri displayed completely similar signal bands between homologous chromosomes. Based on the C0 t-
1 DNA fluorescent bands, a more exact karyotype of C. farreri has been obtained. In this study, the comparative analysis based
on C0 t-1 DNA provides a new insight into the chromosomal reconstructions during the evolution process, and it is helpful for
understanding an important source of genomic diversity, species relationships, and genome evolution.
fosmid clones have been applied to identification of C. 2.2. Genomic DNA Extraction and Preparation of CF C0 t-1
farreri chromosomes and identified 8 from 19 chromo- DNA. The total genomic DNA extraction was carried out by
some pairs [17]. So far, there has not been a successful the standard phenol-chloroform procedure using adductor
example to identify all the chromosome pairs of any scallop muscle [28]. CF C0 t-1 DNA was prepared according to the
species. procedure described by Zwick et al. [29] with slightly mod-
The genomes of eukaryotic species contain numerous ified. In brief, genomic DNA was diluted to a concentration
types of highly or moderately repetitive DNA elements. It of 600 ng/μl in 0.3 M NaCl and was sonicated to 100–1500 bp
has been showen that the variation in genome size is largely DNA fragments. The shearing DNA was denatured in 95◦ C
caused by differences in the amount of repetitive DNA bath water for 10 min, and then annealed in 65◦ C bath water
sequences. The repetitive DNA sequences used as the molec- for the required time which was calculated according to the
ular marker play significant roles in comparative genomics formula C0 t-1 = mol/L × Ts. After the tube was put into
study, especially the research on structure and function ice water for 2 min, the appropriate amount of S1 nuclease
of species genomes and the evolution of chromosomes. (1 U/μg DNA) was added, and reaction at 23◦ C for 30 min.
For example, the satellite repeat sequences were exploited Finally, the reaction was stopped by adding appropriate
for genetic linkage maps construction [18] and variety amount of EDTA (final concentration of 25 mM). Then the
identification [19, 20]. The in situ investigation of repetitive DNA was extracted by Tris-equilibrated phenol, deposited
DNA sequences adds new informative characters useful in by 2.5 volumes of absolute ice-ethanol and washed with
comparative genomics at chromosomal level and provides prechilled 70% ethano1, then air-dried and resuspended
insights into the evolutionary relationships among scallops in TE buffer. CF C0 t-1 DNA was stored in −20◦ C after
[13, 14], as well as the hybridization of satellite DNAs has quantitative analysis.
contributed to the relationship among fish species and their
karyotypic diversification [21–23].
2.3. Probe Labeling and FISH. CF C0 t-1 DNA was labeled
C0 t-1 DNA is enriched with highly and moderately repet-
with digoxigenin-11-dUTP by nick translation following the
itive DNA sequences, which have been widely used as a block-
manufacturer’s instruction (Roche). The length of the CF
ing agent to inhibit hybridization of repeats present within
C0 t-1 DNA used as the probe for FISH was between 100 bp
DNA probes. In some plant species, C0 t-1 DNA has also
and 600 bp, which was estimated by 2% gel electrophoresis.
been used for karyotyping and comparative analysis of
FISH was carried out according to Huang et al. [8].
genomes by FISH [24, 25]. Zhikong scallop (Chlamys farreri
Firstly, chromosomes spreads were pretreated with 0.005%
Jones et Preston, 1904), Yesso scallop (Patinopecten yessoensis
pepsin in 10 mM HCl for 10 min, and followed by washing
Jay, 1857), and Bay scallop (Argopecten irradians Lamarck,
in 2 × SSC twice 5 min at room temperature. Chromosome
1819) are important commercial species in China. C. farreri
spreads were then denatured in a mixture containing 75%
distribute naturally in the northern seacoasts of China. P.
formamide and 2 × SSC at 76◦ C for 2-3 min, dehydrated
yessoensis and A. irradians were introduced to China from
with a chilled ethanol series, 70%, 90%, 100%, 5 min each,
their original distribution areas—Hokkaido, Japan in 1980
and air-dried. The hybridization mix (10 ng/ul probes, 10%
[26] and North America in 1982 [27], respectively. To analyze
dextran sulfate, and 50% deionized formamide in 2 × SSC)
the genome structure and detect chromosome evolution
was denatured at 95◦ C for 6-7 min and chilled immediately
of these three species, we used C0 t-1 DNA of C. farreri
by putting on ice for at least 10 min. Denatured probe was
(called CF C0 t-1 DNA for short) as probes for in situ
applied onto the slide and DNA-DNA in situ hybridization
hybridization on mitotic metaphase chromosomes of these
was carried out in a humidity chamber at 37◦ C for 12–
scallops and analyzed the signals distribution of the repetitive
16 h. Following hybridization, the slides were washed in 2 ×
sequences in the three genomes. In addition, since these DNA
SSC at 42◦ C 5 min, 50% formamide in 2 × SSC at 42◦ C
sequences dispersed in the whole genome, we tried to identify
10 min, 1 × SSC at 42◦ C three times (5 min each), and 2 ×
individual pairs from all the chromosome pairs of C. farreri
SSC once for 5 min at room temperature. Fluorescent signals
with the hybridization signal bands.
were detected with antidigoxigenin rhodamine (Roche).
Chromosomes were counterstained with DAPI (Vector).
Slides were observed using a Nikon E-600 epifluorescence
2. Materials and Methods microscope equipped with a CCD camera (COHU). The
signals were collected using appropriate filter sets and LUCIA
2.1. Scallop Materials and Chromosome Preparations. Sexu-
software. The karyotype was reconstructed according to the
ally mature scallops (C. farreri, A. irradians, and P. yessoensis)
karyotype standard of Levan et al. [30], as well as CF C0 t-1
were obtained from a hatchery in Shandong Province, China.
DNA signal bands patterns using Lucia-FISH Image System.
The chromosome preparations were performed following
the method of Zhang et al. [14]. Briefly, the larvae were
treated with colchicine (0.01%) for 2 h at room temperature 3. Results
and KCl (0.075 M) for 30 min, then fixed in Carnoy’s fixative
(methanol : glacial acetic acid = 3 : 1 v/v) for three times The size of the genomic DNA obtained from C. farreri was
(15 min each). The fixed larvae were dissociated in 50% more than 20 kb (data not shown). After being sonicated,
acetic acid, and then the cell suspension was dropped onto the majority of DNA fragments were within the desired size
hot-wet slides and air-dried. range of 100–1500 bp. Then by reannealing and S1 nuclease
Evidence-Based Complementary and Alternative Medicine 3
Figure 2: FISH results of C0 t-1 DNA probes to the metaphase chromosomes of C. farreri, P. yessoensis and A. irradians. Bar = 5 μm. (a) and
(g), FISH combined image and red hybridization signals image of C. farreri probed with its own C0 t-1 DNA; (b) and (h), FISH combined
image and red hybridization signals image of P. yessoensis probed with C0 t-1 DNA of C. farreri; (c) and (i), FISH combined image and red
hybridization signals image of A. irradians probed with C0 t-1 DNA of C. farreri; (d), (e), and (f), DAPI staining images of C. farreri, P.
yessoensis, and A. irradians, respectively.
repetitive sequences in genus Oryza were quite conserved features and morphological characteristics of juveniles [2,
during evolution. 3].
Although highly and moderately repetitive sequences of Comparative studies on diverse bivalves have shown that
C. farreri existed in the genomes of C. farreri, P. yessoensis, chromosome structures are incredibly dynamic in terms of
and A. irradians, signal coverage, strength, and area on chro- number and location of rDNAs [32–34]. Moreover, Wang
mosomes of these three species were different strikingly. We and Guo [13] postulated chromosomal translocation and
speculated that highly and moderately repetitive sequences duplication may play a dominant role in the karyotypic
are most likely species-specific. Moreover, CF C0 t-1 DNA evolution of Pectinidae by detecting the major and minor
showed more intensive and brighter signals on the chromo- rDNA patterning in C. farreri and A. irradians. Huang et al.
somes in P. yessoensis than in A. irradians, which may indicate [7] speculated that the nonreciprocal translocation of chro-
a relatively higher homology in the repetitive DNA sequences mosome with 18S–28S rDNA loci lead to one 18S–28S rDNA
between the genome of P. yessoensis and C. farreri, than site in C. farreri into two in P. yessoensis. In addition, the
that between A. irradians and C. farreri. The relationship comparative chromosomal localization of histone H3 gene
among these three scallops herein are in accordance with in four scallop species (C. farreri, C. nobilis, P. yessoensis, and
the previous molecular studies that used sequences of the A. irradians) suggested that gene duplication/diminution and
mtDNA [4] or internal transcribed spacer region [31], and chromosome rearrangements may have played important
the classification system based on microsculpture of shell roles during chromosome evolution in Pectinidae [14]. In
Evidence-Based Complementary and Alternative Medicine 5
Research Article
Characteristics of the Aragonitic Layer in
Adult Oyster Shells, Crassostrea gigas : Structural Study of
Myostracum including the Adductor Muscle Scar
Myostracum, which is connected from the umbo to the edge of a scar, is not a single layer composed of prismatic layers,
but a hierarchically complex multilayered shape composed of minerals and an organic matrix. Through the analysis of the
secondary structure, the results revealed that a β-antiparallel structure was predominant in the mineral phase interface between
the myostracum (aragonite) and bottom folia (calcite). After the complete decalcification and deproteinization, the membrane
obtained from the interface between the myostracum buried in upper folia, and the bottom folia was identified as chitin. The
transitional zone in the interface between the adductor muscle scar and folia are verified. The myostracum disappeared at the edge
of the scar of the posterior side. From this study, the entire structure of the myostracum from the adult oyster shell of Crassostrea
gigas could be proposed.
synthesis and marine biomineral formation, such as that of by second derivatization, resolution-enhanced Fourier self-
bivalve shells. deconvolution in the amide I region and Gaussian curve-
fitting using the origin 6.1. Second-derivative spectra [22]
were smoothed by the 9-point FFT filter method. The
2. Materials and Methods number of components and their peak positions were
2.1. Sample Preparation. Shells of Crassostrea gigas (Namhae determined by second derivatization and used as starting
and Tongyoung in Korea) were freshly collected, soaked in parameters [23]. The secondary structure contents were
5% NaOH, lightly scrubbed, and dried at room temperature. calculated from the area of each Gaussian band and their
After they had dried completely, the samples were finely fraction of the total area in the amide I spectral region [24].
separated using a mill, cutting knife and optical microscope. The assignment of these bands is based on the studies of
The decalcified samples were prepared by submerging myos- proteins by vibrational spectroscopy.
tracum buried in folia into acetic acid solution. They were
partly or completely removed by controlling the treatment 3. Results and Discussion
time and the concentration of acetic acid. Deproteinization
process was carried out as follows: the samples were treated 3.1. Overview of the Myostracum of the Adult Oyster Shell
by 20% sodium hydroxide at 65◦ C for 1 hour and then of C. gigas. The adductor muscle scar is the surface of
washed with distilled water. Soluble or insoluble protein the myostracal support for the attachment of the adductor
obtained from the adductor muscle scar was prepared by the muscle, and it is contained in the shell of most bivalves
method of Choi and Kim [17]. [15]. Figure 1(a) shows the inner surface of the C. gigas
shell. Most of the area in the inner surface is composed of
folia that appear to be nacreous layers and chalky layers, of
2.2. Observation Procedure. Analysis is equipment-like as the which 20∼30% have been identified. The folia are composed
following equipment is used to analyze a sample separated of foliated laths. The chalky layer is frequently marked by
from myostracum and organic matrix. Crystal structure and irregularly shaped, chalky-white areas and relatively soft,
crystallinity were characterized by recording a RIGAKU hor- porous material compared to the folia [4]. The adductor
izontal powder X-ray diffractometer using CuKα radiation muscle scar (AMS) is the most conspicuous area on the
via a rotating anode at 30 kV and 20 mA. Microstructures inner surface of the C. Gigas shell. It is pigmented, and
of the specimens were studied by using an Aspex personal its color varies in different individuals from light, lavender-
scanning electron microscope (PSEM) with EDS capability. white to dark purple. The scar is located slightly in the center
During SEM analysis, the features identified as organic toward the posterodorsal side of each valve. Figure 1(b)
matrix were relocated. Residual products of decalcification shows a vertical section of the center of the scar. The
and deproteination were observed by scanning electron myostracum is elongated from the scar to the umbo. As
microscopy (SEM) (S-2500C HITACHI, Japan) with an shown in Figure 1(b), the transitional zone (approximately
acceleration voltage of 20 kV and a beam current of 5 × 10−10 0.5 mm in thickness) with granule-like material exists around
A. the outside of the scar. Foliated laths have been developed
from the anterior to the scar and from the scar to the
2.3. Amide I and Secondary Structure Determination of posterior. The thickness of the myostracum in the hidden
Proteins. The amide I feature, located approximately in the area is identified as above, approximately 10 μm, but the
1680–1597 cm−1 region, results primarily from the C=O thickness decreases to be closer to the transitional zone.
stretching vibration coupled to the in-plane NH bending and Additionally, the myostracum disappears at the transitional
CN stretching modes. The exact frequency of this vibration zone (Figure 1(c)).
depends on the nature of hydrogen bonding involving the Figure 1(c) shows a scheme of the oyster shell with an
C=O and NH moieties; this, in turn, is determined by the enlargement including the myostracum. A specific stratum
particular secondary structure adopted by the polypeptide between the folia and myostracum could exist, but the
chains. The relationship between the position of the amide thickness may be several hundred nanometers. Myostracum
I band and the type of secondary structure may be best with the exception of the adductor muscle scar is buried
observed from the infrared spectra of homopolypeptides between the foliated lath and the chalky structure. As shown
that adopt well-defined, and often highly homogeneous in this figure, the myostracum has been surrounded by the
secondary structures [18, 19]. folia; the polymorph of the myostracum is aragonite, but the
The spectra were recorded using a Fourier transform folia are calcite. The shape of the myostracum is a prismatic
infrared spectrometer with a resolution of 2 cm−1 . The layer (approximately 5∼35 μm in thickness), but that of the
system was purged with dry N2 to reduce interfering water folia is a laminated layer (approximately 100∼200 μm in
vapor IR absorption and verified no water contribution thickness). This single layer that comprises the myostracum
by measuring KBr pellets. For intracrystalline proteins is the myostracal prism, and the layer comprising the folia
intercalated within either calcite or aragonite, the subtraction is the foliated lath. In this study, the interface was defined as
was performed [20, 21]. To obtain the undisturbed protein the point of interaction between the two layers. As previously
vibration spectra, each synthetic calcite and aragonite refer- mentioned, the polymorph and the shape of the two layers
ence IR spectrum was subtracted from each mineral-specific are different. Thus, a buffer zone (organic matrix) could be
layer, respectively. The subtracted spectra were analyzed necessary for the morphological and polymorphic control.
Evidence-Based Complementary and Alternative Medicine 3
Dorsal
Dorsal
Adductor muscle
Chalky
Left umbo scar
Anterior Posterior Posterior
Anterior Chalky
Cutting plane
Myostracum
Adductor
muscle scar
Ventral
(a)
Dorsal
Folia (around 200∼300 μm)
Transitional zone Transitional zone
Folia
Stamen-like materials over myostracum Adductor muscle Posterior
Anterior scar
(b)
(c)
Figure 1: (a) Schematic of the inner surface of the left valve of an oyster shell, Crassostrea gigas (black dotted line: cutting plane). (b)
Schematic of the vertical section with the cutting plane of the adductor muscle scar. The bottom schematic is an enlargement of the cutting
plane including the AMS (adductor muscle scar), myostracum, and folia. (c) An enlargement indicating the thickness of the myostracum
buried in the folia on the anterior side. The size of each layer is exaggerated for clarity. Various terms are in common use in the description
of the bivalve shell [25].
At the organic layer, the interface between the folia and (b)
myostracum is rich at the bottom interface as compared to
the upper interface. Consequently, the area including the C H stretching
interface between the folia and myostracum contains well- C
ordered arrays and structural characteristics of each layer.
C
Dorsal
(b) (c)
Anterior
(iii) (ii) (i) (a) (i) (ii) (iii)
Posterior
000037 25 kV x1 K 30 μm
Ventral
(a) (Scale bar: 30 μm), the area including the transitional zone (refer to Figure 1(b)) from the anterior to the scar side
AMS
FL
TZ
TZ
FL AMS
TZ
the morphological and polymorphic interface. An adult characteristic of the aragonite structure. Moreover, the peak
oyster shell is composed of a high concentration of CaCO3 of the –OH or NH stretching (3450 cm−1 ), the CH stretching
(above 97 wt.%) and a low concentration of organic matrix (2929 cm−1 ) as the organic matrix characteristic and the peak
(approximately 3 wt.%) [3]. CaCO3 has three polymorphs, of HCO3 − (2650∼2520 cm−1 ) that plays a role in providing
including aragonite, vaterite, and calcite. Among these, the the carbonate ion in Ca2+ protein binding in the formation
polymorph of the myostracum is aragonite, and that of the of the shell are confirmed. As shown in Figure 2, organic
folia is calcite. Even more interesting for this study is the characteristics are identified in the myostracum of the AMS
hierarchical structure of the morphological interface. and folia. Additionally, it is verified that the myostracum in
From the analysis of the FTIR spectrum of the myos- the AMS has a rich organic matrix.
tracum in the AMS and folia (Figure 2), the polymorph of The area between the scar and the folia contains a
the folia is identified as calcite, and that of the myostracum transitional zone with a granular-like structure, as shown
is identified as aragonite. The carbonate ions in the mineral in Figure 3. The surface of the central scar from which
were demonstrated by the internal vibration modes of the adductor muscle has been removed with acetic acid is
the CO3 2− ions: 696, 713(υ4 )–858, 875(υ2 )–1082(υ1) and extremely smooth and slightly berm-like (Figure 3(a)). In the
1490(υ3 ) cm−1 . The strong IR band detected at 1792 cm−1 case of C. gigas, the ratio of the scar area in the oyster inner
could also be attributed to the C=O groups of the carbonate shell surface area is from 8 to 15. Figures 3(b) and 3(c) show
ions. The splitting of υ4 (696), υ2 (858), and υ1 (1082) is the interface, or transitional zone, between the AMS and folia
Evidence-Based Complementary and Alternative Medicine 5
Figure 4: SEM images of the myostracum. (a) Central AMS (adductor muscle scar) and (b) the area between the central AMS and the edge
of the scar on the posterior side (Scale bar of (a), (b), and (c) 6 μm).
in both directions. The first is from the anterior side to the the interface between the myostracum and folia could be a
AMS (Figure 3(b)), and the second is from the AMS to the key factor to control the system.
posterior side (Figure 3(c)). The AMS is present at the front Table 1 shows the difference in the amino acid compo-
of the posterior-advancing edge of the growing adductor sition of C. virginica [26] and C. gigas [17]. The amino
muscle and shows a transitional zone of the newly deposited acid composition of Crassostrea gigas was quoted in a
scar approximately 0.5 to 1 mm wide (Figures 3(b) and 3(c)). previously published paper. As evident in Table 1, C. gigas
The surface of the AMS near the transitional zone typically and C. virginica have a difference in their amino acid
consists of a smooth shape similar to that of the central scar. composition according to the position and characteristics
The granules between the transitional myostracum and the of each layer, respectively. Aspartate, serine, and glycine in
foliated structure on the ventral and dorsal sides of the scar C. virginica are rich, while serine in C. gigas is relatively
are usually much narrower than that on the posterior side low (Table 1). It is known that the secondary structure [27]
and are finely granular. The granule is approximately 60-μm of proteins exists mostly as a β structure if Asp, Gly, and
(ventral and dorsal side) to 100-μm (posterior and anterior Ser are mostly contained in the protein. The proportion
side) wide. The distinctly granular nature of this transitional of nonpolar residues is 0.52 in C. virginica and 0.47 in C.
zone is characteristic. The granule-to-transitional surface gigas, which is similar to Wheeler’s result (0.41) [28]. The
of C. virginica [15] consists of a muffin- or mulberry-like analysis by Wheeler et al. was performed on the dark and
microstructure ranging in complexity from single to multiple light fractions of the insoluble matrix extracted from the
granular mounds, in contrast to C. gigas in which a muffin- whole shell; therefore, a direct comparison with our data
or mulberry-like microstructure does not exist. Moreover, may not be appropriate. However, if their dark or light
Carriker et al. [15] reported that granules in C. virginica fractions are assumed to be the foliated lath and adductor
adhere closely between the chalky structure and plywood- muscle scar, respectively, then the data of those two reports
like calcite. However, in the case of C. gigas, the granules also agree relatively well (The insoluble matrix of the prismatic
do not exist. From these results, a granule may be a certainly layer has a darker color than that of the foliated lath.)
distinctive characteristic to classify the differences between C. Several researchers [29, 30] reported that the amino acid
virginica and C. gigas. composition of mollusks affected the structure of the shell
Figure 4 shows that the myostracum outlines in the and differed in the shape of the shell. A comparison between
posterior end of the scar are irregular, with reentrant angles. C. gigas and C. virginica in Table 1 indicates that aspartate,
Especially interesting is that the thickness of the myostracal glycine, and serine are rich residues. Wheeler et al. reported
prism was rapidly tapered (indicated by the white arrows the ratio of aspartate, glycine, and serine as 80% of the total
in Figure 4). As evident from Figure 4, the thickness of the residue.
myostracum decreases toward the posterior direction and Through chemical treatment (10% acetic acid), the
then disappears in the region of the granule that exists in decalcification of myostracum in AMS was carried out
the interfacial posterior side. The interesting aspect is how an (Figure 5). Granules (approximately 3 μm) on the myos-
oyster could control a gradual decrease in the thickness. The tracum were identified (Figure 5(b)), and the decalcified
organic matrix intercalated in the myostracum or located in myostracal prisms possessed horizontal striations along
6 Evidence-Based Complementary and Alternative Medicine
Table 1: Amino acid compositions of the soluble and insoluble proteins from Crassostrea virginica [26] and Crassostrea gigas [17] (Asx: Asp
+ Asn, Glx: Glu + Gln).
Species Layer Asx Thr Ser Glx Pro Gly Ala Val Tyr
Folia 29.4 0.8 22.0 5.2 3.5 33.4 1.42 1.2 0
C. virginica
Whole shell, insoluble only 18.1 1.2 14.2 3.5 6.2 34.1 4.7 3.0 4.9
Folia 24.8 1.9 6.6 4.2 5.5 29.3 10.3 3.0 2.2
C. gigas Whole shell, insoluble only 8.7 2.8 5.8 6.3 6.9 27.4 12.4 5.6 2.0
Myostracum in AMS 20.9 2.7 6.4 7.6 5.1 30.0 6.5 3.2 1.8
AMS
000028 25 kV x5 K 6 μm 000029 25 kV x1 K 30 μm
(a) (b)
000034 25 kV x1 K 30 μm 000042s 25 kV x1 K 30 μm
(c) (d)
Figure 5: The decalcified AMS including the myostracum by acetic acid (10 wt.%) for 30 min (Scale bar of (a) 6 μm; scale bar of (b), (c),
and (d) 30 μm).
the axis (Figure 5(c)). Furthermore, the separation of the of the shell margin (Figure 6(b)). Especially in the region
myostracum at the interface with the folia was easier to between the posterior side and the scar, the laths remain
accomplish after an acidic treatment. It is estimated that the parallel to each other, and the growing front of each lath
removal of the organic matrix allowed the myostracum to faces the posterior margin. The formation of the foliated
adhere to the folia. laths with uniform width and length could be attributed
to the influence of the mantle tissue of the hidden organic
3.3. Characteristic Approach of the Myostracum Buried in the matrix. Wilbur and Saleudin (1983) reported that the shell
Folia of C. gigas. A vertically fractured foliated lath on the formation occurs in the secretion by the mantle epithelial
anterior side shows that the thickness of the folia is from cells and in an extrapallial space in which mineral crystals
500 μm to 800 μm (the white dotted line in Figure 6(a)). The are nucleated and oriented with the secreted organic matrix.
folia structure does not fracture as cleanly as does the scar, The process by which the myostracum is buried in the folia
but the fractures provide valuable information on the form of could be dictated by a uniform prismatic structure into the
the laths. The surface texture ranges form smooth to slightly AMS. Any organic matrix would control the structure. The
dimpled, parallel-lined, or chevron-marked, representing the most important factor is a template to control the structure
growth halts of the crystal fronts, which point in the direction and polymorphism of the myostracum.
Evidence-Based Complementary and Alternative Medicine 7
Above
folia
Below
folia
Figure 6: SEM images of the myostracum buried in the folia on the anterior side. (a) the area including the folia, myostracum, and folia; (b)
an enlargement of the black star region; (c) an enlargement of the white star region (scale bar of (a) 0.3 mm; scale bar of (b) and (c) 15 μm).
The thickness of the upper folia is approximately 300 μm. It appears that the myostracum was inserted in the folia.
Figure 8: The decalcified myostracum buried in folia by acetic acid (10 wt.%). (a) fractured myostracum including the folia; (b)
decalcification for 30 min; (c) decalcification for 1 hr (scale bar of (a) and (b) 15 μm; scale bar of (c) 7.5 μm).
Table 2: Secondary structure of the intracrystalline proteins of each layer in vivo: (a) Folia by fracturing in first, (b) Folia by fracturing in
second, (c) Folia by fracturing in third, and (d) Folia and myostracum buried in folia.
and b-axes of the β-anti of the matrix are aligned with grown in vitro in crystals of proteins extracted from the
the a- and b-crystallographic directions of the aragonite shell have been performed to elucidate their functions during
lattice. That is, the crystals are oriented such that the (001) the formation of either aragonite or calcite. From various
crystal face (the a-b plane) and c axis are parallel and in vitro experiments, some researchers [32] reported that
perpendicular to the underlying matrix surface, respectively. a polyanionic-soluble protein determines the phase of the
Thus, the crystal orientation (001) of the myostracum calcium carbonate, while other researchers have reported
composed of aragonite could indicate the identity of the β- that an insoluble protein determines the phase [33]. Belcher
structure in the myostracum buried in the folia. This result, et al. [34] also produced an in vitro system capable of
moreover, incorporates both an ionotropic and an epitaxial specifically inducing the formation of aragonite and calcite
formation of the myostracum that could be induced by the crystals in the presence of appropriate acidic macromolecules
β-structure. Of course, only the β-structure is a major factor extracted from nacre. This specificity is dependent not only
in accounting for the formation of the myostracum and the on the acidic macromolecules but also requires the presence
control of the interface between the myostracum and folia. of β-chitin, as opposed to α-chitin, and silk fibroin [35];
The optical microscope is used to verify the separation of chitin has an intimate relationship among proteins of the
the myostracum at the boundary of the folia after fracturing. silk-fiber type, rich in Gly and Ala [36]. As shown in Table 1,
Figure 8 shows the results; within 30 min of decalcification, Gly in C. gigas and C. virginica is rich (27∼35%), and Ala of
the myostracal prism is verified (Figure 8(a)), and lawn-like the insoluble portion of C. gigas is approximately three times
material is also verified (Figure 8(b)). After the myostracal higher than that of C. virginica. The interface between the
prism is eliminated, a membrane is verified (Figure 8(c)). myostracum, and folia may have a significant effect on the
The morphology and shape of the membrane differ from mechanical properties of the overall composites.
previous minerals. It can be analogized that the organic After the complete decalcification, the membrane
matrix in contact with the myostracum is mostly soluble, obtained from the interface of the myostracum buried in
while the membrane to be eliminated from the myostracal the folia was deproteinized. After eliminating the insoluble
prism was occupied by a major portion of insoluble matrix. protein, the membrane was identified by XRD analysis
It is known that proteins extracted from the shell play an (Figure 9); it is verified that the organic membrane from
important role in biomineralization. Numerous experiments the myostracum buried in the folia possesses chitin-like
Evidence-Based Complementary and Alternative Medicine 9
[12] A. Berman, L. Addadi, and S. Weiner, “Interactions of sea- [29] H. Kasai and N. Ohta, “Relationship between organic matrices
urchin skeleton macromolecules with growing calcite crystals- and shell structures in recent bivalves,” in Study of Molluscan
a study of intracrystalline proteins,” Nature, vol. 331, no. 6156, Paleobiology, T. Habe and M. Omori, Eds., chapter 4, pp. 101–
pp. 546–548, 1988. 106, Niigata University Press, Niigata, Japan, 1981.
[13] S. Kobayashi, “Calcification in fish and shell-fish I. Tetracy- [30] T. Samata, “Ca2+ -binding glycoproteins in molluscan shells
cline labelling patterns on scale, centrum and otolith in young with different types of ultrastructure,” Veliger, vol. 33, pp. 190–
goldfish,” Bulletin of the Japanese Society for the Science of Fish, 201, 1990.
vol. 30, pp. 893–907, 1964. [31] S. Mann, Biomineralization Principles and Concepts in Bioinor-
[14] H. B. Stenzel, “Aragonite and calcite as constituents of adult ganic Materials Chemistry, Oxford University Press, New York,
oyster shells,” Science, vol. 142, no. 3589, pp. 232–233, 1963. NY, USA, 2001.
[15] M. R. Carriker, “The shell and ligament,” in The Eastern [32] G. Falini, S. Albeck, S. Weiner, and L. Addadi, “Control of
Oyster, V. S. Kennedy, R. I. E. Newell, and A. F. Eble, Eds., pp. aragonite or calcite polymorphism by mollusk shell macro-
75–168, Maryland Sea Grant Collage, 1996. molecules,” Science, vol. 271, no. 5245, pp. 67–69, 1996.
[16] H. A. Lowenstam and S. Weiner, On Biomineralization, Oxford [33] K. M. Wilbur and N. Watabe, “Experimental studies on
University Press, New York, NY, USA, 1989. calcification in molluscs and the alga Cocolithus huxleyi,”
[17] C. S. Choi and Y. W. Kim, “A study of the correlation between Annals of the New York Academy of Sciences, vol. 109, pp. 82–
organic matrices and nanocomposite materials in oyster shell 112, 1963.
formation,” Biomaterials, vol. 21, no. 3, pp. 213–222, 2000. [34] A. M. Belcher, X. H. Wu, R. J. Christensen, P. K. Hansma, G.
[18] F. N. Fu, D. B. DeOliveira, W. R. Trumble, H. K. Sarkar, D. Stucky, and D. E. Morse, “Control of crystal phase switching
and B. R. Singh, “Secondary structure estimation of proteins and orientation by soluble mollusc-shell proteins,” Nature, vol.
using the amide III region of fourier transform infrared 381, no. 6577, pp. 56–58, 1996.
spectroscopy: application to analyze calcium-binding-induced [35] Y. Levi-Kalisman, G. Falini, L. Addadi, and S. Weiner,
structural changes in calsequestrin,” Applied Spectroscopy, vol. “Structure of the nacreous organic matrix of a bivalve mollusk
48, no. 11, pp. 1432–1441, 1994. shell examined in the hydrated state using Cryo-TEM,” Journal
[19] W. K. Surewicz, M. A. Moscarello, and H. H. Mantsch, of Structural Biology, vol. 135, no. 1, pp. 8–17, 2001.
“Secondary structure of the hydrophobic myelin protein in [36] N. Kensuke and C. Yoshiki, “Control of crystal nucleation
a lipid environment as determined by Fourier-transform and growth of calcium carbonate by synthetic substrates,”
infrared spectrometry,” Journal of Biological Chemistry, vol. Chemistry of Materials, vol. 13, no. 10, pp. 3245–3259, 2001.
262, no. 18, pp. 8598–8602, 1987. [37] S. Weiner and W. Traub, “X-ray diffraction study of the
[20] E. Goormaghtigh, V. Cabiaux, and J. M. Ruysschaert, “Sec- insoluble organic matrix of mollusk shells,” FEBS Letters, vol.
ondary structure and dosage of soluble and membrane 111, no. 2, pp. 311–316, 1980.
proteins by attenuated total reflection Fourier-transform
infrared spectroscopy on hydrated films,” European Journal of
Biochemistry, vol. 193, no. 2, pp. 409–420, 1990.
[21] S. J. Gadaleta, N. P. Camacho, R. Mendelsohn, and A. L.
Boskey, “Fourier transform infrared microscopy of calcified
turkey leg tendon,” Calcified Tissue International, vol. 58, no.
1, pp. 17–23, 1996.
[22] H. Susi and D. Michael Byler, “Protein structure by Fourier
transform infrared spectroscopy: Second derivative spectra,”
Biochemical and Biophysical Research Communications, vol.
115, no. 1, pp. 391–397, 1983.
[23] A. Dong, P. Huang, and W. S. Caughey, “Protein secondary
structures in water from second-derivative amide i infrared
spectra,” Biochemistry, vol. 29, no. 13, pp. 3303–3308, 1990.
[24] W. K. Surewicz and H. H. Mantsch, “New insight into pro-
tein secondary structure from resolution-enhanced infrared
spectra,” Biochimica et Biophysica Acta - Protein Structure and
Molecular Enzymology, vol. 952, no. 2, pp. 115–130, 1988.
[25] P. S. Galtsoff, “The American oyster Crassostrea virginica
(Gmelin),” Fishery Bulletin, vol. 64, pp. 1–48, 1964.
[26] T. Kawaguchi, “The organic matrices of the shell of the
American oyster Crassostrea virginica Gmelin,” Journal of
Experimental Marine Biology and Ecology, vol. 170, no. 1, pp.
11–28, 1993.
[27] D. L. Nelson and M. M. Cox, Lehninger Principles of Biochem-
istry, Worth Publishers, City, State, USA, 2000.
[28] A. P. Wheeler, K. W. Rusenko, and C. S. Sikes, “Organic matrix
from carbonate biomineral as a regulator of mineralization,”
in Chemical Aspects of Regulation of Mineralization, C. S. Sikes
and A. P. Wheeler, Eds., pp. 9–13, Unversity South Alabama
Publication, Ala, USA, 1988.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 103425, 6 pages
doi:10.1155/2011/103425
Research Article
Novel 5,6-Dihydropyrrolo[2,1-a]isoquinolines as Scaffolds for
Synthesis of Lamellarin Analogues
Shao Han Liao,1, 2 Dai Hua Hu,3 Ai Ling Wang,1, 2 and De Peng Li1, 2
1 College of Environment and Chemical Engineering, Dalian University, Dalian 116622, China
2 Liaoning Key Laboratory of Bio-Organic Chemistry, Dalian University, Dalian 116622, China
3 College of Agronomy, Northwest A&F University, Yangling 712100, China
As core skeletons of lamellarins: 5,6-Dihydropyrrolo[2,1-a]isoquinolines are one of the important alkaloids that exhibit significant
biological activities, in this study, an efficient synthetic route was described for two novel compounds, 5,6-dihydropyrrolo[2,1-
a]isoquinolines I and II. Compound I was synthesized from isovanillin with 28.3% overall yield by a six-step reaction while II
from 2-(3,4-dimethoxyphenyl) ethanamine was with 61.6% overall yield by a three-step reaction. And the structures of these two
compounds were confirmed by means of IR spectrum, 1 H NMR, 13 C NMR, MS, HRMS, and melting point measurements.
R1 NH2 R1 NHAc R1 R1
v vi X = Br, Cl
iv
N O X N
R2 R2 R2 R2
Me MeO OMe
3a∼b 4a∼b 5a∼b
OMe
OMe MeO OMe
I, II
I II a b
R1 OBn OMe OBn OMe
Scheme 1: Reagents and conditions: (i) BnCl, K2 CO3 , EtOH, reflux, 5 h, 94%; (ii) CH3 NO2 , NH4 OAc, AcOH, reflux, 4 h, 80.5%; (iii) LiAlH4 ,
THF, reflux, 6 h, 84.9%; (iv) CH3 COCl, Et3 N, CH2 Cl2 , 0◦ C, 2 h, 4a: 81.9%, 4b: 90.7%; (v) POCl3 , CH2 Cl2 , reflux, 3 h, 5a: 80.0%, 5b: 83.6%;
(vi) 2-halogen-1-(2,4,5-trimethoxyphenyl)ethanone, CH3 CN, K2 CO3 , reflux, 20 h, I: 74.7%, II: 72.6%.
5a∼b, 2-bromo-1-(2,4,5-trimethoxy-phenyl)-ethanone and 61∼62◦ C (lit.13 m.p. 61∼62◦ C); 1 H NMR (400 MHz, CDCl3 )
anhydrous K2 CO3 in anhydrous acetonitrile was refluxed δ 9.82 (s, 1H), 7.45∼7.47 (m, 4H), 7.38 (t, 2H, J = 7.34 Hz),
for 15 h. After a series of treatment, 5,6-dihydropyrrolo[2,1- 7.32 (t, 1H, J = 7.34 Hz), 6.99 (d, 1H, J = 8.24), 5.19 (s, 2H),
a]isoquinoline I and II were obtained with 28.3% and 61.6% 3.96 (s, 3H); MS (EI, 70 ev) m/z: 242(M+ ), 92, 91, 79, 77, 65,
total yield, respectively. 63, 51.
δ 6.73∼7.44 (m, 8H), 5.12 (s, 2H), 3.85 (s, 3H), 2.85 (t, 7.10 (s, 1H), 6.73 (s, 1H), 6.69 (d, J = 1.6 Hz, 1H), 6.60 (s,
J = 6.7 Hz, 2H), 2.62 (t, J = 6.7 Hz, 2H), 2.20 (br s, 2H); 1H), 5.14 (s, 2H), 4.05 (t, J = 6.6 Hz, 2H), 3.94 (s, 3H), 3.91
MS (EI, 70 ev) m/z: 257 (M+ ), 229, 228, 167, 137, 92, 91, 65. (s, 3H), 3.91 (s, 3H), 3.88 (s, 3H), 2.95 (t, J = 6.6 Hz, 2H);
13 C NMR (500 MHz, CDCl ) δ: 29.61, 44.91, 56.96, 56.97,
3
2.2.4. N-(3-(benzyloxy)-4-methoxyphenethy)acetamide (4a). 57.14, 57.43, 72.14, 99.34, 102.13, 107.32, 112.83, 115.18,
A solution of 0.4 mL of acetyl chloride (5.6 mmol) in 117.55, 120.83, 121.02, 123.60, 123.78, 128.03, 128.03,
5 mL anhydrous CH2 Cl2 was added dropwise at 0◦ C to 128.50, 129.21, 129.21, 130.31, 137.98, 144.06, 147.25,
a solution of compound 3 (1.0 g, 3.88 mmol) and Et3 N 148.13, 149.82, 151.07; MS (LC-MS) m/z: 472 (M+1)+ , 367,
(1.7 mL, 12.26 mmol) in 20 mL anhydrous CH2 Cl2 , with 318, 273; HRMS (ESI-Q-TOF) calcd for C29 H29 NO5 [M+1]+
stirring at 0◦ C for 2 h. After the mixture was stirred, 2.5% 472.4856, found 472.4819.
aqueous HCl was added and the organic solution was washed
with brine (2×10 mL) and H2 O (2×10 mL), dried with anhy- 2.2.7. N-(3,4-dimethoxyphenethyl)acetamide (4b). A solu-
drous Na2 SO4 , evaporated to dryness, and pale-yellow solid tion of 7.6 mL of acetyl chloride (0.11 mol) in 10 mL
was obtained. Crude product was crystallized with EtOAc anhydrous CH2 Cl2 was added dropwise at 0◦ C to a solution
to afford N-(3-benzyloxy-4-methoxyphenylethyl)acetamide of compound 3b (10 mL, 0.059 mol) and Et3 N (32.8 mL,
(0.94 g, 81.9%) as white crystals. m.p. 106∼108◦ C (lit.15 m.p. 0.23 mol) in 25 mL anhydrous CH2 Cl2 , with stirring at 0◦ C
122∼123◦ C); 1 H NMR (400 MHz, CDCl3 ) δ 7.44 (d, J = for 2 h. After the mixture was stirred, 2.5% aqueous HCl was
7.2 Hz, 2H), 7.36 (t, J = 7.2 Hz, 2H), 7.30 (d, J = 7.2 Hz, added and the organic solution was washed with brine (2 ×
1H), 6.84 (d, J = 8.8 Hz, 1H), 6.74 (d, J = 6.8 Hz, 2H), 5.14 30 mL) and H2 O (2 × 20 mL), dried with anhydrous Na2 SO4 ,
(s, 2 H), 3.87 (s, 3H), 3.43 (q, J = 6.8, 12.8 Hz, 2H), 2.70 (t, evaporated to dryness, and yellow solid was obtained.
J = 6.8 Hz, 2H), 1.88 (s, 3H). Crude product was crystallized with EtOAc to afford N-
(3,4-dimethoxyphenethyl) acetamide (4b) (11.8 g, 90.7%) as
2.2.5. 6-(benzyloxy)-7-methoxy-1-methyl-3,4-dihydroiso-quin- yellow crystals. m.p. 85∼86◦ C (lit.16 m.p. 94◦ C); IR (KBr) ν:
oline (5a). A solution of 0.9 mL of POCl3 (9.8 mmol) in 6 mL 1642.54 cm−1 (–C=O), 3301.49 cm−1 (–NH–).
anhydrous CH2 Cl2 was added dropwise at 40◦ C to a solution
of compound 4a (0.4 g, 1.06 mmol) in 10 mL anhydrous
2.2.8. 6,7-dimethoxy-1-methyl-3,4-dihydroisoquinoline (5b).
CH2 Cl2 , with stirring at 40◦ C for 3 h, then was poured
A solution of 9.8 mL of POCl3 (0.1 mol) in 40 mL anhy-
into ice-water mixture, 2.5% aqueous NaOH was added to
drous CH2 Cl2 was added dropwise at 40◦ C to a solution
make pH about 12, the aqueous solution was extracted with
of compound 4b (3.0 g, 13.4 mmol) in 30 mL anhydrous
CH2 Cl2 (3 × 20 mL), and the organic solution was washed
CH2 Cl2 , with stirring at 40◦ C for 3 h, then was poured
with brine (2×10 mL) and H2 O (2×10 mL), dried with anhy-
into ice-water mixture; 2.5% aqueous NaOH was added
drous Na2 SO4 , evaporated to dryness and solid was obtained.
to make pH about 12, the aqueous solution was extracted
The crude product was purified with a silica gel column
with CH2 Cl2 (3 × 60 mL), and the organic solution was
(Petroleum : EtOAc(v/v) = 3 : 1, 200∼300 H) to afford 6-
washed with brine (2 × 50 mL) and H2 O (2 × 50 mL), dried
(benzyloxy)-7-methoxy-1-methyl-3,4-dihydroisoquinoline
with anhydrous Na2 SO4 , evaporated to dryness, and solid
(5a) (0.24 g, 80%) as brick red crystals. m.p. 95∼96◦ C; 1 H
was obtained. The crude product was purified with a sil-
NMR (500 MHz, CDCl3 ) δ 7.30∼7.44 (m, 5H), 7.01 (s, 1H),
ica gel column (Petroleum : EtOAc(v/v) = 1 : 1, 200∼300 H)
6.7 (s, 1H), 5.17 (s, 2H), 3.90 (s, 3H), 3.61 (t, J = 7.2 Hz,
to afford 6,7-dimethoxy-1-methyl-3,4-dihydroisoquinoline
2H), 2.57 (m, J = 1.3, 7.5 Hz, 2H), 2.35 (t, J = 1.3 Hz, 3H).
(5b) (2.3 g, 83.6%) as brick red crystals. m.p. 98∼99◦ C (lit.17
m.p. 85∼96◦ C)1 H NMR (500 MHz, CDCl3 ) δ 6.99 (s, 1H),
2.2.6. 8-benzyloxy-9-methoxy-2-(2,4,5-trimethoxyphenyl)-5, 6.89 (s, 1H), 3.92 (s, 3H), 3.91 (s, 3H), 3.63 (m, J = 1.4,
6-dihydropyrrolo[2,1-a]isoquinoline (I). To a solution of 7.5 Hz, 2H), 2.63 (t, J = 7.5 Hz, 2H), 2.36 (t, J = 1.4 Hz,
0.52 g compound 5a (1.85 mmol) in 15 mL anhydrous 3H).
CH3 CN was added 0.45 g 2-bromo-1-(2,4,5-trimethoxy-
phenyl)-ethanone (1.85 mmol). The reaction mixture was 2.2.9. 8,9-dimethoxy-2-(2,4,5-trimethoxyphenyl)-5,6-dihydro
stirred at 85◦ C for 10 h, then 0.38 g anhydrous K2 CO3 [2,1-a]isoquinoline (II). To a solution of 1.5 g compound 5b
(2.75 mmol) was added and continued to stir for another (7.32 mmol) in 20 mL anhydrous CH3 CN was added 1.78 g
10 h. After that the mixture was poured into 15 mL brine 2-bromo-1-(2,4,5-trimethoxy-phenyl)-ethanone (7.34 mmol).
and extracted with CH2 Cl2 (3 × 15 mL), the combined The reaction mixture was stirred at 85◦ C for 10 h, then
organic layers were dried with anhydrous Na2 SO4 , 1.52 g anhydrous K2 CO3 (11.0 mmol) was added and con-
evaporated to dry, and brown oil was obtained. The crude tinued to stir for another 10 h. After that the mixture
product was purified with a silicagelcolumn (Petroleum was poured into 30 mL brine and extracted with CH2 Cl2
: EtOAc(v/v) = 2 : 1, 200∼300 H) to afford 8-benzyl- (3 × 30 mL), the combined organic layers were dried with
9-methoxy-2-(2,4,5-trimethoxyphenyl)-5,6-dihydropyrrolo anhydrous Na2 SO4 , evaporated to dryness, and brown oil
[2,1-a]isoquinoline (I) (0.65 g, 74.7%) as offwhite sheet was obtained. The crude product was purified with a
solid. m.p. 128◦ C; IR (KBr) ν: 2993, 2934, 2830, 1614, 1568, silica gel column (Petroleum : EtOAc(v/v) = 2 : 1, 200∼300
1529, 1508, 1453,1427, 1365, 1336, 1274, 1166, 1130, 1035, H) to afford 8,9-dimethoxy-2-(2,4,5-trimethoxyphenyl)-5,6-
848, 810, 784, 738, 695 cm−1 ; 1 H NMR (500MHz, CDCl3 ) dihydro[2,1-a]isoquinoline (II) (0.65 g, 72.6%) as gray solid.
δ 7.29–7.46 (m, 5H), 7.12 (d, J = 1.6 Hz, 1H), 7.11 (s, 1H), m.p. 137∼138◦ C; IR (KBr) ν: 2993, 2934, 2836, 1608,
4 Evidence-Based Complementary and Alternative Medicine
7.465
7.356
7.306
7.254
7.128
6.732
6.699
6.695
6.602
2.971
2.955
2.939
7.106
5.141
4.066
4.033
3.947
3.916
3.914
3.883
4.05
7.117
7.128
7.106
7.465
7.447
7.374
7.356
7.306
7.288
7.254
7.131
2.15
0.98
3.12
2.1
7.5 7.4 7.3 7.2 7.1 7
f1 (ppm)
2.10
2.15
3.12
1.02
1.01
2.04
2.06
3.07
6.07
3.08
2.05
0.98
7.6 7.2 6.8 6.4 6 5.6 5.2 4.8 4.4 4 3.6 3.2
f1 (ppm)
Figure 1: 1 H NMR spectrum of the I. Inserted figure is the magnification of the part of 7.00–7.50 of chemical shift.
149.82
147.25
144.06
137.98
129.21
128.03
120.83
117.55
115.18
112.83
107.32
102.13
57.43
57.14
56.97
56.95
29.61
128.5
123.6
99.34
78.02
77.39
72.14
44.9
77.7
130.31
129.21
128.03
123.78
128.5
123.6
Figure 2: 13 C NMR spectrum of the I. Inserted figure is the magnification of the part of 120.00–135.00 of chemical shift.
