NUTRIGENOMICA
NUTRIGENOMICA
Ferdinand Molnár
Nutrigenomics
Nutrigenomics
Carsten Carlberg • Stine Marie Ulven
Ferdinand Molnár
Nutrigenomics
Carsten Carlberg Stine Marie Ulven
Institute of Biomedicine Department of Nutrition
University of Eastern Finland University of Oslo
Kuopio, Finland Oslo, Norway
Ferdinand Molnár
School of Pharmacy
University of Easterm Finland
Kuopio, Finland
Our daily diet is more than a collection of carbohydrates, lipids and proteins that
provide energy and serve as building blocks of our life; our diet is also the most
dominant environmental signal to which we are exposed from womb to death. The
fascinating area of nutrigenomics analyses this daily communication between diet,
food and nutrients, their metabolites and our genome. This book describes how
nutrition shapes human evolution and demonstrates its consequences for our sus-
ceptibility to diseases, such as diabetes and atherosclerosis. Inappropriate diet can
yield stress for our cells, tissues and organs and then it is often associated with low-
grade chronic inflammation. Overnutrition paired with physical inactivity leads to
overweight and obesity and results in increased burden for a body that originally
was adapted for a life in the savannas of East Africa. Therefore, this textbook does
not discuss a theoretical topic in science, but it talks about real life and our life-long
“chat” with diet. We are all food consumers, thus each of us is concerned by the
topic of this book and should be aware of its mechanisms.
The availability of the sequence of the complete human genome and the conse-
quent development of next-generation sequencing technologies have significantly
affected nearly all areas of bioscience. This new knowledge was the starting point
for new disciplines, such as genomics and its sub-discipline nutrigenomics. The lat-
ter comprises not only the variation of the human genome, such as single nucleotide
polymorphisms (SNPs), but also the dynamic packaging of the genome into chro-
matin including all information stored in this epigenome. Moreover, this book
describes the proteins that are involved in the signal transduction between dietary
molecules and the genome, such as nuclear receptors, chromatin modifiers and
energy status-sensing kinases, and their mechanism of action.
The purpose of this book is to provide an overview on the principles of nutrige-
nomics and their relation to health or disease. We are not aiming to compete with
more comprehensive textbooks on molecular nutrition, evolutionary biology, geno-
mics, gene regulation or metabolic diseases, but rather will focus on the essentials
and will combine, in a compact form, elements from different disciplines. In order
to facilitate the latter, we favour a high figure-to-text ratio following the rule “a pic-
ture tells more than thousand words”.
v
vi Preface
The content of this book is based on the lecture course “Nutrigenomics”, which
is held since 2003 once per year by one of us (C. Carlberg) at the University of
Eastern Finland in Kuopio. The book is subdivided into 3 sections and 12 chapters.
Following the “Introduction”, there are sections on the “Molecular genetic basis”
and the “Links to disease”, which take a view on nutrigenomics from the perspec-
tive of molecular mechanisms or from the causes of metabolic diseases,
respectively.
This book is primarily designed for master level students of biosciences, but may
also be used by students of other biomedical disciplines and by PhD students. The
book has five major learning objectives. Students should:
(i) Get an overview on human variation on the level of the genome and epigenome,
in response to dietary molecules and the regulatory proteins involved in the
respective signal transduction processes
(ii) Have an understanding of the diseases that are strongly associated with dietary
intake and physical inactivity, such as obesity, type 2 diabetes, atherosclerosis
and the metabolic syndrome
(iii) Recognize the key components and mechanisms in nutrigenomics and the mul-
tiple layers of its regulatory complexity
(iv) Show the ability to analyze the human genome and epigenome and its variation
in nutrition sensing and information processing processes, i.e. to judge their
impact for on the complex etiology of metabolic diseases
(v) Apply knowledge in nutrigenomics in designing, performing and analyzing
respective experiments, such as quantitative PCR, RNA-seq or ChIP-seq
We hope the readers will enjoy this demonstrative book and get as enthusiastic
about the topic of nutrigenomics as the authors do.
The authors would like to thank Reinhard Bornemann, MD, PhD, Marjukka
Kolehmainen, PhD, Vibeke Telle-Hansen, PhD, and Jenni Puurunen, MSc, for
extensive proofreading and constructive criticism.
vii
Contents
Part I Introduction
1 Nutrition and Common Diseases ........................................................... 3
1.1 Human Nutrition ............................................................................ 3
1.2 Nutrition and Obesity ..................................................................... 8
1.3 Nutrition and Cancer ...................................................................... 9
1.4 Nutrition and Diabetes ................................................................... 11
1.5 Nutrition and Cardiovascular Diseases .......................................... 13
1.6 Impact of Exercise.......................................................................... 20
Additional Reading ................................................................................... 23
2 Human Genomic Variation .................................................................... 25
2.1 Migration and Evolutionary Challenges of the Modern
Human ............................................................................................ 26
2.2 Diversity of Human Populations .................................................... 27
2.3 Genetic Variants of the Human Genome ........................................ 30
2.4 The HapMap Project and Haplotype Blocks ................................. 33
2.5 Genome-wide Association Studies................................................. 35
2.6 Whole Genome Sequencing and the 1000 Genomes
Project ............................................................................................ 40
Additional Reading ................................................................................... 44
ix
x Contents
1,25(OH)2D3 1,25-dihydroxyvitamin D3
25(OH)D3 25-hydroxyvitamin D3
5,10-MTHF 5,10-methylene THF
α-MSH α-melanocyte-stimulating hormone
ABC ATP-binding cassette
ABL abetalipoproteinemia
AC adenylate cyclase
ACAT1 acetyl-CoA acetyltransferase 1
ACC acetyl-CoA carboxylase
ACL ATP citrate lyase
ADRB3 adrenoceptor beta 3
AGRP agouti-related peptide
AKT Akt murine thymoma viral oncogene homolog
ALA α-linolenic acid
ALOX5 arachidonate 5-lipoxygenase
ALOX15 arachidonate 15-lipoxygenase
AMPK adenosine monophosphate-activated protein kinase
AMY1 amylase
ANGPTL2 angiopoietin-like protein 2
APEH N-acylaminoacyl-peptide hydrolase
AP-1 activating protein 1
APO apolipoprotein
AR androgen receptor
ARL4C ADP-ribosylation factor-like
ARNTL aryl hydrocarbon receptor nuclear translocator-like
ASC apoptosis-associated speck
ASIP agouti signaling protein
ATF6 activating transcription factor 6
ATM ataxia telangiectasia mutated
atRA all-trans retinoic acid
β-OHB β-hydroxybutyrate
xiii
xiv Abbreviations
Abstract A significant lifestyle change has happened during the last 100–200 years
with industrialization, rapid urbanization, economic development and market glo-
balization. Changes in food intake and a more sedentary lifestyle both increase the
risk of chronic non-communicable diseases, such as obesity, type 2 diabetes (T2D),
cardiovascular disease (CVD) and various cancers. Diet is one of the key environ-
mental factors particularly involved in the pathogenesis and progression of most of
these diseases. Together with physical inactivity, alcohol abuse and tobacco use,
these four key environmental factors cause metabolic and physiological changes,
such as overweight and obesity (Chap. 8), insulin resistance and β cell failure
(Chap. 9), T2D (Chap. 10), hypertension (Chap. 11), dyslipidemia leading to ath-
erosclerosis and cardiovascular failure (Chap. 11) and the metabolic syndrome
(Chap. 12). However, not a single individual food component but the interaction
between many of them and the overall quality of diet is responsible for the increased
risk for these diseases.
In this chapter, we will provide a first overview of the role of nutrition in health
and disease. We will describe the evidence of dietary factors in non-communicable
diseases and the impact of exercise on the prevention of diseases. Moreover, we will
describe low-grade chronic inflammation (Chap. 7) as the underlying cause of many
non-communicable diseases. We will use obesity and cancer as examples, in order
to describe the link between inflammation and nutrition-triggered diseases.
Diet is composed of food groups that collectively provide the human body with its
nutritional needs of macro- and micronutrients. In addition to nutrients, food also
contains hundreds of bioactive compounds that have an effect on metabolism but
their functions on human health are more or less unknown. The main food groups in
our diet includes cereals and cereals products, fruit and vegetables, milk and dairy
products, meat, fish, and fats and oils. Some of the challenges in studying the role
of single nutrients or food groups on human health are the relatively small effects of
each food item or nutrient. It is the overall quality of diet and the interaction among
many food groups and nutrients, and not an individual food component that is play-
ing a role in human health. Therefore, increased emphasis in nutrition research has
been placed on understanding healthy dietary patterns, such as the Mediterranean
diet and the Nordic diet, on human health.
Human nutrition is the provision to obtain a sufficient amount of macro- and
micronutrients necessary to support essential functions of life, such as energy sup-
ply, reproduction and growth, and to maintain good health. The main macronutri-
ents in diet are carbohydrates (digested to glucose), proteins (digested to amino
acids) and lipids (dissoluted to fatty acids and cholesterol), whereas micronutrients
mainly consist of vitamins and minerals (Chap. 3). Macronutrients provide the body
with energy when they are metabolized or are stored in form of glycogen, proteins
or triacylglycerols when there is excess of energy. Equally, these nutritional com-
pounds can be used in anabolism for the synthesis of new macronutrients. Both
catabolism and anabolism are tightly controlled pathways composed of enzymatic
cascades (Fig. 1.1).
The key metabolic tissues are intestine, liver, adipose tissue, skeletal muscle and
the brain (Chaps. 8, 9, 10, 11, and 12). Food intake relies on the interaction between
Catabolism
ab
boli
oli
Ana
sm
Lactate and
Macromolecules other
intermediates
Glycogen Reactive oxygen
storage
Energy
Energy
Waste
Triacylglycerols species
Proteins Carbon dioxide
Urea
Triacylglycerols
Growth
Proteins
Nucleic acids
Polyamines
Fig. 1.1 Simplified view of metabolism principles. Macronutrients provide the body with
energy via catabolic processes or energy storage of macromolecules, such as glycogen (from glu-
cose), proteins (from amino acids) and triacylglycerols (from fatty acids). When macronutrients
are catabolized to generate energy, lactate and other intermediates, such as reactive oxygen species
(ROS), carbon dioxide and ammonia, are synthesized. The body needs to get rid of this waste via
endogenous anti-oxidant defense systems, respiration via the lungs and urea-excretion via the
urine, in order to avoid intoxication. Furthermore, the human body also uses amino acids for the
synthesis of nucleic acids and polyamines for normal growth and regeneration
1.1 Human Nutrition 5
other purposes than protein synthesis, such as the synthesis of purines and pyrimi-
dines as nucleic acid components. Normally, the rate of amino acid breakdown bal-
ances the rate of their intake, i.e. the body does not store amino acids as an energy
source. Amino acid metabolism takes place primarily in the liver and the exception
is the catabolism of branched chain amino acids in the skeletal muscle. During
extreme situations, such as starvation or disease, the body breaks down proteins to
amino acids, in order to use their carbon backbone as substrates for the synthesis of
glucose, fatty acids and ketone bodies. Thus, amino acids can play an important role
in whole body energy homeostasis.
Lipids are the major source of energy for the human body with an acceptable
daily intake range of 20–35 E%. Triacylglycerols, i.e. glycerol esterified with three
fatty acids, represent most of the dietary fat, while cholesterol and phospholipids are
of lower amount. Fatty acids are classified as saturated (SFAs), monounsaturated or
polyunsaturated depending on the number of double bonds in their backbone struc-
ture. The proportion of the fatty acids in food depends on its source, such as animal
or plant origin. The challenge with fat intake is the proportion between saturated
and unsaturated fat. The recommended daily intake of monounsaturated fatty acids
should be in the order of 10–20 E%, that of SFAs less than 10 E% and that of poly-
unsaturated fatty acids (PUFAs) 5–10 E% including at least 1 E% as ω-3 fatty acids.
Lipids are insoluble in aqueous solutions and are therefore found in all cells as
membrane-associated lipids, in adipocytes as droplets of triacylglycerols and in
blood plasma as major components of differently sized lipoproteins (Sect. 11.3).
Dietary lipids are not only important suppliers of energy (via β-oxidation) but some
of them, such as fatty acids, steroid hormones and eicosanoids, also act as co-
enzymes and biological active molecules (Box 1.1) and play critical roles in the
control of homeostasis (Chaps. 3 and 9). Dyslipidemias, i.e. disturbances in lipid
metabolism, are therefore common in chronic metabolic diseases (Sect. 11.4).
In a historical perspective, the medical focus on diet was to avoid nutrient defi-
ciency diseases, such as scurvy and rickets. In contrast, today the main focus of
nutrition research and the definition of nutritional requirements are from the per-
spective of preventing non-communicable diseases, i.e. the focus is now on dietary
patterns that maintain health rather than just on the intake of nutrients (Box 1.2). A
joint World Health Organization (WHO)/United Nations Food and Agriculture
Organization (FAO) report summarizes evidences from nutritional epidemiology
and experimental research related to diet for the prevention of non-communicable
diseases (see examples in Tables 1.1, 1.2, 1.3 and 1.4). In this context, the term
“convincing evidence” is used when large numbers of epidemiological studies show
consistent associations between exposure and disease, with little or no evidence to
the contrary. These associations are also biological relevant. These evidences have
been translated into food-based nutritional guidelines facilitating the understanding
what a healty diet consist of, in order to prevent non-communicable diseases and
maintain health. These food-based nutritional guidelines focus on food groups
rather than nutrient intake and macronutrient distribution ranges for protein, carbo-
hydrate and fat. A healthy diet includes (i) a nutritious diet based on a variety of
foods originating mainly from plants rather than from animals, (ii) to eat bread,
grains, pasta, rice or potatoes several times a day, (iii) to eat a variety of vegetables
and fruits, preferably fresh and local, several times per day, (iv) to control fat intake
and replace most SFAs with unsaturated vegetable oils or soft margarines, (v) to
replace fatty meat and meat products with beans, legumes, lentils, fish, poultry or
lean meat, (vi) to use milk and dairy products that are low in both fat and salt and
(vii) to select foods that are low in sugar and eat refined sugar sparingly, limiting the
frequency of sugary drinks and sweets. People should also choose a low-salt diet.
Total salt intake should not be more than one teaspoon (6 g) per day, including the
salt in bread and processed, cured and preserved foods, in order to prevent hyperten-
sion (Sect. 11.1).
In 2010, overweight and obesity were estimated to cause 3.4 million deaths and 3.9 %
of years of life lost worldwide. The global prevalence of obesity (defined via a body
mass index (BMI) ≥ 30, which is calculated as weight in kilograms divided by the
square of the height in meters) doubled between 1980 and 2014. In 2014, the world-
wide number of obese adults (BMI ≥ 30) was 600 millions, but the total number of
overweight adults (BMI ≥ 25) was 1.9 billion (Sect. 8.1). In 2013, the worldwide num-
ber of overweight children under the age of 5 years was 42 million. The United States
had the largest absolute increase in the number of obese people since 1980, followed by
China, Brazil and Mexico. The age-standardized mean BMI ranges from less than 22 in
parts of sub-Sahara Africa and Asia to 30 to 35 in some Pacific islands and countries in
the Middle East and North Africa. The risk of T2D (Sect. 10.1) and hypertension (Sect.
11.1) rises with increased weight, while there is overlap between the prevention of
obesity and the prevention of a variety of chronic diseases, especially T2D.
A dietary factor that convincingly reduces the risk of weight gain and obesity is
dietary fibre (Table 1.1). Regular physical activity also convincingly reduces the
risk (Sect. 1.6). In contrast, the dietary factor that convincingly increases the risk of
weight gain and obesity is high intake of energy-dense foods that are not only
highly processed but also micronutrient poor. Typical energy-dense foods are high
in fat (butter, oils and fried foods), sugar or starch. In contrast, energy-dilute foods
have high content of water and fibre, such as fruits, vegetables, legumes and whole
grain cereals. Other dietary factors that have shown a probably increased risk of
weight gain and obesity are high intake of sugar-sweetened soft drinks and fruit
juices. Thus, in order to prevent obesity people should limit energy intake from
total fats and sugars, and increase consumption of fruit and vegetables, as well as
legumes, whole grains and nuts. People should also be engage in regular physical
activity.
In 2012 the worldwide estimated number of persons with recent diagnosis of cancer
was 14.1 millions. This number is expected to increase to some 24 millions by 2035.
In 2012, cancer caused wordwide 8.2 million deaths (representing 22 % of non-
communicable disease deaths). Cancer is defined as a disease, in which the normal
control of cell division is lost, so that an individual cell multiplies inappropriately to
form a primary tumor. The tumor cells may eventually spread through the body and
form metastases, both primary and secondary cancer finally causing suffering and
death. Cancer can arise from different tissues and organs in the body, thus there are
many different forms of cancer.
Common variations in genes that regulate the metabolism of dietary molecules
on their own do not cause any significant cancer risk, but in combination with an
unhealthy lifestyle, such as smoking and high-fat diet, they may do so. Thus, dietary
molecules can both increase or reduce the cancer risk, but compared with smoking
their effects are usually small.
Also according to the WHO, diet is one of the most important environmental fac-
tors contributing to cancer risk. Around one third of cancer deaths are due to high
body mass index, low fruit and vegetable intake, lack of physical activity, tobacco
use and alcohol use. Even if dietary factors account for approximately 30 % of can-
cer cases in industrialized countries, only a few definite relationships between spe-
cific nutrient-related factors and cancer are established.
For example, there is convincing evidence that overweight and obese individuals
have increased risk of cancer of esophagus, colorectum, breast in post-menopausal
women, endometrium and kidney, while individuals who consume a high amount of
alcohol are prone to cancers of the oral cavity, pharynx, larynx, esophagus, liver and
breast. Moreover, aflatoxins and some forms of salted and fermented fish contribute
to the development of liver and nasopharynx cancer, respectively (Table 1.2).
10 1 Nutrition and Common Diseases
Importantly, there is convincing evidence that physical activity decreases the risk of
colon cancer. Dietary factors that probably increase the cancer risk include high
intake of preserved meat (colorectum), of salt-preserved foods and salt (stomach)
and of very hot drinks and spicy food (oral cavity, pharynx and esophagus). In con-
trast, probably protective factors are the consumption of fruit and vegetables (oral
cavity, esophagus, stomach and colorectum) and physical activity (breast cancer).
According to the World Cancer Research Fund (WCRF) and the American Institue
for Cancer Research (AICR), intake of foods containing fibre is also a probably
protective factor against colorectal cancer, while intake of red meat and processed
meat convincingly increases the risk of this type of cancer. Thus, in order to prevent
cancer people should eat a healthy diet consisting of plenty of whole grains, pulses,
1.4 Nutrition and Diabetes 11
vegetables and fruits, and limit the intake intake of high-calorie foods (foods high in
sugar or fat), red meat and foods high in salt. In addition, intake of processed meat
and sugary drinks should be avoided.
One of the largest difficulties to study the role of diet on cancer risk are caused
by the inaccuracy of estimating dietary intake, mostly due to recall bias. Therefore,
especially results from mostly available case-control studies on diet that have retro-
spectively assessed the food intake among people who have already developed can-
cer are less reliable than results from prospective cohort studies. In the latter, diet is
assessed among healthy subjects, who are then followed for a long period (probably
10 years or more) before the diagnosis of cancer. Randomized controlled trials
(RCTs) eliminate the bias and positive results from such studies can provide evi-
dence that the intervention has caused changes in cancer risk. Such trials have to be
very large, are expensive and can only test a specific food or dietary pattern over a
few years. Thus, only few results are available from trials of dietary factors and
cancer risk, while negative results do not rule out the possibility that there could be
an effect at a different dose, a longer duration or if the intervention included subjects
with a different age.
So far, the European Prospective Investigation into Cancer and Nutrition (EPIC)
is the largest diet and disease study ever undertaken. Since 1992 it has recruited
more than half a million people from 10 European countries (23 centers), which
have been physically examined and completed lifestyle surveys including detailed
diet questionnaires. To avoid self-evaluation bias, EPIC combined dietary intake
data with objective dietary biomarkers assessed from blood of the participants.
Results from this study will give us a much better understanding of the role of diet
on cancer risk in the future.
In cancer cells, oncogenes and tumor suppressor genes regulate the metabolism of
nutrients, and thus mutations in genes encoding for metabolic enzymes can contribute
to the development of cancer (Fig. 1.2). There is a large variation in cancer risk
between world regions and types of cancer. For example, there is a marked overall
difference in incidence and mortality of colon cancer in different parts of the
EU. Greece shows the lowest incidence rate and mortality from colon cancer in
Europe, while Germany has the highest incidence rate and mortality being more than
double compared to Greece (Fig. 1.3). Cancer risk is mainly due to environmental
factors affecting the epigenome (Chap. 5) rather then due to genetic factors, as migrant
studies showed that moving from a region with low risk to one with a high risk leads
to the same cancer pattern of the host country within one generation. Studies with
identical twins also support the role of environmental factors affecting the epigenome,
since the genetic risk to develop cancer at the same site is less than 10 %.
In 2012, diabetes (type 1 and type 2) caused 1.5 million deaths worldwide (repre-
senting 4 % of all deaths from non-communicable diseases). In 2013 the worldwide
number of persons with T2D was around 387 million (Sect. 10.1). However, this
12 1 Nutrition and Common Diseases
a Glucose
Serine
Oncogenes Glycine
Epigenetic
Nucleotides effecs
HIF1
Antioxidant defense
cell growth?
Pyruvate Lactate TET2, histone
demethylases other
NRF2 NRF2 dioxygenases
KEAP1 KEAP1 Lipids
Cys Cys Cys Cys
Succ Succ Ac-CoA
PHD 2-HG 2-HG DH
OAA Citrate
Mutant
CO2 O2 IDH1/2 NADP+
Succ α-KG Malate Isocitrate
FH NADPH
AMPK, Fumarate α-Ketoglutarate
Apoptosis SDH
Succinate Succinyl-CoA Oncogenes Glutamine
Mitochondrion
b
Oxalacetate
deh
ydro se Citrate
Malate heta
Mal genase synt rate
ate Cit
D-2-Hydroxyglutarate
se
Fu
ita
Oncometabolite
ma
on
ras
Ac
e
Fumarate
Substrate cis-Aconitate
e.g. 4-OH-Proline
Product CO
dehydrogenase
residue
2
e.g. proline O2 NADP+
Succinate
Aconitase
residue NADH
D-2-hydroxy- Mutated
Dioxygenase glutarate isocitrate
dehydrogenase dehydrogenase
NAD+ 1 and 2
Succinate
Su ynth
NADPH
ase
Isocitrate
rog te
cc et
s
en
hyd tra
iny as
α-Ketoglutarate
de Isoci
l-C e
oA
GTP NAD+
CoA-SH
α-Ke e
t
deh oglutar itrat
ydro a Isoc genase
gen te d ro NADH+H+
ase d ehy
Oxalosuccinate
Succinyl-CoA
NADH
CO2 NAD+ CO2
α-Ketoglutarate
Fig. 1.2 Cancer cell metabolism. (a). The two major nutrients consumed by cancer cells are the
amino acid glutamine and glucose, which provide precursors for (i) nucleotides, (ii) the amino acids
serine and glycine and (iii) lipids. Inside mitochondria glutamine is converted into glutamate.
1.5 Nutrition and Cardiovascular Diseases 13
number is most likely underestimated, since there are many undiagnosed cases,
especially in developing countries, which catch up with diseases related to overnu-
trition. The early stages of T2D are characterized by an overproduction of insulin as
a result of insulin resistance of skeletal muscle and/or the causing increased glucose
levels when the disease progresses (Sect. 9.2). The prevalence and mortality rates of
T2D differ in the world. Highest prevalence is in Qatar and Saudi Arabia and lowest
prevalence is in the Ukraine and Nigeria, while the total number of deaths related to
T2D is highest in India and China. Countries with the highest prevalence and rates
of mortality spend less money per patient (India and China) than USA, Australia,
Germany and United Kingdom (Fig. 1.4). A main concern with T2D is that not only
elderly but also children and adolescents develop the disease. Complications of T2D
also include increased risk of blindness, kidney failure, coronary heart disease
(CHD) and stroke (Sect. 10.1).
In order to prevent T2D and its complications, people should maintain a healthy
body weight by being physically active for least 30 min of regular, moderate-
intensity activity on most days. In addition, people should eat a healthy diet consist-
ing of between 3 and 5 servings of fruit and vegetables per day and reduce sugar and
SFA intake. These recommendations are based on the fact that there is convincing
evidence that weight gain, visceral fat and physical inactivity increases the risk of
T2D (Table 1.3). The dietary factor that probably decreases the risk of T2D is
non-starch polysaccharide, which is the main constituent of dietary fiber. In con-
trast, the intake of SFAs probably increases the risk of T2D. The molecular
mechanisms behind the development of T2D and the possible role of inflammation
and some dietary factors are further described in Chaps. 9 and 10.
CVDs are the major contributor to the global burden of disease among the non-
communicable diseases and in 2012 caused 17.5 million deaths, i.e. 46 % of non-
communicable disease deaths worldwide (Sect. 11.2). Tobacco use, physical
inactivity and unhealthy diet are responsible for about 80 % of CHD and cerebro-
vascular disease, i.e. heart attack and stroke. Ischemic or CHD, i.e. the failure to
supply blood to the heart, is the major cause of CVD deaths (42.5 %), while cerebro-
vascular disease, i.e. the failure to supply blood to the brain, causes 35.5 % of the
Fig. 1.2 (continued) (b). Glutamate is the major source of the TCA cycle intermediate
α-ketoglutarate that is a substrate of dioxygenases, such as prolyl hydroxylases, histone demethyl-
ases (HMTs) and 5-metylcytosine hydroxylases modifying proteins and DNA. Thus, α-ketoglutarate
is an essential component of cell signaling and epigenetic networks. Oncogenic signaling regulates
uptake and catabolism of glucose and glutamine. Presumed metabolic tumor suppressors, such as
kelch-like ECH-associated protein 1 (KEAP1), fumarate hydratase (FH), succinate dehydrogenase
(SDH) and D-2-hydroxyglutarate dehydrogenase (D2HGDH) as well as oncogenes, such as isoci-
trate dehydrogenase (IDH) 1 and 2, control the abundance of key metabolites that regulate signal-
ing functions. These signaling activities contribute to malignant transformation in cancer cells
14 1 Nutrition and Common Diseases
61 29 European Union
59 26
The Netherlands
37 17
61 29 Finland
Belgium 58 28
Sweden
61 39
Denmark
59 30
United
55 27
Kingdom
Ireland 71 34
Germany
64 26
Luxembourg 68 34
61 29 Austria
France
61 29
Italy
51 27
30 15
Spain
64 30 Greece
Incidence/100 000 people
Portugal
Mortality/100 000 people
Fig. 1.3 Rates of colorectal cancer. Incidence and disease-specific mortality per 100,000 people
in 15 EU countries. Data were collected from the EUCAN website (http://eu-cancer.iarc.fr/
EUCAN/Default.aspx), which is administered by the International Agency for Research on
Cancer. EUCAN disseminates country-specific information on cancer burden, derived from data
collected by the national cancer registries and from the WHO mortality database
1.5
Number of deaths (x 100, 000) Expenditure per patient (US$ thousands) Comparative prevelance among adults (%)
0
2
4
6
8
10
12
0
2
4
6
8
10
0
5
10
15
20
25
Sa Q Sa Qa Sa Q
ud ata ud t ud ata
iA r
iA r i A ar ra
ra ra bi
countries in 2011
bi
a
bi
a a
UA UA
UA
E E
Eg E Eg Eg
yp yp yp
t M t M t
M ex ex
ex ico ico
ico
Ba Ba Ira Ba Ira
ng Iran ng n ng n
lad lad lad
es es es
h h h
Br B B
Ph az Ph raz Ph raz
ilip il ilip il ilip il
pi pi pi
Nutrition and Cardiovascular Diseases
ne ne ne
Ru s Ru s Ru s
ss ss ss
ia ia ia
US US US
A A A
In In In
di
di
a
di
a a
Ch Ch Ch
in in in
a a a
Ja Ja Ja
pa pa pa
n n n
Isr Isr Isr
Au el a Au ael Au ael
So stra So stra So stra
l ut l ut l
ut
h ia h ia h ia
Af Af Af
Ge ica r Ge a
ric Ge a
ric
rm rm rm
an an an
y y y
U U U
Ni K Ni K Ni K
ge ge ge
r Uk ria Uk ria
Uk ia ra
ra ra in
in in e
e e
Fig. 1.4 Prevalence, total expenditure per patients and number of diabetes-related deaths selected
15
16 1 Nutrition and Common Diseases
Fig. 1.5 CVD accounts for nearly one-third of deaths worldwide. Ischemic heart diseases are
caused primarily by clogged arteries (atherosclerosis) and are responsible for most of the CVD
deaths
Table 1.4 Overview of lifestyle factors and risk of developing cardiovascular disease
Evidence Decreased risk No relationship Increased risk
Convincing Regular physical activity, Vitamin E Myristic and palmitic
linoleic acid, fish and fish oils, supplements acids
vegetables, fruit and berries, Trans fatty acids
potassium, low to moderate High sodium intake
alcohol intake
Overweight
High alcohol intake
(for stroke)
Probable α-Linolenic acid Stearic acid Dietary cholesterol
Oleic acid Unfiltered boiled
coffee
Non-starch polysaccharides
Wholegrain cereals, nuts
(unsalted) plant sterols/stanols,
folate
Possible Flavonoids Fats rich in lauric acid
Soy products Impaired fetal nutrition
Beta-carotene
supplements
Insufficient Calcium Carbohydrates
Magnesium Iron
Vitamin C
acid linoleic acid (LA) and potassium as well as (iv) physical activity and low to
moderate alcohol intake all contribute to the reduction of CVD risk (Table 1.4). In
addition, the essential ω-3 fatty acid α-linolenic acid (ALA), oleic acid, fibre, whole
grain cereals, nuts, plant sterols and folate reduces the risk of CVD. There is also
convincing evidence that intake of SFAs (myristic acid and palmitic acids), trans-
fatty acids, sodium, overweight and high alcohol intake increases the risk of CVD,
while dietary cholesterol and unfiltered boiled coffee increases the risk of CVD.
Dietary reference values are mainly based on requirements from population
groups and not from individuals. However, enormous variability exists in individual
responses to diet and food components that affect overall health. Both genetic and
environmental factors influence the individual’s response. Discoveries underpin-
ning this variability will lead to advances in personalized nutrition as well as in
improved health and food policies, including dietary reference intakes for nutrient
needs and future dietary recommendations. A top priority for future nutrition
research is a better understanding of the variability in metabolic responses to diet
and food. Cellular and molecular characterization of disease phenotypes is therefore
crucial to understand the role of food components in disease prevention and treat-
ment, which is one of the key concepts of nutrigenomics.
The pathogenesis of T2D, certain cancers, CVD and neurodegenerative diseases
are closely linked with inflammation (Fig. 1.6). Moreover, obesity and the role of
dietary factors on immune function is crucial to understand the underlying mecha-
18 1 Nutrition and Common Diseases
Inflammation
Neurodegenerative Autoimmunity,
diseases Allergy
Metabolism
Fig. 1.6 Metabolic and immune-mediated pathologies as key driver processes of diseases in vari-
ous target organs
nisms how diet can prevent diseases. The role of genetic susceptibility will also be
important to determine who will benefit from specific interventions.
Cancer and obesity are examples of non-communicable diseases, in which
inflammation is the underlying cause of the disease (Sects. 7.4 and 8.1). Several
studies have shown an elevated risk of different types of cancer, such as pancreatic,
prostate, breast and colon cancer, is concomitant with high BMI. White adipose tis-
sue (WAT) is an important endocrine and metabolic organ consisting of both lipid-
loaded adipocytes and a stromal-vascular fraction, which contains pre-adipocytes,
macrophages, other inflammatory cells and endothelial cells (Fig. 1.7a). The latter
fraction may represent the cell population linking obesity to cancer. Obesity
increases the size of adipocytes (hypertrophy) and number of adipocytes (hyperpla-
sia) and is accompanied by infiltration of macrophages in the adipose tissue (Sect.
8.5). Inflammatory responses that are triggered by obesity are characterized by ele-
vated levels of circulating pro-inflammatory cytokines and acute phase proteins,
such as C-reactive protein (CRP). In addition, increased release of pro-inflammatory
adipokines, such as leptin, interleukin (IL) 6, serpin peptidase inhibitor, clade E
(SERPINE1, also called plasminogen activator inhibitor 1) and tumor necrosis fac-
tor (TNF), and reduced release of anti-inflammatory adipokines, such as adiponec-
tin, is associated with obesity (Fig. 1.7a).
The link between obesity and cancer initiation as well as the molecular mecha-
nisms underlying how obesity converses normal epithelial cells to tumor cells is not
completely understood (Fig. 1.7b). In addition to low-grade inflammation and the
1.5 Nutrition and Cardiovascular Diseases 19
Leptin
Adiponectin
TNF
IL6
PAI1
Leptin
Adiponectin
TNF
IL6
PAI1
OBESITY
Basement membrane
Blood vessel
NORMAL CANCER
Fig. 1.7 Obesity, inflammation and risk of disease. (a). WAT is an endocrine and metabolic organ
consisting of lipid-loaded adipocytes and pre-adipocytes, macrophages, other inflammatory cells and
endothelial cells. In subjects with normal weight, the adipose tissue secretes high levels of adiponec-
tin. During weight gain, WAT expands, which mediates the infiltration of macrophages and other
inflammatory cells and leads to the secretion of the cytokine TNF from macrophages. Furthermore,
the secretion of IL6, SERPINE1 (also called PAI1) and leptin is also increased. (b). Elevated inflam-
mation, increased availability of lipids and other macromolecules, impaired insulin signaling and
changes in adipokine signaling all contribute to the conversion of epithelial cells to an invasive
tumor. Although all of these pathways can contribute to cancer in certain circumstances, it remains
unclear whether they are predominantly required for the development of cancer in obese humans
20 1 Nutrition and Common Diseases
Monocyte IL1RN
IL6
IL1RN
Positive energy balance and physical inactivity
IL10
Macrophage
Adipose tissue
Adipocyte size
Triacylglycerols Free fatty acids
Pro-inflammatory LDL
adipokines (IL6, TNF) TLR expression Lymphoid organs - Spleen
Chronic low-grade inflammation IL10
Increased risk for atherosclerosis,
TReg cell
type 2 diabetes, neurodegeneration CD4+ TReg cells
and tumor growth Chemokine receptor TLR expression
Reduced functional capability expression on T cells Ratio of CD14low CD16+
Reduced longevity` and monocytes to CD14hi CD16- subsets
Monocyte
Fig. 1.8 Risk of disease by inflammation, exercise and diet. (a). The anti-inflammatory pheno-
type of adipose tissue is maintained by healthy diet and physical activity. This is marked by small
adipocyte size and the presence of anti-inflammatory macrophages (M2-type). In contrast, a posi-
tive energy balance and physical inactivity lead to the accumulation of fat and the infiltration of
adipose tissue with pro-inflammatory macrophages (M1-type) and T cells. These M1 macrophages
release pro-inflammatory adipokines, such as TNF and IL6, which cause low-grade inflammation,
thus promoting the development of chronic diseases. The lack of exercise also impairs the blood
lipid profile stimulating the development of atherosclerosis. (b). Exercise leads to reduced mass of
adipose tissue mass, smaller adipocyte size, less macrophage infiltration and a switch from M1 to
M2 macrophages. Furthermore, exercise increases the release of the hormones cortisol and adren-
aline from the adrenal cortex and medulla, respectively. Both these hormones inhibit the release of
TNF by monocytes. IL6 produced by contracting of skeletal muscles stimulates the release of
IL1RN from monocytes and macrophages, i.e. the levels of this anti-inflammatory cytokine in the
circulation increases. Exercise mobilizes TREG cells – which are a major source of the anti-
inflammatory cytokine IL10 – from the spleen into circulation
Future View
For more personalized dietary recommendations we need to improve the under-
standing of the variability in metabolic responses caused by diet, physical activity
and (epi)genetics. Even if a number of mechanisms of nutrient actions are well
described, far more needs to be understood. Disease phenotypes have to be charac-
terized more detailed on the cellular and molecular level, in order to understand the
role of diet on health benefit or disease risk. In this context, new biomarkers have to
be identified that better monitor dietary intake or physical activity. Since low-grade
chronic inflammation is the central cause of many lifestyle diseases, more insight
how physical activity and food components influence inflammation is needed. This
includes the identification of critical processes of energy homeostasis and an under-
standing how these pathways are disrupted in disorders that are related to
inactivity.
Key Concepts
• Diet is one of the main environmental factors that is involved in the pathogenesis
and progression of many non-communicable diseases.
• Overall quality of diet and not an individual food component but the interaction
among many of them is responsible for the increased disease risk.
• Carbohydrates (digested to glucose), proteins (digested to amino acids) and fats
(digested as fatty acids and cholesterol) are the main macronutrients that support
the body with energy or are stored when there is excess of energy. Disturbances
in the metabolism of these macronutrients can cause diseases.
• In a healthy diet, the acceptable macronutrient distribution ranges of carbohy-
drates, protein and fat are 45–65 E%, 10–35 E% and 20–35 E%, respectively.
• Obesity and high consumption of alcohol and of some forms of salted and fer-
mented fish increases the risk of certain cancers, while physical activity decreases
the risk of colon cancer.
• The complex interaction between genetic variation, individual metabolic charac-
teristics and diet significantly contributes to cancer.
• Different dietary factors can both increase or reduce cancer risk, but inaccuracies
in estimating dietary intake makes it difficult to define relationships between spe-
cific nutrient-related factors and cancer risk.
• Weight gain, visceral fat and physical inactivity increase the risk of T2D.
• Dietary fibre and regular physical activity reduce the risk of obesity, while high
intake of energy-dense foods increases the risk.
• Consumption of fruits, berries and vegetables, fish and fish oil, foods rich in the
essential fatty acid LA and potassium, as well as physical activity and low to
moderate alcohol intake, reduce the risk of CVD, while intake of SFAs, trans-
fatty acids and sodium each increase the risk.
• Inflammation is etiologically linked to the pathogenesis of cancer, obesity, T2D
and CVD.
• Elevated levels of circulating inflammatory cytokines and acute phase proteins
characterize obesity-triggered inflammation.
Additional Reading 23
Additional Reading
Abstract Due to partial isolation of human populations during history, their genetic
variation is geographically diverted. Positive natural selection, i.e. the force that
drives the increase in prevalence of advantageous traits, has played a central role in
human evolution. Genetic differences between human populations are most pro-
nounced in tissues, such as the skin, the intestinal tract or the immune system, that
are directly affected by the environment. This led not only to obvious differences in
skin color among the populations, but also in different resistance to diseases and
diversity in dietary intake, such as the ability to digest milk sugar (lactose). The
genetic basis of the variation of human populations and individuals has recently
been studied and catalogued by large consortia, such as the HapMap Project and the
1000 Genomes Project. They obtained data via genome-wide genotyping and whole
genome sequencing of 2504 subjects and thus allow the study and analysis of the
relation of human genomic variation and disease risk.
In this chapter, we will briefly describe the genetic adaption of the anatomically
modern human to new geographic and climatic environments in Asia and Europe
and the challenges provided by the shift from hunters and gatherers to farmers
(Chap. 4). We will discuss how complex phenotypic traits influence the risk to
develop diseases, such a T2D and CVD (Chaps. 10 and 11). Each complex disease
is based on dozens to hundreds of gene variants, such as single nucleotide polymor-
phisms (SNPs) and structural variants, such as copy number variations (CNVs). We
will describe how the HapMap Project and the 1000 Genomes Project map these
genetic variants in different human populations. In this context, we will discuss how
whole genome sequencing can result in the identification of rare SNPs that signifi-
cantly contribute to complex traits and diseases.
Approximately 200,000 years ago the anatomically modern human (Homo sapiens
sapiens) developed in East Africa. The main characteristic of this modern human is
a superior locomotive ability that is essential for encountering of predators and food
procurement. Some 60–80,000 years ago, some of these modern humans started to
migrate to Asia and Europe and there replaced, without significant interbreeding
(less than 4 % common genome sequence) already prevalent archaic Homo sapiens
species, such as the Neanderthals (Fig. 2.1). Due to their new environments our
ancestors were exposed to a number of divergent selective pressures, such as ther-
moregulation in colder climates, tolerance to hypoxia at high altitude and light skin
pigmentation in regions with lower levels of ultraviolet (UV)-B radiation (Sect.
4.2). Moreover, within this period humans were exposed to periodic cycles of feasts
and famines, which let certain gene variants, the so-called “thrifty genes” (Sect.
10.4), evolve that regulate efficient storage and utilization of energy from food.
Some 10,000 years ago our ancestors started to give up their hunter and gatherer
habit and became farmers. This significant lifestyle change was associated with
distinct foods, such as cereals and milk (Sect. 4.4). The improved nutrition supply
allowed higher population densities but was compromised with an increased load
with infectious diseases, many of which were acquired from domesticated animals.
Both diet change and immunological challenge caused dominant evolutionary pres-
sure and rather rapid genetic adaption. The phenotypic consequences of these adap-
tive genetic variants did not only shape the biological variation but also the health
and disease risk of the more than seven billion humans presently living on Earth.
However, the by far most drastic lifestyle change happened during the last 100–
200 years, i.e. in less than 10 generations (Sect. 1.1). Industrial revolution invented
machines, such as trains, automobiles and aeroplanes, the use of which caused a
15-35,000
40,000
50-60,000
60-80,000
>15,000
(50-60,000?)
