Methods in

Molecular Biology 1961

Yonglun Luo Editor

CRISPR
Gene Editing
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

http://www.springer.com/series/7651
CRISPR Gene Editing

Methods and Protocols

Edited by

Yonglun Luo
Department of Biomedicine, Aarhus University, Aarhus, Denmark
BGI-Shenzhen, Shenzhen, China
Editor
Yonglun Luo
Department of Biomedicine
Aarhus University
Aarhus, Denmark
BGI-Shenzhen
Shenzhen, China

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-9169-3 ISBN 978-1-4939-9170-9 (eBook)
https://doi.org/10.1007/978-1-4939-9170-9
Library of Congress Control Number: 2019933103

© Springer Science+Business Media, LLC, part of Springer Nature 2019

Open Access Chapter 3 is licensed under the terms of the Creative Commons Attribution 4.0 International License
(http://creativecommons.org/licenses/by/4.0/). For further details see license information in the chapter.
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC, part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface

When the series editor, Dr. John M. Walker, asked me approximately 1 year ago whether I
was interested in editing a book on CRISPR technologies, I immediately took his generous
offer and started my first and challenging editorial journey. Firstly, as a junior researcher, it
has always been a great honor and encouraging experience to be capable of contributing
with knowledge and outreach to our scientific community. Secondly, the particular research
field and technology that we will be focusing on in this book is one of the most fast growing
and important breakthroughs during the past decade. And most importantly, as a researcher
working on gene editing for over 10 years, I deeply realize the importance of having a good
serial of protocols, experimental tips, and notes to increase the success rate and outcomes of
scientific projects.
When I first started the “Pig and Health” PhD project back in 2008, my objective was to
recapitulate the pathogenesis of human diseases, e.g., breast cancer and diabetes, using
genetically tailored pig models. One major milestone of my PhD study was disrupting the
BRCA1 gene in primary porcine fibroblasts by homologous recombination and subse-
quently generating a BRCA1 knockout pig by somatic cell nuclear transfer. Generating a
gene knockout (KO) animal during the pre-TALENs and pre-CRISPR era was rather
technically challenging and time-consuming. Although I spent almost 3 years and finally
got my BRCA1 KO pig, I wish my project was conducted now rather than 10 years ago.
Zinc finger nucleases (ZFNs), known as the second generation of programmable DNA
nucleases, were already available during that period. But this technology was not very
broadly adopted by the scientific community. One main reason is that the ZFN technology
is relatively difficult for the design and generation, and there is a lack of user-friendly
protocols and methods instructing the generation and functional validation of ZFNs.
When the transcription activator-like effector (TALE) protein was engineered as a
programmable DNA endonuclease (TALEN) for gene editing, as compared to ZFNs,
TALEN-based gene editing was more rapidly applied by the whole scientific community.
One important driving force of the TALEN technology is conventional web tools and
protocols developed for TALEN vector design and construction. Using one the most
popular TALEN assembly methods developed by Daniel F. Voytas’s group, although one
has to select the different modular plasmids from a large stock of premade ones, it is much
easier when compared to ZFNs to generate a couple of TALEN constructions.
Since the first proof-of-principle study of harnessing the clustered regularly interspaced
short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) for gene
editing in 2012, led by Jennifer Doudna and Emmanuelle Charpentier, the CRISPR-Cas9-
based gene editing technology rapidly took over ZFNs and TALENs and was successfully
applied for genome editing in almost all cell types and organisms. To date, many Cas9
orthologs, different CRISPR systems from bacteria and archaea have been repurposed for
gene editing. And many more genetic manipulation tools have been built on top of the
CRISPR-Cas9 system, such as CRISPR-based gene activation, gene interference, base
editing, DNA methylation, and histone acetylation. Among all the already harnessed
CRISPR-Cas systems utilized for gene editing, the CRISPR-Cas9 system is still the most
extensively developed and broadly used one.

v
vi Preface

The CRISPR-Cas9 technology is commonly known and described as simple, efficient,

and cost-effective. However, a successful CRISPR gene editing experiment/project requires
strategic planning and user-friendly guidelines to select the most suitable CRISPR-Cas
system and target sites with high activity and specificity. Also, how to quantify the CRISPR
gene editing activity (indel), how to efficiently deliver the CRISPR-Cas9 components into
target cells or tissues, and how to enrich and isolate gene-edited cells with desired genetic
modifications: these are among the most frequently asked questions and experiments when
conducting a CRISPR gene editing study. This book is intended to assist undergraduates,
graduates, and researchers with detailed guidelines and methods for the CRISPR gene
editing field.
I would like to thank all the contributing authors at the front lines of developing
CRISPR technology and applications. Methods covering CRISPR gRNA design, CRISPR
delivery, CRISPR activity quantification (indel quantification), and examples of applying
CRISPR gene editing in human pluripotent stem cells, primary cells, gene therapy, and
genetic screening are included in this book. Without their contributions, this book could
never have been written.
My grateful thanks also to my colleagues from the Lars Bolund Institute of Regenerative
Medicine and the DREAM team for their assistance in editing the book.

Aarhus, Denmark Yonglun Luo

Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

PART I METHODS FOR CRISPR-GRNA DESIGN AND QUANTIFICATION

OF ACTIVITY

1 CRISPR-gRNA Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Maria Pallarès Masmitjà, Nastassia Knödlseder, and Marc Güell
2 Tracking CRISPR’s Footprints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Lin Lin and Yonglun Luo
3 Rapid Quantitative Evaluation of CRISPR Genome Editing by TIDE
and TIDER . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Eva Karina Brinkman and Bas van Steensel
4 Fast and Quantitative Identification of Ex Vivo Precise Genome
Targeting-Induced Indel Events by IDAA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Saskia König, Zhang Yang, Hans Heugh Wandall, Claudio Mussolino,
and Eric Paul Bennett
5 Functional Evaluation of CRISPR Activity by the Dual-Fluorescent
Surrogate System: C-Check . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
Lin Lin and Yonglun Luo

PART II METHODS FOR CRISPR DELIVERY

6 CRISPR-Cas9 Delivery by Artificial Virus (RRPHC) . . . . . . . . . . . . . . . . . . . . . . . . 81

Suleixin Yang, Qinjie Wu, Yuquan Wei, and Changyang Gong
7 Production and Validation of Lentiviral Vectors for CRISPR/Cas9 Delivery . . . 93
Laura Barrett Ryø, Emil Aagaard Thomsen, and Jacob Giehm Mikkelsen
8 Rapid and Simple Screening of CRISPR Guide RNAs (gRNAs)
in Cultured Cells Using Adeno-Associated Viral (AAV) Vectors. . . . . . . . . . . . . . . 111
Julia Fakhiri, Manuela Nickl, and Dirk Grimm
9 Electroporation-Based CRISPR/Cas9 Gene Editing Using Cas9
Protein and Chemically Modified sgRNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127
Anders Laustsen and Rasmus O. Bak

PART III CRISPR GENE EDITING IN HUMAN IPSCS

10 Efficient Gene Editing of Human Induced Pluripotent Stem Cells

Using CRISPR/Cas9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
Saniye Yumlu, Sanum Bashir, Jürgen Stumm, and Ralf Kühn

vii
viii Contents

11 Editing the Genome of Human Induced Pluripotent Stem Cells Using

CRISPR/Cas9 Ribonucleoprotein Complexes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153
Michaela Bruntraeger, Meg Byrne, Kathleen Long,
and Andrew R. Bassett
12 Conditional Gene Knockout in Human Cells with Inducible
CRISPR/Cas9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185
Kirsten E. Snijders, James D. Cooper, Ludovic Vallier,
and Alessandro Bertero