1560, 1530, 1508, 1484, 1397, 1272, 1212, 1126, 1036, 808, 44.28), five –CH3 (56.07, 56.14, 56.29,56.48,56.76), six –CH
776 cm−1 ; 1 H NMR (500 MHz, CDCl3 ) δ: 3.01 (t, J = (98.62, 101.34, 106.05, 111.47, 112.15, 120.11); MS (LC-MS)
6.6 Hz, 2H), 3.87 (s, 3H), 3.88 (s, 3H), 3.91 (s, 3H), 3.92 (s, m/z: 396 (M+1)+ , 371, 276; HRMS (ESI-Q-TOF) calcd for
3H), 3.95 (s, 3H), 4.07 (t, J = 6.6 Hz, 2H), 6.60 (s, 1H), C23 H25 NO5 [M+1]+ 396.4852, found 396.4884.
6.69 (d, J = 1.7 Hz, 1H), 6.70 (s, 1H), 7.08 (s, 1H), 7.12
(s, 1H), 7.13 (d, J = 1.7 Hz, 1H); 13 C NMR (500 MHz,
CDCl3 ) δ: 29.07, 44.28, 56.08, 56.15, 56.30, 56.49, 56.78, 3. Results
98.68, 106.08, 101.36, 111.51, 112.19, 116.90, 120.12, 120.36,
122.43, 122.93, 129.70, 143.40, 147.38, 147.47, 148.38, The target compounds I and II had been synthesized by our
150.42; DEPT 135 (500 MHz, CDCl3 ) δ: two –CH2 (29.06, route and their structures were determined by interpretation
Evidence-Based Complementary and Alternative Medicine 5
6.703
6.693
6.604
4.077
4.063
3.945
3.916
3.913
3.885
7.136
7.133
7.083
3.028
3.015
3.002
6.69
4.09
7.12
7.083
7.136
7.133
7.12
1.03
1
1
7.2 7.15 7.1 7.05 7
f1 (ppm)
1.03
2.04
3.02
6.01
6.07
1.05
1.06
1.01
2.04
1
1
Figure 3: 1H NMR spectrum of the II. Inserted figure is the magnification of the part of 7.00–7.20 of chemical shift.
129.697
122.928
120.363
120.116
116.899
112.193
111.505
106.083
101.357
148.377
147.381
143.402
98.674
56.778
56.488
56.301
56.079
44.285
29.064
77.301
77.047
76.793
56.15
129.697
122.928
122.433
120.363
120.116
116.899
112.193
111.505
Figure 4: 13 C NMR spectrum of the II. Inserted figure is the magnification of the part of 110.00–130.00 of chemical shift.
of spectral data. The 1 H NMR and 13 C NMR spectra of them groups of signals in the aromatic region; they are 7.12 (d,
were assigned as indicated in Figures 1, 2, 3, and 4. J = 1.6 Hz, 1H), 7.11 (s, 1H), 7.10 (s, 1H), 6.73 (s, 1H), 6.69
An initial 1 H-NMR spectrum of I (in CDCl3 ) revealed (d, J = 1.6 Hz, 1H), and 6.60 (s, 1H), respectively. Among
four –OMe–H signals at 3.94 (s, 3H), 3.91 (s, 3H), 3.91 (s, them, 7.12 (d, J = 1.6 Hz, 1H) and 6.69 (d, J = 1.6 Hz, 1H)
3H), 3.88 (s, 3H). These peaks are the featured signals of the – are the signals in the pyrrole ring; this can be estimated from
OMe–. 2.95 and 4.05 doublets (J = 6.6 Hz) indicate –CH2 N– the peak type. Since Ar–H in the Ar–CH2 O are influenced by
and –CH2 – moieties connected with it in the isoquinoline other protons more slightly, they will overlap together and
ring. It can be seen that the distinguishing feature of Ar– show the multiplet in the spectra. So 7.29–7.46 (m, 5H) is
CH2 O 5.14 (s, 2H) is shown in Figure 1. There are several the signal of Ar–H in the Ar–CH2 O. A molecular formula
6 Evidence-Based Complementary and Alternative Medicine
of C29 H29 NO5 , resulted from HR-MS data of I. The 13 C (2009J22DW038). The authors thank Professor Yecheng You
NMR spectrum of I displayed twenty-seven signals, which Dalian University and Professor John Joule University of
represented all twenty-nine C-atoms, eighteen of which were Manchester (UK) for helpful suggestion on this paper.
assignable to three aromatic-C moieties and accounted for
sixteen spectral signals. Of the remaining eleven signals, four References
were from OMe (56.96, 56.97, 57.14, 57.43 ppm), and seven
were from isoquinoline and pyrrole ring C-atoms. [1] R. J. Andersen, D. John Faulkner, H. Cun-heng, G. D. Van
NMR data of II (see Figures 3 and 4) indicated a Duyne, and J. Clardy, “Metabolites of the marine prosobranch
C23 H25 framework, which HR-MS analysis expanded to a mollusc Lamellaria sp,” Journal of the American Chemical
molecular formula of C23 H25 NO5 . The simplest assumed Society, vol. 107, no. 19, pp. 5492–5495, 1985.
relationship between the two isoquinoline, I as an BnO- [2] S. M. Reddy, M. Srinivasulu, N. Satyanarayana, A. K. Kondapi,
substituted II, was reinforced by characterization of the NMR and Y. Venkateswarlu, “New potent cytotoxic lamellarin
data, which exhibited many similar signals. Specifically, too alkaloids from Indian ascidian Didemnum obscurum,” Tetra-
hedron, vol. 61, no. 39, pp. 9242–9247, 2005.
many shifts of H and C resonances are very similar to
[3] F. Ishibashi, S. Tanabe, T. Oda, and M. Iwao, “Synthesis and
each other which proved the basic framework between I structure-activity relationship study of lamellarin derivatives,”
and II. The NMR signals which distinguished I from II Journal of Natural Products, vol. 65, no. 4, pp. 500–504, 2002.
were those of three aromatic protons appropriate for Ar–H [4] J. Kluza, M. A. Gallego, A. Loyens et al., “Cancer cell
(7.29–7.46 ppm, m, 5H) and –CH2 – in the Ar–CH2 O. The mitochondria are direct proapoptotic targets for the marine
remaining distinguishing feature was the number of –OMe– antitumor drug lamellarin D,” Cancer Research, vol. 66, no. 6,
signal in 13 C NMR at 56-57 ppm. pp. 3177–3187, 2006.
[5] M. Facompré, C. Tardy, C. Bal-Mahieu et al., “Lamellarin D:
a novel potent inhibitor of topoisomerase I,” Cancer Research,
4. Discussions vol. 63, no. 21, pp. 7392–7399, 2003.
[6] N. Dias, H. Vezin, and A. Lansiaux, “DNA binders and related
I and II from 1-methyl-3,4-dihydroisoquinoline and 2,4,5- subjects,” Topics in Current Chemistry, vol. 253, pp. 89–109,
trimethoxy-α-halogen-acetophenone were obtained with 2005.
high yields under mild conditions for the first time. This [7] M. Vanhuyse, J. Kluza, C. Tardy et al., “Lamellarin D: a
novel method, as the key reaction step, provides a gen- novel pro-apoptotic agent from marine origin insensitive to
eral and highly efficient method for the preparation of P-glycoprotein-mediated drug efflux,” Cancer Letters, vol. 221,
5,6-dihydropyrrolo[2,1-a]isoquinolines. We envisaged that no. 2, pp. 165–175, 2005.
the 5,6-dihydropyrrolo[2,1-a]isoquinolines could be con- [8] P. Ploypradith, T. Petchmanee, P. Sahakitpichan, N. D.
structed by the formation of quaternary ammonium salt, Litvinas, and S. Ruchirawat, “Total synthesis of natural and
and subsequent lactonization in the presence of anhy- unnatural lamellarins with saturated and unsaturated D-
rings,” Journal of Organic Chemistry, vol. 71, no. 25, pp. 9440–
drous K2 CO3 . The negative carbon ion of 1-methyl-3,4-
9448, 2006.
dihydroisoquinoline is also active in the Knorr reaction. [9] M. Nyerges and L. Tőke, “1,5-Electrocyclisation of azomethine
Both 2,4,5-trimethoxy-α-bromoacetophenone and 2,4,5- ylides leading to pyrrolo[2,1-a] isoquinolines - Concise con-
trimethoxy-α-chloracetophenone were employed. We found struction of the lamellarin skeleton,” Tetrahedron Letters, vol.
that the yield of the former is about 5% higher than the later. 46, no. 44, pp. 7531–7534, 2005.
Therefore, 2,4,5-trimethoxy-α-bromoacetophenone is used [10] A. Bermejo, I. Andreu, F. Suvire et al., “Syntheses and antitu-
in the synthesis of I and II. mor targeting G1 phase of the cell cycle of benzoyldihydroiso-
quinolines and related 1-substituted isoquinolines,” Journal of
Medicinal Chemistry, vol. 45, no. 23, pp. 5058–5068, 2002.
5. Conclusion [11] N. Cabedo, P. Protais, B. K. Cassels, and D. Cortes, “Synthesis
and dopamine receptor selectivity of the benzyltetrahydroiso-
Based on the facile synthetic route depicted in Scheme 1, quinoline, (R)-(+)-nor-roefractine,” Journal of Natural Prod-
two novel scaffolds for synthesis of lamellarin analogues ucts, vol. 61, no. 6, pp. 709–712, 1998.
8-benzyloxy-9-methoxy-2-(2,4,5-trimethoxyphenyl)-5,6- [12] S. Batra, Y. A. Sabnis, P. J. Rosenthal, and M. A. Avery,
dihydropyrrolo[2,1-a] isoquinoline (I) and 8,9-dimethoxy- “Structure-based approach to falcipain-2 inhibitors: synthe-
2-(2,4,5-trimethoxyphenyl)-5,6-dihydro[2,1-a]isoquinoline sis and biological evaluation of 1,6,7-Trisubstituted dihy-
(II) were obtained under mild condition. These two droisoquinolines and isoquinolines,” Bioorganic and Medicinal
compounds are characterized by 1 H NMR, 13 C NMR, IR Chemistry, vol. 11, no. 10, pp. 2293–2299, 2003.
spectrum, and melting points. The products are stable and
may be expected to exhibit biological activities to some
extend.
Acknowledgments
This work was supported by the National Natural Science
Foundation of China (no. 20372013) The outstanding young
talent fund from the Dalian science and technology bureau
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 730356, 9 pages
doi:10.1155/2011/730356
Research Article
Expression of Pigment Cell-Specific Genes in the Ontogenesis of
the Sea Urchin Strongylocentrotus intermedius
One of the polyketide compounds, the naphthoquinone pigment echinochrome, is synthesized in sea urchin pigment cells.
We analyzed polyketide synthase (pks) and sulfotransferase (sult) gene expression in embryos and larvae of the sea urchin
Strongylocentrotus intermedius from various stages of development and in specific tissues of the adults. We observed the highest
level of expression of the pks and sult genes at the gastrula stage. In unfertilized eggs, only trace amounts of the pks and sult
transcripts were detected, whereas no transcripts of these genes were observed in spermatozoids. The addition of shikimic acid, a
precursor of naphthoquinone pigments, to zygotes and embryos increased the expression of the pks and sult genes. Our findings,
including the development of specific conditions to promote pigment cell differentiation of embryonic sea urchin cells in culture,
represent a definitive study on the molecular signaling pathways that are involved in the biosynthesis of pigments during sea urchin
development.
OH O
8 1
C 2 H5 7 2 OH
6 3
HO OH
5 4
OH O
Echinochrome
(2,3,5,6,8-pentahydroxy-7-ethylnaphthoquinone)
(a)
COOH
Shikimic acid C O
COOH CH2
HO CH2 COOH
HO OH
OH OH O
p-hydroxyphenylpyruvic
acid
OH OH OH
CH3
OH OH OH
Homoarbutin Homogentisic
acid
OH
O
H3 C CH3
H3 C CH3
Ox
OH O Chimaphilin
(b)
Figure 1: The structure of the naphthoquinone pigment echinochrome (a). One of the quinone biosynthesis pathways (the formation of
chimaphilin from a shikimic acid through the mevalonic acid biosynthetic pathway) in accordance with [9] (b).
Pigment cells are the first type of secondary mesenchymal cytoplasmic granules store carotenoids and naphthoquinone
cells (SMCs) to be specified at the mesenchyme blastula compounds [2, 12, 13], which have been suggested to
stage in sea urchins [11]. These cells accumulate red-brown function in body coloring and phototropism which aid in the
pigment granules in their cytoplasm [12] and become defense of larval ectoderm [14, 15]. Pigment cell precursors
easily detectable from the late gastrula stage onwards. The are released from the vegetal plate during the initial phase
Evidence-Based Complementary and Alternative Medicine 3
0.8 the probe 5 AAC TAC GGT GTC GAC TCC CTC ATG GC
were used for the expression analysis of the pks gene. The
0.6
∗ ∗ primers 5 AGA AGC GGC GAA ACA GAA, 5 CCA GAG
∗
∗ CCA TTG GTT TTT C, and the probe 5 TGG CGA CTG
0.4 GAA AAA TCA TTT TAC CGT AGC CCA GA were used for
the expression analysis of the sult gene. For the actin gene,
0.2 the primers 5 TGT TGC CCC AGA GGA GCA, 5 ATC TTT
TCC CTG TTG GCC TT, and the probe 5 TCC TCC TTA
0 CCG AGG CTC CCC TCA A were used.
C 1 2
(a) 2.3. Experiments with Shikimic Acid (ShA). Sterile solutions
0.6 of ShA in seawater at the desired concentrations (0.1, 0.5, and
∗ 2 mM) were added to sea urchin zygotes (after 20 min pf)
Expression of SiSult (r.u.)
Zy Bl Gl
Pr Pl
(d) (e)
Figure 4: Normal embryo development of the sea urchin S. intermedius: zygotes (20 min pf, Zy); blastula stage (14 hpf, Bl); gastrula stage
(24 hpf, Gl); (d) prism stage (34 hpf, Pr); (e) pluteus (8 dpf, Pl). Nomarski’s optics. Bar, 50 μm.
protein content in the supernatants was determined as level of the expression increased drastically through the start
described previously [23] and averaged 450–475 μg/mL. The of gastrulation (approximately 24 hours) (Figure 2(b)). After
cell cultures were maintained by changing the old medium that, the level of transcript decreased by more than 10 and
with new medium at 3–5-day intervals for 20 days at 17◦ C. 20 times at the prism and pluteus stages, respectively. In
addition, sult gene expression was detected in coelomocytes
2.5. Statistical Analysis. Statistical analysis was carried out and ambulacra, where the level of the sult gene expression
using the Statistica 8.0 program. The results are represented was lower than that at the gastrula stage by 22.7- and 35.5-
as the mean ± standard error and were tested by paired fold, respectively.
Student’s t-test. P < .05 was selected as the point of minimal
statistical significance in all analyses. 3.2. Experiments with a Precursor of Naphthoquinone Pig-
ments: Shikimic Acid (ShA). Sipks and Sisult expression in
embryo development was significantly increased after the
3. Results incubation of sea urchin embryos with 0.1 mM–0.5 mM
ShA (Figure 3), but not 2.0 mM ShA, which blocked the
3.1. Sipks and Sisult Expression Profiles in Sea Urchin Embryo expression of the pigment genes (data not shown). No
Development and in Specific Adult Tissues. In unfertilized apparent effect on normal development (Figure 4) was
eggs, only trace amounts of the pks and sult transcripts detected after the addition of ShA (0.1 mM and 0.5 mM) to
were detected, whereas no transcripts of these genes were sea urchin zygotes, which developed into morphologically
observed in spermatozoids (Figure 2). We observed the almost normal plutei (Figures 5(a)((1), (2))). In contrast,
highest level of expression of the pks gene at the gastrula the addition of ShA (0.1 mM and 0.5 mM) to the blastula
stage (Figure 2(a)), which exceeded the expression level of and gastrula embryos resulted in a marked slowdown of
this gene at the blastula, prism, and pluteus stages, and in development (Figures 5(b) and 5(c)). In these cases, after
coelomocytes, and ambulacra by 4.6-, 4.3-, 4.5-, 4.5-, and 8 days of cultivation with ShA, the development of the sea
1.9-fold, respectively. The gene expression profile for Sisult urchin larvae was retarded in the prism stage, while the
had a similar trend to that of Sipks. The onset of transcription control embryos reached the pluteus stage. The addition of
for the sult gene began at the blastula stage, and then the 2.0 mM ShA to the zygotes, blastula, and gastrula embryos
6 Evidence-Based Complementary and Alternative Medicine
Figure 5: Effect of shikimic acid (ShA) on the larval morphology of the sea urchin S. intermedius. Disturbances in embryo development
after 8 days of incubation with ShA. ShA was added to (a) zygotes; (b) embryos of the blastula stage; (c) embryos of the gastrula stage. ShA
concentrations tested: 1–0.1 mM, 2–0.5 mM, and 3–2.0 mM. Nomarski’s optics. Bar, 50 μm.
led to significant disturbances in normal development which days after a blastula-derived cell culture was initiated, two
was clearly delayed or arrested (Figures 5(a)(3), 5(b)(3), and types of substrate-attached cells developed: epithelial and
5(c)(3)). After the incubation with 2.0 mM ShA, the embryos mesenchymal cells, which formed dense multilayer cell sheets
from the blastula and gastrula stages remained spherical in (Figure 6(a)). The appearance of pigment cells among the
shape for up to 8 days of development. mesenchymal elements indicated that they are derived from
the secondary mesenchyme. The transfer of these cells to
3.3. Differentiation of Pigment Cells in Cell Culture. Different new dishes with fibronectin-coated coverslips resulted in
conditions of cell cultivation may determine the cytodif- intensive pigment differentiation during the following two
ferentiation patterns of sea urchin embryonic cells. Two days. It should be noted that the morphological appearance
Evidence-Based Complementary and Alternative Medicine 7
Figure 6: Embryonic pigment cells in a blastula-derived cell culture of the sea urchin S. intermedius. (a) Multilayer cell sheets (2-3 days of
cultivation in seawater supplemented with 2% fetal bovine serum); (b) spread pigment cells cultivated in the coelomic fluid of control sea
urchins for 3 days; (c) rounded pigment cells cultivated in the coelomic fluid of injured sea urchins for 3 days. Bar, 10 μm.
of pigment cells was dependent on the cell culture medium. resulted in a marked slowdown of normal development or in
If the coelomic fluid of control sea urchins was used as the larval growth inhibition, respectively.
medium, all the pigment cells were well attached and spread As shown by Kominami [25], pigment cells differentiate
(Figure 6(b)). However, if the coelomic fluid of injured sea in embryos treated with aphidicolin, a specific inhibitor of
urchins was used as the culture medium, all the pigment cells DNA polymerase alpha although gastrulation and successive
were rounded and unspread (Figure 6(c)). Following 20 days morphogenesis are blocked due to the absence of cell
in culture, the pigment cells maintained their morphology; divisions and DNA synthesis. The number of pigment cells
however, further cell division was not detected. Cell viability observed in aphidicolin-treated embryos increased as the
was 90–95% immediately after seeding and declined to 70– treatment was initiated at later time points (from 9, 10, 12,
75% after 20-day cultivation. 16, and 24 h of development) [25]. Pigment cells can be
induced even from animal blastomeres at the 8-cell stage or
4. Discussion mesomeres at the 16-cell stage, if the blastomeres are treated
with LiCl [26, 27]. These data indicate the possible existence
Marine organisms passed through the long path of evolution of an inductive signal for the specification of the pigment cell
and adaptation, and this is reflected in the peculiarities of lineage.
their biosynthesis and metabolism. It is known that the Using dissociated sea urchin embryos transfected with
transcription factor glial cells missing (SpGCM) is required the yeast gene gal4, we have previously shown that the
for the activation of transcription for pigment cell-specific absorption spectrum of red-brown pigments extracted from
differentiation genes; the onset of transcription of these genes the cultured cells coincides with that of echinochrome [28].
occurs a few hours after the activation of Spgcm (12 hours) The number of cells containing the red-brown pigments in
[20]. Phylogenomic studies have suggested that some animal two-month-old cell culture reached 50–60%, while the num-
genomes (sea urchins, birds, and fish) possess a previously ber of naphthoquinone pigments in these cells, as calculated
unidentified group of pks genes in addition to fas genes used per one cell [29], increased 9-10-fold [28] compared to the
in fatty acid metabolism. These pks genes in the chicken, fish, cells of normal plutei in vivo [5]. Here, we continued the
and sea urchin genomes do not appear to be closely related studies of the differentiation process of sea urchin pigment
to any other animal or fungal genes and instead are closely cells in culture and developed conditions for the promotion
related to pks genes from the slime mold Dictyostelium and of pigment cell differentiation without transfection of sea
eubacteria [24]. urchin embryos with foreign genes. Many pigmented cells
Our results agree with the data of Calestani with formed and showed spread morphology similar to pigment
colleagues that showed that the pks genes are expressed in sea cells embedded in the embryonic or larval ectoderm [16, 29].
urchin pigment cells beginning from the blastula stage and However, there is no cell division in these cultures. Today,
that this expression is maintained throughout the pluteus only cells of developmental anomalies in sea urchin embryos
stage [21]. The level of pks transcripts has been found to be transformed by the yeast gal4 gene [30], and malignant
highest at the gastrula stage and then gradually decreases. mussel hemocytes [31] have been reported to be involved in
The addition of shikimic acid (0.1 mM and 0.5 mM), a active proliferation.
precursor of naphthoquinone pigments, to zygotes and We have found the specific effect of the coelomic fluid
embryos was shown to increase the expression of the pks and of control and injured sea urchins on the morphology of
sult genes. The addition of lower concentrations of shikimic cultivated pigment cells. The origin of this phenomenon
acid to sea urchin zygotes did not influence the larval is unclear. We failed to develop a potential permanent cell
developmental stages. However, the addition of 0.5 mM and line; however, the results obtained allow us to assert that the
2.0 mM shikimic acid to the blastula and gastrula embryos culture conditions used promote pigment cell differentiation
8 Evidence-Based Complementary and Alternative Medicine
and can be useful for studying sea urchin pigment cells. The [12] R. R. Chaffee and D. Mazia, “Echinochrome synthesis in
technology of directed differentiation of marine invertebrate hybrid sea urchin embryos,” Developmental Biology, vol. 7, pp.
embryonic cells in vitro opens the pathway for solution- 502–512, 1963.
applied tasks, including the generation of cell cultures that [13] E. Ryberg and B. Lundgren, “Some aspects on pigment cell
produce complex bioactive compounds with therapeutic distribution and function in the developing echinopluteus of
Psammechinus miliaris,” Development Growth and Differentia-
potential.
tion, vol. 21, no. 2, pp. 129–140, 1979.
[14] T. Matsuno and M. Tsushima, “Carotenoids in sea urchins,” in
Acknowledgments Edible sea Urchins: Biology and Ecology, J. M. Lawrence, Ed.,
Elsevier Science, Amsterdam, The Netherlands, 2001.
This study was supported in part by the Far Eastern Branch [15] L. C. Smith, J. P. Rast, V. Brockton et al., “The sea urchin
of Russian Academy of Sciences (Grants nos. 09-I-P22- immune system,” Invertebrate Survival Journal, vol. 3, pp. 25–
39, 2006.
04 and 09-II-SB-06-001) and Program at the Far Eastern
[16] A. W. Gibson and R. D. Burke, “The origin of pigment cells
Federal University (Grant no. 11 G34.31.0010). The authors in embryos of the sea urchin Strongylocentrotus purpuratus,”
are grateful to Dr. A. G. Shilov (Institute of Cytology and Developmental Biology, vol. 107, no. 2, pp. 414–419, 1985.
Genetics, Siberian Branch of RAS, Novosibirsk) and Dr. K. [17] T. Hibino, M. Loza-Coll, C. Messier et al., “The immune
V. Yakovlev (Zhirmunsky Institute of Marine Biology, FEB gene repertoire encoded in the purple sea urchin genome,”
RAS, Vladivostok) for their help in cultivation of sea urchin Developmental Biology, vol. 300, no. 1, pp. 349–365, 2006.
embryonic cells. We greatly appreciate their time and effort. [18] M. Asashima, “On the tyrosinehydroxylase and tyrosinase
activities in developing sea urchin embryos with special
reference to the biosynthesis of echinochrome,” Journal of the
References Faculty of Science, the University of Tokyo. Section IV, vol. 12,
pp. 279–284, 1971.
[1] D. L. Fox and B. T. Scheer, “Comparative studies of the [19] C. H. Yuh, H. Bolouri, and E. H. Davidson, “Genomic cis-
pigments some Pacific Coast echinoderms,” Biological Bulletin, regulatory logic: experimental and computational analysis of
vol. 80, pp. 441–455, 1941. a sea urchin gene,” Science, vol. 279, no. 5358, pp. 1896–1902,
[2] M. Griffiths, “A study of the synthesis of naphthaquinone 1998.
pigments by the larvae of two species of sea urchins and their [20] E. H. Davidson, The Regulatory Genome: Gene Regulatory
reciprocal hybrids,” Developmental Biology, vol. 11, no. 3, pp. Networks in Development and Evolution, Academic Press, San
433–447, 1965. Diego, Calif, USA, 2006.
[3] S. A. Fedoreyev, N. P. Mischenko, E. A. Kol’tsova et al., [21] C. Calestani, J. P. Rast, and E. H. Davidson, “Isolation of
“Drug, Histochrome, from the sea urchin,” in Abstracts of pigment cell specific genes in the sea urchin embryo by
5th International Marine Biotechnology Conference, p. 53, differential macroarray screening,” Development, vol. 130, no.
Townsville, Australia, 2000. 19, pp. 4587–4596, 2003.
[4] N. P. Mishchenko, S. A. Fedoreev, and V. L. Bagirova, [22] A. Giulietti, L. Overbergh, D. Valckx, B. Decallonne, R.
“Histochrome: a new original domestic drug,” Pharmaceutical Bouillon, and C. Mathieu, “An overview of real-time quantita-
Chemistry Journal, vol. 37, no. 1, pp. 48–52, 2003. tive PCR: applications to quantify cytokine gene expression,”
[5] E. A. Koltsova, L. V. Boguslavskaya, and O. V. Maximov, “On Methods, vol. 25, no. 4, pp. 386–401, 2001.
the functions of quinonoid pigment production in sea urchin [23] M. M. Bradford, “A rapid and sensitive method for the
embryos,” International Journal of Invertebrate Reproduction, quantitation of microgram quantities of protein utilizing the
vol. 4, pp. 17–28, 1981. principle of protein dye binding,” Analytical Biochemistry, vol.
[6] E. L. Cooper, “Drug discovery, CAM and natural products,” 72, no. 1-2, pp. 248–254, 1976.
Evidence-Based Complementary and Alternative Medicine, vol. [24] T. A. Castoe, T. Stephens, B. P. Noonan, and C. Calestani, “A
1, no. 3, pp. 215–217, 2004. novel group of type I polyketide synthases (PKS) in animals
and the complex phylogenomics of PKSs,” Gene, vol. 392, no.
[7] K. Benkendorff, C. M. McIver, and C. A. Abbott, “Bioactivity
1-2, pp. 47–58, 2007.
of the Murex homeopathic remedy and of extracts from
[25] T. Kominami, “Establishment of pigment cell lineage in
an Australian muricid mollusc against human cancer cells,”
embryos of the sea urchin, Hemicentrotus pulcherrimus,”
Evidence-Based Complementary and Alternative Medicine, vol.
Development Growth and Differentiation, vol. 42, no. 1, pp. 41–
2011, Article ID 879585, 2011.
51, 2000.
[8] M. Service and A. C. Wardlaw, “Echinochrome-A as a bacte- [26] B. T. Livingston and F. H. Wilt, “Lithium evokes expression
ricidal substance in the coelomic fluid of Echinus esculentus of vegetal-specific molecules in the animal blastomeres of
(L.),” Comparative Biochemistry and Physiology Part B, vol. 79, sea urchin embryos,” Proceedings of the National Academy of
no. 2, pp. 161–165, 1984. Sciences of the United States of America, vol. 86, no. 10, pp.
[9] K. Nishibori, “Studies on pigments of marine animals. III. 3669–3673, 1989.
Echinochrome from the Spine of sand-dollar Echinorachnius [27] B. T. Livingston and F. H. Wilt, “Range and stability of
mirabilis,” Bulletin of Society of Scientific Fishing, vol. 22, no. cell fate determination in isolated sea urchin blastomeres,”
11, pp. 708–711, 1957. Development, vol. 108, no. 3, pp. 403–410, 1990.
[10] G. Britton, The Biochemistry of Natural Pigments, Cambridge [28] N. A. Odintsova, K. V. Kiselev, V. P. Bulgakov, E. A. Koltsova,
University Press, London, UK, 1983. and K. V. Yakovlev, “Influence of the activator of transcription
[11] S. W. Ruffins and C. A. Ettensohn, “A clonal analysis of gal4 on growth and development of embryos and embryonic
secondary mesenchyme cell fates in the sea urchin embryo,” cells in primary cultures of sand dollar,” Russian Journal of
Developmental Biology, vol. 160, no. 1, pp. 285–288, 1993. Developmental Biology, vol. 34, no. 4, pp. 217–222, 2003.
Evidence-Based Complementary and Alternative Medicine 9
Research Article
Distribution and Abundance of Archaea in South China Sea
Sponge Holoxea sp. and the Presence of Ammonia-Oxidizing
Archaea in Sponge Cells
Fang Liu,1 Minqi Han,1 Fengli Zhang,1 Baohua Zhang,2 and Zhiyong Li1
1 Marine Biotechnology Laboratory, State Key Laboratory of Microbial Metabolism and School of Life Sciences and Biotechnology,
Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240, China
2 Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Changhai Road 225, Shanghai 200438, China
Correspondence should be addressed to Baohua Zhang, zhbh [email protected] and Zhiyong Li, [email protected]
Compared with bacterial symbionts, little is known about archaea in sponges especially about their spatial distribution and
abundance. Understanding the distribution and abundance of ammonia-oxidizing archaea will help greatly in elucidating the
potential function of symbionts in nitrogen cycling in sponges. In this study, gene libraries of 16S rRNA gene and ammonia
monooxygenase subunit A (amoA) genes and quantitative real-time PCR were used to study the spatial distribution and abundance
of archaea in the South China Sea sponge Holoxea sp. As a result, Holoxea sp. specific AOA, mainly group C1a (marine group I:
Crenarchaeota) were identified. The presence of ammonia-oxidizing crenarchaea was observed for the first time within sponge
cells. This study suggested a close relationship between sponge host and its archaeal symbionts as well as the archaeal potential
contribution to sponge host in the ammonia-oxidizing process of nitrification.
10 μM 10 μM
(a) (b)
Figure 1: Sponge cells isolated in this study (a) and their autofluorescence (b) (λ = 480 nm).
whether there are archaea in sponge cells. Thus, the examina- supernatant was transferred into a new tube. The resulting
tion of the spatial distribution, diversity, and abundance of pellets were rinsed three times with Ca2+ - and Mg2+ -free
archaea within sponges especially in sponge cells will greatly ASW and identified to be free of bacteria from mesohyl by
help in better understanding the role of archaea play in their autofluorescence (λ = 480 nm) (Figure 1). No bacteria-
sponge biology and ecology. like particulates were found, which proved that the obtained
In this study, gene library and quantitative real-time sponge cells were free of bacteria from mesohyl and, thus,
quantitative PCR (RT-qPCR) were used to determine the dis- were used for diversity analysis of intracellular prokaryotic
tribution, diversity, and abundance of archaea in the different symbionts of sponge. Supernatants resulted from the previ-
parts such as cells and mesohyl of South China Sea sponge ous step were further centrifuged at 15,000 ×g for 10 min.
Holoxea sp. The copy number of ammonia-oxidizing genes The resulting pellet was named sample J and used to analyze
was also studied to assess the distribution of the AOA com- extracellular archaeal endosymbionts (mesohyl).
munity in different parts of sponge Holoxea sp. It is the first Sponge tissues without treatments above, named sample
report of intracellular archaeal symbionts in marine sponges. T, were used to extract genomic DNA for the analysis of
the total communities of bacteria associated with the sponge
2. Materials and Methods Holoxea sp.
2.1. Sampling and Cell Sorting. Marine sponge Holoxea sp. 2.2. DNA Extraction, Gene Library Construction, and RT-
was collected nearby Yongxing Island (112◦ 20 E, 16◦ 50 N) qPCR. Genomic DNA was extracted from samples B, J, and
in the South China Sea at depth of ca. 20 m and processed as W and sponge specimens (sample T) using the QIAGEN
described by Li and Liu [19]. Small cubes of sponge tissues genomic tip protocol. To target the diversity of archaeal
(<0.5 cm3 ) were transferred into a 100 mL conical flask and community, archaea-specific 16S rRNA gene primer set 21F/
washed using 40 mL sterile artificial seawater (ASW) (1.1 g 958R [21] was used for the construction of 16S rRNA gene
CaCl2 , 10.2 g MgCl.2 6H2 O, 31.6 g NaCl, 0.75 g KCl, 1.0 g libraries, named as BArc, JArc, WArc, and TArc for samples
Na2 SO4 , 2.4 g Tris-HCl, and 0.02 g NaHCO3 , 1L distilled B, J, W, T, respectively. The 16S rRNA gene was amplified
water, pH 8.2) 3 times for 40 min with shaking at 150 rpm using the Arch21F/Arch958R primers with the following
and 20◦ C. The resulting artificial seawater, which contained PCR condition: 95◦ C for 3 min; 35 cycles of 95◦ C for 30 s,
extracellular ectosymbionts, was collected, filtered using 55◦ C for 30 s, 72◦ C for 1 min; 72◦ C for 10 min. Ammonia
300-mesh stainless steel sieve, and further centrifuged at monooxygenases subunit A (amoA) gene was amplified with
15,000 ×g to gain extracellular ectosymbionts which refers to primer pair Arch-amoAF/Arch-amoAR [22] from sample T’s
microbes loosely attached to the sponge surface and canals, genomic DNA to construct an amoA gene library. The PCR
choanocyte chambers (sample W). condition: 95◦ C for 3 min; 35 cycles of 95◦ C for 30 s, 53◦ C
The resulting tissue cubes were disintegrated in Ca2+ - for 45 s, 72◦ C for 45 s; 72◦ C for 5 min.
and Mg2+ -free ASW and were separated using differential The abundance comparison of archaea amoA gene be-
centrifugation method described previously [20]. The tissue tween different samples was made using real-time quantita-
cubes washed from the previous step were dissociated in tive PCR (SYBR Premix Ex Taq II, Takara) with primer set
Ca2+ - and Mg2+ -free ASW at 110 rpm and 20◦ C for 60 min. amoA19F/amoA643R [23]. As a control, universal archaea
The resulting cell suspension was filtered using 300-mesh 16S rRNA gene primer set 340F/519R [24] was used to quan-
stainless steel sieve. Holoxea sp. has thin outer layer (1-2 mm tify the total archaea in the four samples. Specificity for real-
thick). After 60 min disassociation, outer layer remained in- time PCR reactions was tested by electrophoresis through a
tact and was removed through the filtration. Sponge cells, 1.5% agarose gel and melting curve analyses. Copy numbers
named sample B for analysis of intracellular archaea, were of amoA and 16S rRNA gene were determined using external
collected by centrifugation at 300 ×g for 10 min, and the standards. A standard curve that describes the relationship
Evidence-Based Complementary and Alternative Medicine 3
56 Theonella swinhoei archaea clones, AF186423-5 100 Luffariella variabilis clone, EU049833
BArc12(9), GU227339 96 TamoA-3(2), GU216237
54
TArc41(113), GU227337 96 TamoA-24(3), GU216241
100
WArc31(2), GU227338 96 TamoA-9(2), GU216236
Okinawa submarine archaea clone, AB301896 TamoA-14(1), GU216242
95
Geodia media archaea clone, DQ299268 100 TamoA-16(9), GU216238
JArc44(1), GU227336 TamoA-2(6), GU216235
70 Rhopaloeides odorabile archaea clone, EU049815 TamoA-8(3), GU216239
100
67 Korean sponge archaea clone, AY192628 Cliona sp. clone,EU049834
64
62 TamoA-37(1), GU216240
0.01 Aplysina insularis clone,EU049838
100 TamoA-22(7), GU216243
Figure 2: Unrooted 16S rRNA gene-based phylogenetic consensus Aplysina aerophoba clone, EF259657
tree displaying the affiliation of sponge-associated Crenarchaeota
100 Rhopaloeides odorabile clone, EU049829
within group C1a (marine group I: Crenarchaeota). Bootstrap val-
ues under 50% were cut off after 100 resamplings. Bar: 1 nucleotide
substitutions per 100 nucleotides. Numbers in parenthesis stand for 0.01
the number of clones found in individual library.
Figure 3: Unrooted amoA-based phylogenetic consensus tree of
AOA affiliated with the group C1a (marine group I: Crenarchaeota).
Bootstrap values under 50% were cut off after 100 resamplings.
between archaeal and bacterial amoA copy numbers and Bar: 1 nucleotide substitutions per 100 nucleotides. Numbers in
cycle threshold (CT) values was generated using serial dilu- parenthesis stand for the number of clones found in library.
tions of a known copy number of the 16S rRNA and amoA
genes of the plasmid DNA: 16S rRNA, GU227337; amoA,
GU216235. We calculated the copy numbers directly from associated archaea and (2) JArc44 located in another sponge-
the concentration of extracted plasmid DNA by spectropho- specific crenarchaeota clade.
tometry (Nanodrop Technologies, Rockland, Del, USA). Analysis of amoA gene fragments of sponge sample
Melting curve analysis was performed from 55◦ C to 95◦ C T revealed a relative high diversity of ammonia-oxidizing
with a reading made every 1◦ C and the samples held for 1 s
archaea (AOA) in sponge Holoxea sp. Richness analysis (ob-
between readings.
served phylotypes/predicted SACE = 0.8974 and observed
phylotypes/predicted SChao1 = 0.9827) indicated that the
2.3. Statistical and Phylogenetic Analysis. Operational taxo- amoA gene library was large enough to yield a stable estimate
nomic units (OTUs) were defined as sequence groups in of phylotype richness. According to the phylogenetic tree in
which sequences differed by ≤1% (2% for amoA). Nonpara- Figure 3, three branches of Holoxea sp. associated AOA com-
metric richness estimations were performed using DOTUR munity including 9 OTUs could be identified based on 2%
[25]. A representative clone of each OTU was selected for cutoff. All the amoA genes detected were affiliated with the
further phylogenetic analysis. All the OTUs and their closest marine group C1a clones [16, 27] and the diversity was no-
neighbors determined by BLAST were imported into MEGA ticeable: three branches, respectively, related to Luffariella
4 [26] for the construction of neighbor-joining trees. Se-
variabilis, Cliona sp., and Aplysina insularis were identified,
quences obtained in this study were deposited in the NCBI
which highlighted the ubiquitous distribution of AOA in
Genbank under accession numbers: GU227336-GU227339
marine sponges. Almost all the amoA genes clustered to-
(16S rRNA archaea) and GU216235-GU216243 (amoA
gether suggesting Holoxea sp. specific AOA. Comparing to
archaea).
the Figures 2 and 3, the phylogenetic affiliation was not
coherent, possibly suggesting that horizontal gene transfer
3. Results and Discussion has occurred.
3.1. Distribution and Diversity of Archaeal Symbionts in
Holoxea sp. According to this study, the archaea community 3.2. Abundance of AOA Varied in Different Parts of Sponge
in Holoxea sp. was rather simple; all the representative Holoxea sp. RT-qPCR displayed an interesting picture, as
clones in the four groups were identified as group C1a the proportion of AOA in archaea community indicated in
(marine group I: Crenarchaeota) and their closest relatives Table 1, the proportion of AOA in intracellular archaeal com-
were sponge-derived sequences. Only four OTUs were ob- munity (sample J and sample B) was greater than that in ex-
served and the biggest one (TArc41) contained 113 clones, tracellular archaeal community (sample W); especially the
including the sequences from all samples. Based on this proportion of intracellular AOA (sample B, 11.67%) was
study, the spatiospecificity for archaea in Holoxea sp. was nearly 3-fold that of AOA in sponge mesohyl (sample J,
not significant. JArc44 represented the only one singleton 4.24%), which strongly suggested the presence of AOA with-
(sequence that only occurs in one sample). In phylogenetic in sponge cells. Sponge cells would not uptake microbes
tree (Figure 2), these OTUs were divided into two groups: randomly [28]. The mechanisms of the presence and transfer
(1) nonsingleton sequences related to Theonella swinhoei of AOA in Holoxea sp. are unknown. It has been shown
4 Evidence-Based Complementary and Alternative Medicine
Table 1: Abundance of archaea and AOA in different parts of [2] N. S. Webster and L. L. Blackall, “What do we really know
sponge Holoxea sp. about sponge-microbial symbioses,” International Society for
Microbial Ecology Journal, vol. 3, no. 1, pp. 1–3, 2009.
Average [3] M. W. Taylor, R. T. Hill, J. Piel, R. W. Thacker, and U.
Sample Copy numbera
proportion of AOA Hentschel, “Soaking it up: the complex lives of marine
archaea 16S sponges and their microbial associates,” International Society
amoA (AOA)
rRNA for Microbial Ecology Journal, vol. 1, no. 3, pp. 187–190, 2007.
T 1.71 ± 0.33 × 103 3.36 ± 0.48 × 104 5.10% [4] G. Vogel, “The inner lives of sponges,” Science, vol. 320, no.
W 1.00 ± 0.24 × 103 4.35 ± 0.55 × 104 2.30% 5879, pp. 1028–1030, 2008.
[5] M. W. Taylor, R. Radax, D. Steger, and M. Wagner, “Sponge-
J 2.33 ± 0.09 × 103 5.50 ± 0.31 × 104 4.24%
associated microorganisms: evolution, ecology, and biotech-
B 1.89 ± 0.21 × 103 1.62 ± 0.29 × 104 11.67% nological potential,” Microbiology and Molecular Biology Re-
a
Average copy numbers of target gene in one nanogram total genomic DNA. views, vol. 71, no. 2, pp. 295–347, 2007.
T: whole sponge tissue sample; W: sample of microbes loosely attached to [6] C. E. Williamson, “An ultrastructural investigation of algal
the sponge surface and canals, choanocyte chambers; J: sample of microbes symbiosis in white and green Spongilla lacustris (L.) (Porifera:
in the sponge mesohyl; B: the intracellular microbes sample. Spongillidae),” Transactions of the American Microscopical
Society, vol. 98, pp. 59–77, 1979.
[7] M. J. Garson, A. E. Flowers, R. I. Webb, R. D. Charan, and E.
that the microbial community in sponges could be estab- J. McCaffrey, “A sponge/dinoflagellate association in the hap-
lished by vertical transmission [10]. Similarly, sponges may losclerid sponge Haliclona sp.: cellular origin of cytotoxic
be able to capture AOA by vertical transmission [16]. alkaloids by percoll density gradient fractionation,” Cell and
Archaea of group C1a probably play an important role in Tissue Research, vol. 293, no. 2, pp. 365–373, 1998.
the ammonia detoxification within marine sponges [1, 16]. [8] A. E. Flowers, M. J. Garson, R. I. Webb, E. J. Dumdei, and R. D.
Charan, “Cellular origin of chlorinated diketopiperazines in
It is known that ammonia oxidation catalyzed by ammonia
the dictyoceratid sponge Dysidea herbacea (Keller),” Cell and
monooxygenase is the first and rate-limiting step of che- Tissue Research, vol. 292, no. 3, pp. 597–607, 1998.
moautotrophic nitrification, the overall oxidation of ammo- [9] M. Maldonado, N. Cortadellas, M. I. Trillas, and K. Rützler,
nia to nitrate. Within the sponge body, the AOA would be “Endosymbiotic yeast maternally transmitted in a marine
directly exposed to ammonia released by sponge, so it was sponge,” Biological Bulletin, vol. 209, no. 2, pp. 94–106, 2005.
suggested that AOA in sponge cells and mesohyl should play [10] S. Schmitt, H. Angermeier, R. Schiller, N. Lindquist, and U.
a role in ammonia oxidization within the sponge host to Hentschel, “Molecular microbial diversity survey of sponge
remove the toxic ammonia. reproductive stages and mechanistic insights into vertical
It was the first time to find Holoxea sp. specific AOA, transmission of microbial symbionts,” Applied and Environ-
mental Microbiology, vol. 74, no. 24, pp. 7694–7708, 2008.
mainly group C1a (marine group I: Crenarchaeota), espe-
[11] C. M. Preston, K. Y. Wu, T. F. Molinski, and E. F. Delong, “A
cially intracellular ammonia-oxidizing archaea in sponge psychrophilic crenarchaeon inhabits a marine sponge: Cenar-
cells. Although the detailed function of the plentiful rest chaeum symbiosum gen. nov., sp. nov,” Proceedings of the Na-
archaea in sponge Holoxea sp. needs to be investigated, the tional Academy of Sciences of the United States of America, vol.
finding of AOA accumulation in sponge cells in this study 93, no. 13, pp. 6241–6246, 1996.
indicates the potential role of sponge symbiotic archaea, [12] B. Holmes and H. Blanch, “Genus-specific associations of ma-
especially the intracellular AOA in ammonia oxidization, and rine sponges with group I crenarchaeotes,” Marine Biology,
suggests a close relationship between sponge host and its vol. 150, no. 5, pp. 759–772, 2007.
archaeal symbionts. To further advance our understanding [13] N. S. Webster, J. E. M. Watts, and R. T. Hill, “Detection and
of the diversity and function of intracellular endosymbionts phylogenetic analysis of novel crenarchaeote and euryachaeote
16S ribosomal RNA gene sequences from a Great Barrier Reef
in sponges, metagenomics technology and novel culture
sponge,” Marine Biotechnology, vol. 3, no. 6, pp. 600–608,
methods will be productive approaches. 2001.
[14] H. Margot, C. Acebal, E. Toril, R. Amils, and J. L. Fernandez
Acknowledgments Puentes, “Consistent association of crenarchaeal archaea with
sponges of the genus Axinella,” Marine Biology, vol. 140, no. 4,
Financial supports from the National Natural Science Foun- pp. 739–745, 2002.
dation of China (NSFC) (41076077, 30821005) and the [15] T. Pape, F. Hoffmann, N. V. Quéric, K. Von Juterzenka, J.
High-Tech Research and Development Program of China Reitner, and W. Michaelis, “Dense populations of archaea
associated with the demosponge Tentorium semisuberites
(2011AA09070203) are greatly acknowledged.
Schmidt, 1870 from Arctic deep-waters,” Polar Biology, vol. 29,
no. 8, pp. 662–667, 2006.
References [16] D. Steger, P. Ettinger-Epstein, S. Whalan et al., “Diversity and
mode of transmission of ammonia-oxidizing archaea in ma-
[1] O. O. Lee, Y. Wang, J. Yang, F. F. Lafi, A. Al-Suwailem, and P. rine sponges,” Environmental Microbiology, vol. 10, no. 4, pp.
Y. Qian, “Pyrosequencing reveals high diverse and species- 1087–1094, 2008.
specific microbial communities in sponges from the Red Sea,” [17] S. J. Hallam, K. T. Konstantinidis, N. Putnam et al., “Genomic
International Society for Microbial Ecology Journal, vol. 5, pp. analysis of the uncultivated marine crenarchaeote Cenar-
650–664, 2010. chaeum symbiosum,” Proceedings of the National Academy of
Evidence-Based Complementary and Alternative Medicine 5
Sciences of the United States of America, vol. 103, no. 48, pp.