Fig. 2.1 The migration of modern Homo sapiens. Approximately 60–80,000 years ago the
spread from East Africa over the rest of the continent was followed by an expansion from the same
area to Asia, probably by both a southern and northern route some 40–60,000 years ago. Oceania,
Europe and America were settled from Asia in that order
2.2 Diversity of Human Populations 27
significant reduction in the physical activity of most humans. In parallel, the world-
wide spreading of easy available, highly processed food led to overnutrition of the
majority of the human population. In Chap. 1 we already started to discuss the sig-
nificant increase in obesity and the resulting increase in the rates of cancer, T2D and
CVD. Worldwide it took several thousand years, i.e. clearly more than 100 genera-
tions, to turn most of the human population from hunters to farmers, but less than
50 years to be preferential users of cars, supermarkets and fast-food. This means
that the human population had simply no time to adapt genetically to the rapidly
changing “obesogenic environment”. In the context of an inactive lifestyle com-
bined with energy-dense foods, the gene alleles that had been initially evolved for
an efficient energy storage and physical mobility, increased the risk for chronic
diseases, such as T2D or CVD.
When humans became distributed to the different continents, new gene variations
could not be spread to all humans. Therefore, during the last 50,000 years, when
humans accumulated further mutations, population-specific alleles of human genes
evolved (Fig. 2.2). This resulted in phenotypic differences of the different geo-
graphic populations concerning skin color, body height and facial features. However,
there are no absolute genetic differences between the populations on the different
continents. For example, there is no single nucleotide difference that may be used as
a marker, in order to distinguish, in general, Africans from Eurasians. In contrast,
the different features in the physiognomy of the populations in the different conti-
nents are based on a multitude of gene loci, which carry alleles that vary in most
populations. This implies that a property (in population genetics often referred to as
a “trait”), such as skin color, can change rather rapidly, when the allele frequencies
shifts at the loci that contribute to this trait (Box 2.1). Furthermore, we have to
remind that some 500 years ago, when shipping and navigation over the oceans
became possible, a large migration started, which caused significant population
mixtures, particularly in the Americas, but also in other continents.
(continued)
28 2 Human Genomic Variation
Hundreds of complex phenotypic traits determine how humans look and behave
as well as their risks to develop certain diseases. Each complex phenotype is based
on dozens to hundreds of gene variants and environmental influences. Whole
genome sequencing has indicated that every human individual carries, on average,
approximately four million genetic variants (Sect. 2.4) covering about 12 Mb of
sequence (0.3 % of all). Most of these genetic variants are neutral, i.e. they do not
contribute to phenotypic variation or disease risk, and achieved significant frequen-
cies in the human population simply by chance. Nevertheless, there are a number of
common variants with a small to modest effect size that have a dominant role in
common complex traits. In addition, the sum of rare, high-penetrance variants is of
significant influence. For example, the trait “body height” is dependent on at least
180 gene loci, i.e. it is a prime example of a complex trait (for further examples see
Chaps. 8, 10 and 12). In Europe, this trait has changed significantly within only a
few generations (in average by 10 additional centimeters) under the environmental
trigger of improved quality and quantity of nutrition.
During evolution of the anatomically modern human up to 10 % of all protein-
coding genes, i.e. some 2000 genes, may have been affected by positive selection.
In particular, the immune system, the digestive tract and the skin (including hair,
sweat glands and sensory organs) had been susceptible to positive selection (Sect.
4.2). This is due to the fact that these organ systems are far more in contact with the
environment than other parts of the body. For example, variants of the innate and
adaptive immune system (Box 2.2), such as genes encoding for membrane immune
receptors, had been under special positive selection by pathogenic microbes. The
most recent example of this is the C-C chemokine receptor 5 (CCR5), which is
essential for the entry of the human immunodeficiency virus (HIV) 1 into T cells. A
32 bp deletion in the CCR5 gene protects its carriers from HIV infection, and this
mutation is currently becoming positively selected in populations where HIV1
infections occur on larger scale. Moreover, some alleles that were introduced into
modern humans through interbreeding with archaic (meaning nowadays extinct)
human species seem to have been positively selected. For example, a Neanderthal
2.2 Diversity of Human Populations 29
EAST ASIANS
Cambodian
Chinese
Japanese Vietnamese
Malay
Poles
French 99 Lower castes
Tribal Indians
Finns Middle castes
96 Upper castes
Scandinavians
INDIANS
EUROPEANS
100
Hema
Alur
Nguni
Mbuti Pygmy 1
Mbuti Pygmy 2
AFRICANS
San
Ancestral
Fig. 2.2 A network of population similarities. Based on the frequencies of insertions of Alu
short interspersed nuclear elements (SINEs) the network is rooted using a hypothetical ancestral
group that lacks the Alu insertions at each locus. Bootstrap values are shown (as percentages) for
main internal branches. Populations tend to cluster according to their geographic distance from
each other. This is to be expected, as geographically distant populations were less likely to
exchange migrants throughout human evolutionary history. Moreover, the African populations are
more diverse, which is consistent with the fact that anatomically modern humans lived in Africa
already since approximately 200,000 years. The observation that the largest genetic distances are
found between African and non-African populations is another indication that the root of the tree,
i.e. the origin of Homo sapiens sapiens, is in Africa
30 2 Human Genomic Variation
variant of the SLC16A11 gene, which encodes for a lipid transporter in the endo-
plasmic reticulum (ER), reached high frequencies, for example in native Americans,
being associated with increased T2D risk. Since archaic human populations outside
of Africa experienced some 300,000 years of independent accumulation of muta-
tions, their maximal 4 % contribution to the gene pool of the modern human may
have an overproportional impact on the physiology of present-day people.
The reference haploid sequence of the human genome (Box 2.3) was released in
2001 by the first “big biology” project, the Human Genome Project (Box 2.4), and
reflects the assembly of sequences derived from a few donors. SNPs are variants of
the reference sequence where exactly one nucleotide (A, T, G or C) is altered
(Fig. 2.3). In contrast, structural variants of the genome mostly affect more than one
nucleotide. These can be insertion-deletion variants (indels), where in most cases
only a few bases are added or removed, respectively, but there are also indels of up
to 80 kb in length. Indels that are not multiples of 3 bp in length and are located
2.3 Genetic Variants of the Human Genome 31
(continued)
32 2 Human Genomic Variation
Deletion (homozygous)
Reference genome GCAGCTGACAA...GTTGCATG
Target genome GCAGCTGA---------GCATG
SNP (heterozygous) Indel (homozygous) GCAGCTGA---------GCATG
Reference genome GACTGAGGCA AGGCTATG
Target genome GACTGGGGCA AGG--ATG
GACTGAGGCA AGG--ATG De novo insertion (heterozygous)
Reference genome GCTGCATG---------GATGC
Target genome GCTGCATGATC---GATGATGC
Phased SNPs GCTGCATG---------GATGC
Reference genome TAGCTGTAGC CTGATAGCT
Target genome TAGCTGTAGC CTGATTGCT
TAGCTCTAGC CTGATAGCT Inversion (heterozygous)
Reference genome ACTTGACTGCAAATCGTCAGTC
Target genome ACTTGACTACGATTTGCCAGTC
ACTTGACTGCAAATCGTCAGTC
Fig. 2.3 Types of variations present in human genome sequences. The haploid reference
genome is indicated at the top of each variant example, while the individual’s diploid genome is
shown below. The genetic variants can be either heterozygous or homozygous
within coding regions result in frameshift mutations, i.e. from the position of the
mutation onwards the whole amino acid sequence is changed. In inversion variants
the order of the bp is reversed, such as a 900 kb region of chromosome 17 that is in
the reverse order in approximately 20 % of individuals with Northern European
decent. Furthermore, CNVs consist of deletions or insertions of DNA streches in one
2.4 The HapMap Project and Haplotype Blocks 33
The genetic approach of linkage mapping (Box 2.5) is used since decades and iden-
tified genes responsible for many inherited monogenetic disorders, such as the neu-
rodegenerative Huntington’s disease. However, these types of diseases represent
only a relatively small fraction of all disorders. In contrast, most human diseases
have a complex origin, i.e. they involve many gene loci in a complex interaction
pattern. For these cases the genome-wide identification of SNPs via genotyping
34 2 Human Genomic Variation
(continued)
2.5 Genome-wide Association Studies 35
50 kb
SNPs
sequence 1 GGACAACC TTACG CGGAGACGA CGCGCCCGGAT CCAGC CCGAT CCCTGCTTACGGTGCAGTGGCACGTATT*CA CGTTTAG ACAACA GTTCTGA TATAG
sequence 2 GACTGGTCG TTGCCCCGGCT CAACC CTGAC CATCACTCCCCAGACTGTGATGTTAGTATCT TAATTGG GTGACG TGTGCGG TATCA
sequence 3 AATTCGTG CCCAA CGCAGACGA CTGCTATAACC GCGCT CTGAC TCCCATCCATCATGGTCGAATGCGTACATTA TGTT*GA GCGGTG TG*GTAA CGGCG
sequence 4 CTGCCCCAACC CCACC ATACT CCCCGCTTACGGTGCAGTGGCACGTATATCA TGATTAG ACGGTG
block 1 block 2 block 3 block 4 block 5 block 6 block 7 block 8 block 9 block 10 block 11
84 kb 3 kb 14 kb 30 kb 25 kb 11 kb 92 kb 21 kb 27 kb 55 kb 19 kb
2
Fig. 2.4 Block-like haplotype diversity and risk for disease. A 500 kb region of human chromosome 5q31 that contains a genetic risk factor for Crohn’s
disease was used as an example. The genomic region is subdivided into 11 common haplotype blocks of 11–92 kb in size, for which tag SNPs are indicated
Human Genomic Variation
2.5 Genome-wide Association Studies 37
Genetic variant A
Ancestral
chromosomes
Recombinantion
through many generations
Descendant chromosomes
A A
Fig. 2.5 The origin of haplotypes. Two ancestral example chromosomes get scrambled through
meiosis-related recombination over many generations, in order to yield different descendant chro-
mosomes. For example, after 30,000 years a typical chromosome will have undergone more than
one crossover per 100 kb. In the case of a genetic variant (marked by the A) on one ancestral chro-
mosome the risk of a particular disease increases. Thus, the two individuals in the current genera-
tion who inherited that region of the ancestral chromosome (referred to as a haplotype block) will
be at increased risk. Within the same haplotype block, which carries the disease-causing variant,
there are many SNPs that can be used to identify the location of the variant
of thousands of SNPs are tested for association with a disease in hundreds or thou-
sands of human individuals. 10 years of intensive GWAS research resulted in more
than 2400 publications reporting some 16,600 SNPs (as of April 2016) being statis-
tically robustly associated with one out of more than 500 complex diseases and
traits (see the database Catalog of Published Genome-Wide Association Studies,
www.ebi.ac.uk/gwas). A number of associations that are identified in one popula-
tion are often not found in members of other populations. Therefore, the most reli-
able evidence of a true genetic association is its replication in multiple populations.
However, most published studies have focused primarily on populations of European
ancestry.
38 2 Human Genomic Variation
Table 2.1 Multiple studies examining bone mineral density (BMD) in women have associated the
A allele with increased risk of low BMD causing osteoporosis
Handle-polulation Id 2n Alelle freq Genotype freq Hardy-Weinberg
TSC-CSHL-SC 12 A 22 A 0.409 G/G 0.182 Chi Square 5.272
G 0.591 A/G 0.818
TSC-CSHL-SC 12 AA 14 G 0.5 A/G 1.000 Chi Square 7
A 0.5
TSC-CSHL-SC 12 C 14 G 0.5 A/A 0.286 Chi Square 0.143
A 0.5 G/G 0.286
A/G 0.429
TSC-CSHL-SC 95 C 88 A 0.432 A/A 0.205 Chi Square 0.239
G 0.568 G/G 0.341
A/G 0.455
CSHL-HAPMAP-HapMap-CEU 120 A 0.442 A/A 0.233 Chi Square 0.144
US (residents with ancestry from G 0.558 G/G 0.35
Northern and Western Europe) A/G 0.417
CSHL-HAPMAP-HapMap-HCB 90 A 0.022 A/G 0.044 Chi Square 0.024
China G 0.978 G/G 0.956
CSHL-HAPMAP-HapMap-JPT 88 A 0.136 A/G 0.273 Chi Square 1.102
Japan G 0.864 G/G 0.727
CSHL-HAPMAP-HapMap-YR1 118 A 0.297 A/A 0.136 Chi Square 3.069
Nigeria (Yoruba) G 0.703 A/G 0.322
G/G 0.542
The SNP rs1544410, also known as the BsmI polymorphism, is located within the VDR gene.
Multiple studies examining BMD in women have associated the A allele with increased risk of low
bone minaral density (BMD) causing osteoporosis. The allele frequency, genotype frequency and
the Hardy-Weinberg equilibrium statistics are indicated for different HapMap populations
With the decreasing cost of the SNP arrays, it became feasible to genotype thou-
sands of samples in GWASs. Despite some notable successes in revealing numerous
novel SNPs and loci associated with complex phenotypes, most of the complex,
polygenic traits have not had much more than 10 % of their heritability explained by
the common variants assessed by GWAS. The “missing” or unsolved heritability
does not allow assigning an individual with any reliable estimation about his/her
risk for a particular disease. The only well-known exceptions are age-related
macular degeneration and type 1 diabetes (T1D), for which the combinations of
common and rare variants can provide a quantifiable risk profile. GWASs with
2000–5000 individuals confidently identify common variants with effect sizes,
referred to as odds ratios (ORs), of 1.5 or greater. This makes it unlikely that further
common SNPs with moderate or even large ORs in complex traits will be discov-
ered in future. Limited statistical power to detect small gene-gene and gene-envi-
ronment interactions requires increasing sample sizes, which may be achieved by
2.5 Genome-wide Association Studies 39
Replication study 1
Replication study 2
Replication study 3
Meta analysis
Fig. 2.6 GWAS meta-analysis. The statistical power of GWASs for the detection of associations
can be increased by a meta-analysis computing the effects of multiple studies. Here a fictive exam-
ple is shown, in which the results of three studies, which each did not reach significant associa-
tions, are combined in a meta-analysis now detecting a strong, significant association on
chromosome 9
pooling several GWASs through meta-analysis (Fig. 2.6). For example, sample
sizes of 60,000 subjects are necessary to provide sufficient power to identify the
majority of variants with ORs of 1.1 (i.e. a 10 % increased risk for the tested dis-
ease). Nevertheless, the majority of the missing heritability may be due to rare vari-
ants with high ORs, which are poorly captured by standard GWASs, or due to
epigenetic effects that cannot be detected by present genotyping arrays (Chap. 5).
GWASs indicate SNPs that are in high linkage disequilibrium to the genomic
variants that cause the disease, i.e. often they are on the same haplotype block.
However, this implies that most disease-associated SNPs are not functionally rele-
vant to mechanisms of the respective disease. Extensive sequencing of an associated
region may identify additional, previously unknown, rare variants with a possible
biologic role. This is one of the goals of the 1000 Genomes Project (Sect. 2.6).
However, protein-coding regions carry only 12 % of all SNPs that are associated
with traits, i.e. only in these cases a straightforward mechanistic explanation of the
impact of the genetic variation is possible. This implies that many of the remaining
88 % variations may affect the genomic binding sites of transcription factors, i.e.
they are regulatory SNPs (Sect. 4.4)
40 2 Human Genomic Variation
Se
1016 kb qu 108 $100,000,000.00
en
cin
g
15
10 kb co
No. of genomes sequences (log-transformed)
stp $10,000,000.00
Current er
ge
1014 kb progress no
m
e
$1,000,000.00
107
1013 kb
Sequencing cost per genome
$100,000.00
Bases per day per machine
1012 kb
$10,000.00
1011 kb 106
$1,000.00
1010 kb
rmed)
$100.00
109 kb
ine
-transfo
ch
105
ma
108 kb $10.00
er
ces (log
p
ay
rd
107 kb $1.00
pe
sequen
ses
Ba
5
10 kb
$0.01
No. of g
104 kb
103
1995 2000 2005 2010 2015 2020
Fig. 2.7 Whole genome sequencing costs. After many years of decline, the cost of sequencing a
genome had leveled off, but may dive again (dashed line) when further technological advances will
become effective. For more details see www.genome.gov/sequencingcosts
2.6 Whole Genome Sequencing and the 1000 Genomes Project 41
Sequencing of the genomes of various species Identification of variations between individuals Characterization of differences between tissues
P. troglodytes H. s. sapiens
Immunogenomics
Epigenomics
Cancer genomics
Metagenomics
G. gorilla H. s. neanderthalensis
DNA methylation
me
me Ac
me
Histone modifications
Looping
mRNA Genome architecture
Protein Transcription
Poly(A)
Fig. 2.8 Road map of sequencing science. The Human Genome Project created a reference
genome and now also the genomes of all other primate species are known including some extinct
human species (top left). Whole genome sequencing of several thousand human individuals is
performed in large consortia, such as the 1000 Genomes Project (top center). Moreover, the genetic
and epigenetic differences between tissues and cell types of the same human individual are col-
lected in cancer genomics and epigenomics projects, such as the Cancer Genome Consortium and
the Human Microbiome Project (top right). These sequencing provide a window into the illustrated
cellular processes (bottom)
total, the project describes 88 million genome variants, of which 84.7 million are
SNPs, 3.6 million short indels and 60,000 structural variants. As expected based on
the out-of-Africa model of human origins, individuals from African ancestry popu-
lations show most variant sites. A typical human genome carries 200,000 variants,
most of which are common and only 20 % are rare (MAF < 0.5 %). In average, a
typical genome contains some 150 variants resulting in protein truncation, 10,000
changing amino acids and 500,000 affecting transcription factor binding sites. The
data demonstrate that each human individual seems to differ from the current refer-
ence genome by putative loss-of-function mutations in 150 or more genes. Moreover,
the results imply that rare variants in individuals with a particular disease should be
interpreted within the context of their geographic and/or ancestry-based genetic
background.
The rapid maturation of next-generation sequencing technologies led to the
exponential development of methods for nearly all aspects of cellular processes,
such as ChIP-seq, RNA-seq and FAIRE-seq, i.e. sequencing emerged to a readout
for their detailed and comprehensive analysis (Fig. 2.8). Fast and inexpensive next-
generation sequencing has enabled a number of other large-scale studies, such as
42 2 Human Genomic Variation
the ENCODE Project and the FANTOM5 Project, which together produced the
presently most comprehensive map of functional genomic elements within the
human genome. In Chap. 4 we will discuss further applications of these projects
including the identification and characterization of regulatory SNPs (Sect. 4.4) and
the integrative personal omics profile (iPOP) of one human individual (Sect. 4.6).
Future View
Within only a few years next-generation sequencing technologies significantly
improved our knowledge of human genetic diseases. It is expected that this trend
will continue. Although data privacy of human subjects is a key issue, it will be
increasingly difficult to control and may deter individuals to participate in genetic
2.6 Whole Genome Sequencing and the 1000 Genomes Project 43
studies. However, many healthy as well as diseased people support an open data
concept and have no problem in making their genomic information public.
Interestingly, each human individual seems to be heterozygous for 50–100 genetic
variants that may cause inherited disorders in homozygous offspring. This will pro-
vide a large demand and challenge for genetic counselling based on whole-genome
sequencing. Moreover, gene-environment interactions provided by lifestyle factors,
as the personal choice of food, will create an additional level of complexity. Within
the next few years a number of next-generation sequencing applications will be
incorporated into clinical diagnostics, but it is yet unclear, how this will be financed.
Nevertheless, further developments of next-generation sequencing will stay a driv-
ing force in basic biomedical research, including nutrigenomics.
Key Concepts
• The anatomically modern human developed some 200,000 years ago in Africa
and started some 60–80,000 years ago to migrate towards Eurasia.
• Some 10,000 years ago, humans started to become farmers implying significant
lifestyle changes, such as the use of cereals and milk as new type of diet, being fol-
lowed from immunological challenge via enhanced rates of microbe infections.
• In the context of an inactive lifestyle combined with energy-dense foods, gene
variants that had been initially evolved for an efficient energy storage and physi-
cal mobility increase the risk for chronic diseases, such as T2D or CVD.
• Hundreds of complex phenotypic traits determine the risk to develop complex
diseases each being based on dozens to hundreds of gene variants and environ-
mental influences.
• Every human individual carries, on average, approximately four million genetic
variants covering about 12 Mb of sequence, i.e. 0.3 % of the whole genome.
• Human genetic variants are referred to as common, when they have a MAF of at
least 1 % in the studied population, or as rare, when they have a MAF of less than
1 %.
• The average difference in the nucleotide sequence of two unrelated humans is in
the order of 1 in 1000.
• The HapMap Project was launched in order to map genetic variants of the main
human populations via genome-wide genotyping.
• Despite some notable successes in revealing numerous novel SNPs and loci asso-
ciated with complex phenotypes, all GWAS-SNPs collectively account for only
some 10 % of the heritability of complex diseases.
• GWASs indicate SNPs that are in high linkage disequilibrium to the genomic
variants that cause the disease, but most disease-associated SNPs are not func-
tionally relevant to mechanisms of the respective disease.
• Whole genome sequencing results in the identification of the complete set of
genetic variants of a given human individual, such as the rare SNPs with large
effect sizes that significantly contribute to complex traits and diseases.
• The 1000 Genomes Project is the natural extension of the HapMap Project and
uses whole genome sequencing of 2504 genomes from populations covering all
five continents.
44 2 Human Genomic Variation
Additional Reading
1000 Genomes Project Consortium, Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM,
Korbel JO, Marchini JL, McCarthy S, McVean GA, Abecasis GR (2015) A global reference for
human genetic variation. Nature 526:68–74
Abecasis GR, Auton A, Brooks LD, DePristo MA, Durbin RM, Handsaker RE, Kang HM, Marth
GT, McVean GA (2012) An integrated map of genetic variation from 1,092 human genomes.
Nature 491:56–65
Altshuler DM, Gibbs RA, Peltonen L, Altshuler DM, Gibbs RA, Peltonen L, Dermitzakis E,
Schaffner SF, Yu F et al (2010) Integrating common and rare genetic variation in diverse human
populations. Nature 467:52–58
Haraksingh RR, Snyder MP (2013) Impacts of variation in the human genome on gene regulation.
J Mol Biol 425:3970–3977
Manolio TA (2010) Genomewide association studies and assessment of the risk of disease. N Engl
J Med 363:166–176
Pääbo S (2014) The human condition – a molecular approach. Cell 157:216–226
Shendure J, Lieberman Aiden E (2012) The expanding scope of DNA sequencing. Nat Biotechnol
30:1084–1094
Sudmant PH, Rausch T, Gardner EJ, Handsaker RE, Abyzov A, Huddleston J, Zhang Y, Ye K, Jun
G, Hsi-Yang Fritz M, Konkel MK, Malhotra A, Stütz AM, Shi X, Paolo Casale F, Chen J,
Hormozdiari F, Dayama G, Chen K, Malig M, Chaisson MJ, Walter K, Meiers S, Kashin S,
Garrison E, Auton A, Lam HY, Jasmine Mu X, Alkan C, Antaki D, Bae T, Cerveira E, Chines
P, Chong Z, Clarke L, Dal E, Ding L, Emery S, Fan X, Gujral M, Kahveci F, Kidd JM, Kong Y,
Lameijer EW, McCarthy S, Flicek P, Gibbs RA, Marth G, Mason CE, Menelaou A, Muzny
DM, Nelson BJ, Noor A, Parrish NF, Pendleton M, Quitadamo A, Raeder B, Schadt EE,
Romanovitch M, Schlattl A, Sebra R, Shabalin AA, Untergasser A, Walker JA, Wang M, Yu F,
Zhang C, Zhang J, Zheng-Bradley X, Zhou W, Zichner T, Sebat J, Batzer MA, McCarroll SA,
1000 Genomes Project Consortium, Mills RE, Gerstein MB, Bashir A, Stegle O, Devine SE,
Lee C, Eichler EE, Korbel JO (2015) An integrated map of structural variation in 2,504 human
genomes. Nature 526:75–81
Veeramah KR, Hammer MF (2014) The impact of whole-genome sequencing on the reconstruc-
tion of human population history. Nat Rev Genet 15:149–162
Part II
Molecular Genetic Basis
Chapter 3
Sensing Nutrition
Keywords Lipid sensing • Amino acid sensing • Glucose sensing • Nuclear recep-
tors • Gene regulation • Target genes • Lipid metabolism • PPARs • LXRs • FXR •
VDR • Innate immunity • Adaptive immunity • Molecular clock • REV-ERB • ROR
a b c
Lumen
Fatty acids Fatty acids Cholesterol
INSIG1
GPR40/ CD36
GPR120 G-protein SREBP SCAP
Cytoplasm
d e f
Cytoplasm
NO Cholesterol Lanosterol NO Lanosterol
Ub UBC7 UBC7
VCP VCP
HMGCR
SREBP 3’
5’
RNA Pol II
Nucleus
Fig. 3.1 Lipid-sensing mechanisms. (a). Fatty acid detection mechanisms by GPR40 and
GPR120 (left) and CD36 (right). In enteroendocrine cells the binding of lipids to GPRs leads to the
release of incretins, such as glucagon-like peptide 1 (GLP1), in taste buds it triggers the release of
neurotransmitters and in WAT it promotes glucose uptake. (b). Binding of fatty acids to CD36 trig-
gers in taste buds calcium release from the ER and neurotransmission, while in enterocytes it
promotes fatty acid uptake. (c). In the presence of cholesterol, the SCAP-SREBF complex binds
INSIG proteins and remains anchored to the ER. (d). In the absence of cholesterol SCAP-SREBF
does not bind INSIG but moves to the Golgi, where the cytoplasmic tail of SREBF is cleaved. This
stimulates the transcription of genes involved in cholesterol synthesis. (e). The ER-embedded
enzyme HMGCR catalyzes a rate-limiting step in cholesterol synthesis and is expressed at low
cholesterol levels. (f). When intermediates of the cholesterol biosynthetic pathway, such as lanos-
terol, are abundant, HMGCR interacts with INSIG proteins leading to HMGCR ubiquitination and
degradation
K+
Low glucose
Insulin
G-protein
GLUT2 GLUT2
TAS1R2 TAS1R3
Low glucose Ca2+
b Glc-6P
c
GCK
Fig. 3.2 Glucose-sensing mechanisms. (a). Due to its low affinity for glucose the transporter
GLUT2 imports glucose only, when it has high concentrations (right) and exports glucose from
hepatocytes into the circulation at hypoglycemic conditions (left). (b). The enzyme GCK has low
affinity for glucose, i.e. only at high glucose concentrations it produces glucose-6-phosphate for
the use in glycolysis or glycogen synthesis. (c). The release of insulin from β cells is a multi-step
process that involves the phosphorylation of glucose by GCK, subsequent ATP production and
ATP-mediated blocking of potassium channels. A resulting calcium influx facilitates the release of
insulin from vesicles into the bloodstream. (d). The heterodimeric oral taste receptors TAS1R2-
TAS1R3 bind only high concentrations of glucose, sucrose, fructose and artificial sweeteners and
trigger signal transduction through G proteins
Most extra-cellular signaling molecules, such as growth factors and cytokines, are
hydrophilic and cannot pass cellular membranes, i.e. they need to interact with
membrane receptors, in order to activate a signal transduction cascade that eventu-
ally leads to the activation of a transcription factor. Therefore, transcription factors
can be considered as sensors of many types of perturbations of a cell. In contrast, in
case of lipophilic signaling molecules, such as steroid hormones, the signal trans-
duction process is more straightforward, since these compounds can pass cellular
membranes and bind directly to a transcription factor that is often already located in
the nucleus (Fig. 3.3).
The nuclear receptor superfamily has 48 members in humans and comprises spe-
cial types of transcription factors that are able to bind and to be activated by small
lipophilic molecules called ligands. Many of these nuclear receptor ligands are
Ribosome
synthesized in the cell HSP
path
ction
nsdu
al tra
Changed
cellular
Nuclear pore function
tion
modific ional
e.g. phos ation
phoryla
nslat
post-tra
mRNA
Co-factors
Fig. 3.3 Principles of nuclear receptor signaling. Some nuclear receptors, such as glucocorti-
coid receptor (GR) and androgen receptor (AR), reside in the cytoplasm in a complex with chap-
erone proteins, such as heat-shock proteins (HSPs), but most nuclear receptors are already located
in the nucleus, where they are activated through the binding of their specific lipophilic ligand. The
ligand is either of extra-cellular origin and has passed cellular membranes or is a metabolite that
was synthesized inside the cell. After ligand binding, cytoplasmic nuclear receptors dissociate
from their chaperones and translocate to the nucleus, where they bind, like the other members of
the superfamily, to their specific genomic binding sites (REs) in the vicinity of transcription start
site (TSS) regions of their primary target genes. Ligand-activated nuclear receptors interact with
nuclear co-factors that build a bridge to the basal transcriptional machinery with Pol II in its core.
This then leads to changes in the mRNA and protein expression of the target genes
52 3 Sensing Nutrition
micro- and macronutrients or their metabolites. These include the vitamin A deriva-
tive retinoic acid (activating retinoic acid receptor (RARα, β, γ)), fatty acids
(PPARα, δ, γ), 1,25-dihydroxyvitamin D3 (1,25(OH)2D3, VDR), oxysterols (LXRα,
β), bile acids (FXR) and other hydrophobic food ingredients (constitutively andro-
stane receptor (CAR) and pregnane X receptor (PXR)) (Table 3.1 and Fig. 3.4). The
affinity of these nuclear receptors for their respective ligands varies between 0.1 nM
for VDR and up to mM for PPARs and reflects the physiological concentrations of
the respective molecules. Therefore, they represent true nuclear sensors for these
Fig. 3.4 Nuclear receptor ligands. The chemical structure of natural ligands of the nuclear
receptors RXR, VDR, FXR, LXR and PPARγ are shown
Co-repressor Co-activator
complex complex
Co-repressor ?
complex
Fig. 3.5 Nuclear receptor action. Genome-wide RXR heterodimers bind specific DNA sequences
already in the absence of ligand. In this constellation they mainly interact with co-repressor pro-
teins and are involved in gene repression. After ligand binding nuclear receptors either change their
co-factors to co-activators and get involved in gene activation or keep the contact with co-repressors
and further repress some of their target genes. As a phenomenon, referred as trans-repression, the
nuclear receptor does not bind directly to DNA but interferes with the activity of other transcrip-
tional factors, such as nuclear factor-κB (NF-κB) by protein-protein interactions combined with
post-translational modifications
tors takes place in the nucleus. The nutrients act as switches of gene regulation by
inducing a conformational change to the ligand-binding domains of their specific
nuclear receptors. This results in the coordinated dissociation of co-repressors and
the recruitment of co-activator proteins, in order to enable transcriptional activation
of up to 1,000 genes (Box 3.1).
(continued)
3.2 Nutrient Sensing via Nuclear Receptors 55
CYP3A
PXR CYP2B ABCA1, G1, G5, G8
ER Vitamin E
Vitamin K
Flavonoids
LXR
Flavonoids
Oxysterols
RXR
Xenobiotics CYP7A1
CYP4A PPAR Fatty acids
CAR PXR
Lanosterol CYP7A1
ABCB1, C2, C3 CYP3A4
CYP8B1
1,25-Dihydroxy- 7-Dehydro-
vitamin D 3 CYP27B1 Cholesterol
ABCB11
VDR
Cholesterol
De novo synthesis
CYP24
Fig. 3.6 The role of nuclear receptor in lipid metabolism, metabolite enzymes and transport-
ers. The inter-relationship between micro- and macronutrient metabolism involves metabolite
enzymes, transporters and nuclear receptors. Only a selected number of metabolites and proteins
are shown. Differently color-coded there are many examples of triangle relationships between a
metabolite acting as a ligand for a nuclear receptor, nuclear receptors activating their target genes,
some of which are metabolic enzymes and transporters for the metabolite. In this feedback loop the
metabolite regulates its nuclear receptor, the receptor its enzyme and the enzyme its metabolite
56 3 Sensing Nutrition
receptor superfamily. There are many examples (RAR, CAR, PXR, PPAR, VDR,
LXR and FXR, differently color-coded in Fig. 3.6), where a metabolite activates a
nuclear receptor, which in turn controls the expression of the enzyme or transporter
handling the metabolite. Nuclear receptor-controlled CYP enzymes have also a cen-
tral role in receptor ligand inactivation and clearance. These triangle regulatory
circuits are found at several critical positions in lipid metabolism pathways and
allow a fine-tuned control on metabolite concentrations and nuclear receptor activ-
ity. This suggests that dietary metabolites are ancestral precursors of endocrine sig-
naling molecules, such as steroid hormones. In turn this emphasizes the
nutrigenomics principle (Chap. 4), that diet is not only a supply for energy, but has
also important signaling function.
An immediate implication that followed from understanding the function of
nuclear receptors is their potential as therapeutic targets. In fact, nuclear receptor
targeting drugs are widely used and commercially successful. For example, bexaro-
tene and alitretinoin (RXRs), fibrates (PPARα), and thiazolidinediones (PPARγ) are
already approved drugs for treating cancer, hyperlipidemia and T2D, respectively.
Moreover, FXR and LXR agonists are in development for treating non-alcoholic
fatty liver disease (NAFLD) (Sect. 9.4) and preventing atherosclerosis (Sect. 11.2).
The different steps in handling fatty acids, especially resorbing them in the intes-
tine, transforming them in the liver, burning them in active tissues and collecting
their excess for long-term storage in adipose tissue, is coordinated by the three
members of the PPAR family of nuclear fatty acid sensors (Fig. 3.7). Common
dietary fats, such as oleic acid, LA and ALA, can all act as PPAR ligands, but their
respective receptors also respond to various lipid metabolites, such as prostaglandin
J2, 8S-hydroxyeicosatetraenoic acid and a number of oxidized phospholipids,
respectively. Due to its distinct tissue distribution, each PPAR subtype has unique
functions. PPARα is expressed pre-dominantly in the liver, heart and brown adipose
tissue (BAT). PPARδ (also called PPARβ in rodents) is ubiquitously expressed but
has most important functions in skeletal muscle, liver and heart. In adipose tissue,
PPARγ is highly expressed in adipocytes and acts there both as a master regulator
of adipogenesis (Sect. 8.2) and a potent modulator of lipid metabolism and insulin
sensitivity. Due to alternative splicing and differential promoter usage, there are two
PPARγ isoforms, of which PPARγ1 is expressed in many tissues, while the expres-
sion of PPARγ2 is restricted to adipose tissue.
After a meal, PPARα and PPARδ are sensing increasing levels of fatty acids
efflux from the liver and start to manage lipid metabolism via the promotion of fatty
acid β-oxidation and ATP production in mitochondria of skeletal muscles and the
heart. PPARα is also the molecular target of fibrates, which are widely used drugs
that reduce serum triacylglycerols through the increased oxidation of fatty acids.
Also PPARδ can decrease serum triacylglycerols, prevent high-fat diet-induced
3.3 Functions and Actions of PPARs 57
a b
Acetyl-CoA
β/δ Macrophages and other cells
β/δ α α
ATP
Acetyl-CoA
Fatty acids
ATP
Fatty acids
NF-κB
α β/δ γ
α AP-1
β/δ
α
Acetyl-CoA
Triacylglycerols TNF, IL6, MCP1 and VCAM
γ2 Fatty acids α ATP
Adipogenesis
c Osteoblast
activity
α
Insulin β/δ
α β/δ
Fatty acids
Glucose
γ
Terminal Osteoclast
β/δ differentiation
activity
Fig. 3.7 Physiological roles of PPARs. (a). PPARα regulates the expression (i) of enzymes that
lead to the mobilization of stored fatty acids in adipose tissue and (ii) of fatty acid catabolizing
enzymes in the liver, heart and kidney. PPARδ is expressed at high levels in the intestine where it
mediates the induction of terminal differentiation of epithelium. Activating PPARδ or PPARγ can
increase insulin sensitivity. PPARδ regulates the expression of fatty acid catabolizing enzymes in
skeletal muscle where released fatty acids are oxidized to generate ATP. PPARγ promotes the dif-
ferentiation of adipocytes. (b). PPARα, PPARδ and PPARγ can interfere with NF-κB and activat-
ing protein 1 (AP-1) in macrophages, endothelial cells, epithelial cells and other tissues, causing
the attenuation of pro-inflammatory signaling by decreasing the expression of pro-inflammatory
cytokines, chemokines and cell adhesion molecules. (c). The activation of PPARα and PPARδ
promotes osteoblast activity in bone, whereas the activation of PPARγ promotes osteoclast
activity
obesity and increase insulin sensitivity through the regulation of genes encoding
fatty acid metabolizing enzymes in skeletal muscle and genes for lipogenic proteins
in the liver. Moreover, PPARδ increases serum HDL-cholesterol levels via stimulat-
ing the expression of the reverse cholesterol transporter ATP-binding cassette
(ABC) A1 and apolipoprotein (APO) A1-specific cholesterol efflux. PPARγ pro-
motes adipose tissue differentiation together with fibroblast growth factors (FGFs)
1 and 21, in order to store excess of non-consumed fatty acids.
In addition, in adipose tissue PPARγ also controls glucose uptake via the regula-
tion of SLC2A4 expression (encoding for GLUT4). High concentrations of circulat-
ing fatty acids can cause insulin resistance (Sect. 9.4). Therefore, enhanced uptake
58 3 Sensing Nutrition
and sequestration of fatty acids in adipose tissue and the stimulation of the secretion
of the adipokines adiponectin and resistin after activation of PPARγ by specific
synthetic ligands, thiazolidinediones, improve insulin resistance. However, the
increased fatty acids uptake and the enhanced adipogenic capacity in WAT after
PPARγ activation both may be responsible for thiazolidinedione-associated weight
gain. Moreover, the thiazolidinedione rosiglitazone was found to increase the risk of
heart failure, myocardial infarction and CVD, leading to restricted access in the
United States and a recommendation for market withdrawal in Europe.
During fasting or starvation, PPARα is the primary regulator of the adaptive
response in the liver. This receptor senses the reversed flux of fatty acids and
activates a gene network to oxidize fatty acids, in order to generate energy in liver
and muscle and to convert fatty acids into a usable energy source, such as ketone
bodies during starvation. In addition, PPARα stimulates the production and secre-
tion of the hepatokine FGF21, which acts as a stress signal to other tissues, in order
to adapt to the energy-deprived state. Furthermore, PPARγ together with FGF1
mediates adipose tissue remodeling for maintaining metabolic homeostasis during
famine.
PPARs are also involved in the control of inflammation (Sect. 7.2). For example,
via trans-repression (Sect. 3.2) PPARα and PPARδ sequester the p65 subunit of
NF-κB and inhibit the expression of NF-κB-controlled cytokines, such as TNF,
IL1B and IL6. Thus, activating PPARs plays a role in inhibiting obesity-related
insulin resistance (Sect. 9.4).
LXRs and FXR are sensors for the cholesterol derivates oxysterols and bile acids,
respectively. These nuclear receptors do not only regulate cholesterol and bile acid
metabolism but also have a central role in the integration of sterol, fatty acid and
glucose metabolism. LXRα is expressed in tissues with a high metabolic activity,
such as liver, adipose and macrophages, whereas LXRβ is found ubiquitously.
LXRs, similarly to PPARs, have a large hydrophobic ligand-binding pocket that can
bind to a variety of different ligands, such as 24(S)-hydroxycholesterol,
25-hydroxycholesterol, 22(R)-hydroxycholesterol and 24(S),25-epoxycholesterol,
at their physiological concentrations. FXR is expressed mainly in the liver, intes-
tine, kidney and adrenal glands. Bile acids, such as chenodeoxycholic acid and cho-
lic acid, are endogenous FXR ligands, but they can also activate the nuclear receptors
PXR, CAR and VDR.
LXR may be known best for its ability to promote reverse cholesterol transport
(Sect. 7.3), i.e. cholesterol delivery from the periphery to the liver for excretion
(Figs. 3.8 and 7.5). This involves the transfer of cholesterol to APOA1 and pre-β
HDLs via the transporter protein ABCA1, which is encoded by one of the most
prominent LXR target genes. Further important LXR targets are ABCG1, which
together with ABCA1 promotes cholesterol efflux from macrophages, and the intra-
3.4 Integration of Lipid Metabolism by LXRs and FXR 59
LIVER
APOAI
ABCA1 Pre-β
HDL
Reverse ABCA1
ABCG5
cholesterol ABCG8
transport Absorption
ABCG1
ARL7
Cholesterol
IDOL
LDL
MACROPHAGE LDLR INTESTINE
(peripheral tissue)
Fig. 3.8 Effects of LXR on metabolism. LXR has effects on multiple metabolic pathways. In
macrophages, LXR induces the expression of the genes IDOL, ARL7, ABCA1 and ABCG1. In the
liver, LXR promotes fatty acid synthesis via induction of SREBF1 and its targets, FASN, ACC and
SCD1. Triglyceride-rich very low-density lipoproteins (VLDLs) in the liver serve as transporters
for lipids to peripheral tissues, including adipose tissue, where the action of LPL liberates fatty
acids from VLDLs. In adipose tissue, LXR regulates the expression of APOD and THRSP and
promotes the breakdown of fatty acids via β-oxidation and glucose uptake via induction of GLUT4.
Finally, in the intestine, LXR inhibits cholesterol absorption by inducing the expression of the
ABCG5-ABCG8 complex
LXR also induces the gene for the enzyme lysophospholipid acyltransferase 3
(LPCAT3), thus mediating the synthesis of phospholipids containing long-chain
PUFAs. This decreases ER stress (Sect. 7.5) and inflammatory responses. In addi-
tion, a major function of LXR in the liver is the promotion of de novo biosynthesis
of fatty acids through the stimulation of SREBF1, ACC, FASN and steroyl-CoA
desaturase 1 (SCD1). Some of these fatty acids are esterified with cholesterol, in
order to avoid toxic levels of free cholesterol. In the intestine, LXR induces the
expression of genes encoding the transporters ABCG5 and ABCG8 that mediate the
apical efflux of cholesterol from enterocytes. In adipose tissue, LXR also affects
glucose metabolism via the stimulation of GLUT4 expression. In this tissue, LXR
regulates the expression of lipid-binding and metabolic proteins, such as APOD and
thyroid hormone responsive (THRSP), and increases fatty acid β-oxidation.