PART IV CRISPR GENE EDITING IN OTHER CELL TYPES

13 CRISPR/Cas9 as a Genome Editing Tool for Targeted Gene Integration

in CHO Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
Daria Sergeeva, Jose Manuel Camacho-Zaragoza, Jae Seong Lee,
and Helene Faustrup Kildegaard
14 Rapid and Efficient Gene Deletion by CRISPR/Cas9 . . . . . . . . . . . . . . . . . . . . . . . 233
Signe Neldeborg, Lin Lin, Magnus Stougaard, and Yonglun Luo
15 Genome Editing in Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
Lisbeth Ahm Hansen and Ernst-Martin Füchtbauer
16 CRISPR/Cas9-Mediated Gene Tagging: A Step-by-Step Protocol . . . . . . . . . . . . 255
Xi Xiang, Conghui Li, Xi Chen, Hongwei Dou, Yong Li,
Xiuqing Zhang, and Yonglun Luo
17 Gene Editing in Primary Cells of Cattle and Pig . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Petra Vochozkova, Kilian Simmet, Eva-Maria Jemiller,
Annegret Wünsch, and Nikolai Klymiuk

PART V CRISPR GENE THERAPY AND SCREENING

18 Toward In Vivo Gene Therapy Using CRISPR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 293

Kristian Alsbjerg Skipper and Jacob Giehm Mikkelsen
19 CRISPR Gene Therapy of the Eye: Targeted Knockout of Vegfa
in Mouse Retina by Lentiviral Delivery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307
Andreas Holmgaard, Sidsel Alsing, Anne Louise Askou,
and Thomas J. Corydon
20 In Vivo Editing of the Adult Mouse Liver Using CRISPR/Cas9
and Hydrodynamic Tail Vein Injection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 329
Francesco Niola, Frederik Dagnæs-Hansen, and Morten Frödin
21 CRISPR-Based Lentiviral Knockout Libraries for Functional Genomic
Screening and Identification of Phenotype-Related Genes . . . . . . . . . . . . . . . . . . . 343
Emil Aagaard Thomsen and Jacob Giehm Mikkelsen

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359
Contributors

SIDSEL ALSING  Department of Biomedicine, Aarhus University, Aarhus, Denmark

ANNE LOUISE ASKOU  Department of Biomedicine, Aarhus University, Aarhus, Denmark
RASMUS O. BAK  Department of Biomedicine, Aarhus University, Aarhus, Denmark;
Aarhus Institute of Advanced Studies (AIAS), Aarhus University, Aarhus, Denmark
SANUM BASHIR  Max-Delbrück-Centrum für Molekulare Medizin, Berlin, Germany; Berlin
Institute of Health, Berlin, Germany
ANDREW R. BASSETT  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton,
Cambridge, UK
ERIC PAUL BENNETT  Faculty of Health Sciences, Department of Odontology, Copenhagen
Center for Glycomics (CCG), University of Copenhagen, Copenhagen, Denmark
ALESSANDRO BERTERO  Wellcome Trust-MRC Stem Cell Institute, Anne McLaren
Laboratory, University of Cambridge, Cambridge, UK; Department of Surgery, University
of Cambridge, Cambridge, UK; Department of Pathology, University of Washington,
Seattle, WA, USA
EVA KARINA BRINKMAN  Division of Gene Regulation and Oncode Institute, Netherlands
Cancer Institute, Amsterdam, The Netherlands
MICHAELA BRUNTRAEGER  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton,
Cambridge, UK
MEG BYRNE  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge,
UK
JOSE MANUEL CAMACHO-ZARAGOZA  The Novo Nordisk Foundation Center for
Biosustainability, Technical University of Denmark, Kgs. Lyngby, Denmark
XI CHEN  BGI-Shenzhen, Shenzhen, China
JAMES D. COOPER  Wellcome Trust-MRC Stem Cell Institute, Anne McLaren Laboratory,
University of Cambridge, Cambridge, UK; Division of Cardiovascular Medicine,
University of Cambridge, Cambridge, UK
THOMAS J. CORYDON  Department of Biomedicine, Aarhus University, Aarhus, Denmark;
Department of Ophthalmology, Aarhus University Hospital, Aarhus, Denmark
FREDERIK DAGNÆS-HANSEN  Department of Biomedicine, Aarhus University, Aarhus,
Denmark
HONGWEI DOU  BGI-Qingdao, Qingdao, China
JULIA FAKHIRI  Department of Infectious Diseases/Virology, Heidelberg University Hospital,
Cluster of Excellence Cell Networks, Heidelberg, Germany; BioQuant Center, University of
Heidelberg, Heidelberg, Germany
MORTEN FRÖDIN  Biotech Research and Innovation Centre (BRIC), University of
Copenhagen, Copenhagen, Denmark
ERNST-MARTIN FÜCHTBAUER  Department of Molecular Biology and Genetics, Aarhus,
Denmark
CHANGYANG GONG  State Key Laboratory of Biotherapy and Cancer Center, West China
Hospital, Sichuan University, Chengdu, China

ix
x Contributors

DIRK GRIMM  Department of Infectious Diseases/Virology, Heidelberg University Hospital,

Cluster of Excellence Cell Networks, Heidelberg, Germany; BioQuant Center, University of
Heidelberg, Heidelberg, Germany; German Center for Infection Research (DZIF), Partner
Site Heidelberg, Heidelberg, Germany
MARC GÜELL  Department of Experimental and Health Sciences, Universitat Pompeu
Fabra, Barcelona, Spain
LISBETH AHM HANSEN  Department of Biomedicine, Aarhus University, Aarhus, Denmark
ANDREAS HOLMGAARD  Department of Biomedicine, Aarhus University, Aarhus, Denmark
EVA-MARIA JEMILLER  Institute for Molecular Animal Breeding and Biotechnology, LMU
Munich, Munich, Germany
HELENE FAUSTRUP KILDEGAARD  The Novo Nordisk Foundation Center for Biosustainability,
Technical University of Denmark, Kgs. Lyngby, Denmark
NIKOLAI KLYMIUK  Institute for Molecular Animal Breeding and Biotechnology, LMU
Munich, Munich, Germany
NASTASSIA KNÖDLSEDER  Department of Experimental and Health Sciences, Universitat
Pompeu Fabra, Barcelona, Spain
SASKIA KÖNIG  Medical Center—University of Freiburg, Institute for Transfusion Medicine
and Gene Therapy and Center for Chronic Immunodeficiency at Center for Translational
Cell Research (ZTZ), Freiburg, Germany
RALF KÜHN  Max-Delbrück-Centrum für Molekulare Medizin, Berlin, Germany; Berlin
Institute of Health, Berlin, Germany
ANDERS LAUSTSEN  Department of Biomedicine, Aarhus University, Aarhus, Denmark
JAE SEONG LEE  Department of Molecular Science and Technology, Ajou University, Suwon,
Republic of Korea
CONGHUI LI  BGI-Qingdao, Qingdao, China
YONG LI  BGI-Shenzhen, Shenzhen, China
LIN LIN  Department of Biomedicine, Aarhus University, Aarhus, Denmark
KATHLEEN LONG  Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton,
Cambridge, UK
YONGLUN LUO  Department of Biomedicine, Aarhus University, Aarhus, Denmark; BGI-
Shenzhen, Shenzhen, China; Guangdong Provincial Key Laboratory of Genome Read and
Write, Shenzhen, China; BGI-Qingdao, Qingdao, China
JACOB GIEHM MIKKELSEN  Department of Biomedicine, Aarhus University, Aarhus,
Denmark
CLAUDIO MUSSOLINO  Medical Center—University of Freiburg, Institute for Transfusion
Medicine and Gene Therapy and Center for Chronic Immunodeficiency at Center for
Translational Cell Research (ZTZ), Freiburg, Germany
SIGNE NELDEBORG  Department of Clinical Medicine, Aarhus University, Aarhus,
Denmark
MANUELA NICKL  Department of Infectious Diseases/Virology, Heidelberg University
Hospital, Cluster of Excellence Cell Networks, Heidelberg, Germany; BioQuant Center,
University of Heidelberg, Heidelberg, Germany; German Center for Infection Research
(DZIF), Partner Site Heidelberg, Heidelberg, Germany
FRANCESCO NIOLA  Biotech Research and Innovation Centre (BRIC), University of
Copenhagen, Copenhagen, Denmark
MARIA PALLARÈS MASMITJÀ  Department of Experimental and Health Sciences, Universitat
Pompeu Fabra, Barcelona, Spain
LAURA BARRETT RYØ  Department of Biomedicine, Aarhus University, Aarhus, Denmark
 Contributors xi