18296–18301, 2006.
[18] A. S. Turque, D. Batista, C. B. Silveira et al., “Environmental
shaping of sponge associated archaeal communities,” PloS
One, vol. 5, Article ID e15774, 2010.
[19] Z. Y. Li and Y. Liu, “Marine sponge Craniella austrialiensis-
associated bacterial diversity revelation based on 16S rDNA
library and biologically active Actinomycetes screening, phylo-
genetic analysis,” Letters in Applied Microbiology, vol. 43, no. 4,
pp. 410–416, 2006.
[20] S. De Rosa, S. De Caro, G. Tommonaro, K. Slantchev, K.
Stefanov, and S. Popov, “Development in a primary cell
culture of the marine sponge Ircinia muscarum and analysis
of the polar compounds,” Marine Biotechnology, vol. 3, no. 3,
pp. 281–286, 2001.
[21] E. F. DeLong, “Archaea in coastal marine environments,”
Proceedings of the National Academy of Sciences of the United
States of America, vol. 89, no. 12, pp. 5685–5689, 1992.
[22] C. A. Francis, K. J. Roberts, J. M. Beman, A. E. Santoro, and
B. B. Oakley, “Ubiquity and diversity of ammonia-oxidizing
archaea in water columns and sediments of the ocean,”
Proceedings of the National Academy of Sciences of the United
States of America, vol. 102, no. 41, pp. 14683–14688, 2005.
[23] A. Nakaya, Y. Onodera, T. Nakagawa et al., “Analysis of
ammonia monooxygenase and archaeal 16S rRNA gene frag-
ments in nitrifing acid-sulfate soil micocosms,” Microbes and
Environments, vol. 24, no. 2, pp. 168–174, 2009.
[24] L. Ovreas, L. Forney, F. L. Daae, and V. Torsvik, “Distribution
of bacterioplankton in meromictic Lake Saelenvannet, as
determined by denaturing gradient gel electrophoresis of
PCR-amplified gene fragments coding for 16S rRNA,” Applied
and Environmental Microbiology, vol. 63, no. 9, pp. 3367–3373,
1997.
[25] P. D. Schloss and J. Handelsman, “Introducing DOTUR, a
computer program for defining operational taxonomic units
and estimating species richness,” Applied and Environmental
Microbiology, vol. 71, no. 3, pp. 1501–1506, 2005.
[26] K. Tamura, J. Dudley, M. Nei, and S. Kumar, “MEGA4:
molecular evolutionary genetics analysis (MEGA) software
version 4.0,” Molecular Biology and Evolution, vol. 24, no. 8,
pp. 1596–1599, 2007.
[27] K. Bayer, S. Schmitt, and U. Hentschel, “Physiology, phylogeny
and in situ evidence for bacterial and archaeal nitrifiers
in the marine sponge Aplysina aerophoba,” Environmental
Microbiology, vol. 10, no. 11, pp. 2942–2955, 2008.
[28] M. Wehrl, M. Steinert, and U. Hentschel, “Bacterial uptake by
the marine sponge Aplysina aerophoba,” Microbial Ecology, vol.
53, no. 2, pp. 355–365, 2007.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 540987, 14 pages
doi:10.1155/2011/540987
Research Article
The Largest Bio-Silica Structure on Earth: The Giant Basal
Spicule from the Deep-Sea Glass Sponge Monorhaphis chuni
The depth of the ocean is plentifully populated with a highly diverse fauna and flora, from where the Challenger expedition
(1873–1876) treasured up a rich collection of vitreous sponges [Hexactinellida]. They have been described by Schulze and represent
the phylogenetically oldest class of siliceous sponges [phylum Porifera]; they are eye-catching because of their distinct body plan,
which relies on a filigree skeleton. It is constructed by an array of morphologically determined elements, the spicules. Later, during
the German Deep Sea Expedition “Valdivia” (1898-1899), Schulze could describe the largest siliceous hexactinellid sponge on
Earth, the up to 3 m high Monorhaphis chuni, which develops the equally largest bio-silica structures, the giant basal spicules
(3 m × 10 mm). With such spicules as a model, basic knowledge on the morphology, formation, and development of the skeletal
elements could be elaborated. Spicules are formed by a proteinaceous scaffold which mediates the formation of siliceous lamellae
in which the proteins are encased. Up to eight hundred 5 to 10 μm thick lamellae can be concentrically arranged around an axial
canal. The silica matrix is composed of almost pure silicon and oxygen, providing it with unusual optophysical properties that are
superior to those of man-made waveguides. Experiments indicated that the spicules function in vivo as a nonocular photoreception
system. In addition, the spicules have exceptional mechanical properties, combining mechanical stability with strength and stiff-
ness. Like demosponges the hexactinellids synthesize their silica enzymatically, via the enzyme silicatein. All these basic insights will
surely contribute also to a further applied utilization and exploration of bio-silica in material/medical science.
rigid framework [5]. The Hexactinellida together with the 1.1. Monorhaphis chuni. The 19th century marks the begin-
Demospongiae forms a common taxonomic unit comprising ning of the deep sea research, when it became overt how
the siliceous sponges. Their skeletons are built of silica that is densely populated this region of our planet is (Figure 1(c))
deposited in the form of amorphous opal (SiO2 ·nH2 O) and [19]: during the repair of a telegraph cable that was laid
constructs a variety of distinct structures termed spicules. across the bed of the Mediterranean, was brought up
According to molecular data from sponge genes that encode in 1860 from a depth of 2000 m, and was found to be
receptors and signal transduction molecules [6–8], the Hex- covered with mollusks, worms, and bryozoa. It then became
actinellida were established to be the phylogenetically oldest evident that the deep sea presents a cornucopia of “exotic”
class of the Porifera. Based on the discovery that the Porifera species. Already Barboza du Bocage [20] described the first
share one common ancestor, the Urmetazoa, with the Hyalonema species (Figure 2(e)). In the following years, an
other metazoans [9, 10], it was deduced that these animals armada of expeditions was sent off to explore the biotic and
represent the oldest, still extant metazoan taxon. Even more, abiotic world of the deep sea, with the Challenger Expe-
the emergence of these animals could be calculated back to ditions (1870 and 1872) as the most famous and pioneering
650–665 million years ago [Ma], a date that was confirmed ones. The major results were published in the series “Report
by fossils records [11]. Hence the Porifera must have lived of the Scientific Results of the Voyage of the H.M.S.
already prior to the Ediacaran-Cambrian boundary, 542 Ma, Challenger During the Years 1873–76”. One complete volume
and thus their elucidated genetic toolkit [8] may contribute in this series was already devoted to the Hexactinellida;
to the understanding of the Ediacaran soft-bodied biota as the material collected during this expedition was prepared
well, as sketched by Pilcher [12]. It was the evolutionary and analyzed by Schulze [21]. This author was initially and
novelty, the formation of a hard skeleton, that contributed primarily focused on the species Aspergillum, but finally also
significantly to the radiation of the animals in the late gave a first comprehensive classification of the different hex-
Proterozoic [13] and the construction of the metazoan body actinellids known at that time. In this compilation, Schulze
plan [14]. Later in evolution after the Ediacaran period [15] [21] did not primarily concentrate on the cytological, struc-
the third class of Porifera appeared, the Calcarea, which tural, and functional aspects of the spicules but on taxonomy.
comprises a calcium-carbonate skeleton. However, with this opus he laid the basis for his intriguing
The hexactinellid sponges are characterized by siliceous description of the hexactinellids, with Monorhaphis, col-
spicules that display hexactinic, triaxonic (cubic) symme- lected during the German Deep Sea Expedition “Valdivia”
tries, or morphologies derived by reduction from the basic in the years 1898-1899, in the center [22]. The Chief of the
building plans of the spicules. Their body shapes are less vari- Expedition Chun [17] gave in his first summary a photo-
able and more structured than those found in Demospon- graph of a Monorhaphis specimen collected from a depth of
giae. The Hexactinellida have been divided into two main 1644 m off the coast of East Africa (Somalia basin). This spec-
lineages, the Amphidiscophora and the Hexasterophora [16]. imen had an estimated size of 3 m and surrounded one
They are funnel to cup shaped and achieve the stability of equally long siliceous spicule (Pfahlnadeln) which became
their bodies by pinular pentactines, and rarely by hexactins, one of the most lionized collected objects of that expedition
while the fixation to the substrate is maintained by basalia (Figure 1(a)). The spicule was surrounded by stony corals
(monactines). It is the variation in the basalia that gives (Figure 1(a)). Because of their sizes and the depths from
the Amphidiscophora their distinguished morphology. The which the specimens were collected, no complete spicule
basalia can be bundled or even balled together. The most was found. Using the giant basal spicules (GBS) from this
outstanding species of this order are Monorhaphis and expedition, Schulze [22] provided a detailed description of
Hyalonema due to their sizes. The second order of hexact- their morphology and their development. His data, with
inellids is represented by the Hexasterophora that comprise their scientific accuracy, are still the reference for present day
a rigid dictyonal framework originating from simple hex- reviews.
actins. Their body plans typically feature branching and
anastomosing forms with terminal oscular plates. The best 2. Organism
known example is Euplectella aspergillum.
The siliceous Hexactinellida and Demospongiae as well Three species of Monorhaphididae have been described
as the Calcarea, comprise spicules which apparently have the Monorhaphis chuni [22], Monorhaphis dives [22], and Monor-
same basic construction plan. It remains enigmatic by which haphis intermedia [18]. These sponges (Figures 1(a) and
genetic program this complex skeleton is initiated, run and 1(b)) are distributed in the Indo-West Pacific region and
maintained. We adopt the view that the formation of the were found in depths between 516 and 1920 m [24]. Monor-
spicules, their morphology, is the primary origin of the haphis inhabits muddy substrata and is fixed there by a single
skeleton, while the spongin cement is secondary. We hope GBS. Photographs from the natural environment are only
that this paper will provide a further basis for a molecu- available from Roux et al. (Figures 2(d), 2(f), and 2(g))
lar/cell biological understanding of spicule formation in [25]. Young specimens have been imagined to comprise
Hexactinellida, taking the giant basal spicules [GBS] from a continuous body, as has been sketched by Schulze [22];
Monorhaphis as the model structural element since they one GBS anchors the specimen to the substratum and
represent the largest bio-silica structure on Earth and allow carries the cylindrical body (Figures 2(a) and 2(b)). The
exemplarily investigations on the formation of the sponge cylindrical/oval body of Monorhaphis is interspersed with
spicules on different morphological levels. many atrial openings which are located along one side
Evidence-Based Complementary and Alternative Medicine 3
Figure 1: Discovery of Monorhaphis chuni. The hexactinellid M. chuni has first been described by Schulze [17]. (a) Original GBS which was
used by Schulze for his description. (b) Glass slides prepared by Schulze for the description of the spicules. (c) Alegoric view how the scientists
at that time advertised the deep sea collection of animals in general and of M. chuni (circled in blue) in particular to the public [18].
(Figures 2(b), 2(c), and 2(g)). Through these openings, the A diagonal SEM analysis of a fractured comitalia (large
regular choanosomal skeleton consisting of 14 different types spicules existing in the body around the atrial openings)
of siliceous spicules can be observed (Figure 2(h)). The dia- shows already the lamellar organization of the silica mantel
meter of the body reaches in larger specimens 12 cm. During (Figure 4). The lamellae are arranged perfectly concentrically
growth, the specimens elongate together with the extension around the central axial cylinder (Figures 4(a) to 4(f)). If
of their GBSs (Figures 2(a) and 2(b)). the comitalia or the GBSs are broken, the central cylin-
der remains almost intact, while the peripheral lamellar
zone is fractured into concentric piles of chipped lamellae
3. Spicule Diversity (Figure 4(c)).
Like all other hexactinellids, also Monorhaphis possesses mi-
Millimeter Scale. The basic microscopic architecture of the
croscleres [<0.1 mm] (Figures 2(i) and 2(j)) as well as megas-
GBSs (up to 3 m long) is also identical with that of the large
cleres [0.2–30 mm to 3 m] (Figure 3(a)). Within the oblong,
comitalia (∼60 mm) that are found in the choanosomal
laterally compressed body (choanosomal body) which is
skeleton of the body. The spicules are, due to their composite
arranged around the single GBS, 14 further types of siliceous
texture and structure, distinguished from other bio-silica
spicules with lengths ranging from a few micrometers to
structures by an unusual mechanical stability with respect to
50 mm are found [22–24]. The likewise large comitalia
strength, flexibility, and toughness.
(around 60 mm) support the basal characteristic habitus of
this species and stabilize the tissue through which particulate
food is filtrated through the aquiferous canal system of Micrometer Scale. Recently published studies have been per-
the animal. The choanosomal body comprises mainly tri- formed by HR-SEM [23, 26]. Cross sections showed a struc-
actines (tauactines), diactines, and amphidiscs. The hexactin tural division of the spicules into three zones (Figure 5). In
spicules of the choanosome with their six nonbranched rays the center of the spicules lies the axial canal, which harbors
are arranged perpendicular to one another. the axial filament; in cross sections the axial canal has
a square appearance [27–30] which is more pronounced
towards the tips of the spicules. The axial canal is surrounded
4. GBSs by a region of electron-dense homogeneous silica constitut-
ing the axial cylinder with a diameter of 100–150 μm. The
The spicules are formed from an inorganic silica layer/mantel third and major zone of the spicules is composed of 300 to
and an organic scaffold. The silica mantel is constructed of 800 regularly and concentrically arranged lamellae (each 3
individual lamellae; these have been analyzed mainly by High to 10 μm thick). The interlamellar space of the spicules is
Resolution Scanning Electron Microscopy (HR-SEM). The surprisingly not a continuous open slit [23]. It is in average
description here proceeds from the mm to the nm scale. 0.1-0.2 μm wide and displays fusion zones and open spaces;
4 Evidence-Based Complementary and Alternative Medicine
Figure 2: M. chuni. (a) Young specimens are anchored to the muddy substratum by one single giant basal spicule (gbs). The body (bo)
surrounds the spicule as a continuous, round cylinder. (b) Schematic representation of the growth phases of the sessile animal with its GBS
(gbs) which anchors it to the substratum and holds the surrounding soft body (bo). The characteristic habitus displays linearly arranged
large atrial openings (at) of approximately 2 cm in diameter. With growth, the soft body dies off in the basal region and exposes the bare GBS
(a to c). (c) Part of the body (bo) with its atrial openings (at). The body surface is interspersed with ingestion openings allowing a continuous
water flow though canals in the interior which open into oscules that are centralized in atrial openings, the sieve-plates. (d) M. chuni in its
natural soft bottom habitat of bathyal slopes off New Caledonia (photograph taken by Michel Roux, University of Reims; reproduced with
permission). The specimens live at a depth of 800–1,000 m [23]. In this region, the sponge occurs at a population density of 1-2 individuals
per m2 . The animals reach sizes of around 1 m in length. (e) Drawing from different hexactinellids. (f and g) Living M. chuni. (h) Part of the
body with one atrium (at). (i) HR-SEM image of the lattice of a grille. The pentactines (pen) are oriented towards the exterior of the body
thus forming a mechanical and relative sealing of the atrial opening. (j) Grilles forming the atrial openings are composed of tauactines (tau),
framing of lattices, on which the pentactines (pen) are arranged in a phalanx.
apparently the fusion zones allow a continuum between two and limited dissolution of the silica using hydrofluoric
silica lamellae. acid (HF) with the limitations described [31]. A rapid
dissolution results in the removal of the inorganic scaffold,
Nanometer Scale. Insights into the structural organization while gentle exposure of cross breaks of the spicules to
of the spicules at the nm scale can be obtained by partial
Evidence-Based Complementary and Alternative Medicine 5
gbs
(a)
(b)
(d)
(e)
(c) (f)
Figure 3: Giant basal spicules (gbs) from M. chuni. (a) Largest GBS hitherto found. GBS lighted with different laser light, green and red
(b to e). The length of the spicule is 270 cm and the diameter 10 mm. (f) Illumination of a spicule with “daylight” to show the organization
of the lamellae.
HF vapor results in the dissolution of the silica material measured in the central part of the spicules, whereas the
under release of the organic component of the lamellae amount dropped considerably (≈0.4 wt%) at the surface.
[32, 33]. The opposite is true for the distribution of Na; this level was
almost negligible at the center (≈0.03 wt%) but increased
towards the surface to ≈0.4 wt%. However, recent studies
5. Chemical Composition using the Laser Ablation-Inductively Coupled Plasma-Mass
Spectrometry (LA-ICP-MS; Figure 6), allowing the simulta-
In a first approach to understand the chemical composition neous determination of 40 elements at detection limits as low
of the bio-silica within the GBS, polished thin sections as ng per g and at 120 μm spots, revealed an almost uniform
were prepared for electron-probe microanalysis (EPMA or distribution of the elements [32]. For those studies GBSs
electron microprobe). These analyses showed that besides with a diameter of approximately 7 mm were systematically
of Si and O trace amounts of Ca, Fe, and Mn are present and completely analyzed [32]. Si was chosen as an internal
in the GBS (Figure 6). The gross chemical composition of standard and an SiO2 content of 86% (wt) was accepted
sponge spicules has been described for both Demospongiae [remaining: 4.6% of protein and 9% of water]. The result
and Hexactinellida in general [see: [28]] and also for Monor- that the contribution of the trace elements to the total
haphis in particular. Already Schulze [22] determined that, inorganic components in the spicules is less than 0.005-
other than Si minerals (96%), only trace amounts of Na fold with respect to Si is of prime interest. This implies
and K contribute to the inorganic material in measurable that the quality of bio-silica in the spicules is in the range
amounts (Figure 6(c)). This composition was later con- of quartz grade with respect to the low concentrations of
firmed by Sandford [28] and Lévi et al. [34]. Based on elements other than silicon and oxygen. These trace elements
microprobe analyses, experimental evidence has been pre- are split as follows: among the monovalent counterions, Na+
sented indicating that Si is uniformly distributed throughout contributes to 86% (wt) [0.21% (wt) with respect to total
the silica shell of the spicules, whereas Na and K are not inorganic material in the bio-silica] and among the divalent
[23, 34]. Higher levels of K (around 1 wt%) have been ions, Ca2+ to 12% (wt) [0.03% (wt)]. All other 35 remaining
6 Evidence-Based Complementary and Alternative Medicine
> < cy
cy
> <
cy
100 μm 100 μm 50 μm
cy
> <
cy
cy
> <
100 μm 100 μm 100 μm
cy
> <
100 μm
Figure 4: Lamellar composition of the GBS axial cylinder; light microscopic (a, b, d, e, g-i) and SEM images (c and f). The cross sections
illuminated with red and green light; overlays from those images were computed. (g) A cross section illuminated with white light; the same
section illuminated with green (h) or red laser light (i) to highlight that the axial cylinder is a better/more effective waveguide. The solid axial
cylinder (>< cy) is marked.
elements contribute with <2% (wt) only unimportantly to follows a telescope-like pattern. In more recent studies we
the inorganic composition of the trace elements in bio-silica. could demonstrate that the proteinaceous matrix of the Mon-
The impact of this finding becomes even more meaningful orhaphis spicules (the GBSs and the comitalia) is not evenly
in comparison with the element composition of seawater. distributed throughout the inorganic shell around the axial
Referring to natural seawater, Na and Cl are dominant there canal. In fact, two morphological/structural zones can be
with 32.4% and 58.5% [solid material], respectively. Mg distinguished: the axial cylinder and the lamellar zone. After
contributes 3.9%, Ca 1.2%, and Si only 0.006%. having described the morphology of the GBSs of Monor-
haphis, applying modern electron microscopic techniques
6. Mechanical Properties [23], we demonstrated that the layers setting up the lamellar
zone contain one major protein (size: ∼27 kDa). Based on
From studies with Monorhaphis, Lévi and coworkers [34] its binding to labeled E-64, this ∼27-kDa molecule could be
suggested that the layered structure of the spicules has characterized as a protease, a (silicatein-related) polypeptide.
a “beneficial” effect on the mechanical properties of the Considering the morphological construction and the
spicules. Inspired by these findings, the concept of natural composite nature of the GBSs from Monorhaphis, we studied
composite material in rigid biological systems was born and by load-displacement experiments if these properties provide
fundamentally outlined by Mayer [35]. The organic phase them with an exceptional mechanical stability [33, 37]. The
controls energy dissipation especially in systems that are pattern of fractures within the spicules was correlated with
interspersed by very thin organic layers. In continuation the organization of the lamellar zone and the axial cylin-
of this topic, Mayer et al. [36] proposed from their load- der, since both areas are characterized by different bioor-
displacement studies that in Euplectella breakage of spicules ganic/inorganic hybrid compositions [23]. The consecutively
Evidence-Based Complementary and Alternative Medicine 7
Figure 5: Tauactin spicules with open tips. (A-1–A-3) All spicules in Hexactinellida display a square opening of the axial canal (ac); SEM
analysis. The quadrangular axial filament (af) is connected with the outer surface of the spicules and permits longitudinal growth; it also
determines the direction of spicule formation. Whereas in most spicules, the opening does not contain any material (A-2, A-3), the axial
canal of some spicules contains an axial filament (af; A-1). (B-1–B-5) Scheme of the longitudinal growth of the spicules. (B-1) In the initial
stage, the spicule with its silica layers (dark green) has within its axial canal the axial filament (red), which reaches almost to the tip of the
spicule. (B-2–B-4) During the growth of the spicule, silicatein-like material mediates the deposition of the polymeric silica (green dots and
patches), which is deposited as a new layer on top of the previous silica layer (light green). (B-4-B-5). With progress of the axial growth of
the spicules, the organic material becomes internalized into the spicule and contributes to the elongation of the axial filament. (C) Proposed
formation of spicules in the hexactinellid M. chuni by appositional lamellar growth. The center of the spicule comprises an axial canal filled
with an axial filament (af, red); the protein composition includes also the silicatein(-related) protein. Around the axial filament, the first
lamella has been formed (1). The formation of the next silica lamella is thought to be mediated by silicatein(-related) proteins (red ellipsoid
dots) arranged on both the surface of the first lamella and on a proteinaceous tube/cage stabilized in its outer layer by lectin molecules
(yellow dots). The final orientation of the tube is provided by the collagen mat. Within the cage, a solid silica lamella is formed through
an association of the silica clusters (left to right). During this growth process of the spicules, a thickening of the spicules takes place by the
formation of new silica lamellae (2-3). The organic material of the cage undergoes proteolytic disintegration, as indicated in layer 2. The
concentric arrangement of the silicatein(-related) proteins/lectin associates is proposed to be stabilized by collagen (gray fibers).
8 Evidence-Based Complementary and Alternative Medicine
Figure 6: LA-ICP-MS and spectral light analyses. (a) Element concentrations (μg/g) within the Monorhaphis spicule “Q-B”; the elements are
arranged according to their abundance. Note the logarithmic scale of the abscissa. (b) Pie diagram, showing the abundance of SiO2 , protein,
and water, in comparison to the low portion of trace elements (sector part), including Na- and Ca-oxides, and further trace components.
(c) A comparative diagram showing the distribution of these elements in seawater; there, Si exists as a trace element, as seen in the sector
piece, whereas Cl, Na, Mg, and Ca are abundant. (d) Refraction of polarized light by spicules from the hexactinellid M. chuni [18]. Spectral
light pattern of a cross-sectioned GBS (above) and a stauractine spicule (below) after illumination with two crossed nicol prisms. (e) Electron
microprobe analysis of a GBS. The maps for the elements K, Ca, Fe, and Mn are shown.
recordable elastic responses of the spicules which are caused separated from each other by 50 and 100 nm wide gaps (Fig-
by cracks of distinct lamellar piles could be resolved. By this ures 8(a) to 8(e)). Closer inspection by NanoSIMS revealed
property, the spicules acquire an unusually high stability. that those lamellae are composed of substructures that are
We attribute this property, the combination of mechanical not delimited by gaps but are closely packed; these were
stability with strength and stiffness, to the existence of or- termed sublamellae. Hence, every lamella is formed of three
ganic molecules, especially to the ∼27-kDa protein existing to six stacked solid sublamellae, each measuring 3–6 μm
within the inorganic rigid bio-silica material. The inner (Figures 8(f) to 8(h)).
organic axial barrel stabilizing the axial cylinder is composed The distribution of C, O, S, and Si has been investigated
of rope-like filaments and provides the spicules with more on a 7 × 7 μm2 area, spanning a total of three sublamellae
mechanical flexibility and less rigidity. It must be stressed with one complete sublamella in the middle (Figure 7(C-a)).
that in our studies we could not obtain conclusive results The NanoSIMS 50 ion microprobe, operating in the multi-
for the existence of any organic layer between the individual collection detector mode, allowed a simultaneous imaging
lamellae of the spicules. Therefore, we do not attribute the of C− , O− , Si− , and S− . C, S, and O were normalized
assumed viscoelastic and/or energy dissipation properties to to Si in order to minimize crater effects, which occur
a possible organic interphase between the lamellae but to the towards the edge of the image (Figure 7(C)). Normalization
proteins within them. of the signals to silicon (28 Si) revealed that the peak signals
obtained followed distinct lines which correspond to the
borders of the sublamellae (Figure 7(C-c) and 7(C-d)). The
7. Nanosecondary Ion Mass Spectrometry borders of the sublamellae are especially highlighted in
the scan obtained from the 16 O− /28 Si− mapping. The ratio
Nanosecondary ion mass spectrometry (NanoSIMS) has of C and Si (Figure 7(C-b)) and the ratios of these two
been performed to obtain a further insight into the silica elements [12 C− /28 Si− ] indicate a further substructure within
material [38]. The selected GBS used for NanoSIMS com- the sublamella, [5 μm thick] the 1.6–1.8 μm subsublamellae,
prised 243 concentrically arranged lamellae (Figure 7(a)) which we term here cylindrical slats. It is obvious that
with an axial cylinder of 250 μm. The lamellae nearest to the this particular sublamella, from which the mappings were
axial cylinder are thicker (10–30 μm) than those which exist derived, is composed of three slats (Figure 7(C-c)). The ratio
more distantly, towards the surface of the spicules (2–10 μm; 12 C/28 Si indicates that the C concentrations within the slats
Figure 8). The larger lamellae (10–30 μm), surrounding the differ from each other (Figure 7(C-b)). It is interesting to
axial cylinder, were analyzed by HR-SEM and found to be note that the highest 12 C/28 Si values were not found at
Evidence-Based Complementary and Alternative Medicine 9
Figure 7: NanoSIMS images taken from a sublamella of the GBS. (A) Polished cross section through a GBS showing the three morphological
regions within a spicule, the central axial canal (ac), the surrounding axial cylinder (cy), and the lamellar region (la). Light microscopic image.
(B) Schematic illustration of the cross section through the GBS outlining the growth of the spicules with emphasis on the outlining the axial
cylinder (cy) of which lamellae have been “biosintered”. The measurements have been performed in the boxed area. The axial cylinder
surrounds the axial filament (af). (C) NanoSIMS analyses. (C-a) Image taken simultaneously with the NanoSIMS by secondary electrons;
the sublamella is marked (sla) and has a thickness of 5 μm. (C-b to C-e) NanoSIMS mapping to determine the distributions of 12 C, 28 Si, 18 O,
and 32 S. (C-b) The pseudocolor image reflects the changes of the 12 C/28 Si-ratio along the indicated line field. Below: the 12 C concentrations
are calculated based on the 12 C/28 Si-ratio and applying the relative sensitivity factors. (C-c) 16 O/28 Si-ratio shows the homogeneity of the
“biological glass” within the lamellae. The absolute ratio is caused by the difference of the ionization probability of silicon and oxygen in this
matrix. Mapping of (C-d) silicon; the total counts of 28 Si are given, and of (C-e) sulfur and silicon; the 32 S/28 Si ratios are computed. Either
(absolute) concentrations or the ratio of concentrations are given as pseudocolor images. Different colors correspond to different intensities
of signal or ratio, increasing from black to red. Below the color images the corresponding line-scan data are given. In (C-a), (C-b), and (C-c),
the hierarchical composition of one 5 μm sublamella (sla; double-headed arrow; bordered by red arrows) from three slats (s; framed by green
arrows), displaying widths of about 1.5 to 1.8 mm each, is indicated. (D) and (E) Light and SEM microscopical images showing the location
of the axial cylinder (cy).
the borders of the sublamella but between two slats. The (Figure 7(C-e)). Based on these mapping data, we can
determination of the relative level of Si, given in counts/pixel, conclude that the lamellae are hierarchically built from three
revealed the highest level within the sublamellae and showed to five sublamellae which are composed of three slats each.
a distinct decrease at their “borders” (Figure 7(C-d)). Finally, This new insight into the highly ordered distribution of
the 32 S− /28 Si− ratios were determined along the same lines protein within lamellae and lamellar substructures confirms
10 Evidence-Based Complementary and Alternative Medicine
la
-g
la
-g
sla
la
sla
la
10 μm 10 μm 10 μm 10 μm
sla
la sla
-g
sla ri
la
10 μm 1 μm 1 μm 100 nm
Figure 8: Presence of the three sublamellae within the lamella where the NanoSIMS analysis has been performed. (a) to (e) The 18 μm thick
lamella (la) shows a substructuring into three sublamellae (sla). In contrast to the lamellae, the sublamellae are not delimited by visible gaps
(g). At higher magnifications, the spacing of the gap (g), separating individual lamellae (la), and the absence of any gap/slit between the
sublamellae (sla) is more distinct. (e) The location of the area ([quadratic area]) within a lamella that had been analyzed by NanoSIMS is
shown. (f) to (h) View of a GBS cross-fracture, obtained by mechanical breaking, showing a ribbed surface. Magnification at the submicron
level reveals that the surface of the fracture is a rib-like corrugated sheet (ri) without gap.
earlier findings, revealing that the silica nanospheres built wider diameter to a white light source with a spectrum rang-
from 2.8 nm small colloids and reaching sizes of 50–200 nm ing from 400 nm to >1600 nm (Figures 3(b) to 3(f)). Even
in diameter are arranged within the GBS in a highly ordered, with the naked eye, the optical waveguide properties of the
concentric manner. GBS could be recorded. During the passage of the light,
a distinct white-to-red color gradient along the spicules of
8. Optophysical Properties glass sponges was seen, suggesting a (partial) scattering of
the light (Figure 3(c)). In a closer view, it became obvious
Sponges can react fast to physical stimulation from the envi- that the guided light in the paraxial region of the spicule
ronment with contraction or expansion. Morphological and has a bright yellow color in contrast to the light quality at
cellular structures for such responses are conceivable based the outer surface. The spectrum of the output of the
on the complex cell-cell- and the diverse cell-matrix-inter- light source was measured between 400 nm and >1600 nm.
action systems in sponges that have already been detected A distinct cut-off of the wavelengths below 600 nm and above
[see: [8]]. These observations could imply that the coor- 1400 nm could be measured, while the light transmission
dinate reactions are governed by a nerve system. However, between these borders was only slightly/gradually reduced.
until now no nerve fibers or synapses could be identified Hence, the spicules act as optical fibers [like a high pass filter]
in sponges. Nevertheless, our previous studies showed that cutting off the light of wavelengths below about 600 nm
the siliceous demosponges Suberites domuncula and Geodia from transmission by more than 2 orders. A similar cut-
cydonium contain and express genes coding for neuronal off of the spicule was observed in the infrared wavelength
molecules, for example, a metabotropic glutamate/GABA range above 1400 nm. Here light transmission was blocked
[γ-aminobutyric acid-] like receptor [39]. like a low pass filter. Three weaker absorption minima were
Especially suitable for optophysical studies are the longer observed on the overall profile at the centre wavelengths at
Monorhaphis GBSs, as well as the stalk spicules of Hyalonema around ∼960 nm and ∼1150 nm which were attributed to
sieboldi [40]. Using those spicules, comparable and more the existing water. Within the visible part of the spectrum
extensive studies have been published [26, 40]. The giant transmitted by the fibers, less pronounced absorption wave-
spicules (Monorhaphis) were exposed at their end with the length regions were found which matched the molecular
Evidence-Based Complementary and Alternative Medicine 11
PHR APHVA ME S L S I T E F S P S A P S P I S S S S S PDE E TDRD I VAKD I EQDV E PQGKV L LH I F NNRHL R L KDNT A L YQAMAQNPDK F Y AV Y I F DG - - - F 84
CRY CRAME - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - MT YNT LH I F TDDA L R I NDNN S L L S N L E - NT KN L Y T V F Y YGH - - I K 42
CRY SUBDO - - - - - - - - - - - - - - - - - - - - - - - - - MHCNY P L A TQT T F QGQ S I P DT T VHWF R L DA L R LHDNP A F VDAVK - TDGN F KAV F I I D PWF NA 61
CRY1 ACRO - - - - - - - - - - - - - - - - - - MS L N L K S V E DNN S AV S A E K S QGK L KAKHA I HWVR KD - L R LHDNP S L L E AVK - G S DT VR I I Y V L DT - - KV 65
[ photolyase ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
PHR APHVA D S K - - P VA P VRWQ F L I DC L E D L K EQ L NG - - F G L E L Y C F RG E T I DV L A T L VQAWKVK L L S I NMDP - DVN - F T F F NE K I VKMC T I NAVQ 165
CRY CRAME K I N - - H I P PHR V I F L L E S L KN L K E R L D E - - YG I P L Y F I D E PMF Q S L RML I S KWN I NR V T T E P - - - VV S I VGKRDQ L S L RN F L S A F GV 122
CRY SUBDO NYNNGG PQVNVWR F L L E A LHD L D S R L QKK P Y CA R L NV L YGQP TM I L P E L Y KKWNVKK I T F QA S QV S S E - - SMKHDG I I K I L S EQQNV 146
CRY1 ACRO DHA - TG I G L N LWR F L L Q S L E DVDD S L R K - - L N S R L F VVRGQP ADV F P R L F R EWK T S F L T F E E - - - D S E P F GR E KDAA I R L L AQE S GV 146
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
PHR APHVA L YNDMD S HR L L Y L P P K Y K S A I PMS K F R V L L A E A I T AKQNN L E S E AK I QD I T P P L NP EQ L S D L G - NK P R L D S P L P - S E I P K L NA L F T E 250
CRY CRAME ML R T YN S S - T L YDT VKV P VN - - - - - - - I T R S E F F R I I TQM - E P E L S L P E E L T - - - - E F L S K F S S F PDP F I NKK - - - - I P S L S E F G I T 192
CRY SUBDO QAV S Y F S H - T L YDP ANV I A L N - NGR V P L S Y K E F R R LMP LMGK P A S P I P E P - - - - - - HPMS L CMKA P P S E L V P E P E GK I P K L QD L G L S 225
CRY1 ACRO E VAVGR S H - T L YD PQ L I I KHN - S GT A P L T Y KK F L A I VR S L GNPQHP CA T L DV - - - - HL L GGC S - T P V S E DHE E K F G - V P S L K E L G L D 225
~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ photolyase]
PHR APHVA E E I A - - K L N F I F QGG E R R T EDY L NE Y R E A R L RDV S - - - GDED - - A S P I AAKAMG I S PHL R F GC I T P RHL F N F L VK T I KDANY S R I K I 330
CRY CRAME NE TMS S I DT K F R - GG E T AA I L Q L E K L I ANR C E PNN - - - - L P K - - VAQ L NQYDA - I S P A I K F GC I S VR T I YNR V S K L E P K Y - - - NE VK 268
CRY SUBDO DE F A - - L Y TN SWVGG E T E A L S R L S S F C S R R AA I PN - - E - - P - - - VHWLMS KDT - L S P Y I K F GC L S VRQ L F S Q L L Q F A S T S S KGQE L F 302
CRY1 ACRO VAK - - - L S T E I WHGG E T E A L I R L DRHL E R KAW I A S - - F E K P KV T PN S L F P S P TG L S P Y L R F GC L S P R L F YHR L S E L Y R KV - KCKDP P 306
[ FAD binding domain + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
PHR APHVA NKV L AG I MA RD F A L QV S Q L QT I P E R I I S - L NK I C L P I PWDKNNNE I V E K L TDAQTG F P F F DAA I TQ L K T E GY V I NE V S E A L A T F V TN 416
CRY CRAME NQ I YDG L RNRDY C I L VG - - GNC PN I DNQ - G S I Y T Y I L PWD - VKQDA S T R F QTGR TGY P F I DAA I AQ L KR E G F I HN S VKN I L VR T L T C 351
CRY SUBDO E L L T KN L L L R E F A F L VG - - S S S P K F DVME GN S L C I Q L PWE - S NNV F I QA F RNGQTGY PW I DA I I RQ I RQDGWAH F L A RQ S I AV F L T R 386
CRY1 ACRO I S L YGQ L LWR E F F F T VA - - ANNPN F DQMD ENP VC L Q I PWT - ANP EWL KKWEQGQTG F PW I DA I M I Q L KQE GX I HHL A RHAVGC F L T R 390
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
PHR APHVA S L LWV SWE E GQN F F S QHL I C F D L AMS TH SWL E A S G S TMV TGRQK S YQDP L L F V S KK L DPNG E Y I KR Y L P K F I N F P I E F I HK P GNA S - 502
CRY CRAME D LMW I GWHE GVRMF Y KWS L DYNAA I CA L SWMHG S K S TWL L E E I S I S Q I NP I E E AK E I DKDGDY I R K Y L P E L KDY P S E Y I HT PWL A P - 437
CRY SUBDO GY LW I SWV L GK E F F QE FM I D F E L P V S S VCWMQ S S C S G F F C TQ I E S - - YDP C L VGKQ I DTDGHY I K T Y V P E L KD F P S E Y VHQPWKC S S 471
CRY1 ACRO GD LW I SWE E GMKV F E RWL L DA EWS L NAGNWMWL S C S A F F QQ F F NC - - I C P VG F GR K L DPNGDY VR K Y L P V L KG F P AK Y I HA PWT A P - 474
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
PHR APHVA L E AQQAANCV I D I DY P K P L F E Y E CRNG I CCK - R L R V FME VVD S AAKA T K L PHV I ENC S GK F P 563
CRY CRAME L DQQ I E S E CV I GQDY P Y PNY CDV E E R VQQCR KR L Q I F YN I MP I AKKR R T L S L L KKR T R I N I NNND S V I N I R AQ L E CKA T K L S Q 520
CRY SUBDO LHT E A SWL CDR - EQY P K P I I DVCKQG E L CCK - R VQ S I MKA L ADV YGV E 517
CRY1 ACRO ENVQR AA R C I I GKDY P R P I VDHHKV S T AN L E - KMRNV F KA L L R Y K E S T VVA T S E K S DG S KDKQAK L KQQML N L E DK ENR 552
+ + + + + + + + + + + + + + + + + + + FAD binding domain ]
(a)
CPD ARATH
CRY4 DARE
1000
CRY6-4 DARE
586
1000 PHR1 DROME
CRY2a DARE
977
CRY1b DARE
996 1000
CRY1a DARE
CRY XENLA
CRY HUMAN
1000
1000
0.1 CRY1 MOUSE
1000
PHR MOUSE
(b)
Figure 9: Poriferan cryptochromes. (a) The deduced poriferan cryptochrome protein sequences CRY SUBDO (Suberites domuncula
(CRYPTO SUBDO; accession number FN421335), CRY CRAME (Crateromorpha meyeri; FN421336), and the photolyase-related protein
from Aphrocallistes vastus (PHR APHVA; AJ437143.1) were aligned with the coral (Acropora millepora) cryptochrome CRY1 (CRY1 ACRO;
145881069). Residues conserved (identical or similar with respect to their physicochemical properties) in all sequences are shown
in white on black; those which share similarity in three sequences are shown in black on gray. The characteristic domains the
N-terminal photolyase-related region (photolyase), and the FAD-binding domain, are marked. (b) Phylogenetic relationship of
the photolyase/cryptochrome polypeptides. The sponge photolyase-related molecule (PHR APHVA) has been aligned with related
sequences; finally a rooted tree has been computed. The numbers at the nodes are an indication of the level of confidence for the
branches as determined by bootstrap analysis (1000 bootstrap replicates). The scale bar indicates an evolutionary distance of 0.1 aa
substitutions per position in the sequence. The following sequences have been included [“class I photolyases”]. The cryptochrome
sequences from Danio rerio zcry1a (CRY1a DARE; AB042248/AB042248), zcry1b (CRY1b DARE; AB042249/AB042249.1), zcry2a
(CRY2a DARE; AB042250/AB042250.1), zcry2b (CRY2b DARE; AB042251/AB042251.1), zcry3 (CRY3 DARE; AB042252/AB042252.1),
zcry4 (CRY4 DARE; AB042253/AB042253.1), and (6–4) photolyase (CRY6-4 DARE; AB042254), the human photolyase (CRY HUMAN;
D83702), mouse photolyase/blue-light receptor homolog 1 (CRY1 MOUSE; AB000777) and homolog 2 (CRY2 MOUSE; AB003433), frog
cryptochrome 1 (CRY XENLA; AY049033), the photolyase from D. melanogaster (PHR1 DROME; BAA12067.1). The Arabidopsis thaliana
class II photolyases (CPD photolyase; CPD ARATH; CAA67683.1) were used as outgroup to root the tree.
12 Evidence-Based Complementary and Alternative Medicine
absorption lines of water (970 nm and 1150/1190 nm, resp.) Extracellular Phase (Appositional Growth). Silicatein is pre-
[41]. sent also in the extracellular space. As mentioned, the
In a first approach, a cryptochrome [CRY] sequence from immunogold electron microscopic analysis showed that the
the hexactinellid sponge Aphrocallistes vastus, that com- silicatein molecules are arranged along strings, which are
prises high sequence similarity to genes encoding (6–4) organized in parallel to the surfaces of the spicules. In
photolyases and related proteins, has already been identified the presence of Ca2+ , silicatein associates with galectin and
[26]. Earlier, functional studies showed that this gene allows the appositional growth of the spicules. Since the
codes in S. domuncula for a photolyase-related protein surface of a newly siliceous spicule is also covered with sili-
[42]. Based on sequence similarities, the DNA photolyase catein, the appositional growth/thickening of a spicule hence
from A. vastus has been classified together with the cryp- proceeds from two directions [axial (Figure 5B) and radial
tochromes, which include blue-light receptors, into a single (Figure 5C)].
DNA photolyase/chryptochrome protein family (Figure 9)
[26]. Taking this experimental finding together with the Extracellular Phase (Shaping). In the next step, the galectin-
demonstration of the luciferase in S. domuncula, we propose containing strings are organized by collagen fibers to net-
that sponges are provided with an unusual, (perhaps) unrec- like structures [45]. It is very likely that collagen, which is
ognized photoreception system. We postulate that sponges released by the specialized cells the collencytes, provides the
coordinate their sensory reception systems not through a organized platform for the morphogenesis of the spicules.
protein-based nervous network alone, but primarily through The longitudinal growth of the spicules can be explained by
a siliceous spicular meshwork and nerve-cell-related sensory the assumption that at the tips of the spicules, the galectin/
molecules at the ends of those spicules. Since sponges are silicatein complexes are incorporated into deposited bio-
provided with the genetic machinery to express luciferase silica under formation and elongation of the axial canal.
enzymes and also a photolyase/chryptochrome molecule, the
optical fibers [spicules] might guide and convert the light, via 10. Concluding Remarks
a chemical/photoelectric reaction, into electric signals. The
subsequent amplification system which translates the electric Until 15 years ago, the Porifera [sponges] were an enigmatic
signals into the nervous transmission system in sponges as animal taxon whose evolutionary origin, its phylogenetic
well as to other metazoan phyla might be mediated by similar position, and its genetic toolkit were largely unknown. The
biological amplifiers/receptors. discovery of one protein, the cell adhesion molecule galectin,
clarified those questions almost suddenly [48]. Cloning and
9. Synthesis of GBS functional studies of that molecule solved the question on
the evolutionary origin of the multicellular animals by the
As outlined earlier [43, 44] the initial phase of spicule forma- demonstration that all metazoan phyla including the Porifera
tion proceeds intracellularly in sclerocytes, where the spicules originate from one common ancestor, the hypothetical Ur-
elongate up to 8 μm. These cells are loosely embedded in metazoa [48]. After having established the monophyly of
the mesohyl and usually start to synthesize several spicules animals and having underscored the relevance of the phylum
simultaneously; the lengths of the spicules observed reach Porifera for the elucidation of the deep phylogeny of animals
values of 0.7–8 μm and diameters of up to 0.9 μm. [9], it could be resolved that among the three classes in the
Silicatein, the major structural protein in the GBS and phylum Porifera the evolutionary oldest class is represented
also the enzyme that mediates the synthesis of polymeric by the Hexactinellida [7]. This insight came as a surprise,
silica, is present not only in the axial canal, but also in the since the members display the most sophisticated body plan
extra-spicular and extra-cellular space [43, 45]. Recently among the sponges. This enlightenment was supported and
Ehrlich et al. [46] got some experimental evidence that flanked by the realization that sponges comprise (almost all)
spicules in hexactinellids contain collagen onto which they basic functional circuits known also from higher metazoan
deposit silica. phyla. Regardless of that progress, one main issue remained
mysterious, the genetic basis for the construction of the
The Intracellular Phase of Spicule Formation in Sclerocytes. highly complex skeleton built of spicules. Focusing on the
Silica is actively taken up by a Na+ /HCO−3 [Si(OH)4 ] cotrans- siliceous sponges, major progress has been made in the un-
porter [47]. In the first steps silicatein is synthesized as derstanding of the formation and the development of the
a proenzyme (signal peptide-propeptide-mature enzyme: spicules in the last few years. Furthermore, with the availabil-
36.3kDa) and processed via the 34.7kDa form (propeptide- ity of the GBSs from Monorhaphis, substantial advances in
mature enzyme) to the 23/25kDa mature enzyme. Very likely the insight of the construction of the siliceous spicules have
during the transport through the endoplasmic reticulum and been achieved as outlined in this paper.
the Golgi complex, silicatein undergoes phosphorylation and
is transported into vesicles where silicatein forms rods, the Acknowledgments
axial filaments. After assembly to filaments, the first layer(s)
of silica is (are) formed. Finally the spicules are released Werner E. G. Müller is a holder of an ERC Advanced Inves-
into the extracellular space where they grow in length and tigator Grant (no. 268476 BIO-SILICA). The authors thank
diameter by appositional growth. The immature spicules are the Chinese Academy of Sciences for providing them with the
extruded from the pinacocytes. Monorhaphis chuni spicules for their research. They are
Evidence-Based Complementary and Alternative Medicine 13
indebted to Professors A. Bick and S. Richter (Institut für [13] A. H. Knoll, “Biomineralization and evolutionary history,”
Biowissenschaften, Allgemeine und Spezielle Zoologie; Uni- Reviews in Mineralogy and Geochemistry, vol. 54, pp. 329–356,
versität at Rostock; Germany) for the loan of the original 2003.
microscopic slides of M. chuni GBS that had been used by [14] W. E. G. Müller, “Spatial and temporal expression patterns in
F. E. Schulze. The examined type specimen originates from animals,” in Encyclopedia of Molecular Cell Biology and Molec-
the collection of the Zoological Institute in Leipzig and is ular Medicine, R. A. Meyers, Ed., vol. 13, pp. 269–309, WILEY-
VCH, Weinheim, Germany, 2005.
kept at the Museum für Naturkunde Berlin, Germany (ZMB
[15] J. Schütze, M. R. Custodio, S. M. Efremova, I. M. Müller, and
Por 12700). They acknowledge Emily S. Damstra (Kitchener,
W. E. G. Müller, “Evolutionary relationships of metazoa with-
Ontario) for providing the drawing of hexactinellids; it is in the eukaryotes based on molecular data from Porifera,” Pro-
used by permission. This work was supported by grants ceedings of the Royal Society London B, vol. 266, no. 1414, pp.
from the German Bundesministerium für Bildung und 63–73, 1999.