In the control of lipid metabolism FXR often acts in a complementary or recipro-
cal way to LXR (Fig. 3.9). Since high bile acid concentrations are toxic to cells, a
central function for FXR is to control these levels. Bile acids are cholesterol deriva-
tives that facilitate the efficient digestion and absorption of lipids after a meal, but
they represent also the major way to eliminate cholesterol from the body.
Nevertheless, most bile acids are recycled via the enterohepatic circulation, i.e. they
pass from the intestine back to the liver. FXR controls this bile acid flux via modu-
lating their synthesis, modification, absorption and uptake. In the liver, FXR inhibits
bile acid synthesis by repressing the enzymes CYP7A1 and CYP8B1. FXR
stimulates the secretion of FGF19 from the intestine, which then activates FGF
receptor 4 (FGFR4) in the liver and in this way provides a complementary mecha-
nism for the feedback inhibition of bile acid synthesis.
In the gall bladder, FXR up-regulates the enzymes bile acid-CoA synthase
(SLC27A7) and bile acid-CoA-amino acid N-acetyltransferase (BAAT), which cat-
alyze the conjugation of bile acid with the amino acids taurine or glycine, and the
bile salt export pumps ABCB11 and ABCB4. In the intestine, FXR inhibits the
absorption of bile salts via the down-regulation of the apical sodium-dependent bile
salt transporter SLC10A2 and promotes the movement of bile salts from the apical
to the basolateral membrane of enterocytes via the up-regulation of ileal fatty acid-
binding protein (FABP6). FXR limits hepatic bile salt levels by the down-regulation
of the bile acid transporters solute carrier organic anion transporters (SLCOs) A1
and A2. Furthermore, in order to protect the liver from toxicity, FXR induces the
expression of the enzymes CYP3A4 and CYP3A11, which hydroxylate bile acids,
as well as sulfotransferase family 2A, member 1 (SULT2A1) and UDP glucuronos-
yltransferase 2 family, polypeptide B4 (UGT2B4), which sulphate and glucuroni-
date bile acids, respectively. In addition, in the liver FXR reduces lipogenesis via the
repression of SREBF1 and FASN gene expression, i.e the receptor decreases triacyl-
glycerole levels. Finally, FXR also influences hepatic carbohydrate metabolism and
inhibits glucogenesis via the down-regulation of glucose-6-phosphatase (G6PC)
and phosphoenolpyruvate carboxykinase (PCK) 2.
3.5 Coordination of the Immune Response by VDR 61
ABCB4 FGF4R
ABCB11
GALL Entero-
BLADDER hepatic
circulation
SLC10A2
FABP6
Absorption
FGF19
Enterocyte
INTESTINE
Fig. 3.9 Effects of FXR on metabolism. In the liver, FXR reduces the conversion of cholesterol
to bile acids by down-regulating the enzymes CYP7A1 and CYP8B1. FXR also reduces bile acid
toxicity in the liver by increasing SULT2A1, UGT2B4 and CYP3A4 expression. Bile acids are con-
jugated to either glycine or taurine before secretion into the bile, which is enhanced by FXR via
increasing SLC27A7 and BAAT expression. Moreover, FXR promotes the transport of bile acids to
the gall bladder via up-regulation of the bile salt export pumps ABCB11 and ABCB4. Within the
intestine, FXR reduces bile acid absorption via down-regulation of the apical sodium-dependent
bile acid transporter SLC10A2 and promotes bile acid movement across the enterocyte via control-
ling FABP6. In the liver, FXR reduces hepatic uptake of bile acids by reducing the expression of
the transporters SLCOA1 and SLCOA2. FXR also promotes the release of FGF19 from the intes-
tine, which acts on FGF4R to reduce CYP7A1 expression and thus represses bile acid synthesis.
In the liver, FXR also acts on glucose metabolism by reducing gluconeogenesis via PCK2 and
G6PC and lipogenesis via inhibition of SREBF1 and FASN
human body, i.e. also in metabolic tissues in disease scenarios, such as obesity
(Chap. 8). These immune cells are often exposed to large amounts of lipids, such as
pathogen- and host-derived lipoproteins or lipids of apoptotic cells, and are the key
integrators of lipid and immune signaling. This means that macrophages and den-
dritic cells as well as their precursors, monocytes, coordinate metabolic, inflamma-
tory and general stress-response pathways via changes of their transcriptome profile
and respective subtype specification. Nuclear receptors, such as VDR, RAR, LXR
and PPAR, have central functions in sensing these endogenous and exogenous stim-
uli as well as in adapting the respective gene expression profiles of the immune
cells. As a representative of all micro- and macronutrient-sensing nuclear receptors,
in the following we will focus on VDR and its ligand 1,25(OH)2D3.
Vitamin D3 and its most abundant metabolite, 25-hydroxyvitamin D3 (25(OH)D3),
either derive from from diet, such as fatty fish, or from endogenous production of
vitamin D3 in response to UV-B exposure of the skin (Sect. 4.1). Therefore, there are
rather seasonal than daily variations in the vitamin D status of the human body.
Worldwide more than one billion people are vitamin D deficient, i.e. their serum
25(OH)D3 levels are below 50 nM. Bone malformations, such as rickets and osteo-
malacia, are extreme examples of the effects of vitamin D deficiency, but since
vitamin D is involved in a broad range of physiological processes, it can increase
the risk for various diseases and susceptibility for infections. Living at higher lati-
tudes, i.e. at significant seasonal variations of UV-B exposure, increases the risk of
the autoimmune disease T1D, multiple sclerosis and Crohn’s disease, but also of
metabolic diseases, such as hypertension, T2D and CVD.
VDR is expressed in all important cell types of the immune system, i.e. these
cells are sensitive to changes in the vitamin D concentrations. Importantly, macro-
phages and dendritic cells express the enzyme CYP27B1 that converts 25(OH)D3
into the VDR ligand 1,25(OH)2D3, i.e. in these cells vitamin D can act autocrine or
paracrine (Fig. 3.10). Interestingly, while CYP27B1 expression in the kidneys is
negatively regulated by a number of signals, such as Ca2+, parathyroid hormone,
phosphate and 1,25(OH)2D3, antigen-presenting cells do not respond to these inhib-
itory signals but rather further up-regulate CYP27B1 expression after stimulation
with cytokines and TLR ligands.
TLRs and other PRRs detect pathogens on the surface of macrophages and initi-
ate an immune response (Sect. 7.2), for example against the intra-cellular bacterium
Mycobacterium tuberculosis. Notably, no other infectious disease had so far more
human victims (in total up to one billion) than tuberculosis. In macrophages, the
TLR-triggered increased expression of VDR target genes encoding for anti-microbial
peptides, such as cathelicidin (CAMP) and defensin, beta 4A (DEFB4), efficiently
kills intra-cellular M. tubercolosis (Fig. 3.10). This vitamin D-dependent anti-
microbial mechanism can explain, why (i) sun or artificial UV-B exposure is effi-
cient in the supportive treatment of tuberculosis, (ii) vitamin D deficiency is
associated with tuberculosis, (iii) some variations of the VDR gene increase the
susceptibility to M. tuberculosis infection and (iv) humans with dark skin living
distant from the equator have an increased susceptibility to tuberculosis infection.
Moreover, vitamin D-induced cytokine production of T cells and monocytes modu-
3.5 Coordination of the Immune Response by VDR 63
DIET
LIVER
CAMP
1α,25-dihydroxy
CYP27B1 CYP27B1 DEFB4
vitamin D3 Paracrine 25-hydroxy Intracrine
VDR Monocyte/
vitamin D3 VDR macrophage
DC
Th
CYP27B1
CYP27B1 Epithelial cell
Intracrine 25-hydroxy Intracrine
VDR VDR trophoblast
vitamin D3
decidua
DC ?
e
in
Th
cr
tra
In
e
in
cr
do
En
CYP27B1 KIDNEY
Endocrine Endocrine Neutrophil
VDR 1α,25-dihydroxy
vitamin D3 VDR
Th
ANTIGEN PRESENTATION/ ANTI-BACTERIAL
T-CELL FUNCTION ACTIVITY
Fig. 3.10 Innate and adaptive immune responses to vitamin D. Macrophages and dendritic
cells express the vitamin D-activating enzyme CYP27B1 and VDR can then utilize 25(OH)D3 for
intracrine and paracrine responses via localized conversion to active 1,25(OH)2D3. In monocytes
and macrophages, this promotes the anti-bacterial response to infection via CAMP and DEFB4.
1,25(OH)2D3 inhibits dendritic cell maturation and modulates T helper (TH) cell function. Intracrine
immune effects of 25(OH)D3 may also occur in CYP27B1/VDR-expressing epithelial cells. In con-
trast, most other cells, such as TH cells and neutrophils, depend on the circulating levels of
1,25(OH)2D3 that are synthesized by the kidneys, i.e. they are endocrine targets of 1,25(OH)2D3
Artificial light, shift work, travel and temporal disorganization have disrupted for
many humans the alignment between the external light-dark cycle and their internal
clock. This is of disadvantage for metabolic health. Longitudinal population studies
and clinical investigations both have indicated an association between shift work
and diseases, such as T2D, gastrointestinal disorders and cancer that can be modu-
lated by changes in the circadian rhythm. Furthermore, the habit of altering bedtime
on weekends, the so-called “social jet lag”, has been associated with increased body
weight. Light-sensitive organisms, such as humans, synchronize their daily behav-
ioral and physiological rhythms with the rotation of Earth on its axis, i.e. they dis-
play circadian (meaning “approximately one day”) activity cycles. In humans and
other mammals, these rhythms are generated by the suprachiasmatic nucleus (SCN)
of the hypothalamus (Fig. 3.11a). The core of this molecular 24 h clock is a series
of transcription-translation feedback loops of the transcription factors aryl hydro-
carbon receptor nuclear translocator-like (ARNTL, also called BMAL1) and clock
circadian regulator (CLOCK) and their co-repressor proteins. This ARNTL-CLOCK
complex, in a circadian fashion, activates the expression of hundreds of genes both
in the brain and in peripheral metabolic tissues, including also the genes period
circadian clock 1 (PER1) and cryptochrome circadian clock 1 (CRY1). The PER1-
CRY1 co-repressor complex inactivates ARNTL-CLOCK, but phosphorylation and
ubiquitylation of CRY1 during the night initiates the proteosomal degradation of the
a b
DAY/NIGHT
L
CK
NT
CLO
AR
12 E-box PER1
9 3 PER1
6 SCN
TL
CK
CRY1
N
CLO
Master clock
AR
L
CK
AR
NT
CLO
AR
12 12 12 12 12 12
L
CK
NT
CLO
Peripherial clocks
AR
9 3 9 3 9 3 9 3 9 3 9 3
REVERBA
6 6 6 6 6 6
E-box REV-ERBα
Cyclic gene expression target target target target target target
Peripherial organs
ARNTL RORE
CLOCK
Fig. 3.11 The circadian clock in mammals. (a). Electrical and humoral signals from the SCN
synchronize phases of circadian clocks in peripheral organs, which then generate time dependent
rhythms in gene expression, metabolism and other physiological activities. (b). In the feedback
loop of the molecular circadian oscillator positive elements, such as the transcription factors
ARNTL, CLOCK and ROR, are shown in red, and negative elements, such as PER1, CRY1 and
REV-ERBα, in yellow. The combined actions of hundreds of ARNTL-CLOCK target genes pro-
vide a circadian output in physiology
3.6 Circadian Control of Metabolic Processes 65
repressors and re-activates ARNTL-CLOCK. The genes encoding for the nuclear
receptors REV-ERBα and ROR are further targets of ARNTL-CLOCK. REV-ERBα
negatively and ROR positively regulates the expression of the ARNTL gene, i.e.
these nuclear receptors form additional feedback loops in the control of the molecu-
lar clock (Fig. 3.11b).
The molecular clock is a self-sustained activity, but circadian gene transcription
can also be modulated by metabolites, in particular by those representing energetic
flux (Box 3.2). For example, the AMP sensor AMPK (Sect. 6.5) connects the inter-
nal clock function to the nutrient state via phosphorylation and subsequent protea-
somal degradation of the ARNTL-CLOCK repressor CRY1 (Fig. 3.12a). In parallel,
the cyclical activity of ARNTL-CLOCK is modulated by the HDM lysine-specific
demethylase 5A (KDM5A, also called JARID1A), which in turn is linked via its
co-factors iron and α-ketoglutarate to cellular redox and mitochondrial energetics.
The bidirectional interaction between circadian and metabolic signaling is the inhi-
bition of ARNTL-CLOCK by the nicotinamide adenine dinucleotide (NAD+)-
dependent histone deacetylase (HDAC) SIRT1 (Fig. 3.12b). This represents another
feedback control of the molecular clock, since the gene encoding for the critical
enzyme for NAD+ synthesis, nicotinamide mononucleotide phosphoribosyltransfer-
ase (NAMPT, also known as visfatin), is a direct ARNTL-CLOCK target.
Since NAD+-dependent sirtuins are important regulators of metabolic pathways
in response to calorie restriction (Sect. 6.4), the link between the molecular clock
a b c d
HEME
AMPK NAMPT Glucocorticoids
Iron α-Ketoglutarate NAD+
NAM
AMPK Ac-ADPr REV-ERBα
P KDM5A-HDM inhibition NAMPT
CRY1 CRY1 PER of HDAC1promotes SIRT1
PER2 transcription REV-ERB, NCOR1 Glucocorticoid
SIRT1 deacetylation and HDAC3 repression CRY1 interactions
PER loop
HDAC3
HDAC1 GR
A
NCOR1
M5
AR LOCK
me
KD
ac
C
ac
L
L
L
CK
NT
CK
NT
REV-ERBα
NT
CLO
CLO
AR
MeOH Me
AR
Fig. 3.12 Links between circadian and metabolic regulation. (a). The ARNTL-CLOCK com-
plex is supported by the α-ketoglutarate-triggered HDM KDM5A, while AMP-stimulated AMPK
phosphorylates the repressor protein CRY1 and controls its proteolytic degradation. (b). The
ARNTL-CLOCK heterodimer up-regulates the NAMPT gene that encodes for an enzyme critical
for NAD+ synthesis. This increases NAD+ and the activity of SIRT1, which itself is a negative feed-
back regulator of the ARNTL-CLOCK complex. (c). The repressive complex of REV-ERBα with
HDAC3 and NCOR1 is sensitive to concentrations of heme levels and inactivates the ARNTL-
CLOCK complex. (d). Binding of GR for its genomic loci is triggered by glucocorticoids and
CRY1
66 3 Sensing Nutrition
Gluconeogenesis
Oxidative phosphorylation
Vesicle trafficking
RNA processing and protein translation
Peroxiredoxin Kinase
elimination
NAD+
accumulation
Repressors
hydrolysis
biosynthesis
cycle cycle
Activators
biosynthesis
AMP
Transcription
ATP
cycle
factors
ROS
ARNTL-CLOCK
REV-ERBα
ROR
NAD+
ROS
Temperature cycles
AMPK
Fig. 3.13 Cross-talk between circadian transcription and metabolic systems. The key
transcription factors ARNTL-CLOCK, REV-ERBα and ROR control cellular and meta-
bolic pathways, such as gluconeogenesis, oxidative phosphorylation, vesicle trafficking and
RNA processing and translation, in a cyclical fashion. Metabolic cycles reciprocally affect
this molecular clock. The cycles of NAD+ biosynthesis as well as the activity of peroxire-
doxin and various kinases (for example, AMPK, see Fig. 3.12) generate active intermedi-
ates that provide feedback to regulate the core clock transcriptional network
3.6 Circadian Control of Metabolic Processes 67
and sirtuin activity has implications for aging. A further example is the circadian
recruitment of HDAC3 to the complex of REV-ERBα with the co-repressor NCOR1,
which leads to the rhythmic repression of genes involved in lipogenesis and carbo-
hydrate metabolism (Fig. 3.12c). Finally, many nuclear receptors exhibit, at least in
mice, circadian oscillation in their expression, so that the timing of the interaction
with their specific ligands allows coupling between temporal and physiological sys-
tems (Fig. 3.12d). Interestingly, the expression of REV-ERBα is also modulated by
glucocorticoids.
Future View
The future, further insight on nutrient sensing systems, including that via nuclear
receptors, will allow a more integrative view of the molecular (re)action of the
human body to dietary molecules. This will not only address the cross-regulation
between different nutrient-sensing pathways, but will also incorporate other signal-
ing pathways, such as those ones controlling cellular growth or mediating chronic
inflammation. The dense integration of metabolic pathways makes it difficult to
achieve specific responses to a treatment with one natural or synthetic nuclear
receptor ligand without provoking side effects through compensatory or comple-
mentary responses from other pathways. Nevertheless, future studies that will be
performed in a safe and clever way in humans (rather than in rodents) should pro-
vide a level of understanding that will lead to more specific ligands and identifica-
tion of new target genes regulated by dietary components. Moreover, a better
understanding of the links between circadian biology and metabolism will allow
tailoring preventive interventions and therapies. Taken together, the field of person-
alized nutrition/medicine will benefit a lot from this additional insight.
Key Concepts
• Periodical scarcity of nutrients was a strong evolutionary pressure to select effi-
cient mechanisms of their sensing.
• Fatty acids are sensed by GPRs in the plasma membrane and cholesterol by the
SCAP-SREBF complex in the ER membrane.
• LXR is activated by elevated cholesterol levels, i.e. the pathways of SREBF and
LXR work in a reciprocal fashion, in order to maintain cellular and systemic
cholesterol homeostasis.
• The TOR component mTORC1 senses amino acids, which are scavenged in
lysosomes from cellular components through autophagy.
• The transporter GLUT2 and the hexokinase GCK are true sensors for glucose,
since they are only active at high but not at low physiologic glucose
concentrations.
• Many nuclear receptors bind micro- and macronutrients or their metabolites with
an affinity that varies between 0.1 nM for VDR and up to mM for PPARs and
reflect the physiological concentrations of the respective molecules.
68 3 Sensing Nutrition
Additional Reading
Ahmadian M, Suh JM, Hah N, Liddle C, Atkins AR, Downes M, Evans RM (2013) PPARγ signal-
ing and metabolism: the good, the bad and the future. Nat Med 19:557–566
Bass J (2012) Circadian topology of metabolism. Nature 491:348–356
Calkin AC, Tontonoz P (2012) Transcriptional integration of metabolism by the nuclear sterol-
activated receptors LXR and FXR. Nat Rev Mol Cell Biol 13:213–224
Carlberg C, Molnár F (2014) Mechanisms of gene regulation. Springer, Dordrecht. ISBN
978-94-007-7904-4
Efeyan A, Comb WC, Sabatini DM (2015) Nutrient-sensing mechanisms and pathways. Nature
517:302–310
Evans R, Mangelsdorf D (2014) Nuclear receptors, RXR, and the big bang. Cell 157:255–266
Nagy L, Szanto A, Szatmari I, Szeles L (2012) Nuclear hormone receptors enable macrophages
and dendritic cells to sense their lipid environment and shape their immune response. Physiol
Rev 92:739–789
Chapter 4
Adaption of the Human Genome to Dietary
Changes
Abstract Nutrition is essential for life, but the effects of nutritional molecules are
complex and influenced by many factors. Genes influence the dietary response,
while nutrients, or the lack of them, can affect gene expression. More than 90 % of
human genes have not changed since the life in the stone ages, where food avail-
ability meant survival. Humans evolved a sense for taste, in order to detect the most
energy-rich diet, but this initial survival instinct nowadays causes overweight and
obesity. Modern nutrition research has taken up many elements from molecular
biology and next-generation sequencing technologies and turned into nutrigenom-
ics. This new discipline attempts to understand the effects of food on multiple
molecular levels, such as genomics and epigenomics.
In this chapter, we will start with a definition of nutrigenomics and will provide
a few examples of its applications and potential. We will discuss the molecular basis
for the recent adaption of the human genome to environmental changes, such as less
UV-B exposure after migrating north, and dietary challenges due to dairy farming,
such as lactose tolerance. We will demonstrate that the majority of disease-associated
genetic variants are located outside of protein-coding regions, for example, within
transcription factor binding sites. This means that regulatory SNPs are rather the
rule than the exception. Nutrigenomics will be understood as the application of vari-
ous “omics” technologies for investigations on the level of the epigenome, genome,
transcriptome, proteome and metabolome. We will experience that nowadays it is
possible to apply these methods for a most comprehensive assessment of a human
individual, which is summarized as integrative personal omics profile (iPOP). These
individual datasets will be the basis for the optimization of personalized nutrition
for preserving health via the prevention of disease, such as T2D and CVD.
Vitamin D is a micronutrient that can be obtained in its D3 form from animals, such
as fatty fish, or as D2 from plants or fungi (Fig. 4.2). However, at present as well as
in the stone ages, the average human diet is not providing sufficient amounts of the
vitamin. Therefore, for humans it is critical to use their own vitamin D3 production
pathway, which starts in the skin from 7-dehydrocholesterol and uses essentially the
energy of UV-B radiation from sunlight (Fig. 4.2). The amount of vitamin D3 syn-
thesis in the skin depends on the UV-B dose received that varies based on season,
day length, latitude, altitude and out-door activities of the individual. Moreover,
endogenous vitamin D3 production depends on the melanin content of the skin, i.e.
darker skin color can be a very effective natural sunscreen. Two hydroxylation steps
4.2 Vitamin D and Skin Color 73
DIET
OH
O CH3 CH3
COOH
H3C CH3
HO OH
OH
CH3 H
OH HO O
O
HO
HO
OH
OH
Nutrients HO OH
a
Metabolism
Signal
transduction EFFECT
c
b
Gene
expression
Physiological
functions
(e.g., cell growth)
Fig. 4.1 Basis of nutrigenomics. Nutrigenomics seeks to provide a molecular understanding for
how dietary nutrients affect health by altering the expression of a larger set of genes. These nutri-
tional compounds have been shown to alter gene expression in a number of ways. For example,
they may (a) act as direct ligands for transcription factors, (b) be transcription factor modulators
after a chemical conversion in primary or secondary metabolic pathways or (c) serve as activators
of signal transduction cascades that end with the activation of a transcription factor. All three acti-
vation pathways modulate physiological effects, such as cellular growth
74 4 Adaption of the Human Genome to Dietary Changes
Dietary intake
Vitamin D3 and D2
Mushroom
Fish
Sunlight
Digestive
tract
UV-B (290-315nm)
Skin
H
Heat
Vitamin D3 Pre -vitamin D3 7-Dehydrocholesterol H
H
HO
HO
Liver 25-OHase Regulation of cellular functions:
a) metabolism H
OH
1α-OHase b) cellular growth and differentiation
OH c) immune function
H
25-Hydroxyvitamin D3 1α,25-Dihydroxyvitamin D3
Degradation Degradation
Fig. 4.2 Vitamin D synthesis and metabolism pathway. Humans can obtain vitamin D3 from
animal diet, such as fatty fish (or in D2 form from plants and fungi), but higher quantities are syn-
thesized in UV-B exposed skin. Irrespective of its origin, vitamin D is hydroxylated in the liver and
the kidney to its biologically most active metabolite 1,25(OH)2D3, which acts as a high-affinity
ligand to the nuclear receptor VDR
that are performed primarily in the liver and the kidneys, respectively, create the
biologically most potent vitamin D metabolite 1,25(OH)2D3. As an example of a
metabolized nutritional compound (see pathway B in Fig. 4.1), 1,25(OH)2D3 acts as
a specific ligand of the nuclear receptor VDR (Sect. 3.5). VDR is a transcription
factor and regulates more than 1000 genes that are involved in the control of cal-
cium homeostasis, bone formation, innate and adaptive immunity and cellular
growth.
The outer surface of humans, the skin, mediates many interactions with the envi-
ronment, such as thermoregulation, tactile sensitivity, detection of pain and the
absorption of UV radiation. Besides these physiological functions, the color of skin,
hairs and eyes represent the most obvious differences between human populations.
People that live close to the equator or at high altitude, such as in the Himalayas or
the Andes, have the darkest skin, while on the northern hemisphere at higher lati-
tude lighter skin types are observed (Fig. 4.3). Some 100,000 years ago the skin of
the anatomically modern humans was dark, because 1 million years earlier their
ancestors turned dark when they lost most of their body hair, in order to better regu-
late their body temperature via sweating during endurance physical activity.
Permanent dark skin better protects against the deleterious effects of solar UV-B
4.2 Vitamin D and Skin Color 75
equator
Fig. 4.3 World map of human skin color. The skin of original human populations is darker
where UV-B radiation is strongest. This is close to the equator, at high altitude and by the oceans,
as shown by the shading of the map
radiation, such as sunburns and skin cancer, but the main evolutionary driver for
skin darkening most likely was the protection of the photosensitive B vitamin folate.
More than 30 genes were found to influence the pigmentation of human skin. In
the process of melanogenesis the amino acids phenylalanine, tyrosine and cysteine
are converted to melanin. SNPs in the genes encoding for the enzymes of this path-
way as well as for ion channels in melanocytes or transporting molecules involved
in melanosome maturation and export can result in light hair, light skin and blue
eyes, as it is typical in northern European populations, or in dark skin and hair and
brown eyes in equatorial population. The analysis of the haplotypes of these genes
allowed estimating the time period when European skin became lighter. Changes
within the KITLG gene that encodes for a ligand of the receptor tyrosine kinase KIT
appeared already some 30,000 years ago, while the genes for the tyrosine convert-
ing enzyme TYRP1 and the ion transporters SLC24A5 and SLC45A2 were affected
some 11,000–19,000 years ago. Interestingly, Europeans, Asians and first
Neanderthals evolved light skin independently from each other. The evolutionary
driver for the skin lightening genetic variations was most likely the low vitamin D3
synthesis rate of darker skin in northern latitudes, which results in vitamin D3 defi-
ciency and serious consequences for evolutionary fitness, such as reduced bone
strength and a defective immune system. For example, the tuberculosis rate of dark
skin people living distant from the equatorial regions is significantly higher than
that of individuals with light skin.
The correlation between human skin color evolution and the essential need for
vitamin D3 synthesis is only one of multiple examples how dietary needs and
changes have directed human evolution over the past 60,000 years. In fact, radical
76 4 Adaption of the Human Genome to Dietary Changes
changes in diet seem to have been a major driver of human evolution and probably
even the main factor that enabled the modern human to survive and progress.
Humans have spread from Africa around the world, experienced an ice age, domes-
ticated hundreds of plant species and more than a dozen animals for the start of
agriculture and dairy farming. Moreover, they significantly increased in population
density and finally were exposed to a larger number of infectious diseases. In fact,
infectious diseases, in particular malaria, have been among the strongest selective
pressures in the most recent human evolution (Chap. 7).
Humans were the only species that learned up to 1 million years ago to use fire to
cook raw food and thereby created a safer and more easily digestible diet. Together
with the use of tools and the omnivorous choice of diet, the advantage of cooking
increased the energy yield for metabolism and allowed the enlargement of human
brains. Interestingly, in today’s human diet starch from grain flour, rice or potatoes
is a major component, while early humans were not able to efficiently extract the
energy from tubers and other starchy plant parts. The salivary enzyme amylase,
encoded by a cluster of AMY1 genes on chromosome 1, is the central human protein
that hydrolyzes starch. The number of copies of the AMY1 gene varies among
human individuals (it can be up to nine copies per haploid genome) and directly
correlates with enzyme concentrations. Interestingly, the genomes of other primates
and that of Neanderthals carry only one copy of AMY1 (as only 1–2 % of present
humans). The average AMY1 copy number within a human population relates to the
starch content of their traditional diet, i.e. cultural variation in human diet explains
some of the adaptive genetic differences between human populations. For example,
in Japan large amounts of rice and starch from other sources are consumed reflect-
ing many copies of the AMY1 gene, whereas in the genetically closely related
Siberian Yakut population (primarily eating fish and meat) significantly less AMY1
copies are found. Since starch consumption is a central feature of agricultural soci-
eties, there seemed to be selective evolutionary pressure on the AMY1 gene.
The genes of alcohol dehydrogenase (ADH) cluster that encode for ethanol
metabolizing enzymes are another example of a gene locus that was positively
selected when agriculture made the production of fermented alcoholic beverages
easy. These examples suggest that the transition to new diet sources after the advent
of agriculture and the colonization of new habitats seems to have been a major fac-
tor for the selection of human genes. Additional examples of genes that were posi-
tively selected due to dietary changes are: ADAM metallopeptidase with
thrombospondin motif 19 and 20 (ADAMTS19 and ADAMTS20), N-acylaminoacyl-
peptide hydrolase (APEH), plasminogen activator, urokinase (PLAU) and ubiquitin
protein ligase E3 component n-recognin 1 (UBR1), which encode for enzymes
related to protein metabolism. Human population-specific examples are genes
involved in metabolizing mannose (MAN2A1 in West Africa and East Asia), sucrose
4.4 Regulatory SNPs and Quantitative Traits 77
(SI in East Asia) and fatty acids (SLC27A4 and PPARD in Europe, SLC25A20 in
East Asia, NCOA1 in West Africa and leptin receptor (LEPR) in East Asia). Taken
together, human populations have genetically adapted to their traditional diet, in
order to make the most of local resources.
A prominent illustrative example is the co-evolution of dairy farming and the use
of milk from infanthood to adulthood, referred to as lactase persistence. Lactase is
an enzyme that is expressed in the intestine and splits the disaccharide lactose
(“milk sugar”) into glucose and galactose. Lactase non-persistence, also referred to
as adult-type hypolactasia or lactose intolerance, represents an autosomal recessive
trait that is characterized by diminished expression of the LCT gene after weaning.
Lactose intolerance is the default genetic setup of early humans (as well as in most
other mammals), maybe in order to avoid competition for mother milk between
newborns and older children or even adults. It is still present in more than half of the
human population, since the new variant of the LCT gene has emerged only within
the last 10,000 years, primarily in parts of Europe after the start of dairy farming.
Milk drinking created one of the strongest presently known selection pressures on
the human genome that drove alleles for lactose tolerance to high frequency. Lactose
tolerance is found also in livestock raising populations from Africa and Western
Asia, but is almost completely absent elsewhere. Since milk is a perfect source of
carbohydrates (primarily lactose), fat and calcium, the ability to use it as a reliable
dietary source provides an enormous advantage for survival.
The SNPs associated with lactase persistence are located approximately 14 kb
and 22 kb upstream of the LCT gene within exons 13 and 9 of the minichromosome
maintenance type 6 (MCM6) gene on chromosome 2 (Fig. 4.4). The T/T allele at
position -13,910 relative to the TSS of the LCT gene binds the transcription factor
OCT1 with higher affinity than the C/T or the C/C variant. Also the transcription
factors GATA6, CDX2 and HNF4A and HNF3A were described to associate with
this regulatory region. Further SNPs at positions -22,018, -14,010, -13,915 and
-13,907 in different human populations are also associated with lactose tolerance
but did not show to be functional. As expected, the respective SNPs in the
Neanderthal genome indicated that ancient human populations were lactose intoler-
ant. Furthermore, the larger genomic region around the LCT gene demonstrates
significant difference in the size of the respective haplotype blocks between lactose
tolerant Europeans (more than 1 Mb) and non-Europeans, reflecting strong selec-
tion for the lactase persistence allele in particular in the Northern European
population.
GWAS analysis has indicated that 90 % of trait-associated variants are located out-
side of protein-coding regions of the human genome (Sect. 2.5). The SNP 13,910 kb
upstream of the LCT gene that is associated in the northern European population
with the trait lactose tolerance (Sect. 4.3) is a master example of a regulatory
78 4 Adaption of the Human Genome to Dietary Changes
2q21.3 - 2q22.1
≈3 Mb
136,215,806 136,459,692
Centromere Telomere
UBXD2 LCT
MCM6 DARS
LOC391448
136,350,481 136,313,666
5’ 3’
INTRON 9 INTRON 13
...GGC G/A CGGTGG... ...C G/C TAAGTTACCA... ...AAGATAA T/G GTAG C/T CC C/G TC...
Fig. 4.4 Map of the genomic region of the LCT and MCM6 gene. Location of the SNPs respon-
sible for lactose tolerance within introns 9 and 13 of the MCM6 gene in African and European
populations
HMT
HMT Tall
Me Me Me
Me Gene
Transcription factor
expression
5’ G A A C T G T C 3’
3’ C T T G A C A G 5’
ac
ac ac ac RNA Pol II
HAT
A HAT
G No gene
Short
expression
5’ G A A C C G T C 3’
3’ C T T G G C A G 5’
Fig. 4.5 The basis of human trait variation. Small variations within the DNA binding site for a
transcription factor can faciliate and even enhance the association of this protein, such as the A
(top) or inhibit its binding, when it is a G (bottom). The binding of the transcription factor influ-
ences the local chromatin structure via the activation of chromatin modifying enzymes, such as the
histone acetyltransferases (HATs) and/or histone methyltransferases (HMTs), eventually leading to
the activation of RNA polymerase II (Pol II) and the transcription of the respective gene. This may
have a positive effect on the trait of interest, such as body height. In contrast, when the transcrip-
tion factor does not bind, the respective genomic region remains inactive and the gene is not
transcribed. This may have a negative effect on the studied trait
affinity of transcription factors for their genomic binding sites within promoters and
silencers, (ii) a disruption of chromatin interactions, (iii) the modulation of the func-
tionality of non-coding RNAs, (iv) the induction of alternative splicing and (v) an
alternation in the post-translational modification pattern of proteins. The effect size
of the functional SNPs can vary a lot and depend on the affected regulatory process
and its epigenomic context, i.e. they are difficult to predict. At present, changes in
the association of transcription factors due to variants in their specific binding sites
are the best-understood types of regulatory SNPs (see examples in Box 4.1).
(continued)
80 4 Adaption of the Human Genome to Dietary Changes
Results of the ENCODE Project have demonstrated that transcription factor bind-
ing sites regulating a given gene show a Gaussian distribution in relation to the the
gene’s TSS, i.e. they are found equally likely up- and downstream. Moreover,
ENCODE data have created a unique genome-wide resource on (i) post-translational
histone modifications, such as methylations and acetylations at various positions of
the histones H3 and H4, indicating active and repressed enhancer and promoter
regions, (ii) the chromatin accessibility, (iii) the genomic association of more than
100 transcription factors, (iv) DNA methylation indicating inactive genomic binding
profiles and (v) the non-coding transcriptome in more than 100 human cell lines.
Figure 4.6 provides an example how ENCODE data can be used for the functional
characterization of a regulatory SNP. The set of annotations of the human genome
are further extending for primary human tissues and cell types by data from the
FANTOM5 Project and the International Human Epigenome Consortium (Box 2.4).
The database RegulomeDB (http://regulomedb.org) combined information on chro-
matin state, transcriptional regulator binding and eQTLs and allows the identification
and interpretation of functional DNA elements at the sites of regulatory variants.
Fig. 4.6 (continued) in suited tissues, in relation to the genotypes of the concerned SNPs (center).
This approach demonstrated that the expression of gene 3 is significantly associated with the
genetic variant. The use of genome annotation data from the ENCODE Project or comparable
sources, such as histone modifications, transcription factor binding or accessible chromatin, may
allow a mechanistic explanation of the function of the regulatory SNP (bottom)
14
12
10
–log10(p)
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 21
Chromosome
8
–log10(p)
0
Gene 1 Gene 2 Gene 3
Position on chromosome 5
1 2 3 4 5 6 7 8 9 10 11 12
Correlation
No correlation
9.5
4.0 7.0
Gene 1 expression
Gene 2 expression
Gene 3 expression
Gene 3
Histone marks
Transcription
factor binding
DNase I clusters
Fig. 4.6 Identifying regulatory SNPs by eQTL mapping combined with ENCODE data
inference. The Manhattan plot representation (top) of a hypothetical GWAS study indicated a
number of SNPs within a region of chromosome 5 that are with high statistical significance associ-
ated with the studied trait. The horizontal red line represents the p-value threshold. The regional
association plot suggests three genes to be tested for eQTL mapping, such as mRNA expression,
82 4 Adaption of the Human Genome to Dietary Changes
Isolated ingredient(s)
Connectivity
Ingredient,
Target cells
lead compound Define markers
(in culture)
or mixture
Connectivity
Ingredient Model organism Define and/or
or mixture (mouse, rat) validate markers
Fig. 4.7 Applications of omics technologies in nutrition research. The effect of food or its
ingredients are studied either in cell culture, animal models or, e.g., in human intervention studies.
In all cases, samples are analyzed via the use of omics technologies on the level of the transcrip-
tome, proteome or metabolome. The integration of these large-scale datasets results in the defini-
tion of biomarkers that can be validated via complementary studies
the complete set of all mRNA molecules, proteins and metabolites in a cell or in a
biological sample. Thus, food as a whole as well as individual dietary components
induce a pattern in gene expression, protein expression and metabolite production
that can be interpreted as “signatures” of the respective nutritional compound.
These dietary signatures can be investigated in vitro, such as in cell lines represent-
ing metabolic organs, or in vivo, such as in rodent model organisms (Fig. 4.7).
However, the most meaningful results may be obtained from intervention studies
with human subjects.
Via the use of omics technologies, such as microarrays or RNA-seq for
transcriptome-wide monitoring of mRNAs, nutrigenomics seeks to identify the
genes that influence the risk of diet-related diseases. These genes are related to
metabolic and/or regulatory pathways eventually providing a molecular explanation
for the mechanism of action of the dietary compound. Nutrigenomics technologies
that are based on the use of next-generation sequencing methods, i.e. the massive
parallel sequencing of DNA or RNA molecules, are presently far more advanced
than proteomic and metabolomic technologies. Nevertheless, proteome and metab-
olome data allow more precise measures of a physiological state. At present, the
method liquid chromatography mass spectrometry (LC-MS/MS) analysis identifies
up to 5000 of the most abundantly expressed proteins. The analysis of metabolites
is performed either targeted, via gas chromatography-mass spectrometry (GC-MS)
4.6 Integrative Personal Omics Profile 83
for a few hundred metabolites, or untargeted via LC-MS, which allows the detection
of several thousand different molecules. A central point in nutrigenomic methodol-
ogy is the integration of the data that were obtained from transcriptomic, proteomic
and metabolomic profiling with specific nutrients or diets. Ideally, this results in the
identification of biomarkers that can serve as early warning for nutrient-induced
changes to homeostasis, such as the development of pre-diabetes (Chap. 10). In this
way, nutrigenomic investigations can provide basic insight on the interaction
between nutrition and the genome but can also serves as a diagnostic tool.
RNA Transcriptome
T1 iPOP iPOP
RNA expression
Indels
Proteome Duplications
Protein
Auto-antibodyome Deletions
Chr. ideogram
Int
iPOP eg
iPOP rat Chr. number
i
Metabolite Metabolome iPOP on
T2 iPOP
T3 iPOP
Pharmaco- T4
genome T5
Tn
Database
Prevention (deidentified)
Treatment
Fig. 4.8 Implementation of iPOP for personalized medicine. Tissue samples (for example,
PBMCs) of an iPOP participant are collected at time points T1 to Tn, while diet, exercise, medical
history and present clinical data are also recorded. The results of the iPOP analysis can be moni-
tored by Circos plots (right), in which DNA (outer ring), RNA (middle ring) and protein (inner
ring) data match to chromosome position. The data may be reported back to genetic counselors
and/or medical practitioners, in order to allow most rational choices for prevention and/or treat-
ment, which may be matched with pharmacogenetic data
84 4 Adaption of the Human Genome to Dietary Changes
datasets were complemented by medical lab tests for regular blood biomarkers.
Interestingly, the frequent sampling enabled the detection of personalized physio-
logical state changes, such as markedly elevated glucose levels in response follow-
ing two viral infections during the investigation period. The integrative profile
monitored both gradual trend changes as well as spike changes in particular at the
onset of each physiological state adjustment. Thus, the iPOP analysis allowed a
most comprehensive view on the biological pathways that changed during T2D
onset of the study subject including dynamic changes in allele-specific expression
and RNA editing events. Importantly, the T2D outbreak was detected in a very early
stage, so that it could be effectively controlled and reversed by changing diet and
intensified physical exercise of the individual.
The central aim of an iPOP-type analysis is the accurate assessment of disease
risk of the investigated human individual. Due to the large number of genetic vari-
ants and the fact that many diseases are based on the combination of genetic and
environmental factors, this aim is challenging. Results from genotyping approaches
can be summarized in a “riskogram” that takes age, gender and ethnicity as well as
multiple independent disease-associated SNPs into account, in order to calculate the
subject’s likelihood of developing a disease. The original iPOP study calculated for
the investigated subject a previously unexpected increased risk to develop T2D
(Fig. 4.9), which in fact was confirmed experimentally after a viral infection.