DARIA SERGEEVA  The Novo Nordisk Foundation Center for Biosustainability, Technical
University of Denmark, Kgs. Lyngby, Denmark
KILIAN SIMMET  Institute for Molecular Animal Breeding and Biotechnology, LMU Munich,
Munich, Germany
KRISTIAN ALSBJERG SKIPPER  Department of Biomedicine, Aarhus University, Aarhus,
Denmark
KIRSTEN E. SNIJDERS  Wellcome Trust-MRC Stem Cell Institute, Anne McLaren Laboratory,
University of Cambridge, Cambridge, UK; Department of Surgery, University of
Cambridge, Cambridge, UK
MAGNUS STOUGAARD  Department of Clinical Medicine, Aarhus University, Aarhus,
Denmark
JÜRGEN STUMM  Max-Delbrück-Centrum für Molekulare Medizin, Berlin, Germany; Berlin
Institute of Health, Berlin, Germany
EMIL AAGAARD THOMSEN  Department of Biomedicine, Aarhus University, Aarhus,
Denmark
LUDOVIC VALLIER  Wellcome Trust-MRC Stem Cell Institute, Anne McLaren Laboratory,
University of Cambridge, Cambridge, UK; Department of Surgery, University of
Cambridge, Cambridge, UK; Wellcome Trust Sanger Institute, Hinxton, UK
BAS VAN STEENSEL  Division of Gene Regulation and Oncode Institute, Netherlands Cancer
Institute, Amsterdam, The Netherlands
PETRA VOCHOZKOVA  Institute for Molecular Animal Breeding and Biotechnology, LMU
Munich, Munich, Germany
HANS HEUGH WANDALL  Faculty of Health Sciences, Department of Cellular and Molecular
Medicine, Copenhagen Center for Glycomics (CCG), University of Copenhagen,
Copenhagen, Denmark
YUQUAN WEI  State Key Laboratory of Biotherapy and Cancer Center, West China Hospital,
Sichuan University, Chengdu, China
QINJIE WU  State Key Laboratory of Biotherapy and Cancer Center, West China Hospital,
Sichuan University, Chengdu, China
ANNEGRET WÜNSCH  Institute for Molecular Animal Breeding and Biotechnology, LMU
Munich, Munich, Germany
XI XIANG  BGI Education Center, University of Chinese Academy of Sciences, Shenzhen,
China; BGI-Shenzhen, Shenzhen, China
SULEIXIN YANG  State Key Laboratory of Biotherapy and Cancer Center, West China
Hospital, Sichuan University, Chengdu, China
ZHANG YANG  Faculty of Health Sciences, Department of Cellular and Molecular Medicine,
Copenhagen Center for Glycomics (CCG), University of Copenhagen, Copenhagen,
Denmark
SANIYE YUMLU  Max-Delbrück-Centrum für Molekulare Medizin, Berlin, Germany; Berlin
Institute of Health, Berlin, Germany
XIUQING ZHANG  BGI-Shenzhen, Shenzhen, China
 Part I

Methods for CRISPR-gRNA Design and Quantification

of Activity
 Chapter 1

CRISPR-gRNA Design
Maria Pallarès Masmitjà, Nastassia Knödlseder, and Marc Güell

Abstract
Gene editing has great therapeutic impact, being of interest for many scientists worldwide. Clustered
regularly interspaced short palindromic repeats (CRISPR) technology has been adapted for gene editing
to serve as an efficient, rapid, and cost-effective tool. To fulfill CRISPR experiment’s goals, two components
are important: an endonuclease and a gRNA. The most commonly used endonucleases are Cpf1 and Cas9
and are described in depth in this chapter. The gRNA targets the genome site to be edited, giving great
importance to its design to obtain increased efficiency and decreased off-target events. In this chapter, we
describe different tools to design suitable gRNAs for a variety of experimental purposes.

Key words CRISPR, gRNA design, Genome editing, Cas9, Cpf1

1 Introduction

Technologies for genome engineering are on high demand. The

adaptation of CRISPR, a new tool for gene editing, has revolutio-
nized the field of genome engineering [1, 2]. Nowadays, CRISPR
is the most used technology in gene editing, with Cas9 being the
most used CRISPR system [3].
Basically, this new technology consists of two components: A
single- or double-strand endonuclease, such as Cas9 or Cpf1, and a
synthetic single-guide RNA (gRNA) which will direct the CRISPR
system to a target region in the genome. The Cas9-gRNA complex
scans the protospacer adjacent motif (PAM) region and forms
Watson-Crick base pairing to a target DNA fragment of 20 nucleo-
tides [3]. This conformation enables the endonuclease to cleave site
specifically the target DNA. Finally, the endogenous DNA repair
machinery of the cells repairs the double-stranded break and intro-
duces the desired changes.
Minimizing to a two-component system enabled genome engi-
neering to be easier than ever before. The gRNA can be changed to
any target DNA sequence of interest.

Yonglun Luo (ed.), CRISPR Gene Editing: Methods and Protocols, Methods in Molecular Biology, vol. 1961,
https://doi.org/10.1007/978-1-4939-9170-9_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019

3
4 Maria Pallarès Masmitjà et al.

This chapter provides a methodology for gRNA design and

includes all necessary information and options when designing an
adequate gRNA for your CRISPR experiment.

2 Nuclease Types

Choosing the right nuclease is key for our experiment success.

There are many different nucleases to use; the CRISPR-Cas system
is divided into 2 classes, which are divided into 6 types and 19 sub-
types [4]. However, the most used endonucleases are Cas9 and
cpf1, both from class 2, which both work as a single unit for
recognition of the target and cleavage (Table 1).
Cas9 is a dual RNA-guided DNA endonuclease of type II. It
cleaves double-stranded DNA.
It has preference for PAM (protospacer-adjacent motif)
sequence 50 NGG0 3 following the 20 bp gRNA target [5], and it
generates blunt ends three nucleotides upstream of the PAM site.
Multiple Cas9 variants have been developed including a nickase
Cas9 and a dead Cas9. Nickase Cas9 (nCas9) has either of the two
nuclease domains (HNH and RuvC) [6] inactivated whereas if both
nuclease domains are inactivated it becomes Dead cas9 (dCas9).
nCas9 generates single-strand breaks (SSBs), a pair of nCas9 can be
used to generate paired nicks instead of DSBs, and this would
reduce off-target cleavage [7]. dCas9 will work as a site-specific
DNA-binding vehicle able to be combined with other effectors
instead of a genome editing tool [8].
On the other hand, Cpf1 is a CRISPR type V endonuclease
which recognizes PAMs 50 -TTN which is more frequent in the
human genome than Cas9 PAMs requirements, and also improves
the editing of TA-rich parts of the genome [9]. This endonuclease
cleaves in a staggered manner creating five nucleotide 50 overhang
18–23 bases away from PAM. It is also smaller than Cas9 nuclease
enabling a better packaging in viruses if needed; however, there are
two relevant types of Cas9: Cas9 from Streptococcus pyogenes

Table 1
Features of Cas9 and Cpf1

Cas9 Cpf1
Type II V
Cleavage Double-stranded DNA Double-stranded DNA
0
Protospacer-adjacent motif NGG 3 50 -TTN
(PAM)
Ends Blunt end 3 nt upstream 5 nucleotide 50 overhang 18–23 nt from
PAM PAM
 CRISPR-gRNA Design 5

(SpCas9) and Cas9 from Staphylococcus aureus (SaCas9) which is

smaller and better for adeno-associated viruses packaging and
transduction [10].