Forschung (project “Center of Excellence BIOTECmarin”), [16] H. M. Reiswig, “Classification and phytogeny of Hexactinell-
the Deutsche Forschungsgemeinschaft (Schr 277/10-1), the ida (Porifera),” Canadian Journal of Zoology, vol. 84, no. 2, pp.
European Commission/EUREKA (EUROSTARS, no. 4289 - 195–204, 2006.
SILIBACTS), the International Human Frontier Science Pro- [17] C. Chun, Aus den Tiefen des Weltmeeres, Fischer, Jena, 1900.
gram, the European Commission (Project no. 244967 -Mem- [18] J. Li, “Monorhaphis intermedia—a new species of Hexactinel-
S Project), the Public Welfare Project of Ministry of Land and lida,” Journal of Oceanology and Limnology, vol. 18, pp. 135–
Resources of the People’s Republic of China (Grant no. 137, 1987.
201011005-06), and the International S & T Cooperation [19] J. Murray and J. Hjort, The Depths of the Ocean, Macmillan,
Program of China (Grant no. 2008DFA00980). London, UK, 1912.
[20] J. V. Barboza du Bocage, “Note sur la découverte d’un zoo-
phyte de la famille Hyalochaetides sur la côte du Portugal,”
References Proceedings Zoological Society London, vol. 1864, pp. 265–269,
1864.
[1] R. E. Grant, “Lectures on comparative anatomy and animal
[21] F. E. Schulze, Report on the Hexactinellida Collected by H.M.S.
physiology; on the classification of the animals,” The Lancet,
“Challenger” During the Years 1873–1876, H.M.S. Challenger
vol. 1, pp. 153–159, 1833.
Scientific Results in Zoology, H.M.S. Challenger Reports, Neill,
[2] O. Schmidt, Grundzüge Einer Spongien-Fauna des Atlantischen
Edinburgh, UK, 1887.
Gebietes, W. Engelmann, Leipzig, Germany, 1870.
[22] F. E. Schulze, “Wissenschaftliche Ergebnisse der deutschen
[3] L. H. Hyman, The Invertebrates: Protozoa Through Ctenophora,
Tiefsee-Expedition auf dem Dampfer “Valdivia” 1898-1899,”
McGraw-Hill, New York, NY, USA, 1940.
in Hexactinellida, Fischer, Stuttgart, Germany, 1904.
[4] L. G. Campbell, Log Letters from “The Challenger”, MacMillan,
London, UK, 1876. [23] W. E. G. Müller, C. Eckert, K. Kropf et al., “Formation of
[5] S. P. Leys, G. O. Mackie, and H. M. Reiswig, “The Biology of giant spicules in the deep-sea hexactinellid Monorhaphis chuni
glass sponges,” Advances in Marine Biology, vol. 52, pp. 1–145, (Schulze 1904): electron-microscopic and biochemical stud-
2007. ies,” Cell and Tissue Research, vol. 329, no. 2, pp. 363–378,
[6] M. Kruse, I. M. Müller, and W. E. G. Müller, “Early evolution 2007.
of metazoan serine/threonine and tyrosine kinases: identifica- [24] K. R. Tabachnick, “Family monorhaphididae ljima, 1927,” in
tion of selected kinases in marine sponges,” Molecular Biology Systema Porifera: A Guide to the Classification of Sponges, J. N.
and Evolution, vol. 14, no. 12, pp. 1326–1334, 1997. A. Hooper and R. van Soest, Eds., pp. 1264–1266, Kluwer
[7] M. Kruse, S. P. Leys, I. M. Müller, and W. E. G. Müller, “Phy- Academic, New York, NY, USA, 2002.
logenetic position of the hexactinellida within the phylum [25] M. Roux, P. Bouchet, J. P. Bourseau, C. Gaillard, R. Grand-
Porifera based on the amino acid sequence of the protein perrin, A. Guille et al., “L’environment bathyal au large de la
kinase C from Rhabdocalyptus dawsoni,” Journal of Molecular nouvelle-calédonie: résultats preliminaries de la campagne
Evolution, vol. 46, no. 6, pp. 721–728, 1998. CALSUB et consequences paléoécologiques,” Bulletin de la
[8] W. E. G. Müller, M. Wiens, T. Adell, V. Gamulin, H. C. Societe Geologique de France, vol. 162, pp. 675–685, 1991.
Schröder, and I. M. Müller, “The bauplan of the urmetazoa: [26] X. H. Wang, J. Li, L. Qiao et al., “Structure and characteristics
the basis of the genetic complexity of metazoa using the of giant spicules of the deep sea hexactinellid sponges of the
siliceous sponges [Porifera] as living fossils,” International Re- genus Monorhaphis (Hexactinellida: Amphidiscosida: Monor-
views in Cytology, vol. 235, pp. 53–92, 2004. haphididae),” Acta Zoologica Sinica, vol. 53, pp. 557–569, 2007.
[9] W. E. G. Müller, “Origin of metazoa: sponges as living fossils,” [27] A. Pisera, “Some aspects of silica deposition in lithistid demo-
Naturwissenschaften, vol. 85, no. 1, pp. 11–25, 1998. sponge desmas,” Microscopy Research and Technique, vol. 62,
[10] W. E. G. Müller, I. M. Müller, B. Rinkevich, and V. Gamulin, no. 4, pp. 312–326, 2003.
“Molecular evolution: evidence for the monophyletic origin of [28] F. Sandford, “Physical and chemical analysis of the siliceous
multicellular animals,” Naturwissenschaften, vol. 82, no. 1, pp. skeletons in six sponges of two groups (Demospongiae and
36–38, 1995. Hexactinellida),” Microscopy Research and Technique, vol. 62,
[11] J. Reitner and G. Wörheide, “Non-lithistid fossil demospon- no. 4, pp. 336–355, 2003.
giae—origins of their plaeobiodiversity and highlights in his- [29] M. J. Uriz, “Mineral skeletogenesis in sponges,” Canadian Jour-
tory of preservation,” in Systema Porifera: A Guide to the Clas- nal of Zoology, vol. 84, no. 2, pp. 322–356, 2006.
sification of Sponges, J. N. A. Hooper and R. van Soest, Eds., [30] M. J. Uriz, X. Turon, M. A. Becerro, and G. Agell, “Siliceous
Kluwer Academic, New York, NY, USA, 2002. spicules and skeleton frameworks in sponges: origin, diversity,
[12] H. Pilcher, “back to our roots,” Nature, vol. 435, no. 7045, pp. ultrastructural patterns, and biological functions,” Microscopy
1022–1023, 2005. Research and Technique, vol. 62, no. 4, pp. 279–299, 2003.
14 Evidence-Based Complementary and Alternative Medicine
[31] T. L. Simpson, P. F. Langenbruch, and L. Scalera-Liaci, “Silica [46] H. Ehrlich, R. Deutzmann, E. Brunner et al., “Mineralization
spicules and axial filaments of the marine sponge Stelletta of the meter-long biosilica structures of glass sponges is tem-
grubii (Porifera, Demospongiae),” Zoomorphology, vol. 105, plated on hydroxylated collagen,” Nature Chemistry, vol. 2, pp.
no. 6, pp. 375–382, 1985. 1084–1088, 2010.
[32] W. E. G. Müller, K. Jochum, B. Stoll, and X. H. Wang, “Forma- [47] H. C. Schröder, S. Perović-Ottstadt, M. Rothenberger et al.,
tion of giant spicule from quartz glass by the deep sea sponge “Silica transport in the demosponge Suberites domuncula flu-
Monorhaphis,” Chemistry of Materials, vol. 20, no. 14, pp. orescence emission analysis using the PDMPO probe and
4703–4711, 2008. cloning of a potential transporter,” Biochemical Journal, vol.
[33] W. E. G. Müller, X. Wang, K. Kropf et al., “Bioorganic/ 381, pp. 665–673, 2004.
inorganic hybrid composition of sponge spicules: matrix of [48] W. E. G. Müller, “How was metazoan threshold crossed: the
the giant spicules and of the comitalia of the deep sea hexact- hypothetical urmetazoa,” Comparative Biochemistry and Phys-
inellid Monorhaphis,” Journal of Structural Biology, vol. 161, iology, vol. 129, pp. 433–460, 2001.
no. 2, pp. 188–203, 2008.
[34] C. Lévi, J. L. Barton, C. Guillemet, E. Le Bras, and P. Lehuede,
“A remarkably strong natural glassy rod: the anchoring spicule
of the Monorhaphis sponge,” Journal of Materials Science Let-
ters, vol. 8, no. 3, pp. 337–339, 1989.
[35] G. Mayer, “Rigid biological systems as models for synthetic
composites,” Science, vol. 310, no. 5751, pp. 1144–1147,
2005.
[36] G. Mayer, R. Trejo, E. Lara-Curzio et al., “Lessons for new
classes of inorganic/organic composites from the spicules and
skeleton of the sea sponge Euplectella aspergillum,” in Materials
Research Society Symposium Proceedings, vol. 844, pp. 79–86,
December 2005.
[37] X. Wang, U. Schloßmacher, K. P. Jochum et al., “Silica-pro-
tein composite layers of the giant basal spicules from Monor-
haphis Basis for their mechanical stability,” Pure and Applied
Chemistry, vol. 82, no. 1, pp. 175–192, 2010.
[38] W. E. G. Müller, X. Wang, B. Sinha, M. Wiens, H. C. Schröder,
and K. P. Jochum, “NanoSIMS: insights into the organization
of the proteinaceous scaffold within hexactinellid sponge
spicules,” ChemBioChem, vol. 11, no. 8, pp. 1077–1082, 2010.
[39] S. Perović, I. Prokić, A. Krasko, I. M. Müller, and W. E. G.
Müller, “Origin of neuronal-like receptors in metazoa: cloning
of a metabotropic glutamate/GABA-like receptor from the
marine sponge Geodia cydonium,” Cell and Tissue Research,
vol. 296, no. 2, pp. 395–404, 1999.
[40] W. E. G. Müller, K. Wendt, C. Geppert, M. Wiens, A. Reiber,
and H. C. Schröder, “Novel photoreception system in sponges?
unique transmission properties of the stalk spicules from the
hexactinellid Hyalonema sieboldi,” Biosensors and Bioelectron-
ics, vol. 21, no. 7, pp. 1149–1155, 2006.
[41] C. L. Braun and S. N. Smirnov, “Why is water blue?” Journal
of Chemical Education, vol. 70, pp. 612–617, 1993.
[42] H. C. Schröder, A. Krasko, D. Gundacker, S. P. Leys, I. M.
Müller, and W. E. G. Müller, “Molecular and functional analy-
sis of the (6–4) photolyase from the hexactinellid Aphrocallistes
vastus,” Biochimica et Biophysica Acta, vol. 1651, no. 1-2, pp.
41–49, 2003.
[43] W. E. G. Müller, M. Rothenberger, A. Boreiko, W. Tremel, A.
Reiber, and H. C. Schröder, “Formation of siliceous spicules in
the marine demosponge Suberites domuncula,” Cell and Tissue
Research, vol. 321, no. 2, pp. 285–297, 2005.
[44] W. E. G. Müller, S. I. Belikov, W. Tremel et al., “Siliceous spic-
ules in marine demosponges (example Suberites domuncula),”
Micron, vol. 37, no. 2, pp. 107–120, 2006.
[45] H. C. Schröder, A. Boreiko, M. Korzhev et al., “Co-expression
and functional interaction of silicatein with galectin:matrix-
guided formation of siliceous spicules in the marine demo-
sponge Suberites domuncula,” Journal of Biological Chemistry,
vol. 281, no. 17, pp. 12001–12009, 2006.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 824962, 8 pages
doi:10.1155/2011/824962
Research Article
Modulation and Interaction of Immune-Associated Parameters
with Antioxidant in the Immunocytes of Crab
Scylla paramamosain Challenged with Lipopolysaccharides
Invertebrates are dependent on cellular and humoral immune defences against microbial infection. Scylla paramamosain is an
important commercial species, but the fundamental knowledge on its immune defense related to the antioxidant and immune-
associated reactions is still lacking. The study was to differentiate the responses of immune-associated parameters of haemolymph
components in S. paramamosain when challenged with bacterial lipopolysaccharides (LPSs). The immunostimulating effects of
LPS in crab by triggering various immune parameters (phagocytosis, lysozyme, antibacterial activity, phenoloxidase, and the
generation of superoxide and nitric oxide) were investigated. Results showed that the generation of free radicals, phenoloxidase,
lysozyme and antibacterial activities was significantly increased through the exposure periods. Conversely, total hemocyte count
and lysosomal membrane stability decreased significantly as the exposure period extended to 96 h. The relationship between
the antioxidant enzymes and immune reactions due to LPS was highly significant. In addition, ROS production was positively
correlated with antioxidant showing immediate response of antioxidant defense to the oxyradicals generated. Overall, the study
indicated that nonspecific immune components in hemocytes of crab showed active response to the LPS stimulation, and
their responses suggested that many immune-associated parameters could be modulated and interrelated with the influence of
antioxidants in crustaceans.
Our previous studies reported that antioxidant enzyme formazan formed from NBT reduction. The samples were
Sp-CAT and Sp-SOD gene expression were induced towards further centrifuged (8,000 rpm, 15 min, 4◦ C), and the O.D.
LPSs challenge in crab [19, 20], and it has been well was measured at 625 nm using spectrophotometer, against a
documented that these antioxidant activities or their gene reagent blank.
expression increased parallelly to immunostimulant chal-
lenge or pathogen infections in crustaceans [14, 16]. Fol- 2.5. Nitrite Production. Nitric oxide (NO) production by
lowing our previous work, the present study was designed crab hemocyte lysate was evaluated as described previously
to evaluate the hemocyte immune functions when the crab [21] by the Griess reaction, which quantifies the nitrite
challenged with LPSs. The immune parameters analyzed (NO2 − ) content of supernatants. Aliquots of HLS was incu-
include total hemocyte counts, membrane stability, phago- bated for 10 min in the dark with 1% (w/v) sulphanilamide in
cytosis, superoxide anion generation, nitric oxide produc- 5% H3 PO4 and 0.1% (w/v) N-(1-naphthy)-ethylenediamine
tion, phenoloxidase, lysozyme, and antibacterial activity. In dihydrochloride. The O.D. of the samples was measured at
addition, the relationship between the immune parameters 540 nm in a spectrophotometer against a suitable reagent
with the antioxidant enzymes such as SOD and CAT was also blank. The molar concentration of nitrite in the samples was
analyzed. This investigation will provide general information determined from a standard curve generated using known
on the immunomodulation of many immune-associated concentrations of sodium nitrite and was represented as μM
parameters and their interrelation with the antioxidants nitrite.
generated in S. paramamosain due to LPSs challenge.
2.6. Detection of Phenoloxidase (PO). Plasma PO was inves-
2. Materials and Methods tigated following the procedure of Asokan et al. [22]. Briefly,
plasma samples (100 μL) were preincubated with the same
2.1. Collection and Maintenance of Mud Crab S. paramamo- volume of L-dihydroxyphenyl-alanine (L-DOPA) or with
sain. S. paramamosain (300 ± 50 g in weight) purchased TBS for 20 min at 22◦ C. All incubation experiments were
from a local commercial crab farm in Xiamen, Fujian performed in the dark. The O.D. of both control and
Province, China were acclimatized at 25 ± 2◦ C for one week experimental was measured at 460 nm. Plasma samples were
before the experiments were carried out. estimated for protein content by Bradford [23].
2.2. Lipopolysaccharide (LPSs) Injection. LPSs from E. coli 2.7. In Vitro Phagocytosis. Suspensions of lyophilised Saccha-
(L2880, Sigma, USA) was prepared as described previously romyces cerevisia were prepared in a sterile saline solution
[19, 20]. To study the immune parameters, 36 crabs were (0.15 M NaCl). The cells were washed three times with
injected with a dose of 0.1 and 0.5 mg kg−1 LPSs, respectively, saline solution and suspended (106 cells mL−1 ) in 0.45 M
and the other 18 individuals were injected with an equal NaCl. Hemocyte monolayers were prepared on glass slides,
volume of sterile saline solution as control treatments. The allowing the cells to attach for 15–20 min at 20◦ C. The
crabs for each group (3 crabs per group) were separately monolayers were carefully rinsed with TBS and incubated
reared in individual container under the same culture with suspension of S. cerevisiae for 1 h at room temperature.
conditions. Meanwhile, three normal crabs were reared in After incubation, the monolayers were carefully rinsed with
an individual tank as a normal control group. Sampling TBS, fixed for 10 min in methanol, stained with Giemsa for
was performed at different time intervals (3, 6, 12, 24, 20 min, and rinsed with distilled water [24]. Then, the slides
48, and 96 h) after LPSs challenge. Haemolymph collection were mounted and examined under the light microscope to
and separation of hemocytes and preparation of serum and record the phagocytosis of the yeast by the hemocytes.
hemocyte lysate suspension were described in detail in our
earlier study [19, 20]. 2.8. Lysozyme Assay. Serum lysozyme assay was deter-
mined by using modified turbidometric assay developed by
2.3. Total Hemocyte Count. Total hemocytes in haemolymph Hutchinson and Manning [25]. Briefly, 0.3 mg mL−1 suspen-
were determined by using hemocytometer. A sample of 20 μL sion of freeze-dried Micrococcus lysodeikticus was prepared in
of diluted haemolymph was added to a hemocytometer and 0.05 M Na2 HPO4 buffer immediately before use and the pH
counted in microscope under 40x magnifications. adjusted to 6.0 using 1.0 M NaOH. Ten microlitres of serum
were added to 250 μL of the bacterial suspension and allowed
2.4. Superoxide Anion Production by Hemocytes. The genera- to equilibrate at 28◦ C. Hen egg white lysozyme (HEWL),
tion of superoxide anion (O2 − ) by hemocytes of individual with a specified activity of 46 200 Units mg−1 was used as
crab was quantified by measuring the reduction of nitroblue an external standard. The reduction in O.D. at 450 nm was
tetrazolium (NBT) following the procedure of Arumugam et determined over a 10 min period at 28◦ C in a microplate
al. [4]. Briefly, hemocyte suspension obtained from individ- reader. The standard curve was constructed by using HEWL.
ual crab was incubated with 1 mg mL−1 of NBT at 22◦ C for The amount of lysozyme present in the serum was calculated
15 min. At the end of incubation, the reaction was stopped by from the standard.
adding 70% methanol and centrifuged (1500 rpm, 10 min,
4◦ C). Two mL of extraction fluid (6 mL KOH + 7 mL 2.9. Lysosomal Membrane Stability. Haemolymph (100 μL)
DMSO) were added to the pellet, to dissolve the insoluble sample pipetted into 0.5 mL centrifuge tube and aliquots
Evidence-Based Complementary and Alternative Medicine 3
(10 μL) of 0.33% neutral red (Sigma) solution in TBS was effect of endotoxin on the phagocytic ability of the hemocytes
added to each tube, and the tube was incubated for 1 h at of S. paramamosain is shown in Figure 1(B). After LPSs
10◦ C. The tubes were then centrifuged for 5 min and washed injection, the phagocytic ability of hemocytes of the crab
twice in TBS. Aliquots (100 μL) of 1% acetic acid in 50% was triggered significantly in both groups. Though increase
ethanol were added to all tubes. The tubes were covered with in phagocytosis was observed after LPSs challenge in both
foil, incubated for 15 min at 20◦ C, and then read at 550 nm. groups, such increase in activity was significant only after 3 h
and at 24 h after challenge. The similar result was observed
2.10. Antibacterial Activity of Haemolymph. Antibacterial in crustacean hemocytes as described previously, as the
activity of the haemolymph was investigated by measure- phagocytic activity triggered by LPSs was able to accelerate
ment of growth inhibition by turbidometry [26]. Briefly, the cellular reactions [35].
100 μL of serum from both control and experimental groups
were added to 96 wells plate. A log phase broth culture 3.3. Superoxide Anion Generation. Phagocytosis is also asso-
of Aeromonas hydrophilla suspension (100 μL) in NB was ciated with the production of ROS namely superoxide
prepared (∼108 bacteria mL−1 ; OD 600 = 0.509) and added anion generation (O2− ) which is highly microbicidal [36].
to each of the experimental and control wells. Positive Although ROS play an important role in host defense, over-
control with broth and bacteria were also maintained. induced and residual ROS may lead to cellular damage in
Aliquots of 100 μL sterile TBS and 100 μL sterile broth were the host. Consequently, phagocytosis becomes essential for
added to a well to act as a blank. The plate was incubated at cells exerting proper functions to rapidly eliminate excessive
room temperature and absorbance measured after 0, 1, and ROS, and thus maintain the homeostasis of organisms. This
24 h, respectively. cellular reaction is immunologically vital and studied in
crustaceans [18, 37]. Significant induction of superoxide
2.11. Statistical Analyses. The SPSS software version 11.0 for generation observed following LPSs challenge in both groups
Windows was used for the statistical analysis. Results are indicated that the bacterial endotoxin can stimulate genera-
reported as mean ± S.D. of three individuals per group per tion of superoxide in S. paramamosain even at a low dose
time point (n = 3). The data were processed by two-way (Figure 1(C)). These results were similar to those of Song
analysis of variance (ANOVA) followed by Tukey’s multiple- and Hsieh [38] in which the relative in vitro intracellular
comparison post hoc test to identify statistical differences. O2− production was enhanced twice for Penaeus monodon
Pearson correlation coefficient was used in the correlation hemocytes treated by heat killed Vibrio vulnificus, β-1,3-
matrix. Differences were statistically significant when P < .05 1,6-glucan and zymosan. However, whether such induction
and .01. would help crabs survival for a longer time if the crabs
suffered from a pathogen remains to be further elucidated.
3. Results and Discussion
3.4. Nitric Oxide Generation. LPSs injection also stimulated
3.1. Total Hemocyte Count (THC). THC plays an impor- an increased level of nitric oxide, a molecule considered as
tant role in regulating the physiological functions includ- precursor of a variety of reactive nitrogen intermediates. As
ing haemolymph coagulation, phagocytosis, encapsulation, shown in Figure 1(D), there was up to 3- and 4-fold increase
and confinement of invasive organisms. In addition, it in nitrite generation in the case of hemocytes collected from
also involves in hardening of exoskeleton, carbohydrate LPSs-injected crab, and this increase was significant during
metabolism, and transport or storage of protein and amino the exposure period. The maximum nitrite generation was
acid [27, 28], and more important THC will reflect the observed after 12 h after injection of 0.5 mg of LPSs to crab.
health status of the host. There was no significant difference As observed in crayfish Procambarus clarkii by Yeh et al. [39],
in THC for crabs challenged with LPSs up to 24 h with the hemocyte-derived NO increased by two-fold following
the respective control groups; however, after 48 h, the THC LPSs challenge.
decreased significantly in both groups challenged with LPSs
(Figure 1(A)). Similar decrease in THC due to nonself 3.5. Phenoloxidase Activity. Phenoloxidase (PO) is an impor-
challenge in crustaceans was described previously, which tant humoral defense component in crustaceans, as it can
led to the rapid reduction in the numbers of circulating be activated by nonself material. Its activation results in
hemocytes [29–31]. Variations in hemocyte numbers may induction of a number of potent bioactive products which
result in different defense activities including hemocyte assist phagocytosis, cell adhesion, and formation of melanin
migration to the injection site and hemocyte lysis [32]. The deposits [40]. In general, PO is present in crab plasma in
loss of hemocytes from the haemolymph might result from an inactive proPO state. Modulations in the levels of this
degranulation, lysis, and the formation of cell clumps or important defense enzyme will have positively influence on
nodules [30]. the survivability of animals upon challenge with infectious
pathogens. Earlier studies showed that LPSs induce prophe-
3.2. Phagocytosis. Phagocytosis is one of the most important noloxidase activation and melanisation reactions [31, 41].
parameter associated with immune reaction in both inver- Significant induction of plasma PO due to endotoxin was
tebrates and vertebrates [24, 33], which normally mobilizes observed when the crab was injected with LPSs, the levels
lysosomes for the invading phagocytosed materials [34]. The of PO activity in the plasma were altered in both groups
4 Evidence-Based Complementary and Alternative Medicine
×106
7 a 70 b ab
a a ab ab ab a b
b b b b ab
6 ab a 60 b
Phagocytosis (%)
bb ab ab a
bb bc b 50 a a a a
THC (mL−1 )
5 b bc a a a
c a
4 40
3 30
2 20
1 10
0 0
Healthy 3h 6h 12 h 24 h 48 h 96 h Healthy 3h 6h 12 h 24 h 48 h 96 h
control control
Different time points Different time points
(A) (B)
c 3 c
0.3 bc bc bc bc bc
Superoxide generation O.D
bc bc c
0.25 bc b 2.5
b
μmol nitrite
0.2 ab b 2 bc bc
a bcbc
at 630 nm
a bc bc
a 1.5 bc bc
0.15 a bc
a a bc
0.1 1
a a
0.5 a a a a a
0.05
0 0
Healthy 3h 6h 12 h 24 h 48 h 96 h Healthy 3h 6h 12 h 24 h 48 h 96 h
control control
Different time points Different time points
Saline i njected Saline i njected
LPS injected 0.1 mg LPS injected 0.1 mg
LPS injected 0.5 mg LPS injected 0.5 mg
(C) (D)
Figure 1: The effect of LPSs on (A) THC, (B) percent phagocytosis, (C) superoxide anion generation, and (D) nitric oxide. Data, representing
the mean ± S.D. of 3 determinations using samples from different preparations, were analyzed using ANOVA followed by the Tukey post hoc
test. The same letters (a, b, and c) indicate no significant difference between challenge groups at different exposure periods, whereas different
letters indicate statistically significant differences (P ≤ .05) between different exposure periods and groups.
of LPSs-injected crabs, indicating active responses of proPO injection decreased and well correlated with the decrease
to a nonself molecule (Figure 2(A)). Earlier research on of THCs. The similar phenomenon was founded in other
crustaceans’ species demonstrated that PO activation by studies [45].
glucans or other nonself molecules generates a range of
immunoactive agents and activities, including peroxinectin 3.7. Lysozyme Activity. Lysozyme is a lysosomal enzyme
and ROS [42]. secreted by the host during phagocytosis and has an impor-
tant bacteriolytic characteristic in the immune system of
3.6. Lysosomal Membrane Stability. Stability of lysosomal crustaceans against pathogenic bacteria. In the study, signif-
membranes in hemocytes of S. paramamosain following LPSs icant induction of lysozyme activity was only observed after
injection was evaluated by the neutral red retention assay. 12 and 24 h post challenge in both groups (Figure 2(C)). An
Membrane stability is a sensitive indicator of lipid membrane increase in phagocytic activity observed in S. paramamosain
integrity in shellfish [43]. Membrane stability can be affected after LPSs injection reflected the involvement of induced
by both chemical and nonchemical stressors, suggesting lysozyme activity. In addition, the lysozyme activity began
that hemocyte viability itself is central to the response to raise after 12 h LPSs injection, which suggests that the
to both immunological challenge and other stressors [44]. cellular reactions are in the first line of defense followed by
The results of the present study indicated that lysosomal an increase in antimicrobial activity [35]. The present results
membrane stability was significantly reduced after 24 h were consistent with previous study in which lysozyme
of LPSs challenge when compared to respective control activity in the shrimp Fenneropenaeus chinensis increased by
groups (Figure 2(B)). With the challenge time increased, the nonself molecule [46].
membrane stability became weaker and the figure clearly
showed that LPSs affected the lysosomal membrane. The 3.8. Antibacterial Activity. Earlier reports revealed that crus-
stability of hemocyte lysosomal membranes following LPSs tacean haemolymph has the ability to inhibit bacterial
Evidence-Based Complementary and Alternative Medicine 5
0.004 bc 0.025 a
Units·mg protein−1 ·min−1
a ab
(A) (B)
8 10
b b
9
6 ab ab ab a
a aa a a a 7 a a a a
5 a a a 6 b
(t24 /t0 )
4 5 b b b
4 bc
3 c c
3 c
2 c
2
1 1
0 0
Healthy 3h 6h 12 h 24 h 48 h 96 h Positive Healthy 3 h 6h 12 h 24 h 48 h 96 h
control control control
Different time points Different time points
Saline i njected Saline i njected
LPS injected 0.1 mg LPS injected 0.1 mg
LPS injected 0.5 mg LPS injected 0.5 mg
(C) (D)
Figure 2: The effect of LPSs on (A) phenoloxidase, (B) membrane stability, (C) lysozyme activity, and (D) antibacterial activity. Data,
representing the mean ± S.D. of 3 determinations using samples from different preparations, were analyzed using ANOVA followed by the
Tukey post hoc test. The same letters (a, b, and c) indicate no significant difference between challenge groups at different exposure periods,
whereas different letters indicate statistically significant differences (P ≤ .05) between different exposure periods and groups.
growth [39, 47, 48]. Yeh et al. [39] reported that hemocyte- which play important physiological roles including immuno-
derived NO promotes bacterial adhesion to hemocytes and logical functions [4, 50, 51]. Though these two enzymes play
increase the bactericidal activity of hemocytes. Bacterial different roles, the common function is the generation of
growth was significantly slower in serum of LPSs challenged superoxide radicals (NADPH-oxidase) and by lesser extent
crab, indicating the antibacterial activity in serum was in producing phenoloxidase.
triggered due to endotoxin (Figure 2(D)). It was noted that Moreover, these two enzymes remain in an inactive state
the results were accompanying to the decrease in lysosomal in the cytosol and are activated by various stimulants [5, 52].
membrane stability after 24 h LPSs injection in both groups. Upon stimulation, phenoloxidase is activated, catalyzes the
Similar findings were observed for the Chinese shrimp melanin synthesis, and deposits near the pathogen, and
hemocytes as a response to injection with Vibrio anguillarum this cascade reaction is characterized by numerous redox
[49]. However, the high dose of LPSs injection suppresses the intermediates which generate the superoxide [53, 54]. On the
bacterial growth in all the exposure periods. other hand, during phagocytosis, there will be an increase
in production of ROS as a positive immune reaction by
3.9. Correlation Analyses and Summary. In earlier study, we the host to invade the pathogen. It has been reported that
reported that the gene expression of antioxidants such as nonself induced nitric oxide generation involving nitric
SOD and CAT and their activities were induced significantly oxide synthase in crustacean hemocytes and the generation
when the crab were challenged with LPSs [19, 20]; corre- of nitric oxide during phagocytosis as a cellular immune
spondingly, it was found in the present study that there was reaction [18]. In the immune system of higher invertebrates
a relationship between the immune associated parameters like arthropods and molluscs, lysozyme is one of the
and the antioxidants (Table 1). The correlation between the most important bacteriolytic agents against corresponding
antioxidant and immune parameters such as phenoloxidase, species of Gram-positive and Gram-negative bacteria, and
antibacterial activity, phagocytosis, superoxide generation, during phagocytosis, the hemocytes produce lysozyme which
and nitric oxide production was much high. In higher actively participate in the inactivation of invading pathogens.
invertebrate species like arthropods and molluscs, NADPH- In addition, the breakage of membrane of hemocyte might
oxidase and phenoloxidase are two redox-catalyzing systems have increased acid phosphates activity which contributed
6 Evidence-Based Complementary and Alternative Medicine
Table 1: Correlation matrix for measured parameters in Scylla paramamosain challenged with LPSs.
Correlation Matrix
HLS- HLS- SERUM- SERUM-
LMS PO LY AB PHA SO2 − NO THC
SOD CAT SOD CAT
LMS 1.000 −0.483∗ −0.293 0.807∗∗ −0.202 −0.374 −0.453 0.684 ∗∗
−0.326 −0.441 0.192 0.265
PO 1.000 0.565∗ −0.799∗∗ 0.606∗∗ 0.787∗∗ 0.799∗∗ −0.601∗∗ 0.652∗∗ 0.671∗∗ 0.249 0.298
LY 1.000 −0.313 0.540∗ 0.399 0.444 −0.549∗ 0.069 0.432 0.000 0.066
AB 1.000 −0.416 −0.733∗∗ −0.724∗∗ 0.724∗∗ −0.673∗∗ −0.671∗∗ −0.144 −0.117
PHA 1.000 0.769∗∗ 0.693∗∗ −0.520∗ 0.433 0.661∗∗ 0.206 0.381
SO−2 1.000 0.863∗∗ −0.559∗ 0.725∗∗ 0.818∗∗ 0.394 0.561∗
NO 1.000 −0.590∗∗ 0.709∗∗ 0.726∗∗ 0.343 0.304
THC 1.000 −0.446 −0.632∗∗ 0.125 −0.006
HLS-SOD 1.000 0.742∗∗ 0.690∗∗ 0.638∗∗
HLS-CAT 1.000 0.472∗ 0.639∗∗
SERUM-SOD 1.000 0.772∗∗
SERUM-CAT 1.000
∗∗
Correlation is significant at the 0.01 level (2-tailed); ∗ Correlation is significant at the 0.05 level (2-tailed).
LMS: lysosomal membrane stability, PO: phenoloxidase, LY: lysozyme activity, AB: antibacterial activity, PHA: phagocytosis, SO2− : superoxide anion
generation, NO: nitric oxide, THC: total hemocyte count, HLS: hemocyte lysate solution, SOD: superoxide dismutase, and CAT: catalase.
in lysis and eventual decomposition of pathogens and by of crustacean’s immune system. Furthermore, the correlation
the evident of antibacterial activity shown to increase in the existing between the immune associated parameters and
present study. All these cellular defense reactions were vital antioxidants strongly supports our previous work that
in immune response and have been well characterized in the antioxidant enzymes play an important role in ROS
invertebrates. detoxification in host-microbe interactions. Future work will
The correlation between antioxidant enzyme and be focus on evaluating whether the induced antioxidant and
oxyradicals produced were high in the present study. immune-associated reactions provoked by LPSs will together
Increase in these oxyradicals can cause direct or indirect enhance the capability of S. paramamosain resistant to an
damage to the membrane and DNA. SOD is the first enzyme infection caused by live pathogenic bacteria.
to deal with oxyradicals by accelerating the dismutation
of superoxide generated, and CAT is a peroxisomal
haemoprotein which catalyses the removal of H2 O2 formed Acknowledgments
during the reaction catalyzed by SOD. ROS, thus, generated
may modulate the levels of SOD, which leads to alteration This work was supported by a grant (2007AA091406)
of CAT activity as a chain reaction. In this sense, the from the National High Technology Research and Devel-
antioxidants interact with excess oxyradicals produced in opment Program of China (863 Program), by program
aerobic animals. Hence, the net result of these antioxidant for Changjiang Scholars and Innovative Research Team in
enzymes provides a postphagocytosis self-protection in the University (PCSIRT, IRT0941), and the Minjiang Scholar
host. Correlation between the free radicals generated in Program to K.-J. Wang (2009). S. Gopalakrishnan and F.-Y.
hemocytes and the antioxidants produced to counteract Chen contributed equally to this work.
the free radicals were significantly high indicating that the
antioxidant enzymes (SOD and CAT) detoxify the free
radicals generated and these enzymes might act as important References
acute defense molecules under stress of immunostimulant
challenge or microbial infection. [1] T. Koshiba, T. Hashii, and S. Kawabata, “A structural per-
The present study showed that LPSs could modulate the spective on the interaction between lipopolysaccharide and
immune parameters of the crab, and the response was quick, factor C, a receptor involved in recognition of gram-negative
time dependent/dose dependent. The immune parameters bacteria,” Journal of Biological Chemistry, vol. 282, no. 6, pp.
3962–3967, 2007.
such as phagocytosis, phenoloxidase, lysozyme, and antibac-
[2] G. G. Martin, D. Poole, C. Poole et al., “Clearance of bacteria
terial activity were all significantly induced after LPSs after injected into the hemolymph of the penaeid shrimp, Sicyonia
injection indicating that crabs respond positively to LPSs ingentis,” Journal of Invertebrate Pathology, vol. 62, no. 3, pp.
stimulation. The overall results indicated that nonspecific 308–315, 1993.
components actively responded to the bacterial endotoxic [3] S. Iwanaga and B. L. Lee, “Recent advances in the innate
stimulation and their responses implied that the immune- immunity of invertebrate animals,” Journal of Biochemistry
related parameters were involved in the immunomodulation and Molecular Biology, vol. 38, no. 2, pp. 128–150, 2005.
Evidence-Based Complementary and Alternative Medicine 7
[4] M. Arumugam, B. Romestand, J. Torreilles, and P. Roch, superoxide anion and nitric oxide by the hemocytes of the
“In vitro production of superoxide and nitric oxide (as giant freshwater prawn Macrobrachium rosenbergii,” Fish and
nitrite and nitrate) by Mytilus galloprovincialis haemocytes Shellfish Immunology, vol. 24, no. 3, pp. 337–345, 2008.
upon incubation with PMA or laminarin or during yeast [19] F. Y. Chen, H. P. Liu, J. Bo, H. L. Ren, and K. J. Wang,
phagocytosis,” European Journal of Cell Biology, vol. 79, no. 7, “Identification of genes differentially expressed in hemocytes
pp. 513–519, 2000. of Scylla paramamosain in response to lipopolysaccharide,”
[5] S. Y. Lee and K. Söderhäll, “Early events in crustacean innate Fish and Shellfish Immunology, vol. 28, no. 1, pp. 167–177,
immunity,” Fish and Shellfish Immunology, vol. 12, no. 5, pp. 2010.
421–437, 2002. [20] H. P. Liu, F. Y. Chen, S. Gopalakrishnan, K. Qiao, J. Bo,
[6] J. M. Mates, C. Perez-Gomez, and I. N. de Castro, “Antioxidant and K. J. Wang, “Antioxidant enzymes from the crab Scylla
enzymes and human diseases,” Clinical Biochemistry, vol. 32, paramamosain: gene cloning and gene/protein expression
no. 8, pp. 595–603, 1999. profiles against LPS challenge,” Fish and Shellfish Immunology,
[7] J. D. Lambeth, “NOX enzymes and the biology of reactive vol. 28, no. 5-6, pp. 862–871, 2010.
oxygen,” Nature Reviews Immunology, vol. 4, no. 3, pp. 181– [21] C. L. Green, A. D. Wagner, J. Glogowski, L. P. Skipper, S. J.
189, 2004. Wishnok, and S. R. Tannenbaum, “Analysis of nitrate, nitrite
[8] S. Arun, P. Krishnamoorthy, and P. Subramanian, “Properties and [15N] nitrate in biological fluids,” Analytical Biochemistry,
of glutathione peroxidase from the hepatopancreas of freshwa- vol. 126, no. 1, pp. 131–138, 1982.
ter prawn Macrobrachium malcolmsonii,” International Journal [22] R. Asokan, M. Arumugam, and P. Mullainadhan, “Activation
of Biochemistry and Cell Biology, vol. 31, no. 6, pp. 725–732, of prophenoloxidase in the plasma and haemocytes of the
1999. marine mussel Perna viridis Linnaeus,” Developmental and
[9] R. T. Di Giulio, W. H. Benson, B. M. Sanders, and P. A. Comparative Immunology, vol. 21, no. 1, pp. 1–12, 1997.
Van Veld, “Biochemical mechanisms: metabolism, adaptation [23] M. M. Bradford, “A rapid and sensitive method for the
and toxicity,” in Fundamentals of Aquatic Toxicology, Effects, quantitation of microgram quantities of protein utilizing the
Environmental Fate, and Risk Assessment, G. Rand, Ed., pp. principle of protein dye binding,” Analytical Biochemistry, vol.
523–561, Taylor and Francis, London, UK, 1995. 72, no. 1-2, pp. 248–254, 1976.
[10] A. D. Correia, M. H. Costa, O. J. Luis, and D. R. Livingstone,
[24] R. Thiagarajan, S. Gopalakrishnan, and H. Thilagam,
“Age-related changes in antioxidant enzyme activities, fatty
“Immunomodulation the marine green mussel Perna viridis
acid composition and lipid peroxidation in whole body
exposed to sub-lethal concentrations of Cu and Hg,” Archives
Gammarus locusta (Crustacea: Amphipoda),” Journal of Exper- of Environmental Contamination and Toxicology, vol. 51, no. 3,
imental Marine Biology and Ecology, vol. 289, no. 1, pp. 83–
pp. 392–399, 2006.
101, 2003.
[25] T. H. Hutchinson and M. J. Manning, “Seasonal trends in
[11] E. M. Ha, C. T. Oh, Y. S. Bae, and W. J. Lee, “A direct role for
serum lysozyme activity and total protein concentration in
dual oxidase in Drosophila gut immunity,” Science, vol. 310,
dab (Limanda limanda L.) sampled from Lyme Bay, U.K,” Fish
no. 5749, pp. 847–850, 2005.
and Shellfish Immunology, vol. 6, no. 7, pp. 473–482, 1996.
[12] E. M. Ha, C. T. Oh, J. H. Ryu et al., “An antioxidant
system required for host protection against gut infection in [26] E. C. Wootton, E. A. Dyrynda, R. K. Pipe, and N. A. Ratcliffe,
Drosophila,” Developmental Cell, vol. 8, no. 1, pp. 125–132, “Comparisons of PAH-induced immunomodulation in three
2005. bivalve molluscs,” Aquatic Toxicology, vol. 65, no. 1, pp. 13–25,
[13] U. E. Zelck, B. Janje, and O. Schneider, “Superoxide dismutase 2003.
expression and H2 O2 production by hemocytes of the trema- [27] G. G. Martin, J. E. Hose, S. Omori, C. Chong, T. Hoodbhoy,
tode intermediate host Lymnaea stagnalis (Gastropoda),” and N. McKrell, “Localization and roles of coagulogen and
Developmental and Comparative Immunology, vol. 29, no. 4, transglutaminase in hemolymph coagulation in decapod
pp. 305–314, 2005. crustaceans,” Comparative Biochemistry and Physiology , vol.
[14] A. I. Campa-Cordova, N. Y. Hernandez-Saavedra, R. De 100, no. 3, pp. 517–522, 1991.
Philippis, and F. Ascencio, “Generation of superoxide anion [28] C. B. T. Van de Braak, M. H. A. Botterblom, W. Liu, N. Tav-
and SOD activity in haemocytes and muscle of American erne, W. P. W. van de Knaap, and J. H. W. M. Rombout, “The
white shrimp (Litopenaeus vannamei) as a response to beta- role of the haematopoietic tissue in haemocyte production and
glucan and sulphated polysaccharide,” Fish and Shellfish maturation in the black tiger shrimp (Penaeus monodon),” Fish
Immunology, vol. 12, no. 4, pp. 353–366, 2002. and Shellfish Immunology, vol. 12, no. 3, pp. 253–272, 2002.
[15] S. Mathew, K. A. Kumar, R. Anandan, P. G. Viswanathan Nair, [29] S. Lorenzon, S. de Guarrini, V. J. Smith, and E. A. Ferrero,
and K. Devadasan, “Changes in tissue defence system in white “Effects of LPS injection on circulating haemocytes in crus-
spot syndrome virus (WSSV) infected Penaeus monodon,” taceans in vivo,” Fish and Shellfish Immunology, vol. 9, no. 1,
Comparative Biochemistry and Physiology, vol. 145, no. 3, pp. pp. 31–50, 1999.
315–320, 2007. [30] V. J. Smith and K. Söderhäll, “Induction of degranulation and
[16] P. F. Ji, C. L. Yao, and Z. Y. Wang, “Immune response and gene lysis of haemocytes in the freshwater crayfish, Astacus astacus
expression in shrimp (Litopenaeus vannamei) hemocytes and by components of the prophenoloxidase activating system in
hepatopancreas against some pathogen-associated molecular vitro,” Cell and Tissue Research, vol. 233, no. 2, pp. 295–303,
patterns,” Fish and Shellfish Immunology, vol. 27, no. 4, pp. 1983.
563–570, 2009. [31] V. J. Smith, K. Söderhäll, and M. Hamilton, “β 1,3-Glucan
[17] V. J. Smith, J. H. Brown, and C. Hauton, “Immunostimulation induced cellular defence reactions in the shore crab, Carcinus
in crustaceans: does it really protect against infection?” Fish maenas,” Comparative Biochemistry and Physiology, vol. 77, no.
and Shellfish Immunology, vol. 15, no. 1, pp. 71–90, 2003. 4, pp. 635–639, 1984.
[18] R. Thiagarajan, M. Arumugam, and P. Mullainadhan, [32] S. A. Omori, G. G. Martin, and J. E. Hose, “Morphology of
“Agglutinin-mediated phagocytosis-associated generation of hemocyte lysis and clotting in the ridgeback prawn, Sicyonia
8 Evidence-Based Complementary and Alternative Medicine
ingentis,” Cell And Tissue Research, vol. 255, no. 1, pp. 117–123, microbial challenge,” Journal of Cell Science, vol. 113, no. 3,
1989. pp. 461–469, 2000.
[33] W. Cheng, F. M. Juang, and J. C. Chen, “The immune response [48] M. Muñoz, F. Vandenbulcke, D. Saulnier, and E. Bachère,
of Taiwan abalone Haliotis diversicolor supertexta and its “Expression and distribution of penaeidin antimicrobial
susceptibility to Vibrio parahaemolyticus at different salinity peptides are regulated by haemocyte reactions in microbial
levels,” Fish and Shellfish Immunology, vol. 16, no. 3, pp. 295– challenged shrimp,” European Journal of Biochemistry, vol. 269,
306, 2004. no. 11, pp. 2678–2689, 2002.
[34] C. J. Bayne, “Phagocytosis and non-self recognition in inverte- [49] Z. Zhao, Z. Yin, S. Weng et al., “Profiling of differentially
brates: phagocytosis appears to be an ancient line of defense,” expressed genes in hepatopancreas of white spot syndrome
BioScience, vol. 40, pp. 723–731, 1990. virus-resistant shrimp (Litopenaeus vannamei) by suppression
[35] D. Wittwer, C. Weise, P. Götz, and A. Wiesner, “LPS subtractive hybridisation,” Fish and Shellfish Immunology, vol.
(Lipopolysaccharide)-activated immune responses in a hemo- 22, no. 5, pp. 520–534, 2007.
cyte cell line from Estigmene acraea (Lepidoptera),” Develop- [50] H. Peltroche-Llacsahuanga, N. Schnitzler, S. Schmidt, K.
mental and Comparative Immunology, vol. 21, no. 4, pp. 323– Tintelnot, R. Lütticken, and G. Haase, “Phagocytosis, oxida-
336, 1997. tive burst, and killing of Candida dubliniensis and Candida
[36] A. I. Campa-Córdova, N. Y. Hernández-Saavedra, and F. albicans by human neutrophils,” FEMS Microbiology Letters,
Ascencio, “Superoxide dismutase as modulator of immune vol. 191, no. 1, pp. 151–155, 2000.
function in American white shrimp (Litopenaeus vannamei),” [51] E. P. Reeves, H. Lu, H. L. Jacobs et al., “Killing activity of
Comparative Biochemistry and Physiology, vol. 133, no. 4, pp. neutrophils is mediated through activation of proteases by K1
557–565, 2002. flux,” Nature, vol. 416, no. 6878, pp. 291–297, 2002.