The field of personalized medicine significantly advanced due to the rapid devel-
opment of omics technologies. Future personalized health care as well as the emerg-
ing field of personalized nutrition will benefit from the combination of personal
Likelihood ratio 1.18 0.85 0.80 0.87 0.91 0.94 1.06 1.15 0.88 1.31 1.07 1.12 1.07 1.03 1.00 1.05 1.07 1.48 1.01 1.09 1.06 0.94 0.96 1.03 1.04 1.02 0.94 1.13 100%
50%
46%
43% 42% 43% 44% 44% 43%
42%
39% 40%
Probability
30% 31%
29% 29% 29% 28% 29%
27% 27% 27%
25%
24%
23%
21%
20%
19% 19% 19%
18%
Prevalence
PPARGC1A
TP53INP1
KCNJ11
CDKAL1
SLC30A8
MTNR1B
IGF2BP2
TCF7L2
THADA
ARAP1
KCNQ1
KCNQ1
RBMS1
HNF1B
JAZF1
WFS1
Genes
EPO
FTO
10%
AG
TC
TC
TC
CT
TC
GG
CT
TT
GG
GG
GG
CC
TT
CC
CC
GG
GT
TT
AA
AA
AA
GG
CC
AA
GA
TA
CT
7 3 0
8 7 1
rs 93 07 5
12 45 54
rs 77 01 2
44 83 7
rs 23 53
02 34
7 0 5
rs 17 31
6
rs 52 62
16 01 9
rs 70 71 7
10 36 03
13 54 36
44 66 0
1 5 0
2 1 9
rs 59 68 0
1 9 6
rs 570 6
44 09 1
30 63
1 4 4
10 00 31
rs 46 85 8
2 1 6
rs 15 79
rs 23 66
rs 02 74
rs 05 89
rs 57 84
rs 97 87
79
rs 01 03
1 0 9
rs 26 84
rs rs 96
rs 11 21
rs 89 64
rs 77 32
2
rs 83 10
rs 86 22
rs 57 18
rs 81 14
Genotypes
15 13
10 03
rs 79
rs
Fig. 4.9 The potential of personalized medicine. The “riskogram” illustrates how the volun-
teer’s post-test probability of T2D was calculated on the basis of 28 independent SNPs. On top, the
likelihood ratio is indicated, the central graph displays the post-test probability, while the associ-
ated genes, SNPs and the subject’s genotypes are shown on the bottom
4.6 Integrative Personal Omics Profile 85
genomic information with global monitoring of the molecular profile that represent
physiological states, as exemplified by the iPOP approach. iPOP-type investigations
can be tailored and applied to monitor any disease or physiological state changes of
interest. The integrative profile is modular and allows the addition of further omics
information, such as epigenome-wide data and the microbiome of skin, oropharynx,
nasopharynx, stomach, intestinal mucosa or urine, respectively, as well as quantifi-
able environmental factors. In this way, iPOP-like analyses may become also cen-
tral to nutrigenomics.
Future View
In a few years whole genome sequence information will be available for millions of
human individuals. This will allow a deeper understanding of the processes of
human evolution and the causes of patterns of genetic variations for all human pop-
ulations. The rapid development of omics technologies in combination with decreas-
ing costs will allow collecting iPOP-style large-scale datasets on many individuals,
the integration of which will allow further exploring the relationship between human
genetic variations and complex diseases and respective traits. In particular the sys-
tematic exploration of epigenomics (Chap. 5) will provide critical insights into dis-
ease susceptibility. The ability to stratify individuals according to their genotype
will make clinical trials more efficient by enrolling a lower number of subjects with
an anticipated larger effect when personalizing the intervention. Diseases, such as
T2D, will be classified into sub-phenotypes based on the genotype and the dynamic
reply of the human individual, for example in response to a personalized diet.
Nutrigenomics will assist in obtaining a comprehensive insight on the molecular
links between nutrition and the (epi)genome. This will allow using diet for preserv-
ing health and for an improved personalized therapy, most likely in combination
with synthetic drugs, in case of disease.
Key Concepts
• Human diet is a complex mixture of micro- and macronutrients, some of which
(i) have a direct effect on gene expression, (ii) after metabolism modulate the
activity of a transcription factor or (iii) stimulate a signal transduction cascade
that ends with the induction of a transcription factor.
• When human individuals are classified according to the interplay of their life-
style, metabolic pathways and genetic variation, the molecular insight based on
nutrigenomics studies can suggest tailored diets, referred to as personalized
nutrition, for early therapeutic intervention.
• The evolutionary driver for the skin lightening genetic variations was most likely
the low vitamin D3 synthesis rate of darker skin in northern latitudes, which
results in vitamin D3 deficiency and serious consequences for evolutionary fit-
ness, such as reduced bone strength and a defective immune system.
• The average copy number of the salivary amylase-encoding gene AMY1 within a
human population relates to the starch content of their traditional diet, i.e. cul-
tural variation in human diet explains some of the adaptive genetic differences
between human populations.
86 4 Adaption of the Human Genome to Dietary Changes
• Drinking milk obtained from domesticated animals created one of the strongest
presently known selection pressures on the human genome that drove alleles for
lactose tolerance to high frequency.
• A SNP 13,910 kb upstream of the LCT gene is associated in the Northern
European population with the trait lactose tolerance and represents a master
example of a regulatory SNP.
• Food as a whole, as well as individual dietary molecules, induce a pattern in gene
expression, protein expression and metabolite production that represent “signa-
tures” of the respective nutritional compounds or the whole diet.
• Integration of large-scale datasets in nutrigenomics may result in the identifica-
tion of biomarkers that can serve as early warning for nutrient-induced changes
to homeostasis, such as the development of pre-diabetes.
• The iPOP analysis of one human individual represents a proof-of-principle study
demonstrating nowadays potential of next-generation technologies. It allowed a
most comprehensive view on the biological pathways that changed during T2D
onset of the study subject.
• Future personalized nutrition and health care will benefit from the combination
of personal genomic information with global monitoring of the molecular that
represents physiological states, as exemplified by the iPOP approach.
Additional Reading
Frazer KA, Murray SS, Schork NJ, Topol EJ (2009) Human genetic variation and its contribution
to complex traits. Nat Rev Genet 10:241–251
Järvelä I, Torniainen S, Kolho KL (2009) Molecular genetics of human lactase deficiencies. Ann
Med 41:568–575
Knight JC (2014) Approaches for establishing the function of regulatory genetic variants involved
in disease. Genome Med 6:92
Laland KN, Odling-Smee J, Myles S (2010) How culture shaped the human genome: bringing
genetics and the human sciences together. Nat Rev Genet 11:137–148
Li-Pook-Than J, Snyder M (2013) iPOP goes the world: integrated personalized Omics profiling
and the road toward improved health care. Chem Biol 20:660–666
Scheinfeldt LB, Tishkoff SA (2013) Recent human adaptation: genomic approaches, interpretation
and insights. Nat Rev Genet 14:692–702
Sturm RA, Duffy DL (2012) Human pigmentation genes under environmental selection. Genome
Biol 13:248
Chapter 5
Nutritional Epigenomics
Abstract Not only the genome but also the epigenome stores heritable informa-
tion. The genome is supposed to stay stable during lifetime, while the epigenome is
very dynamic and modulated by environmental stimuli, such as dietary molecules.
It is expected that the missing classical genetic heritability of the susceptibility for
complex diseases and traits might be eventually explainable via epigenetics. For
example, persons that are born with low birth weight have a high risk to develop
T2D later in their life, suggesting that epigenetic programming during embryogen-
esis and the intra-uterine environment both contribute to the T2D risk. Moreover,
the lifestyle of the human individual, i.e. primarily the daily choice of diet, seems to
create a metabolic memory within the epigenome. This concept suggests that life-
style changes, such as the use of personalized diet, increased physical activity and
consecutively weight loss can have a beneficial effect on the epigenome and thus on
the risk for suffering from the metabolic syndrome (Chap 12).
In this chapter, we will define different epigenetic mechanisms, such as post-
translational histone modifications and DNA methylation, that process information
provided by dietary molecules. We will learn that many chromatin-modifying
enzymes are susceptible to changes in the levels of intermediary metabolites acting
as co-substrates and co-factors and respond to changes in nutrient intake and metab-
olism. Via the understanding of pre-natal supplementation in mouse models, we
will get insight into the concepts of epigenetic programming. This will lead us to the
thrifty hypothesis, and we will discuss the different approaches of epigenetic epide-
miology including the concept of an “epigenetic drift” during adult life.
a
me me
HAT me me me
ac KMT me CoR
ac
CoA DNMT me
me me me
me Me
KMD HDAC
Me
me
ac me me
me
ac Me-CpG
ac
b
OH OH OH
OH OCH3 OCH3
OH O HO
HO O HO O HO OH
OH OH
OH OH
HO O
OH OH OH O O
Fig. 5.1 Chromatin, associated proteins and nutrition-based epigenetic modulators. (a).
Chromatin is distinguished into open chromatin (euchromatin, left) with loose nucleosome
arrangement and closed chromatin represented by dense nucleosome packing (heterochromatin,
right). There are several stages between these extremes that are summarized as facultative hetero-
chromatin. Each stage is characterized by a set of chromatin modifying enzymes, such as HATs,
HDACs, HMTs and histone demethylases (HMDs), DNA methyltransferases (DNMTs), co-
activators (CoAs) and co-repressors (CoRs) of transcription factors that lead to the schematically
indicated scenarios of acetylation and methylation of histone tails and genomic DNA. (b). The
indicated plant-origin natural compounds have been shown to modulate the activity of chromatin
modifying enzymes and in this way affect the epigenetic status of cells and tissues
5.1 Epigenetics Mechanisms 89
The ENCODE Project and other big biology consortia (Box 2.4) provide
genome-wide maps of epigenetic marks in more than 100 human cell lines, primary
cells and tissues. These data collectively indicate that in regions of open, active
chromatin histone proteins are acetylated (for example, at lysine 14 of histone 3,
H3K14ac) and genomic DNA remains unmethylated. In contrast, in repressed,
closed chromatin histones are methylated (for example, at lysine 27 of histone 3,
H3K27me) and also the DNA gets methylated. The change in DNA methylation
during development starts with demethylation during cell devisions of the fertilized
egg, followed by de novo methylation after implantation. Due to this epigenetic
reprogramming during development, the intra-uterine period is considered critical
for long-term health and disease risk (Sect. 5.5). However, DNA methylation does
not only control the expression of specific genes during the development and dif-
ferentiation of individual tissues, but it is also essential for silencing of imprinted
genes, the second female X chromosome and retro-transposons (Box 5.3).
Importantly, histone modifications precede or succeed DNA (de)methylations, i.e.
both epigenetic processes display a cross-talk. For example, methyl-CpG binding
proteins are capable of recruiting HDACs to methylated regions of genomic DNA.
Chromatin density plays an important role in regulating gene expression, primar-
ily by controlling the accessibility of genomic binding sites for transcription factors.
The dynamic competition between nucleosomes and transcription factors for criti-
cal binding sites is influenced by a large set of enzymes that either covalently mod-
ify histone proteins, termed chromatin modifiers, or move, reconfigure or eject
nucleosomes, called chromatin remodelers. This process determines for each geno-
mic region the density, composition and positioning of nucleosomes relative to the
transcription factor binding sites that it contains.
A wide spectrum of secondary metabolites from fruits, vegetables, teas, spices,
and traditional medicinal herbs, such as genistein, resveratrol, curcumin and poly-
phenols from green tea, coffee and cocoa, respectively, are able to modulate the
activity of transcription factors and chromatin modifiers (Fig. 5.1b). Next-generation
sequencing technologies allow the genome- and transcriptome-wide assessment of
the specificity and efficacy of these compounds, for example, in order to prevent and
treat cancer.
In general, gene expression is controlled on the level of (i) the genomic DNA
sequence (the DNA code), (ii) the accessibility of genomic DNA (the epigenetic
code) and (iii) the abundance and activity of transcription factors (the transcription
factor program) (Box 5.4). Most trait-associated variations of genomic DNA are
located outside of protein-coding regions, such as the major SNP controlling the
persistence of LCT gene expression after weaning (Sect. 4.3). These regulatory
SNPs offer the possibility to understand the mechanistic function of those SNPs that
do not change the amino acid composition of a protein. However, since regulatory
SNPs are a part of the DNA code, they do not close the gap in the missing classical
genetic heritability. Thus, the latter may be explained via the epigenetic code or the
transcription factor program.
Within a cell, signal transduction pathways result in the activation of gene expres-
sion programs (Box 5.4) that integrate environmental inputs, such as the availability
of energy substrates, in order to mediate responses targeting homeostasis. Numerous
connections between products of intermediary metabolism and chromatin modify-
ing enzymes (Box 5.5) are known. The human genome tissue-specifically expresses
hundreds of chromatin modifiers that interpret (“read”), add (“write”) or remove
(“erase”) post-translational histone modifications. So-called “bromodomains” are
found in all type of proteins that are able to recognize acetylated residues, such as
92 5 Nutritional Epigenomics
Nutrition OR Metabolism
Signaling metabolites
SAM, FAD, NAD, acetyl-CoA, β-OHB, ATP, O-GlcNAc
Fig. 5.2 Epigenetic mechanisms link metabolites and transcription. Changes in nutrition or
fluctuations in metabolism affect the transcriptional responses of metabolic tissues. Several inter-
mediary metabolites change the activity of chromatin-modifying enzymes in a dose-dependent
manner. These proteins use some of these metabolites as co-substrates and/or co-factors and act in
this way as metabolic sensors. “Writer” enzymes create covalent chromatin marks, “reader”
enzymes recognize these marks and “eraser” enzymes remove them. These histone tail modifica-
tions create changes in the local chromatin structure, which has consequences for the activity and
regulation of the neighboring genes
UDP-GlcNAc
Folate
CoA-SH GDP (ADP)
GTP (ATP)
One-carbon
NADPH NADP +
metabolism
Succinate α-Ketoglutarate Isocitrate
FAD FADH2 SAH
IDH1
SAM KDM
KDM Me1 STOP
JmjC
LSD1
STOP
Me2 HMT Me3
Fig. 5.3 Links between metabolic pathways and chromatin signaling. Metabolites that are
essential for the function of chromatin modifiers participate in key biochemical pathways of intra-
cellular energy balance. The TCA cycle is the central connection between catabolic and anabolic
pathways. Glycolysis of glucose and β-oxidation of fatty acids are catabolic processes that gener-
ate acetyl-CoA, whereas during periods of glucose excess acetyl-CoA is removed from mitochon-
dria via the citrate shuttle that fuels lipogenesis and the biosynthesis of various other
macromolecules. This also provides acetyl-CoA for histone acetylation via HATs. Glucose is also
used via the hexosamine biosynthetic pathway generating the co-enzyme UDP-GlcNAc that
together with OGT mediates histone O-GlcNAcylation. Folate is a micronutrient that acts as a
methyl-group donor for DNA and histone methylation. It is the central substrate of the one-car-
bon metabolism, i.e. of a cyclic reaction generating SAM (Sect. 5.3). Finally, the NAD+/NADH
ratio in mitochondria is connected with the malate-aspartate shuttle and controls the activity of
sirtuins (Sect. 6.5)
Methyl donors are critical during pregnancy and dietary excess as well as deficiency
may have an impact on epigenetic programming in mice (Sect. 5.4) and humans
(Sect. 5.5). The methyl donor substrate SAM connects DNA methylation with inter-
mediary metabolism. SAM is generated from the amino acid methionine and ATP
in the one-carbon metabolism pathway (Fig. 5.4). When a methyl-group of SAM is
transferred to DNA or a histone, the product S-adenosylhomocysteine (SAH) is
recycled back to SAM. Interestingly, SAH acts as a negative feedback regulator for
HMTs, suggesting that the SAM/SAH ratio, referred to as the “methylation index”,
is critical for histone and DNA methylation. A derivative of the B vitamin folate,
5.3 One-Carbon Metabolism and DNA Methylation 95
CH3
COOH H3C
O N+ CH2 OH
CH3 H3C CH2
O N H2N COOH
H COOH CH Choline
HN N N CH2
H 5m-THF
N N CH2
NH2 CH
B2 H
SH Homocysteine H3C
N+ CH COOH
H3C 2
O COOH
Betaine
O N COOH
HN H B12 B12
N N
NH2 5,10-MTHF
N CH3
N H3C N
H
O COOH H2N COOH CH2 COOH
CH
H2 N
O N Dimethylglycine
COOH CH2
CH COOH H H
HN N N CH2 Methionine
H Glycine H THF
B6 N N S
NH2 H
H2 N COOH CH3
CH DHFR O COOH
CH2 Serine O N
HO COOH
H NH2 NH2
HN N N CH3
H DHF N N
N N N N
NH2 +
H HOOC S N HOOC S N
O COOH ON ON
H2 N H2 N
O N COOH
H HO OH HO OH
HN N N
H Folate SAM SAH
NH2 N N
CH3
Fig. 5.4 Metabolism and methyltransferases. DNA and HMTs use the methyl-group of SAM
and generate SAH that is converted to homocysteine. In a vitamin B12-dependent reaction that
utilizes carbons derived from either choline or folate, homocysteine is converted back to methio-
nine. Also shown are steps that require the vitamins B6 and B12. For simplicity, the respective
converting enzymes are not shown
In the mouse, the gene agouti signaling protein (Asip) encodes a paracrine signaling
molecule that causes hair follicle melanocytes to synthesize pheomelanin, a yellow
pigment, instead of the black or brown pigment, eumelanin. The insertion of the
retrotransposon intracisternal A particle (IAP) into the regulatory region of the Asip
gene creates a dominant allele of the gene (termed Avy) that is expressed depending
on the methylation status of the IAP element. Some retrotransposons, such as IAP,
show so-called stochastic epigenetic variability that may substantially contribute to
the phenotypic variability in mammals. In case of Avy/a mice this results in coat col-
ors that can vary from yellow via mottled to wild-type dark coat color, i.e. Avy is a
metastable epiallele. Interestingly, yellow coat mice become obese and are hyperin-
sulinemic. When the IAP element is methylated, the synthesis of the yellow pig-
ment is down-regulated and a pseudoagouti dark coat color is produced. In contrast,
unmethylated IAP allows ubiquitous Asip expression leading to both yellow coat
color and obesity. Another interesting characteristic of the Avy mouse model is its
capacity for epigenetic inheritance, meaning that, when Avy/a animals inherit the Avy
allele maternally, Asip expression and coat color correlate with the maternal pheno-
type. In addition, the mottled phenotype indicates that IAP methylation is mosaic,
i.e. the Asip gene is not expressed in all cells. This suggests that the methylation
pattern of the IAP element is established early in development and the coat color
provides an easy phenotypic readout of the methylation and expression status of the
element throughout life. All these properties make the Avy Asip mouse an ideal in
vivo model, in order to investigate a mechanistic link between environmental stim-
uli, such as nutrition, and epigenetic states of the genome (for details see below).
This was supported by the following experiment: Two weeks before mating with
male Avy/a mice, female wild-type a/a mice were either supplemented or not with
methyl donors, such as folate, vitamin B12 and betaine (Fig. 5.5). The supplemen-
tation was continued during pregnancy and lactation. While the F1 generation of
non-supplemented mothers displayed the expected number of yellow color pheno-
types, the offspring of supplemented mothers shifted toward a brown coat color
phenotype. This suggests that maternal methyl donor supplementation leads to
increased Avy methylation in the offspring. The inheritance of an epigenetic pro-
gramming to the next generation indicates that at least metastable epialleles, such as
IAP, are able to resist the global demethylation of the genome before pre-
implantation. Interestingly, when Avy mice were fed with a soy polyphenol diet
causing changes in their DNA methylation patterns, their offspring was protected
against diabetes, obesity and cancer across multiple generations.
In a mouse model of maternal undernutrition that leads to low birth weight and
glucose intolerance in male and female F1 offspring, it could be shown that expo-
sure to suboptimal nutrition during fetal development leads to changes in the germ-
cell DNA methylome of male offspring even when these males were nourished
normally after weaning. These phenotypic differences are transmitted through the
5.4 Nutrition-Triggered Transgenerational Epigenetics in Mice 97
Offspring
c
Asip Asip
IAP IAP
Fig. 5.5 Maternal dietary supplementation affects the phenotype and epigenome of Avy/a
offspring. (a). The diets of female wild-type a/a mice are either not supplemented (left) or supple-
mented with methyl-donating compounds (right), such as folate, choline, vitamin B12 and betaine,
for 2 weeks before mating with male Avy/a mice, and ongoing during pregnancy and lactation. (b).
The coat color of offspring that are born to unsupplemented mothers is predominantly yellow,
whereas it is mainly brown in the offspring from mothers that were supplemented with methyl-
donating substances. About half of the offspring from these matings do not contain an Avy allele,
are therefore black (a/a) and are not shown here. (c). The molecular explanation of DNA methyla-
tion and Asip gene expression. Maternal hypermethylation after dietary supplementation shifts the
average coat-color distribution of the offspring to brown by causing the IAP element upstream of
the Asip gene to be more methylated on average than in offspring that are born to mothers fed an
unsupplemented diet. The arrow size is proportional to the amount of ectopic and developmental
Asip gene expression. White circles indicate unmethylated CpGs and red circles are methylated
CpGs
The results from rodent models (Sect. 5.4) impose the question whether the concept of
a metabolic memory is also valid in humans. However, there are no comparable natural
human mutants, and embryonal feeding experiments are not compatible with ethical
requirements, respectively. However, the rather new discipline of epigenetic epidemiol-
ogy has found a number of alternative approaches to address this question (Box 5.6).
From these, the Dutch Hunger Families Study raised most public interest. The study
investigated human individuals that had been exposed in utero to an extreme undernutri-
tion that occurred in the Netherlands during the winter of 1944/45. The subjects in the
cohort had low birth weight, however, later in life were overweighted and displayed
increased incidence of insulin resistance (Sect. 9.4). Moreover, even six decades after
birth lower DNA methylation levels were observed at the regulatory region of the
imprinted gene insulin-like growth factor 2 (IGF2), which is associated with an increased
risk of obesity, dyslipidemia and insulin resistance. This suggests also for humans a link
between pre-natal nutrition and epigenetic changes as described for rodents.
(continued)
Box 5.6 (continued)
Birth Cumulative
a environmental
Pre-natal Post-natal
changes
Epigenomic variation
Cumulative
stochastic
changes
b Long-lived
100 y families
Timing of studies of phenotypic consequence
Natural
experiments
Longitudinal Short-term
Family studies cohort studies interventions
of paternal (including twins)
exposures
40 y
Guthrie
cards
0y
0 8 d 8 w 38 w 0 1 m 1 y 12 y 18 y 40 y 90 y 100 y
Gametogenesis Extreme longevity
Conception Aging
Blastocyst stage Adulthood
Embryogenesis Adolescence
Fetal development Childhood
Infancy
Neonatal period
Fig. 5.6 Analyzing epigenetic variation in populations. (a). Epigenetic changes can
occur at any time during life, but there is significantly increased sensitivity during early
pre-natal development. (b). The pre-natal epigenetic changes may be investigated using
IVF cohorts (Box 5.6), archived Guthrie cards, and birth cohorts tracking life from as early
as periconception. Historical famines represent the few opportunities to link the pre-natal
environment to health outcomes later in life. Longitudinal cohort studies (especially involv-
ing twins) sample peripheral tissues and take biopsies from disease-relevant tissues. Short-
term (dietary) interventions can identify specific dietary compounds that induce
tissue-specific epigenetic modifications, while long-lived families can help in identifying
the importance of maintaining epigenetic control for healthy aging
100 5 Nutritional Epigenomics
Intra-uterine insult:
Overnutrition
Undernutrition
Inactivity
Placental dysfunction Catch-up Obesity
Hypoxia Growth Aging
Decreased blood flow
T2D
Pre-natal Post-natal
Risk
Altered development
Histone modification
DNA methylation
Molecular changes
Fig. 5.7 Thrifty hypothesis. Intra-uterine stressors, including maternal undernutrition or placen-
tal dysfunction (leading to impaired blood flow, nutrient transport, or hypoxia) can initiate abnor-
mal patterns of development, histone modification and DNA methylation. Additional post-natal
environmental factors, including accelerated post-natal growth, obesity, inactivity and aging can
further contribute to T2D risk, potentially via further histone modifications and DNA methylation
in metabolic tissues
Aging
Epigenetic drift
Altered transcriptional Reprogrammed
control epigenome
Disease Transcriptional
Inherited
inheritance of
epigenetic lesions
disease risk
Germ line
Reprogrammed
epigenome
Adult life
Epigenetic drift
Homeostatic
transcriptional control
Acquired epigenetic
lesions Nutrition
Metabolism
Intra-uterine
Environment growth
Disease
Establishment of
chromatin landscape
Control of development
and differentiation
Growth
phase
Epigenetic drift
Homeostatic
transcriptional
control
Fig. 5.8 Epigenetic drift and transgenerational inheritance of risk for metabolic disease.
During embryogenesis epigenetic marks, such as DNA methylation and post-translational histone
modifications are established, in order to maintain cell lineage commitment. After birth, this chro-
matin landscape stays dynamic throughout life and responds to nutritional, metabolic, environ-
mental and pathological signals. This epigenetic drift is part of homeostatic adaptations and keeps
the individual at good health. However, when an adverse epigenetic drift compromises the capac-
ity of metabolic organs to adequately respond to nutritional or inflammatory challenges, suscepti-
bility to metabolic disease increases. Some of these acquired epigenetic marks can be inherited to
subsequent generations when they escape epigenetic reprogramming during gametogenesis
5.5 Epigenetic Programming in Humans 103
Key Concepts
• Epigenetics is the study of functionally relevant chromatin modifications that do
not involve a change in the genome sequence.
• The change in DNA methylation during development starts with demethylation
during cell devisions of the fertilized egg, followed by de novo methylation after
implantation.
• The dynamic competition between nucleosomes and transcription factors for
critical binding sites within genomic DNA is influenced by a large set of chroma-
tin modifying enzymes that covalently modify histone proteins.
• A wide spectrum of plant-derived metabolites, such as genistein, resveratrol,
curcumin and polyphenols from green tea, coffee and cocoa, are able to modu-
late in vitro the activity of transcription factors and chromatin modifiers.
• Numerous connections between products of intermediary metabolism and chro-
matin modifying enzymes are known. Since the cellular concentrations of sev-
eral of these metabolites represent the metabolic status of the cell, the activities
of the chromatin modifiers reflect the intermediary metabolism.
• A derivative of the B vitamin folate, tetrahydrofolate, serves as a methyl-group
donor for feeding of the cyclic one-carbon pathway that is essential for DNA and
histone methylation. The dependence of the pathway on folate and other micro-
nutrients is another example of the direct connection between nutrition and
epigenetics.
• The Avy/a Asip mouse is an ideal in vivo model to investigate the link between
environmental stimuli, such as nutrition, and epigenetic states of the genome.
• Exposure to sub-optimal nutrition during fetal development leads to changes in
the germ-cell DNA methylome of male offspring.
• Different rodent models indicate that epigenetic memory can be passed from one
generation to another by inheriting the same indexing of chromatin marks.
• Thrifty hypothesis: Fetal malnutrition leads to impaired fetal growth and low
birth weight that favors a thrifty phenotype being epigenetically programmed to
use nutritional energy efficiently.
• Developmental origins of health and disease hypothesis: The early-life develop-
ment is critically sensitive to inadequate nutrition and other environmental fac-
tors leading to permanent changes in metabolism that can alter susceptibility to
complex diseases.
• Nutrigenomic approaches will open up new therapeutic strategies, such as a pos-
sible reprogramming of the epigenome of metabolic organs through personalized
diet including natural compounds that modulate the activity of chromatin modi-
fiers and transcription factors.
104 5 Nutritional Epigenomics
Additional Reading
Abstract Under conditions of calorie restriction, i.e. at reduced food intake, the
lifespan of model organisms, such as yeast, worms or flies, is increased. Similarly,
when the activity of nutrient-sensing pathways is reduced by the knockdown of one
or several of their key genes, these species live longer. Even in rodents and rhesus
monkeys decreased nutrient-sensing pathway activity or calorie restriction protects
them against T2D, CVD and cancer. The molecular basis of these processes are
sensing of glucose and amino acids via the insulin/IGF and the TOR pathways,
respectively, and the integration of the nutritional and energetic status of cells and
tissues via HDACs of the sirtuin family and AMPK. Since these signal transduction
pathways are evolutionary conserved, also humans may be protected against age-
related pathologies. Humans may slow down their aging process, when their nutri-
ent signaling pathways are modulated by moderate intake of a diet that was
personalized for them.
In this chapter, we will get insight into the evolutionary conservation of nutrition-
sensing pathways and their relation to the aging process. We will realize that higher
organisms, such as mammals, use more complex regulatory circuits for sensing
food that involve the CNS via the growth hormone endocrine axis. However, a
detailed view on signal transduction related to calorie restriction will show us that
even for humans very similar regulatory principles apply. We will discuss this
insight and its potential application in preventing of age-related diseases and pro-
moting healthy aging in humans.
Aging is a complex molecular process that affects almost all species. It is repre-
sented by the accumulation of molecular, cellular and organ damage, leading to loss
of function and increased risk to disease and early death. Nutrient-sensing pathways
are fundamental to the aging process. Abundance of food activates nutrient-sensing
pathways that stimulate a diverse set of physiological processes, including repro-
duction, but this is compromised by a limited lifespan. In contrast, in times of star-
vation or when the nutrient-sensing pathways are genetically interrupted,
reproduction is delayed and the lifespan increased. This suggests that the availabil-
ity of food determines the speed of aging. Understanding the molecular basis of
aging is a central topic of nutrigenomics. However, aging research in humans takes
time, and for ethical reasons many types of experiments are not possible. Therefore,
most of the principles of aging were first understood via the use of model organ-
isms, such as Saccharomyces cerevisiae (yeast), Caenorhabditis elegans (round-
worm), Drosophila melanogaster (fruit fly) and Mus musculus (mouse) that have a
far shorter lifespan than humans (Box 6.1).
(continued)
6.1 Aging and Conserved Nutrient-Sensing Pathways 107
G0 X X
mutagenesis
+/- +/- +/- +/+ +/- +/+ +/-
G1 X X
+/- +/- +/- +/- +/- +/- +/+ +/- +/- +/+ +/- +/- +/-
induced loss
haploid hermaphrodite mating mating
of heterozygosity
G2 X X
+ + - - +/+ +/- +/- +/- +/- +/- +/+ -/-
mating
+/- -/-
G3 X X
+/+ +/- +/+ +/-
Fig. 6.1 Model organisms in aging research. Short generation length and the possibility
to study genetic mutants with variant lifespans make the model organisms yeast, round-
worm, fruit fly and mouse attractive for aging research
Activation of anti-aging ? ? ?
transcription factors
? ? ? ?
Anti-aging Anti-aging Anti-aging Anti-aging
Fig. 6.2 Nutrient signaling pathways involved in longevity are conserved in various species.
The activity of various signal transduction pathways is reduced by calorie restriction either directly
(in yeast) or indirectly (in worm, fruit fly and mice) through the reduced levels of growth factors,
such as IGF1. In all four species TOR and S6K activation promote aging (reduce lifespan).
Moreover, in yeast and mammals activation the adenylate cyclase (AC)-protein kinase A (PKA)
pathway accelerates aging. In addition, aging is promoted by the insulin/IGF1 signaling pathway
directly or indirectly via its upstream factors, such as GH. Transcription factors, such as GIS1,
MSN2/4, DAF16 and FOXO1, are inactivated by either the AC-PKA, the IGF1-AKT or the TOR-
S6K pathway. They protect from aging in all the major model organisms
pathway and the inhibition of its activity also can increase lifespan, at least in lower
organisms. In mice, mutations in genes for growth hormone (GH) and the insulin/
IGF signaling pathway can increase lifespan by up to 50 %. Mice that are deficient
in GH in their muscle cells and fibroblasts, express more anti-oxidant enzymes and
have increased stress resistance than normal mice. In contrast, in liver, kidney, mus-
cle and heart the administration of GH decreases the anti-oxidant defense of mice.
Moreover, the inhibition of the TOR pathway increases the lifespan of mice and at
the same time reduces the incidence of age-related pathologies, such as bone,
immune and motor dysfunctions and insulin resistance.
Taken together, the study of conserved nutrient-sensing pathways suggests that
the genetic alterations create a physiological state in the investigated model organ-
isms that resembles to periods of food shortage. Interestingly, a reduction in food
intake without malnutrition, referred to as calorie restriction (Sect. 6.3), is also able
to extend the lifespan of diverse species spanning from yeast to rhesus monkeys.
6.2 Neuroendocrine Aging Regulation in Humans and Other Mammals 109
Aging starts for humans after the peak of their maximal physical ability in the age
of 20–25 years, i.e. already at this age begins a slow progressive decline of the
physiological capabilities of the different tissues and cell types forming the human
body. From an age of 45 years onwards, there is a significant increase in the onset
of aging-related complex diseases, such as cancer, T2D, CVD and Alzheimer’s dis-
ease. The average generation length of modern humans for many thousand years
was approximately 20 years and just increased in the recent past. Assuming some
additional 25 years for raising all offspring, evolutionary adaption had only approxi-
mately 45 years to select humans for sufficient fitness and health. This means that
any harm occurring to humans above this age, such as developing diabetes or car-
diovascular problems, can not be corrected via evolutionary adaption principles,
such as an increased or decreased number of vital offspring (Sect. 2.2). Nevertheless,
the maximal lifespan of humans extends to approximately 120 years. The extra time
of 75 years, however realized only in a few subjects, can be considered as a margin
of safety, in order to guarantee that the vast majority of humans have enough time
to fulfill the primary evolutionary sense of life, i.e. to reproduce and to assure the
survival of their children until these start reproduction themselves.
Studies of the mouse model have indicated that in mammals the sensing of nutri-
tion involves additional control circuits, including actions of the CNS and its asso-
ciated glands. For example, the somatotrophic axis comprises GH (Sect. 6.1) that is
secreted by the anterior pituitary and its secondary mediator IGF1 that is produced
primarily by the liver. Interestingly, GH receptor-deficient primates develop seldom
diabetes or cancer but due to developmental defects and the increased mortality at
younger ages they do not seem to have an increased life expectancy. However,
genetic variations that reduce the functions of GH, IGF1 receptor (IGF1R), insulin
receptor (IR) or their downstream effectors, such as AKT, TOR and FOXO1, have
been linked also to longevity in humans (Fig. 6.3). This reflects a defensive response
of minimized cell growth and metabolism in case of cellular damage or food short-
age, which enables an organism with a constitutively decreased insulin/IGF signal-
ing to survive longer. For the same reason physiologically or pathologically aged
mammals decrease their insulin/IGF signaling, i.e. during normal aging the levels
of GH and IGF1 decline. In addition to insulin/IGF signaling sensing glucose, also
in mammals high amino acid concentrations are sensed by TOR and low-energy
states by sirtuins via high NAD+ levels (Sect. 6.4) and by AMPK via high AMP
levels (Sect. 6.5) (Fig. 6.3). During aging, TOR activity increases in mouse hypo-
thalamic neurons and contributes to age-related obesity, which can be reversed by
infusion of the TOR inhibitor rapamycin to the hypothalamus. However, TOR inhi-
bition creates side effects, such as impaired wound healing and insulin resistance,
i.e. this pathway is not suited for pharmacological intervention in humans. In con-
trast, sirtuins and AMPK are counteracting to insulin/IGF and TOR signaling, i.e.
their activity represents low food availability and catabolism instead of nutrient
110 6 Nutritional Signaling and Aging
GH
PTEN PI3K
AMPK SIRT1
AKT
Aging
Fig. 6.3 Nutrient-sensing in mammals. Overview of the endocrine somatotroph axis that
involves GH and the insulin/IGF1 signal transduction pathway. Proteins that favor aging are shown
in orange and those with anti-aging properties in green
abundance and anabolism. Interestingly, one of the activities of AMPK is the direct
inhibition of TOR. The sirtuin SIRT1 and the kinase AMPK are connected in a posi-
tive feedback loop concerning sensing low-energy states of cells. Furthermore,
SIRT1 controls the activity of the co-activator protein PPARGC1A, which in turn
manages central metabolic pathways counteracting aging, such as mitochondrio-
genesis, enhanced anti-oxidant defenses and improved fatty acid oxidation (Fig. 6.3)
(Sect. 6.4). Taken together, anabolic signaling accelerates aging also in mammals,
while decreased nutrient signaling extends the lifespan.
For thermodynamic reasons life does not function without energy supply, i.e. there
would be no life without high-energy nutrients, such as fatty acids or glucose. When
lowering food intake of model organisms, such as yeast, worms or flies, their life-
span rises to a maximum but then declines rapidly. This indicates that there is a
species-specific optimal percentage of dietary reduction and an amplitude of
6.3 Calorie Restriction from Yeast to Mammals 111
Fig. 6.4 Calorie restriction. In a number of model organisms experiments of calorie restriction
have been performed, where nutrient-sensing pathways have been modulated genetically or chem-
ically. However, there is a wide range of results and the long-term effects in humans are not yet
known
reduced the incidence of cancer and CVD by 50 % compared with controls and there
was even no case of diabetes or pre-diabetes. In analogy, also in humans, calorie
restriction provides beneficial effects against obesity, insulin resistance, inflamma-
tion and oxidative stress. Moreover, also humans show adaptations in their hormonal
circuits, such as increased levels of adiponectin and reduced concentrations of
triiodothyronine, testosterone and insulin. Moreover, reduced concentrations of
cholesterol and CRP are observed and also blood pressure decreases. Taken together,
in rodents, monkeys and even in humans calorie restriction protects against age-
related diseases, such as T2D, CVD and cancer.
Despite convincing evidence of health benefits from calorie restriction, in the
general population this approach may not be socially and ethically accepted for
reducing the risk of age-related diseases. An alternative may be repeated fasting and
eating cycles, which, at least in rats, prolonged the lifespan by more than 80 %.
Moreover, mice that got a high-fat diet with regular fasting breaks, were lean, had
lower levels of circulating inflammatory markers and no fatty liver compared to
mice that consumed an equivalent total number of calories ad libitum. The body of
the anatomically modern human is genetically still adapted to a life as a hunter and
gatherer and has not changed much since then (Chap. 2). Therefore, at stone age
time the human feeding pattern was most likely also shifting between starvation and
times of overeating after a successful hunt. However, the efficacy of most fasting
strategies are probably limited, if they are not combined with diets that have health-
associated benefits, such as the Mediterranean diet. Taken together, the switch
between nutrient intake, usage and storage, i.e. between feeding and fasting, is a
fine-tuned regulatory, evolutionarily conserved program that involves the nutrient-
6.4 Properties and Functions of Sirtuins 113
sensing insulin/IGF1 and TOR signaling pathways (Sects. 6.1 and 6.2) and the food
restriction pathways involving sirtuins (Sect. 6.4) and AMPK (Sect. 6.5).
SIRT1, the human homolog to Sir2, is one of the best-studied human signaling
proteins. It regulates the metabolism of glucose and fat in response to energy level
changes and therefore acts as a central control of the energy homeostasis network.
Important non-histone target of SIRT1 are the tumor suppressor protein p53 and the
co-activator protein PPARGC1A (Sect. 5.2) (Fig. 6.5). The deacetylation by SIRT1
activates PPARGC1A and induces downstream pathways that control gene expres-
sion in mitochondria. Furthermore, SIRT1 controls the acetylation of FOX tran-
scription factors, such as FOXO1, that are in turn inhibited by the insulin/IGF
pathway (Sect. 6.1). In addition, SIRT1 represses the transcription of uncoupling
protein 2 (UCP2). This increases the yield of ATP production from glucose oxida-
tion and the secretion of insulin from β cells. Importantly, SIRT1, SIRT3 and SIRT6
all suppress the transcription factor hypoxia-inducible factor 1α (HIF1α) leading to
decreased glycolysis and increased oxidative metabolism. From the three mitochon-
drial sirtuins, SIRT3 is the major deacetylase of key regulatory proteins in metabolic
homeostasis, such long-chain acyl-CoA dehydrogenase (LCAD, being involved in
fatty acid oxidation), 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2, reg-
ulates the production of ketone bodies), IDH2 (TCA cycle), glutamate dehydroge-
nase (GDH, also TCA cycle) and superoxide dismutase 2 (SOD2, a key mitochondrial
anti-oxidant enzyme) (Fig. 6.5). Interestingly, SIRT4 ADP-ribosylates GDH,
thereby inhibiting its activity and blocking amino acid-induced insulin secretion,
i.e. SIRT4 counteracts the activity of SIRT3.
LXR is a key transcription factor controlling the expression of genes involved in
lipid synthesis, partly via the induction of the gene SREBF1. SIRT1 deacetylates
and increases the activity of both LXR and SREBF1 targeting lipid metabolism,
while SIRT6 serves as a negative regulator of triacylglycerol synthesis (Fig. 6.6).
SIRT1 inhibits adipogenesis and enhances fat mobilization through lipolysis by
suppressing PPARG expression via complex formation with the co-repressor pro-
teins NCOR1 and NCOR2. The activities of SIRT3, SIRT4 and SIRT6 in the regula-
tion of fatty acid oxidation in the liver resemble those of glucose metabolism
(compare Figs. 6.5 and 6.6).
In a simplified view, the deacetylase activity of sirtuins counterbalances nutrient-
driven protein acetylation. During fasting and/or exercise, the sirtuin co-factor
NAD+ levels rise in muscle, liver and WAT, while high-fat diet reduces the NAD+/
NADH ratio. Pharmacological targeting of sirtuins, in particular of SIRT1, is prom-
ising for the treatment of T2D. The search for further natural or synthetic sirtuin
activators led to the identification of several compounds, of which resveratrol, a
polyphenol found in red grapes and berries (Sect. 5.1), received most attention.
Resveratrol improves mitochondrial activity and metabolic control in humans, i.e. it
may also increase the health span of humans. The most prominent synthetic sirtuin
activator is SRT1720, which protects against diet-induced obesity by improving
mitochondrial function. However, both resveratrol and SRT1720 seem to not acti-
vate sirtuins directly, but at least resveratrol acts via AMPK (Sect. 6.5).