3 gRNA Efficiency

gRNAs will guide the CRISPR system molecules to the specific site
intended to edit in the genome. It has a scaffold that will bind the
endonuclease and a spacer of 20 nucleotides which target specific
sequence in the genome.
The efficiency of the gRNA can vary from a sequence to
another, and it is crucial for the genome editing experiment.
Some factors are known to correlate with high efficiency gRNAs
such as higher stability of the duplex between gRNA and target
DNA [11]. Scores tend to correlate with gRNA efficiency, but their
accuracy depends on the experimental system considered [12]. For
instance, Moreno-Mateos score is useful for zebrafish injection
experiments [13] (where gRNAs need to be very stable after injec-
tions including G-rich sequence) but inaccurate in cultured mam-
malian cells [14]. This score is also reliable for assays based on
delivery of gRNAs produced synthetically or by T7 in vitro tran-
scription [15]. The most common scores are based on datasets
where gRNA is continuously expressed from a U6 promoter so
they do not need to be very stable. One of the most used for
mammalian cells is the score by Doench et al. [16]; also the Wang
score is useful when designing second generation libraries of human
gRNAs in some cancer cell lines [17]. It is recommended to use
scoring systems trained with the same expression system planned to
be used. The web tool http://crispor.org provides multiple scores
such as Moreno-Mateos and Doench simultaneously to help select
efficient gRNA for different applications.
Recently, approaches based on machine learning such as
CRISTA have been developed, which determines the propensity
of a genomic site to be cleaved by a gRNA [18].

4 gRNA Off Target

CRISPR RNA-guided endonucleases have been tested for its off-

target activity in human cells. Cpf1 is highly specific in human and
does not show much measurable off target [19]. There is an essen-
tial need of identifying Cas9-induced off-target mutations, to pre-
vent unwanted chromosomal translocations or unintended
mutations, in human research to ensure safe use of the CRISPR
nucleases in genome engineering and treatment of diseases
[20, 21]. Off targets are generally induced by the targeted site
and never represent a random change [20].
6 Maria Pallarès Masmitjà et al.

Off-target cleavage represents a major challenge for CRISPR/

Cas9-mediated genome editing, as Cas9 is able to cleave even if
there is no complete complementarity between genomic site and
gRNA sequence [22]. It was believed that Cas9 specificity was
strictly controlled by PAM and the 20 nt guide sequence, but
recently it was shown that it was controlled by a 5 bp sequence 50
of the PAM, termed “Seed Sequence” [23]. Through the recent
findings of the importance of the sequence in proximity to the
PAM, some rules for the design were proposed:
1. U-rich seeds: WHY? Decrease of sgRNA abundance and
increase of specificity.
2. Mis-matches: WHERE? Tolerated better at the 50 end of the
sgRNA.
3. GC content: HOW? Exceptionally high or low GC content in
sgRNA leads to an increase in activity. Guanine is preferred as
first base after PAM and cytosine as the base for the fifth
position after PAM [23].
Researchers try to find different solutions for minimizing and
eliminating off-target mutations in CRISPR experiments. One way
is to minimize the concentration of used gRNA or/and Cas9 in
human cells. Another way is to change the gRNA sequence by
either truncating the 30 ends within the tracrRNA-derived sequence
or by addition of two guanines on the 50 ends prior to the comple-
mentary region. Paired nickases represent an additional approach,
where two gRNAs and a cas9 nickase are generating nicks at the
target site [7].
It was shown that 5’ truncated gRNAs at their complementary
region, which have at least 17-18 nt of complementary function,
are as efficient as their full-length construct, but with a lower off-
target cleavage [24]. While all the mentioned approaches decrease
off-target cleaves, also on-target efficiency gets reduced and
through truncated guides, indel formation can occur and lead to
less overall target sites in the genome [22]. Slaymaker et al. engi-
neered the cas9 nuclease in a structure-guided manner where they
neutralize positive charges in the nt-groove. Hereby, off-target
indel formation could be decreased and on-target cleavage
stabilized [22].
The off-target activity of the CRISPR system can be carefully
minimized by designing a precise gRNA. A study to minimize the
off-target binding of the gRNAs was performed using the earlier
study on the on-target activity as a model (Rule Set 1) and setting
up computational design rules to create better gRNA libraries
[16]. It is important to mention the CFD score (cutting frequency
determination), which predicts off-target scores combined with
Doench et al. designed gRNA designer 2016 which can predict
activity and specificity of guides [16].
 CRISPR-gRNA Design 7

In a similar way, in order to facilitate Cpf1-based genome

editing, a study of >11,000 different target sequences and guide
RNAs was performed [9] and a tool to predict indel sequences for
given target sequences was created (http://big.hanyang.ac.kr/
cindel).

5 gRNA Design

To design a satisfactory CRISPR gene editing experiment, here are

some important steps:
1. Selection of a suitable endonuclease. We described cas9 and
cpf1 before, the most used endonucleases in CRISPR
experiments.
2. Target selection of the gRNA upstream 50 -NGG for cas9 or
downstream of TTN for cpf1.
3. Selecting an efficient gRNA with reduced off-target. Different
candidates can be found using different tools described in
Table 2.
4. Design ssODN template (optional for homology-directed
repair (HDR)).
As mentioned before, the specificity of the nuclease depends on
the 20 nt sequence on the gRNA that will base pair with our target
sequence. The two critical points to design a suitable gRNA are the
efficiency to target our gene of interest avoiding large off-target
events. In the previous section about gRNAs, we mentioned some
useful scores to design it such as Wang score and CFD score or
tools to calculate off target like sgRNA scorer for cas9 or hanyang
for cpf1 gRNAs. Select an efficiency score that has been trained on
the same gRNA production system planned in your experiment
(U6 expression, synthetic/T7 in vitro transcribed).

6 gRNA Expression, Construction, and Delivery

There are a wide variety of approaches to deliver the CRISPR

machinery (gRNAs and endonucleases) to the experimental system
of election; here we will mention some of them:
1. By PCR amplification: enclose the gRNA onto the reverse
primer used to amplify a U6 promoter template. The amplicon
can be co-transfected into the cells with cas9 expression plas-
mid. This is a good method for quick screening of different
gRNAs candidates and for generating libraries.
8 Maria Pallarès Masmitjà et al.

Table 2
Selected websites for gRNA design

Websites for design

Link Name Description

http://tools.genome-engineering. CRISPRDesign To take a large input sequence, identify and rank
org good target sites and predict their off-target
equivalent sites and also specify the necessary
oligos and primers; you also can select 20 bp
nucleotide sequences and score them and
design the primers manually.
http://crispor.org CRISPOR To design, evaluate and clone guide sequences
for CRISPR experiments. It provides multiple
scores to design a more accurate gRNA
depending on the system used. It also works
with cpf1 gRNAs.
https://portals.broadinstitute. sgRNAdesigner To rank gRNA candidates maximizing the
org/gpp/public/analysis-tools/ 2016 on-target candidates and minimizing the off-
sgrna-design target using Rule Set 2 from Doench et al.
https://genome.ucsc.edu UCSC genome To look for CRISPR gRNA. It has already all the
browser reliable gRNA sequences designed and simply
choose by looking at the target gene region
http://big.hanyang.ac.kr/cindel CINDEL To predict indel sequences for given target
sequences for Cpf1 gRNAs. The sequence
must be 27 bp maximum.

2. By plasmid-based procedure: oligo pairs encoding the 20 nt

guide sequence which will be annealed and ligated into a
plasmid (which can be the cas9 expression plasmid).
3. Topocloning the gRNAs onto an episomal vector and
co-transfecting it with the endonuclease plasmid.
4. Endonucleases and gRNAs can also be transfected into the cells
as mRNA and RNA, or RNA-protein complexes.

7 Design of Repair Template (Only for HDR Applications)

Previously, there was the need to use plasmid-based donor repair

templates containing homology arms flanking the site of alteration.
Nowadays, ssODNs [25] can be used for short modifications in a
defined locus without cloning. For high HDR efficiency, ssODNs
contain flanking sequences around 40 bp on each side homologous
to the target regions.
It has been shown that by adding ssDNA donors complemen-
tary to the strand that cas9 dissociates from first, the HDR rate in
 CRISPR-gRNA Design 9

human cells can be increased using either cas9 or nickase

variants [26].