[37] M. H. Lee and S. Y. Shiau, “Dietary vitamin C and its [52] K. Söderhäll and V. J. Smith, “The prophenoloxidase activating
derivatives affect immune responses in grass shrimp, Penaeus cascade as a recognition and defence system in arthropod,” in
monodon,” Fish and Shellfish Immunology, vol. 12, no. 2, pp. Hemocytic and Humoral Immunity in Arthropods, A. P. Gupta,
119–129, 2002. Ed., pp. 251–285, Wiley Interscience Publication, New York,
[38] Y. L. Song and Y. T. Hsieh, “Immunostimulation of tiger NY, USA, 1986.
shrimp (Penaeus monodon) hemocytes for generation of [53] A. J. Nappi, E. Vass, F. Frey, and Y. Carton, “Superoxide anion
microbicidal substances: analysis of reactive oxygen species,” generation in Drosophila during melanotic encapsulation of
Developmental and Comparative Immunology, vol. 18, no. 3, parasites,” European Journal of Cell Biology, vol. 68, no. 4, pp.
pp. 201–209, 1994. 450–456, 1995.
[39] F. C. Yeh, S. H. Wu, C. Y. Lai, and C. Y. Lee, “Demonstration [54] J. L. Freeman and J. D. Lambeth, “NADPH oxidase activity is
of nitric oxide synthase activity in crustacean hemocytes independent of p47phox in vitro,” Journal of Biological Chem-
and anti-microbial activity of hemocyte-derived nitric oxide,” istry, vol. 271, no. 37, pp. 22578–22582, 1996.
Comparative Biochemistry and Physiology, vol. 144, no. 1, pp.
11–17, 2006.
[40] K. Söderhäll and L. Cerenius, “Role of the prophenoloxidase-
activating system in invertebrate immunity,” Current Opinion
in Immunology, vol. 10, no. 1, pp. 23–28, 1998.
[41] M. Ashida and K. Söderhäll, “The prophenoloxidase activating
system in crayfish,” Comparative Biochemistry and Physiology,
vol. 77, no. 1, pp. 21–26, 1984.
[42] T. Holmblad and K. Söderhäll, “Cell adhesion molecules
and antioxidative enzymes in a crustacean, possible role in
immunity,” Aquaculture, vol. 172, no. 1-2, pp. 111–123, 1999.
[43] D. M. Lowe, V. U. Fossato, and M. H. Depledge,
“Contaminant-induced lysosomal membrane damage in
blood cells of mussels Mytilus galloprovincialis from the
Venice Lagoon: an in vitro study,” Marine Ecology Progress
Series, vol. 129, no. 1–3, pp. 189–196, 1995.
[44] T. S. Galloway and M. H. Depledge, “Immunotoxicity in
invertebrates: measurement and ecotoxicological relevance,”
Ecotoxicology, vol. 10, no. 1, pp. 5–23, 2001.
[45] P. K. Sahoo, B. R. Pillai, J. Mohanty, J. Kumari, S. Mohanty, and
B. K. Mishra, “In vivo humoral and cellular reactions, and fate
of injected bacteria Aeromonas hydrophila in freshwater prawn
Macrobrachium rosenbergii,” Fish and Shellfish Immunology,
vol. 23, no. 2, pp. 327–340, 2007.
[46] C. L. Yao, C. G. Wu, J. H. Xiang, F. Li, Z. Y. Wang, and X.
Han, “The lysosome and lysozyme response in Chinese shrimp
Fenneropenaeus chinensis to Vibrio anguillarum and laminarin
stimulation,” Journal of Experimental Marine Biology and
Ecology, vol. 363, no. 1-2, pp. 124–129, 2008.
[47] D. Destoumieux, M. Muñoz, C. Cosseau et al., “Penaeidins,
antimicrobial peptides with chitin-binding activity, are pro-
duced and stored in shrimp granulocytes and released after
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 613629, 10 pages
doi:10.1155/2011/613629
Research Article
Polymorphism and Balancing Selection of MHC Class II DAB
Gene in 7 Selective Flounder (Paralichthys olivaceus ) Families
Min Du,1, 2, 3 Song-lin Chen,1 You Liang,1 Lei Wang,1 Feng-tao Gao,1
Yang Liu,1 and Xiao-Lin Liao1
1 Key Lab for Sustainable Utilization of Marine Fisheries Resources, Ministry of Agriculture, Yellow Sea Fisheries Research Institute,
Chinese Academy of Fishery Sciences, Nanjing Road 106, Qingdao 266071, China
2 College of Aqua-life Science and Technology, Shanghai Ocean University, Shanghai 200090, China
3 Honghe University, Yunnan Province, Mengzi, 661100, China
In order to determine the genetic variation of the MHC class IIB exon2 allele in the offspring, 700 fry from seven families of
Japanese flounder challenged with V. anguillarum were studied, and different mortality rates were found in those families. Five
to ten surviving and dead fry from each of the seven families were selected to study the MHC class II B exon2 gene with PCR
and a direct sequencing method. One hundred and sixteen different exon2 sequences were found and 116 different alleles were
identified, while a minimum of four loci were revealed in the MHC class II B exon2 gene. The ratio (dN /dS ) of nonsynonymous
substitution (dN ) to synonymous substitutions (dS ) in the peptide-binding region (PBR) of the MHC class IIB gene was 6.234,
which indicated that balancing selection is acting on the MHC class IIB genes. The MHC IIB alleles were thus being passed on to
their progeny. Some alleles were significantly more frequent in surviving than dead individuals. All together our data suggested that
the alleles Paol-DAB∗ 4301, Paol-DAB∗ 4601, Paol-DAB∗ 4302, Paol-DAB∗ 3803, and Paol-DAB∗ 4101 were associated with resistance
to V. anguillarum in flounder.
been carrying out, since 2002. Three basic populations Table 1: Numbers of the dead/surviving individuals when infected
(i.e., Japanese (JS), Resistance (RS), and Yellow Sea (YS) with the V. anguillarum were selected from seven families of
populations) were developed in 2002 and 2003 [21]. JS were Japanese flounder.
imported from Japan in 2003; RS were obtained from natural Individuals per family
selection and artificial challenge with Vibrio anguillarum; Family Total
Dead Surviving
YS were captured from the Yellow Sea in 2003. These were
called “generation 0” (G0 ). A little more than three years Family 101 20 20 40
later, in March, 2007, the fry of the three basic populations Family 104 20 20 40
that had become sexually mature were selected to mate and Family 5 10 10 20
produced 63 full-sib families or half-sib families and were Family 41 10 10 20
designated “generation 1” (G1 ). After artificial challenge with Family 75 10 10 20
Vibrio anguillarum, the survival percentage ratios (Mean ± Family 92 10 10 20
S.D. (%)) of the families studied (family 0751, family 0768, Family 102 10 10 20
family 0743, family 0750, and family 0719) were 54.13 ± Total 90 90 180
1.23, 62.08 ± 22.52, 7.27 ± 3.57, 64.05 ± 0.74, and 30.86 ±
7.22, respectively; the survival ratio of the resistance families
was not available. Two years later, in March, 2009, sexually The body weight of the fish analyzed was 12–17 g. The test
mature fish were selected for mate (generation 2 (G2 )) and fish of each family were kept in a separate tank at the same
artificial challenge were performed, with the result that the farming factory under flow-through conditions with a fresh
survival ratios of the families were different. water supply at 20 ± 0.5◦ C and were fed twice daily. The
The fry of the next generation exhibited clear genetic V. anguillarum isolated by our laboratory was used in the
information within each family. In this study, their offspring challenge test and prechallenge experiment, and the median
were infected with V. anguillarum and their survival rate was lethal concentration was determined according to Xu et al.
recorded. We amplified and directly sequenced MHC class II [15]. Dead fish were recorded and collected every day. The
B exon2 in order to estimate the number of MHC class II loci, challenge experiment was terminated 14 days after infection.
assess the MHC polymorphism of selected individuals, and The survival ratio (Mean ± S.D. (%)) of families 5, 41, 102,
test for balancing selection, as well as to discover the pattern 75, 101, 92, and 104 was 78.3 ± 7.43, 32.2 ± 3.61, 31.9 ±
of the inheritance of the allele in seven families of Japanese 22.36, 37.9 ± 9.44, 33.4 ± 3.7, 21.8 ± 11.97, and 55.6 ± 1.83,
flounder. respectively. In addition to the daily recording of the fish
that had died, fin clippings were taken from all fish and were
2. Materials and Methods stored individually in absolute ethanol.
2.1. Experimental Design. According to a previous study 2.3. Sampling and DNA Isolation. Fin samples from the top
[15], the fish from family 0768 and family 0751 had the Paol- 10 (families 5, 41, 75, 92, and 102, resp.) or 20 (families
DAB∗ 4301 allele, while the fish from the 0743, R7, 0750, and 101, 104, resp.) individuals to die and the top 10 (families
0719 families did not. The Paol-DAB∗ 4301 allele in flounder 5, 41, 75, 92, and 102, resp.) or 20 (families 101 and
was associated with resistance to V. anguillarum. The survival 104, resp.) surviving individuals from each family were
ratio of families 0768 and 0751 was higher than that of the collected from the challenge trials (Table 1). Table 1 shows
0743, R7, 0750, and 0719 families. Males and females from the number of the dead fish. Surviving individuals were
G1 in these six families were selected as parental fish to selected from the seven families of Japanese flounder in
propagate the offspring in G2 (Figure 1). The brood fish in the study. Genomic DNA was extracted from the dorsal or
G0 were involved in our previous study [21]. Families 92, caudal fin tissue of the dead and surviving fry via a modified
102, and 5 were offspring of self-cross of families 0751, 0768, phenol-chloroform method [22]. The integrity of the DNA
and 0750, respectively, (Figure 1). Family 101 had one dam was analyzed on a 1% agarose gel containing 0.5% μg/mL
from family 0743 crossed with one sire from family 0751. ethidium bromide by electrophoresis and visualized under
Family 41 had a dam from family R7 crossed with one sire UV light. The concentrations of DNA were measured using
from family 0768. Family 75 were the offspring of one dam a GENEQUANT Pro (Pharmacia Biotech Ltd.) RNA/DNA
from family 0750 and one sire from family 0743, and family spectrophotometer. Finally, DNA was adjusted to 100 ng/μL
104 were the offspring of one dam from family 0719 and one and stored at −20◦ C.
sire from family 0768. A total of 7 full-sib families of Japanese
flounder were established, as reported by Chen et al. [21]
2.4. Primer Design and Polymerase Chain Reaction (PCR).
and were reared at the fish farming factory at Haiyang city,
Two oligonucleotides of the gene-specific primers: fMPN
Shandong province. The fry were fed a commercial diet and
(5-CTCCCTCTTCTTCATCACGG T-3) and fMPC (5-
were kept in separate tanks.
ACACACTCACCTGACTTCGT-3) were used for amplifying
the flounder MHC II B sequences, which were designed
2.2. Challenge Experiment. Approximately 100 individuals according to the flounder cDNA sequences reported [20]
from each family and a total of 700 offspring from 7 and published communications [15]. The forward primer
full-sib families were used in the challenge experiment. for class II B is based on the end of exon1 sequence,
Evidence-Based Complementary and Alternative Medicine 3
G0
× × × × × ×
R31# J29# 107# J29# J6 R56 R1 R23 J15 R46 R75 J29
G1
0751 0751 0751 0768 0768 0768 0768 0743 0743 R7 0750 0750 0750 0719
G2
Family 92 Family 101 Family 102 Family 41 Family 75 Family 5 Family 104
Figure 1: The pedigree denotes the families in generation G2 with parents in G1 and grandparents in the G0 .
and the reverse primer for class II B is on the end of 2.6. Genotyping, Sequence Analysis, and Statistical Tests.
exon2 sequence, respectively. Polymerase chain reaction MHC gene sequences were aligned using DNAMAN soft-
(PCR) was performed in a total volume of 25 μL, which ware. Comparison of these nucleotide sequences and
consisted of 100 ng template DNA, 2.5 μL of 10 × Taq deduced amino acid sequences was performed using the
polymerase buffer (TransGen Biotech), 1.5 mM MgCl2 , MEGA4.0 program [24]. The relative rates of synonymous
0.2 mM deoxynucleotide triphosphate, 0.2 μM each of the (dS ) and non-synonymous (dN ) substitution were deter-
forward and reverse primers, and 1 unit of Taq polymerase
mined according to Nei and Gojobori [25] and corrected
(TransGen Biotech). The amplification conditions were
optimized to reduce the nonspecific amplification [23]. for multiple hits (Jukes and Cantor) [26] using MEGA4.0.
Thermocycling was conducted on a Peltier Thermal Cycler The frequency of polymorphism was analyzed using all of
(PTC-200) and the amplification schedule was 94◦ C for 5 the alleles in the program by means of DnaSP4.0 [27] and
minutes, 30 cycles of 94◦ C for 40 s, 52◦ C for 40 seconds, DAMBE [28] with Jukes-Cantor distances. Statistical analysis
72◦ C for 50 seconds, and finally 72◦ C for 10 minutes. The was obtained using SPSS13.0. Allele frequency discrepancies
Molecular Imager Gel Doc XR system (Bio-rad) was used were verified using Fisher’s exact test and the significance
to check for integrity and visualize the PCR products by level [29] was determined for every individual (n = 180) and
electrophoresis on a 1% agarose gel. The amplified fragments every family (n = 7).
exhibited one distinct band with an approximate length of
500 bp.
3. Results
2.5. Cloning and Sequencing. PCR products were excised
The average mortality ratio was 66.65 ± 24.31 (the Mean ±
and then purified with the QIAEX II gel extraction kit
S.D. (%)), which was calculated 14 days after the bacterial
(Qiagen). According to the standard protocol, the purified
products were ligated into a PBS-T vector with a TA cloning infection in the 7 families. In this study, we verified
kit (Takara) and then cloned into TOP 10 Escherichia coli 116 distinct MHC class II nucleotide sequences from 180
competent cells (TransGen Biotech). Positive clones were individuals of the seven flounder families (Table 1). Among
screened in PCR reactions with the cloning primers T7 and these sequences, 72 sequences were present only once, and
M13R. The PCR products for appropriately sized clones were 17 sequences were the same as in previous reports [15], that
cleaned with a Qiaquick PCR purification column (Qiagen) is, Paol-DAB∗ 0101, Paol-DAB∗ 0301, Paol-DAB∗ 0801, Paol-
before cycle sequencing with a Big Dye Terminator cycle- DAB∗ 0901, Paol-DAB∗ 2201, Paol-DAB∗ 3201, Paol-DAB∗ 35
sequencing kit following the manufacturer’s instructions on 01, Paol-DAB∗ 3801, Paol-DAB∗ 3803, Paol-DAB∗ 3804, Paol-
an ABI 3730 automated sequencer (Applied Biosystems, DAB∗ 3805, Paol-DAB∗ 4302, Paol-DAB∗ 0102, Paol-DAB∗
Foster City, CA, USA). All of the alleles shown in the present 2202, Paol-DAB∗ 0502, Paol-DAB∗ 4101, and Paol-DAB∗ 4301.
study were confirmed by sequencing a minimum of five times 99 sequences were newly discovered in the present study
in ten individuals from five of the families, but up to 10 times and were deposited in GenBank (accession no. HQ634973–
or more in twenty individuals from two of the families. HQ635071; Table 2).
4 Evidence-Based Complementary and Alternative Medicine
The new alleles detected in this study were based on the average number of nucleotide differences (k) was 20.84, and
deduced amino acid sequences and designated based on the the nucleotide diversity value (Pi ) for these sequences was
rules reported previously [15, 30–32]. For example, in Paol- 0.07634. Among the individuals of the seven families, five (10
DAB∗ 0103, Paol refers to Paralichthys olivaceus, D to class II, individuals from families 5, 41, 75, 92, 102, resp.) or ten (20
A to the family designation, and B to the β chain-encoding individuals from family 101, 104, resp.) clones per individual
genes. In the four digits after the asterisk, the first two digits were sequenced. Only one sequence was present in five clones
refer to the major type (i.e., alleles that differ by at least per individual from 25 individuals of families 102, 92, 75, 41,
five amino acid substitutions), and the last two digits to the and 5; two sequences were detected in five or ten clones per
subtype (i.e., alleles that differ by less than five amino acid individual from 71 individuals; three sequences were found
substitutions within a single major type). in five or ten clones per individual from 57 individuals; four
sequences were present in five or ten clones per individual
from 18 individuals; five sequences were only detected in
3.1. MHC Class II B Sequence Diversity. The length of the ten clones per individual from 5 individuals from family
amplified MHC class II sequence was 407 bp. The sequences 101 and family 104; six sequences were only detected in ten
covered 91 amino acid residues of the MHC class II B exon2 clones per individual from 3 individuals from family 101;
and complete intron1 (84/96 bp, including a 12 bp repeat seven sequences were detected in ten clones per individual
loci) [15]. There were no frame-shift mutations or stop from one individual from family 101, indicating that this
codons in these alleles. There were 151 polymorphic sites primer set amplifies at least four loci or copies in this species
across the 116 different MHC class II exon2 sequences. The (Table 3) [6, 33].
Evidence-Based Complementary and Alternative Medicine 5
∗ ∗ ∗ ∗ ∗∗∗ ∗∗ ∗ ∗ ∗∗ ∗ ∗ ∗ ∗ ∗ ∗∗ ∗∗ ∗∗
#Paol-DAB∗0101 ADGFRHYTVA DCEFNS S KLN DI EYTQSYYY NKLEYVRFS S SVGKYVGYTE YG IKNAERWN NGPEVI ARRG EKERYCFHNV G I DVEADLT KS
#Paol-DAB∗0301 . . . . . Y . V. T . . . . . .. . . . . . . . . . .. .. .......... .... ...... H. . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . FT. S A . . . .
#Paol-DAB∗0801 . . . . . . .. . N S . . . . . . . . . . . . . . H. . . . .......... .... ...... F. . . . . .K. . . . . . . . T. . . . . . . . . .R . . . N. . . . A . . . .
#Paol-DAB∗0901 . . . . LY . V. T S . . . . . . . . . . . . F. E . . . . .. . . I. . . . . .... ...... F. . . . . . S . . . . . . . . T. . . . . . . . . .P . . . . . .. SA . . . .
#Paol-DAB∗4601 . . . .L. .. . T . . . . . .. . . . . . . . . . .. .. .. . . I. . . . . . . . . F. . . . . F . . . . . . S . . . . Q. . . T . . . . . . . V. . . . . . V. .. . A . . . .
#Paol-DAB∗2201 . . . . . Y . V. G S . . . . . . . . . . . . F. L . . . . .. . . . I. . . . .... ...... H. . . . . . . . . . . . . . . TS . . . . . . . . . R . . . VFT. S A . . . .
#Paol-DAB∗3201 . . . . . . . V. N S. . . . . . . . . . . . . . E . . . . .. . . . I. . . . .... ...... H. . . . . . . . . . . . . . . S . . A . . . . . . .R . . . N. . . . A . . . .
#Paol-DAB∗3501 . . . . . F . V. T . . . . . . . . . . . . . . I Y . H. . .. . . . I. . . . .... ...... H. . . . . . . . . . . . . . . . . . A . . . . . . .Y . . . V . . . . A . . . .
#Paol-DAB∗3801 . . . . L . . M. D S . . . . . . . . . . . . . I Y . H. . .. . . . I. . . . . . . . F. . . . . V . . . . . . . L . . . . . . . N. . A Q. . . . . . . . . . VFT. . A . . . .
#Paol-DAB∗3803 . . . . L . . M. D S . . . . . . . . . . . . . I Y . H. . .. . . . I. . . . . . . . F. . . . . V . . . . . . . L . . . . . . . N. . A Q. . . . . . . . . . . FT. S A . . . .
#Paol-DAB∗3804 . . . . L . . V. D S . . . . . . . . . . . . . I Y . H. . .. . . . I. . . . . . . . F. . . . . V . . . . . . . L . . . . . . . N. . A Q. . . . . . . . . . . FT. S A . . . .
#Paol-DAB∗3805 . . . . L . . M. D N. . . . . . . . . . . . . I Y . H. . .. . . . I. . . . . . . . F. . . . . V. . . . . . . L . . . . . . . T . . A Q. . . V . . . . . . VFT. S A . . . .
#Paol-DAB∗4101 . . . . . Y . M. . E. . . . . . . . . . . . F. E . . . . . . . . FI . . . . . . . . F. . . . . H. . . . . . . . . . . . . . . . . . . F. . S . . LN . . . N . . . S A . . . .
#Paol-DAB∗4301 . . . . L . . V. T . . . . . .. . . . . . . . . E.. .. .. . . II. . . . . . . . F. . . . . V. . . . . . . L . . . . . . . . . . A Q. . S . . LS . . . . . . . S A . . . .
Figure 2: Putative amino acid sequences for MHC II B exon2 alleles of Japanese flounder. Dots denote identity with the first sequences; the
putative peptide binding region is indicated with asterisks.
The putative amino acid sequences for the MHC II juveniles from family 104, with a frequency of 19.9%, 20.2%,
B exon2 alleles of Japanese flounder along with those 16.4%, 19.9%, and 7.3%, respectively. Two alleles (Paol-
previously reported are shown in Figure 2. The nucleotide DAB∗ 0301 and Paol-DAB∗ 4101) were obtained from one
sequence homology in the MHC class II B genes ranged from hundred clones from twenty juveniles from family 5 with
87% to 99%. Alleles differed in amino acid composition by a frequency of 6% and 34%. Four alleles (Paol-DAB∗ 0101,
one to twenty-eight substitutions out of 91 sites. Paol-DAB∗ 0801, Paol-DAB∗ 3803, and Paol-DAB∗ 2202) were
present in one hundred and five clones from twenty juveniles
in family 41 with a frequency of 21.9%, 46.7%, and 22.9%,
3.2. Alleles Distribution in the Seven Flounder Families. respectively. Four alleles (Paol-DAB∗ 0901, Paol-DAB∗ 2201,
Alleles were shared among certain individuals and families Paol-DAB∗ 3805 and Paol-DAB∗ 0502) were obtained from
in this study. Table 4 summarizes the alleles which were one hundred and two clones from twenty juveniles in
frequently present in individuals of the seven families family 75, with a frequency of 25.5%, 22.6%, 20.6%, and
investigated (one allele Paol-DAB∗ 4601 was presented only 15.7%, respectively. Two alleles (Paol-DAB∗ 3501 and Paol-
in this study, while the other 16 alleles have been reported DAB∗ 4301) were obtained from one hundred and one
previously [15], and these were Paol-DAB∗ 4301, Paol- clones from twenty juveniles family 92 with a frequency of
DAB∗ 4302, Paol-DAB∗ 0101, Paol-DAB∗ 3201, Paol-DAB∗ 40.5% and 43.6%, and three alleles (Paol-DAB∗ 0101, Paol-
2201, Paol-DAB∗ 3803, Paol-DAB∗ 3804, Paol-DAB∗ 0102, DAB∗ 4301, and Paol-DAB∗ 3803) were presented in ninety-
Paol-DAB∗ 0301, Paol-DAB∗ 4101, Paol-DAB∗ 0801, Paol- seven clones in twenty juveniles from family 102 with a
DAB∗ 2202, Paol-DAB∗ 0901, Paol-DAB∗ 3805, Paol-DAB∗ frequency of 39.2%, 24.7%, and 13.4%, respectively.
0502, and Paol-DAB∗ 3501, resp.). Thus, four alleles (Paol-
DAB∗ 4301, Paol-DAB∗ 0101, Paol-DAB∗ 3201, and Paol-
DAB∗ 2201) were obtained from three hundred and ninety- 3.3. Association between Allele Frequency and Resistance/Sus-
seven clones from forty juveniles from family 101, with a fre- ceptibility to V. anguillarum in the Surviving and Dead
quency of 16%, 22.1%, 20.3%, and 22.6%, respectively. Five Individuals within the Seven Families. Most of the 116
alleles (Paol-DAB∗ 4301, Paol-DAB∗ 4601, Paol-DAB∗ 3803, alleles were presented only once or twice and therefore
Paol-DAB∗ 0101, and Paol-DAB∗ 0102) were found to be they were excluded from the analysis of the association
present in three hundred and ninety-five clones from forty with bacterial resistance. Fourteen alleles were selected
6 Evidence-Based Complementary and Alternative Medicine
Allele Mode Number Frequency Family Allele Mode Number Frequency Family
S 21 0.21∗∗ S 26 0.26∗∗
Paol-DAB∗ 0301 D 38 0.38 F5 Paol-DAB∗ 4101 D 8 0.08 F5
Total 60 0.6 Total 34 0.34
S 12 0.114 S 20 0.19
Paol-DAB∗ 0101 D 11 0.105 F41 Paol-DAB∗ 0801 D 29 0.267 F41
Total 23 0.219 Total 49 0.467
S 18 0.171∗∗ S 5 0.05
Paol-DAB∗ 3803 D 6 0.057 F41 Paol-DAB∗ 2202 D 1 0.01 F75
Total 24 0.229 Total 6 0.059
S 12 0.118 S 12 0.118
Paol-DAB∗ 0901 D 14 0.138 F75 Paol-DAB∗ 2201 D 11 0.108 F75
Total 26 0.255 Total 23 0.226
S 12 0.118 S 7 0.069
Paol-DAB∗ 3805 D 9 0.088 F75 Paol-DAB∗ 0502 D 9 0.088 F75
Total 21 0.206 Total 16 0.157
S 16 0.158 S 25 0.248
Paol-DAB∗ 3501 D 25 0.248 F92 Paol-DAB∗ 4301 D 19 0.188 F92
Total 41 0.405 Total 44 0.436
S 24 0.061∗∗ S 40 0.102
Paol-DAB∗ 3201 D 56 0.142 F101 Paol-DAB∗ 0101 D 47 0.118 F101
Total 80 0.203 Total 87 0.221
S 33 0.084∗∗ S 44 0.112∗∗
Paol-DAB∗ 2201 D 56 0.142 F101 Paol-DAB∗ 4301 D 19 0.048 F101
Total 89 0.226 Total 63 0.16
S 8 0.02 S 12 0.03
Paol-DAB∗ 0102 D 9 0.023 F101 Paol-DAB∗ 4302 D 2 0.005 F101
Total 17 0.043 Total 14 0.035
S 30 0.076 S 54 0.136∗∗
Paol-DAB∗ 4301 D 49 0.123 F104 Paol-DAB∗ 4601 D 26 0.065 F104
Total 79 0.199 Total 80 0.202
S 32 0.081 S 43 0.108
Paol-DAB∗ 3803 D 33 0.083 F104 Paol-DAB∗ 0101 D 36 0.091 F104
Total 65 0.164 Total 79 0.199
S 16 0.04 S 5 0.013
Paol-DAB∗ 0102 D 13 0.033 F104 Paol-DAB∗ 4302 D 13 0.033 F104
Total 29 0.073 Total 18 0.045
S 7 0.018 S 7 0.072
Paol-DAB∗ 3804 D 5 0.013 F104 Paol-DAB∗ 3803 D 6 0.062 F102
Total 12 0.03 Total 13 0.134
S 17 0.175 S 12 0.124
Paol-DAB∗ 4301
Paol-DAB∗ 0101 D 21 0.217 F102 D 12 0.124 F102
Total 38 0.392 Total 24 0.247
Notes: S denotes survivor individual and D denotes dead individual in the challenge tests. (One allele Paol-DAB∗ 4601 was first present in this study as well as
the other 16 alleles have presented in previous reports [15]). ∗∗ denotes difference is significant at the 0.05 level (P < 0.05).
for further analysis, of which one allele, Paol-DAB∗ 4601, 3804, Paol-DAB∗ 3805, Paol-DAB∗ 4101, and Paol-DAB∗
was first identified in this study, while the 13 other 4301. A sharing of the same alleles, Paol-DAB∗ 4301 and
alleles were identified in previous reports [15]. The latter Paol-DAB∗ 0101, were observed in four of the seven families
were Paol-DAB∗ 0101, Paol-DAB∗ 0301, Paol-DAB∗ 0801, examined (Table 4), with the frequency different in each
Paol-DAB∗ 0901, Paol-DAB∗ 2201, Paol-DAB∗ 3201, Paol- family. In family 104, there was a 7.6% frequency in the
DAB∗ 3501, Paol-DAB∗ 3801, Paol-DAB∗ 3803, Paol-DAB∗ surviving individuals and a 12.3% frequency in dead
Evidence-Based Complementary and Alternative Medicine 7
individuals for Paol-DAB∗ 4301, as well as a 10.8% frequency 3.5. Inheritance of the Allele in the Next Generation. The
in the surviving individuals and a 9.1% frequency in dead pedigree of the Japanese flounder was shown in Figure 1. At
individuals for Paol-DAB∗ 0101. In family 92, there was a G1 , both family 0768 and family 0751 had Paol-DAB∗ 4301
24.8% frequency for Paol-DAB∗ 4301 in the survivors and an alleles, while family 0768 also had Paol-DAB∗ 0801 allele.
18.8% frequency in the dead individuals. In family 101, there We found that the Paol-DAB∗ 4301 alleles were presented in
was an 11.2% frequency for Paol-DAB∗ 4301 in survivor families 101, 104, 92, and 102, and Paol-DAB∗ 0801 in family
individuals and a 4.8% frequency in dead individuals, and 41 at G2 , respectively. The sire and dam of family 92 were
this difference was significant (P = 0.0010); there was a
10.2% frequency found for Paol-DAB∗ 0101 in the surviving from family 0751, while the sire and dam of family 101
individuals and an 11.8% frequency in the dead. In family were from family 0743 and family 0751, respectively. The
102, there was a 12.4% frequency in the surviving and 12.4% sire and dam of family 102 were from family 0768. The sire
frequency in the dead individuals for Paol-DAB∗ 4301, as and dam of family 41 were from family 0768 and family R7,
well as a 17.5% frequency in the survivors and a 21.7% respectively, while the sire and dam of family 104 were from
frequency in dead individuals for Paol-DAB∗ 0101. In family 0768 and family 0719, respectively. This denoted that
family 41, an 11.4% frequency was found in the surviving the MHC II B alleles were passed on to the progeny. Neither
individuals while a 10.5% frequency was found in the dead Paol-DAB∗ 4301 nor Paol-DAB∗ 0801 was present in family
individuals for Paol-DAB∗ 0101. Some MHC class II B allele 75 and 5. The sire and dam of family 75 were from family
frequencies differed significantly between the surviving 0743 and 0750, respectively, while the sire and dam of family
and dead individuals within the family. In family 104, the 5 were both from family 0750. The distribution patterns of
Paol-DAB∗ 4601 allele, which was newly identified in this
the alleles in each family were obtained from DNA sequence
study, was significantly more frequent in the surviving
(13.6%) individuals than in the dead individuals (6.5%, analysis and are shown in Table 4.
P = 0.001).
In family 101, the Paol-DAB∗ 2201 frequency in the 4. Discussion
surviving individuals (8.4%) was significantly lower than in
the dead individuals (14.2%, P = 0.001), while in family 41, The major histocompatibility complex (MHC) is a vital
the Paol-DAB∗ 3803 allele was significantly more frequent in portion of the vertebrate immune system, and MHC allele
the survivors (17.1%) than the dead (5.7%, P = 0.009). In diversity is critical for resistance against parasites [14]. Dixon
family 5, the Paol-DAB∗ 4101 allele was significantly more et al. [35] discovered 57 alleles in 17 individuals with greater
frequent in the surviving (26%) than dead fish (8%, P = polymorphism than is found in most mammals. This region
0.01), while the Paol-DAB∗ 0301 allele was significantly more was selected for amplification as a result of it covering the
frequent in the dead (38%) than the survivors (21%, P = whole of exon2 in the β1 domain, which corresponded to the
0.008). In family 75, family 92, and family 102, the difference highly variable region of the PBR. Therefore, in this study, we
between the allele frequencies in the surviving and dead investigated variations in seven flounder families using MHC
individuals was not significant. These results suggested that class II B exon2 as a gene marker, and the diversity was found
the Paol-DAB∗ 4301, Paol-DAB∗ 4601, Paol-DAB∗ 4302, Paol- to differ significantly (116 sequences in 180 individuals). At
DAB∗ 3803, and Paol-DAB∗ 4101 alleles were associated with least four MHC class II exon2 loci were present in Japanese
resistance to V. anguillarum, while Paol-DAB∗ 2201 and Paol- flounders, which was more than the number previously
DAB∗ 0301 appeared to be associated with susceptibility to reported by Xu et al. [15] and Zhang et al. [20]. Homology
this bacteria. of these alleles from each individual was from 89% to 100%,
and in all the individuals examined was from 87% to 100%,
3.4. Evidence for Balancing Selection. The pattern of nucle- with levels as high as 0.11 in mammals [36].
otide substitution was examined in the putative PBR In a previous study by Xu et al. [15], Paol-DAB∗ 4301,
(peptide-binding region) and other regions. Twenty-three Paol-DAB∗ 0601, Paol-DAB∗ 0801, Paol-DAB∗ 2001, and Paol-
amino acid residues were selected as the putative PBR sites in DAB∗ 3803 were the alleles which found to be associated with
the human regions [34]. The mean numbers of synonymous resistance to V. anguillarum, while Paol-DAB∗ 1601, Paol-
substitutions per synonymous site (dS ) and nonsynonymous DAB∗ 2201, and Paol-DAB∗ 2701 were the alleles which asso-
substitutions per nonsynonymous site (dN ) were based on ciate with susceptibility. In the present study, we found that
pairwise comparisons among the whole sequences in seven Paol-DAB∗ 4301, Paol-DAB∗ 4601, Paol-DAB∗ 3803, and Paol-
families (Table 5). In the putative PBR region, the mean dN DAB∗ 4101 were associated with resistance to V. anguillarum,
(0.231, 0.134, 0.109, 0.180, 0.167, 0.146, 0.147, and 0.177) while Paol-DAB∗ 3201, Paol-DAB∗ 2201, and Paol-DAB∗ 0301
was significantly higher than the mean dS (0.037, 0.031, alleles were associated with susceptibility. Moreover, the
0.048, 0.060, 0.024, 0.009, 0.024, and 0.004) for all of the significant difference in the frequency of each allele between
pairwise comparisons, respectively. Furthermore the dN /dS the survivors and dead fish was only found in one family.
in the PBR (6.243, 4.323, 2.271, 3.000, 6.96, 16.2, 6.125, In addition to the fact that analysis within family was less
44.25) was greater than that in the non-PBR (1.390, 2.5, influenced by the background of the families’ genetic varia-
1.109, 1.065, 1.27, 1.410, 1.606, 1.389) in terms of the whole tions. The link between the alleles and the bacterial resistance
sequence and in each family sequence, respectively. These was unpredictable both within and among families, as well as
results indicated that positive selection was at work in the the pooled material. It might be that the alleles are indirectly
PBR of MHC class II B genes. involved in the resistance to pathogens, or it was possible
8 Evidence-Based Complementary and Alternative Medicine
Table 5: Synonymous (dS ) and nonsynonymous (dN ) substitution rate in the putative peptides binding region (PBR) and nonpeptides
binding region (non-PBR) among Japanese flounder families.
that the families which were challenged displayed different [39–42]. Evidence for balancing selection operating in the
but “functionally similar” alleles by chance. MHC class II B gene was a significantly higher rate of
Xu et al. [15] demonstrated that the MHC II B alleles non-synonymous mutation (dN /dS > 1), which indicated
were passed on to the progeny. In the present study, the allele that the rate of non-synonymous substitution per non-
Paol-DAB∗ 4301 in family 0768 at G1 was also discovered synonymous sites exceeds that of synonymous substitution
in families 101, 104, 92, and 102 at G2 . This stability of per synonymous sites [43, 44].
inheritance within the families had been shown for two We examined the Paol-DAB alleles, including both the
generations. Klein [37] reported that the high levels of allelic whole sequences and the sequences in each family discovered
diversity and polymorphism in the MHC resulted from the in the present study and found that the dN /dS ratio (6.234,
long-term coevolution of parasites and MHC molecules. In 4.323, 2.271, 3.000, 6.96, 16.2, 6.125, and 44.25, resp.) in the
this study, no complete sequences (alleles) were shared across putative PBR regions was higher than that of dN /dS (1.390,
all of the families, while certain alleles were shared among 2.5, 1.109, 1.065, 1.27, 1.410, 1.606, and 1.389, resp.) in
individuals and two to three families in the Japanese floun- the non-PBR regions in the MHC class II exon2 domain
der. The sequences of the MHC alleles were not consistent of Japanese flounder (Table 5), as was also the case for the
with the phylogeny relationships of individuals seen as a human, nonhuman primate, and mouse class II genes[44–
family. This was in agreement with the result of Ye et al. 46]. This was evidence for balancing selection or positive
[38], who reported that the MHC allele sequences were not selection at work in the PBR of MHC class II B genes.
consistent with the phylogeny relationships of a population In this study, certain alleles exhibited a high frequency
in a closely related species. Therefore, to fully understand in individual families (Table 4), while other alleles were
the polymorphism of the MHC class II genes in Japanese found only once or twice in seven families, which indicated
flounder, it was necessary to carry further studies, including frequency-dependent selection [17, 47], that is, one model
an estimation of the number of gene loci, introductions of balancing selection, acting on the polymorphism of the
of improved methods, and analysis of a greater number of MHC class II B genes in the Japanese flounder.
individuals as well as genes and functions. Genetic poly- In the seven families investigated, the percentage of
morphism of MHC was generally thought to be maintained heterozygosity (two different sequences in one individual) in
by a balancing selection driven by host-parasite coevolution families 101, 104, 102, 92, 75, 41, and family 5 is 100%, 100%,
Evidence-Based Complementary and Alternative Medicine 9
85%, 75%, 95%, 85%, and 55%, respectively. All but one of [5] J. D. Hansen, P. Strassburger, G. H. Thorgaard, W. P. Young,
these corresponds to the level of heterozygosity in humans and L. Du Pasquier, “Expression, linkage, and polymorphism
and mice, which was in a range of 80–90% [48]. The sire of MHC-related genes in rainbow trout, Oncorhynchus
and dam of family 92 were from family 0751, the sire and mykiss,” Journal of Immunology, vol. 163, no. 2, pp. 774–786,
dam of family 5 were from family 0750, and sire and dam 1999.
of family 102 were from family 0768. These exhibited lower [6] K. Hashimoto, T. Nakanishi, and Y. Kurosawa, “Isolation
of carp genes encoding major histocompatibility complex
heterozygosity (75%, 55%, 85%), especially family 5 with the
antigens,” Proceedings of the National Academy of Sciences of
lowest heteroxygosity (55%), but the survival ratio of family the United States of America, vol. 87, no. 17, pp. 6863–6867,
5 was the highest among the seven families examined in this 1990.
study. It might indicate that other genes in family 5 or the [7] J. Nikolich-Žugich, D. H. Fremont, M. J. Miley, and I.
homozygosity of the MHC class II B gene resulted in the Messaoudi, “The role of mhc polymorphism in anti-microbial
resistance to V. anguillarum in the Japanese flounder. Further resistance,” Microbes and Infection, vol. 6, no. 5, pp. 501–512,
studies are needed to examine the MHC class II B genes in the 2004.
offspring of the seven families reported in this study. [8] N. Otting, N. G. de Groot, G. G. M. Doxiadis, and R. E.
Between 5 and 10 clones in each of the individual Bontrop, “Extensive Mhc-DQB variation in humans and non-
PCR products had one or seven sequences, and most human primate species,” Immunogenetics, vol. 54, no. 4, pp.
of these sequences were the same as that of the other 230–239, 2002.
clones, indicating that some of these were not the result of [9] K. Musolf, Y. Meyer-Lucht, and S. Sommer, “Evolution of
PCR amplification “errors” [49] or the mismatch repair of MHC-DRB class II polymorphism in the genus Apodemus
heteroduplex molecules during the course of cloning in E. and a comparison of DRB sequences within the family
Muridae (Mammalia: Rodentia),” Immunogenetics, vol. 56, no.
coli. [50]. In this study, ten (20 individuals from family 101
6, pp. 420–426, 2004.
and 104, resp.) or five (10 individuals from family 5, 41, 75,
[10] H. C. Miller, K. Belov, and C. H. Daugherty, “Characterization
92 and 102, resp.) clones per individual were sequenced, and of MHC class II genes from an ancient reptile lineage,
we found a significant difference in the allele distribution Sphenodon (tuatara),” Immunogenetics, vol. 57, no. 11, pp.
in the surviving and dead individuals in each of the seven 883–891, 2005.
families. It was possible that the results would differ in terms [11] Y. Shi, W. Xiao-bing, Y. Peng, and C. Bi-hui, “Cloning and
of the clones and samples, so further studies were needed to sequences analysis of the second exon of MHC class II B genes
select a greater number of both for sequencing and analysis. in Chinese alligator, Alligator sinensis,” Zoological Research,
In summary, the detection of MHC class II B alleles vol. 25, pp. 415–421, 2004.
and their polymorphisms as depicted in the present study [12] D. H. Bos and J. A. DeWoody, “Molecular characterization
will be helpful for immunological research in the future. of major histocompatibility complex class II alleles in wild
This investigative work has the ultimate aim of developing tiger salamanders (Ambystoma tigrinum),” Immunogenetics,
families or strains of Japanese flounder with bacterial vol. 57, no. 10, pp. 775–781, 2005.
resistance. [13] S. Consuegra, H. J. Megens, K. Leon, R. J. M. Stet, and W. C.
Jordan, “Patterns of variability at the major histocompatibility
class II alpha locus in Atlantic salmon contrast with those at
Acknowledgments the class I locus,” Immunogenetics, vol. 57, no. 1-2, pp. 16–24,
2005.
This work was supported by the National Major Basic [14] K. M. Wegner, M. Kalbe, G. Rauch, J. Kurtz, H. Schaschl, and
Research Program of China (2010CB126303), Special T. B. H. Reusch, “Genetic variation in MHC class II expression
Fund for Agroscientific Research in the Public Interest and interactions with MHC sequence polymorphism in three-
(200903046), the National Natural Science Foundation of spined sticklebacks,” Molecular Ecology, vol. 15, no. 4, pp.
China (30871918), and Taishan scholar project of Shandong 1153–1164, 2006.
province, China. [15] T. J. Xu, S. L. Chen, X. S. Ji, and Y. S. Tian, “MHC poly-
morphism and disease resistance to Vibrio anguillarum in 12
selective Japanese flounder (Paralichthys olivaceus) families,”
References Fish and Shellfish Immunology, vol. 25, no. 3, pp. 213–221,
2008.
[1] R. Sheng, X. X. Xu, Q. Tang et al., “Polysaccharide of radix
pseudostellariae improves chronic fatigue syndrome induced [16] A. L. Hughes and M. Nei, “Models of host-parasite interaction
by poly I:C in mice,” Evidence-Based Complementary and and MHC polymorphism,” Genetics, vol. 132, no. 3, pp. 863–
Alternative Medicine. In press. 864, 1992.
[2] R. N. Germain, “MHC-dependent antigen processing and [17] R. W. Slade and H. I. McCallum, “Overdominant vs.
peptide presentation: providing ligands for T lymphocyte frequency-dependent selection at MHC loci,” Genetics, vol.
activation,” Cell, vol. 76, no. 2, pp. 287–299, 1994. 132, no. 3, pp. 861–862, 1992.
[3] J. Bingulac-Popovic, F. Figueroa, A. Sato et al., “Mapping of [18] P. W. Hedrick, “Balancing selection and MHC,” Genetica, vol.
Mhc class I and class II regions to different linkage groups in 104, no. 3, pp. 207–214, 1998.
the zebrafish, Danio rerio,” Immunogenetics, vol. 46, no. 2, pp. [19] P. Srisapoome, T. Ohira, I. Hirono, and T. Aoki, “Cloning,
129–134, 1997. characterization and expression of cDNA containing major
[4] A. Sato, F. Figueroa, B. W. Murray et al., “Nonlinkage of major histocompatibility complex class I, IIα and IIβ genes of
histocompatibility complex class I and class II loci in bony Japanese flounder Paralichthys olivaceus,” Fisheries Science, vol.
fishes,” Immunogenetics, vol. 51, no. 2, pp. 108–116, 2000. 70, no. 2, pp. 264–276, 2004.
10 Evidence-Based Complementary and Alternative Medicine
[20] Y. X. Zhang, S. L. Chen, Y. G. Liu, Z. X. Sha, and Z. J. [36] M. Nei and A. L. Hughes, “Polymorphism and evolution of
Liu, “Major histocompatibility complex class IIB allele poly- the major histocompatibility complex loci in mammals,” in
morphism and its association with resistance/susceptibility Evolution at the Molecular Level, R. K. Selander, A. G. Clark,
to Vibrio anguillarum in Japanese flounder (Paralichthys and T. S. Whittam, Eds., pp. 222–247, Sinauer Associates,
olivaceus),” Marine Biotechnology, vol. 8, no. 6, pp. 600–610, Sunderland, UK, 1991.
2006. [37] J. Klein, “Of HLA, tryps, and selection: an essay on coevolution
[21] S. L. Chen, Y. S. Tian, T. J. Xu, H. Deng, B. W. Liu, and G. of MHC and parasites,” Human Immunology, vol. 30, no. 4, pp.
C. Yu, “Development and characterization for growth rate 247–258, 1991.
and disease resistance of disease-resistance population and [38] Y. Ye, J. She, and E. K. Wakeland, “Diversification of class II
family in Japanese flounder (Paralichthys olivaceus),” Journal A within the genus Mus,” in Molecular Evolution of the Major
of Fisheries of China, vol. 32, no. 5, pp. 665–673, 2008. Histocompatibility Complex, J. Klein and D. Klein, Eds., pp.
[22] Y. Palti, J. T. Silverstein, H. Wieman, J. G. Phillips, F. T. 131–138, Springer, Berlin, Germany, 1991.
Barrows, and J. E. Parsons, “Evaluation of family growth
[39] J. A. Eimes, J. L. Bollmer, P. O. Dunn, L. A. Whittingham, and
response to fishmeal and gluten-based diets in rainbow trout
C. Wimpee, “Mhc class II diversity and balancing selection in
(Oncorhynchus mykiss),” Aquaculture, vol. 255, no. 1–4, pp.
greater prairie-chickens,” Genetica, vol. 138, no. 2, pp. 265–
548–556, 2006.
271, 2010.
[23] P. Zylstra, H. S. Rothenfluh, G. F. Weiller, R. V. Blanden, and
E. J. Steele, “PCR amplification of murine immunoglobulin [40] S. B. Piertney and M. K. Oliver, “The evolutionary ecology of
germline V genes: strategies for minimization of recombina- the major histocompatibility complex,” Heredity, vol. 96, no.
tion artefacts,” Immunology and Cell Biology, vol. 76, no. 5, pp. 1, pp. 7–21, 2006.
395–405, 1998. [41] L. Bernatchez and C. Landry, “MHC studies in nonmodel
[24] K. Tamura, J. Dudley, M. Nei, and S. Kumar, “MEGA4: vertebrates: what have we learned about natural selection in
Molecular Evolutionary Genetics Analysis (MEGA) software 15 years?” Journal of Evolutionary Biology, vol. 16, no. 3, pp.
version 4.0,” Molecular Biology and Evolution, vol. 24, no. 8, 363–377, 2003.
pp. 1596–1599, 2007. [42] T. Strand, H. Westerdahl, J. Höglund, R. V. Alatalo, and H.
[25] M. Nei and T. Gojobori, “Simple methods for estimating Siitari, “The Mhc class II of the Black grouse (Tetrao tetrix)
the numbers of synonymous and nonsynonymous nucleotide consists of low numbers of B and Y genes with variable
substitutions,” Molecular Biology and Evolution, vol. 3, no. 5, diversity and expression,” Immunogenetics, vol. 59, no. 9, pp.
pp. 418–426, 1986. 725–734, 2007.