6.4 Properties and Functions of Sirtuins 115
Glucose
GLUT2 Cytoplasm
PPARGC1A
SIRT1 PPARGC1A targets
CREB
3’ SIRT1 CRTC2 targets
5’ CREB
RNA Pol II
FOXO1
Gluconeogenesis Glycolysis 3’
5’
PPARGC1A targets
SIRT1 FOXO1 3’ Nucleus
5’
RNA Pol II
Phosphoenolpyruvate
Nucleus
Pyruvate
SIRT2 PEPCK
Pyruvate
Oxaloacetate NAD + Mitochondrion
NADH
Acetyl-CoA
Malate
Oxaloacetate Citrate
NADH SIRT3
NAD +
Malate Isocitrate
SIRT4
SIRT1 UCP2 NAD +
3’ IDH2
5’ NADH
Nucleus
ROS GDH
Fumarate α-Ketoglutarate Glutamate
Insulin FADH2
secretion FAD NAD +
SOD2
Succinate NADH
Succinyl-CoA
Mitochondrial SIRT3 UCP2 SIRT1
CoA-SH GDP (ADP)
biogenesis GTP (ATP)
HIF1α SIRT3
SIRT6
targets SDH ADP+Pi ATP
NADH NAD +
SIRT1 HIF1α 3’
5’
RNA Pol II
II
Nucleus I III IV V
+ + + +
H H H H
Fig. 6.5 Sirtuins and pathways involved in glucose metabolism. SIRT1 controls gluconeogen-
esis by deacetylating and activating the co-activator PPARGC1A and the transcription factor
FOXO1. Furthermore, SIRT1 inhibits glycolysis, but activates lipid utilization and mitochondrial
biogenesis. Moreover, it increases insulin secretion by suppressing uncoupling protein (UCP) 2 in
the pancreas. Glucose taken up by the cell via GLUT is catabolized into pyruvate (glycolysis),
which enters the TCA cycle in mitochondria, in order to generate energy. In cases of limited energy
supplies, gluconeogenesis increases by the conversion of pyruvate to oxaloacetate and malate.
Malate is shuttled into the cytoplasm and there converted back to oxaloacetate. The latter is used
by PCK2 to produce phosphoenolpyruvate that is converted to glucose. SIRT1 also increases insu-
lin secretion by repressing UCP2 gene expression. SIRT2 activates gluconeogenesis by increasing
the stability of PCK2. SIRT3 decreases ROS production by stimulating SOD2. Moreover, SIRT3
enhances oxidative phosphorylation by increasing the activities of complex I, complex II (via
SDH), complex III and IDH2. By modulating the activity of GDH SIRT3 and SIRT4 both also
regulate gluconeogenesis and insulin secretion through deacetylation and ADP-ribosylation,
respectively
116 6 Nutritional Signaling and Aging
Cytoplasm Transporter
Lipolysis Nucleus SREBF1
PPARα targets
targets SIRT1 SREBF1 3’
SIRT1 PPARα 3’ 5’
5’
Triacylglycerol
RNA Pol II
SIRT1 PPARGC1A
PPARGC1A SIRT1,6
targets
3’
Fatty acid Fatty acids
5’ NCOR1
RNA Pol II oxidation Fatty acids SIRT1 PPARγ
CRTC2
Nucleus targets
FAS PPARγ 3’
5’
SIRT4 Nucleus
Malonyl-CoA
Pyruvate
NAD + Acetyl-CoA
Ketogenesis SIRT3
Citrate
Ketone Oxaloacetate
bodies
NADH
NAD +
Malate Isocitrate
NAD +
IDH2 SIRT3
NADH
HMGCS2
Fumarate α-Ketoglutarate
FADH2
FAD NAD +
II
I III IV V
+ + + +
H H H H
Fig. 6.6 Sirtuins control lipid metabolism. SIRT1 inhibits lipid synthesis by deacetylating
SREBF1 through suppressing the activity of PPARγ. SIRT1 also promotes fatty acid oxidation by
increasing PPARA and PPARGC1A gene expression. In mitochondria, fatty acids are oxidized, in
order to produce ATP. Via the action of HMGCS2 this fatty acid breakdown can lead to the produc-
tion of ketone bodies. Fatty acids can be synthesized in the cytosol from malonyl-CoA by FASN
and then converted to triacylglycerols. In adipose tissue during periods of high-energy demand,
triacylglycerols can be broken down by lipolysis into FFAs that are released into circulation.
Moreover, SIRT1 decreases fatty acid storage by increasing lipolysis via inhibiting PPARγ and
decreasing fatty acid synthesis via SREBF1. In addition, SIRT6 acts as a repressor of genes
involved in fatty acid synthesis. SIRT3 increases β-oxidation and the formation of ketone bodies
via LCAD and HMGCS2, decreases ROS production by stimulating SOD2 and enhances cellular
respiration by increasing the activities of complex I, complex II, complex III and IDH2, respec-
tively. SIRT4 dampens the expression of genes involved in fatty acid oxidation
6.5 Cellular Energy Status Sensing by AMPK 117
α-Kinase domain
ATP
ADP Subunit
α α
α
β β Subunit β
ATP 2 ATP
1 2 1 2
γ γ
AMP ATP ATP
AMP ADP
Subunit γ
4 3
Protein ADP
LKB1
phosphatase Phosphorylation and CAMKK2
dephosphorylation
P P P
ATP ATP
activation
Nucleotide
ATP
ADP
AMP
ADP/ATP concentration
Fig. 6.7 Model of the mechanism for AMPK activation. Increasing cellular concentrations of
AMP and ADP activate AMPK. In the basal state ATP binds to sites 1 and 3 of the γ-subunit of
AMPK, while AMP always occupies site 4. When during moderate stress ATP is replaced by ADP
or AMP at site 3 the phosphorylation of T172 is stimulated, which causes a 100-fold increase in
the respective activity. During more severe stress ATP is replaced by AMP at site 1 and thus causes
a further tenfold activation. When the cellular energy status returns to normal, AMP at site 1 and
either ADP or AMP at site 3 are progressively replaced by ATP. This stimulates the dephosphoryla-
tion of T172 and a return to the basal state. Changes in the predicted concentrations of ATP, ADP
and AMP are displayed. They go from an unstressed, fully charged cell to a cell undergoing a
severe energy stress corresponding to a tenfold decrease in the ATP/ADP ratio. In contrast, the
AMP concentration in a fully charged cell is very low, but when ADP/ATP increases its percentage
change in concentration is significantly larger than those of ATP or ADP
118 6 Nutritional Signaling and Aging
Mitochondrial biogenesis
and autophagy
+
+ +
Mitochondrial
biogenesis Autophagy
(mitophagy) Fatty acid uptake Lipid
CD36
+ metabolism
+ Glucose uptake
Fatty acid synthesis
GLUT1 PPARGC1A
+ SIRT1 ULK1/2 ?
Glycolysis
PFKL ? ACC1 Fatty acid oxidation -
PFKFB3/4 ACC2
Gluconeogenic
+ enzymes CRTC2, HDACs AMPK SREBF1 Lipogenic enzymes +
(transcription)
(transcription)
GYS1/2 GPAT?
Fig. 6.8 Consequences of AMPK activation. This scheme displays the metabolic effects of
AMPK activation. Proteins shown with question marks may not be directly phosphorylated by
AMPK. CRTC2, CREB-regulated transcription co-activator 2; GPAT, glycerol phosphate acyl
transferase; RAPTOR, regulatory associated protein of mTOR; TBC1D, TBC1 domain; TIFIA,
transcription initiation factor IA; TSC2, tuberous sclerosis 2
Future View
In future, aging may be delayed and age-related diseases may be prevented by
reprogramming gene expression of major nutrition signaling pathways. However,
more important than extending the lifespan will be a diet-triggered prolongation of
the healthy lifespan. Although diet shows convincing heath benefits, it may not be
the ideal approach for humans. In future, alternating fasting-feeding regimes and
natural or synthetic sirtuin activators may be used for the treatment and prevention
of human diseases.
Key Concepts
• In case of food availability, activated nutrient-sensing pathways stimulate a
diverse set of activities, including reproduction, but this is compromised by a
limited lifespan.
120 6 Nutritional Signaling and Aging
Additional Reading
Fontana L, Partridge L, Longo VD (2010) Extending healthy lifespan – from yeast to humans.
Science 328:321–326
Hardie DG, Ross FA, Hawley SA (2012) AMPK: a nutrient and energy sensor that maintains
energy homeostasis. Nat Rev Mol Cell Biol 13:251–262
Houtkooper RH, Pirinen E, Auwerx J (2012) Sirtuins as regulators of metabolism and healthspan.
Nat Rev Mol Cell Biol 13:225–238
Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013) The hallmarks of aging.
Cell 153:1194–1217
Chapter 7
Chronic Inflammation and Metabolic Stress
Abstract Macrophages are associated with various tissues and either derive from
monocytes circulating in the blood or from self-renewing embryonal cell popula-
tions. They show a large variety of stimulus- and tissue-specific functions, of which
the extremes are pro-inflammatory M1-type and anti-inflammatory M2-type macro-
phages. M1 macrophages are key cells in the initiation of the acute inflammatory
response, while M2 macrophages are resolving inflammation and coordinate tissue
repair. However, tissue inflammation is not only caused by bacterial infection or
tissue injury but may also derive from changes in the concentration of nutrients and
metabolites. In this case, the immune system cannot cope the primary stimulus, so
that chronic inflammation develops. This metabolic stress, in contrast to infectious
or traumatic stress, is often caused by lipid overload in the blood and in adipose tis-
sue. This again is a hallmark of age-related metabolic diseases, such as obesity,
insulin resistance and atherosclerosis. For example, hypercholesterolemia (Sect.
11.3) causes stress to macrophages and their associated cells. Moreover, perturba-
tions of the homeostasis of nutrient metabolism dys-regulate functions of the liver.
In this chapter, we will present monocytes and macrophages as the key players
in acute and chronic inflammation. We will provide molecular and cellular details of
examples of metabolic stress, such as disturbance of reverse cholesterol transport
and ER stress. In this context, we will discuss macrophages as important therapeutic
targets.
Fetal liver
M-CFU
M-CFU Osteoclast
Adult MDP
bone
marrow
Pro-DC
Pro-monocyte CDP
Adult
peripherial Pro-DC
blood
Monocyte Monocyte
Lymphoid
DC
Adult
tissue
Resident tissue Monocyte-
Microglial cell Tumor-associated Inflammatory
macrophage: liver,
Langerhans cell macrophage macrophage derived DC
lung, intestine
Fig. 7.1 Differentiation of monocytes. M-CFUs in the bone marrow are the precursors to mac-
rophages and dendritic cell progenitors (MDPs). In the bone marrow, MDPs differentiate to com-
mon dendritic cell progenitors (CDPs) or to pro-monocyte precursors. Langerhans cells in the skin,
microglial cells in the brain and a number of other tissue-resident macrophages initially develop
during embryogenesis from M-CFUs in the yolk sac or fetal liver. The remaining tissue macro-
phages get polarized, depending on the inflammatory milieu, into M1 or M2 macrophages
(Fig. 7.2). Monocytes are also the precursors to monocyte-derived dendritic cells
differentiation, monocytes are released into the blood stream and migrate within
1–3 days through the endothelium of blood vessels into tissues. This extravasation
is stimulated by the cytokine- and chemokine-induced expression of adhesion mol-
ecules, such as selectins, on the surface of endothelial cells. In tissues, monocytes
differentiate into macrophages or dendritic cells, i.e. into the central cellular com-
ponents of the innate immune system (Box 2.2). Thus, the primary role of mono-
cytes is to refill the pool of tissue-resident macrophages and dendritic cells in steady
state and in response to inflammation.
Tissue-resident macrophages have a wide variety of homeostatic and immune
surveillance functions ranging from the clearance of cellular debris, the response to
infection and the resolution of inflammation. A substantial proportion of these mac-
rophages is self-renewing and derives during embryogenesis from the yolk sac and
the fetal liver. Populations of tissue-resident macrophages are found in most tissues
of the human body, such as Kupffer cells in the liver, microglia in the CNS, osteo-
clasts in the bone and alveolar macrophages in the lung. Transcriptional profiling
indicates that the same tissue often contains several phenotypically distinct
macrophage subsets that have tissue-specific functions. Nevertheless, the unifying
role of all tissue-resident macrophages is that they are in the frontline of the immune
7.1 The Central Role of Monocytes and Macrophages 123
IL13/IL4
TGFB
ROS, NO IL1, IL12, IL23 IL10 Proline polyamines,
Iysosomal enymes chemokines TGFB TGFB
Fig. 7.2 Classical and alternative macrophage activation. Different stimuli activate mono-
cytes/macrophages to develop into functionally distinct populations. Classically activated macro-
phages (M1-type) are induced by cytokines and microbial products, particularly IFNγ, and are
microbicidal as well as involved in potentially harmful inflammation. Alternatively activated mac-
rophages (M2-type) are induced by IL4 and IL13 produced by TH2 cells and are important in tis-
sue/wound repair and fibrosis
124 7 Chronic Inflammation and Metabolic Stress
Acute inflammatory responses to insults, such as injury and infection, are critical
for organism’s health and recovery. Infection or tissue damage is initially sensed by
PRRs, such as TLRs, NLRs, retinoic acid-inducible gene 1 (RIG1)-like helicase
receptors (RLRs), lectins and scavenger receptors, that bind to PAMPs and DAMPs
Box 7.2 The Inflammasome
Inflammasomes belong to the key components of the intracellular surveil-
lance system. The inflammasome is a large protein complex composed of
NLRPs, the adaptor protein apoptosis-associated speck (ASC) and the pro-
inflammatory caspase (CASP) 1 and CASP5 that is formed in response to the
rise of the levels of a number of pathogen-associated molecular patterns
(PAMPs) and damage-associated molecular patterns (DAMPs) (Fig. 7.3).
Inflammasome activation requires a priming signal from PPRs, such as TLR4,
and a second signal involving potassium ion efflux, lysosomal damage or
ROS generation. Cholesterol crystals in lysosomes can provide this second
signal, either as a result of phagocytosis of extracellular cholesterol crystals or
via uptake of modified LDLs and free cholesterol released from LDLs.
Inflammasome activation leads to the secretion of the pro-inflammatory cyto-
kines IL1B and IL18. NLRP3 is the most prominent NRLP.
SELF-DERIVED Bacteria
d
Amyloid-β rive Virus
ATP e n - de Fungi
s
hog tor
Glucose Pat activa Protozoa
Hyaluronan
MSU crystals Steril NLR
Cholesterol crystals activ e
ators
ENVIRONMENTALLY PYD NACHT
DERIVED Caspase-1
Alum
Asbestos CARD p20/p10
Silica
UV radiation ASC
CARD PYD
IL1B
Host inhibitors IL18 Pathogen inhibitors
Pyroptosis
Resolution of infection
and/or inflammation
Chronic inflammation
Homeostasis
Fig. 7.3 Central role of the inflammasome. During acute or chronic inflammation, inflam-
masomes are directly or indirectly activated by a wide array of DAMPs. The initial event leads
to the activation of CASP1, the release of IL1B and IL18 as well as sometimes to pyroptosis,
which is a form of apoptosis associated with anti-microbial responses during inflammation.
The release of IL1B and IL18 induces the recruitment of effector cell populations of the
immune response and tissue repair, i.e. the activation of inflammasomes results in the resolu-
tion of infection or inflammation and contributes to homeostatic processes. However, constant
activation of the inflammasome can lead to chronic inflammatory diseases. Pathogen-derived
inhibitors can block inflammasome activation and thus the resolution of infection, while host-
derived inflammasome inhibitors will prevent chronic inflammation
126 7 Chronic Inflammation and Metabolic Stress
PAMP
Normal tissue
Macrophage/lymphocyte recruitment
Infection
Persistant stimulus
Primary
pathophysiology
DAMP
Macrophage/lymphocyte recruitment
Chronic
infammatory
disease
Normal tissue
Amplification of
inflammatory responses
Tissue damage
Fig. 7.4 Acute and chronic inflammation. (a). Acute inflammatory response to infection is initi-
ated by the presentation of PAMPs to PRRs. Eradication of the pathogen eliminates the stimulus but
may cause some collateral but reversible tissue damage. The resolution/repair phase leads then to
7.2 Acute and Chronic Inflammation 127
(Fig. 7.4a). A tissue-specific use of these receptors implicates that distinct macro-
phage subsets are involved in the activation of the immune response to microbes.
However, basically in all cases PAMP- or DAMP-activated PRRs start a signal
transduction cascade that ends in the activation of inflammation-associated tran-
scription factors, such as NF-κB and AP-1. Major targets of these transcription fac-
tors are genes encoding for pro-inflammatory cytokines, such as TNF and IL1B,
anti-microbial factors, such as inducible nitric oxide synthase 2 (NOS2), and cell-
recruiting chemokines, such as CCL2 and CCL5. Another important component of
the DAMP sensing system is the inflammasome (Box 7.2) that enhances IL1B pro-
duction and secretion. After initial recognition of the microbial challenge, resident
macrophages stimulate the influx of cells from the blood, such as neutrophils and
monocytes as a source of inflammatory macrophages (Sect. 7.1).
Most inflammatory lesions are initially dominated by monocyte-derived macro-
phages. The changed expression profile of these macrophages activates further cells
of the innate immune system as well as the adaptive immune system. This implies
that the early inflammatory response comprises a number of redundant components
and is further amplified in cytokine-mediated feed-forward loops. Under resting
conditions most tissues contain only a few resident macrophages, while at acute
inflammation the number of immune cells drastically increases and the characteris-
tics of these cells changes, respectively. For example, adipose tissue of lean persons
contains deactivated macrophages, eosinophils and TREG cells, while within the ini-
tial phase of the acute inflammation there is rapid invasion of neutrophils that is
followed by the recruitment of monocyte-derived macrophages, T cells and stromal
cells (Sect. 8.6).
The combined action of innate and adaptive immune cells eradicates the infec-
tious microbes but also results in collateral tissue damage, such as cytotoxicity due
to ROS production and the degradation of extracellular matrix via proteases. After
the clearance of pathogens and the removal of apoptotic neutrophils by phagocytes,
there is recruitment or phenotypic switching of macrophages into the M2-type, i.e.
into a pro-resolving phenotype. This results in an overall repair and normalization
of the tissue architecture and function, including the re-establishment of the vascu-
larization. Most of these processes are activated by metabolites, such as prostaglan-
din E2 (PGE2) and ω-3 fatty acids. These metabolites function as signaling
molecules binding to membrane proteins, such as GPR120, or directly activate
nuclear receptors and initiate intracellular pathways leading to an anti-inflammatory
response. This also involves anti-inflammatory cytokines, such as IL10 and TGFB1,
and small lipid mediators, such as lipoxins, resolvins, protectins and maresins that
Fig. 7.4 (continued) the restoration of normal tissue homeostasis. (b). Chronic inflammation is
caused by non-immune pathophysiological processes that trigger an initial sterile inflammatory
response involving DAMPs and is amplified by cytokines and chemokines. However, this response
does not eliminate the initial stimulus, so that non-resolving inflammation persists and results in
continuous tissue damage
128 7 Chronic Inflammation and Metabolic Stress
ABCA1
Bile acids 20% ABCG1
MACROPHAGE
APOAI
ABCA1
APOA1 production secretion ABCA1 on hepatocytes
ABCG5 and enterocytes Cholesterol
ABCG8 APOAI efflux
Pre-β
HDL
75% ABCG1
Cholesterol
ABCG5 and ABCG8
Cholesterol excretion
HDL content LDL uptake
SCARB1 Serum amyloid A LCAT Foam cell formation
Cholesterol HDL
Oxidized phospholipids MPO production
HDL LCAT APOA1 oxidation
and inactivation
CETP
Inflammation
LPL
LPLC
oxidized LDL
VLDL production VLDL Clearance of VLDL LDL
LDL aggregate
LPL activity
LIVER Modified LDL
Fig. 7.5 Reverse cholesterol transport and the effect of inflammation. After secretion of
APOA1 from the liver and the intestines, this protein interacts with ABCA1 on hepatocytes and
enterocytes and is assembled into pre-βHDLs. In macrophages, these lipoproteins are loaded via
the action of ABCA1 and ABCG1 with cholesterol and phospholipids and form HDLs. LCAT
catalyzes the esterification of free cholesterol in HDLs. In the liver, SCARB1 removes some of the
free cholesterol or cholesteryl esters from HDLs. In the liver, cholesterol is then either recycled
into VLDLs via the action of CETP or is transformed into bile acids that are excreted by the trans-
porters ABCG5 and ABCG8. VLDLs undergo a lipolytic cascade mediated by the enzymes LPL
and hepatic lipase and are transformed into cholesterol-rich LDLs. A small proportion of the LDLs
end up in the arterial wall, where they are modified by oxidation or aggregation and are taken up
by macrophages. This leads to the formation of macrophage foam cells (Sect. 11.2), the production
of myeloperoxidase (MPO) and inflammation. Red boxes indicated how inflammation negatively
affects this reverse cholesterol transport
triacylglycerols of VLDLs, so that primarily cholesteryl esters remain and the lipo-
proteins transform into LDLs.
Increased LDL-cholesterol levels in the circulation are the principal drivers of
atherosclerosis, since this causes cholesterol accumulation and inflammatory
response in the artery wall (Fig. 7.5). Under healthy conditions, HDLs can oppose
this process and are able to reduce inflammation by promoting the cholesterol efflux
from foam cells. However, acute inflammation impairs reverse cholesterol transport
at two central steps. On one hand it down-regulates the expression of ABCA1 and
ABCG1 in macrophages, which reduces cholesterol efflux from macrophages, and
on the other hand it decreases the hepatic expression of the genes APOA1, CETP,
ABCG5, ABCG8 and CYP7A1, which results in the reduced excretion of choles-
terol. Moreover, acute inflammation causes the accumulation of triacylglycerols
130 7 Chronic Inflammation and Metabolic Stress
the innate immune system can use changes in cholesterol metabolism, in order to
amplify the inflammatory response, but also for restoring homeostasis.
Metabolic organs, such as the liver, pancreas and adipose tissue, are formed by
parenchymal cells and stromal cells, including macrophages. In healthy state, these
cell types work together, in order to maintain metabolic homeostasis. Also in dis-
ease these tissues try to interact, in order to adapt to altered conditions, such as
increased nutritional needs of the affected organs. For example, during microbe
infection, activated immune cells have an increased consumption of glucose,
because they preferentially use the anaerobic but energetically inefficient glycolysis
for ATP production. Therefore, these cells are supported best when the cytokines
TNF, IL6 and IL1B are produced through the inflammatory response of macro-
phages and thus induce a timely restricted peripheral insulin resistance (Sect. 9.4),
in order to decrease glucose storage. In fact, many diseases with active inflamma-
tory responses, such as hepatitis C, HIV and rheumatoid arthritis, can lead to insulin
resistance. Of note, the initiation and maintenance of immunity is energy consum-
ing. For example, fever leads to a 7–13 % increase of energy consumption for every
1 °C of body temperature elevation, and sepsis can increase the human metabolic
rate even by even 30–60 %.
Stromal cells, such as macrophages, support adipocytes in WAT in their main
metabolic function, the long-term storage of lipids. The number and activation state
of macrophage both reflect the metabolic health of WAT. In lean persons, only
10–15 % of the stromal cells are macrophages and most of them are of M2-type
(Fig. 7.6). These M2-type macrophages secrete IL10 that potentiates insulin action
in adipocytes, i.e. it maintains or even increases the insulin sensitivity of these cells.
During the development of obesity, at least in mice WAT recruits monocytes that
differentiate into M1-type macrophages and finally can comprise up to 60 % of all
stromal cells in the tissue. These M1-type macrophages are a major driver of insulin
resistance in WAT, but they are also involved in the remodeling of the enlarging
adipocytes. Taken together, the two types of macrophages coordinate homeostatic
adaptations of adipocytes in the lean and the obese state.
The TH2-type cytokines IL4 and IL13 that are secreted primarily by eosinophils
within WAT are essential to polarize macrophages into the M2-type (Fig. 7.6). The
transcriptome profile of these macrophages is controlled by the nuclear receptors
PPARδ and PPARγ and the Krüppel-like transcription factor (KLF) 4. Although
adipocytes in lean persons can easily accommodate acute changes in food intake, a
chronic overload with nutrients causes metabolic stress. As a result, the enlarging
WAT releases chemokines, such as CCL2, CCL5 and CCL8, in order to recruit
monocytes. These monocytes differentiate into macrophages that phagocytize dead
adipocytes. The resulting lipid overload of the macrophages initiates, via the tran-
scription factors IRF3 and NF-κB, the expression of pro-inflammatory cytokines,
132 7 Chronic Inflammation and Metabolic Stress
Insulin
Insulin Monocyte
sensitivity
sensitivity
IL4
IL10
IL13
TNF
Apoptotic
IL6 M1 pro-inflammatory
Adiponectin and M2 anti-inflammatory fat cells
IL1B activation
ω-3 fatty acids block activation
inflammatory pathways
Inflammatory factors
released
M2-activated
macrophage M1-activated
macrophage
such as TNF and IL6. Although the cytokine expression in obese tissues is signifi-
cant, it is often rather modest and local in comparison to the acute inflammatory
response after an infection or trauma.
Nevertheless, the long-term exposure of adipocytes with pro-inflammatory cyto-
kines from M1-type macrophages can induce insulin resistance of WAT (Sect. 9.4).
Like in acute microbe infection, this reduced insulin sensitivity initially tries to
react to the increased levels of nutrients by limiting their storage. However, the
strategy of inducing insulin resistance becomes maladaptive in case of a constant,
long-term nutrient overload. Taken together, the hallmarks of obesity-induced
inflammation, sometimes also referred as “metaflammation”, are that it (i) is a
nutrient-induced inflammatory response orchestrated by WAT-associated macro-
phages, (ii) changes the polarization of these macrophages from M2 to M1 pheno-
type, (iii) represents a moderate/low-grade and local expression of inflammatory
cytokines and (iv) is chronic without apparent resolution.
In other metabolic organs, polarized macrophages play a comparable role. In the
primary thermogenic organ, the BAT, resident macrophages differentiate into
M2-type after exposure to cold temperatures. These M2 macrophages induce ther-
mogenic genes in BAT and lipolysis of stored triacylglycerols in WAT via the secre-
tion of the catecholamine noradrenaline. Kupffer cells, the resident macrophages of
7.5 ER Stress Response 133
The ER is an organelle that has a vital role in maintaining cellular and whole body
metabolic homeostasis. Although the ER has significant adaptive capacity to man-
age the periodic cycles associated with feeding, fasting and other metabolic demands
of limited duration, it is less flexible to respond appropriately to chronic and escalat-
ing metabolic challenges. Therefore, ER dysfunction of cells of metabolic tissues,
such as liver, pancreas, WAT and muscle, is a key contributor to metabolic disinte-
gration and chronic inflammation (Sects. 8.6 and 9.5). For example, hepatocytes
and adipocytes of obese humans show increased ER stress compared with lean con-
trols. Moreover, multiple cardiovascular disease risk factors, such as inflammation,
dyslipidemia, hyper-homocysteinemia and insulin resistance, can lead to the devel-
opment of ER stress in atherosclerotic lesions.
The ER is the primary site of the 3-dimensional folding of all membrane proteins
and secreted proteins that are produced in the cell and also performs their quality
control. An accumulation of unfolded proteins in the ER as well as other challenges
of ER functions, such as hypoxia (i.e. oxygen supply deprivation), infections, tox-
ins, nutrient overload or energy deprivation, can trigger an adaptive, protective
mechanism, the so-called unfolded protein response (Fig. 7.7a).
On the molecular level the ER stress response is primarily mediated by the pro-
teins eukaryotic translation initiation factor 2-alpha kinase 3 (EIF2AK3), endoplas-
mic reticulum to nucleus signaling 1 (ERN1) and activating transcription factor 6
(ATF6). In the absence of a stress signal, these three transmembrane proteins are
bound by the chaperone HSPA5 and are kept inactive. An increased protein load, in
particular improperly folded proteins, activates EIF2AK3 and ERN1, i.e. they
dissociate from HSPA5 and initiate signal transduction cascades. EIF2AK3 phos-
phorylates eukaryotic translation initiation factor 2A (EIF2A) and suppresses gen-
eral protein translation. ERN1 interacts with TNF receptor-associated factor 2
(TRAF2) and activates the kinases inhibitor of kappa light polypeptide gene
enhancer in B cells (IKBK) and mitogen-activated protein kinase 8 (MAPK8, also
called JNK). This activates the transcription factors NF-κB and AP-1 and increases
the expression of inflammatory cytokines. In metabolic tissues, such as WAT and
134 7 Chronic Inflammation and Metabolic Stress
Free CYTOPLASM
cholesterol
AKT mTOR
Unfolded-protein
Stressed ER
response
GOLGI EIF2AK3
Protein synthesis
ERN1
ATF6
Fatty acids ER
EIF2AK3
CREB3L3
P
Altered metabolic Inflammatory IKBK XBP1 MAPK8
P
response response IRS1
P
IκB AP-1
CYTOPLASM NF-κB
ATF6f Altered metabolic
response
Inflammatory
ATF6f NF-κB XBP1 AP-1 response
NUCLEUS
Fig. 7.7 The unfolded protein response and inflammation. (a) The ER responds to multiple
nutrient-associated signals, such as those induced by fatty acids, glucose, free cholesterol, insulin
and amino acids. ER stress due to nutrient overload induces the unfolded protein response, which
activates inflammatory signaling pathways that result in altered metabolic and inflammatory
responses. (b) The three ER transmembrane proteins EIF2AK3, ERN1 and ATF6 are the molecu-
lar mediators of the unfolded protein response. Via the phosphorylation of the kinases IKBK and
MAPK8 (also called JNK) ERN1 activates the transcription factors NF-κB and AP-1 leading to an
increase in the expression of inflammatory genes. This response is further enhanced by (i) translo-
cation of ATF6 to the Golgi and processing there to an active transcription factor, (ii) up-regulation
of the expression of the transcription factor XBP1 and (iii) the transcription factor CREB3L3.
MAPK8 also phosphorylates IRS1 resulting in an altered metabolic response. A functional and
molecular integration between the different organelles can mediate the spread of the stress
liver, the activation of MAPK8 also leads via serine phosphorylation of IRS1 to
defective insulin actions, such as insulin resistance (Sect. 9.4).
Moreover, ERN1 has also endoribonuclease activity and cleaves, for example,
the mRNA of the transcription factor X-box binding protein 1 (XBP1), which
results in the translation of an activated form of XBP1 responsible for up-regula-
tion of many chaperone genes. Furthermore, ATF6 translocates from the ER to the
Golgi apparatus, where it is processed by proteases to an active transcription fac-
tor. Finally, ER stress also leads to the cleavage and activation of the transcription
factor cAMP responsive element binding protein 3-like 3 (CREB3L3), which
induces, particularly in the liver, the production of the acute-phase protein
CRP. The goal of activating the three arms of the unfolded protein response is to
restore ER homeostasis by (i) reducing general protein synthesis, (ii) facilitating
protein degradation and (iii) increasing the protein folding capacity (Fig. 7.7b).
The lipophilic environment of the large ER membrane is provided with impor-
tant functions in the metabolism of lipids, in particular of phospholipids and choles-
7.5 ER Stress Response 135
Key Concepts
• The primary role of monocytes is to refill the pool of tissue-resident macro-
phages and dendritic cells in steady state and in response to inflammation.
• Acute inflammation is caused by an infection or an injury and resolves within a
few days to weeks, while chronic inflammation lasts over months or years and
origins from a stimulus that cannot be resolved.
136 7 Chronic Inflammation and Metabolic Stress
Additional Reading
Fu S, Watkins SM, Hotamisligil GS (2012) The role of endoplasmic reticulum in hepatic lipid
homeostasis and stress signaling. Cell Metab 15:623–634
Lawrence T, Natoli G (2011) Transcriptional regulation of macrophage polarization: enabling
diversity with identity. Nat Rev Immunol 11:750–761
Tabas I, Glass CK (2013) Anti-inflammatory therapy in chronic disease: challenges and opportuni-
ties. Science 339:166–172
Tall AR, Yvan-Charvet L (2015) Cholesterol, inflammation and innate immunity. Nat Rev Immunol
15:104–116
Wynn TA, Chawla A, Pollard JW (2013) Macrophage biology in development, homeostasis and
disease. Nature 496:445–455
Part III
Links to Diseases
Chapter 8
Obesity
Keywords BMI • Visceral fat • Sub-cutaneous fat • White, beige and brown adipo-
cytes • Adipogenesis • Chronic inflammation • M1 and M2 macrophages •
Adipokines • Leptin • Hindbrain • Hypothalamus • MC4R • FTO
No other tissue of the human body can change its dimension as dramatically as the
adipose tissue. This is accomplished first by increasing the size of individual cells
up to a critical threshold (hypertrophy) and then increasing the number by recruiting
new adipocytes from the resident pool of progenitors (hyperplasia). The WHO
defines overweight and obesity as “abnormal or excessive fat accumulation that may
impair health”. Obesity is the consequence of excess WAT accumulation and devel-
ops when energy intake exceeds energy expenditure. The most commonly used
measure of obesity is the BMI (Sect. 1.2). A person is defined as normal weight if
his/her BMI is 18.5–24.9 kg/m2, overweight if the BMI is 25–29.9 or obese if the
BMI is 30 or above (Fig. 8.1a). Individuals with adult-onset of obesity mostly
a Pear-shaped Apple-shaped
LOW WHR HIGH WHR
LESS visceral fat MORE visceral fat
LOWER risk of weight- HIGHER risk of weight-
related health problems related health problems
Above the
waist
Bellow the
waist
Fig. 8.1 Fat distribution influences obesity associated risks in humans. (a). Obesity is defined
by a BMI of ≥ 30 and in general is a consequence of fat accumulation. The respective fat distribution
in the body can also be measured using anthropometric measures, such as waist circumference
or waist-to-hip ratio (WHR). Obese subjects with a low WHR, characterized as “pear-shaped”
obesity with predominantly increased sub-cutaneous fat, have a low risk of diabetes and metabolic
syndrome. In contrast, obese subjects with a high WHR, characterized as “apple-shaped” obesity
with increased visceral fat, have a high risk of for these diseases. (b). In humans, WAT is found in
all areas of the body. The sub-cutaneous and the intra-abdominal depots are the main fat storage
compartments. BAT is abundant at birth and is still present in adults, but to a lesser extent
8.1 Definition of Obesity 143
b Cranial S
WAT
Retro-orbital
Cervical Facial S
Supra-clavicular
Bone marrow
Paraventrical Periarticular region
Intra-muscular
Pericardial
OmentalI I
BAT Visceral I
Abdominal S
Retro-peritoneal I
Gluteal S
S Sub-cutaneous
Inter-scapular
I intra-abdominal
Newborn Adult
exhibit increased adipocyte size, whereas persons with early-onset obesity show
both adipocyte hypertrophy and hyperplasia.
The location of WAT in the body also plays an important role for the risk to
develop the metabolic syndrome (Chap. 12). High amount of visceral fat (i.e. intra-
abdominal fat), referred to as central or “apple-shaped” obesity, increases the risk,
while rise in sub-cutaneous fat, referred to as peripheral or “pear-shaped” obesity,
exerts far less risk. Obesity is rare to occur in the wild life, but there are examples
of animals living in harsh climates, such as polar bears and seals, that are obese.
This indicates that a high degree of natural adiposity can even contribute to evolu-
tionary fitness. However, obesity found in modern humans is mostly accompanied
by inflammation (Sect. 8.6) and consecutively often by the different features of the
metabolic syndrome (Chap. 12). In fact, most of the world’s population today lives
in countries where individuals are more likely to die from the consequences of
being obese than starving (Box 8.1). Of note, human obesity does not always result
in disease suggesting that the threshold for tolerable BMI differs among individuals
and may be determined by environmental and genetic variables (Sect. 8.7).
144 8 Obesity
40
20
30
20
10
10
0 0
4
9
15 4
20 9
25 4
30 9
35 4
40 9
45 4
50 9
55 4
60 9
65 4
70 9
75 4
9
0
4
9
15 4
20 9
25 4
30 9
35 4
40 9
45 4
50 9
55 4
60 9
65 4
70 9
75 4
9
0
–7
–7
2–
5–
–1
–1
–2
–2
–3
–3
–4
–4
–5
–5
–6
–6
–7
≥8
2–
5–
–1
–1
–2
–2
–3
–3
–4
–4
–5
–5
–6
–6
–7
≥8
10
10
Fig. 8.2 Age pattern of overweight and obesity in 2013. Worldwide prevalence of over-
weight and obesity (a) and obesity alone (b) is shown by age and sex in developed and
developing countries (data collected from 188 countries by Ng et al. Lancet 384,
766–781)
8.2 Adipogenesis 145
8.2 Adipogenesis
Mesenchymal stem cells are the precursors to fat, bone and muscle cells. Growth
factors of the bone morphogenetic protein (BMP) and FGF families are central in
the first phase of the development of adipocytes. In this commitment phase, the
multi-potent mesenchymal stem cells differentiate to WAT and BAT precursors.
Both brown adipocytes and myocytes derive from paraxial mesoderm-derived pro-
genitor cells that express the transcription factors myogenic factor 5 (MYF5) and
paired box (PAX) 7 (Fig. 8.3). However, in adults brown adipocytes can also develop
from skeletal muscle satellite cells. White adipocytes derive from both MYF5− and
MYF5+ progenitors. Beige adipocytes either differentiate from WAT precursor cells
or directly from white adipocytes after exposure to cold. Like in other differentia-
tion processes in the human body, transcription factor networks play the main role
in driving adipocyte differentiation towards the brown, beige or white phenotype.
Adipocyte
Mesenchymal
precursor
precursor
(lineage origins)
MYF5– MYF5+
Adult origins
Mature
adipocytes
Fig. 8.3 Origins of white, beige and brown adipocytes. BAT contains UCP1 expressing brown
adipocytes (UCP1+), whereas WAT is formed by UCP1− white adipocytes and UCP1+ beige adipo-
cytes. In adults, the expansion of adipose tissue is mainly achieved through the growth and differ-
entiation of pre-adipocytes (i.e. adipocyte precursors). The precursors of WAT and BAT adipocytes
derive from mesenchymal cells: for WAT they derive from both MYF5+ and MYF5− lineages,
whereas for BAT they come exclusively from the MYF5+ lineage. Beige adipocytes are obtained
from WAT adipocyte precursors or directly from mature white adipocytes. In contrast, brown adi-
pocytes can derive from stem-cell-like skeletal muscle satellite cells. In addition, brown and white
adipocytes are generated from endothelial precursors
8.2 Adipogenesis 147
Cold
Functional activity
0 energy uptake
energy processing
energy expenditure
? Sympathetic
OBESITY
nervous system
? Transcriptional activity
M1 Macrophage M2
Catecholamines
Energy-sensing pathways
FGF21, BMP4, BMP7, PKA, MAPK, PKG, AMPK
prostaglandins, T4
Fig. 8.4 Hormonal control of WAT browning. Metabolic adaptions to environmental factors are
regulated by the release of endocrine and paracrine factors from metabolic tissues. In response to
(thermal) cold, catecholamines are released by the SNS and from M2-type macrophages in adipose
tissue. This activates energy-sensing pathways in white adipocytes and stimulates their transforma-
tion to beige adipocytes. This beige phenotype is generated through the actions of transcription
factors that induce activities characteristic of their phenotype, such as increase energy uptake,
energy processing and energy expenditure
Complex variables
Mood, hedonic effect of food,
relative rating or alternative, Extrinsic influenses Intrinsic influences
pleasurable activities Environmental Biological- “the
determinants drive to move”
How much energy is stored? of the need and
How much stored as fat vs. lean? opportunity
for physical activity
in work, domestic
and leasure time
Fig. 8.5 Variables of energy homeostasis. Energy homeostasis is regulated by a complex inter-
action between the variation in food intake, the tendency to store excess energy as fat or lean mass,
referred to as nutrient partitioning, and the variation in energy expenditure. The intrinsic variables
that have an impact on energy homeostasis causing obesity are influenced by food intake through
effects on satiety and hunger
The coordinated activity of multiple peptide hormones and autonomic circuits are
needed for efficient digestion of food. Prior an anticipated meal, the gastrointestinal
tract is prepared for the digestion of nutrients and for avoiding extreme metabolic
consequences of the pending caloric load. Human individuals who habitually eat at
the same time each day begin these CNS-initiated hormone secretions, such as insu-
lin, before food serving. This is important for the efficient disposal of absorbed
glucose (Sect. 9.1). Moreover, CNS signals also stimulate ghrelin secretion from the
stomach approximately 30 min before the meal, and GLP1 from the intestine rises
even 1 h earlier. When food is consumed, numerous hormones and enzymes are
secreted, in order to allow nutrient digestion and absorption. Most of these hor-
mones related to digestion, such as cholecystokinin, are satiety signals. Further gas-
trointestinal peptides that influence the hindbrain to reduce the meal size are GLP1,
glucagon, APOA4 and peptide YY. The half-life of these peptides is short and the
function of most of them is redundant, i.e. they can compensate each other. Satiation
signals converge in the nucleus tractor solitarius (NTS) and the adjacent area pos-
trema of the hindbrain (Fig. 8.6).