8 Functional Validation of gRNA

1. Cell culture and transfection with endonucleases and gRNAs.

2. Isolation of the clonal cell lines (optional). There are many
techniques to isolate the successfully edited clonal cell lines:
to isolate cells with specific modifications you can use FACS
enrichment or serial dilutions followes by an expansion period
to establish a new clonal cell line.

9 On-Target Efficiency

There are different methodologies to calculate the success of a

CRISPR experiment.
1. Gene editing efficiency can be estimated using SURVEYOR
nuclease assay [27].
2. Sanger sequencing can be used to assess the mutation reper-
toire generated.
3. Fragment analysis based to estimate population of indels.
4. Deep sequencing can simultaneously measure efficiency and
mutations repertoire [28, 29].

10 Off-Target Analysis

Many different high-throughput sequencing techniques have

evolved lately to analyze on-target and off-target efficiency. Two
highly used systems are GUIDE-seq and CIRCLE-seq [30, 31].

11 Conclusion

CRISPR is a relatively new tool for gene editing. Appropriate

experimental design may impact significantly the quality of the
results.

References
1. Mojica FJM, Dı́ez-Villaseñor C, Garcı́a- 2. Zhang F, Wen Y, Guo X (2014) CRISPR/Cas9
Martı́nez J, Almendros C (2009) Short motif for genome editing: progress, implications and
sequences determine the targets of the pro- challenges. Hum Mol Genet 23:R40–R46
karyotic CRISPR defence system. Microbiol- 3. Jinek M, Chylinski K, Fonfara I, Hauer M,
ogy 155:733–740 Doudna JA, Charpentier E (2012) A
10 Maria Pallarès Masmitjà et al.

programmable dual-RNA-guided DNA endo- scoring algorithms and integration into the
nuclease in adaptive bacterial immunity. Sci- guide RNA selection tool CRISPOR. Genome
ence 337:816–821 Biol 17:148
4. Nishimasu H, Nureki O (2017) Structures and 16. Doench JG, Fusi N, Sullender M, Hegde M,
mechanisms of CRISPR RNA-guided effector Vaimberg EW, Donovan KF et al (2016) Opti-
nucleases. Curr Opin Struct Biol 43:68–78 mized sgRNA design to maximize activity and
5. Mali P, Yang L, Esvelt KM, Aach J, Guell M, minimize off-target effects of CRISPR-Cas9.
DiCarlo JE et al (2013) RNA-guided human Nat Biotechnol 34:184–191
genome engineering via Cas9. Science 17. Wang T, Birsoy K, Hughes NW, Krupczak KM,
339:823–826 Post Y, Wei JJ et al (2015) Identification and
6. Makarova KS, Grishin NV, Shabalina SA, Wolf characterization of essential genes in the
YI, Koonin EV (2006) A putative RNA- human genome. Science 350:1096–1101
interference-based immune system in prokar- 18. Abadi S, Yan WX, Amar D, Mayrose I (2017) A
yotes: computational analysis of the predicted machine learning approach for predicting
enzymatic machinery, functional analogies with CRISPR-Cas9 cleavage efficiencies and pat-
eukaryotic RNAi, and hypothetical mechan- terns underlying its mechanism of action.
isms of action. Biol Direct 1:7 PLoS Comput Biol. Public Library of Science
7. Ran FA, Hsu PD, Lin C-Y, Gootenberg JS, 13:e1005807
Konermann S, Trevino AE et al (2013) Double 19. Kleinstiver BP, Tsai SQ, Prew MS, Nguyen NT,
nicking by RNA-guided CRISPR Cas9 for Welch MM, Lopez JM et al (2016) Genome-
enhanced genome editing specificity. Cell wide specificities of CRISPR-Cas Cpf1
154:1380–1389 nucleases in human cells. Nat Biotechnol.
8. Wen W-S, Yuan Z-M, Ma S-J, Xu J, Yuan D-T NIH Public Access 34:869
(2016) CRISPR-Cas9 systems: versatile cancer 20. Fu Y, Foden JA, Khayter C, Maeder ML,
modelling platforms and promising therapeutic Reyon D, Keith Joung J et al (2013) High
strategies. Int J Cancer 138:1328–1336 frequency off-target mutagenesis induced by
9. Kim HK, Song M, Lee J, Vipin Menon A, CRISPR-Cas nucleases in human cells. Nat
Jung S, Kang Y-M et al (2016) In vivo high- Biotechnol. NIH Public Access 31:822
throughput profiling of CRISPR–Cpf1 activity. 21. Cho SW, Kim S, Kim Y, Kweon J, Kim HS, Bae
Nat Methods 14:153–159 S et al (2014) Analysis of off-target effects of
10. Friedland AE, Baral R, Singhal P, Loveluck K, CRISPR/Cas-derived RNA-guided endonu-
Shen S, Sanchez M et al (2015) Characteriza- cleases and nickases. Genome Res. Cold Spring
tion of Staphylococcus aureus Cas9: a smaller Harbor Laboratory Press 24:132
Cas9 for all-in-one adeno-associated virus 22. Slaymaker IM, Gao L, Zetsche B, Scott DA,
delivery and paired nickase applications. Yan WX, Zhang F (2016) Rationally engi-
Genome Biol 16:257. https://doi.org/10. neered Cas9 nucleases with improved specific-
1186/s13059-015-0817-8 ity. Science 351:84–88
11. Wong N, Liu W, Wang X (2015) WU-CRISPR: 23. Zhang XH, Tee LY, Wang XG, Huang QS,
characteristics of functional guide RNAs for Yang SH (2015) Off-target effects in
the CRISPR/Cas9 system. Genome Biol CRISPR/Cas9-mediated genome engineer-
16:218 ing. Mol Ther Nucleic Acids. Cell Press 4:
12. Haeussler M, Concordet J-P (2016) Genome e264. https://doi.org/10.1038/mtna.2015.
editing with CRISPR-Cas9: can it get any bet- 37
ter? J Genet Genomics 43:239–250 24. Jeffry D, Sander JKJ (2014) CRISPR-Cas sys-
13. Moreno-Mateos MA, Vejnar CE, Beaudoin tems for genome editing, regulation and tar-
J-D, Fernandez JP, Mis EK, Khokha MK et al geting. Nat Biotechnol. NIH Public Access
(2015) CRISPRscan: designing highly efficient 32:347
sgRNAs for CRISPR-Cas9 targeting in vivo. 25. Yang L, Guell M, Byrne S, Yang JL, De Los
Nat Methods 12:982–988 Angeles A, Mali P et al (2013) Optimization of
14. Malina A, Cameron CJF, Robert F, scarless human stem cell genome editing.
Blanchette M, Dostie J, Pelletier J (2015) Nucleic Acids Res 41:9049–9061
PAM multiplicity marks genomic target sites 26. Richardson CD, Ray GJ, DeWitt MA, Curie
as inhibitory to CRISPR-Cas9 editing. Nat GL, Corn JE (2016) Enhancing homology-
Commun 6:10124 directed genome editing by catalytically active
15. Haeussler M, Schönig K, Eckert H, and inactive CRISPR-Cas9 using asymmetric
Eschstruth A, Mianné J, Renaud J-B et al donor DNA. Nat Biotechnol 34:339–344
(2016) Evaluation of off-target and on-target
 CRISPR-gRNA Design 11