[26] T. H. Jukes and C. R. Cantor, “Evolution of protein molecules,” [43] A. L. Hughes and M. Nei, “Pattern of nucleotide substitution
in Mammalian Protein Metabolism, H. N. Munro, Ed., pp. 21– at major histocompatibility complex class I loci reveals
132, Academic Press, New York, NY, USA, 1969. overdominant selection,” Nature, vol. 335, no. 6186, pp. 167–
[27] P. Librado and J. Rozas, “DnaSP v5: a software for comprehen- 170, 1988.
sive analysis of DNA polymorphism data,” Bioinformatics, vol. [44] A. L. Hughes and M. Nei, “Nucleotide substitution at major
25, no. 11, pp. 1451–1452, 2009. histocompatibility complex class II loci: evidence for over-
[28] X. Xia and Z. Xie, “DAMBE: software package for data analysis dominant selection,” Proceedings of the National Academy of
in molecular biology and evolution,” Journal of Heredity, vol. Sciences of the United States of America, vol. 86, no. 3, pp. 958–
92, no. 4, pp. 371–373, 2001. 962, 1989.
[29] W. R. Rice, “Analysis tables of statistical tests,” Evolution, vol. [45] T. Bergström and U. Gyllensten, “Evolution of the Mhc class
43, pp. 223–225, 1989. II polymorphism: the rise and fall of class II gene function in
[30] R. F. Xu, K. Li, G. H. Chen, Y. Z. Qiang, Y. B. Zhang, and L. Lin, primates,” Immunological Reviews, no. 143, pp. 14–31, 1995.
“Genetic variation within exon 2 of the MHC B-LB II gene [46] E. Medina and R. J. North, “Resistance ranking of some com-
inTibetan chicken,” Acta Genetica Sinica, vol. 32, no. 11, pp. mon inbred mouse strains to Mycobacterium tuberculosis and
1136–1146, 2005. relationship to major histocompatibility complex haplotype
[31] S. G. Antunes, N. G. De Groot, H. Brok et al., “The common and Nramp1 genotype,” Immunology, vol. 93, no. 2, pp. 270–
marmoset: a new world primate species with limited Mhc class 274, 1998.
II variability,” Proceedings of the National Academy of Sciences
[47] N. Takahata and M. Nei, “Allelic genealogy under overdom-
of the United States of America, vol. 95, no. 20, pp. 11745–
inant and frequency-dependent selection and polymorphism
11750, 1998.
of major histocompatibility complex loci,” Genetics, vol. 124,
[32] K. Trtková, H. Kupfermann, B. Grahovac et al., “Mhc-DRB
no. 4, pp. 967–978, 1990.
genes of platyrrhine primates,” Immunogenetics, vol. 38, no.
3, pp. 210–222, 1993. [48] J. Klein, Natural History of the Major Histocompatibility
[33] D. Klein, H. Ono, C. O’hUigin, V. Vincek, T. Goldschmidt, and Complex, John Wiley & Sons, New York, NY, USA, 1986.
J. Klein, “Extensive MHC variability in cichlid fishes of Lake [49] P. D. Ennis, J. Zemmour, R. D. Salter, and P. Parham,
Malawi,” Nature, vol. 364, no. 6435, pp. 330–334, 1993. “Rapid cloning of HLA-A,B cDNA by using the polymerase
[34] J. H. Brown, T. S. Jardetzky, J. C. Gorga et al., “Three- chain reaction: frequency and nature of errors produced in
dimensional structure of the human class II histocompatibility amplification,” Proceedings of the National Academy of Sciences
antigen HLA-DR1,” Nature, vol. 364, no. 6432, pp. 33–39, of the United States of America, vol. 87, no. 7, pp. 2833–2837,
1993. 1990.
[35] B. Dixon, L. A. J. Nagelkerke, F. A. Sibbing, E. Egberts, and R. [50] M. Longeri, M. Zanotti, and G. Damiani, “Recombinant DRB
J. M. Stet, “Evolution of MHC class II β chain-encoding genes sequences produced by mismatch repair of heteroduplexes
in the Lake Tana barbel species flock (Barbus intermedius during cloning in Escherichia coli,” European Journal of
complex),” Immunogenetics, vol. 44, no. 6, pp. 419–431, 1996. Immunogenetics, vol. 29, no. 6, pp. 517–523, 2002.
Hindawi Publishing Corporation
Evidence-Based Complementary and Alternative Medicine
Volume 2011, Article ID 965153, 11 pages
doi:10.1155/2011/965153
Research Article
Molecular Characterization and Expression of α-Globin and
β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)
Weiqun Lu,1, 2 Aurelie Mayolle,3 Guoqiang Cui,2 Lei Luo,2 and Richard J. Balment3
1 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Shanghai Ocean University, Shanghai 201306, China
2 Laboratory of Adaptive Biology, College of Fisheries and Life Science, Shanghai Ocean University, 999 Huchenghuan Road,
Shanghai 201306, China
3 Faculty of Life Sciences, The University of Manchester, Oxford Road, Manchester M13 9PT, UK
In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and
expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading
frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were
both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that
expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin
and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits
were higher in freshwater- (FW-) than in seawater- (SW-) adapted fish kidney. If globins do play a role in salinity adaptation, this
is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which
occur in SW.
of urine through increased renal filtration rate and renal transcription, total RNA was treated with deoxyribonuclease
tubule diameter to enhance urine flow [23]. The changing I (Invitrogen, UK) according to manufacturer’s instructions.
metabolic status and blood tonicity may also cause changes For the library, mRNA was purified from kidney total RNA
in oxygen consumption. In addition, a number of studies using Dynabeads mRNA Direct kit (Dynal, UK).
have revealed that nitrite, which is a potent vasodilator in
humans, is bioactivated by reaction with deoxyhaemoglobin
2.4. cDNA Library Construction and EST Sequence. First
to preferentially generate nitric oxide (NO) under hypoxic
strand cDNA synthesis was carried out using the Clontech
conditions. The physiological function of deoxyhaemoglobin
SMART cDNA Library Kit (Clontech, Basingstoke, UK) as
in this process is as an electronically and allosterically
detailed by the manufacturers and amplified by polymerase
regulated nitrite reductase [24–27].
chain reaction (PCR). The resulting cDNA was purified,
Here, we report the characterization of cDNAs encoding
cloned to the pDNR-LIB vector (Clontech, Basingstoke, UK),
four types of globin in the flounder, along with a preliminary
and then transformed into DH5α Escherichia coli (Euro-
analysis of gene expression and tissue distribution of globins.
gentec). Following cloning, 2,794 colonies (29 plates of 96
The kidney was confirmed as the major site of globin
wells) were randomly picked from kidney library, sequenced
expression in this species. Using quantitative real-time PCR
(Macrogen, Seoul, Korea), and aligned with BLAST (basic
measures of the four types of globin mRNA expression, we
local alignment search tool) against available databases using
have examined differences in globin expression along with
Trace2dBest [28]. The sequence alignment and homology
NO content in kidneys of chronically FW- and SW-adapted
analysis was performed using DNAMAN V4.15 software.
fish.
Table 1: Gene-specific primers and probes for α-globin, β-globin, β-actin, and 18S rRNA.
Flounder α1 · · · MS L S GKDKRVVKA IWEKMS SKSDV I GAEAL GRML V S 36 Table 2: Plasma (a) and blood (b) composition of flounder
Flounder α2 · · · - - - - a - - - s l - r g l - a - a eg r v l d- - g - - - - - - - - - 36
Flounder β1 mv qwt d s e r s a i i s l wgk i dv g e i g pq a l t r l l i v y pw t q 40
chronically adapted to SW or FW.
Flounder β2 mv qwt d s e r s s i i a l wgk i dv g e i g pq a l t r l l i v y pw t q 40
(a) Plasma composition.
Flounder α1 YPQTKTYF SHW . ADL S P S S APVRKHGA T I MAAVGDAVGHM 75
Flounder α2 - - - - - - - - a e - g t - - t - q - qk - gh - - g v - - g - - -mg - k y i 76
Flounder β1 r h f s t f gd l s t t - a i l g - e kv a khg k t vmg g l e r a v k s l d 80 SW FW
Flounder β2 r h f s t f gd l s t t - a i l g - e kv a khg k t vmg g l e r a v k s l d 80 Osmolality
302.62 ± 3.32 285.2 ± 3.35∗∗
Flounder α1 DDLQGF L S KY S E LHA FKLRVDPTNFK I L AHNMI L VMAMY F 115 (mosmo/kgH2 O)
Flounder α2 v t - t e am- s l - - - - - - t - - - - - s - - - - - - - s i - - - - - - - y 116
Flounder β1 - i kg v y s a l s t mhs e k l hv dpdnf r l l a e c i s v c - a - k f g 120 Mg2+ (mmol/liter) 4.7 ± 0.18 2.8 ± 0.35∗∗
Flounder β2 - i kg v y s a l s t mhs e k l hv dpdnf r l l a e c i s v c - a - k f g 120 Cl− (mmol/liter) 141.4 ± 1.65 124.4 ± 2.21∗∗
Flounder α1 PKDF TAEVHV S VDKF LQCL ALAL S EKY R 143 Ca2+ (free)
Flounder α2 - - e - - - - - - - - f - - - - s - - -w- - - - - - - 144 1.77 ± 0.027 1.8 ± 0.039
Flounder β1 - s v - - - - - qe awq - - - s v v v s - - g r q- h 148
(mmol/liter)
Flounder β2 - s v - - - - - qe awq - - - s v v v s - - g r q- h 148 Na+ (mmol/liter) 151.48 ± 2.39 146.92 ± 2.38
Figure 1: Alignment of deduced amino acid sequences of two types K+ (mmol/liter) 2.7 ± 0.038 2.74 ± 0.13
of the flounder α-globin cDNAs and two types of the flounder β-
globin cDNAs. Dot indicates that the amino acid is absent. Dash (b) Blood composition.
indicates the identical amino acid. SW FW
Hematocrit (Hct)
25.82 ± 1.3 29.78 ± 1.7
%
3.2. Alignment of α-Globin and β-Globin Amino Acid
Se-quences. Cluster analysis of the two types of flounder α- RBC × 1012 /L 2.258 ± 0.1 2.562 ± 0.2
globin cDNAs named α1 and α2 is presented in Figure 2(a). Hgb g/L 74.4 ± 3.6 84.2 ± 5.4
The homology of flounder α1 and α2 was 65.7%, and they Independent samples t-test was used to assess differences between chron-
were placed in different homology tree clusters. Amino acid ically adapted FW and SW flounder and between experimental and time
homology of the flounder α1-globin gene compared with matched controls at each time point, ∗ P < 0.05, ∗∗ P < 0.005 (n = 7).
other reported fish ranged from 62.2% to 79.7%, whereas
homology for α2-globin amino acid sequences was between
52.4% and 68.1%. The flounder α1-globin shared 50.0% while the spleen also appeared to express relatively high levels
and α2-globin 43.7% sequence homology with human α1- of α-globin and β-globin transcripts. The expression level of
and α2-globin. Irrespective of the different nomenclature, α-globin and β-globin mRNA in the kidney was 1.5 times
the flounder α1-globin was closely related to yellowtail higher than those in head kidney. In kidney, expression levels
α-globin type A, red seabream α-globin type A, and gilthead of the four individual types of globin mRNA also differed.
seabream α-globin type 2, whereas flounder α2-globin was Figure 3(c) shows that the expression levels of α1-globin and
more closely related to yellowtail α-globin type B, Amoy β1-globin mRNAs were higher than those of α2-globin and
croaker α-globin type 2, large yellow croaker α-globin type β2-globin mRNAs.
1, red rum α-globin type 2, and gilthead seabream α-globin
type 1. 3.4. Differential Expression of Globins between SW- and
The homology analysis of the flounder β-globin cDNAs FW-Adapted Fish. Blood composition of chronically FW-
is shown in Figure 2(b), both have 148 amino acid residues. and SW-adapted flounder is shown in Table 2. Plasma
β1 and β2 shared 98.6% sequence homology and were placed chloride, magnesium, and osmolality were significantly
together in the same homology tree cluster. Comparison higher in SW- than in FW-adapted fish. No significant
of flounder β-globin with orthologous vertebrate β-globin differences were evident for calcium, potassium, and sodium
showed that flounder β-globin shared between 59.9% and between long-term SW- and FW-adapted fish. There were
85.0% homology with other fish β-globin, and only 50.3% also no significant differences in blood hematocrit, RBC,
homology with human β-globin. Cluster analysis showed and haemoglobin content, which were slightly higher in
that the β-globin gene in yellowtail was closest to that in FW- than in SW-adapted fish. Although there were no
flounder. statistically significant differences in RBC or haemoglobin
content between FW- and SW-adapted flounder, expression
3.3. Tissue Distribution of Flounder α-Globin and β-Globin levels of α-globin and β-globin mRNAs in the kidney
mRNA. Northern analysis on a range of flounder tissues were significantly higher in FW- than in SW-adapted fish
showed that α-globin and β-globin transcripts were only (Figure 4(a)). Notably, the pooled kidney NOx level in
present in head kidney, kidney, and spleen RNA samples FW-adapted fish was double that in SW- adapted fish
(Figure 3(a)). The major band size was approximately 650 (Figure 4(b)).
nucleotides, which was consistent with the predicted length Further study of the kidney as the major site of α-
based on the cDNA clones obtained. The relative α-globin globin and β-globin expression, by in situ hybridisation using
and β-globin mRNA expression levels in different tissues 35 S-labeled α-globin and β-globin RNA probes (antisense)
were also determined by real-time PCR (Figure 3(b)). The showed that all four types of globin genes were expressed
expression levels of α-globin and β-globin mRNA in head in cells around the renal blood vessels (Figure 5). Abundant
kidney and kidney were much greater than in other tissues, expression of both α1 and β globin (both types of β globin)
Evidence-Based Complementary and Alternative Medicine 5
Flounder 1 77%
Yellowtail A 85% 75%
Red seabream A
Gilthead seabream 2
Common carp 90% 72%
Goldfish 88%
86%
Zebrafish 68%
84%
Grass carp
Oriental weatherfish
Common carp 2 80% 67%
Common carp 3
Atlantic salmon 91% 64%
Rainbow trout 1 94%
Taiwan salmon 4
Rainbow trout 4 92% 63%
Taiwan salmon 1
Founder 2
Yellowtail B 75%
Gilthead seabream 1 66% 51%
Amoy croaker 87%
67%
Large yellow croaker 1 81%
Red drum
Human 1 99%
Human 2
(a)
Flounder 1 99%
Flounder 2 84%
Yellowtail A
Yellowtail B 97%
78%
Atlantic salmon
98%
Rainbow trout
Rainbow trout 4
97% 96% 77%
Taiwan salmon
Amoy croaker 85%
83%
Large yellow croaker
Red drum
Gilthead seabream 79% 73%
Red drum B 89%
Red seabream 83%
Common carp 98%
Goldfish 95%
Oriental weatherfish 90% 62%
Grass carp
Zebrafish 1 92%
Zebrafish 2 49%
97%
Common carp 2
Common carp 3 71%
Human
(b)
Figure 2: Homology tree of flounder α-globin and β-globin. (a) Comparison of the predicted amino acid sequences of the flounder α-
globin with corresponding chains from previously known fish and human α-globin. DDBJ accession numbers: red drum (AAX35759);
Amoy croaker (AAZ79649); large yellow croaker 1 (AAV52697); yellowtail A (BAA86218); yellowtail B (BAA86219); gilthead seabream 1
(ABF67512); gilthead seabream 2 (ABF67513); goldfish (CAP69820); grass carp (AAM93257); common carp (BAA20511); common carp 2
(BAB79237); common carp 3 (BAB79240); oriental weatherfish (AAM93258); taiwan salmon 1 (ABY21328); taiwan salmon 4 (ABY21327);
red seabream A (AAP20155); atlantic salmon (CAA65949); zebrafish (NP 571332); rainbow trout 1 (NP 001118022); rainbow trout 4
(NP 001118023); human 1 (AAK37554); human 2 (AAN04486). (b) Comparison of the predicted amino acid sequences of the flounder
β-globin with corresponding chains from previously known fish and human β-globin. DDBJ Accession Numbers: yellowtail A (BAA86220);
yellowtail B (BAA86221); goldfish (CAP69821); grass carp (AAM93253); common carp 1 (BAA13536); common carp 2 (BAB79238);
common carp 3 (BAB79239); zebrafish 1 (AAI15159); zebrafish 2 (AAH53176); large yellow croaker (AAV91971); oriental weatherfish
(AAM93260); amoy croaker (AAZ79648); taiwan salmon (ABY21329); rainbow trout 1 (ACO07479); rainbow trout 4 (ACO08017); red
seabream (AAP20173); atlantic salmon (ACI68343); red drum A (AAW55624); red drum B (AAZ14832); gilthead seabream (ABE2802);
human (ACU56984).
6 Evidence-Based Complementary and Alternative Medicine
Muscle
Gill
Stomach
Brain
Spinal core
CNSS
Intestine
Bladder
Rectum
Heart
Liver
Gonad
Spleen
Head kidney
Kidney
Stomach
Intestine
Rectum
Bladder
Muscle
Kidney
Gonad
Spleen
CNSS
Heart
Brain
Liver
Gill
(kb)
2.37
Muscle
Gill
Stomach
Brain
Spinal core
CNSS
Bladder
Intestine
Rectum
Heart
Liver
Gonad
Spleen
Head kidney
Kidney
(a) (b)
8
7
6
Relative mRNA level
5
4
3
2
0
α1 α2 β1 β2
(c)
Figure 3: Tissue distribution of α-globin and β-globin mRNA. (a) Northern blot showing tissue distribution and size of the P. flesus α1-
globin and β1-globin transcripts. (b) Relative mRNA expression levels of α1-globin and β1-globin in different tissues. α-globin and β-globin
expressions in different tissues were analyzed by real-time qPCR with 18S rRNA as reference gene. Values are relative fold change with brain
as 1 for pooled samples from 8 SW-acclimated adult flounder; (c) expression levels of four types of globin mRNAs in kidney. α-globin
and β-globin expressions in kidney were analyzed by real-time qPCR with 18S rRNA as reference gene. Values are relative fold change with
α2-globin as 1 for pooled samples from 8 SW-acclimated adult flounder.
genes was evident in the FW-adapted fish kidney, and the In FW-adapted fish kidney, the immunoreactivity of
incidence and apparent density of signal was much higher α1-globin was located in both the haematopoietic stroma
for β-globin than α1-globin. There was no precise signal and the external contour of renal tubules, whereas β-
detected in α2-globin-hybridised tissue sections. In SW- globins were localised only in the haematopoietic stroma.
adapted fish kidney, the signal obtained was weak, and In SW-adapted fish kidney, α1-globin was localised in the
no cells contained precisely dark dots. The transcriptional haematopoietic stroma and internal contour of tubules, but
activity of both α- and β-globin was clearly higher in FW- there was no detectable signal for β-globin (Figure 6). The
than in SW-adapted fish kidney tissue sections. RBCs were protein expression level seemed to be higher in FW- than in
void of signal. The negative controls showed few silver grains, SW-adapted kidney tissues. Immunoreactivity for PCNA in
indicating the background produced by weak nonspecific kidney appeared limited to the haematopoietic stroma, and
binding (Supplementary, see Figure 2 in Supplementary again the expression level seemed to be higher in FW- than
Material available online at doi: 10.1155/2011/965153). in SW-adapted kidney tissues (Figure 7). The heterogeneous
Evidence-Based Complementary and Alternative Medicine 7
∗ 10
35
9
30 ∗
8
25 7
Relative mRNA level
NOx ( μM)
6
20
5
15 4
10 3
∗
2
5
∗ 1
0 0
α1 α2 β1 β2 SW FW
SW
FW
(a) (b)
Figure 4: Relative mRNA expression levels of four types of globin and concentration of NOx in kidney of FW- and SW-adapted flounder.
(a) Expressions of four types of globin were analyzed by real-time qPCR with β-actin as reference gene. Values are relative fold change
with α2-globin in SW-adapted flounder kidney as 1; the significant difference between FW- and SW-adapted flounder was indicated as
∗
P < 0.05 (n = 7). (b) Concentration of total NO in kidney. Values are measurements from 7 pooled kidneys of FW- or SW-adapted
flounder.
FW α1 FW α2 FW β
PT
PT
PT
SW SW α2 SW β
α1
PT
PT
PT
100 μm 100 μm 100 μm
Figure 5: In situ hybridization for α1-globin, α2-globin, and β-globin in kidney of FW- and SW-adapted flounder. Abundant α1-globin
and β-globin gene expression in haematopoietic stroma of FW-adapted flounder is shown with antisense α1-globin and β-globin 35 S RNA
probes, and α1-globin and β-globin mRNA was not detected in SW-adapted flounder. α2-globin mRNA was not detected in either of FW-
and SW-adapted flounder kidney using an antisense α2-globin 35 S RNA probe. The haematopoietic stroma with abundant globins expression
are indicated by solid arrows. PT: proximal tubule.
8 Evidence-Based Complementary and Alternative Medicine
FW FW
PT
PT
100 μm α 100 μm β
(a) (b)
SW SW
PT
PT
100 μm 100 μm
α β
(c) (d)
Figure 6: Immunocytochemistry for α-globin and β-globin in kidney of FW- and SW-adapted flounder. The immunoreactivity of α1-globin
was located in both of external contour of tubules and haematopoietic stroma, whereas β-globin was localised only in haematopoietic stroma
in FW-adapted fish kidney. The haematopoietic stroma with abundant globins is indicated by solid arrows. PT: proximal tubule.
FW SW
50 μm 50 μm
PT
BC
PT
PCNA PCNA
(a) (b)
Figure 7: PCNA immunocytochemistry in kidney of FW- and SW-adapted flounder. The immunoreactivity of PCNA was located in
haematopoietic stroma. The haematopoietic stroma with abundant PCNA is indicated by solid arrows. PT: proximal tubule; BC: blood
cell.
Evidence-Based Complementary and Alternative Medicine 9
nature of the results regarding the peroxidase precipitates are formed in head kidney and spleen in these species [7].
intensity in kidney tissue sections and obviates more precise The presence of higher levels of α-globin and β-globin
statements regarding the levels of PCNA, α-globin, and β- transcripts in kidney, suggests that the kidney may be a more
globin present. important site of erythropoiesis than head kidney and spleen
in flounder.
4. Discussion
4.3. Differential Expression of Globins between SW and FW.
This paper is the first to describe the cloning and molecular European flounders are able to survive in both FW and SW
characterization of flounder α- and β-globin genes, and to but, in common with other euryhaline fish species, maintain
examine the effect of altered environmental salinity on α- and a lower blood tonicity, and also increased urine volume
β-globin gene expression. and reduced urine osmolality in the FW environment. In
terms of blood oxygen transport, we did not see significant
4.1. Molecular Identification and Characterization of α-Globin differences in blood hematocrit, RBC, or haemoglobin
and β-Globin cDNA. Two α-globin genes were isolated, content between FW- and SW-adapted fish. In contrast, the
and the homology of deduced amino acid sequences was expression levels of all four types of globin mRNAs in the
65.7%. The α2-globin had one Gly insertion at position kidney were significantly higher in FW-adapted compared
48. However, Yellowtail α-globin type B has a Gly insertion with SW-adapted fish. This is consistent with the observed
at position 47 [32, 33]. Miyata et al. [33] suggested that expression changes of two α-globins following exposure of
an insertion of Arg or Asp residue at position 47 in carp the elasmobranch, S. aurata, to low salinity [14]. These
α-globin produced only inconsequential changes in function observations suggest that Hb may be involved in some
and the three-dimensional structure of globin. Despite these aspects of salinity adaption in fish although exactly the
structural similarities, a comparison of deduced amino acid mechanism by which Hb is employed remains unclear.
sequences of the two types of flounder α-globin placed them To clarify these important observations, further investi-
in different homology tree clusters, namely, those that are gations were performed using histochemical methods. The
structurally more akin to α1-globin, and those more akin to apparent increased necessity for globin protein in FW-
α2-globin. Flounder α1-globin is most closely related to that adapted fish was further supported by the higher globin
of yellowtail α-globin type A, red seabream α-globin type mRNA expression determined by ISH. This increased mRNA
A, and gilthead seabream α-globin type 2 (75–78%), while expression in FW kidney was regionalised in the haematopoi-
Salmonidae α1-globin only shares 68% identity with floun- etic stroma, in a group of cells probably associated with
der and occupies a separate group. The other two groups the early stages of erythrocyte generation, but no expression
consist of the rest of known freshwater teleosts, namely, was identified in RBCs themselves. This was coincident with
carp, goldfish, and zebrafish (72–75%), and a separate group apparently greater immunoreactivity of PCNA, a cell prolif-
which contains human α-globin (Figure 2(a)). eration marker, in the haematopoietic stroma of FW kidney
We isolated two β-globin genes in flounder, and the tissue. Importantly, the immunohistochemistry results also
deduced amino acid sequences were 98.6% homologous, and showed that both α- and β-globin subunits were located in
considerably homologous with other vertebrate β-globins. haematopoietic stroma, confirming the kidney as a major
Both types of flounder β-globin had a Phe residue at position site of production of all four types of globin and of the
121, in contrast to a Lys residue in yellowtail β-globins, erythropoietic processes.
when compared with human β-globin [32]. Yoshizaki et al. In humans, deoxyhaemoglobin is an electronically and
[34] suggested that such a residue insertion may affect the allosterically regulated nitrite reductase, and it can convert
function of β-globin. The homology tree was consistent with nitrite to NO preferentially under hypoxic conditions [24–
the phylogeny based on classical taxonomy. The two types 27]. NO may also be controlled by haemoglobin binding
of β-globin were placed together and although yellowtail β- properties [35]. Interestingly, kidney tubules dilate and
globin was the closest β-globin of members of Sciaenidae, tubule diameter increase in FW flounder [23]. The finding
Cyprinidae, and Salmonidae were also close to that of that kidney total NO level in FW-adapted fish was double
flounder. It appears that β-globins are more conserved than that in SW-adapted fish, in combination with our previous
α-globin in fishes. studies [23], suggests that NO could perhaps play a role in
variation of tubule diameter dependent upon haemoglobin
binding and reductase activity. The exact mechanisms clearly
4.2. Tissue Distribution of Flounder Globin mRNAs. Northern warrant further investigation.
blot analysis of total RNA prepared from a range of flounder
tissues revealed that the kidney (mesonephros), head kidney 5. Conclusion
(pronephros), and spleen are major sites of expression of
the α-globin and β-globin transcripts. Previous histological From this study, we conclude that head kidney, kidney, and
studies in Clarias gariepinus and Sarotherodon mossambicus spleen are erythropoietic tissues in flounder, The kidney
revealed that the kidney, head kidney, and the spleen are the is the major site of production of all four types of globin
main organs forming blood [6]. Boomker also demonstrated although all four types of globin genes are not expressed
that the cells forming the erythroid and granuloid lineage are equally. Importantly, we also found that α- and β-globin
mostly found in kidney, while thrombocytes and monocytes mRNAs are differentially expressed in chronically FW- and
10 Evidence-Based Complementary and Alternative Medicine
SW-adapted flounder, which raises the possibility that, in [8] P. C. de Souza and G. O. Bonilla-Rodriguez, “Fish hemo-
fish, these globins may be important in some aspects of globins,” Brazilian Journal of Medical and Biological Research,
salinity adaptation. The newly generated deoxyhaemoglobin vol. 40, no. 6, pp. 769–778, 2007.
may play an important role in combating the hemodilution [9] M. E. Favero and F. F. Costa, “Alpha-hemoglobin-stabilizing
faced in FW. This may be particularly relevant for migratory protein: an erythroid molecular chaperone,” Biochemistry
Research International, vol. 2011, Article ID 373859, 7 pages,
fish such as flounder and salmonids as they move between
2011.
media of different salinities. Similar mechanism may also
[10] D. A. Powers, G. S. Greaney, and A. R. Place, “Physiological
be of importance in mammals and would be of interest to correlation between lactate dehydrogenase genotype and
examine in the future. haemoglobin function in killifish,” Nature, vol. 277, no. 5693,
pp. 240–241, 1979.
Abbreviations [11] M. Nikinmaa, “Haemoglobin function in vertebrates:
evolutionary changes in cellular regulation in hypoxia,”
Hb: Haemoglobin Respiration Physiology, vol. 128, no. 3, pp. 317–329, 2001.
PCR: Polymerase chain reaction [12] B. Giardina, D. Mosca, and M. C. De Rosa, “The Bohr effect
PCNA: Proliferating cell nuclear antigen of haemoglobin in vertebrates: an example of molecular
CNSS: Caudal neurosecretory system adaptation to different physiological requirements,” Acta
NOx : Nitric oxide and nitrogen dioxide Physiologica Scandinavica, vol. 182, no. 3, pp. 229–244, 2004.
Hct: Hematocrit. [13] F. B. Jensen, “Red blood cell pH, the Bohr effect, and other
oxygenation-linked phenomena in blood O2 and CO2
transport,” Acta Physiologica Scandinavica, vol. 182, no. 3, pp.
Acknowledgments 215–227, 2004.
[14] S. Campo, G. Nastasi, A. D’Ascola et al., “Hemoglobin system
This work was supported in part by Shanghai Education of Sparus aurata changes in fishes farmed under extreme
Commission Grant (no. 10ZZ102), Shanghai Ocean Univer- conditions,” Science of the Total Environment, vol. 403, no.
sity (A-2400-09-0140), National Natural Science Foundation 1–3, pp. 148–153, 2008.
of China (31072228), and Science & Technology Commit- [15] C. Ton, D. Stamatiou, and C. C. Liew, “Gene expression
tee of Shanghai (09320503500), and Natural Environment profile of zebrafish exposed to hypoxia during development,”
Research Council (NER/T/S/2001/00282) also funded the Physiological Genomics, vol. 13, no. 2, pp. 97–106, 2003.
study. [16] D. L. van der Meer, G. E. van den Thillart, F. Witte et al.,
“Gene expression profiling of the long-term adaptive response
to hypoxia in the gills of adult zebrafish,” American Journal of
References Physiology, vol. 289, no. 5, pp. R1512–R1519, 2005.
[17] J. A. Sulikowski and L. A. Maginniss, “Effects of environmental
[1] C. E. Willett, A. Cortes, A. Zuasti, and A. G. Zapata, “Early dilution on body fluid regulation in the yellow stingray,
hematopoiesis and developing lymphoid organs in the Urolophus jamaicensis,” Comparative Biochemistry and
zebrafish,” Developmental Dynamics, vol. 214, no. 4, pp. Physiology A, vol. 128, no. 2, pp. 223–232, 2001.
323–336, 1999. [18] B. L. Mui, P. R. Cullis, E. A. Evans, and T. D. Madden,
[2] J. H. Rombout, H. B. Huttenhuis, S. Picchietti, and G. “Osmotic properties of large unilamellar vesicles prepared by
Scapigliati, “Phylogeny and ontogeny of fish leucocytes,” Fish extrusion,” Biophysical Journal, vol. 64, no. 2, pp. 443–453,
and Shellfish Immunology, vol. 19, no. 5, pp. 441–455, 2005. 1993.
[3] J. Meseguer, M. A. Esteban, A. Garcia Ayala, A. Lopez Ruiz, [19] P. K. T. Pang, R. W. Griffith, and J. W. Atz, “Osmoregulation
and B. Agulleiro, “Granulopoiesis in the head-kidney of the in elasmobranchs,” American Zoologist, vol. 17, no. 2, pp.
sea bass (Dicentrarchus labrax l.): an ultrastructural study,” 365–377, 1977.
Archives of Histology and Cytology, vol. 53, no. 3, pp. 287–296, [20] T. J. Shuttleworth, “Salt and water balance-extrarenal mech-
1990. anisms,” in Physiology of Elasmobranch Fishes, T. J. Shuttle-
[4] M. A. Esteban, J. Munoz, and J. Meseguer, “Blood cells of sea worth, Ed., pp. 171–199, Springer, New York, NY, USA, 1988.
bass (Dicentrarchus labrax L.). Flow cytometric and micro- [21] W. N. Holmes and E. M. Donaldson, “Body compartments
scopic studies,” Anatomical Record, vol. 258, no. 1, pp. 80–89, and distribution of electrolytes,” in Fish Physiology, W. S. Hoar
2000. and D. J. Randall, Eds., vol. 1, pp. 1–89, Academic Press, New
[5] F. J. Stephens, S. R. Raidal, and B. Jones, “Haematopoietic York, NY, USA, 1969.
necrosis in a goldfish (Carassius auratus) associated with [22] A. R. Cooper and S. Morris, “Haemoglobin function and
an agent morphologically similar to herpesvirus,” Australian respiratory status of the Port Jackson shark, Heterodontus
Veterinary Journal, vol. 82, no. 3, pp. 167–169, 2004. portusjacksoni, in response to lowered salinity,” Journal of
[6] J. Boomker, “The haemocytology and histology of the Comparative Physiology B, vol. 174, no. 3, pp. 223–236, 2004.
haemopoietic organs of South African fresh water fish. I. The [23] E. Weybourne, J. M. Warne, H. Hentschel, M. Elger, and R.
haemopoietic organs of Clarias gariepinus and Sarotherodon J. Balment, “Renal morphology of the euryhaline flounder
mossambicus,” Onderstepoort Journal of Veterinary Research, (Platichthys flesus): distribution of arginine vasotocin
vol. 46, no. 4, pp. 217–222, 1979. receptor,” Annals of the New York Academy of Sciences, vol.
[7] J. Boomker, “The haematology and histology of the 1040, pp. 521–523, 2005.
haemopoietic organs of South African freshwater fish. III. The [24] R. Grubina, Z. Huang, S. Shiva et al., “Concerted nitric oxide
leucocytes, plasma cells and macrophages of Clarias gariepinus formation and release from the simultaneous reactions of
and Sarotherodon mossambicus,” Onderstepoort Journal of nitrite with deoxy—and oxyhemoglobin,” Journal of Biological
Veterinary Research, vol. 48, no. 4, pp. 185–193, 1981. Chemistry, vol. 282, no. 17, pp. 12916–12927, 2007.
Evidence-Based Complementary and Alternative Medicine 11
Research Article
Species Identification of Marine Fishes in China
with DNA Barcoding
Junbin Zhang
College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China
DNA barcoding is a molecular method that uses a short standardized DNA sequence as a species identification tool. In this study,
the standard 652 base-pair region of the mitochondrial cytochrome oxidase subunit I gene (COI) was sequenced in marine fish
specimens captured in China. The average genetic distance was 50-fold higher between species than within species, as Kimura two
parameter (K2P) genetic distances averaged 15.742% among congeners and only 0.319% for intraspecific individuals. There are no
overlaps of pairwise genetic variations between conspecific and interspecific comparisons apart from the genera Pampus in which
the introgressive hybridization was detected. High efficiency of species identification was demonstrated in the present study by
DNA barcoding. Due to the incidence of cryptic species, an assumed threshold is suggested to expedite discovering of new species
and biodiversity, especially involving biotas of few studies.
protocol [27]. Firstly, fragments of the 5 region of the mito- VR1d t1: ∗∗ 5 -CAGGAAACAGCTATGACTAGACT-
chondrial COI gene were PCR-amplified using C FishF1t1/ TCTGGGTGGCCAAAGAATCA-3 .
C FishR1t1 primer cocktails [28]. The cocktail C FishF1t1 LepR1 t1: ∗∗ 5 -CAGGAAACAGCTATGACTAAAC-
contained two primers (FishF2 t1/VF2 t1), and C FishR1t1 TTCTGGATGTCCAAAAAATCA-3 .
also contained two primers (FishR2 t1/ FR1d t1). All PCR
primers were tailed with M13 sequences to facilitate sequenc- VRli t1: ∗∗ 5 -CAGGAAACAGCTATGACTAGACT-
ing of products. The nucleotide sequences of the primers TCTGGGTGICCIAAIAAICA-3 .
were ∗
The M13F primer sequence is underlined; ∗∗
the
FishF2 t1: ∗ 5 -TGTAAAACGACGGCCAGTCGACT- M13R primer sequence is underlined.
AATCATAAAGATATCGGCAC-3 . The thermocycling protocol used was 1 min at 95◦ C and
VF2 t1: ∗ 5 -TGTAAAACGACGGCCAGTCAACCA- 35 cycles of 30 sec at 94◦ C, 40 sec at 50◦ C, and 1 min at 72◦ C,
ACCACAAAGACATTGGCAC-3 . with a final extension at 72◦ C for 10 min. Sequecing PCR and
FishR2 t1: ∗∗ 5 -CAGGAAACAGCTATGACACTTC- sequencing followed above procedure.
AGGGTGACCGAAGAATCAGAA-3 . DNA sequences were aligned with SEQSCAPE v.2.5
software (Applied Biosystems, Inc.). Sequence divergences
FR1d t1: ∗∗ 5 -CAGGAAACAGCTATGACACCTCA- were calculated using the Kimura two parameter (K2P)
GGGTGTCCGAARAAYCARAA-3 . distance model [29], and unrooted NJ trees based on K2P
∗ ∗∗ distances were created in MEGA software [30]. In the chosen
The M13F primer sequence is underlined; the
M13R primer sequence is underlined. taxonomic group, phylogenetic analysis was carried out in
PAUP 4.010b using the maximum parsimony (MP) method,
PCR reactions were carried out in 96-well plates using with 1,000 replications of the full heuristic search.
Mastercycler Eppendorf gradient thermal cyclers (Brink- The following categories of K2P distances were calcu-
mann Instruments, Inc.). The reaction mixture of 825 μl lated: intraspecific distances (S), interspecies within the con-
water, 125 μl 10× buffer, 62.5 μl MgCl2 (25 mM), 6.25 μl gener (G), and interspecies from different genus but within
dNTP (10 mM), 6.25 μl each primer (0.01 mM), and 6.25 μl intrafamily (F). These values were plotted using the boxplot
Taq DNA polymerase (5 U/μl) was prepared for 96 wells of representation of R. Boxplots [31] in SPSS 11.5 software
each plate, in which each well contained 10.5 μl mixture and (SPSS Inc., Chicago, IL, USA). Only for families containing
2 μl genomic DNA. Thermocycling comprised an initial step 2 or more genera, separate boxplot was constructed for the
of 2 min at 95◦ C and 35 cycles of 30 sec at 94◦ C, 40 sec at sake of comparisons among taxonomic categories. Boxplots
52◦ C, and 1 min at 72◦ C, with a final extension at 72◦ C for describe median (central bar), interquartile range (IQR:
10 min. Amplicons were visualized on 2% agarose E-Gel 96- between upper (Q3) and low (Q1) quartile), values lying
well system (Invitrogen). PCR products were amplified again within 1.5× IQR beneath Q1 or 1.5× above Q3 (“whiskers”),
with the primers M13F (5 -TGTAAAACGACGGCCAGT-3 ) and extreme values (outliers). Mann-Whitney tests were
and M13R (5 -CAGGAAACAGCTATGAC-3 ), respectively, performed between S, G, and F distributions to estimate the
using the BigDye Terminator v.3.1 Cycle Sequencing Kit overlap among taxonomic ranks.
(Applied Biosystems, Inc.). Thermocycling conditions were
as follows: an initial step of 2 min at 96◦ C and 35 cycles of 3. Results
30 sec at 96◦ C, 15 sec at 55◦ C, and 4 min at 60◦ C. Sequencing
was performed on an ABI 3730 capillary sequencer according A total of 329 specimens were analyzed, from which 321
to manufacturer’s instructions. sequences (all >500 bp) belonging to 121 species (another
For specimens that failed to yield sequences using the species was identified to the genus level) were ultimately obt-
primer combinations above, a second round of PCR using ained (GenBank accession numbers: EF607296-EF607616).
the alternative C VF1LFt1/ C VR1LRt1 primer combination These species cover the majority of fishes living in the coast-
was carried out. C VF1LFt1 consisted of four primers (VF1 line of the South China Sea. All sequences were aligned with
t1/VF1d t1/LepF1 t1/VFli t1), and C VR1LRt1 also compri- a consensus length of 652 bp, and no insertions, deletions,
sed four primers (VR1 t1/VR1d t1/LepR1 t1/VRli t1) [28]. or stop codons were observed in any sequence. However,
multiple haplotypes were detected for some species.
VF1 t1: ∗ 5 -TGTAAAACGACGGCCAGTTCTCAA-
Except for Acentrogobius caninus, Scomber japonicus,
CCAACCACAAAGACATTGG-3 .
Terapon jarbua, Upeneus sulphureus, Elops hawaiensis, Gym-
VF1d t1: ∗ 5 -TGTAAAACGACGGCCAGTTCTCA- nothorax pseudothyrsoideus, Dendrophysa russelii, and Pen-
ACCAACCACAARGAYATYGG-3 . nahia anea (which reached the maximum value of 2.02%),
LepF1 t1: ∗ 5 -TGTAAAACGACGGCCAGTATTCA- intraspecific genetic distances were generally below 1%, and
ACCAATCATAAAGATATTGG-3 . some decreased to zero (between some intraspecific individ-
uals of Thryssa setirostris, Parapercis ommatura, Scatophagus
VFli t1: ∗ 5 -TGTAAAACGACGGCCAGTTCTCAA- argus, etc.).
CCAACCAIAAIGAIATIGG-3 . The mean intraspecies K2P (Kimura two-parameter)
VR1 t1: ∗∗ 5 -CAGGAAACAGCTATGACTAGACT- distance was 0.319%; the distance increased sharply to
TCTGGGTGGCCRAARAAYCA-3 . 15.742% among individuals of congeneric species. Overall,
Evidence-Based Complementary and Alternative Medicine 3
Table 1: Genetic divergences (percentage, K2P distance) within various taxonomic levels. Data are based on 321 sequences (>500 bp) from
122 species.
Comparisons within Taxa Number of comparisons Mean Median Minimum Maximum s.e.#
Species 121 453 0.319 0.150 0 2.021∗ 0.018
Genus 85 397 15.742 16.490 0.154∗∗ 25.189 0.292
Family 55 848 20.199 19.850 11.532 34.333 0.134
Order 15 17881 24.656 — 12.923 39.627 0.024
Class 2 29262 25.225 — 15.730 40.800 0.016
∗ ∗∗
Pennahia anea; Pampus argenteus versus Pampus cinereus.
# Standard error.
40 40
Clupeidae
Engraulidae
Carangidae
Scombrbidae
Leiognathidae
Mullidae
Synodontidae
Cynoglossidae
Monacanthidae
Muraenesocidae
30 30
k2P genetic distance (%)
10 10
p.anea
P.argenteus versus P.cinereus
0 0
−10 −10
S G F S GF S GF S GF S GF S GF S GF S GF S GF S GF S GF
Figure 1: Box plots of K2P distances. IQR: interval into which Figure 2: Boxplot distributions of S, G, and F. Intra-species (S),
the “central” 50% of the data fall. Black bar in the box indicates interspecies among congeneric species (G), and intergenera but
the median. Circle: “mild outlier” and asterisks: “extreme outliers”. intrafamily (F) K2P distances for different families.