Insulin and leptin are obesity signals, i.e. their secretion is proportional to the
amount of body fat. Together with ghrelin, they enter the brain through the blood–
brain barrier via receptor-mediated active transport and act directly on the arcuate
nucleus (ARC) of the hypothalamus (Fig. 8.6). This area of the brain also receives
information from the hindbrain on the progress of meals and from limbic centers
reflecting non-homeostatic influences. In addition, the peptide hormone amylin that
is secreted like insulin from β cells of the pancreas, as well as cytokines derived
from adipose tissue, such as IL6 and TNF, all act on the brain to increase energy
expenditure. The ARC contains two populations of neurons that either express neu-
ropeptide Y (NPY) and agouti-related peptide (AGRP) or pro-opiomelanocortin
(POMC) (Fig. 8.6). POMC is a pro-hormone that is cleaved to produce α-melanocyte-
stimulating hormone (α-MSH) being a ligand of the melanocortin 4 receptor
(MC4R). In contrast, insulin and leptin activate POMC neurons that release α-MSH
counteracting AGRP and stimulating MC4R neurons. This results in reduced food
intake and decreased body weight in the long-term inhibition of food intake. Ghrelin
stimulates NPY-AGRP neurons that secrete AGRP acting as an antagonist of MC4R
on neurons in the paraventricular nuclei (PVN). This leads to increased food intake
and induction of weight gain. These areas of the forebrain also receive information
8.4 Hormonal Regulation of Food Anticipation 151
TNF AP
Hindbrain
Macrophage +
Hypothalamus Amylin
ARC +
+ POMC + Insulin
NPY
AGRP Pancreas
– + + NTS +
Leptin
Ghrelin
Cholecystokinin Vagus
Adipocytes APOA4 nerve
Gastroinstestinal
tract
Fig. 8.6 Hormonal signals from the periphery influence multiple brain areas. Insulin and
amylin from the pancreas stimulate POMC neurons in the ARC of the hypothalamus and in the AP
of the hindbrain, respectively. Ghrelin stimulates NPY-AGRP neurons in the ARC, while leptin
from adipocytes inhibits these cells. However, leptin and TNF stimulate POMC cells.
Gastrointestinal peptides, such as cholecystokinin and APOA4, either stimulate the NTS directly
or stimulate vagal afferent nerves whose axons end in the NTS. Most of these peptide hormones
enter the brain via active transport
from the hindbrain concerning the progress of the meal and information from non-
homeostatic factors.
Reduced leptin and insulin signaling in the ARC results in increased food intake
and eventually weight gain. Also the cytokines IL6 and TNF, derived from adipose
tissue, reduce food intake. In particular TNF is associated with the cachexia seen in
cancer patients. Adiponectin is secreted from adipose tissue in inverse proportion to
body fat and acts on the brain to increase energy expenditure. Some amino acids,
such as leucine, glucose and fatty acids, can also regulate the activity of ARC neu-
rons making them important for normal regulation of body weight/fat mass. Insulin
152 8 Obesity
and leptin can also regulate ongoing food intake by directly adjusting the sensitivity
to incoming satiation signals in the NTS of the hindbrain. For example, when an
individual loses weight, the secretion of insulin and leptin decreases and the reduced
adiposity signal in the brain results in reduced sensitivity to the satiating action of
cholecystokinin and GLP1. This leads to an increase in meal size until lost weight
is regained and the levels of adiposity signals are restored. The opposite can be
observed when people overeat and gain weight.
Adipose tissue is not only a passive storage container for nutrients, as it was believed
to be some decades ago, but it is an active endocrine organ that via the reception of
signals as well as the secretion of paracrine and endocrine molecules communicates
with all important organs of the body. This communication can be mediated by
nutritional mechanisms, neural pathways (Sect. 8.4) and via autocrine, paracrine
and endocrine actions of secreted proteins that are collectively referred to as adipo-
kines (Table 8.1). The secretion pattern of adipokines varies, based on the location
of the adipose tissue within the body, but the two most abundant fat depots, visceral
and sub-cutaneous adipose tissue, display a unique expression profile. However, the
adipokine secretion profile of adipocytes significantly changes when the cellular
composition of the tissue is altered during the onset of obesity. Since most adipo-
kines act pro-inflammatory and only a few anti-inflammatory, their overall expres-
sion is increased in the obese state compared to the lean state. Pro-inflammatory
adipokines are: the peptide hormones leptin and resistin, the transport proteins reti-
nol binding protein 4 (RBP4) and lipocalin 2, the growth factors angiopoietin-like
protein 2 (ANGPTL2), the enzyme NAMPT, the cytokines TNF, IL6 and IL18 and
the chemokine (C-X-C motif) ligand 5 (CXCL5). In contrast, only the adipokines
adiponectin and secreted frizzled-related protein 5 (SFRP5) act anti-inflammatory.
The balance between pro-inflammatory and anti-inflammatory adipokines is crucial
for determining homeostasis throughout the body based on the nutritional status.
Leptin is the most important hormone produced by adipose tissue, since it regu-
lates feeding behavior through the CNS (Sect. 8.4). The hormone improves meta-
bolic dysfunction in patients with lipodystrophy or inherited leptin deficiency.
However, although obese individuals have high leptin concentrations, they do not
show any anorexic response. In addition to its CNS functions, leptin has effects on
cells of the immune system. It stimulates the production of pro-inflammatory cyto-
kines and chemokines in monocytes and macrophages, such as TNF, IL6 and
CXCL5. Furthermore, leptin polarizes T cells towards a TH1 phenotype by inducing
the production of the TH1-type cytokines IL2 and IFNγ and the suppression of the
TH2-type cytokine IL4. All these effects confirm that leptin is a pro-inflammatory
adipokine. The peptide hormone resistin is also associated with inflammation, since
it promotes the expression of the pro-inflammatory cytokines TNF and IL6. At least
in mice, resistin induces insulin resistance via the activation of an inhibitor of insulin
8.5 Adipose Tissue is an Endocrine Organ 153
while high adiponectin levels are associated with a lower risk for developing
T2D. Adiponectin is the adipokine that is expressed at the highest levels in func-
tional adipocytes of lean persons, while its expression is down-regulated in dysfunc-
tional adipocytes of obese individuals. The beneficial effects of adiponectin on
insulin sensitivity are mediated via increased Ca2+ levels in skeletal muscle that
activate CAMKK2, AMPK and SIRT1 and result in the up-regulation of PPARGC1A
expression. Adiponectin also modulates the function and phenotype of macro-
phages. For example, it inhibits the transformation of macrophages into foam cells
(Chap. 11.2) by reducing the intracellular cholesteryl ester content and suppressing
the expression of macrophage scavenger receptor 1 (MSR1). Furthermore, in mac-
rophages adiponectin up-regulates the secretion of the anti-inflammatory cytokine
IL10. Taken together, adiponectin induces a shift from M1-type to M2-type
macrophages.
The main function of the other anti-inflammatory adipokine, SFRP5, is to pre-
vent the binding of wingless-type MMTV integration site family member (WNT)
proteins to their respective receptors. The WNT signaling pathway has a number of
important downstream targets, such as MAPK8, leading to pro-inflammatory cyto-
kine production in macrophages. WNT5A antagonizes SFRP5 and the balance
between SFRP5 and WNT5A in adipocytes and adipose tissue macrophages, modu-
lates inflammation and metabolic function.
Taken together, adipose tissue influences and communicates via adipokines with
many other organs, such as the brain, heart, liver and skeletal muscle, and vascular-
ization, respectively. During adipose tissue expansion adipocyte dysfunction often
occurs, such as a dys-regulation of adipokine production, which has both local and
systemic effects on inflammatory responses. This changed adipokine profile signif-
icantly contributes to the initiation and progression of obesity-induced cardiovascu-
lar and metabolic diseases (Chaps. 11 and 12).
In WAT, lipid-loaded adipocytes represent only 20–40 % of the cell number of a fat
pad but more than 90 % of its volume, i.e. every gram of adipose tissue contains 1–2
million adipocytes but 4–6 million stromal-vascular cells, of which more than half
are immune cells. As already discussed in Sect. 7.4, obesity causes the recruitment
and infiltration of M1-type macrophages to WAT, which is the initial event in
obesity-induced inflammation. These macrophages secrete a variety of pro-
inflammatory cytokines, which act locally in a paracrine manner or they leak out of
the adipose tissue and cause systemic effects, such as insulin resistance in metabolic
organs (Sect. 9.4). The inflammatory response in obesity is chronic, i.e. it persists
far longer than acute inflammation caused by infections or tissue injury.
Adipose tissue can be classified into at least three structural and functional
groups. Lean individuals with normal metabolic function store excess nutrients as
triacylglycerols in WAT. The WAT in these lean subjects contains M2-type macro-
phages and TH2 cells that respond to nutrient-derived signals by promoting lipid
156 8 Obesity
storage and suppressing lipolysis (Fig. 8.7, stage 1). As obesity develops with
chronic overnutrition, the storage capacity is exceeded causing cellular dysfunction,
such as lipid dys-regulation, mitochondrial dysfunction, oxidative stress and ER
stress (Sect. 7.5), leading to reduced metabolic control. This causes adipocytes to
secrete chemokines, such as CCL2, that attract monocytes into the adipose tissue
that become M1-type macrophages (Fig. 8.7, stage 2). When these alterations esca-
late, they lead to adipocyte death. In order to remove remnants of dead adipocytes,
additional macrophages infiltrate the WAT. They surround the dead cells and create
crown-like structures that are associated with increased inflammation (Fig. 8.7,
stage 3). T cells in adipose tissue also play a role in obesity-induced inflammation.
TH1 cells produce pro-inflammatory cytokines, such as IFNγ, while TH2 cells and
TREG cells secrete anti-inflammatory cytokines, such as IL10, inducing differentia-
tion of macrophages into M2 type (Sect. 7.2). In lean individuals, however, TH2 and
TREG cells dominate in WAT, while in obese persons there are far more TH1 cells.
Compared to sub-cutaneous fat, visceral fat accumulates a larger number of macro-
phages and secretes greater amounts of pro-inflammatory cytokines. In addition,
adipocytes in visceral fat are more fragile and reach earlier a critical size triggering
cell death than sub-cutaneous adipocytes. This may explain the different health risk
between the two “apple” and “pear” shapes of fat depots (Sect. 8.1).
Anti-inflammatory adipokines
Anti-inflammatory adipokines
• Leptin • ANGPTL2 • CXCL5
• Adiponectin
• Resistin • TNF • NAMPT
• SFRP5
• RBP4 • IL6, IL18 • Lipocalin 2
Fig. 8.7 Functional classification of adipose tissue. Adipose tissue can be distinguished into at
least three stages. In normal-weight tissue with normal metabolic function (stage 1) adipocytes are
associated with a rather low number of M2-type macrophages. This tissue produces preferentially
anti-inflammatory cytokines, such as adiponectin and SFRP5. During onset of obesity, adipocytes
increase their triglyceride storage, i.e. they become hypertrophic. At limited obesity (stage 2) adi-
pocytes still retain relatively normal metabolic function and display low levels of immune cell
activation and sufficient vascular function. However, in obesity with full metabolic dysfunction
(stage 3) the tissue has recruited a large number of M1-type macrophages and produces preferen-
tially pro-inflammatory adipokines, such as leptin, resistin, RBP4, lipocalin, ANGPTL2, NAMPT,
TNF, IL6, IL18 and CXCL5
8.7 Genetics of Obesity 157
Some rare forms of severe obesity result from mutations in an individual gene or
chromosomal region, i.e. they represent monogenic obesity (Table 8.2). The impor-
tance of the leptin-melanocortin pathway in hyperphagia (increased appetite) and
obesity susceptibility is indicated by the fact that so far primarily mutations in the
genes for leptin (LEP), LEPR, POMC, proprotein convertase subtilisin/kexin type 1
(PCSK1), MC4R and single-minded family bHLH transcription factor 1 (SIM1)
were found as causes of monogenetic obesity. PCSK1 encodes for an enzyme
responsible for post-translational processing of POMC, while SIM1 encodes for a
transcription factor that is both an upstream and downstream target of MC4R.
MC4R mutations may be responsible for up to 6 % of childhood obesity and 2 % of
adult obesity cases. Importantly, the very rare obesity phenotype of patients with
homozygous LEP mutations can be reversed by administration of leptin.
The rapid increase in the number of obese people pointed out above (Fig. 8.2)
can be explained by radical changes in lifestyle, such as high intake of energy-dense
food and physical inactivity. However, some subjects seem to be more susceptible
to these lifestyle changes than others, suggesting a relevant genetic component.
Polygenic “common” obesity results from the combined effect of multiple genetic
variants in concert with environmental risk factors. Linkage analysis, candidate
gene approaches and in particular GWAS (Sect. 2.5) in various populations have
indicated dozens of genes to be associated with the traits BMI and obesity (Fig. 8.8).
Widely replicated candidate genes are MC4R, BDNF, PCSK1, adrenoceptor beta 3
(ADRB3) and PPARG. The most prominent result from GWAS analysis was the
identification of a strong association of the chromosomal region of the FTO gene
with BMI and obesity. Although the effect size of the genetic variations at the FTO
locus is not comparable to that of monogenic forms, it represents the most estab-
lished association with common obesity, primarily due to its high frequency (47 %)
in the European population. The FTO protein shares motifs with iron- and
α-ketoglutarate-dependent oxygenases that are involved in fatty acid metabolism
and DNA repair, but its exact function is still unknown. FTO is located in the
nucleus, may be involved in DNA demethylation and is expressed in multiple
tissues, including the hypothalamus. Carriers of FTO risk SNPs show increased
appetite and measured food intake suggesting that the mechanism of this common
genetic variant is, like for rare variants, through increased energy intake.
Further prominent genes identified by GWAS are the transmembrane protein 18
(TMEM18) and the ER transporter SEC16 homolog B (SEC16B). In total, a recent
GWAS meta-analysis of nearly 340,000 individuals identified 97 genomic loci asso-
ciated with BMI. However, these loci in total account only for 2.7 % of the variation
in BMI. The same study suggests that maximal 21 % of the BMI variation may be
explained by common genetic variations. Also, in view of this very large study, the
role of the CNS is confirmed, in particular of genes expressed in the hypothalamus,
in the regulation of body mass. This suggests that obesity may be considered as a
“neurobehavioral” disorder with high susceptibility to the obesogenic environment.
Taken together, some 100 genes are associated with obesity and fat distribution, but
158 8 Obesity
most of them are not yet mechanistically understood. The small effect size of these
common variants implies that they do not have much predictive value. In addition,
the genetics of common obesity has a very heterogeneous etiology, but it links with
several related metabolic diseases and processes, such as cardiometabolic traits.
Future View
In future, the development and pathogenesis of obesity might be seen as a response
to metabolic toxicity. The metabolic syndrome (Chap. 12) may be improved when
the nutrient storage capacity of WAT would be improved and the energy-dissipating
potential of thermogenic brown and beige adipocytes would be maximized. This
8.7 Genetics of Obesity 159
Position Loci
19q13.11 * KCTD15 0.0 - 0.1 kg/m2
11p11.2 MTCH2 0.1 - 0.2 kg/m2
6p21.31 NUDT3 0.2 - 0.3 kg/m2
11p15.4 * RPL27 0.3 - 0.4 kg/m2
1p21.3 * PTBP2
1p31.1 TNNI3K
5p23.2 *ZNF608
19q13.32 * TMEM160
2q22.1–q22.2 * LRP1B
13q12.2 MTIF3
5q13.3 * FLJ35779
2p16.1 * FANCL
3p12.1 CADM2
9p21.1 LRRN6C
12q13.13 FAIM2
1p31.1 * NEGR1
6p12.3 TFAP2B
14q31.1 NRXN3
15q23 MAP2K5
3q27.2 * ETV5
2p23.3 * RBJ
16p11.2 SH2B1
19q13.32 QPCTL
14q12 * PRKD1 O
16p12.3 * GPRC5B
4p13 * GNPDA2
11p14.1 BDNF
4q24 SLC39A8
1q25.2 SEC16B
18q21.32 * MC4R
2p25.3 * TMEM18
16q12.2 FTO
Fig. 8.8 The genetics of BMI. The chromosomal position of genes is listed that are located at or
close to (*) SNPs associating with BMI
will include the need of a better understanding of the development and activation of
white, beige and brown adipocytes and the role of nutrients on the differentiation of
M1- and M2-type macrophages. This may be achieved by insight into the functions
and mechanisms of key adipokines and the development of therapeutic strategies
160 8 Obesity
Key Concepts
• Overweight and obesity are abnormal and excessive fat accumulations that may
impair health. Obesity is the consequence of excess WAT accumulation and
develops when energy intake exceeds energy expenditure.
• The location of the WAT within the body plays an important role for the risk to
develop metabolic disease: high amount of visceral fat increases the risk, while
gain in sub-cutaneous fat exerts far less risk.
• WAT is the primary site of energy storage, while BAT represents a site of basal
and inducible energy expenditure.
• Like in other differentiation processes in the human body, transcription factor
networks play the main role in driving adipocyte differentiation towards the
brown, beige or white phenotype.
• PPARγ is the “master regulator” of fat cell formation, as it is both necessary and
sufficient for adipogenesis.
• Excess of calorie intake, altered food composition and physical inactivity, which
are promoted by today’s obesogenic environment, are the most likely drivers of
the obesity epidemic.
• Hormonal and neuronal control circuits have been trained by evolutionary adap-
tion to make hunger the first ranking desire of nearly all humans, which strongly
counteracts to most attempts of losing excessive body weight.
• When adipocyte dysfunction occurs as a result of adipose tissue expansion, dys-
regulation of adipokine production has both local and systemic effects on inflam-
matory responses. This changed adipokine profile significantly contributes to the
initiation and progression of obesity-induced metabolic and cardiovascular
diseases.
• Leptin may be the most important hormone produced by adipose tissue, since it
regulates feeding behavior through the CNS.
• To maintain energy homeostasis, the CNS receives hormonal signals from adi-
pose tissue (leptin and other adipokines), from the pancreas and from other parts
of the gastrointestinal tract.
• Obesity causes a recruitment and infiltration of M1-type macrophages, which
comprise up to 40 % of the cells in the obese adipose tissue.
• The balance between pro-inflammatory and anti-inflammatory adipokines is cru-
cial for determining homeostasis throughout the body based on the nutritional
status.
• The importance of the leptin-melanocortin pathway in hyperphagia and obesity
susceptibility is indicated by the fact that so far primarily mutations in the genes
Additional Reading 161
LEP, LEPR, POMC, PCSK1, MC4R and SIM1 were found as causes of monoge-
netic obesity.
• The most prominent result from GWAS analysis was the identification of a strong
association of the chromosomal region of the FTO gene with BMI and obesity.
• Some 100 genes are associated with obesity and fat distribution, but most of
them are not mechanistically understood. The small effect size of these common
variants implies that they do not have much predictive value.
• Obesity may be considered as a neurobehavioral disorder with high susceptibil-
ity to the obesogenic environment.
Additional Reading
Bartelt A, Heeren J (2014) Adipose tissue browning and metabolic health. Nat Rev Endocrinol
10:24–36
Begg DP, Woods SC (2013) The endocrinology of food intake. Nat Rev Endocrinol 9:584–597
El-Sayed Moustafa JS, Froguel P (2013) From obesity genetics to the future of personalized obe-
sity therapy. Nat Rev Endocrinol 9:402–413
Ng M, Fleming T, Robinson M, Thomson B, Graetz N, Margono C, Mullany EC, Biryukov S,
Abbafati C, Abera SF et al (2014) Global, regional, and national prevalence of overweight and
obesity in children and adults during 1980–2013: a systematic analysis for the Global Burden
of Disease Study 2013. Lancet 384:766–781
Ouchi N, Parker JL, Lugus JJ, Walsh K (2011) Adipokines in inflammation and metabolic disease.
Nat Rev Immunol 11:85–97
Peirce V, Carobbio S, Vidal-Puig A (2014) The different shades of fat. Nature 510:76–83
Rosen ED, Spiegelman BM (2014) What we talk about when we talk about fat. Cell 156:20–44
Chapter 9
Glucose Homeostasis, Insulin Resistance
and β Cell Failure
Abstract Humans rely on that their blood glucose levels maintain within a physio-
logical range of 4–6 mM during the day with periods of fasting and refeeding.
Therefore, glucose intake, storage, mobilization and breakdown are tightly regu-
lated, in particular by the peptide hormones insulin and glucagon. The insulin sig-
naling axis is composed of a number of critical nodes including the insulin receptor
(IR), the adaptor protein IRS, the kinases PI3K and AKT as well as the transcription
factor forkhead box O (FOXO). Each of these nodes is represented by several pro-
tein isoforms and is interconnected with a number of other signal transduction cas-
cades. For example, multiple upstream pathways regulate FOXO activity through
post-translational modifications and nuclear-cytoplasmic shuttling of both the tran-
scription factor and its co-regulators. In this way, insulin is controlling a number of
physiological functions, but is also sensible to several cellular processes that, when
misbalanced, affect insulin signaling, what might lead to insulin resistance. In insu-
lin resistance, normal concentrations of insulin cause an insufficient response of the
major insulin target tissues, such as skeletal muscle, liver and adipose tissue. Three
main processes can lead to insulin resistance in skeletal muscle and liver: an ectopic
overload of lipids, a chronic inflammatory response and ER stress. Similarly, gluco-
toxic and lipotoxic stress to β cells are mediated via inflammatory response, oxida-
tive stress and ER stress eventually resulting in the failure of the cells.
In this chapter, we will describe the molecular principles of glucose homeostasis
and insulin signaling. Using the example of FOXO transcription factors we will
analyze the mechanisms how a central signal transduction cascade interacts with
environmental challenges mediated via multiple other pathways, in order to keep
cells and tissues in homeostasis. This mechanistic understanding will help to inte-
grate the complexity of insulin resistance. We will summarize our insight on chronic
inflammation (Sect. 7.2) and the unfolded protein response (Sect. 7.5), in order to
interpret the response of muscle and liver cells while developing insulin resistance
and that of β cells in the process towards their failure.
Glucose homeostasis results both from the hormonal and neural control of glucose
production and use, which even at physiological challenges, such as food ingestion,
fasting and intense physical exercise, maintains the blood glucose level within a
range of 4–6 mM. This constant level is essential for providing energy to tissues,
most importantly for an uninterrupted glucose supply to the brain, which almost
exclusively uses glucose as an energy source. Hypoglycemia, i.e. a blood glucose
level below 4 mM, can lead in the brain to a number of neuroglycopenic effects,
while chronic hyperglycemia, a constant concentration above 10 mM, is toxic to
blood vessels (Box 10.1). The principal regulators of glucose homeostasis are the
peptide hormones glucagon and insulin that are secreted by α and β cells, respec-
tively, of the endocrine pancreas (forming Langerhans islets). Glucagon is secreted
when blood glucose concentrations are low, such as between meals and during exer-
cise. Glucagon has the greatest effect on the liver, where it stimulates (i) the release
of glucose that was stored in form of glycogen into the blood and (ii) the production
of glucose via the gluconeogenesis pathway.
In contrast, rising blood glucose levels directly after food ingestion stimulates
insulin secretion. The glucose transporter GLUT2 in the plasma membrane of β
cells and the hexokinase GCK in the cytoplasm both sense glucose (Sect. 3.1) and
initiate glucose import and its metabolism via glycolysis (Fig. 9.1). The increasing
ATP-ADP ratio stimulates the closing of ATP-sensitive K+ (KATP) channels, plasma
membrane depolarization, activation of voltage-gated Ca2+ channels and Ca2+-
mediated stimulation of exocytosis of insulin granules. This KATP channel-dependent
mechanism is a triggering signal that is particularly important for the acute phase of
insulin release, i.e. during the first 10 min after glucose rise. In the second phase of
insulin secretion, the mitochondrial glucose metabolism generates signals addi-
tional to the ATP-ADP ratio, which are important for gaining insight into the func-
tional failure of β cells during T2D. Pyruvate, the final product of glycolysis, flows
into mitochondria through an anaplerotic (meaning “refilling”) process via pyruvate
carboxylase (PC) and an oxidative pathway via the pyruvate dehydrogenase (PDH)
complex (Fig. 9.1). The conversion of pyruvate to oxaloacetate via the action of PC
and the following metabolism of oxaloacetate to malate, citrate or isocitrate in the
TCA cycle provides several possibilities for the reconversion of these metabolites
into pyruvate via cytosolic and mitochondrial pathways. These pathways are impor-
tant for the regulation of glucose-stimulated insulin secretion. One of these path-
ways is the export of citrate from the mitochondria through the citrate-isocitrate
carrier (SLC25A1) and the subsequent conversion of isocitrate to α-ketoglutarate
by the cytosolic NADP-dependent IDH complex. The metabolic byproducts of this
pyruvate-isocitrate cycling may also act as amplifying signals for the control of
glucose-stimulated insulin secretion.
After food ingestion, carbohydrates are digested in the gastrointestinal tract and
glucose is absorbed into the circulation primarily via the hepatic portal vein. Thus,
9.1 Glucose Homeostasis in Health 165
Activation
Membrane
K+ Ca2+ Insulin granule
depolarization
exocytosis
Extra-cellular space
Voltage-gated
KATP channel GLUT2 Ca2+ channel
Cytoplasm
Inhibition
Ca2+
Glucose
ATP
ATP:ADP ratio
Insulin granules
Glycolysis GSK
Pyruvate Pyruvate
Dicarboxylate Amplifying signals
PDH or malate (NADPH, GTP,
carrier
PC α-Ketoglutarate)
Acetyl-CoA
Malate
Oxaloacetate
Oxaloacetate
TCA Citrate-
Fumarate Isocitrate Isocitrate
cycle isocitrate
NADP
carrier
α-Ketoglutarate
Succinate
α-Ketoglutarate
Succinyl-CoA Mitochondrion
Pancreatic β cell
Fig. 9.1 Glucose-stimulated insulin secretion in β cells. Rising blood glucose levels stimulate
GLUT2 in the membrane of β cells to import glucose and GCK to start glucose breakdown via
glycolysis generating ATP. The increased ATP-ADP ratio inhibits KATP channels resulting in mem-
brane depolarization, activation of voltage-gated Ca2+ channels, influx of Ca2+ and stimulation of
insulin granule exocytosis. Moreover, pyruvate is the end product of glycolysis and enters mito-
chondrial metabolism via PDH or PC. The β cells also exhibit active “pyruvate cycling” via the
anaplerotic entry of pyruvate or other substrates into the TCA cycle generating excess of interme-
diates that then exit the mitochondria to engage in various cytosolic pathways leading back to
pyruvate. Pyruvate-isocitrate cycling generates an amplifying signal that enhances the Ca2+-
mediated triggering signal for insulin exocytosis
the liver has a central role in monitoring and regulating post-prandial (meaning
“after a meal”) glucose levels (Fig. 9.2, left). Insulin promotes hepatic triacylglyc-
erol synthesis and storage of triacylglycerols in WAT upon feeding. Moreover, insu-
lin also suppresses the release of stored lipids from adipose tissue. Ingested nutrients
in intestinal endocrine cells stimulate the release of incretins, such as GLP1, that
itself, together with the rise in blood glucose, stimulates β cells to deliver insulin.
166 9 Glucose Homeostasis, Insulin Resistance and β Cell Failure
Glycogen Glycogen
Liver
Intake Glycogen synthesis
Glycogen synthesis Gluconeogenesis
Gluconeogenesis De novo lipogenesis
De novo lipogenesis
Triacylglycerols
Glucose
Glucose
Triacylglycerols
Pancreas
β cells Insulin
Fatty acids
Insulin
Fatty acids
Glucose
Lipolysis
Glucose transport Lipolysis
Glycogen synthesis
Glycogen
Skeletal muscle
WAT
Glycogen
Triacylglycerols
Triacylglycerols
Fig. 9.2 Insulin action in health. In the fed state, dietary carbohydrates increase plasma glucose
levels and promote insulin secretion from β cells. In skeletal muscle, insulin increases the transport
of glucose and permits glucose entry and glycogen synthesis. In adipose tissue, insulin suppresses
lipolysis and promotes de novo lipogenesis. In the liver, insulin stimulates glycogen synthesis and
de novo lipogenesis and inhibits gluconeogenesis. In the fasted state, insulin secretion is decreased,
which increases hepatic gluconeogenesis and promotes glycogenolysis. Under these conditions,
hepatic lipid production diminishes while adipose lipolysis increases
The first phase of insulin secretion primarily prevents the liver from producing more
glucose by stimulating glycogen synthesis and suppressing gluconeogenesis. The
second phase, approximately 1–2 h after the meal, stimulates glucose uptake by
insulin-sensitive tissues, such as skeletal muscle and adipose tissue. During fasting
(Fig. 9.2, right), hepatic glycogenolysis decreases as hepatic glycogen stores
deplete. Low insulin levels combined with elevated counter-regulatory hormones,
such as glucagon, adrenaline and corticosteroids, promote hepatic glucose produc-
tion via gluconeogenesis, so that blood glucose levels remain stable across a wide
range of physiological conditions. Moreover, glucagon and adrenaline stimulate
lipolysis in WAT and fatty acid oxidation in other tissues when nutrients are in lim-
ited supply. Although the hormonal regulation of glucose homeostasis is essential,
also the CNS can sense and respond to acute changes in glucose and nutrient needs
through innervation of the intestine, the liver, the pancreas, the portal vein and all
other glucose-demanding tissues (Sect. 8.4)
9.2 Principles of Insulin Signaling 167
Insulin resistance is a major predictor for the development of T2D (Chap 10) and
the metabolic syndrome (Chap 12). In order to develop new drugs to treat T2D and
its cardiovascular complications, it is essential to understand the principles of insu-
lin signaling. The major role of insulin signaling is the regulation of glucose, lipid
and energy homeostasis, predominantly via action on skeletal muscle, liver and
WAT. The final results of the insulin signaling are increased glucose uptake in mus-
cle and fat tissue and inhibition of glucose synthesis in the liver. In adipose tissue,
insulin also inhibits the release of FFAs.
Insulin acts via IRs which are located in the plasma membrane of insulin sensing
cells. The IR is a tetrameric protein complex formed of each two α- and β-subunits
and, together with IGF1R (Sect. 6.1), belongs to the receptor tyrosine kinase super-
family. When insulin binds to the α-subunit, the receptor undergoes a conforma-
tional change that activates the cytosolic kinase domain of the β-subunit and allows
the recruitment of IRS proteins to its cytosolic component. The activity of IR is
up-regulated by tyrosine phosphorylation, while the receptor is negatively regulated
by protein tyrosine phosphatases. Moreover, SOCS1 and SOCS3, growth factor
receptor-bound protein (GRB) 10 and ectonucleotide pyrophosphatase/phosphodi-
esterase 1 (ENPP1) inactivate the function of IR by blocking its interaction with IRS
proteins or by modifying the receptor’s kinase activity. SOCS proteins are up-
regulated in insulin resistance (Sect. 9.4).
In particular during insulin resistance, IR is inactivated by ligand-stimulated
internalization and degradation. IR has at least 11 intra-cellular substrates, such as
IRSs 1–6, GRB2-associated binder 1 (GAB1), Cbl proto-oncogene, E3 ubiquitin
protein ligase (CBL) and different isoforms of the Src homology 2 domain contain-
ing (SHC) protein. The interaction of phosphorylated IRS proteins with the regula-
tory subunit of PI3K results in the generation of the second messenger
phosphatidylinositol-3,4,5-triphosphate (PIP3) activating AKT (Fig. 9.3). IR/IRS,
PI3K and AKT form three important nodes in the insulin signal transduction cas-
cade being responsible for most of the metabolic actions of insulin, such as glucose
uptake, glucose synthesis and inhibition of gluconeogenesis. Main criteria for criti-
cal nodes are that they (i) have several isoforms that are involved in divergent sig-
naling, (ii) are highly positively and negatively regulated, (iii) are essential for the
biological actions of the ligand and (iv) mediate crosstalk with other signal trans-
duction cascades. In this way, the three nodes explain the diversification and fine-
tuning of insulin signaling both in health and disease.
IRS1 and IRS2 are ubiquitously expressed, while IRS3 is found primarily in
adipocytes and the brain and IRS4 in embryonic tissues. IRS proteins are character-
ized by a 100 amino acids pleckstrin-homology (PH) domain close to their
N-terminus and a central phosphotyrosine-binding (PTB) domain (Fig. 9.4). In
addition, each IRS protein contains more than 20 tyrosine and serine phosphoryla-
tion sites. After IR phosphorylates IRS’ tyrosine sites the protein interacts with Src-
homology 2 (SH2) domain-containing adaptor proteins, such as the regulatory
Insulin
cellular
membrane IR A/B
CYTOPLASM PTPN1
SORBS1
CBL IRS1 JAK
CDC42 IRS2
RHOQ p85α
PTEN
IRS3 STAT
p110α p55α
IRS4
p110β PI3K p50α
p110γ p85β NODE 1 SOCS
Glucose uptake PRKCI PDPK
p55γ
NODE 2
TBC1D4 AKT1
SHC
AKT2
MAPK8
AKT3 Cell growth,
MAPK3
differentiation
NODE 3
MAPK1
Gluconeogenesis
Fig. 9.3 Critical nodes in insulin signaling. Three important nodes of the insulin signaling net-
work are IR/IRS, PI3K with its several regulatory and catalytic subunits and the three isoforms of
AKT. Downstream of these nodes are the proteins TBC1D4, protein kinase C, iota (PRKC1),
sorbin and SH3 domain containing 1 (SORBS1), cell-division cycle 42 (CDC42), glycogen synth-
ase kinase 3 (GSK3), ribosomal protein S6 kinase (RPS6K) A1, 3-phosphoinositide dependent
protein kinase (PDPK) 1 and 2, phosphatase and tensin homologue (PTEN), protein tyrosine phos-
phatase, non-receptor type 1 (PTPN1), ras homolog family member Q (RHOQ), CBL, JAK,
FOXO1, MAPK1, MAPK3, MAPK8, TOR, SHC, SOCS and STAT
Fig. 9.4 IRS isoforms. The isoforms IRS1, IRS2, IRS3 and IRS4 share an N-terminal PH domain,
a central PTB domain and several tyrosine (Y) and serine (S) phosphorylation sites. The kinases
responsible for Y and S phosphorylations are shown; blue circles represent sites of positive regu-
lation, red circles indicate sites of negative regulation, whereas function of the sites marked in
white is not yet known. The proteins that bind or phosphorylate IRSs are listed
9.3 Central Role of FOXO Transcription Factors 169
subunit of PI3K or GRB2. GRB2 then associates with the adaptor protein son of
sevenless (SOS) to activate the MAPK pathway via MAPK1, MAPK3 and MAPK8.
This links the action of insulin to the control of cell growth and differentiation. Like
for IR, the signaling function of IRS proteins is also regulated by the action of tyro-
sine phosphatases, such as SH2-domain-containing tyrosine phosphatase 2 (SHP2).
SHP2 dephosphorylates the IRS binding sites of PI3K and GRB2 and interrupts
their respective signal transduction cascades. In response to insulin, FFAs and cyto-
kines IRS proteins are phosphorylated at serine residues. Most of these serine phos-
phorylations negatively regulate IRS signaling, i.e. they represent a negative-feedback
mechanism for the insulin signaling. Interestingly, serine phosphorylation of IRS1
strongly correlates with insulin resistance (Sect. 9.4). Moreover, reduced expression
of IRS proteins or IR contributes to insulin resistance.
The kinase PI3K is formed by a regulatory and a catalytic subunit, each of which
has several isoforms. The catalytic subunit is activated via the interaction of two
SH2 domains in the regulatory subunit of IRS proteins. Inhibition of PI3K blocks
most of insulin’s actions on glucose transport, glycogen synthesis, lipid synthesis
and adipocyte differentiation, i.e. the enzyme has a central role in the metabolic
actions of insulin. The most important downstream target of PI3K is the serine/
threonine kinase AKT, which phosphorylates a number of key proteins, such as
GSK3, TBC1D4 and FOXO1. AKT has three isoforms, of which AKT2 seems to be
most important in controlling metabolic functions. Phosphorylation of GSK3
decreases the kinases’ inhibitory activity on GS leading to increased glycogen syn-
thesis, but GSK3 has also a number of additional targets. Activated TBC1D4 stimu-
lates small GTPases that are involved in cytoskeletal re-organization, which is
required for the translocation of the glucose transporter GLUT4 to the plasma mem-
brane, i.e. TBC1D4 controls glucose uptake. Finally, AKT controls the activity of
FOXO1 (Sect. 9.3).
The FOX transcription factor family contains over 100 members, some of which are
crucial for the regulation of metabolism. The proteins FOXO1, FOXO3, FOXO4
and FOXO6 form a subclass of the family. FOXO1 is highly expressed in organs
that control glucose homeostasis, such as in liver, skeletal muscle and adipose tis-
sue, as well as in β cells.
FOXOs are activated by oxidative stress and ER stress via MAPK8 and are neg-
atively regulated by the insulin signaling pathway via PI3K and AKT (Fig. 9.5a). In
C. elegans and other model organisms the IR-PI3K-AKT-FOXO signaling axis
shows central functions in aging: optimal FOXO signaling ensures longer lifespan,
while the de-regulation of this pathway contributes to the age-related diseases can-
cer and T2D (Sect. 6.1). This provides FOXO with a central role at the interconnec-
tion of aging and disease and suggests that the main function of FOXOs is to
maintain homeostasis in response to environmental stress, such as an increased oxi-
170 9 Glucose Homeostasis, Insulin Resistance and β Cell Failure
a Insulin
b
cellular
IR A/B
Phosphorylation
membrane
PKB MAPK8
IKK MST1
CYTOPLASM
ROS
CKI MAPK14
IRS
DYRK1A AMPK
CDK1 MAPKAPK5
EP300 SETD7
FOXO1 Methylation
Anabolic Cell cycle HDAC PRMT1
metabolism inhibition MDM2
SIRT1 USP7
Catabolic Ubiquitylation
metabolsim Acetylation
Fig. 9.5 Control and outcome of FOXO activation. (a). Antagonistic control of FOXO through
PI3K-AKT signaling and MAPK8 signaling. Insulin and growth factors signal converge in their
signaling at PI3K and activate PDPK1 and AKT. This is counteracted by PTEN. Active AKT can
inhibit the transcriptional activity of FOXOs through phosphorylation at three conserved residues,
resulting in cytoplasmic retention of FOXO. Oxidative stress induces the nuclear translocation of
FOXOs via MAPK8 and thereby activates FOXO target genes. MAPK8 can inhibit the action of
insulin at multiple levels and thereby counteracts the inhibition of FOXO. The activation of FOXO
inhibits the cell cycle, increases oxidative stress resistance, induces apoptosis and shifts cellular
metabolism away from anabolic pathways towards catabolic metabolism. (b). In addition to AKT
and MAPK8, FOXOs are also regulated via post-translational modifications, such as phosphoryl-
ation, acetylation, methylation and ubiquitylation, by various signal transduction pathways
ogous to the histone code (Box 5.1). FOXOs interact with SIRT1 during oxidative
stress, but only when active PI3K signaling also promotes uptake of SIRT1 into the
nucleus. Moreover, the energy sensor AMPK (Sect. 6.5) phosphorylates FOXOs,
i.e. AMPK directs the transcriptional action of FOXOs, so that it activates alterna-
tive energy sources and stress resistance, as it was already observed under condi-
tions of calorie restriction. Interestingly, AMPK activates FOXOs without
influencing its subcellular localization, but it affects the shuttling of FOXO co-
regulators. For example, AMPKs retains HDAC4, HDAC5 and HDAC7 in the cyto-
sol and enhances the interaction of the HAT CREB-binding protein (CBP) with
FOXOs in the nucleus, i.e. the acetylation of FOXOs is maximized. Taken together,
FOXO transcription factors function as scaffolds that are post-transcriptionally
modified by a number of common signal transduction cascades. This means that the
activity of FOXOs depends a lot on the cellular context and the complete set of sig-
nals that a cell type or tissue is exposed to.
Under conditions of tissue homeostasis FOXOs are inactive and located in the
cytoplasm (Fig. 9.6a). The signal transduction of both insulin and growth factors
converge at PI3K, the activation of which leads to an increased level of PIP3. This
second messenger then activates PDPK1, which in turn stimulates AKT. Active
AKT translocates to the nucleus and phosphorylates FOXOs at three conserved
residues, resulting in increased binding of the transcription factors to tyrosine
3-monooxygenase/tryptophan 5-monooxygenase activation protein (YWHA, also
called 14-3-3). YWHA proteins bind more than 200 functionally diverse signaling
proteins, such as transcription factors, kinases and transmembrane receptors, when
they are phosphorylated at serine or threonine residues and retain them in inactive
form in the cytoplasm. In contrast, under cellular stress, in particular at high ROS
levels, FOXOs translocate into the nucleus and activate their target genes (Fig. 9.6a).
MAPK8 counteracts the activity of insulin at multiple levels, such as by decreasing
IRS activity (Sect. 9.2) and by inducing the release of FOXOs from YWHA
proteins.
All FOXOs recognize the same octameric binding sequence, i.e. they can replace
each other. The FOXO binding site occurs quite often in the genome suggesting that
the transcription factors can act as pioneer factors, i.e. as factors that make the first
contact with condensed chromatin, open it up via the recruitment of HATs, such as
CBP, and help other transcription factors to bind at these regions. In this way,
FOXOs functionally interact with a number of transcription factors. These include
the nuclear receptors RAR and PPAR and the cell growth-regulating transcription
factors p53 and MYC. p53 and FOXOs have a comparable functional profile, but
MYC and FOXOs act as reciprocal antagonists, i.e. both potent transcription factors
keep each other under control. Thus, FOXOs contribute to cellular homeostasis by
integrating different signal transduction cascades that are sensitive to environmental
changes, such as starvation, oxidative stress and growth factor deprivation. FOXO
expression does not predict a certain cellular function, but it rather enables the
amplification of the cellular potential, i.e. the transcription factor provides an inte-
gration point for several cellular inputs and induces a distinct gene expression
program.