27. Shrock E, Güell M (2017) CRISPR in animals 30. Tsai SQ, Zheng Z, Nguyen NT, Liebers M,
and animal models. Prog Mol Biol Transl Sci. Topkar VV, Thapar V et al (2015) GUIDE-
Academic Press 152:95–114 seq enables genome-wide profiling of
28. Guell M, Yang L, Church GM (2014) Genome off-target cleavage by CRISPR-Cas nucleases.
editing assessment using CRISPR Genome Nat Biotechnol 33:187–197
Analyzer (CRISPR-GA). Bioinformatics 31. Tsai SQ, Nguyen NT, Malagon-Lopez J, Top-
30:2968–2970 kar VV, Aryee MJ, Joung JK (2017) CIRCLE-
29. Pinello L, Canver MC, Hoban MD, Orkin SH, seq: a highly sensitive in vitro screen for
Kohn DB, Bauer DE et al (2016) Analyzing genome-wide CRISPR-Cas9 nuclease
CRISPR genome-editing experiments with off-targets. Nat Methods 14:607–614
CRISPResso. Nat Biotechnol 34:695–697
 Chapter 2

Tracking CRISPR’s Footprints

Lin Lin and Yonglun Luo

Abstract
The programmable clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-
associated 9 (Cas9) and CRISPR-Cas9-derived gene editing and manipulation tools have revolutionized
biomedical research over the past few years. One important category of assisting technologies in CRISPR
gene editing is methods used for detecting and quantifying indels (deletions or insertions). These indels are
caused by the repair of CRISPR-Cas9-introduced DNA double-stranded breaks (DBSs), known as
CRISPR’s DNA cleavage footprints. In addition, CRISPR-Cas9 can also leave footprints to the DNA
without introducing DSBs, known as CRISPR’s DNA-binding footprints. The indel tracking methods have
contributed greatly to the improvement of CRISPR-Cas9 activity and specificity. Here, we review and
discuss strategies developed over that past few years to track the CRISPR’s footprints, their advantages, and
limitations.

Key words CRISPR, Cas9, Indels, DSB, Indel frequency, Off-target

1 The Important Role of Endogenous DSB Repair Machineries in CRISPR Gene

Editing

Living organisms have developed an intrinsic mechanism to repair

lesions introduced to their genetic materials. Some of these genetic
lesions can be lethal, such as DNA double-stranded breaks (DSBs).
Unrepaired DSBs will lead to chromosomal abnormality and cell
death. In mammalian cells, several DSB repair mechanisms have
evolved to cope with these lethal DNA damages. Two major DSB
repair pathways have been broadly accepted to be the main DNA
repair mechanisms in mammalian cells: non-homologous end join-
ing (NHEJ) and homology-directed repair (HDR) [1]. More and
more evidences have uncovered that microhomology-mediated end
joining (MMEJ) and single strand annealing (SSA) are two DNA
repair mechanisms that mammalian cells frequently used to repair
DSBs (Fig. 1) [2, 3].
The DNA repair machinery is a very complicated but systemat-
ically organized system that cells have developed to maintain their

Yonglun Luo (ed.), CRISPR Gene Editing: Methods and Protocols, Methods in Molecular Biology, vol. 1961,
https://doi.org/10.1007/978-1-4939-9170-9_2, © Springer Science+Business Media, LLC, part of Springer Nature 2019

13
14 Lin Lin and Yonglun Luo

Fig. 1 Schematic illustration of DSB repair by homology-directed repair (HDR), non-homologous end joining
(NHEJ), microhomology-mediated end joining (MMEJ), and single strand annealing in mammalian cells. HDR
leads to precise and intended gene insertion, replacement, or modification. Indels (deletions or insertions) are
typically introduced by NHEJ. Variable-size small and large deletions are introduced by MMEJ and SSA,
respectively, after the repair of DSBs

genomic stability. Errors introduced to the DSBs repair pathways

are the major cause of oncogenesis in humans. In 2015, the Nobel
Prize in Chemistry was awarded to Tomas Lindahl, Paul Modrich,
and Aziz Sancar, to acknowledge their work on deciphering the
molecular mechanisms of DNA repair processes [4–6]. Although
great progresses have been achieved in understanding the mecha-
nism of DNA repair machinery in mammalian cells, and many genes
such as LIG4, KU70, KU80, DNA-PKcs, MRN, ARTEMIS,
RAD51, TP53, BRCA1, and NSB1 are found to be involved in
the DSB repair pathways, our knowledge of the cellular DNA repair
machinery is still expanding [7].
DSBs are not always a bad thing. Traditional gene knockout by
homologous recombination or HDR has greatly contributed to the
generation of cell and animal models for biomedical research
[8]. However, this approach is hampered by its extremely low
efficiency. It has long been observed that introduction of DSBs
can lead to disruption of gene function, or knockout, and can
dramatically enhance the efficiency of HDR. Thus, there has been
a long period of hunting for programmable DNA nucleases, which
can be harnessed to introduce DSBs to a specific gene locus. The
discovery of meganucleases (MGNs) and zinc finger nuclease
(ZFNs) are two keystones for the foundation of gene editing,
which is conceptionally defined as intentional modification of
genes using a molecular scissor [9–11]. These two generations of
 Tracking CRISPR’s Footprints 15

gene editing tools are not very broadly adopted mostly due to the
technical difficulty and the workload of designing and generating a
working MGNs or ZFNs. The Transcription Activator-Like Effec-
tor Nucleases (TALENs) technology is the second revolution in the
gene editing history. Compared to MGNs and ZFNs, TALENs
hold a much more stringent protein-to-DNA code for targeting.
The DNA-binding domain of a TALEN is defined by the number
and order of four types of modular repeated domains. These highly
conserved 33–34 amino acids repeated domains contain two diver-
gent 12th and 13th amino acids, also known as repeat variable
diresidue (RVD): NG, HD, NI, NN/NH/NK that target T,
C, A, G nucleotide respectively. Nevertheless, it is still quite time-
consuming to generate a pair of TALEN vectors, although the
whole procedure of generating TALENs has been greatly simplified
compared to MGNs and ZFNs. The third generation of revolution
in gene editing history is the RNA-guided endonucleases, also
known as the clustered regularly interspaced short palindromic
repeats (CRISPR) and CRISPR-associated protein (Cas) gene edit-
ing technologies [12–14].
The CRISPR-Cas gene editing technology has overcome
almost all the disadvantages of previous gene editing tools. Unlike
MGNs, ZFNs, and TALENs, the CRISPR gene editing tool is
based on RNA-to-DNA code for targeting. Thus, the sole Cas
protein, with the Streptococcus Pyogenes Cas9 protein (SpCas9)
being the most broadly used one, can be used for gene editing in
almost all cells and organisms [15]. Designing and generating a
new CRISPR targeting component is now simply achieved through
changing the guide sequences presented in a small RNA molecule,
known as guide RNA (gRNA) or small guide RNA (sgRNA). In the
SpCas9-based CRISPR gene editing system, the gRNA is a chime-
ric RNA (crRNA:tracrRNA), which interacts with SpCas9 and
guides SpCas9 to the target site through a Watson-Crick base
pairing between the guide sequences of crRNA and the target
site. As the guide or spacer sequences are the same as the target
site (protospacer), the bacterial Cas protein has evolved an
extremely smart system to distinguish self and non-self sequences,
which is the of protospacer adjacent motif (PAM)-dependent DNA
cleavage system [12]. Once all these features are met, the endonu-
clease activity of Cas9 protein is activated and a DSB is introduced
in the target sites (Fig. 2).
One essentially common feature and outcome of all these gene
editing tools is the introduction of a DSB to the target site. These
DSBs are repaired by endogenous DNA repair machineries, leading
to DNA alterations such as small deletions or insertions (called
indels) at the DSB sites. These indels are just like footprints left
by CRISPR to the DNA. Thus, quantification of the indel fre-
quency has been used to quantify the overall activity and specificity
(off-target) of these gene editing tools. Several methods have been
16 Lin Lin and Yonglun Luo

Fig. 2 Schematic illustration of CRISPR-Cas9-mediated gene targeting and the core components. The SpCas9
protein has two nuclease domains: RuvC and HNH. The first step of CRISPR gene editing is delivery of Cas9
and gRNA into cells, which can form Cas9:gRNA complex. The next step is the nucleus entry of Cas9:gRNA
complex, mediated by the nucleus localization signal (NLS) peptides fused Cas9. The last step of CRISPR gene
editing is the repair of DSBs introduced by Cas9:gRNA with DSBs repair machineries

developed over the past decade for quantifying indel frequency and
specificity (Fig. 3). To give readers a systematic overview and help
with choosing the right method for their CRISPR gene editing
experiment, this chapter reviews the advantage and disadvantage of
different methods.