Extreme outliers are discussed in the text.
the average genetic distance among congeneric species is divergences among congeneric species are above 10%. There
nearly 50-fold higher than that among individuals within are no overlaps between intraspecific and congeneric K2P
species. For the higher taxonomic ranks (family, order, and distances within the same family (Figure 3).
class), mean pairwise genetic distances increased gradually At the species level, all COI sequences clustered in
and reached 20.199%, 24.656%, and 25.225%, respectively monophyletic species units. At the family level, there were
(Table 1). Standard errors for K2P genetic distances were paraphyletic clusters for three families (Carangidae, Gobi-
small, and values of the mean and median were close idae, and Ariidae) (Figure 3), though over 98% of specimens
within different taxonomic ranks (Table 1). This indicates fell into the expected division of families. Intrafamily K2P
fluctuations of K2P genetic distances tend to be convergent distances (F) were generally higher than congeneric (G)
(Figures 1 and 2). distances, which were definitely higher than intraspecific
In the unrooted NJ (neighbour-joining) tree (Figure 3), (S) distances (Table 1, all Mann-Whitney tests were highly
three specimens of Pampus argentenus were grouped together significant, P value <10−6). However, overlaps between F
and contained within the cluster of Pampus cinereus. These and G distances were observed in Clupeidae, Carangidae,
Pampus argentenus specimens were collected in the same site Mullidae, and Muraenesocidae.
off the west coast of the South China Sea, and were difficult
to identify because of their complex morphological char- 4. Discussion
acteristics (available at http://www.barcodinglife.org/). They
possessed combined characteristics of Pampus cinereus and In morphological taxonomy, characters are delimited usually
Pampus argentenus: the asymmetrical tail of Pampus cinereus without any explicit criteria for character selection or coding,
and silver color of Pampus argentenus. If the suspicious and morphological data sets have the potential to be quite
congeneric K2P distances in the genera Pampus are excluded arbitrary. For example, morphologists do not generally
(the extreme outliers in Figure 1), the pairwise genetic report their criteria for including or excluding characters,
4 Evidence-Based Complementary and Alternative Medicine
5%
Dendrophysa russelii|FSCS071-06|FSCS 29-W-4|Sciaenidae
Dendrophysa russelii|FSCS070-06|FSCS 29-W-3|Sciaenidae
Dendrophysa russelii|FSCS069-06|FSCS 29-W-2|Sciaenidae
Dendrophysa russelii|FSCS072-06|FSCS 29-W-5|Sciaenidae
Dendrophysa russelii|FSCS068-06|FSCS 29-W-1|Sciaenidae
Johnius belangerii|FSCS297-06|FSCS 76-b-1|Sciaenidae
Johnius belangerii|FSCS201-06|FSCS 76-l-2|Sciaenidae
Johnius belangerii|FSCS200-06|FSCS 76-l-1|Sciaenidae
Scomberomorus commerson|FSCS248-06|FSCS 86-yz-1|Scombridae
Scomberomorus guttatus|FSCS228-06|FSCS 86-l-2|Scombridae
Scomberomorus guttatus|FSCS298-06|FSCS 86-b-1|Scombridae
Scomberomorus guttatus|FSCS249-06|FSCS 86-yz-2|Scombridae
Scomber japonicus|FSCS090-06|FSCS 38-W-2|Scombridae
Scomber japonicus|FSCS180-06|FSCS 38-l-1|Scombridae
Scomber japonicus|FSCS091-06|FSCS 38-W-3|Scombridae
Scomber japonicus|FSCS309-06|FSCS 38-sz-1|Scombridae
Scomber japonicus|FSCS089-06|FSCS 38-W-1|Scombridae
Scomber japonicus|FSCS181-06|FSCS 38-l-2|Scombridae
Scomber japonicus|FSCS092-06|FSCS 38-W-4|Scombridae
Scomber sp.|FSCS093-06|FSCS 38-W-5|Scombridae
Lepturacanthus savala|FSCS007-06|FSCS 3-w-1|Trichiuridae
Lepturacanthus savala|FSCS290-06|FSCS 3-b-1|Trichiuridae
Trichiurus lepturus|FSCS156-06|FSCS 3-l-2|Trichiuridae
Trichiurus lepturus|FSCS155-06|FSCS 3-l-1|Trichiuridae
Parupeneus ciliatus|FSCS211-06|FSCS 79-l-2|Mullidae
Parupeneus ciliatus|FSCS210-06|FSCS 79-l-1|Mullidae
Upeneus sulphureus|FSCS046-06|FSCS 22-W-2|Mullidae
Upeneus sulphureus|FSCS045-06|FSCS 22-W-1|Mullidae
Upeneus sulphureus|FSCS171-06|FSCS 22-l-1|Mullidae
Upeneus japonicus|FSCS245-06|FSCS 56-yz-1|Mullidae
Upeneus japonicus|FSCS129-06|FSCS 56-w-4|Mullidae
Upeneus japonicus|FSCS127-06|FSCS 56-w-2|Mullidae
Upeneus japonicus|FSCS128-06|FSCS 56-w-3|Mullidae
Upeneus japonicus|FSCS126-06|FSCS 56-w-1|Mullidae
Upeneus subvittatus|FSCS130-06|FSCS 56-w-5|Mullidae
Upeneus tragula|FSCS209-06|FSCS 78-l-3|Mullidae
Upeneus tragula|FSCS208-06|FSCS 78-l-2|Mullidae
Upeneus tragula|FSCS207-06|FSCS 78-l-1|Mullidae
Upeneus tragula|FSCS279-06|FSCS 78-z-1|Mullidae
Sardinella aurita|FSCS329-06|FSCS 114-st-3|Clupeidae
Sardinella aurita|FSCS328-06|FSCS 114-st-2|Clupeidae
Sardinella aurita|FSCS327-06|FSCS 114-st-1|Clupeidae
Amblygaster clupeoides|FSCS286-06|FSCS 94-z-1|Clupeidae
Sardinella jussieu|FSCS272-06|FSCS 18-z-5|Clupeidae
Sardinella jussieu|FSCS271-06|FSCS 18-z-4|Clupeidae
Sardinella melanura|FSCS235-06|FSCS 107-l-1|Clupeidae
Sardinella melanura|FSCS169-06|FSCS 18-l-2|Clupeidae
Sardinella melanura|FSCS269-06|FSCS 18-z-2|Clupeidae
Sardinella melanura|FSCS268-06|FSCS 18-z-1|Clupeidae
Sardinella melanura|FSCS168-06|FSCS 18-l-1|Clupeidae
Sardinella sp.|FSCS287-06|FSCS 94-z-2|Clupeidae
Dussumieria elopsoides|FSCS036-06|FSCS 16-W-2|Clupeidae
Dussumieria elopsoides|FSCS035-06|FSCS 16-W-1|Clupeidae
Dussumieria elopsoides|FSCS262-06|FSCS 16-z-1|Clupeidae
Anchoviella sp.|FSCS265-06|FSCS 17-z-3|Engraulidae
Engraulis japonicus|FSCS267-06|FSCS 17-z-5|Engraulidae
Engraulis japonicus|FSCS266-06|FSCS 17-z-4|Engraulidae
Engraulis japonicus|FSCS263-06|FSCS 17-z-1|Engraulidae
Thryssa hamiltonii|FSCS019-06|FSCS 9-w-5|Engraulidae
Thryssa hamiltonii|FSCS016-06|FSCS 9-w-2|Engraulidae
Thryssa kammalensis|FSCS161-06|FSCS 9-l-3|Engraulidae
Thryssa kammalensis|FSCS241-06|FSCS 9-yz-2|Engraulidae
Thryssa kammalensis|FSCS015-06|FSCS 9-w-1|Engraulidae
Thryssa kammalensis|FSCS017-06|FSCS 9-w-3|Engraulidae
Thryssa kammalensis|FSCS240-06|FSCS 9-yz-1|Engraulidae
Thryssa kammalensis|FSCS160-06|FSCS 9-l-2|Engraulidae
Thryssa kammalensis|FSCS159-06|FSCS 9-l-1|Engraulidae
Thryssa setirostris|FSCS018-06|FSCS 9-w-4|Engraulidae
Thryssa setirostris|FSCS014-06|FSCS 8-w-1|Engraulidae
Thryssa setirostris|FSCS158-06|FSCS 8-l-1|Engraulidae
Chirocentrus dorab|FSCS176-06|FSCS 26-l-2|Chirocentridae
Chirocentrus nudus|FSCS056-06|FSCS 26-W-1|Chirocentridae
Chirocentrus nudus|FSCS057-06|FSCS 26-W-2|Chirocentridae
Chirocentrus nudus|FSCS058-06|FSCS 26-W-3|Chirocentridae
Chirocentrus nudus|FSCS175-06|FSCS 26-l-1|Chirocentridae
Arnoglossus polyspilus|FSCS118-06|FSCS 52-w-3|Bothidae
Arnoglossus polyspilus|FSCS117-06|FSCS 52-w-2|Bothidae
Arnoglossus polyspilus|FSCS116-06|FSCS 52-w-1|Bothidae
Fistularia commersonii|FSCS215-06|FSCS 81-l-2|Fistulariidae
Fistularia commersonii|FSCS214-06|FSCS 81-l-1|Fistulariidae
Harpadon nehereus|FSCS326 06|FSCS 113 st 1|Synodontidae
(a)
Figure 3: Continued.
Evidence-Based Complementary and Alternative Medicine 5
(b)
Figure 3: Continued.
6 Evidence-Based Complementary and Alternative Medicine
(c)
Figure 3: Continued.
Evidence-Based Complementary and Alternative Medicine 7
(d)
Figure 3: Neighbor-joining (NJ) tree of COI sequences. Scale: 5% K2P distance. The first numbers following species names are the process
IDs, and the latter are the sample IDs.
8 Evidence-Based Complementary and Alternative Medicine
and when criteria are given, they vary considerably among cannot set a threshold of the genetic variation in species
studies [32]. Thus, it is not surprising that there are so many delimitation, we find ourselves sunk in the dilemma facing
synonyms for organisms [33], and an objective, rigorous new or cryptic species. On the one hand, the morphological
species delimitation according to explicit criteria is therefore taxonomy cannot give a definite identification. On the
necessary for many taxonomic studies [34]. While DNA other hand, we cannot claim that it may be a new species
barcoding provides taxonomic identification for a specimen, based on molecular analysis without the species delimitation.
the accuracy of such an assignment depends on whether An assumed threshold is helpful to expedite discovery of
species are monophyletic with respect to sequence variations new species and biodiversity, especially in dealing with
of the COI gene. That is, individuals of a given species little-studied biotas, although a single, uniform threshold
are more closely related to all other conspecifics than to for species delimitation seems arbitrary because rates of
any member of other species. Except for the hybridized molecular evolution vary widely within and among lineages
specimens in the genus Pampus, there are no overlaps [24, 25, 48].
between genetic variations of S and G (Figure 1).
The factors responsible for deviations from taxonomic Acknowledgments
monophyly may be varied and complex [35]; one potential
cause of species-level polyphyly is the occasional mat- Thanks are due to Chinese National Funding U0633007 and
ing between distinct species, resulting in hybrid offspring 40776089 and CAS Founding KZCX2-YW-213.
carrying a mixture of genes from both parent species.
Furthermore, mitochondrial genes are generally subjected
to introgression more frequently than nuclear ones, and
References
introgression also leads to phylogenetic paraphyly [35– [1] R. S. Rasmussen, M. T. Morrissey, and P. D. N. Hebert,
38], like the hybridization between Pampus argentenus and “DNA barcoding of commercially important salmon and trout
Pampus cinereus in this study. In such cases, combinations species (oncorhynchus and salmo ) from North America,”
of morphological and genotypic data are needed for species Journal of Agricultural and Food Chemistry, vol. 57, no. 18, pp.
assignment of hybrids. 8379–8385, 2009.
Biological mechanisms, water dynamics, or historical [2] B. C. Victor, R. Hanner, M. Shivji, J. Hyde, and C. Cal-
events may cause deep genetic structuring of populations dow, “Identification of the larval and juvenile stages of the
in marine species [26, 39]. Many explanations for genetic Cubera Snapper, Lutjanus cyanoptems , using DNA barcoding,”
population structuring on local and regional scales involve Zootaxa, no. 2215, pp. 24–36, 2009.
behaviors such as the adoption of pelagic early life stages [3] B. Patwardhan, D. Warude, P. Pushpangadan, and N. Bhatt,
and movement over broad geographic ranges, and these “Ayurveda and traditional Chinese medicine: a comparative
overview,” Evidence-Based Complementary and Alternative
factors are theoretically associated with gene flow [40–42].
Medicine, vol. 2, no. 4, pp. 465–473, 2005.
For many marine fishes, there is a lack of phylogeographic
[4] S. E. Bartlett and W. S. Davidson, “Identification of Thunnus
structure among populations [43, 44]; in this study, for tuna species by the polymerase chain reaction and direct
individuals from long distance localities, some intraspecific sequence analysis of their mitochondrial cytochrome b genes,”
genetic variations reduced to zero within families Carangi- Canadian Journal of Fisheries and Aquatic Sciences, vol. 48, pp.
dae, Sciaenidae, and Mullidae. However, some pairwise 309–317, 1991.
K2P distances exceeded 1.00% within the coastal species [5] A. Rocha-Olivares, “Multiplex haplotype-specific PCR: a new
such as Acentrogobius caninus, Scomber japonicus, Terapon approach for species identification of the early life stages of
jarbua, Upeneus sulphureus, Elops hawaiensis, Gymnothorax rockfishes of the species-rich genus Sebastes Cuvier,” Journal
pseudothyrsoideus, and Dendrophysa russelii. It implied that of Experimental Marine Biology and Ecology, vol. 231, no. 2,
biological mechanisms were responsible for the fluctuation pp. 279–290, 1998.
of intraspecific genetic divergences in marine fishes. [6] A. J. Gharrett, A. K. Gray, and J. Heifetz, “Identification
The neighbor-joining method was originally employed in of rockfish (Sebastes spp.) by restriction site analysis of the
this study for species identification, but some phylogenetic mitochondrial ND-3/ND-4 and 12S/16S rRNA gene regions,”
information was also revealed by the dendrogram, and over Fishery Bulletin, vol. 99, no. 1, pp. 49–62, 2001.
98% of specimens were allocated into different families with- [7] B. Horstkotte and H. Rehbein, “Fish species identification by
out polyphyly/paraphyly in the NJ tree (Figure 3). However, means of restriction fragment length polymorphism and high-
performance liquid chromatography,” Journal of Food Science,
DNA barcoding is independent of the way the taxonomy has
vol. 68, no. 9, pp. 2658–2666, 2003.
been built, and it cannot be regarded as the “taxonomic” tag
[8] C. J. Noell, S. Donnellan, R. Foster, and L. Haigh, “Molecular
[45]. DNA barcoding is no substitute for taxonomy Ebach discrimination of garfish Hyporhamphus (Beloniformes) lar-
and Holdrege [46], and a great deal of work is needed vae in southern Australian waters,” Marine Biotechnology, vol.
to bring about the reconciliation between traditional and 3, no. 6, pp. 509–514, 2001.
molecular taxonomy. It is unfeasible to build the phylogeny [9] J. Zhang, L. Huang, and H. Huo, “Larval identification of
of fishes only based on mitochondrial DNA fragments. Lutjanus Bloch in Nansha coral reefs by AFLP molecular
Polyphyly/paraphyly in the NJ tree probably results from method,” Journal of Experimental Marine Biology and Ecology,
“bad taxonomy” when named species fail to identify the vol. 298, no. 1, pp. 3–20, 2004.
genetic limits of separate evolutionary entities, particularly [10] G. Comi, L. Iacumin, K. Rantsiou, C. Cantoni, and L. Cocolin,
for perplexing taxa involving cryptic species [47]. If we “Molecular methods for the differentiation of species used in
Evidence-Based Complementary and Alternative Medicine 9
production of cod-fish can detect commercial frauds,” Food [26] P. H. Barber, S. R. Palumbi, M. V. Erdmann, and M. K. Moosa,
Control, vol. 16, no. 1, pp. 37–42, 2005. “Biogeography: a marine Wallace’s line?” Nature, vol. 406, no.
[11] P. D. N. Hebert, A. Cywinska, S. L. Ball, and J. R. DeWaard, 6797, pp. 692–693, 2000.
“Biological identifications through DNA barcodes,” Proceed- [27] N. V. Ivanova, J. R. DeWaard, and P. D. N. Hebert, “An inex-
ings of the Royal Society B: Biological Sciences, vol. 270, no. pensive, automation-friendly protocol for recovering high-
1512, pp. 313–321, 2003. quality DNA,” Molecular Ecology Notes, vol. 6, no. 4, pp. 998–
[12] P. D. N. Hebert, E. H. Penton, J. M. Burns, D. H. Janzen, and 1002, 2006.
W. Hallwachs, “Ten species in one: DNA barcoding reveals [28] N. V. Ivanova, T. S. Zemlak, R. H. Hanner, and P. D. N.
cryptic species in the neotropical skipper butterfly Astraptes Hebert, “Universal primer cocktails for fish DNA barcoding,”
fulgerator,” Proceedings of the National Academy of Sciences of Molecular Ecology Notes, vol. 7, no. 4, pp. 544–548, 2007.
the United States of America, vol. 101, no. 41, pp. 14812–14817, [29] M. Kimura, “A simple method for estimating evolutionary
2004. rates of base substitutions through comparative studies of
[13] M. Hajibabaei, D. H. Janzen, J. M. Burns, W. Hallwachs, and nucleotide sequences,” Journal of Molecular Evolution, vol. 16,
P. D. N. Hebert, “DNA barcodes distinguish species of tropical no. 2, pp. 111–120, 1980.
Lepidoptera,” Proceedings of the National Academy of Sciences [30] S. Kumar, K. Tamura, and M. Nei, “MEGA3: integrated
of the United States of America, vol. 103, no. 4, pp. 968–971, software for molecular evolutionary genetics analysis and
2006. sequence alignment,” Briefings in Bioinformatics, vol. 5, no. 2,
[14] D. M. Lambert, A. Baker, L. Huynen, O. Haddrath, P. D. pp. 150–163, 2004.
N. Hebert, and C. D. Millar, “Is a large-scale DNA-based [31] J. W. Tuckey, Exploratory Data Analysis, Addison–Wesley,
inventory of ancient life possible?” Journal of Heredity, vol. 96, Boston, Mass, USA, 1977.
no. 3, pp. 279–284, 2005. [32] J. J. Wiens, Phylogenetic Analysis of Morphological Data,
[15] M. H. Greenstone, D. L. Rowley, U. Heimbach, J. G. Lundgren, Smithsonian Institution Press, Washington, DC, USA, 2000.
R. S. Pfannenstiel, and S. A. Rehner, “Barcoding generalist [33] J. Köhler, K. Munn, A. Rüegg, A. Skusa, and B. Smith,
predators by polymerase chain reaction: carabids and spiders,” “Quality control for terms and definitions in ontologies and
Molecular Ecology, vol. 14, no. 10, pp. 3247–3266, 2005. taxonomies,” BMC Bioinformatics, vol. 7, article 212, 2006.
[16] R. D. Ward, T. S. Zemlak, B. H. Innes, P. R. Last, and P. D. N. [34] M. Pfenninger, M. Cordellier, and B. Streit, “Comparing
Hebert, “DNA barcoding Australia’s fish species,” Philosophical the efficacy of morphologic and DNA-based taxonomy in
Transactions of the Royal Society B: Biological Sciences, vol. 360, the freshwater gastropod genus Radix (Basommatophora,
no. 1462, pp. 1847–1857, 2005. Pulmonata),” BMC Evolutionary Biology, vol. 6, article 100,
[17] G. G. Pegg, B. Sinclair, L. Briskey, and W. J. Aspden, “MtDNA 2006.
barcode identification of fish larvae in the southern Great [35] D. J. Funk and K. E. Omland, “Species-level paraphyly and
Barrier Reef, Australia,” Scientia Marina, vol. 70, no. 2, pp. 7– polyphyly: frequency, causes, and consequences, with insights
12, 2006. from animal mitochondrial DNA,” Annual Review of Ecology,
[18] N. Hubert, R. Hanner, E. Holm et al., “Identifying Canadian Evolution, and Systematics, vol. 34, pp. 397–423, 2003.
freshwater fishes through DNA barcodes,” PLoS ONE, vol. 3, [36] J. Arnold, “Cytonuclear disequilibria in hybrid zones,” Annual
no. 6, article e2490, 2008. Review of Ecology and Systematics, vol. 24, pp. 521–554, 1993.
[19] M. Vences, M. Thomas, R. M. Bonett, and D. R. Vieites, [37] T. G. Barraclough and S. Nee, “Phylogenetics and speciation,”
“Deciphering amphibian diversity through DNA barcoding: Trends in Ecology and Evolution, vol. 16, no. 7, pp. 391–399,
chances and challenges,” Philosophical Transactions of the Royal 2001.
Society B: Biological Sciences, vol. 360, no. 1462, pp. 1859–1868, [38] P. Alexandrino, R. Faria, D. Linhares et al., “Interspecific
2005. differentiation and intraspecific substructure in two closely
[20] M. Vences, M. Thomas, A. van der Meijden, Y. Chiari, and D. related clupeids with extensive hybridization, Alosa alosa and
R. Vieites, “Comparative performance of the 16S rRNA gene Alosa fallax,” Journal of Fish Biology, vol. 69, pp. 242–259, 2006.
in DNA barcoding of amphibians,” Frontiers in Zoology, vol. 2, [39] J. S. Nelson, R. J. Hoddell, L. M. Chou, W. K. Chan, and V.
article 5, 2005. P. E. Phang, “Phylogeographic structure of false clownfish,
[21] M. Aliabadian, M. Kaboli, V. Nijman, and M. Vences, “Molec- Amphiprion ocellaris, explained by sea level changes on the
ular identification of birds: performance of distance-based Sunda shelf,” Marine Biology, vol. 137, no. 4, pp. 727–736,
DNA barcoding in three genes to delimit parapatric species,” 2000.
PLoS ONE, vol. 4, no. 1, article e4119, 2009. [40] S. F. Chenoweth and J. M. Hughes, “Genetic population struc-
[22] V. Nijman and M. Aliabadian, “Performance of distance-based ture of the catadromous perciform: Macquaria novemaculeata
DNA barcoding in the molecular identification of Primates,” (Percichthyidae),” Journal of Fish Biology, vol. 50, no. 4, pp.
Comptes Rendus—Biologies, vol. 333, no. 1, pp. 11–16, 2010. 721–733, 1997.
[23] S. J. Scheffer, M. L. Lewis, and R. C. Joshi, “DNA barcoding [41] C. L. Dudgeon, N. Gust, and D. Blair, “No apparent genetic
applied to invasive leafminers (Diptera: Agromyzidae) in the basis to demographic differences in scarid fishes across
Philippines,” Annals of the Entomological Society of America, continental shelf of the great barrier reef,” Marine Biology, vol.
vol. 99, no. 2, pp. 204–210, 2006. 137, no. 5-6, pp. 1059–1066, 2000.
[24] K. W. Will and D. Rubinoff, “Myth of the molecule: DNA bar- [42] G. Bernardi, S. J. Holbrook, and R. J. Schmitt, “Gene flow at
codes for species cannot replace morphology for identification three spatial scales in a coral reef fish, the three-spot dascyllus,
and classification,” Cladistics, vol. 20, no. 1, pp. 47–55, 2004. Dascyllus trimaculatus,” Marine Biology, vol. 138, no. 3, pp.
[25] R. DeSalle, M. G. Egan, and M. Siddall, “The unholy 457–465, 2001.
trinity: taxonomy, species delimitation and DNA barcoding,” [43] S. R. Palumbi, “Genetic divergence, reproductive isolation,
Philosophical Transactions of the Royal Society B: Biological and marine speciation,” Annual Review of Ecology and System-
Sciences, vol. 360, no. 1462, pp. 1905–1916, 2005. atics, vol. 25, pp. 547–572, 1994.
10 Evidence-Based Complementary and Alternative Medicine
Research Article
Treatment of Rheumatoid Arthritis with Marine and Botanical
Oils: Influence on Serum Lipids
The gap in mortality between patients with rheumatoid arthritis (RA) and the general population (1.5–3.0 fold risk) is increasing.
This disparity is attributable mainly to cardiovascular disease (CVD), as the CVD risk is comparable to patients with diabetes
mellitus. The purpose of this study is to determine whether borage seed oil rich in gamma-linolenic acid, fish oil rich in
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), or the combination of both oils are useful treatments for
dyslipidemia in patients with RA. We randomized patients into a double blind, 18 month trial. Mixed effects models were used to
compare trends over time in serum lipids. No significant differences were observed between the three groups: All three treatment
groups exhibited similar meaningful improvement in the lipid profile at 9 and 18 months. When all groups were combined,
these treatments significantly reduced total and LDL-cholesterol and triglycerides, increased HDL-cholesterol, and improved the
atherogenic index. All improvements observed at 9 months persisted at 18 months (P < 0.001 verses baseline). Conclusion. Marine
and botanical oils may be useful treatment for rheumatoid arthritis patients who are at increased risk for cardiovascular disease
compared to the general population.
Omega-6-fatty acids
Delta-6-desaturase
Elongase
Delta-5-desaturase
Dihomogamma-linolenic acid (20:3) Arachidonic acid (20:4)
Figure 1
participate in development and regulation of immunological (TXA2 ), and leucotriene B4 (LTB4 ). Randomized, placebo
and inflammatory responses [15–18]. The fatty acids them- controlled double blind trials indicated that fish oil treatment
selves, by virtue of their incorporation into cell membranes of patients with RA result in clinical improvement, and those
and signal transduction elements, also have effects on cells that monitored NSAID use suggest that fish oil treatment has
involved in inflammation and immune responses that are an NSAID sparing effect [22].
independent of eicosanoids [18, 19]. A disease such as RA, A combination of EPA- and GLA-enriched oils exhibits
characterized by abnormal immune responses, persistent synergy in reduction of synovitis in animal models [23], and
inflammation, and joint tissue injury [20], may, therefore, be administration of black currant seed oil, which contains the
amenable to control by treatment with oils rich in specific n-3 fatty acid alpha-linolenic acid (which is converted to
polyunsaturated fatty acids. EPA) and the n-6 GLA, suppresses active synovitis in patients
Gamma-linolenic acid (GLA: 18:3 omega 6, see Figure 1) with RA [24]. Taken together, these studies suggest that both
is an essential fatty acid found in certain plant seed oils, inc- EPA and GLA are beneficial therapies for patients with RA.
luding borage seed oil. GLA is metabolized to dihomoga- With this knowledge, we carried out an 18-month, multi-
mma-linolenic acid (DGLA; 20:3 omega 6), the immediate center, randomized, double-blind, phase 3 trial of borage
precursor of prostaglandin E1 (PGE1 ), an eicosanoid with seed oil, fish oil, and a combination of both oils in patients
anti-inflammatory and immunoregulatory properties [18]. with RA and active synovitis, to determine whether the
In addition, GLA cannot be converted to inflammatory combination of oils is superior to either oil used alone for
leucotrienes by 5-lipoxygenase. Instead, it is converted to the treatment of RA. Clinical outcomes of that study will be
15-hydroxy-DGLA which has the additional virtue of sup- presented elsewhere. The object of the study presented here is
pressing 5-lipoxygenase activity [21]. GLA and DGLA also to assess the influence of marine and botanical oils on serum
modulate immune responses in an eicosanoid-independent lipids in patients with RA.
manner by acting directly on T lymphocytes [18] and GLA
suppresses acute and chronic inflammation, including arth- 2. Methods and Materials
ritis, in animal models [18]. In addition, fish oil, rich in
eicosapentaenoic acid (EPA; 20:5 omega 3, see Figure 2) and The study was an 18-month randomized double-blind
docosahexanoic acid (DHA; 22:6 w-3), suppresses formation comparison of borage oil, fish oil, or a combination of both
of the inflammatory eicosanoids PGE2 , thromboxane A2 oils in RA patients with active joint inflammation.
Evidence-Based Complementary and Alternative Medicine 3
Omega-3-fatty acids
Delta-6-desaturase
Stearadonic acid
Cyclooxygenase Lipoxygenase
PGH
LTD5
Synthases
LTE5
PGE3 PG13 TxA3
Figure 2
Patients received 3.5 gm omega-3 fatty acids daily in a Patients were ineligible for the study if they had been
2.1 gm EPA/1.4 gm DHA ratio (7 fish oil and 6 sunflower oil treated with any investigational drug within 1 month of
capsules daily), 1.8 gm/d GLA (6 borage oil and 7 sunflower entry. If a patient was taking a fish oil supplement, the dose
oil capsules/d), or 7 fish oil and 6 borage oil capsules was stable and ≤2000 mg/d for 2 months before screening. If
daily (combination therapy). All capsules were identical in a patient was taking a borage oil supplement, the dose was
appearance and color and were purchased from the manufac- stable and ≤2000 mg/d for 2 months before screening. An
turer, Bioriginal Food and Service Corp, Saskatoon, Canada, AST, ALT, or creatinine >1.5 times the upper limit of normal
who shipped the capsules in opaque plastic bottles to the or a total bilirubin >1.8 mg/dL excluded patients from the
University of Massachusetts University Hospital pharmacy, trial. Patients were instructed to maintain their typical diet.
from whence they were distributed to participating centers. The lipid profile was assessed at baseline, 9, and 18
Capsules were taken in 2 or 3 divided doses with meals. months. Diet was assessed by 24-hour dietary assessment
The protocol was reviewed and approved initially by calls (24-HR), performed at baseline and 18 months. Both
the Committee for the Protection of Human Subjects at laboratory evaluation and 24-HR were obtained in most
the University of Massachusetts Medical School and the patients who dropped out of the study before 18 months and
Food and Drug Administration. Subsequent approvals were after 3 months. These results are included in the analysis, and
obtained from the Review Boards at the University of were assigned to the closest 9-month interval to the date of
Alabama, Geisenger Clinic, Fallon Health Care, and the New patient’s termination in the study.
England IRB. Written informed consent was obtained from
each patient. 2.1. Dietary Assessment. To measure the effects of supple-
Patients were eligible to participate in the study if mental polyunsaturated fats upon lipids, it is necessary
they had RA according to the 1987 criteria of the American to measure the impact, if any, of the background diet.
Rheumatism Association [25], were in functional class I, II or Because a single 24-HR cannot assess day-to-day variation in
III according to the revised criteria of the American College dietary intake [27], 3 unannounced 24-HRs were conducted
of Rheumatology [26], and were between the ages of 18 and on randomly selected days within a 3-week period (two
85. Patients were on a stable dose of drugs for RA for at weekdays and one weekend) at baseline and 18 months or
least 2 months before the screening visit and a total duration time of the final visit. The dietary assessments, including
of therapy of at least 6 months. Doses of nonsteroidal reported intake of supplemental non-study marine and
anti-inflammatory drugs (NSAID) and/or prednisone botanical oils or phytosterols, were completed utilizing a
(<10 mg/d) were stable for at least 1 month before screening. computer-assisted telephone interview with a multiple pass
4 Evidence-Based Complementary and Alternative Medicine
technique [28]. The 24-HR dietary recalls were administered Table 1: Baseline characteristics in patients with rheumatoid
by non-intervention registered dietitians, blinded to the arthritis.
patients’ treatment group, and trained to collect dietary Total (N = 146)∗
data using our interview system. The 24-HR-derived data
Mean SD
were analyzed using the University of Minnesota Nutrition
Age 59.24 11.58
Coordinating Center Nutrition Data System for Research
software (annually updated, current version: NDS-R 2009). BMI (kg/m2 ) 30.55 8.3
Limitations to 24-HR dietary assessment in this population N %
include factors related to self report, including possible Gender
underreporting of nutrient intake which has been observed Male 28 19.2%
in several studies [29]. Female 118 80.8%
Marital status
2.2. Laboratory Measurement Methodology. Total cholesterol Married 100 69.0%
(TC) and triglyceride (TG) values were measured by con-
Other 45 31.0%
ventional enzymatic methods. Briefly, cholesterol esters are
Race-collapsed
converted to a colored quinine imine product. For HDL
cholesterol, the lipoprotein particles are solubilized and White 132 90.4%
release HDL cholesterol to react with cholesterol esterase and Minority 14 9.6%
oxidase in the presence of chromogens to produce a color Work status
product. LDL cholesterol is calculated [30] according to the Full time 51 34.90%
Friedewald Calculation which is TC-HDL − (TG ÷ 5) = LDL. Part time 14 9.60%
Atherogenic index of plasma (AIP) was used to measure the Other 81 55.50%
risk of hypertension, diabetes, and vascular events in this ∗
None of the demographics are significantly different across the groups at
population. The calculation of AIP is log 10 triglyceride/ baseline.
high-density lipoprotein cholesterol [31].
2.3. Statistical Methods. The three treatment arms were abnormal laboratory values. The overall drop-out rate was
characterized at baseline using frequencies for categorical 51% and was similar across groups: 25 in the borage oil
variables and means and standard deviations for continuous group, 28 in the fish oil group, and 22 in the combination
variables. Differences in mean values at 18 months or at the group. Reasons for dropout were mainly gastrointestinal
final visit were assessed for change in diet by the Student t- distress (belching, bloating, diarrhea, nausea, cramping) or
test [23]. Outcomes that were not normally distributed were an inability to swallow the large number of rather sizable
log transformed for calculation of P values. Nontransformed capsules.
data are reported for changes from baseline. To assess the Patient characteristics at baseline are presented in
effect of the intervention on lipids, lipid values were modeled Table 1. The mean age of participants was 59 years and
using linear mixed modeling as a function of time (baseline, 9 the sample predominantly female (80%). Most were white
month and 18 month, or the final visit treated as a categorical (90%), married (69%), and had a mean body mass index
variable to allow for nonlinear trajectories), treatment arm, (BMI) of 30.5. An equal number were retired (33%) or work-
and their interaction, with adjustment for baseline value. ing full time (34%), and 16% listed themselves as disabled.
To assess the overall changes over time, outcome measures There were no significant differences between groups.
were modeled using linear mixed modeling as a function of
time, treatment arm, and with adjustment for baseline value.
3.1. Diet. No significant change in dietary intake of fatty
All analyses were intention to treat. Analyses included all
acids was seen (Table 2). However, a significant (P < 0.001)
participants with a baseline lipid measure.
reduction in sources of dietary calcium (∼200 mg) and a
slight increase (1% of total calories) in protein intake were
3. Results observed.
One hundred fifty-six patients were randomized, 56 received
fish oil, 53 received borage seed oil, and 47 received both 3.2. Weight. No significant differences in weight between
fish and borage seed oils. Patients were stratified by site groups were observed. Analysis was done using log-trans-
(thus randomized to group within each site), and all sites formed weight; however, results are from the original scale.
were combined, resulting in non-significant differences per The mean increase when all groups were combined across the
group. Serum lipids were obtained in 146 patients (93.6%) entire study was not significant: 0.5 lb increase at 9 months
at baseline, 84 patients (53.8%) at 9 months, and 69 patients and 0.4 lb increase at 18 months (Table 4).
(44.2%) at 18 months.
Another 34 patients were screened but not randomized 3.3. Lipids. There were no significant differences between
for the following reasons: arthritis medicine dose was not groups for any lipid measure, with the exception of triglyc-
stable, too few tender joints, anticoagulated, high fish oil erides. Therefore, all groups were, combined to evaluate
intake, high borage seed oil intake, medical issues, or the influence of marine and botanical oils on serum lipids
Evidence-Based Complementary and Alternative Medicine 5
Table 2: Change in dietary factors from baseline to 18 months. data, which indicates that missing data would not have a large
impact on results from the all groups combined analyses.
Change in Mean 95% CI
Energy 9.01 −121.17 to 139.19 3.5. Blood Pressure. Significant changes in blood pressure
Total dietary fiber −0.15 −1.75 to 1.45 within and among groups were not observed. Systolic blood
Soluble dietary fiber −0.15 −0.64 to 0.33 pressure increased 1.8 mm hg at 9 months and decreased
Insoluble dietary fiber −0.05 −1.27 to 1.17 0.2 mm hg at 18 months. Diastolic blood pressure increased
Calcium −204.48 −375.78 to −33.19∗ 2.3 mm hg at 9 months and 1.9 mm hg at 18 months
PUFA 18:3 (linolenic acid) −0.03 −0.22 to 0.16
(Table 4).
% calories from fat −0.31 −2.28 to 1.65 3.6. Erythrocyte Sedimentation Rate (ESR) [32] and C-React-
% calories from SFA 0.09 −0.89 to 1.08 ive Protein (CRP). ESR is a common hematology test that
% calories from MUFA −0.13 −0.91 to 0.66 is a nonspecific measure of inflammation. CRP is a protein
% calories from PUFA −0.26 −1.21 to 0.69 found in the blood, and its levels increase in response to
Omega-3-fatty Acids 0.13 −0.12 to 0.38 inflammation.
% calories from carbohydrate −1.34 −3.19 to 0.51 No significant differences in ESR or in CRP were seen
% calories from protein 1.17 0.13 to 2.21∗ among groups. However, when patients from all treatment
∗ groups were analyzed together, a modest but significant
Values are presented as regression coefficient (95% CI) unless stated
otherwise and control from baseline values. P < 0.001. reduction in ESR was seen at 9 months, and ESR was still
reduced from baseline at 18 months. A similar small but
significant reduction in CRP was seen at 9 months, but not
(Table 3(a)). Lipids were done at baseline, 9 months, 18 maintained at 18 months (Table 4).
months, or when the patient terminated the trial.
Total cholesterol reduction from baseline was 3.4 mg/dL 4. Discussion
(P = 0.129) at 9 months and 8.4 mg/dL (P ≤ 0.001) Part of the intrigue of research is the often unanticipated
at 18 months. LDL was reduced significantly by 4.4 mg/dL findings encountered. The current study was not designed
at 9 months (P = 0.019) and 9.4 mg/dL at 18 months to detect differences in lipids in patients with RA; hence,
(P ≤ 0.001). HDL was significant: 4.0 mg/dL increase at 9 we lack a control group. Because marine and botanical oils
months (P ≤ 0.001) and 5.0 mg/dL increase at 18 months given individually reduce joint inflammation in RA patients
(P < 0.001). TC/HDL ratio decreased significantly over [14–18], and because the groups in this study showed
the time of the trial: a 0.26 reduction at 9 months (P < improvement in the lipid profile, a trial of these oils with a
0.001) and a reduction of 0.43 at 18 months (P < 0.001). placebo arm is warranted.
Triglycerides were log transformed for analysis and reporting RA is a chronic systemic inflammatory disease. Mediators
of P values. However, the coefficients and the differences of inflammation and prothrombotic factors contribute to
reported are from the nonlog-transformed scale. Reductions endothelial dysfunction and development of cardiovascular
in triglyceride concentrations were observed in all 3 groups disease in RA patients [33]. There is little evidence that
(Table 3(a)). The overall decrease across the study period was therapy for inflammation also leads to cardiovascular risk
22.0 mg/dL at 9 months (P < 0.001) and 24.4 mg/dL at 18 reduction in this group. Marine and botanical oils represent
months (P < 0.001). The TG reduction in the group treated an excellent primary or secondary therapy for improvement
with both oils was significantly greater (P < 0.031) than the of cardiovascular risk management in patients with rheuma-
borage oil or fish oil groups at 9 months, a pattern that per- toid arthritis.
sisted at 18 months (Table 3(b)). Atherogenic index of plasma Results of studies presented in this paper indicate that a
(AIP) was reduced in all 3 groups (Table 3(a)). The overall GLA-enriched botanical oil (borage seed oil), an EPA/DHA-
decrease across the study period was 0.22 at 9 months (P < enriched fish oil, or a combination of these oils are useful for
0.001) and 0.26 at 18 months (P < 0.001). The reduction in correcting dyslipidemia in patients with RA. Since there were
the AIP was significantly greater (P = 0.011) at 9 months and no differences observed between the groups, with the notable
18 months in the group treated with both oils than that in the exception of triglycerides and the AIP (shown separately
groups treated with either oil alone (Table 3(b)). in Table 3(b)), all 3 treatment groups were analyzed as a
single group. Although lipid profiles of most patients were
3.4. Sensitivity Analysis of Lipids. A sensitivity analysis was acceptable at baseline, patients taking these oils exhibit sig-
run to detect if missing data might have affected the study nificant additional reductions in total and LDL cholesterol,
results. Missing data were imputed by substituting the triglycerides, the TC/HDL ratio, and the atherogenic index,
baseline value. Since this would be the worst case scenario, and experience a significant increase in HDL cholesterol. All
in which all missing data return to baseline; analyses were of these improvements in the lipid profile were seen after
repeated with the imputed data. The intragroup differences 9 months of therapy and increased after 18 months of oils
seen in triglyceride concentrations were not sustained with administration. Particularly noteworthy is the group treated
the imputed data. However, the intragroup differences seen with both oils, as they experienced a significantly greater
with the AIP did persist. The significant change seen with reduction in serum triglyceride concentrations and in the
all groups combined was also sustained with the imputed AIP than the groups on either oil alone. Oils enriched in
6 Evidence-Based Complementary and Alternative Medicine
Table 3
(a) Serum Lipids and Atherogenic Index of Plasma
Table 4: Change from baseline for anthropometric and inflamma- GLA affect inflammation differently than oils enriched in
tory markers. EPA/DHA, and the anti-inflammatory and joint protective
effects of the combination of these oils are synergistic
9 months (N = 88) 18 months (N = 71) in animal models [23]. Thus, it is possible that these
0.52 0.35 different oils influence different aspects of TG synthesis or
Weight† metabolism. Indeed, fish and botanical oils that provide EPA
(−1.41 to 2.46) (−2.43 to 3.14)
Systolic blood 1.77 −0.24
both reduce hepatic synthesis of TG in rats [34]. In humans
pressure (−0.66 to 4.20) (−3.37 to 2.90) the delta-5-desaturase that converts DGLA to arachidonic
acid (AA) is sluggish, and we have not seen increases in
Diastolic blood 2.32∗ 1.88∗∗ circulating arachidonic acid after administration of GLA
pressure (0.56 to 4.09) (−0.003 to 3.79)
for 24 weeks [17]. Nonetheless, the possibility of increased
−5.39∗ −4.42∗∗ circulating AA must be considered if treatment is to be long
ESR†
(−9.71 to −1.07) (−9.22 to 0.38) term. When fish oil is administered with borage oil to healthy
−0.65∗ −0.09 individuals, bioconversion of GLA to AA is prevented [34],
CRP†
(−1.20 to −0.10) (−0.77 to 0.60) perhaps another reason for administering both GLA- and
∗
P < 0.001. EPA-rich oils together.
∗∗ P ≤ 0.05.
† P values are from log-transformed data.
All treatments were safe. Rates and types of adverse
events were similar across all treatment groups, and as
N = 90 at 9 months and N = 72 at 18 months for blood pressure measu-
rements. anticipated, were due entirely to mild to moderate gastroin-
N = 81 at 9 months and N = 67 at 18 months for ESR. testinal distress. The main reason for the large drop-out
N = 66 at 9 months and N = 58 at 18 months for CRP. rate (in excess of 45%) was the large size and the number
Evidence-Based Complementary and Alternative Medicine 7
of capsules ingested each day over the 18-month-study and EPA-rich oils to reduce platelet aggregation [49] and
period. It is possible to deliver much larger amounts of the production of inflammatory cytokines [18] and the ability
individual polyunsaturated fatty acids (GLA, EPA, and DHA) of EPA to form resolvins and protectins, compounds that
in far smaller capsules than are needed to accommodate the facilitate resolution of inflammation [50], further suggest
natural marine and botanical oils, a strategy which should their potential long-term therapeutic value in patients with
substantially reduce the dropout rate. RA. The current study suggests their beneficial effect on
Alterations in diet can influence serum lipid concentra- cardiovascular risk factors in patients with RA. Additional
tions [35]. However, the patients in our study did not change studies of marine and botanical polyunsaturated fatty
their diets over the course of the trial, suggesting that the acids—in isolated form in order to reduce the number
improvements in their lipid profiles, including the significant and the size of capsules administered—are warranted to
increase in HDL cholesterol, are due to administration further determine their influence on lipid dysfunction in
of the study oils. Most pharmacological treatments of patients with RA and other diseases characterized by chronic
dyslipidemia address reduction of LDL cholesterol [36, 37]. inflammation.
Since improvement in HDL cholesterol depends to a large
extent on an exercise regimen [13, 38], many patients with Acknowledgments
RA are denied this manner of therapy. Thus, treatment with
one or a combination of these oils could aid in the reduction These studies were supported by the National Institutes of
of cardiovascular risk in RA patients whose disability impairs Health Grant RO1-AT000309 from the National Center for
or prevents a prescribed exercise program. Complementary and Alternative Medicine. The authors are
Although LDL-C is the primary target of lipid-lowering grateful for the statistical help of Robert Magner and the
therapy, other measures of the lipoprotein lipid profile, as efforts of the principal investigators at the 13 sites and their
reflected in the AIP and the TC/HDL-C ratios, are also patients, without whom this study would not have been
associated with CVD risk. The AIP is a useful monitor of the possible.
lipid profile and its subsequent impact on the progression
of cardiovascular risk [39]. In the study presented here, the References
AIP is significantly and beneficially altered at both 9 and
18 months compared to baseline. Patients in this study also [1] M. Boers, B. Dijkmans, S. Gabriel, H. Maradit-Kremers, J.
exhibit a significant reduction in the TC/HDL ratio at 9 O’Dell, and T. Pincus, “Making an impact on mortality in
and 18 months, another indication of reduced CVD risk rheumatoid arthritis: targeting cardiovascular comorbidity,”
Arthritis and Rheumatism, vol. 50, no. 6, pp. 1734–1739,
[40]. The safety of marine and botanical oils, and their
2004.
remarkable impact observed in this study on the lipid profile [2] V. P. van Halm, M. J. L. Peters, A. E. Voskuyl et al., “Rheu-
of RA patients who are at increased risk for dyslipidemia and matoid arthritis versus diabetes as a risk factor for cardio-
cardiovascular disease [1], suggest that these oils should have vascular disease: a cross-sectional study, the CARRÉ Investi-
a prominent role in therapy of patients with RA. gation,” Annals of the Rheumatic Diseases, vol. 68, no. 9, pp.
Additionally, there is some evidence [41] that these oils 1395–1400, 2009.
can substitute for treatment of RA patients with nonsteroidal [3] V. P. van Halm, M. M. Nielen, M. T. Nurmohamed et al.,
anti-inflammatory drugs (NSAIDs). The adverse gastroin- “Lipids and inflammation: Serial measurements of the lipid
testinal and renal events associated with NSAID therapy are profile of blood donors who later developed rheumatoid
well known [42]. In addition, macrophages treated with a arthritis,” Annals of the Rheumatic Diseases, vol. 66, no. 2, pp.
cyclooxygenase inhibitor in vitro exhibit greater vulnerability 184–188, 2007.
to formation of foam cells, a key element in development of [4] W. H. Yoo, “Dyslipoproteinemia in patients with active rheu-
matoid arthritis: effects of disease activity, sex, and meno-
atheromatous plaques [43]. Neither borage oil nor fish oil
pausal status on lipid profiles,” Journal of Rheumatology, vol.
is associated with serious gastrointestinal events (ulceration, 31, no. 9, pp. 1746–1753, 2004.
bleeding, perforation). In addition, whereas NSAIDs increase [5] G. Kerekes, Z. Szekanecz, H. Dér et al., “Endothelial dys-
the incidence of myocardial infarction and stroke [44], fish function and atherosclerosis in rheumatoid arthritis: a multi-
oil reduces the risk of cardiovascular events in patients at risk, parametric analysis using imaging techniques and laboratory
including those with RA [45]. The efficacy of omega-3-fatty markers of inflammation and autoimmunity,” Journal of
acids in reducing mortality after a myocardial infarction [46] Rheumatology, vol. 35, no. 3, pp. 398–406, 2008.
is further reason to recommend their use in patients with [6] S. van Doornum, G. McColl, and I. P. Wicks, “Accelerated
RA. Although studies in humans of the influence of GLA atherosclerosis: an extraarticular feature of rheumatoid arthri-
on serum lipids are scant, GLA administration appears to tis?” Arthritis and Rheumatism, vol. 46, no. 4, pp. 862–873,
prevent increases in TC and LDL-C [47]. 2002.
[7] V. P. van Halm, M. M. J. Nielen, M. T. Nurmohamed et
al., “Lipids and inflammation: serial measurements of the
5. Conclusion lipid profile of blood donors who later developed rheumatoid
arthritis,” Annals of the Rheumatic Diseases, vol. 66, no. 2, pp.
Chronic inflammation, experienced by patients with RA, 184–188, 2007.
includes development of microthrombi in small vessels and [8] S. clair, C. L. Wagner, A. A. Fasanmade et al., “The relationship
production of inflammatory cytokines and is associated with of serum infliximab concentrations to clinical improvement in
accelerated atherosclerosis [48]. The capacity of both GLA- rheumatoid arthritis: results from ATTRACT, a multicenter,
8 Evidence-Based Complementary and Alternative Medicine
randomized, double-blind, placebo-controlled trial,” Arthritis taenoic acid,” Arthritis and Rheumatism, vol. 31, no. 12, pp.
and Rheumatism, vol. 46, no. 6, pp. 1451–1459, 2002. 1543–1551, 1988.
[9] D. Hürlimann, A. Forster, G. Noll et al., “Anti-tumor necrosis [24] L. J. Leventhal, E. G. Boyce, and R. B. Zurier, “Treatment
factor-α treatment improves endothelial function in patients of rheumatoid arthritis with blackcurrant seed oil,” British
with rheumatoid arthritis,” Circulation, vol. 106, no. 17, pp. Journal of Rheumatology, vol. 33, no. 9, pp. 847–852, 1994.
2184–2187, 2002. [25] F. C. Arnett, S. M. Edworthy, D. A. Bloch et al., “The American
[10] E. N. Pollono, M. A. Lopez-Olivo, J. A. M. Lopez, and M. E. Rheumatism Association 1987 revised criteria for the classifi-
Suarez-Almazor, “A systematic review of the effect of TNF- cation of rheumatoid arthritis,” Arthritis and Rheumatism, vol.
α antagonists on lipid profiles in patients with rheumatoid 31, no. 3, pp. 315–324, 1988.
arthritis,” Clinical Rheumatology, vol. 29, no. 9, pp. 947–955, [26] D. T. Felson, J. J. Anderson, M. Boers et al., “The American
2010. College of Rheumatology preliminary core set of disease
[11] M. J. L. Peters, M. Vis, V. P. van Halm et al., “Changes in activity measures for rheumatoid arthritis clinical trials,”
lipid profile during infliximab and corticosteroid treatment in Arthritis and Rheumatism, vol. 36, no. 6, pp. 729–740, 1993.
rheumatoid arthritis,” Annals of the Rheumatic Diseases, vol. [27] G. H. Beaton, J. Milner, and V. McGuire, “Source of variance
66, no. 7, pp. 958–961, 2007. in 24-hour dietary recall data: implications for nutrition study
[12] C. A. Wijbrandts, S. I. van Leuven, H. D. Boom et al., design and interpretation. Carbohydrate sources, vitamins,
“Sustained changes in lipid profile and macrophage migration and minerals,” American Journal of Clinical Nutrition, vol. 37,
inhibitory factor levels after anti-tumour necrosis factor no. 6, pp. 986–995, 1983.
therapy in rheumatoid arthritis,” Annals of the Rheumatic [28] Y. Ma, B. C. Olendzki, S. L. Pagoto et al., “Number of 24-
Diseases, vol. 68, no. 8, pp. 1316–1321, 2009. hour diet recalls needed to estimate energy intake,” Annals of
[13] G. Steiner and M. B. Urowitz, “Lipid profiles in patients Epidemiology, vol. 19, no. 8, pp. 553–559, 2009.
with rheumatoid arthritis: mechanisms and the impact of
[29] B. C. Olendzki, Y. Ma, J. R. Hébert et al., “Underreporting of
treatment,” Seminars in Arthritis and Rheumatism, vol. 38, no.
energy intake and associated factors in a Latino population
5, pp. 372–381, 2009.
at risk of developing type 2 diabetes,” Journal of the American
[14] G. Zuliani, M. Galvani, E. Leitersdorf, S. Volpato, M. Cavalieri, Dietetic Association, vol. 108, no. 6, pp. 1003–1008, 2008.
and R. Fellin, “The role of polyunsaturated fatty acids (PUFA)
[30] S. Mora, N. Rifai, J. E. Buring, and P. M. Ridker, “Comparison
in the treatment of dyslipidemias,” Current Pharmaceutical
of LDL cholesterol concentrations by Friedewald calculation
Design, vol. 15, no. 36, pp. 4087–4093, 2009.
and direct measurement in relation to cardiovascular events
[15] P. C. Weber, “Membrane phospholipid modification by
in 27,331 women,” Clinical Chemistry, vol. 55, no. 5, pp. 888–
dietary n-3 fatty acids: effects on eicosanoid formation and cell
894, 2009.
function,” Progress in Clinical and Biological Research, vol. 282,
pp. 263–274, 1988. [31] A. Onat, G. Can, H. Kaya, and G. Hergenç, “”Atherogenic
index of plasma” (log10 triglyceride/high-density lipoprotein-
[16] J. D. Prickett, D. R. Robinson, and A. D. Steinberg, “Dietary
cholesterol) predicts high blood pressure, diabetes, and vas-
enrichment with the polyunsaturated fatty acid eicosapen-
cular events,” Journal of Clinical Lipidology, vol. 4, no. 2, pp.
taenoic acid prevents proteinuria and prolongs survival in
89–98, 2010.