172 9 Glucose Homeostasis, Insulin Resistance and β Cell Failure
a Insulin b
FOXO1cyt
β cells
Insulin+
cellular
IR membrane
Metabolic stress
Oxidative FOXO1
stress CYTOPLASM translocation
to nucleaus
Ac P FOXO1–
FOXO1 FOXO1
Glucagon+
NUCLEUS
Fig. 9.6 FOXO1 signaling is affected by metabolic and oxidative stress. (a). Continuous insu-
lin stimulation activates AKT, which in turn phosphorylates serine and threonine sites of FOXO1,
so that the transcription factor is retained to the cytoplasm. However, under oxidative stress condi-
tions FOXO1 is acetylated by CBP and locates preferentially in the nucleus. The acetylation pre-
vents the ubiquitination of FOXO1, i.e. the protein is stabilized and retained in the nucleus. In
addition, oxidative stress also activates MAPK8, which phosphorylates FOXO1 at serine and
threonine sites distinct from those phosphorylated by AKT and further enhances nuclear retention
of FOXO1. Furthermore, also ER stress can induce nuclear retention of FOXO1 via MAPK8 acti-
vation. (b). Under severe hyperglycemic conditions, β cells no longer express FOXO1, insulin,
PDX1 and MAFA but the pluripotency markers POU5F1, NANOG and MCYL, indicating de-
differentiation into progenitor-like cells. Some of these cells start to express glucagon suggesting
they re-differentiate into α cells
Insulin
Transcriptional
Activation Inactivation
activation
a PNPLA2
TAG DAG PRKCQ IRS IR A/B
PNPLA3 PRKCZ
Glycogen
ceramide
b synthesis
PPP2 AKT GS
GLUT4
TBC1D4
GSV
Glucose
TLR4 GLUT4
LPS
TNF
IKBK MAPK8
Lipogenic PPARGC1A
enzymes
unfolded protein
AFT6
ER response in the ER
Skeletal muscle C
Fig. 9.7 Pathways involved in muscle insulin resistance. The insulin-IR-IRS-PI3K-AKT sig-
naling axis promotes via TBC1D4 the translocation of GLUT4-containing storage vesicles (GSVs)
to the plasma membrane permitting the entry of glucose into the cell and also stimulates glycogen
synthesis via GS. This central signal transduction cascade is connected to a number of other path-
ways. (a). Green shaded: DAG-mediated activation of PRKCQ and the subsequent inhibition of
IRS, ceramide-mediated increases in the AKT inhibitor PPP2 and increased sequestration of AKT
by PRKCZ. Impaired AKT2 activation limits translocation of GSVs to the plasma membrane,
resulting in impaired glucose uptake. It also decreases insulin-mediated glycogen synthesis. (b).
Yellow shaded: Inflammatory pathways, such as the activation of IKBK affecting ceramide synthe-
sis and the activation of MAPK8 inhibiting IRS via phosphorylation. (c). Pink shaded: The
unfolded protein response in the ER leading to activation of ATF6 and a PPARGC1A-mediated
response. Key lipogenic enzymes in the ER membranes stimulate lipid droplet formation
esterify with sphingosine to form ceramides. This means that the levels of the sec-
ond messengers DAG and ceramide rise in parallel to the increased lipid load of the
cells. Intracellular lipid droplets possess a mantle of enzymes, such as the lipases
patatin-like phospholipase domain containing (PNPLA) 2 and PNPLA3, that regu-
late the entry and exit of lipid molecules and catalyze their lysis, for example from
triacylglycerols to DAG. Thus, these enzymes are essential both for the access of the
energy stored in triacylglycerols and the generation of lipid mediators of insulin
resistance. Interestingly, PNPLA2 is an AMPK target.
Both in muscle and in liver DAG activates members of the protein kinase C fam-
ily, such as PRKCQ, that impair insulin signaling via inhibition of IRS1 and IRS2
resulting in a decreased glucose uptake via GLUT4 (Figs. 9.7 and 9.8). Ceramides
dampen insulin signaling (i) by the activation of protein phosphatase 2 (PPP2)
9.4 Insulin Resistance in Skeletal Muscle and Liver 175
Insulin
Transcriptional
Activation Inactivation
activation
a PNPLA2
TAG DAG PRKCQ IRS IR A/B
PNPLA3
PRKCZ
b Ceramide
Glycogen synthesis
synthesis PPP2 AKT FOXO1
Gluconeogenesis
SREBF1
TLR4
LPS
TNF
XBP1
Lipogenic
enzymes
unfolded protein
Liver ER response in the ER
CEBP
Fig. 9.8 Pathways involved in hepatic insulin resistance. The insulin-IR-IRS-PI3K-AKT sig-
naling axis promotes glycogen synthesis (not shown), suppresses gluconeogenesis and activates de
novo lipogenesis. This central signal transduction cascade is connected to a number of other path-
ways. (a). Green shaded: DAG-mediated activation of PRKCQ and subsequent inhibition of IRS,
ceramide-mediated increases in PPP2 and increased sequestration of AKT by PRKCZ. Impaired
AKT2 activation (i) limits the inactivation of FOXO1 leading to increased expression of key
enzymes of gluconeogenesis and (ii) decreases insulin-mediated glycogen synthesis (not shown).
(b). Yellow shaded: Inflammatory pathways, such as the activation of IKBK affecting ceramide
synthesis and the activation of MAPK8 impairing lipogenesis. (c). Pink shaded: The unfolded pro-
tein response in the ER leads to increased lipogenesis via XBP1 and also increased gluconeogen-
esis via CEBPs. The ER membrane also contains key lipogenic enzymes stimulating lipid droplet
formation. Proteins that regulate the lipid release from these droplets, such as PNPLA2 and
PNPLA3, can modulate the concentration of key lipid intermediates in discrete cell
compartments
dephosphorylating AKT and (ii) via PKCζ that binds AKT and prevents its activa-
tion. When in the liver the rates of DAG synthesis from fatty acid re-esterification
and de novo lipogenesis exceed the rates of lipid oxidation in the mitochondria, i.e.
when there is an increase of DAG levels, PRKCE is activated, IR tyrosine kinase
activity is inhibited, GSK3 is hyperphosphorylated and glycogen synthesis is
decreased. Furthermore, this leads to increased translocation of FOXO to the
nucleus promoting elevated expression of gluconeogenic enzymes, such as PCK2
and G6PC (Fig. 9.8).
Ectopic accumulation of lipids in the liver is termed non-alcoholic fatty liver dis-
ease (NAFLD). Many individuals with this disease also have increased visceral adi-
176 9 Glucose Homeostasis, Insulin Resistance and β Cell Failure
posity (Sect. 8.1), but hepatic insulin resistance is primarily related to intra-hepatic
lipid content, not to the visceral fat mass. Lipid overload in the liver can be caused
both by increased delivery, such as in obese individuals, as well as by decreased
export caused, for example, by malfunctional APOC3 proteins. Stress of the ER
caused by the accumulation of unfolded proteins in its lumen (Sect. 7.5) plays a
special role in the pathogenesis of insulin resistance in the liver. Activation of three
key proteins of the unfolded protein response, EIF2AK3, ERN1 and ATF6, results
in increased membrane biogenesis, stop of protein translation and elevated expres-
sion of chaperone proteins in the ER. Via the activation of MAPK8 this leads to
inhibitory serine phosphorylation of IRS1 (Sect. 9.2) (Fig. 9.8). Moreover, the
unfolded protein response results in an expansion of the ER membrane and increases
the expression of SREBF1 (Sect. 3.1) and MLX interacting protein-like (MLXIPL),
which both stimulate lipogenesis. Thus, the unfolded protein response causes
hepatic insulin resistance, when it is able to alter the balance of lipogenesis and lipid
export to promote hepatic lipid accumulation.
Inflammatory mediators and adipokines, such as TNF, secreted from adipose tis-
sue (Sect. 8.6), can act locally in a paracrine manner or they leak out of the adipose
tissue causing a systemic effect (endocrine action) on insulin sensitivity in muscle
and liver cells. Via the TNF receptor (TNFR) signaling axis this activates MAPK8
and IKBK (Figs. 9.7 and 9.8). Like in the unfolded protein reaction, this inflamma-
tory response results in the inactivation of IRS1 and thus leading to insulin resis-
tance. MAPK8 and IKBK also phosphorylate and activate transcription factors,
such as AP-1 and NF-κB, leading to increased expression of inflammatory media-
tors. In parallel, activation of TLR4 by PAMPs, such as SFAs, in skeletal muscle and
liver cells further enhances the NF-κB pathway.
The failure of β cells during the progression to T2D involves their chronic exposure
to glucose and lipids, also known as “glucotoxicity” and “lipotoxicity”, or in com-
bination “glucolipotoxicity”. The chronic glucose exposure increases glucose
metabolism in β cells, leading to the formation of citrate, which acts as a signal for
the formation of malonyl-CoA in the cytosol (Fig. 9.9). Malonyl-CoA inhibits the
key fatty acid transporter in mitochondria, carnitine palmitoyltransferase 1A
(CPT1A), and blocks in this way fatty acid β-oxidation. This causes accumulation
of SFA-CoAs in β cells. The high demand for insulin secretion during hyperglyce-
mia creates significant metabolic stress to the ER of β cells and results in the over-
production of ROS in their mitochondria.
This oxidative stress is a central element of glucotoxicity. When intracellular
glucose concentrations exceed the glycolytic capacity of β cells, some of the mole-
cules are converted to enediol intermediates, leading to superoxide formation. Since
β cells contain only low levels of anti-oxidant enzymes, such as catalase, glutathi-
one peroxidase and SOD2, they are very susceptible to superoxide damage.
9.5 β Cell Failure 177
Glucose Lipids
Insulin, amylin
Amyloid fibrils
hypersecretion
cellular
membrane
CYTOPLASM
Stress relief
Unfolded protein
response XBP1
NUCLEUS
Fig. 9.9 Mechanisms of β cell failure. Overnutrition and/or increased lipid supply induces in
mitochondria of β cells enzymes of β oxidation, such as CPT1A, resulting in increased acetyl-CoA
levels, allosteric activation of PC and constitutive up-regulation of pyruvate cycling. This leads to
increased basal secretion of insulin and a loss of the glucose-stimulated increment in the flux of
pyruvate cycling, i.e. blunting of glucose-stimulated insulin secretion. The elevated demand for
synthesis of insulin in the ER increases the stress to this organelle, thus resulting in elevated rates
of protein misfolding. The protein unfolding response is initially able to balance this ER stress, but
over time this becomes less effective, and the deleterious effects of ER stress leads to cell death.
Insulin hypersecretion is accompanied by amylin secretion forming amyloid fibrils that accumu-
late at the surface of β cells and induce dysfunction and apoptotic death to the cells
Moreover, β cells have many mitochondria and consume more oxygen than most
other cell types. Therefore, at high glucose conditions, such as directly after a meal,
the accelerated mitochondrial function enhances the oxygen consumption and
causes hypoxia. This parallels with the increased expression of hypoxia-inducible
genes. In addition, T2D patients have an expanded ER in their β cells indicating
increased stress to the organelle. The hyperinsulinemia in response to chronic
hyperglycemia disrupts ER homeostasis in β cells due to the exceeded capacity for
proinsulin biosynthesis. This leads to accumulation of misfolded proteins and
induction of the unfolded protein response (Sect. 7.5), which enhances the oxidative
stress and eventually results in β cell dysfunction.
Patients with a long clinical history of T2D (Chap 10) commonly have a
decreased β cell number and function, respectively, which is often referred to as “β
cell exhaustion”. Compared with weight-matched healthy individuals, obese T2D
patients have a 63% reduction of β cell mass, while lean T2D patients only show a
41% loss. This suggests that β cell dysfunction has a primary role in the pathogen-
178 9 Glucose Homeostasis, Insulin Resistance and β Cell Failure
Hyperglycemia
Oxidative stress
β cells ER stress
Hypoxic stress
Cytokine induction
Failure of
Apoptosis
proliferation
Autophagy De-differentiation
Fig. 9.10 Principles of β cell failure in T2D. Prolonged hyperglycemia results in oxidative, ER
and hypoxic stress and in increased exposure of β cells with cytokines. Therefore, β cells may
cease their proliferation, de-differentiate or undergo uncontrolled autophagy or apoptosis. All
these processes reduce the number of β cells and their function. This leads dysfunction and deple-
tion of β cells and to progress of T2D
but not in healthy individuals, a sustained increase in plasma FFA levels causes
β cell dysfunction.
In β cells, FOXO1 proteins are constitutively localized to the cytoplasm, which
is in contrast to hepatocytes, muscle cells and adipocytes (Sect. 9.3). This is due to
the continuous endogenous production of insulin, which activates AKT and keeps
FOXO1 in the cytoplasm. However, in response to oxidative stress, FOXO1 is acet-
ylated by CBP/p300-interacting transactivator 1 (CITED1) and translocates to the
nucleus. The acetylation of FOXO1 also prevents ubiquitination of the protein and
thus enhances its nuclear retention (Sect. 9.3). In addition, oxidative stress and ER
stress activate MAPK8, which phosphorylates FOXO1 and further keeps the pro-
tein in the nucleus. Since FOXO1 regulates the expression of anti-oxidant enzymes,
such as catalase and SOD2, this should protect β cells against various stressors.
Future View
The insulin signaling axis via IR, IRS, PI3K, AKT and FOXO is a paradigm for the
complexity and flexibility of a molecular signaling pathway. Although this signaling
cascade is better understood than many other pathways, in future we need to get
significantly more insight, in order to monitor the molecular response of metabolic
organs to metabolic and inflammatory stress in health and disease. A critical issue
will be the understanding of the post-translational modification code of key regula-
tory proteins, such as FOXOs. Furthermore, we need to better understand, (i) the
mechanisms that drive and regulate the lipid accumulation in skeletal muscle and
liver, (ii) the genes involved in lipid uptake, transport and export, (iii) how diet regu-
lates lipid accumulation causing or protecting against insulin resistance and (iv) the
mechanisms of β cell failure and the genes involved in this process.
Key Concepts
• Glucose homeostasis controls glucose production and glucose use even at physi-
ological challenges, such as food ingestion, fasting and intense physical exercise,
and maintains the blood glucose level within the range of 4–6 mM.
• The first phase of insulin secretion primarily prevents the liver from producing
more glucose by stimulating glycogen synthesis and suppressing gluconeogen-
esis. The second phase, approximately 1–2 h after the meal, stimulates glucose
uptake by insulin-sensitive tissues, such as skeletal muscle and adipose tissue.
• Insulin resistance is a major predictor for the development of T2D and the meta-
bolic syndrome.
• IR/IRS, PI3K and AKT form three important nodes in the insulin signal trans-
duction cascade being responsible for most of the metabolic actions of insulin,
such as glucose uptake, glucose synthesis and inhibition of gluconeogenesis.
• The most important downstream target of PI3K is the serine/threonine kinase
AKT, which phosphorylates a number of key proteins, such as GSK3, TBC1D4
and FOXO1.
• FOXOs have a special role at the interconnection of aging and disease. Their
main function is to maintain homeostasis in response to environmental stress,
such as an increased oxidative status, starvation or overnutrition.
180 9 Glucose Homeostasis, Insulin Resistance and β Cell Failure
Additional Reading
Keywords T1D • T2D • OGTT • Insulin • β cells • Liver • Skeletal muscle • Adipose
tissue • Inflammation • MODY • GWAS • Epigenetic programming • Thrifty gene
hypothesis
their blood. Without insulin, a person with T1D will die. This type of diabetes has a
sudden onset and usually affects children of 10 years or older, i.e. in an age when
their immune system has reached full potency. The number of people who develop
T1D is increasing, which may be due to changes in environmental risk factors, pre-
natal events, diet early in life or viral infections.
T2D is the most common type of diabetes, representing more than 90 % of all
diabetes cases. It usually occurs in adults, but is increasingly seen in children and
adolescents. In initial stages of T2D, β cells are still able to produce insulin, but
either the amounts are insufficient or the body is unable to respond to its effects
(known as insulin resistance, Sect. 9.4), both leading to elevated glucose levels in
the blood. T2D often remains unnoticed and undiagnosed for years, i.e. the respec-
tive persons are unaware of the already smouldering long-term damage being caused
by their disease. In contrast to people with T1D, the majority of T2D patients usu-
ally do not require daily doses of insulin to survive. Many T2D patients are able to
manage their hyperglycemia through a healthy diet and increased physical activity
or by oral medication for a rather long time (Sect. 10.2). However, when they reach
10.1 Definition of Diabetes 183
a stage, in which they are unable to regulate their blood glucose levels, they need
external insulin substitution. Women, who during pregnancy may develop a resis-
tance to insulin (mostly around the 24th week due to hormones produced by the
placenta) and subsequent develop high blood glucose levels, have gestational
diabetes. Uncontrolled gestational diabetes can have serious consequences for both
the mother and her baby and increases the risk of the child to develop T2D later in
life.
An oral glucose tolerance test (OGTT) with measurements of glucose and insu-
lin at defined times (for example, 0, 30, 60 and 120 min) after oral uptake of a
defined amount of glucose (often 75 g) is the easiest way to determine the glucose
homeostasis status of human individuals (Box 10.2). Healthy persons have a fasting
blood glucose level in the order of 5 mM, already 1 h after the glucose bolus show
a peak below 10 mM and return to less than 7.8 mM after 2 h (Fig. 10.1, No. 1).
Individuals that start at normal glucose concentrations but after 2 h still have levels
higher than 7.8 mM have impaired glucose tolerance (Fig. 10.1, No. 2). However,
when the fasting glucose level exceeds 7 mM and after 2 h still is higher than
11.1 mM, the person is considered diabetic (Fig. 10.1, No. 3). The response
measured in the OGTT reflects (i) the ability of β cells to secrete insulin and (ii) the
responsiveness of the whole body to insulin. For example, someone with a fasting
glucose in the range of 6.1–7.0 mM is categorized to have impaired fasting glucose
and may have established insulin resistance (Sect. 9.4). These individuals have
impaired glucose homeostasis and are at increased risk to develop T2D.
184 10 Diabetes
11
7.8M mM
.1
m
Pre-diabetes
Normal Diabetes
1 2 3
12
person 3
10
Serum glucose (mM)
person 2
8
6
person 1
4
0 30 60 90 120 150
Time after oral glucose administration (min)
Fig. 10.1 Oral glucose tolerance test. The test measures how the human body responds to an oral
challenge of glucose (usually as a drink of 75 g). Blood glucose is measured in a time course (for
example, every 30 min over 2 h). The glucose level increases quickly, but the secretion of insulin
should manage the normalization of the glucose concentration after 2 h (5 mM, person No. 1).
Person No. 2 has normal fasting plasma glucose levels, but due to impaired glucose tolerance does
not return after 2 h to normal concentrations (below 7.8 mM). In contrast, person No. 3 is diabetic,
since his/her fasting glucose level already exceeds 7.8 mM, and the 2 h value is clearly elevated,
respectively
The worldwide T2D prevalence of adults is 8.3 % (2014) and this rate will further
increase (Fig. 10.2). The incidence of diabetes rises when countries become more
industrialized, people eat a more sugar- and fat-rich diet and are less physical active.
In high-income countries, primarily people above the age of 50 years become T2D,
while in middle-income countries the highest prevalence is in younger persons. As
these populations age, the prevalence will rise further due to the increase of older
age groups. The mortality rate of diabetes varies sharply with the economy of the
country. In 2011, the disease caused more than 3.5 million deaths in middle-income
countries, of which more than 1 million were in China and just less than a million
were in India. Mortality rates are significantly lower in high-income countries with
a more developed healthcare system, but in 2011 also in the United States still some
180.000 people died due to T2D.
10.2 Failure of Glucose Homeostasis in T2D and Its Treatment 185
52 M
(7.9%)
33.1%
undiagnosed
39 M
(11.4%)
27.1%
undiagnosed 75 M
(8.3%)
52.8%
37 M undiagnosed
(9.7%)
48.6%
undiagnosed
138 M
22 M (8.5%)
53.6%
25 M (5.1%) undiagnosed
62.5%
(8.1%) undiagnosed
27.4%
undiagnosed
Fig. 10.2 Diabetes in numbers. The majority of the 387 million people with diabetes (2013) are
between 40 and 59 years old. The present worldwide prevalence of the disease is 8.3 %. Until 2035,
the number of people with diabetes will increase by 55 %. An additional 21 million cases of hyper-
glycemia during pregnancy, i.e. 17 % of live births to women in 2013, contribute to the global
burden of diabetes. Worldwide diabetes caused 5.1 million deaths and consumed some 548 billion
dollars (11 % of the total) in health spending in 2013. Despite the predominantly urban impact of
the epidemic, T2D is rapidly becoming also a major health concern in rural communities in low-
and middle-income countries. No country seems to be escaping this diabetes “epidemic”
Triacylglycerols Triacylglycerols
Liver
Carbohydrate
intake Glycogen synthesis
Glycogen synthesis Gluconeogenesis
Gluconeogenesis
Lipid re-esterification
De novo lipogenesis
Glucose
Triacylglycerols
Insulin
Pancreas Insulin
β cells Glucose
Fatty acids Fatty acids
Glucose Lipolysis
Glucose transport Lipolysis
Glycogen synthesis
Glycogen Glycogen
Skeletal
IMCL IMCL
muscle
White
adipose tissue
Fig. 10.3 Insulin action in T2D. In T2D, insulin-mediated skeletal muscle glucose uptake is
impaired, which directs glucose to the liver. Increased hepatic lipid levels impair the ability of
insulin to regulate gluconeogenesis and to stimulate glycogen synthesis. However, lipogenesis is
not affected. In combination with increased delivery of dietary glucose, this stimulates lipogenesis
causes NAFLD. Impaired insulin action in adipose tissue increases lipolysis, which promotes re-
esterification of lipids in other tissues, such as the liver, and further exacerbates insulin resistance.
In combination with a decline in the number of active β cells, this leads to the development of
hyperglycemia. IMCL = intramyocellular lipid
with increased glucagon levels (Sect. 9.5). The shift in the glucagon/insulin ratio
leads to a further rise in hepatic gluconeogenesis, i.e. more glucose is released by
the liver to the circulation. In consequence, basal and post-prandial blood glucose
levels are chronically increased (Fig. 10.1), i.e. the individual has hyperglycemia.
Moreover, defective insulin secretion also causes dyslipidemia, including perturbed
homeostasis of fatty acids, triacylglycerols and lipoproteins (Fig. 10.3) (Sect. 11.4).
The defective insulin secretion and responses in T2D have several reasons. For
example, constant exposure of β cells to elevated levels of glucose and lipids, i.e.
gluco-lipotoxicity, induces their dysfunction and ultimately triggers their death
(Sect. 9.5). These processes are related to chronic inflammation of pancreatic islets
(Fig. 10.4). Elevated glucose levels increase the metabolic activity of the islet cells,
in which via increased ROS production, the NLRP3 inflammasome is activated
(Sect. 7.1). In addition, increased insulin demand and production induces ER stress
to β cells (Sect. 7.5) further activating the inflammasome. Moreover, endotoxins or
Fetuin A-bound FFAs can stimulate TLR2 and TLR4 that lead to the translocation
of NF-κB into the nucleus and the induction of the expression of pro-inflammatory
genes, such as IL1B, IL6, IL8, TNF and CCL2. Like in other inflammatory scenar-
ios (Sect. 7.4), this cytokine production leads to the attraction of macrophages and
10.2 Failure of Glucose Homeostasis in T2D and Its Treatment 187
Glucose Glucose
FFA FFA
Endotoxins Endotoxins
Fetuin-A
Fetuin-A
TLR4
TLR4
R1
activation IL1R1 Cannabinoid
CN
receptor 1
Pro-IL1B Pro-IL1B
inflammasome
NLRP3 NLRP3
Caspase 1 IL1B Caspase 1
Cannabinoid
receptor 1
Macrophage
Cytokines, chemokines
Endocannabinoids
Fig. 10.4 β cells inflammation in T2D. Prolonged exposure of β cells to elevated concentrations
of glucose and FFAs increases the metabolic activity of these cells and ROS formation. This acti-
vates the NLRP3 inflammasome, leading to the production and release of IL1B. Endocannabinoids
can also activate the inflammasome via the cannabinoid receptor 1 (CNR1). In parallel, TLR2 and
TLR4 are stimulated by endotoxins or Fetuin A-bound FFA, which via NF-κB activation causes
the expression of pro-inflammatory genes. IL1B induces the expression of various cytokines and
chemokines that lead to the attraction of macrophages. These macrophages are then activated by
high levels of glucose, FFAs, endotoxins and endocannabinoids
other immune cells. Furthermore, the islets produce an amyloid polypeptide that
aggregates to form amyloid fibrils in patients with T2D. In net result, resident islet
macrophages adopt a pro-inflammatory M1 phenotype that induces islet
dysfunction.
Current treatments for T2D include insulin, the indirect AMPK activator metfor-
min, KATP channel inhibiting sulphonylureas, PPARγ-activating thiazolidinediones
and inhibitors of either starch- and disaccharides-digesting α-glucosidase or of glu-
cose transporters. Each of these therapies can improve hyperglycemia, and some
may even delay the onset of diabetes. However, none of these drugs can slow down
the progressive decline in insulin secretion. Intensive diabetes treatment results in
tight glycemic control and therefore a substantial reduction in the risk of microvas-
cular complications. Since T2D is often associated with hypertension and dyslipid-
emia (Sects. 11.1 and 11.4), respective drugs are prescribed to most patients with
T2D in addition to glucose-lowering medications. However, several anti-diabetic
drugs are associated with adverse effects, for example gastrointestinal symptoms
with metformin therapy, increase in body weight with sulphonylureas, increase in
body weight under insulin, and bone fractures with thiazolidinedione medication.
Importantly, T2D can be prevented by lifestyle changes. For example, already a
moderately increase in physical activity combined with a decrease in caloric intake,
aiming for a persistent 5–10 % weight loss, reduces the risk for T2D by more than
50 %. One goal of future personalized medicine should be to identify those patients
who will most likely benefit from serious lifestyle changes, such as substantial
weight loss.
188 10 Diabetes
1 2 3 4 5 6 7 8 9 10 11 12
WFS1
PPARG CDKAL1 CAMK1D KCNJ11
JAZF1 CDKN2A-2B
THADA
ADAMT59 TSPAN8
HHEX-IDE MTNR1B
IGF2BP2
13 14 15 16 17 18 19 20 21 22 X Y
HNF1B
FTO
Fig. 10.5 Insights into the genetic basis of T2D. Examples of 18 genes are shown that were
identified by GWAS to be associated with T2D. Four genes were previously known as T2D candi-
date genes, while the remaining 14 genes have previously not been suspected to play a role in T2D,
such as MTNR1B, which shows the involvement of the circadian rhythms in T2D. The genes that
participate in β cell disturbance have diverse functions, such as pancreatic islet proliferation, insu-
lin secretion and cell signaling. SNPs of further six genes are statistically associated with T2D, but
their role has not yet been identified
to be associated with T2D. They all represent common SNPs with minor allele fre-
quencies (MAFs) ranging from 7.3 to 50 %. The gene transcription factor 7-like 2
(TCF7L2) has an odds ratio (OR) of 1.37 for developing T2D (i.e. an 37 % increased
T2D risk), while the ORs for the 17 remaining genes range only between 1.05 and
1.15 (5–15 % increased risk). These numbers are comparable to what is observed for
other common traits and diseases, such as obesity (Sect. 8.4). Some of the 18 T2D
risk genes, such as CDK5 regulatory subunit associated protein 1-like 1 (CDKAL1),
the zinc transporter SLC30A8, the transcription factor hematopoietically expressed
homeobox (HHEX) and potassium inwardly-rectifying channel, subfamily J, mem-
ber 11 (KCNJ11), are involved in insulin secretion in β cells. This suggests that the
common risk for T2D agrees with the findings of monogenetic diabetes.
However, the genetic propensity to develop T2D involves also genes in a number
of additional pathways that affect β cell formation and function, as well as pathways
affecting fasting glucose levels and obesity. The cluster of the cyclin-dependent
kinase inhibitor (CDKN) 2A and 2B controls β cell growth, melatonin receptor 1B
(MTNR1B) links circadian rhythms (Sect. 3.6) with fasting glucose levels, FTO is
the key risk gene for obesity (Sect. 8.4), PPARG encodes for the master regulator of
adipogenesis (Sect. 8.5) and insulin-like growth factor 2 mRNA binding protein 2
190 10 Diabetes
Intermediate
variants with
intermediate effect
Common
1.5 Rare variant of variant
Modest
Fig. 10.6 Identifying genetic variants by risk allele frequency. The strength of the genetic
effect is indicated by odds ratios. Most emphasis and interest lies in identifying associations with
characteristics shown within the diagonal box
(IGF2BP2) is involved in insulin signaling (Sect. 9.2). However, for the remaining
T2D risk genes no direct link to metabolic homeostasis had been identified so far
(Fig. 10.5). This indicates that not always the closest genes to the T2D-associated
SNP provide a functional explanation, but in some cases more distant genes may be
involved.
However, the 18 genetic variants explain only some 4 % of the heritable risk for
T2D. In the meantime, larger study populations and meta-analyses of existing stud-
ies increased the number of T2D risk genes to more than 40 (www.genome.gov/
gwastudies). The additional genes have similar or even lower MAFs and ORs.
Nevertheless, in personalized medicine approaches, such as exemplified iPOP (Sect.
4.6), the presently known T2D risk genes are already used as predictive markers.
Moreover, for some forms of MODY different therapies are suggested, such as high
sensitivity of HNF1A mutations to sulphonylurea drugs. Taken together, this sug-
gests that T2D is a very heterogenous disease that can be segregated into multiple
subtypes, which should be treated on a personalized basis on the individual’s genetic
background and phenotype.
In general, common SNPs are characterized by low ORs, while rare monoge-
netic forms of T2D have high ORs (Fig. 10.6). However, both extremes do not
explain all genetic basis of T2D. Like for many other common diseases and traits,
also for T2D it is assumed that there is a large number of low frequency SNPs with
10.4 Thrifty Gene Hypothesis 191
intermediate ORs. These genetic variants will be identified by the use of whole
genome sequencing (Sect. 2.6). Nevertheless, these additional genetic variations
will not be able to explain all heritability of T2D. In contrast, pre-natal and post-
natal epigenetic programming via DNA methylation (Sect. 10.4) will demonstrate
its contribution to the disease risk.
Fig. 10.7 Thrifty gene hypothesis in T2D. T2D can be the outcome of maternal-fetal malnutri-
tion, such as poor maternal diet, low maternal fat stores or reduced transfer of nutrients because of
placental abnormalities. The fetus adapts to this environment by being nutritionally thrifty, result-
ing in decreased fetal growth, islet function and β cell mass and other hormonal and metabolic
adaptations. A transition to overnutrition later in adult life exposes the impaired islet function to
increased metabolic stress, which is further enhanced by obesity and age, so that T2D results.
Thus, the thrifty gene hypothesis is based on an altered epigenetic programming that aids survival
pre- and early post-natally
192 10 Diabetes
more a human population have been selected for longer periods of famine in recent
evolutionary history, the more their members are prone to develop obesity and T2D
when exposed to high-fat diet. In the past it was a clear evolutionary advantage,
when an individual could store efficiently energy in form of WAT hypertrophy,
since food was never constantly available in large amounts. In contrast, in today’s
obesogenic environment, the offspring of these people suffers from obesity and
T2D. This also implies that those human populations who did not experience long
periods of starvation in past few 100 years, such as the Europeans, have still a rela-
tively low prevalence for T2D. Interestingly, the prevalence of T2D in European
immigrants of British and German ancestry to the United States and Australia is
significantly higher than that of British and German people still living in Europe
with similar lifestyles. The people who stayed in Europe tended to be richer than
those who emigrated, i.e. poorer people are more likely starvation-prone carrying
the thrifty genotype.
The experience from the already discussed Dutch hunger winter (Sect. 5.5) pro-
vides a molecular explanation for an increased obesity and T2D risk. The in utero
environment has a strong impact on fetal programming, as individuals exposed to
either famine or maternal gestational diabetes during fetal development develop
obesity and/or T2D later in life more likely. Food-deprived conditions of the mother
change the epigenome of the fetus, so that genes involved in energy homeostasis are
more sensitive to food intake. In times of continued famine, this epigenetic sensitiz-
ing is a survival advantage, while in times of plenty food it may drive the individual
into obesity and T2D. DNA methylation is particularly sensitive to events during
development in utero, because DNA is almost fully demethylated during zygote
formation, and specific methylation is re-established throughout embryogenesis.
Patterns of DNA methylation at candidate genes, such as the LEP gene, associate
with in utero exposure to famine and to maternal impaired glucose tolerance during
pregnancy.
However, epigenetic programming happens not only during the pre-natal phase,
but occurs also in the post-natal and adult phases of life. It is not clear how many
generations’ epigenetic marks can be inherited, but it is obvious that epigenetic
inheritance is not comparably persistent as genetic inheritance. Therefore, popula-
tions that made a very fast transition from famine to food surplus, for example
within 1–2 generations, are under higher risk for T2D than those that were improv-
ing the nutritional conditions over many generations. T2D patients, who maintain
intense glucose control, remain at increased risk of macrovascular complications
and diabetic organ damage even years after the initial diagnosis. This “glycemic
memory” is also an epigenetic effect, i.e histone methylation changes within human
aortic endothelial cells in response to increased glucose exposure.
Future View
Diabetes, like cancer, is a very heterogenous disease that in future will be diagnosed
and treated on the basis of their molecular features, i.e. on a far more personalized
basis. One particular goal will be to use personalized lifestyle and medication, in
order to reduce the risk of cardiovascular complications of T2D. Since most cases
Additional Reading 193
of T2D are preventable, in future far more effort will be taken in detecting early
genetic and epigenetic markers for increased T2D susceptibility. Such epigenetic
markers will help to detect children, or families, respectively, for whom intensive
lifestyle intervention are likely to prevent the onset of metabolic disease.
Key Concepts
• Diabetes is a condition of chronically elevated plasma glucose levels that eventu-
ally causes toxicity to blood vessels.
• In contrast to people with T1D, T2D patients at least in the beginning do not
necessarily require daily doses of insulin to survive.
• Healthy persons have a fasting blood glucose level in the order of 5 mM, already
1 h after a defined glucose bolus show a peak with less then 10 mM and return to
less than 7.8 mM after 2 h. However, when the fasting glucose level exceeds
7 mM and is after 2 h still higher than 11.1 mM, the person fulfills the definition
of T2D.
• The worldwide T2D prevalence of adults is 8.3 % (2014) and will further rise.
• T2D basically is an age-related disease that is strongly promoted by overnutri-
tion and physical inactivity. In pre-disposed individuals, insulin secretion defects
are mostly detected together with a reduced response to insulin-stimulated glu-
cose uptake in the liver and adipose tissues, referred to as insulin resistance.
• All MODY genes are expressed in β cells and affect insulin secretion, while the
normal control of glucose metabolism via insulin involves a number of addi-
tional organs, such as muscle, liver and fat.
• T2D is a very heterogenous disease that can be divided into multiple subtypes,
which might be treated personalized based on the individual’s genetic back-
ground and phenotype.
• The thrifty gene hypothesis suggests that the ancestors of some human popula-
tions have an epigenetically programmed increased T2D susceptibility because
their ancestors went through an evolutionary bottleneck of prolonged periods of
starvation. The more a human population had been selected for longer periods of
famine in recent evolutionary history, the more their members are prone to
develop obesity and T2D when exposed to the high-fat diet.
• Populations that made a very fast transition from famine to food surplus, such as
within 1–2 generations, are under higher risk for T2D than those that had
improved their nutritional conditions over many generations.
Additional Reading
Donath MY (2014) Targeting inflammation in the treatment of type 2 diabetes: time to start. Nat
Rev Drug Discov 13:465–476
Grayson BE, Seeley RJ, Sandoval DA (2013) Wired on sugar: the role of the CNS in the regulation
of glucose homeostasis. Nat Rev Neurosci 14:24–37
194 10 Diabetes
Abstract Hypertension is the most important preventable risk factor for pre-mature
death. Chronically elevated blood pressure increases the risk of ischemic heart dis-
ease, stroke, peripheral vascular disease and other CVDs, such as heart failure, aor-
tic aneurysms, diffuse atherosclerosis and pulmonary embolism. The high
consumption of saturated fat, low intake of fruit and vegetables and whole grain
fiber high-cholesterol diets, i.e. Western-type diet, can lead to hypercholesterolemia
and atherosclerosis, especially in genetically predisposed individuals.
Atherosclerosis is a chronic inflammatory disease caused by the accumulation of
cholesterol-laden macrophages in the artery wall, i.e it is based on dyslipidemia and
an overeaction of the immune system. Central cells in atherosclerosis are macro-
phages and their phenotype, i.e. their programming to M1 and M2 type, which influ-
ences both disease progression and regression.
In this chapter, we will link three important risk factors for heart disease, hyper-
tension, atherosclerosis and dyslipidemia, in a combined mechanistic model. We
will understand that the susceptibility to CVD is associated with levels of plasma
lipids and lipoproteins. Like in obesity and T2D, the genetic basis of the cardio-
metabolic traits, such as plasma lipoprotein levels, can be explainable to a minor
part on a monogenetic basis causing a large effect and to a larger part by common
genetic variants with minor effects on the trait. This will provide another example
how molecular medicine is applied, in order to diagnose and treat the basis of a
disease.
11.1 Hypertension
Each cycle of heart contraction pumps some 70 ml blood into the systemic arterial
system, in order to supply all cells and tissues of the human body with oxygen and
nutrients. This pulsation creates pressure on the vascular walls that depends on the
amount of pumped blood and the resistance created by the vasculature. Due to the
periodic ejection of blood from the heart, this pressure is highest at the peak of a
Table 11.1 Blood pressure ranges. The systolic blood pressure indicates how much pressure
blood is exerting against the artery walls while the heart is pumping blood, while the diastolic
blood pressure measures the pressure while the heart is resting between beats. The ranges for
normal blood pressure, pre-hypertension, hypertension (stages I and II) and hypertensive crisis are
defined. In individuals older than 50 years, hypertension is present when the blood pressure is
consistently above 140 mm Hg systolic or 90 mm Hg diastolic.
Blood pressure category Systolic mm Hg (upper level) Diastolic mm Hg (lover level)
Normal less then 120 and less than 80
Pre-hypertension 120–139 or 80–89
Hypertension, stage 1 140–159 or 90–99
Hypertension, stage 2 160 or higher or 100 or higher
Hypertensive crisis higher than 180 or higher than 110
passing amount of blood (systolic) and lowest after its passage (diastolic). For
healthy adults the values should be in the order 120 millimeters of mercury (mm
Hg) systolic and 80 mm Hg diastolic, respectively (Box 11.1 and Table 11.1). Blood
pressure varies with physical activity and depends on diseases, such as obesity. It is
tightly regulated by signals from the SNS, in order to permit uninterrupted blood
perfusion of all vital organs. For example, even transient interruption in blood flow
to the brain causes loss of consciousness, and longer interruptions will result in
death of unperfused tissues, such as in cerebral stroke or myocardial infarction
(Sect. 11.2).
Increased salt reabsorption in the kidneys, for example after a salty meal, requires
increased water reabsorption, in order to maintain plasma sodium concentration at
some 140 mM. This results in an increased intravascular volume boosting venous
blood return to the heart. Thus, the cardiac output raises and leads to elevated blood
pressure. A central point for salt absorption is the Na+ channel SCNN1 in the corti-
cal collecting tubule of the kidney. Decreased delivery of salt leads to increased
secretion of the aspartyl protease renin resulting in the secretion of the peptide hor-
mone angiotensin. This causes vasoconstriction and a subsequent increase in blood
pressure. Angiotensin binds to its specific G protein-coupled receptor in the adrenal
gland inducing there the production of aldosterone, i.e. the ligand of the nuclear
11.2 Mechanisms of Atherosclerosis 197
The endothelium is a single layer of endothelial cells that covers blood vessels and
serves as a barrier between the circulating blood and subendothelial tissues. In ath-
erosclerosis, cholesterol deposition below the endothelium causes a macrophage-
dominated inflammatory response in large and medium arteries. Some atherosclerotic
lesions can develop already in the first years of life, and 95 % of humans by the age
of 40 have some type of lesion. However, in most cases clinical manifestations
198 11 Hypertension, Atherosclerosis and Dyslipidemias
1 Stroke
Vision problem 2
3 Heart attack
4 Kidney failure
Blood vessel
5
damage
Fig. 11.1 Main complications from hypertension. Hypertension is the most important prevent-
able risk factor for pre-mature death worldwide. It increases the risk of ischemic heart disease,
strokes, peripheral vascular disease and other cardiovascular diseases, including heart failure, aor-
tic aneurysms, diffuse atherosclerosis and pulmonary embolism. Hypertension is also a risk factor
for cognitive impairment and dementia as well as for chronic kidney disease. Other complications
include hypertensive retinopathy and hypertensive nephropathy
occur not before the age of 50–60 years. The distribution of atherosclerotic plaques,
i.e. the core lesions of atherosclerosis, is not randomly, but they tend to accumulate
at the inner curvatures and branch points of arteries, i.e. at positions where laminar
flow is either disturbed or insufficient, in order to maintain the normal, quiescent
state of the endothelium.