2 CRISPR’s Footprint Detection by Mismatch-Specific Endonuclease Assay (MSE)

The mismatch-specific endonucleases have been the gold standard

of measuring overall activities of gene editing tools [16]. This assay
is based on the mismatch-specific endonucleases such as Surveyor
nuclease and T7 endonuclease 1 (T7E1) that are capable of cleaving
heteroduplex DNAs [17]. The whole procedure of quantifying
CRISPR activity by Surveyor assay or T7E1 is relative simple.
First, genomic DNA or cell lysate is made from cells or tissues
that are typically a few days after being treated with Cas9-gRNA
components. The delivery of Cas9-gRNA can be in various forms,
such as transfections in plasmid DNA, RNP, mRNA, or transduc-
tion through viral vectors [18–21]. Second, the targeted region is
amplified by PCR using a specific primer and proofreading DNA
polymerase. As the repairing of DSBs introduced by CRISPR/Cas9
is mainly mediated by NHEJ and MMEJ in mammalian cells, the
targeted PCR product is a mixture of WT amplicons and amplicons
with various indels. Third, the PCR product is purified and
 Tracking CRISPR’s Footprints 17

Fig. 3 Schematic illustration of the procedures and methods used for CRISPR indel profiling. Mismatch-
specific enzyme assay, TIDE, IDAA, HRM, and Drop-Off methods are presented

subjected to the generation of heteroduplex DNA through dena-

turing and annealing. And finally, the heteroduplex DNA is
digested with mismatch-specific endonuclease and indel frequency
is quantified by measuring the electrophoresis band intensity using
software such as Image J.
The assay is in principle very straightforward, as the mismatch-
specific endonucleases can recognize any mismatches. However, to
achieve a successful mismatch-specific endonuclease assay, two steps
must be fully optimized: (1) Amplification of target region by PCR.
This PCR should be very specific. (2) The generation of heterodu-
plex PCR product. The purity of PCR product, buffers, denaturing
and annealing programs should be well optimized to generate
authenticable heteroduplex PCR products. In addition to the prac-
tical steps, a few studies have highlighted that mismatch-specific
endonuclease assay could underestimate the actual gene editing
efficiency [22, 23]. Increasing evidence proves that indels gener-
ated by CRISPR for a specific site are not fully random [24]. For
example, a given CRISPR target site has an activity as high as 90%,
and the majority of indels is one base pair deletion. Most of the
indel-containing PCR product will not form heteroduplex DNA.
Thus, the mismatch-specific endonuclease assay can only be used to
estimate the activity of gene editing tools.
18 Lin Lin and Yonglun Luo

3 CRISPR’s Footprint Detection by TIDE and TIDER Assays

TIDE (Tracking of Indels by DEcomposition) and TIDER assays

are developed by Bas van Steensel’s group from the Netherlands
Cancer Institute [25, 26]. According to our experience [27, 28],
TIDE and TIDER assays are by far the most convenient, cost-
effective, and fastest methods for quantifying indel frequency and
genotyping. The assay is based two PCRs, two standard capillary
sequencing (or Sanger sequencing), and sequencing trace decom-
position algorithm. Unlike enzymatic-based assays which can only
estimate the overall indel frequency, TIDE can provide quite accu-
rate and sensitive calculation of indel frequency for each class of
indels. Very detailed instructions and a friendly web-based TIDE
analysis tool are provided by Bas van Steensel’s group (see Chapter 3
of this book), which really benefit the whole gene editing commu-
nity (https://tide.deskgen.com). Similarly, another web tool,
CRISP-ID, has been developed for genotyping up to three alleles
from a single Sanger sequencing trace [29]. The CRISP-ID serves
as a very good method for genotyping gene-edited single clones.

4 CRISPR’s Footprint Detection by IDAA Assay

IDAA (Indel Detection by Amplicon Analysis) is another method

developed by Eric P. Bennett and colleagues from Copenhagen
University [23, 30]. This assay is based on tri-primer amplicon
labeling and DNA fragment size analysis using capillary electropho-
resis, also see another similar method reported by Ramlee,
M.K. and colleagues [31], also see Chapter 4 of this book. One
conventional and smart design of the IDAA system is the utilization
of a unique FAM-label primer, which can be used for almost any
target site. This strategy greatly reduces the cost of using directly
fluorescent-labeled target primers. IDAA has much more advan-
tages over enzymatic-based indel quantification methods. Com-
pared to the TIDE method, the IDAA is similar in its sensitivity,
reproductively, and cost for indel quantification. However, IDAA
can only give the quantification of each indel types such as one base
pair insertion, while TIDE can provide more detailed information
of the indels such as the constitution of this one base pair insertion.
Nevertheless, IDAA provides a very good, conventional and cost-
effective method for quantifying indel frequency.

5 CRISPR’s Footprint Detection by High Resolution Melting Curve

High resolution melting (HRM) curve assay is based on the size-

and base-dependent melting temperature of PCR amplicons
 Tracking CRISPR’s Footprints 19

[32, 33]. The HRM method has been used for epigenetic genotyp-
ing, high-throughput genotyping, and SNP genotyping. Com-
pared to enzymatic-based methods and TIDE, the HRM method
can provide a much more cost-effective and high-throughput
option for screening a large number of gene-edited clonal cells
(Fig. 3). For HRM, the PCR reaction and melting curve determi-
nation can be performed in the same reaction tube consecutively,
thus avoiding many practical steps such as purification of PCR
product, concentration measuring, enzymatic-reaction and gel
electrophoresis for enzymatic-based method, or preparation of
Sanger sequencing for TIDE. However, the HRM method is not
sensitive enough to measure overall indel frequency as compared to
the aforementioned methods. In addition, the HRM method can-
not quantify the frequency of different types of indels.

6 CRISPR’s Footprint Detection by Drop-Off Assay

The Drop-Off assay is based on droplet digital PCR (ddPCR) for

quantification of indel frequency and genotyping, developed by
Lynne-Marie Postovit and colleagues from the University of
Alberta and Bio-Rad Laboratorie [34]. This approach uses two
fluorescent-labeled duplexed primer probes-based ddPCR for
indel detection and quantification [35]. One reference probe
binds to a distal none-target site of the amplicon, and another
NHEJ/drop-off probe binds the nuclease target site. The Drop-
Off assay has a great advantage for distinguishing mono- and
bi-allelic modified cell clones, as well as having a relatively high
sensitivity (up to 0.6% tested). However, since the method is based
on probe hybridization, the Drop-Off method might not be able to
distinguish 1 bp indels from wt. We and many other groups have
found that, for most gRNA, 1 bp indels (1 bp deletion or insertion)
are the most frequent indel types. The Drop-Off will underestimate
overall indel frequency when used to evaluate gRNA efficiencies.

7 CRISPR’s Footprint Detection by Surrogate Reporter Systems

Another approach of assaying the Cas9 gRNA activity is using

surrogate reporter vectors. The finding that plasmids and extra-
chromosomal DNAs can also utilize the endogenous DNA repair
machineries leads the development of several surrogate reporter
vector to sensing DBS and repair in cells [36]. Surrogate vectors
have been made based on HDR, NHEJ, SSA, and fluorescent- or
antibiotic-based reporters [37–41]. The common feature of all
these surrogate reporter vectors is that a surrogate target site,
which is identical to the actual target site in the genome, is intro-
duced to the inactivated fluorescence or antibiotic gene of the
20 Lin Lin and Yonglun Luo

reporter vector. Previously, we have developed a system based on

Split EGFP and SSA-mediated DSB repair, called C-Check [38],
also see Chapter 5 of this book. Upon introduction of a DSB to the
surrogate target site of C-Check vector, SSA-mediated DSB repair
will generate a functional EGFP. We have validated that the C-
Check-based CRISPR activity correlates well with TIDE-based
quantification [28]. Although surrogate vectors cannot distinguish
the different indel profiles, C-Check and other fluorescent surro-
gate reporter vectors serve as an extremely useful tool for enrich-
ment of gene-edited cells [42].