NZB x NZW F1 mice,” Journal of Clinical Investigation, vol.
68, no. 2, pp. 556–559, 1981. [32] D. E. King, B. M. Egan, R. F. Woolson, A. G. Mainous III,
[17] R. B. Zurier, R. G. Rossetti, E. W. Jacobson et al., “Gamma- Y. Al-Solaiman, and A. Jesri, “Effect of a high-fiber diet vs a
linolenic acid treatment of rheumatoid arthritis: a random- fiber-supplemented diet on C-reactive protein level,” Archives
ized, placebo-controlled trial,” Arthritis and Rheumatism, vol. of Internal Medicine, vol. 167, no. 5, pp. 502–506, 2007.
39, no. 11, pp. 1808–1817, 1996. [33] C. Jurcuţ, R. Jurcuţ, and C. Tanasescu, “Cardiovascular risk
[18] R. B. Zurier, “Prostaglandins, leukotrienes, and related com- and rheumatoid arthritis: from mechanisms of atherosclero-
pounds,” in Kelley’s Textbook of Rheumatology, G. S. Firestein, sis to therapeutic approach,” Romanian Journal of Internal
E. D. Harris, I. B. McIness, S. Ruddy, and J. S. Sergent, Eds., Medicine, vol. 42, no. 4, pp. 659–669, 2004.
pp. 343–358, Saunders, Philadelphia, Pa, USA, 2009. [34] F. H. Chilton, L. L. Rudel, J. S. Parks, J. P. Arm, and M. C.
[19] D. Vassilopoulos, R. B. Zurier, R. G. Rossetti, and G. C. Seeds, “Mechanisms by which botanical lipids affect inflam-
Tsokos, “Gammalinolenic acid and dihomogammalinolenic matory disorders,” American Journal of Clinical Nutrition, vol.
acid suppress the CD3- mediated signal transduction pathway 87, no. 2, pp. 498S–503S, 2008.
in human T cells,” Clinical Immunology and Immunopathology, [35] C. M. Berg, G. Lappas, E. Strandhagen et al., “Food pat-
vol. 83, no. 3, pp. 237–244, 1997. terns and cardiovascular disease risk factors: The Swedish
[20] B. Bartok and G. S. Firestein, “Fibroblast-like synoviocytes: INTERGENE research program,” American Journal of Clinical
key effector cells in rheumatoid arthritis,” Immunological Nutrition, vol. 88, no. 2, pp. 289–297, 2008.
Reviews, vol. 233, no. 1, pp. 233–255, 2010. [36] K. Miyauchi and H. Daida, “Clinical significance of intensive
[21] V. A. Ziboh and R. S. Chapkin, “Biologic significance of lipid-lowering therapy using statins in patients with coronary
polyunsaturated fatty acids in the skin,” Archives of Dermatol- artery disease: LDL-cholesterol: the lower, the better; Is it true
ogy, vol. 123, pp. 1686a–1690, 1987, Rheumatology. In press. for Asians? (Pro),” Circulation Journal, vol. 74, no. 8, pp. 1718–
[22] P. C. Calder, “n-3 polyunsaturated fatty acids, inflammation, 1730, 2010.
and inflammatory diseases,” The American Journal of Clinical [37] A. L. Catapano, “Perspectives on low-density lipoprotein
Nutrition, vol. 83, no. 6, Article ID 986797, pp. 1505S–1519S, cholesterol goal achievement,” Current Medical Research and
2006. Opinion, vol. 25, no. 2, pp. 431–447, 2009.
[23] G. A. Tate, B. F. Mandell, R. A. Karmali et al., “Suppression [38] T. R. Thomas, S. O. Warner, K. C. Dellsperger et al., “Exercise
of monosodium urate crystal-induced acute inflammation and the metabolic syndrome with weight regain,” Journal of
by diets enriched with gamma-linolenic acid and eicosapen- Applied Physiology, vol. 109, no. 1, pp. 3–10, 2010.
Evidence-Based Complementary and Alternative Medicine 9
Research Article
Novel Lipolytic Enzymes Identified from Metagenomic Library of
Deep-Sea Sediment
Jeong Ho Jeon,1, 2 Jun Tae Kim,1 Hyun Sook Lee,1, 3 Sang-Jin Kim,1, 3 Sung Gyun Kang,1, 3
Sang Ho Choi,2 and Jung-Hyun Lee1, 3
1 Marine Biotechnology Research Center, Korea Ocean Research & Development Institute, P.O. Box 29,
Ansan 425-600, Republic of Korea
2 National Research Laboratory of Molecular Microbiology and Toxicology, Department of Agricultural Biotechnology,
Metagenomic library was constructed from a deep-sea sediment sample and screened for lipolytic activity. Open-reading frames
of six positive clones showed only 33–58% amino acid identities to the known proteins. One of them was assigned to a new group
while others were grouped into Families I and V or EstD Family. By employing a combination of approaches such as removing the
signal sequence, coexpression of chaperone genes, and low temperature induction, we obtained five soluble recombinant proteins
in Escherichia coli. The purified enzymes had optimum temperatures of 30–35◦ C and the cold-activity property. Among them,
one enzyme showed lipase activity by preferentially hydrolyzing p-nitrophenyl palmitate and p-nitrophenyl stearate and high salt
resistance with up to 4 M NaCl. Our research demonstrates the feasibility of developing novel lipolytic enzymes from marine
environments by the combination of functional metagenomic approach and protein expression technology.
unique properties including cold activity. In this study, we DNA fragments of 2 to 4 kb were isolated from a 0.6% low-
used another sediment core sample of deep sea which had melting-temperature agarose (FMC Bioproducts, Rockland,
been explored in our previous researches and could unveil ME) gel and end-repaired to generate blunt ends. The blunt-
the existence of novel lipolytic enzymes. Here, we describe ended DNA was ligated into the EcoRV site of pBluescript
the identification of novel lipolytic enzyme-encoding genes SK(−) (Stratagene, La Jolla, CA), and the ligations were
from metagenomic library, the enhancement of soluble introduced into E. coli DH5α cells. The E. coli transformants
protein expression, and the biochemical characterization of were plated onto LB agar plates containing 100 μg/mL of
the purified enzymes. ampicillin and 1% tributyrin. After incubation at 37◦ C for
24 h, colonies surrounded by a clear halo were selected.
Nucleotide sequencing was performed with the automated
2. Materials and Methods sequencer (ABI3100) using the BigDye terminator kit (PE
2.1. Strains, Library Construction, and Screening Escherichia Applied Biosystems, Foster City, CA). The DNA sequence
coli. DH5α (Stratagene, La Jolla, CA, USA), EPI300-T1R was determined by primer walking in both directions and
(Epicentre, Madison, WI, USA), and BL21(DE3) (Novagen, assembled using the ContigExpress program of the Vector
Madison, WI, USA) were used as host strains for cloning NTI suite 7 software package (InforMax, North Bethesda,
and expression. pBluescript SK- (Stratagene), pET-24a(+) Md.). The open reading frame (ORF) was detected using
vector (Novagen), and fosmid vector (Epicentre) were used the ORF search tool provided by the National Center for
as vectors. Biotechnology Information (NCBI). Sequence homology
searches were performed with the basic local alignment
2.2. Metagenomic Library Construction and Screening for search tool (BLAST) program [27]. Signal sequence search
Lipolytic Clones. Deep-sea sediment sample was collected was performed with the SignalP 3.0 program [28]. Multiple
from the southern clam beds area around the summit of alignments between protein sequences were performed with
Edison Seamount in the New Ireland Fore-arc near Papua the ClustalW program [29]. The phylogenetic tree was
New Guinea (3◦ 89 S/152◦ 49 E; depth 1,440 m). DNA from constructed by the neighbor-joining method [30] using
the sediment sample was extracted based on a previously the Molecular Evolutionary Genetics Analysis 4.1 software
described method [25] with minor modifications. After (MEGA, version 4.1) [31].
extraction, the DNA was further purified by gel elec-
trophoresis in a 1% low-melting-temperature agarose gel 2.3. Overexpression and Purification of the Lipolytic Enzyme-
(FMC Bioproducts, Rockland, ME) containing 1% polyvinyl Encoding Genes. The lipolytic enzyme genes were ampli-
polypyrrolidone (Sigma, St. Louis, MO). Gel electrophoresis fied by PCR with primer pairs, and the amplified DNA
was performed at 35 V for 13 h, and DNA fragments of fragments were inserted into the pET-24a(+) expression
approximately 40 to 50 kb were then isolated from the vector (Table 1). Three recombinant plasmids including
gel. The isolated DNA was end-repaired with End-It DNA genes of EM3L1, EM3L2, and EM3L3 were transformed
End-Repair kit (Epicentre, Madison, WI), which caused the into E. coli BL21 (DE3) cells while three recombinant
DNA to be blunt ended and 5 -phosphorylated. The blunt- plasmids including genes of EM3L4, EM3L6, and EM3L7
ended DNA was ligated into a pCC1FOS vector (Epicentre, were transformed into E. coli BL21 (DE3) expressing
molecular chaperones GroEL-GroES with pGro7 (Takara,
Madison, WI). Lambda packaging extracts were added
Kyoto, Japan) and the transformants were inoculated into
to ligations, and infection of phage T1-resistant EPI300-
LB medium containing 20 μg/mL of chloramphenicol and
T1R cells was performed according to the manufacturer’s
50 μg/mL of kanamycin for plasmid selection and 0.5 mg/mL
instructions. The E. coli transformants were transferred to L-arabinose for induction of chaperone expression. A trans-
96-well microtiter plates and stored at −80◦ C. To screen formants were cultivated at 37◦ C, and 1 mM isopropyl-β-
for esterase/lipase activity, the transformants were plated D-thiogalactopyranoside (IPTG) was added to induce gene
on Luria-Bertani (LB) agar plates containing 12.5 μg/mL of expression when the optical density at 600 nm reached 0.4.
chloramphenicol and 1% tributyrin as a substrate. Colonies After incubation for 16 h at 16◦ C, the cells were harvested
were incubated for one day at 37◦ C and subsequently by centrifugation (6,000 ×g, 20 min, 4◦ C) and resuspended
incubated for a week at 4◦ C. Candidates surrounded by a in 50 mM Tris-HCl buffer (pH 8.0) containing 0.1 M KCl
clear halo on the plate were selected. The positive clones were and 10% glycerol. The cells were disrupted by sonication and
reconfirmed and subcloned. centrifuged (20,000 ×g, 1 h, 4◦ C). The resulting supernatants
Fosmid clones showing lipolytic activity on the tribu- were applied to a column of TALON metal-affinity resin
tyrin agar plate were inoculated into 200 mL of LB broth (BD Biosciences Clontech, Palo Alto, CA) and washed with
containing 12.5 μg/mL of chloramphenicol. After overnight 10 mM imidazole (Sigma, St. Louis, MO) in 50 mM Tris-
incubation at 37◦ C, the cells were harvested by centrifugation HCl buffer (pH 8.0) containing 0.1 M KCl and 10% glycerol,
at 5,000 ×g for 15 min and washed twice with distilled and the enzymes were eluted with 300 mM imidazole in
water. The fosmid DNA was purified using the alkaline lysis the buffer. The protein concentration was measured by the
method [26] with minor modifications and was randomly Bradford method using the Bio-Rad protein assay kit (Bio-
sheared by nebulization according to the manufacturer’s Rad, Hercules, CA) with bovine serum albumin as a standard
instruction (Invitrogen, Carlsbad, CA). After nebulization, [32]. The purity of the protein was examined by sodium
Evidence-Based Complementary and Alternative Medicine 3
Gene Primer∗
5 -TTTGGAGGCATATGCTTATCCCTTCCGATGGTCTGGAAC-3
EM3L1
5 -CTGGTGTCCTCGAGGTTTGCCAAAAAACGGCCGTATATC-3
5 -TGATAAATCATATGAACAGAATGACAATAGGCTTCTC-3
EM3L2
5 -CCTTTTAGCTCGAGATTATTGTCTTGCAACCAGGATT- 3
5 -TAGCTGCACATATGATCCTTTTTAGCTTGGTCGGTGTC-3
EM3L3
5 -AAAGTTGGCTCGAGTGTCTTAATCCCAAGAAAATTCAAG-3
5 -GAGAAGTGAACCGGGGGACATATGACTGGTAGAATTG-3
EM3L4
5 -CAAAAGCGCCCCTCGAGCGGCTGCTCCTCC-3
5 -AGGAGAAGCATATGAAATGCATCCCATCAGACGGCC-3
EM3L6
5 -GTTGCAGACTCGAGATCATTATTCGAGCCTAATTCCTC-3
5 -CGGAGTGAAAGCATATGACTTATCCGATTGTGCTC-3
EM3L7
5 -GTATTACCTCTCGAGGTTAAGGTAGTTGTTCCGCGATTC-3
∗
Underlined bases in the primers indicate the restriction enzyme recognition site (NdeI/XhoI).
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- The effect of NaCl concentration on enzyme activity was
PAGE) under denaturing conditions as described method measured using p-nitrophenyl hexanoate as the substrate.
[33]. The reaction mixture contained enzyme solution in 50 mM
Tris-HCl (pH 7.5) containing different final NaCl concentra-
tions ranging from 0.5 to 4 M. The mixture was preincubated
2.4. Characterization of Lipolytic Enzymes. Esterase and
lipase activities were measured by a spectrophotometric at 35◦ C for 30 min, and then the enzyme activity was detected
method using p-nitrophenyl butyrate and p-nitrophenyl by adding p-nitrophenyl hexanoate.
palmitate (Sigma, St. Louis, MO) as the substrate, respec-
tively. The reaction mixture contained p-nitrophenyl 2.5. Nucleotide Sequence Accession Numbers. The obtained
butyrate in acetonitrile, Tris-HCl buffer, and the enzyme nucleotide sequences have been deposited in the Gen-
solution. p-nitrophenyl palmitate solutions were mixed with Bank database under the accession numbers EM3L1
Tris-HCl buffer containing Triton X-100 as emulsifying (GQ340923), EM3L2 (GQ340924), EM3L3 (GQ340925),
agent. After incubation at each optimum temperature for EM3L4 (GQ340926), EM3L6 (GQ340927), and EM3L7
5 min, the absorbance at 405 nm was measured to detect (GQ340928).
the released p-nitrophenol. One unit of esterase and lipase
activity was defined as the amount of enzyme required to 3. Results
release 1 μmol of p-nitrophenol from p-nitrophenyl butyrate
or p-nitrophenyl palmitate per min. 3.1. Screening and Primary Sequence Analysis of Lipoly-
The optimum temperature of the enzymes was deter- tic Enzyme-Encoding Genes. To explore the untapped
mined at various temperatures of 5 to 65◦ C. The optimum esterases/lipases in marine environment, metagenomic
pH was determined over a pH range of 4.0 to 10.0, using the approach was applied to the samples from deep-sea sed-
following buffer systems: 50 mM sodium acetate (pH 4.0 to iment, located near a small volcanic cone named the
6.0), 50 mM sodium phosphate (pH 6.0 to 7.5), 50 mM Tris- Edison Seamount at a depth of 1440 m where there are
HCl (pH 7.5 to 8.5), and 50 mM CHES (pH 8.5 to 10.0). The extensive clam beds associated with the low-temperature
substrate specificity was determined with different aliphatic vents [34]. Deep-sea sample was chosen to represent the
side chain, C2 (acetate), C4 (butyrate), C6 (hexanoate), C8 psychrophilic environment with average temperature below
(octanoate), C10 (decanoate), C12 (laurate), C14 (myris- 4◦ C. A metagenomic library consisting of 81,100 fosmid
tate), C16 (palmitate), and C18 (stearate) as substrates. clones was constructed in a fosmid vector, pCC1FOS. Each
Various metal ions (MnCl2 , MgCl2 , CaCl2 , CuCl2 , clone contained an insert of approximately 15 to 33 kb. Fos-
ZnSO4 , FeSO4 , CoSO4 , and NiSO4 ) and enzyme inhibitors, mid clones having lipolytic activity were identified by activity
Phenylmethylsulfonyl fluoride (PMSF) and Ethylenedi- screening on agar plates containing 1% tributyrin (TBN).
aminetetraacetic acid (EDTA), at a final concentration of As a result, 6 positive clones (designated as pFosEM3L1,
1 mM were added to the enzyme in 50 mM Tris-HCl buffer pFosEM3L2, pFosEM3L3, pFosEM3L4, pFosEM3L6, and
(pH 7.5) then assayed for enzyme activity after preincubation pFosEM3L7) were obtained by zones of clearance around the
at 35◦ C for 1 hr. The effects of detergents on enzyme activity colonies.
were determined by incubating the enzyme in 50 mM Tris- The 6 fosmid clones were subjected to further subcloning
HCl buffer (pH 7.5) containing 1% (w/v) of the detergents into the pBluescript SK(−) plasmid. The subclones with
SDS, Triton X-100, and Tween-20, -40, -60, -80 at 35◦ C for lipolytic activity were selected on TBN plates again. Sequence
1 hr. analyses of the 2-3 kb DNA inserts in the subclones revealed
4 Evidence-Based Complementary and Alternative Medicine
the presence of ORFs encoding putative α/β hydrolases with genes with signal sequence removed were amplified, and
G + C contents of 46.5–66.6%. A BLAST search of the the resulting expression constructs were expressed in E. coli
amino acid sequences of six ORFs indicated that they yielded BL21 strain. Total cell lysates, soluble fractions, and insoluble
identities of less than 60% to proteins in the database. The fractions were analyzed by 12% SDS-PAGE, and we found
deduced amino acid sequences of EM3L1, EM3L2, EM3L3, that some portion of the proteins encoded by three of the
EM3L4, EM3L6, and EM3L7 showed the highest similar- genes (EM3L1, EM3L2, and EM3L3) were detected in the
ity to α/β hydrolase fold protein (YP 003395264) from soluble fraction (Figure 3(a)), whereas the proteins encoded
Conexibacter woesei DSM 14684 (39% identity), hypothet- by the three genes (EM3L4, EM3L6, and EM3L7) were
ical protein (ZP 01915829) from Limnobacter sp. MED105 expressed as insoluble forms.
(49% identity), triacylglycerol acyl hydrolase (AAK07450) Based on the fact that expression at low temperature
from Moritella marina (49% identity), LpqC (ZP 01463024) increases the stability and proper folding of proteins, possibly
from Stigmatella aurantiaca DW4/3-1 (39% identity), α/β due to the fact that the hydrophobic interactions that deter-
hydrolase fold protein (ZP 01697334) from Bacillus coag- mine inclusion body formation are temperature dependent
ulans 36D1 (33% identity), and lipase (ACJ13070) from [37–39], we made three proteins (EM3L4, EM3L6, and
uncultured bacterium (58% identity), respectively. EM3L7) being induced at the low temperature of 16◦ C.
To see how the ORFs were related to known esterases/ However, the induction of expression at low temperature
lipases, the phylogenetic relationship was analyzed based on alone was not successful in enhancing the solubility of the
the esterase/lipase classification (family I–VIII) by Arpigny expressed proteins (data not shown). Since it has been
and Jaeger [1] including recently reported families such reported that GroEL-GroES is effective in facilitating their
as LipG [35], EstA [36], LipEH166 [20], FLS18 [18], and correct folding by minimizing aggregation and misfolding
EstD2 [17] (Figure 1). EM3L1, EM3L3, and EM3L6 were [40], we employed GroEL-GroES co-expression in solubi-
grouped into family V in Figure 1, retaining the G-X-S-M- lizing the proteins. It turns out that EM3L4 and EM3L6
G pentapeptide motif and the HG sequence for the oxyanion proteins were solubly expressed by coexpressing GroEL-
hole (Figures 2(a) and 2(b)). The His residue consisting of GroES at 16◦ C. In contrast to the other proteins, the
the catalytic triad could not be predicted in EM3L1 and majority of the expressed EM3L7 remained in the insoluble
EM3L6 by the sequence alignment (Figure 2(a)). EM3L2 was fraction regardless of the experimental conditions we tried
clustered together with EstD2 reported from metagenomic in this study (Figure 3(b)). The expressed proteins were
library of plant rhizosphere soil recently [17]. Multiple purified as described in Section 2, and SDS-PAGE analysis
alignment analysis of EM3L2 revealed that the active site of purified EM3L1, EM3L2, EM3L3, EM3L4, and EM3L6
serine was encompassed by the conserved pentapeptide G- showed a protein band which correlated well to the predicted
H-S-Q-G in EstD2 family (Figure 2(c)). molecular weight (Figure 3(c)). This result demonstrated
On the other hand, it was found that EM3L4 did not that the combination of co-expression of chaperones and
show significant similarity to any member in the eight fami- induction at low temperature may be effective in achieving
lies and branched out to a group together with close homol- soluble expression of lipolytic enzyme-encoding genes.
ogous genes. It is noteworthy that the comparative analysis of The purified enzymes showed an optimum activity in
the deduced amino acid sequence revealed that EM3L4 dis- the temperature range of 30–35◦ C and at a neural or
played low similarity to poly(3-hydroxyalkanoate) depoly- slightly alkaline pH (pH 7.5–8.5) (Table 2 and see Figures
merase (ZP 07602911) from Streptomyces violaceusniger S1 and S2 in Supplementry Material available on line at
(34% identity), and both the active site serines in the two doi:10.1155/2011/271419). It is noteworthy that they could
proteins were encompassed by G-X-S-N-G pentapeptide in be classified as cold-active enzymes based on the temperature
common (Figure 2(d)). From the sequence analysis, it seems profiles and activation energy values. As the source of the
likely that EM3L4 could be a novel enzyme (Figure 1). Lastly, genes was a deep-sea sediment sample, we predicted that
EM3L7 was clustered together with family I bacterial lipolytic they are cold-adapted enzymes. A similar phenomenon has
enzymes, and the active site serine was encompassed by the been reported in other studies; for example, two cold-
characteristic A-X-S-X-G motif (Figure 2(e)). The motif was adapted esterase from Arctic sediment metagenome showed
usually found in Bacillus lipases belonging to Subfamily I.4 an optimum temperature at 30◦ C [23] and thermostable
even if no significant homology (less than 14% identity) esterase from hot spring metagenome showed enzyme activ-
was found between them. Taken together, the metagenomic ity above 30◦ C up to 95◦ C [41]. This result suggested that
study applied to marine sediment sample of deep sea has the the property of lipolytic enzymes derived from metagenomic
potential to yield novel molecular entities unrelated to the library might be reflected by their environmental characters.
known sequences. EM3L1, EM3L2, EM3L3, and EM3L6 could hydrolyze
short chain substrates (C2 to C12 ) and showed the highest
3.2. Expression and Characterization of the Lipolytic Enzyme- activity toward p-Nitrophenyl hexanoate (C6 ) (Table 2 and
Encoding Genes. To express six genes, EM3L1, EM3L2, Figure S3). On the other hand, EM3L4 showed enzymatic
EM3L3, EM3L4, EM3L6, and EM3L7, we investigated the activity toward long-chain substrates (C16 –C18 ), which can
presence of signal sequences using the SignalP 3.0 program be classified as a lipase. The specific activities of the enzymes
and found that EM3L2, EM3L3, and EM3L4 retained a were determined to be in the range of 1.7–558.2 U/mg at the
putative signal sequence 18–25 amino acids long. All the optimal conditions (Table 2).
Evidence-Based Complementary and Alternative Medicine 5
0.2
Figure 1: Phylogenetic tree of the lipolytic enzymes. The tree was constructed using the MEGA 4.1 program with the neighbor-joining
algorithm. Only bootstrap values greater than 50% are shown. Bar: 0.2 substitutions per amino acid site.
Since EM3L4 belonged to a new group and the homolo- EM3L4 was increased by the presence of Mn2+ , Mg2+ , Ca2+ ,
gous proteins have never been characterized, the biochemical Cu2+ , and Ni2+ (Table 3). It was inhibited by Zn2+ , Fe2+ ,
property of EM3L4 was further analyzed. To determine the and Co2+ and was completely inhibited by PMSF (Table 3).
resistance to various chemical agents, the purified EM3L4 Besides, it was also inhibited by various nonionic detergents
was incubated with chemical agents, and the remaining such as Tween-20, -40, -60, -80 and Triton X-100 and ionic
activity was measured with p-nitrophenyl palmitate or p- detergent, SDS (Table 3). The enzyme activity of EM3L4
nitrophenyl hexanoate as substrate at 35◦ C. The activity of was significantly affected by salinity. As shown in Figure 4,
6 Evidence-Based Complementary and Alternative Medicine
EM3L1 9: E LAVECFGEGP S L I FAHGLTGN 87: KA I VGGE S MGAATTL L FALR H PQRVEKL 203: CPTC I I A - -WEDDPLHPLALAQR Y AAE I PNAR L EVL P S LAE
EM3L6 10: QLAVETFGSGPPL IMAHGLTGN 88: RA I I GGE S MGAATALTFALNWPQRVETL 206: MPVR I VA - -WENDDLHPL I LAQRMAAL I PDVKMTVLAS LTE
YP 003395264 12: L L SGTDEGEGPP I VL LHGLTAT 88: RAVLAGAS MGAHTL LRFALD A PE RVAG I 211: I P SVVVADRD EA DPGHPLA I GEA Y AGAL PGAR L VVEDEGRS
ZP 01697334 7: EYHVETAGDGEPL L L LHGFTGN 85: RAS I LGY S MGGRLALTFAVQ Y PQMVDKL 209: F PVL LAA - - G EWDAKF - CR I AGEMEERL PHAK K I I F SHAGH
NP 767479 10: G I YYEVHGDGPPL L LTHGY S S T 88: RAV I GGL S L GGYMS LAFTRA Y PQRVRAL 194: VP S L I VV - - G ADDTP F - LAASDYMAAK I PGAQ K VV I PAAGH
ZP 06812025 9: S YHVE S FGDGEPL L L LHGFTGS 86: DAHVLGY S MGGRLALTFA I L Y PHRVRTL 210: I PTL L LC - - G EWDQKF - CR I AEEMKKYL PNCEMVKVARAGH
(a)
EM3L3 57: LHGF SANKDNW 121: HLGGS SMGGG I A GA 241: PTL I I WGAQDRVLHVSGAK I L E SV I PKAKVE I I DAVGHLPM
AAK07450 68: LHGFGADKDNW 132: NLAGS SMGGY I A GN 257: PVLVS WGHKDRVLHVSGAKV L KK I I PQAQ I NI MASVGHLPM
YP 001530963 62: LHGFGANKDN F 116: HI GGS SMGGHI AMT 232: PAL I VWGDQDRA I RVE SAG I L HGL L PVS EV I I MKGLGHLPM
YP 001188192 68: IHGFAADKDNW 131: HL LGNSMGGHI A AL 249: PTL L LWGEQDRVLHVS S I EVMRP L LRHS SVAVMPGVGHAPM
(b)
EM3L2 91: PPVDCFYVYPTVS SDS SGNSD L 176: GRGFVL I GHSQGTGH LRRL I AEE I E 348: LQVTAQVDADDPRADDFNGE FT I G - - - - PGWGLHLVD I NL
ZP 01915829 97: PPVDCFYVYPTTS I DLAGNSD L 194: GRGF I LVGHSQGSG I LRRL I AEE I E 366: L EAS I VADPDDPRADDYPGE F I GG - - - - TNWGFHL I D V S I
ADN26553 81: AP I DCFYVYPTVS LDTTPNSDM 173: GRGVVL I GHSQGSMV LTQL I TNE I D 336: L EVTVNADPADPRTDD I SGDVLTNGQVQAS WGLHL I D VHV
ZP 00952831 59: PAVDCFYVYPTVSVDPGVNSD L 151: GRGV I LVGHSQGARM LQTL INQE I E 312: L SVTVNADP SDPRTD I LTGDVVANGQVLTDWGLHLVDMHV
YP 003594738 77: PAYDCFYVYPTVS TDSGGNSDM 168: GRGVVL I GHSQGSR I L L S L LKNE I D 331: LAVKVNADPADPRADE I GGD I SVAGV I LKDWGLHL I D V NL
(c)
EM3L4 72: NPAQPAPVVVS FHGF L S 152: VDRSRVYVNGF SNGGGMAVR I GC 196: CS P SRPVPVMAYHGTADPVVPYEG 281: AEVS LYT I DGGGHTWPG G
ZP 01463024 80: DAAKPTPTV I AFHGFGS 176: VDTRRTYATGL SNGAF F S YRLAC 219: CEPHRPVPVMHFHGTADTT I S YHG 293: ATATLCTVEGGGHTWPG G
YP 004018523 71: TGTAPL P LVVQLHGGGG 158: VDPRR I YLTGF SNGAMMTYRLGC 201: CAPARPL P L LA IHGTADENVPYAG 282: TDVVLDT I VGGVHAWPG G
ZP 06968499 86: RSTLKYP LVL S FHGHGS 168: I DPHR I YATGF SNGGS LTN I LAC 213: CTPQRP I S L L E FHGTGDHTVPYNG 284: AVV IHYR I TGGQHTWPK G
ZP 06502439 72: EAAKP S P LVVVYHGRGS 152: I DERRVYATGKSNGAGLVG I LAC 198: CTPARPVPMI S FHGSADAT I PYVG 268: AEVRLVTVDGGGHTWPG A
ZP 07756384 124: DANQATPVV I AFHGGGG 211: VDT SR I FATG I SNGG IMTYYVAS 254: CNPKRPVPV IHFHGTADGLAP F EG 341: AEVVL I E I KNGGHTWPGM
(d)
EM3L7 7: LAHGVCRFDAL 86: VNI I AHSMG GLDARHMMFN 212: EGENDGMVSVRSATWR 231: FKGTLDKTDHLNEM
ACJ13070 7: LAHG I CRFDVL 86: VNI I AHSMG GLDARH L L FN 212: EGDNDG L VSVRSARWQ 231: FKGVL ENADHLNE L
XP 390196 90: LAHGL FGFAE L 158: VT I V AHSMG GLDARYM L SH 283: EGPNDG L VSVE S S S WG 300: YKGTL LGVS HLDL I
XP 504639 52: LCHGLCGFNE I 137: VNL I AHSMG GLDSRY L IHN 259: EGP SDG L VSVKSAQWG 276: YLGT I NNCDHLDL I
(e)
Figure 2: Multiple alignments of the conserved motifs of the ORFs isolated from metagenomic library with the homologs of each
family or group. (a) Family V including EM3L1 and EM3L6: YP 003395264, an α/β hydrolase fold protein from Conexibacter woesei
DSM 14684; ZP 01697334, an α/β hydrolase fold from Bacillus coagulans 36D1; NP 767479, a hypothetical protein bll0839 from
Bradyrhizobium japonicum USDA 110; ZP 06812025, an α/β hydrolase fold protein from Geobacillus thermoglucosidasius C56-YS93. (b)
Family V including EM3L3: AAK07450, a triacylglycerol acyl hydrolase from Moritella marina; YP 001530963, an α/β hydrolase fold from
Desulfococcus oleovorans Hxd3; YP 001188192, an α/β hydrolase fold from Pseudomonas mendocina ymp (YP 001188192). (c) EstD2 family
including EM3L2: ZP 01915829, a hypothetical protein from Limnobacter sp. MED105; ADN26553, an EstD2 from uncultured bacterium;
ZP 00952831, a hypothetical protein from Oceanicaulis alexandrii HTCC2633; YP 003594738, a hypothetical protein from Caulobacter
segnis ATCC 21756. (d) New group including EM3L4: ZP 01463024, an LpqC from Stigmatella aurantiaca DW4/3-1; YP 004018523,
a lipoprotein from Frankia sp. EuI1c; ZP 06968499, a putative lipoprotein from Ktedonobacter racemifer DSM 44963; ZP 06502439, a
conserved hypothetical protein from Micrococcus luteus SK58. (e) Family I including EM3L7: ACJ13070, a lipase from uncultured bacterium;
(ACJ13070); XP 390196, a hypothetical protein from Gibberella zeae PH-1; XP 504639, a YALI0E31515p from Yarrowia lipolytica. Triangles
and squares represent the residues involved in the formation of the catalytic triad and the oxyanion hole, respectively, and the conserved
pentapeptide motifs are boxed.
Activation
Temperaturea pHb Substratec Specific activity
Enzyme energy
(optimum) (◦ C) (optimum) (optimum) (U/mg)
(kcal/mol)
EM3L1 15–50 (35) 3.6 7.5–9.5 (8.5) C2 –C10 (C6 ) 558.2
EM3L2 15–40 (30) 8.6 7.0–10.0 (8.5) C6 (C6 ) 1.7
EM3L3 15–40 (35) 3.5 7.0–10.0 (8.5) C2 –C10 (C6 ) 29.7
EM3L4 20–50 (35) 10.6 7.0–10.0 (7.5) C16 –C18 (C16 ) 5.3
EM3L6 15–40 (35) 4.1 7.5–9.0 (8.5) C2 –C10 (C6 ) 23.3
a
The temperature range is the temperatures at which the activities are greater than 50% of the highest value (Figure S1). b pH range is the pHs at which the
activities are greater than 50% of the highest value (Figure S2). c Substrates are the p-nitrophenyl esters for which the enzyme shows an activity greater than
20% of the highest value (Figure S3).
Evidence-Based Complementary and Alternative Medicine 7
(kDa) M T S P T S P T S P (kDa) M T S P T S P T S P
250
250 130
130 100
100 70
70 55
55
35 35
25 25
15 15
(a) (b)
(kDa) M 1 2 3 4 5
250
130
100
70
55
35
25
15
(c)
Figure 3: Expression of esterase/lipase genes. (a) Expression analysis of EM3L1, EM3L2, and EM3L3; (b) expression analysis of EM3L4,
EM3L6, and EM3L7 with co-expression of the GroEL-GroES chaperone genes at 16◦ C; (c) purified enzymes. The bands corresponding to
the proteins are indicated by arrows. Lane M: molecular mass standards, lane T: total cell lysate, lane S: soluble fraction, lane P: insoluble
fraction, lane 1: purified EM3L1, lane 2: purified EM3L2, lane3: purified EM3L3, lane 4: purified EM3L4, and lane 5: purified EM3L6.
300
MnCl2 147 Tween 20 74
MgCl2 175 Tween 40 70
200 CaCl2 175 Tween 60 54
CuCl2 165 Tween 80 69
ZnSO4 52 Triton X-100 92
100 FeSO4 0 SDS 0
CoSO4 35
NiSO4 112
0 PMSF 42
0 0.5 1 1.5 2 2.5 3 3.5 4
NaCl (M) EDTA 107
sequence in the N-terminus and co-expression of chap- [8] P. D. Schloss and J. Handelsman, “Biotechnological prospects
erone gene at low temperature, we could obtain soluble from metagenomics,” Current Opinion in Biotechnology, vol.
recombinant proteins encoded by 5 genes from E. coli. The 14, no. 3, pp. 303–310, 2003.
biochemical characterization of them revealed being cold- [9] H. L. Steele and W. R. Streit, “Metagenomics: advances in
adapted, reflecting the environmental feature of the origin ecology and biotechnology,” FEMS Microbiology Letters, vol.
of metagenome. 247, no. 2, pp. 105–111, 2005.
Particularly, EM3L4 branched out to a new group in [10] J. C. Venter, K. Remington, J. F. Heidelberg et al., “Envi-
ronmental genome shotgun sequencing of the Sargasso Sea,”
the phylogenetic tree, and any of homologous proteins to
Science, vol. 304, no. 5667, pp. 66–74, 2004.
EM3L4 has never been characterized. The purified EM3L4
[11] M. R. Rondon, P. R. August, A. D. Bettermann et al., “Cloning
preferred to hydrolyze longer fatty acids, and highly active the soil metagenome: a strategy for accessing the genetic and
at high NaCl concentration. Recently, some esterases whose functional diversity of uncultured microorganisms,” Applied
activities were increased in the presence of NaCl have been and Environmental Microbiology, vol. 66, no. 6, pp. 2541–2547,
identified using metagenomic libraries of various marine 2000.
environments such as deep-sea water [42], sea water [36], [12] P. Entcheva, W. Liebl, A. Johann, T. Hartsch, and W. R. Streit,
and sea sediment [18]. We suggest that EM3L4 is a novel “Direct cloning from enrichment cultures, a reliable strategy
lipase retaining salt-resistance property. Then, a question for isolation of complete operons and genes from microbial
consortia,” Applied and Environmental Microbiology, vol. 67,
arises whether homologous proteins belonging to the same
no. 1, pp. 89–99, 2001.
group with EM3L4 show similar properties, and it will need [13] O. Béjà, E. V. Koonin, L. Aravind et al., “Comparative
further investigation. genomic analysis of archaeal genotypic variants in a single
Conclusively, this study demonstrated that novel lipolytic population and in two different oceanic provinces,” Applied
enzymes in terms of primary sequence, activity profile, and Environmental Microbiology, vol. 68, no. 1, pp. 335–345,
and substrate specificity could be obtained by metagenomic 2002.
approach using deep-sea sediment sample. They could be [14] J. Handelsman, “Metagenomics: application of genomics
potentially used as a biocatalyst in pharmaceutical and fine to uncultured microorganisms,” Microbiology and Molecular
chemical industries. Biology Reviews, vol. 68, no. 4, pp. 669–685, 2004.
[15] W. R. Streit, R. Daniel, and K. E. Jaeger, “Prospecting
for biocatalysts and drugs in the genomes of non-cultured
Acknowledgments microorganisms,” Current Opinion in Biotechnology, vol. 15,
no. 4, pp. 285–290, 2004.
This work was supported by the KORDI in-house program [16] W. R. Streit and R. A. Schmitz, “Metagenomics—the key to the
(PE98513) and the Marine and Extreme Genome Research uncultured microbes,” Current Opinion in Microbiology, vol. 7,
Center Program and the Development of Biohydrogen no. 5, pp. 492–498, 2004.
Production Technology Using Hyperthermophilic Archaea [17] M. H. Lee, K. S. Hong, S. Malhotra et al., “A new esterase EstD2
Program of the Ministry of Land, Transport, and Maritime isolated from plant rhizosphere soil metagenome,” Applied
Affairs, Republic of Korea. Microbiology and Biotechnology, vol. 88, no. 5, pp. 1125–1134,
2010.
[18] Y. Hu, C. Fu, Y. Huang et al., “Novel lipolytic genes from the
References microbial metagenomic library of the South China Sea marine
[1] J. L. Arpigny and K. E. Jaeger, “Bacterial lipolytic enzymes: sediment,” FEMS Microbiology Ecology, vol. 72, no. 2, pp. 228–
classification and properties,” Biochemical Journal, vol. 343, 237, 2010.
no. 1, pp. 177–183, 1999. [19] P. Wei, L. Bai, W. Song, and G. Hao, “Characterization of two
[2] M. Nardini and B. W. Dijkstra, “α/β hydrolase fold enzymes: soil metagenome-derived lipases with high specificity for p-
the family keeps growing,” Current Opinion in Structural nitrophenyl palmitate,” Archives of Microbiology, vol. 191, no.
Biology, vol. 9, no. 6, pp. 732–737, 1999. 3, pp. 233–240, 2009.
[3] K. E. Jaeger, B. W. Dijkstra, and M. T. Reetz, “Bacterial [20] E. Y. Kim, K. H. Oh, M. H. Lee, C. H. Kang, T. K. Oh, and J. H.
biocatalysts: molecular biology, three-dimensional structures, Yoon, “Novel cold-adapted alkaline lipase from an intertidal
and biotechnological applications of lipases,” Annual Review flat metagenome and proposal for a new family of bacterial
of Microbiology, vol. 53, pp. 315–351, 1999. lipases,” Applied and Environmental Microbiology, vol. 75, no.
[4] K. E. Jaeger and T. Eggert, “Lipases for biotechnology,” Current 1, pp. 257–260, 2009.
Opinion in Biotechnology, vol. 13, no. 4, pp. 390–397, 2002. [21] P. Tirawongsaroj, R. Sriprang, P. Harnpicharnchai et al.,
[5] A. Pandey, S. Benjamin, C. R. Soccol, P. Nigam, N. Krieger, and “Novel thermophilic and thermostable lipolytic enzymes
V. T. Soccol, “The realm of microbial lipases in biotechnology,” from a Thailand hot spring metagenomic library,” Journal of
Biotechnology and Applied Biochemistry, vol. 29, no. 2, pp. 119– Biotechnology, vol. 133, no. 1, pp. 42–49, 2008.
131, 1999. [22] J. H. Jeon, J. T. Kim, Y. J. Kim et al., “Cloning and character-
[6] R. Sharma, Y. Chisti, and U. C. Banerjee, “Production, ization of a new cold-active lipase from a deep-sea sediment
purification, characterization, and applications of lipases,” metagenome,” Applied Microbiology and Biotechnology, vol. 81,
Biotechnology Advances, vol. 19, no. 8, pp. 627–662, 2001. no. 5, pp. 865–874, 2009.
[7] J. Handelsman, M. R. Rondon, S. F. Brady, J. Clardy, and R. [23] J. H. Jeon, J. T. Kim, S. G. Kang, J. H. Lee, and S. J.
M. Goodman, “Molecular biological access to the chemistry of Kim, “Characterization and its potential application of two
unknown soil microbes: a new frontier for natural products,” esterases derived from the arctic sediment metagenome,”
Chemistry & Biology, vol. 5, no. 10, pp. R245–R249, 1998. Marine Biotechnology, vol. 11, no. 3, pp. 307–316, 2009.
Evidence-Based Complementary and Alternative Medicine 9
[24] H. J. Park, J. H. Jeon, S. G. Kang, J. H. Lee, S. A. Lee, and H. [41] J. K. Rhee, D. G. Ahn, Y. G. Kim, and J. W. Oh, “New ther-
K. Kim, “Functional expression and refolding of new alkaline mophilic and thermostable esterase with sequence similarity
esterase, EM2L8 from deep-sea sediment metagenome,” Pro- to the hormone-sensitive lipase family, cloned from a metage-
tein Expression and Purification, vol. 52, no. 2, pp. 340–347, nomic library,” Applied and Environmental Microbiology, vol.
2007. 71, no. 2, pp. 817–825, 2005.
[25] R. A. Hurt, X. Qiu, L. Wu et al., “Simultaneous recovery [42] M. Ferrer, O. V. Golyshina, T. N. Chernikova et al., “Microbial
of RNA and DNA from soils and sediments,” Applied and enzymes mined from the Urania deep-sea hypersaline anoxic
Environmental Microbiology, vol. 67, no. 10, pp. 4495–4503, basin,” Chemistry & Biology, vol. 12, no. 8, pp. 895–904, 2005.
2001.
[26] H. C. Bimboim and J. Doly, “A rapid alkaline extraction
procedure for screening recombinant plasmid DNA,” Nucleic
Acids Research, vol. 7, no. 6, pp. 1513–1523, 1979.
[27] S. F. Altschul, T. L. Madden, A. A. Schäffer et al., “Gapped
BLAST and PSI-BLAST: a new generation of protein database
search programs,” Nucleic Acids Research, vol. 25, no. 17, pp.
3389–3402, 1997.
[28] O. Emanuelsson, S. Brunak, G. von Heijne, and H. Nielsen,
“Locating proteins in the cell using TargetP, SignalP and
related tools,” Nature Protocols, vol. 2, no. 4, pp. 953–971, 2007.
[29] J. D. Thompson, D. G. Higgins, and T. J. Gibson, “CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice,” Nucleic Acids Research,
vol. 22, no. 22, pp. 4673–4680, 1994.
[30] N. Saitou and M. Nei, “The neighbor-joining method: a
new method for reconstructing phylogenetic trees,” Molecular
biology and evolution, vol. 4, no. 4, pp. 406–425, 1987.
[31] K. Tamura, J. Dudley, M. Nei, and S. Kumar, “MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA) software
version 4.0,” Molecular Biology and Evolution, vol. 24, no. 8,
pp. 1596–1599, 2007.
[32] M. M. Bradford, “A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein dye binding,” Analytical Biochemistry, vol.
72, no. 1-2, pp. 248–254, 1976.
[33] U. K. Laemmli, “Cleavage of structural proteins during the
assembly of the head of bacteriophage T4,” Nature, vol. 227,
no. 5259, pp. 680–685, 1970.
[34] P. Herzig, M. Hannington, B. McInnes et al., “Submarine
volcanism and hydrothermal venting Studied in Papua, New
Guinea,” EOS, vol. 75, no. 44, pp. 513–520, 1994.
[35] M. H. Lee, C. H. Lee, T. K. Oh, J. K. Song, and J. H.
Yoon, “Isolation and characterization of a novel lipase from
a metagenomic library of tidal flat sediments: evidence for a
new family of bacterial lipases,” Applied and Environmental
Microbiology, vol. 72, no. 11, pp. 7406–7409, 2006.
[36] X. Chu, H. He, C. Guo, and B. Sun, “Identification of
two novel esterases from a marine metagenomic library
derived from South China Sea,” Applied Microbiology and
Biotechnology, vol. 80, no. 4, pp. 615–625, 2008.
[37] L. Niiranen, S. Espelid, C. R. Karlsen et al., “Comparative
expression study to increase the solubility of cold adapted
Vibrio proteins in Escherichia coli,” Protein Expression and
Purification, vol. 52, no. 1, pp. 210–218, 2007.
[38] A. Vera, N. González-Montalbán, A. Arı́s, and A. Villaverde,
“The conformational quality of insoluble recombinant pro-
teins is enhanced at low growth temperatures,” Biotechnology
and Bioengineering, vol. 96, no. 6, pp. 1101–1106, 2007.
[39] J. A. Chesshyre and A. R. Hipkiss, “Low temperatures
stabilize interferon α-2 against proteolysis in Methylophilus
methylotrophus and Escherichia coli,” Applied Microbiology and
Biotechnology, vol. 31, no. 2, pp. 158–162, 1989.
[40] K. Braig, “Chaperonins,” Current Opinion in Structural Biol-
ogy, vol. 8, no. 2, pp. 159–165, 1998.