A first sign of lesion formation is the accumulation of cholesterol within the arte-
rial wall, referred to as fatty streaks. This is initiated by the sequestration of
cholesterol-rich, APOB-containing lipoproteins, called LDLs (Sect. 11.3). When
LDLs are modified by oxidation, enzymatic and non-enzymatic cleavage and/or
aggregation, they become pro-inflammatory and stimulate endothelial cells to pro-
duce chemokines, such as CCL5 and CXCL1, glycosaminoglycans and P-selectin
for the recruitment of monocytes. Hypercholesterolemia and cholesterol accumula-
tion in hematopoietic stem cells promotes the overproduction of monocytes leading
11.2 Mechanisms of Atherosclerosis 199
Lumen
Endothelial
cell oxidized LDL
RETENTION FACTORS
Netrin 1
Semaphorin 3E
Monocyte-
derived DC native LDL T cell
Intima
CD36 CYTOKINES
IL1B, IL6 and TNF
T cell
MSR1
CHEMOKINES
Macrophage Foam cell CCL2, CCL5 and CXCL1
Media
Fig. 11.2 Monocyte recruitment and accumulation in plaques. Hyperlipidemia increases the
number of monocyte subsets that are recruited to atherosclerotic plaques. Different chemokine-
chemokine receptor pairs and endothelial adhesion molecules, such as selectins, ICAM1 and
VCAM1, mediate the infiltration of the monocytes into the intima. There the monocytes differen-
tiate into macrophages or dendritic cells and interact with atherogenic lipoproteins. Macrophages
take up native and oxidized LDLs via macropinocytosis or scavenger receptors, such as MSR1 and
CD36, resulting in the formation of foam cells (Box 11.2). These foam cells secrete pro-
inflammatory cytokines, such as IL1B, IL6 and TNF, and chemokines, such as CCL2, CCL5 and
CXCL1, as well as macrophage retention factors, such as netrin 1 and semaphorin 3E, that amplify
the inflammatory response
cytokines, such as IL6 and IL12, matrix-degrading proteases as well as ROS and
NO. The plaque macrophages are subject to both retention and emigration signals
and a misbalance of these processes contributes to the net accumulation of plaque
macrophages. Dysregulation of lipid metabolism in foam cells contributes to ER
stress ultimately resulting in apoptotic cell death. Since defective lipid metabolism
pathways, such as cholesterol esterification and efflux, impair efficient clearance of
apoptotic cells, this results in necrosis and in the release of cellular components and
lipids that form the necrotic core (Fig. 11.4). Chronic inflammation stimulates the
migration of smooth muscle cells into the intima region, where they transform into
fibroblasts that proliferate and produce larger amounts of extracellular matrix. This
leads to the formation of fibrous atherosclerotic plaques. Due to the calcification of
the plaques, the artery wall becomes rigid, i.e. sclerotic and fragile. Most humans
11.2 Mechanisms of Atherosclerosis 201
LIPOPROTEIN UPTAKE
oxidized VLDL
LOX1 LDL
MACROPINOCYTOSIS MSR1
LDL
SCARB1
CD36
PHAGOCYTOSIS OF
LYSOSOMAL oxidized
AGGREGATED LDLs Endosome DYSFUNCTION LDL
LIPID EFFLUX
Lipid-poor APOAI NLRP3
ACID LIPOLYSIS Cholesterol INFLAMMASOME TLR4-6
crystal ACTIVATION CD36
Nascent PRO-INFLAMMATORY
HDL Free cholesterol SIGNALING
ABCA1 LYSOSOME
ER
TLR4
Mature ABCG1
Cholesterol-rich
HDL
Autophagosome lipid rafts
NUCLEUS
ACAT1 ER STRESS
Phagophore
Lipid droplets APOPTOSIS
Macrophage
Fig. 11.3 Lipoprotein uptake and efflux in macrophages. Via macropinocytosis, phagocytosis
of aggregated LDLs and scavenger receptor-mediated uptake, macrophages within the plaque
internalize native LDLs and VLDLs as well as oxidized lipoproteins. The internalized lipoproteins
and their associated lipids are digested in the lysosome releasing free cholesterol. The latter moves
to the plasma or ER membrane and can be effluxed from there. The enzyme ACAT1 in the ER
membrane esterifies the free cholesterol with fatty acids for their storage within cytosolic lipid
droplets. Via lipophagy resulting in the delivery of lipid droplets to lysosomes for efflux of via
lipolysis by neutral cholesterol ester hydrolase 1 (NCEH1), these lipids can be mobilized. LXR is
activated by the accumulation of cellular cholesterol and up-regulates the expression of ABCA1
and ABCG1. These genes mediate the transfer of free cholesterol to lipid-poor APOA1 to form
nascent HDLs or mature HDLs, in which free cholesterol is esterified and stored in the core of the
particle. Cholesterol crystal formation in the lysosome is stimulated by excessive free cholesterol
accumulation and can activate the NLRP3 inflammasome, promotes ER stress and leads to apop-
tosis. Moreover, lipid rafts are enriched in sphingomyelin form a complex with free cholesterol and
promote TLR4 signaling. This leads to activation of NF-kB and in the production of pro-
inflammatory cytokines and chemokines
have small atherosclerotic lesions that do not compromize blood flow. However, in
subclinical atherosclerosis some lesions reduce the oxygen supply of tissues. The
growth of the lesions and inward arterial remodeling gradually narrow the diameter
of the blood vessels and thus reduces the blood flow (referred to as stenosis). When
this stenosis applies to more than 80 % of the coronary arteries, the heart muscle
becomes ischemic, especially when a high cardiac workload increases oxygen
demand. Finally, the originally stable lesion changes into an unstable vulnerable
202 11 Hypertension, Atherosclerosis and Dyslipidemias
Cross-section of arteria
Progressing Regressing
Lumen plaque plaque
Collagen
Necrotic core
Circulating
monocytes
Adhesion
Chemokine
gradient
Reverse transmigration
Media
Fig. 11.4 Macrophage retention and emigration in plaques. Imbalances in the lipid metabo-
lism of macrophages within the progressing plaque can lead to the retention of the cells and sub-
sequently to chronic inflammation. Retention molecules, such as netrin 1 and its receptor unc-5
homolog B (UNC5B), semaphorin 3E and cadherins, are expressed by lipid-laden macrophages
express and promote macrophage chemostasis. This inflammatory milieu causes ER stress, leads
to apoptosis and results in the formation of the necrotic core. Lipid unloading via ABCA1 and
cholesterol efflux can reverse foam cell accumulation (Fig. 11.3). In parallel, in myeloid-derived
cells the chemokine receptor CCR7 is up-regulated and the expression of retention factors is
decreased
plaque that can easily rupture the endothelium leading to the formation intravascu-
lar blood clots that can cause myocardial infarction or, in the case of damage of
brain supplying arteries, in cerebral stroke.
SCARB1
LIVER
A1
HMGCR X
PCSK9 Peripheral
cell
A1
AP
X
LR
PCSK9
AP LDLR
INTESTINE TG B100
LD
LIPG
B100 LDL LDL
A5 HL
C3 VLDL CETP
ABCA1
B48 LRP1 LCAT
Free ABCG1
LIPC IDL
cholesterol C2 B100 A1
LIPC HDL
CMR VLDL FA
NPC1L1
B48 BLOODSTREAM
FA
PIPE
ABCG5/G8 MTTP
DGAT1
Intestinal
PNPLA2
cell TG
FA transporter
FA ADIPOCYTE
expected to show efficient cholesterol lowering effects in patients. The inverse cor-
relation between HDL levels (causing increased triacylglycerol levels) and the risk
of CHD is due to the importance of HDL-cholesterol in reverse cholesterol transport
from the periphery to the liver (Sect. 7.3). This initiated the search for HDL raising
compounds, such as CEPT inhibitors, but they are far less efficient in preventing
CVD than statins. The association between HDL-cholesterol and CHD is more
complex than initially assumed, since HDLs contain a variety of proteins that are
implicated in a number of biological pathways, such as oxidation, inflammation,
hemostasis and innate immunity. This heterogeneity in the biological function of
HDLs suggests that the measurement of HDL-cholesterol levels alone is insufficient
for reflecting the role of HDLs in atherosclerosis.
11.4 Dyslipidemias 205
FHC HLP1
FH HLP2A
FCH HLP2B
DBL HLP3
FHTG HLP4
MHL HLP5
ABL
HBL
TD
LCATD
HLD
CETPD
SITO
APOA5
APOE
ABCG5/G8
CETP
LIPC
LCAT
ABCA1
MTTP
LDLRAP1
PCSK9
APOB
LDLR
APOC2
LPL
Renal abnormalities
Enlarged tonsils
Splenomegaly
Fatty liver
Night blindness
Red blood cell abnormality
Coagulopathy
Myopathy
Ataxia
Peripheral neuropathy
Retinal abnormalities
Corneal abnormalities
Xanthelasma
Tendon xanthomata
Plantar xanthomata
Palmar xanthomata
Eruptive xanthomata
Pancreatitis
Peripheral vacular disease
Stroke
Coronary heart disease
Elevated plant sterols
Fasting chylomicronaemia
IDL present
HDL cholesterol
LDL cholesterol
Triglyceride
Total cholesterol
Common Rare
SNPs mutations
11.4 Dyslipidemias
Levels of certain plasma lipids and lipoproteins are key risk factors for CVD. Some
10 % of the hypercholesterolemia cases have a monogenic basis, such as heterozy-
gous familial hypercholesterolemia, familial defective APOB and autosomal domi-
nant hypercholesterolemia that is based on a gain of function of the PCSK9 gene
(Table 11.2). In contrast, different homozygous loss-of-function mutations in the
genes APOB or PCSK9 cause homozygous hypobetalipoproteinemia (HBL), in
which almost no LDL-cholesterol is present. Homozygous mutations in MTTP
cause a similar disease called abetalipoproteinemia (ABL). Rare monogenic disor-
ders, such as Tangier disease (TD), affect HDL levels and are based on homozygous
mutations in the ABCA1 gene or deficiencies in the genes APOA1, LCAT, CETP or
LIPC. Moreover, there are also rare monogenic disorders causing severe hypertri-
glycerolemia (HTG) that are due to homozygous loss-of-function mutations of the
genes LPL, APOC2 and APOA5. Very low triacylglycerol levels are found in patients
with both ABL and HBL. Like in the case of monogenetic forms of obesity (Sect.
8.5) and T2D (Sect. 10.4), the identification of the genes causing monogenic dysli-
poproteinemias significantly increased the understanding of the disease. For
206 11 Hypertension, Atherosclerosis and Dyslipidemias
Increasing plasma
concentration of
lipid or lipoprotein
MTTP ABCA1 MTTP APOB ABCA1 APOB APOE CETP APOA5 APOB CETP LPL APOB CETP LPL
APOB APOA1 PSCK9 PCSK9 APOA1 PSCK9 LDLR ABCA1 LPL PCSK9 LIPC APOC2 PCSK9 LIPC APOC2
PCSK9 LCAT LCAT ANGPTL3 PCSK9 LIPC GCKR LDLR LIPG APOA5 LDLR APOA5
APOC3 FADS2,3 LIPG TRIB1 LDLRAP1 LMF1
APOB LPL CHREBP GPIHBP1
HMGCR GALNT2 GALNT2
LDL HDL TAG LDL HDL TAG SORT1 PLTP ANGPTL3 LDL HDL TAG
Cholesterol Cholesterol CILP2 MVK DOCK7 Cholesterol LDL HDL TAG
WWOX FADS1,2,3 Cholesterol
LIPC
APOB
CILP2
APOA5
LPL
GCKR
TRIB1
CHREBP
GALNT2
ANGPTL3
Fig. 11.6 Genetic variants affecting plasma lipoprotein distribution. The frequency of the
traits LDL-cholesterol, HDL-cholesterol and triacylglycerol levels (y axis) is plotted over plasma
concentrations (x axis). The bottom and top fifth percentiles of the distribution are indicated by
shaded areas. The genes (no shading: by classical genetic or biochemical methods; orange: by re-
sequencing; blue: by GWAS) that determine lipoprotein concentrations in specific segments of the
distribution are shown below the respective graphs. The extremes of the distribution represent
homozygotic (ho) monogenic disorders, the less extremes heterozygous (he) mutations and the
center common variants. The green shading indicates small to moderate effect sizes associated
with severe HTG
The variations in lipoprotein levels that are based on common genetic variants
are often too small to be meaningful in the clinical practice. However, these insights
have a high value in basic research for the identification of novel pathways.
Moreover, (epi)genetic profiling of human individuals for metabolic diseases, such
as dyslipidemias, allows a genetic risk stratification far earlier than the onset of the
metabolic syndrome (Chap. 12). Such personalized medicine approaches will
provide for the respective human individuals longer and more effective periods of
lifestyle changes. Since diet is a key determinant of lipoprotein levels, early dietary
interventions are the most efficient and most economic strategies for CVD preven-
tion. Furthermore, the results of biochemical assays, such as measurements of lipo-
protein serum levels, should be integrated from multiple time points of the patient’s
lifetime.
Integrative genomic approaches can combine large-scale genome- and
transcriptome-wide data, in order construct gene networks that underlie metabolic
traits, such as plasma lipoproteins levels. For example, plasma HDL-cholesterol
levels were linked to variants in the regulatory region of the vanin 1 (VNN1) gene
using RNA expression profiles in lymphocytes. This type of analysis indicates that
metabolic traits are the products of molecular networks being modulated by sets of
complex genetic loci and environmental factors. This re-emphasizes that the genetic
predisposition for a metabolic disease, such as atherosclerosis, is comprised of mul-
tiple common genetic variants that each have a small to moderate effect on the trait,
either alone or in combination with modifier genes or environmental factors.
Future View
Atherosclerosis is the most important disease linked to chronic inflammation. Thus,
a better understanding of the regulation of macrophage polarization will provide
insights into pathways that could be used for the potential manipulation of macro-
phage behavior towards an athero-protective state. Next-generation whole genome
sequencing will provide an unbiased approach for the identification of additional
causative genes in patients with extreme lipoprotein phenotypes. This information
needs to be integrated with metabolic states, such as obesity and T2D. Since diet
plays a key part in the management of dyslipidemias, rational nutrigenetic studies
should be undertaken. Defining new pathways and targets will allow new drug
design and eventually lead to evidence-based changes in clinical practice. A predic-
tion of the evolution and consequences of dyslipidemias in human individuals has
to take into account the confounding influence of the environment, non-linear inter-
actions between genes and environment and stochastic effects in the underlying
genetic network.
Key Concepts
• Hypertension is the most important preventable risk factor for pre-mature death
worldwide. It is defined as the blood pressure level above which therapeutic
intervention has clinical benefit.
• Chronic hypertension in combination with atherosclerosis is the major risk factor
for stroke, CHD, congestive heart failure and end-stage renal disease.
208 11 Hypertension, Atherosclerosis and Dyslipidemias
• Dietary factors, such a salt intake, significantly influence blood pressure, and
reduced dietary salt intake as well as increased consumption of fruits and low fat
food, exercise, weight loss and reduced alcohol intake can reduce hypertension.
• Atherosclerosis is a chronic disease of large and medium arteries, in which cho-
lesterol deposition below the endothelium causes a macrophage-dominated
inflammatory response.
• Hypercholesterolemia is important for the recruitment of macrophages into the
arterial wall, but also immunological and mechanical injuries, as well as bacte-
rial and viral infections, contribute to the pathogenesis of atherosclerosis.
• Macrophages internalize native LDLs and VLDLs as well as oxidized lipopro-
teins in the plaque via macropinocytosis, phagocytosis of aggregated LDLs and
scavenger receptor-mediated uptake.
• Dys-regulation of lipid metabolism in foam cells contributes to ER stress ulti-
mately resulting in apoptotic cell death.
• Originally stable lesions change into unstable vulnerable plaques that can easily
lead to the rupture of the endothelium, leading to attachment of cell debris and/
or blood clots that can cause myocardial infarction or cerebral stroke.
• In contrast to most other chronic inflammatory diseases, in atherosclerosis there
is the potential to remove the inflammatory stimulus.
• Only a small amount of circulating cholesterol originates from the diet, while
approximately 80 % is derived from endogenous synthesis.
• There are four main types of lipoproteins: chylomicrons, VLDLs, LDLs and
HDLs, which are classified based on their density and size.
• Some 10 % of the hypercholesterolemia cases have a monogenic basis. Like in
case of monogenetic forms of obesity and T2D, the identification of the genes
causing monogenic dyslipoproteinemias significantly increased the understand-
ing of the disease.
• (Epi)genetic profiling of human individuals for metabolic diseases, such as dys-
lipidemias, allows a genetic risk stratification far earlier than the onset of the
metabolic syndrome.
• Integrative genomic approaches can combine large-scale genome- and
transcriptome-wide data, in order construct gene networks that underlie meta-
bolic traits, such as plasma lipoproteins levels.
Additional Reading
Hegele RA (2009) Plasma lipoproteins: genetic influences and clinical implications. Nat Rev
Genet 10:109–121
Jensen MK, Bertoia ML, Cahill LE, Agarwal I, Rimm EB, Mukamal KJ (2014) Novel metabolic
biomarkers of cardiovascular disease. Nat Rev Endocrinol 10:659–672
Moore KJ, Sheedy FJ, Fisher EA (2013) Macrophages in atherosclerosis: a dynamic balance. Nat
Rev Immunol 13:709–721
Swirski FK, Nahrendorf M (2013) Leukocyte behavior in atherosclerosis, myocardial infarction,
and heart failure. Science 339:161–166
Chapter 12
The Metabolic Syndrome
Changes in
Caloric excess lifestyle
Physical inactivity
Primary factors
underlying the Visceral adiposity Ectopic lipid overload
syndrome
β cell failure
HDL reduced TAG elevated Inflammation Hypertension Cardiac dysfunction
DIABETES
Microvascular disease
Myocardial infaction
Heart failure
Fig. 12.1 Interactions of metabolic syndrome traits in T2D and CVD. Changes in lifestyle,
such as increased consumption of high-caloric diets combined with reduced physical activity play
important roles in the worldwide dramatic increase in the metabolic syndrome. Visceral obesity,
ectopic lipid overload, dyslipidemias and insulin resistance are the primary factors underlying the
syndrome. These factors cause inflammation, hypertension and β cell failure. Individuals with the
metabolic syndrome are therefore at increased risk for the development of atherosclerosis, T2D,
microvascular diseases, myocardial infarction and finally heart failure
(Sect. 9.4), β cell failure (Sect. 9.5), hypertension (Sect. 11.1) and dyslipidemias
with high plasma concentrations of triacylglycerols and low concentrations of
HDL-cholesterol (Sect. 11.4) (Fig. 12.1). The dramatic worldwide increase in obe-
sity (Sect. 8.1) and the parallel rise in life expectancy, i.e. the increased number of
elderly around the world, make this condition a major global health problem.
Historically, the concept of “syndrome X” was used to describe the metabolic
syndrome in the end of 1980s as a condition with increased risk of T2D and CVD
caused by insulin resistance in metabolic tissues. More recent, the National
Cholesterol Education Program (NCEP), the WHO, the European Group for the
study of Insulin Resistance (EGIR) and the International Diabetes Federation (IDF)
used slightly different thresholds to define the metabolic syndrome based on rate of
obesity, hyperglycemia, dyslipidemias and hypertension (Table 12.1). Moreover,
while the NCEP definition does not require any defined parameter, the WHO pro-
poses that an evidence of insulin resistance, such as impaired glucose tolerance
(IGT), impaired fasting glucose (IFG) or T2D, is essential. In contrast, the EGIR
12.1
30 kg/cm2
Hyperglycemia Fasting glucose > 5.6 mM Insulin resistance Insulin resistance Fasting glucose > 5.6 mM
Dyslepidemia I Triacylglycerols > 1.7 mM Triacylglycerols > 1.7 mM Triacylglycerols > 2.0 mM Triacylglycerols > 1.7 mM
or HDL < 0.9 mM or HDL < 1.0 mM
Dyslepidemia II HDL: HDL:
Males < 1.0 mM, Males < 1.0 mM,
females < 1.25 mM females < 1.25 mM
Hypertension >130 mm Hg systolic or >140/90 mm Hg >140/90 mm Hg >130 mm Hg systolic or
>85 mm Hg diastolic >85 mm Hg diastolic
Other criteria Microalbuminuria
211
212 12 The Metabolic Syndrome
emphasizes hyperinsulinemia as main criterium, while for the IDF central obesity is
essential. At present, the definitions of NCEP and IDF are most widely used.
The human body has developed integrated mechanisms to become either catabolic,
when energy demands cannot be met by food intake, or anabolic, when calorie sup-
ply exceeds energy demands. The key regulator of these mechanisms is insulin
(Chaps. 9 and 10), which is secreted by β cells in the pancreas after a meal and
promotes carbohydrate resorption, energy utilization (via glycolysis), storage of
carbohydrates as glycogen, storage of fat (as triacylglycerols), synthesis of fat from
carbohydrates (via activating de novo lipogenesis) in key metabolic tissues. At the
same time, insulin inhibits lipolysis, i.e. the release of energy from triacylglycerols,
and the synthesis of glucose (via gluconeogenesis) after a meal. Thus, the actions of
insulin create an integrated set of signals that represent the nutrient availability and
the energy demands of the human body. In turn, a disturbance in insulin actions,
such as obesity-triggered insulin resistance in one or multiple metabolic organs,
such as skeletal muscle, liver and WAT, often serves as the onset of the metabolic
syndrome (Fig. 12.2). These conditions can lead to organ-specific consequences,
such as β cell failure and NAFLD, but also to systemic effects, such as glucotoxicity,
lipotoxicity and low-grade inflammation. All these conditions are key factors of the
metabolic syndrome and accelerate the risk of diabetes, heart disease and their
complications.
Systemic effects of the metabolic syndrome influence the metabolism in key meta-
bolic organs, such as liver, muscle, pancreas and WAT. Hepatic insulin resistance
causes elevated activity of the key gluconeogenesis enzymes G6PC and PCK, and
increased glycogenolysis, both leading to increased glucose output from the liver
(Fig. 12.3). In parallel, the expression of enzymes that regulate glycogen synthesis
and glycolysis, such as GCK and pyruvate kinase, is reduced, driving GLUT2 to
transport glucose out of hepatocytes. All these alterations in the glucose metabolism
pathways accelerate systemic glucotoxicity. In addition, a decreased insulin sensi-
tivity in the liver increases the uptake of FFAs and the formation of triacylglycerols.
These are loaded to VLDLs for transport in the circulation and thus cause dyslipid-
emia. The increase of glucose levels in the liver increases lipogenesis via the activ-
ity of SREBF1 and FASN, which are both not impaired by insulin resistance. This
accumulation of lipids in liver can cause NAFLD. Hepatic insulin resistance also
contributes to hyperlipidemia through the down-regulation of LDLR (Sect. 11.4). In
12.3 Metabolic Syndrome in Key Metabolic Organs 213
Fig. 12.2 Whole body’s view on the metabolic syndrome. Under normal conditions, energy
intake and utilization is perfectly balanced with the body’s energy needs. Intestine, pancreas and
brain sense food after a meal and send signals to muscle, liver, fat and back to the brain, in order
to maintain metabolic homeostasis via the coordination of uptake and storage of nutrients and
energy production. The metabolic syndrome often starts with obesity, triggering a state of systemic
low-grade inflammation that affects various major organs involved in metabolic homeostasis
(Chaps. 7 and 8). The brain’s ability to regulate meal size or frequency is impaired leading to
weight gain and further organ dysfunction. The autonomic nervous system and the hypothalamic-
pituitary-thyroid (HPT) axis are disrupted causing a change in the release of gut hormones (Sect.
8.4). Insulin resistance is a further important trigger of the metabolic syndrome (Sect. 9.4). In the
pancreas, the islets expand to release more insulin (hyperinsulinemia) in an attempt to overcome
insulin resistance of muscle, liver and WAT. However, over time the islets become exhausted and
little or no insulin is produced, so that T2D occurs (Chap. 10). Insulin resistance in the muscle
leads to excessive glucose uptake in the liver that is primarily converted to fatty acids often causing
NAFLD. Moreover, in the liver, glucotoxicity and insulin resistance result in inefficient down-
regulation of hepatic glucose production leading to further increase of circulating glucose levels.
The fat excess in the liver can be released into the circulation as VLDLs leading to elevated serum
triacylglycerol levels. Insulin resistance of adipose tissue increases its lipolytic activity, thus also
releasing excess fatty acids. All together these lipid sources result in lipotoxicity that further con-
tributes to organ dysfunction and disease, especially CVD. Lipotoxicity and glucotoxicity worsen
T2D and lead to numerous complications, such as kidney disease, blindness, nerve damage and
non-healing skin ulcers
this way, liver insulin resistance causes decreased clearance of LDLs and VLDLs,
leading to increased LDL and VLDL levels in the circulation, respectively.
Skeletal muscle is the main tissue for glucose storage and utilization, and approx-
imately 80 % of the glucose load of the blood stream after a meal are taken up by the
muscle. Insulin resistance in muscles leads to reduced insulin-stimulated
214 12 The Metabolic Syndrome
OBESITY
Glucose Leptin
Insulin Adiponectin
resistance disposal
Insulin
Brain
LIPOLYSIS GLUCONEOGENESIS
Cortisol NAFLD
LIPOGENESIS
Dyslipidemia
Adrenal gland FA
KETOGENESIS VLDL
Atherosclerosis
Energy for CVD
LIVER other organs
Fig. 12.3 Metabolic syndrome in the liver. Early stages of the metabolic syndrome are associ-
ated with insulin resistance causing a decreased glucose disposal in skeletal muscle. Obesity also
alters the secretion pattern of adipokines, such as increased levels of leptin and decreased adipo-
nectin concentrations (Sect. 8.6). Together this leads to a re-routing of glucose and lipids (as a
consequence of increased lipolysis from adipose tissue) to the liver. As intracellular lipid levels in
the liver rise, along with the increased plasma insulin, hepatic insulin signaling rapidly deteriorates
and this impairment turns the liver into a “co-conspirator” in the further progression of the meta-
bolic syndrome and its complications. Hepatic insulin resistance leads to increased hepatic glucose
production. Further hormones can contribute to decreased insulin sensitivity of the liver. For exam-
ple, cortisol increases glucose production, promotes lipolysis and increases lipid deposition.
Insulin resistance increases the secretion of VLDLs from the liver and causes dyslipidemia.
Excessive hepatic secretion of VLDLs play an important role in promoting atherosclerosis and
CVD (Sect. 11.3). Insulin resistance also increases intra-hepatic fat accumulation finally causing
to NAFLD. Activation of inflammatory pathways occurs both systemically, as a result of cytokines
released from circulating immune cells, and locally through resident liver macrophages. This fur-
ther accelerates lipid accumulation and storage. Liver insulin resistance also causes abnormalities
in bile acid production and increases the risk for cholesterol gallstone formation
GLUT4-mediated glucose transport into the myocytes (Fig. 12.4). Decreased glu-
cose uptake reduces the levels of glucose-6-phosphate to be used for glycogen syn-
thesis and glycolysis. This increases the glucose concentration in the bloodstream
and causes systemic glucotoxicity. Like the liver, systemic lipotoxicity also over-
loads the muscle with FFAs. These lipids are taken up and stored in form of triacyl-
glycerols in intra-muscular lipid droplets.
In the early stages of insulin resistance, β cells increase the production and secre-
tion of insulin, in order to maintain glucose tolerance (Fig. 12.5). Since insulin
under these conditions is less potent in suppressing hepatic glucose production, the
12.3 Metabolic Syndrome in Key Metabolic Organs 215
Insulin
LIPOLYSIS Pancreas
Cytokines
TAG
Chemokines Plasma
Insulin
Post-prandial Liver
Hyperinsulinemia
DE NOVO
INFLAMMATION LIPOGENESIS
FA
DAGs
Ceramides Glucose
Insulin
uptake
resistance in
sceletal muscle
INCOMPLETE
β-OXIDATION Glycogen
Acyl-
carnitines GLYCOGEN SYNTHESIS
Branched-chain AAs Intramuscular
SKELETAL MUSCLE ROS lipid droplets
Fig. 12.4 Metabolic syndrome in skeletal muscles. Insulin resistance in skeletal muscle causes
reduced insulin-stimulated glucose uptake and therefore less glucose is available for insulin-
stimulated glycogen synthesis. Overload of lipids increases the level of intra-myocellular lipids in
the form of DAG and ceramides as well as increases in acyl-carnitines (due to incomplete mito-
chondrial fatty acid oxidation). Pro-inflammatory adipokines, branched-chain amino acids and
ROS further contribute to this defect in insulin signaling. Insulin resistance in skeletal muscle
promotes post-prandial hyperinsulinemia and diversion of ingested carbohydrates away from stor-
age as glycogen in skeletal muscle to liver where they are converted to triacylglycerols through
increased hepatic de novo lipogenesis
liver becomes insulin resistant. When insulin resistance progresses, β cells lose their
ability to compensate for decrease insulin response via an increase of insulin release.
This finally results in reduced circulating insulin concentrations and often comes
along with increased glucagon levels. This shift in the glucagon-insulin ratio leads
to a further rise in hepatic gluconeogenesis and advanced hyperglycemia occurs.
Systemic glucotoxicity and lipotoxicity, i.e. constant exposure of β cells to elevated
levels of glucose and lipids, both increase glucose metabolism in β cells and cause
metabolic stress leading to the unfolding protein response of the ER in these cells.
In response to ER stress, hypoxic stress and pro-inflammatory cytokines, the β cells
fail to proliferate and undergo uncontrolled autophagy or even apoptosis. This leads
to β cell dysfunction and ultimately their death.
In obesity, the storage capacity of adipocytes is often exceeded causing cellular
dysfunctions, such as increased formation of ceramides, ER stress and hypoxia
leading to reduced metabolic control and cell death. An increase in number and size
of adipocytes also influences the secretion of adipokines. In addition, adipocytes
attract monocytes into WAT that become M1-type macrophages, secreting
pro-inflammatory cytokines, together with adipokines leading to low-grade sys-
216 12 The Metabolic Syndrome
INFLAMMATION
β cell proliferation FA
and survival
Metabolic syndrome Glucose
Changes in signaling
Intestine Peptide secretion
Insulin Circulation
Leptin
Osteocalcin
Adiponectin
Glucose uptake
Glycolysis
Glycogenesis
Lipogenesis
Protein synthesis
Bone White adipose tissue Skeletal muscle Liver
Fig. 12.5 Metabolic syndrome in the pancreas. Obesity promotes the development of insulin
resistance leading to compensatory increases in insulin release from β cells. Chronic overproduc-
tion of insulin leads to β cell expansion, i.e. pancreatic islet hypertrophy. As insulin resistance
progresses, the effects of insulin on target tissues diminish, thereby leading to impairments in glu-
cose uptake, glycolysis, glycogenesis, lipogenesis and protein synthesis. This leads to hyperglyce-
mia and elevated FFA levels in the circulation that negatively affect β cell proliferation and survival.
This results in a vicious cycle that further reduces β cell function. In the setting of the metabolic
syndrome, many tissues show alterations in hormone levels that directly impact β cell function.
The intestine changes the secretion of signaling peptides, the bone secretes less osteocalcin and
WAT secretes more leptin but less adiponectin. These hormonal changes together with oxidative
stress, ER stress, inflammation and intracellular amyloid deposition cause β cell death (Sect. 9.5)
TREG
Cytokines
NECROSIS APOPTOSIS Chemokines
Cellular hypertrophy
and hyperplasia
Dead adipocyte
TLR4
ADIPOCYTES
LOCAL HYPOXIA
TNFR
Impaired
β3-adrenergic OXIDATIVE STRESS
stimulation ER STRESS IL6
ADIPOCYTES
Insulin
Brain sensitivity
Cortisol
Glucose
uptake
FA
Adrenal gland LIPOGENESIS
Fig. 12.6 Metabolic syndrome in WAT. In the presence of excess energy supply WAT expands
as a result of cellular hypertrophy and hyperplasia. These enlarged adipocytes become dys-
regulated through an increased rate of local necrosis, apoptosis and pro-inflammatory responses.
Dead adipocytes attract macrophages that are conventionally skewed towards an M1-like pro-
inflammatory profile. Under obese conditions there is also a reduction of TREG. This causes an
increase in the local pro-inflammatory environment that can ultimately spill over to systemic
increases in pro-inflammatory cytokines. The rapid tissue expansion during obesity leads to local
hypoxia and the activation of ER stress response causing a reduced release of insulin-sensitizing
adipokines, such as adiponectin (Sect. 8.6). Moreover, increased levels of cortisol and the activa-
tion of TLRs and other pro-inflammatory cytokine receptors, such as TNFR and IL6 receptors,
further reduce insulin sensitivity. This leads to reduced rates of triacylglycerol synthesis, increas-
ing levels of FFAs and a decrease in insulin-mediated glucose uptake. In contrast, the impaired
β3-adrenergic response downstream of SNS activity leads to reduced metabolic flexibility, since
FFAs cannot be appropriately activated in response to β3-adrenergic stimulation
GWAS analysis for central factors of the metabolic syndrome, such as BMI, T2D
and dyslipidemia, have identified for each of these traits highly statistically signifi-
cant associations with 40 to 100 genetic variants (Sects. 8.4, 10.4 and 11.4). The key
genes of these lists, such as LPL, APOE, MC4R, FTO and TCF7L2 (Table 12.2), are
also the central determinants for the genetic risk for the metabolic syndrome.
218 12 The Metabolic Syndrome
M1-type
macrophage Further M1-type
recruitment macrophage
recruitment
SFA
INFLAMMATION
TLR2
TLR4
Insulin
Cytokines resistance in
Chemokines adipocytes
AP-1
NF-κB LIPOLYSIS
IRF3
Adiponectin
TNF SFRP5
IL1B
NLRP3
Caspase 1 Inhibition of
insulin actions
Inflammasome
INFLAMMATION
ADIPOCYTE
M1-TYPE MACROPHAGE
Systemic
insulin
resistance
Fig. 12.7 Metabolic syndrome driven by the interaction of macrophages with WAT. Obesity
recruits M1-type macrophages into adipose tissue that promote local inflammation and insulin
resistance. SFAs stimulate TLR2 and TLR4 in these M1 macrophages leading to the activation of
the pro-inflammatory transcription factors IRF3, AP-1 and NF-κB. This induces the production of
inflammatory cytokines, such as IL1B and TNF, that inhibit insulin actions in neighboring adipo-
cytes. The production of IL1B is also augmented by activation of the NLRP3 inflammasome
inducing lipolysis. In a feed-forward loop, the released fatty acids from the increased lipolysis
induce the expression of chemokines leading to the recruitment of further M1-type macrophages
into adipose tissue. Reduced circulating levels of the anti-inflammatory adipokines adiponectin
and SFRP5 potentiate inflammation. Finally, as inflammation spreads from adipocytes to other
organs, such as skeletal muscle and liver, systemic insulin resistance ensues
However, the dilemma with all these common SNPs remains that their individual
ORs are clearly below 2, i.e. they contribute considerably less than 100 % increased
risk for the disease. This implies that the common SNPs can explain only a small
fraction of the cases of the metabolic syndrome.
Within slightly more than one generation (33 years) the worldwide prevalence
for obesity doubled (Sect. 8.1). Very obviously the Western-style high-fat diet com-
bined with decreased physical activity are the main environmental contributors to
obesity and the subsequent development of the metabolic syndrome. In addition,
human populations that made a transition from famine to food surplus just within
1–2 generations are under significantly higher risk for obesity, T2D and the meta-
bolic syndrome, than those that were improving their nutritional conditions over
many generations. This means that people who are born and live in countries that
had particularly rapid changes in urbanization and economic development have an
increased risk of the metabolic syndrome in the years to come. This suggests that
both socio-environmental factors and epigenetic mechanisms rather than variations
of the core genome play a role in the obesity epidemic and its associated metabolic
abnormalities.
There are more and more epidemiological and clinical evidences that the concept
of the thrifty hypothesis (Sects. 5.5 and 10.5), i.e. a pre-natal epigenetic program-
ming in utero, may be the key cause for metabolic diseases. Persons that carry an
epigenome that during their anthropologic development was programmed by sub-
optimal nutrition in utero, can despite normal post-natal nutrition transgeneration-
ally transmit a predisposition for obesity (Fig. 12.8). So far, there is no comprehensive
analysis of the epigenome of persons suffering from the metabolic syndrome, i.e. no
concrete genomic regions of elevated risks have been identified. However, it can be
assumed that due to the complexity of insulin signaling and its interference with
multiple pathways (Sect. 9.2) a high number of regions will be affected in a
individual-specific way. Nevertheless, since epigenetic modifications respond
dynamically to environmental conditions (Chap. 5), there is potential for interven-
tion and reversibility.
Future View
Healthy dietary patterns, such as Mediterranean or Nordic diet, lower the risk of the
metabolic syndrome. In future, studies understanding the molecular mechanism of
diet on epigenetic programming in the pre-natal, post-natal and adult phases of life
will be of major importance to understand how diet can prevent the metabolic syn-
drome. Thus, cleverly designed dietary intervention studies and observational stud-
ies will investigate the impact of individual nutrients, such as vitamin D3 or PUFAs,
within a healthy dietary pattern, in order to improve the conditions of the metabolic
syndrome. In these studies, a larger number of epigenome-, transcriptome-, pro-
teome- and metabolome-wide data will need to be integrated. A futuristic way to
measure these will be injectable nanosensors that perform a continuous surveillance
of the blood. Such sensors will detect epigenome, RNA, protein and metabolite
signals and may transmit them wirelessly to the individual’s smartphone. For exam-
ple, this allows an early warning of a heart attack via endothelial obliteration from
220 12 The Metabolic Syndrome
First generation
Second generation
Normal/increased
Macrosomic/ OBESE
OBESE food availability
Increased body fat Metabolic syndrome
High fat/calorie diet
Fig. 12.8 Epigenetic programming and the shift of populations towards obesity and meta-
bolic syndrome. Non-obese mothers usually give birth to non-obese children, which develop into
adults with a normal metabolic profile and a normal body fat content. However, undernutrition
combined with improved neo-natal survival, formula feeding and exposure to a Western post-natal
diet increased the incidence of pre-maturity and intra-uterine growth restriction. This results in
increased obesity of the offspring and higher risk for obtaining the metabolic syndrome. Some
obese mothers may give birth to newborns with increased body fat, as a result of consumption of a
high-fat diet. All these processes contribute to a shift of the population towards an obese pheno-
type. This also includes that second generation obese women have an increased risk to give birth
to infants with increased body fat content and a further increased risk to develop obesity and the
metabolic syndrome
an artery, the onset of T1D in a child via the detection of auto-antibodies against
β cells before they get destroyed or the rise of fasting glucose levels after infectious
diseases (Sect. 4.6). This surveillance concept has the potential to detect a risk sig-
nal in time and to implement better prevention and therapy by personalized
nutrititon.
Key Concepts
• No universally accepted definition for the metabolic syndrome exists, but sub-
jects with metabolic syndrome have a cluster of features including visceral obe-
sity, hypertension, dyslipidemia and dysglycemia, increasing the risk of T2D and
CVD.
• The dramatic worldwide increase of obesity and the parallel rise in life expect-
ancy, leading to an increased number of elderly obese people, makes the meta-
bolic syndrome a major global health problem.
• Excess food intake and β cell failure caused by insulin resistance and obesity
leads to systemic glucotoxicity, systemic lipotoxicity and systemic low-grade
inflammation. All these conditions are key components of the metabolic
syndrome.
• All metabolic tissues are affected, and in the liver, the glucose output is increased
due to increased glucose synthesis and increased breakdown of glycogen, caused
by insulin resistance. At the same time, systemic lipotoxicity overloads liver with
lipids that are taken up by the cells and form triacylglycerol, which are trans-
ported as VLDL in the circulation and causes dyslipidemia, but also accumulate
to form fatty liver and NAFLD.
• In skeletal muscle, insulin resistance leads to reduced insulin-stimulated glucose
uptake. Since skeletal muscle normally takes up 80 % of the glucose in the circu-
lation, the reduced uptake, utilization and storage of glucose all increase the
concentration of glucose in the bloodstream and cause systemic glucotoxicity.
The skeletal muscle is also overloaded with lipids, which are stored in intramus-
cular lipid droplets.
• The β cells produce less insulin, which occurs in parallel with increased gluca-
gon levels. The shift in the glucagon-insulin ratio leads to a further rise in hepatic
synthesis. Systemic glucotoxicity and systemic lipotoxicity both increase glu-
cose metabolism in β cells and cause ER stress and hypoxic stress, leading to β
cell dysfunction and cell death.
• In WAT, lipolysis is increased, and uptake of FFAs is impaired, causing systemic
lipotoxicity. Obesity increases the adipocytes number and size, which influences
the secretion of adipokines.
• The metabolic and inflammatory response is integrated due to the role that these
two pathways have played in evolution. The reason why inflammatory mediators
impair insulin signaling is the cells ability to shift rapidly from glucose oxidation
to lipid oxidation.
• The genes LPL, APOE, MC4R, FTO and TCF7L2 are the central determinants of
the genetic risk for the metabolic syndrome. However, common SNPs can
explain only a small fraction of the cases of the metabolic syndrome.
• Human populations that made a transition from famine to food surplus just
within 1–2 generations are under significantly higher risk for obesity, T2D and
the metabolic syndrome than those that were improving nutritional conditions
over many generations.
• There is no comprehensive analysis of the epigenome of persons suffering from
the metabolic syndrome, but it can be assumed that due to the complexity of
insulin signaling and its interference with multiple pathways that a high number
of regions will be affected in a individual-specific way.
222 12 The Metabolic Syndrome
Additional Reading
Desai M, Jellyman JK, Ross MG (2015) Epigenomics, gestational programming and risk of meta-
bolic syndrome. Int J Obes (Lond) 39(4)
Hotamisligil GS (2010) Endoplasmic reticulum stress and the inflammatory basis of metabolic
disease. Cell 140:900–917
Huang PL (2009) A comprehensive definition for metabolic syndrome. Dis Model Mech
2:231–237
Keane D, Kelly S, Healy NP, McArdle MA, Holohan K, Roche HM (2013) Diet and metabolic
syndrome: an overview. Curr Vasc Pharmacol 11:842–857
Lusis AJ, Attie AD, Reue K (2008) Metabolic syndrome: from epidemiology to systems biology.
Nat Rev Genet 9:819–830
Nature Medicine: www.nature.com/nm/e-poster/eposter_full.html
Perez-Martinez P, Garcia-Rios A, Delgado-Lista J, Perez-Jimenez F, Lopez-Miranda J (2012)
Metabolic syndrome: evidences for a personalized nutrition. Mol Nutr Food Res 56:67–76