8 CRISPR’s Footprint Detection by Targeted Amplicon Next-Generation Sequencing

(TA-NGS)

Targeted amplicon next-generation sequencing (TA-NGS) is a very

straightforward method for both quantifying the activity and indel
profile of CRISPR-Cas9 gene in cells. Similar to enzymatic-based
assay, TIDE, or IDAA, TA-NGS is based on PCR amplification of
the target region from cells treated with CRISPR-Cas9 compo-
nents. The PCR product is then subjected to next-generation
sequencing using any of the commercially available NGS platforms.
Currently, many sequencing NGS platforms have been used for
such purposes including Illumina miSeq system, BGIseq500, Ion
Torrent, etc. The TA-NGS method has several unique advances
that other methods lack. First, TA-NGS has the highest sensitivity
and R2 coefficient when compared with TIDE, T7E1, and IDAA
[23]. Second, TA-NGS is the only method that can give most
spectrum of indels in the cells, including what kind of indels and
their percentage. However, the TA-NGS method also has its dis-
advantages. First, the TA-NGS method is more expensive and takes
a relatively longer period (approximately 1 week) as compared to
other methods. Secondly, handling of the TA-NGS data could be
impractical for most labs that are not familiar with NGS data.
However, several web tools have been developed to facilitate the
application of TA-NGS in gene editing experiments, such as the
AGEseq [43], CRISPResso [44], BATCH-GE [45], and CRISPR-
DAV [43] for analysis of CRISPR-Cas9 genome editing outcomes
from deep sequencing data.

9 Genome-Scale Detection of CRISPR’s Footprints

In addition to activity, specificity is another major concern of

CRISPR-Cas9 or CRISPR-Cas9-derived gene editing and manipu-
lation tools. Currently, by engineering the catalytic domain of Cas9
protein and using protein fusion strategy, the CRISPR-Cas9 system
 Tracking CRISPR’s Footprints 21

has been developed for nicking single strand, gene interference,

gene activation, DNA methylation, histone acetylation, base edit-
ing, etc. [46–51]. When discussing the specificity of CRISPR-Cas9,
we have to look at it from two different angles: (1) cleaving nontar-
get sites and (2) binding to nontarget sites; all together we refer to
these as CRISPR footprints.
All aforementioned methods are focusing on detecting and/or
measuring the CRISPR-introduced cleavages and indels. In order
to unbiasedly detect the global CRISPR cleavage footprint, a few in
intro and in vivo genome-scale CRISPR cleavage footprint meth-
ods have been developed. The commonly used in vitro methods for
detecting CRISPR cleavage footprint are Digenome-seq [52] and
CIRCLE-seq [53], which are based on in vitro nuclease-digested
genomes (Digenome-seq), circularization of fragmented genomic
DNA followed by nuclease digestion (CIRCLE-seq), and selective
enrichment and identification of adapter-tagged DNA ends by
sequencing (SITE-Seq) [54]. The disadvantage of in intro methods
is that they cannot recapitulate the effects of chromatin structure on
CRISPR-Cas9 cleavage footprints. A few in vivo methods have
been developed to detect the genome-wide CRISPR cleavages in
cells, including high-throughput, genome-wide translocation
sequencing (HTGTS) [55], capturing of double-stranded oligo-
deoxynucleotides into DSBs (GUIDE-seq) [56], capturing of
integrase-defective lentiviral vectors (IDLVs) into DSBs (IDLV-
seq) [57], and directly labeling DSBs in situ with biotinylated linker
and streptavidin enrichment (BLESS) [58]. All these in vivo meth-
ods commonly rely on the DSBs introduced by CRISPR/Cas9, and
capture DSBs chemically or through inserting a DNA tag. In
addition, whole-genome sequencing (WGS) has been broadly
used to identify CRISPR cleavage footprints [59, 60]. However,
the WGS method is only recommended to genotype whether off-
targets have been introduced to CRISPR-edited cell clones or
gene-edited animals. Due to the high frequency of somatic muta-
tions and polymorphism, cautions should be carefully taken when
defining single-nucleotide polymorphisms (SNP), indels (deletions
or insertions) resulted from CRISPR cleavage or simply from
parental inheritance or somatically accumulated mutations.
Another major type of CRISPR’s footprint is binding to non-
target sites. This kind of footprints is more prominent than the
cleavage footprint. The binding of CRISPR-Cas9 to DNA is
depending on both the Cas9 protein’s DNA-binding ability and
the Watson-Crick base pairing between the gRNA spacer and the
target site. Through neutralizing Cas9 protein’s DNA-binding
domain, high-fidelity Cas9 proteins have been generated
[61, 62]. Unlike DNA cleavage, CRISPR-Cas9 is much more
loosely depending on the matches between the gRNA spacer and
the target site. Three mismatches between the gRNA spacer and the
target site can almost completely prevent DNA cleavage by
22 Lin Lin and Yonglun Luo

CRISPR-Cas9, whereas CRISPR-Cas9 can still firmly bind to sites

with 9 mismatches [63]. The different characteristics between
CRISPR DNA cleavage and binding footprints highlight the
importance of developing and using the right method to validate
the specificity of CRISPR-Cas9-based gene engineering tools. For
example, the catalytically inactivated Cas9 (dCas9) has been har-
nessed for epigenome editing such as histone acetylation, DNA
demethylation, DNA methylation, etc. Previously, we showed
that the fusion of dCas9 to the DNA methylation catalytic domain
of DNMA3A or DNMT3B can achieve efficient methylation of the
CpG dinucleotides adjacent to the target site [64]. Using targeted
bisulfite sequencing for a few selected potential off-target sites
selected based on sequence similarity, we cannot detect off-target
methylation. However, using unbiased whole-genome bisulfite
sequencing, we found that the dCas9-DNMT3A and dCas9-
DNMT-3B can cause quite a large number of unspecific methyla-
tions, which is enriched in open chromatin regions, promoter,
5’UTR regions, and CpG island. Similarly, when defining the spec-
ificity of Cas9-derived effectors that rely on DNA binding of
dCas9-gRNA, unbiased CRISPR footprint detection methods
should be chosen.

10 CRISPR Indels Are Not Random

It is commonly thought that the DSBs introduced by gene editing

tools, e.g., CRISPR/Cas9 in mammalian cells are predominantly
repaired by NHEJ and MMEJ pathway, which is error prone and
random. The formation of indels has thus been considered as
random and unpredictable in cells. As our knowledge of the indel
profiles increases from CRISPR-edited studies, it becomes clear
that these indel events are not random. Megan van Overbeek and
colleagues analyze indel profiles of 223 target sites in human cells
and found that classical NHEJ and MMEJ are the major DNA
repair machineries in mediated DSB repair, and the protospacer
sequences (target site) determine the indel outcomes [24]. Consis-
tent with that, we also observed that for each gRNA, the indel
profiles are consistent across experimental repeats (Fig. 4) and
different cell types [28] (Fig. 5).
Another frequently observed characteristics of gene editing
indels is the highly frequent insertion of 1 bp at the break site
[65], also see Figs. 4 and 5. It has been found that small indels
occur earlier during CRISPR gene editing. Consistent with that, a
study from Eric Bennett’s group systematically evaluates the effect
of different delivery formats (lentivirus transduction, plasmid lipo-
fection, and ribonuclear protein electroporation) and time on
CRISPR cleavage indel profiles [65], and observes similar indel
profile characteristics. Large indels and deletions, which are
 Tracking CRISPR’s Footprints 23

Fig. 4 Profiling of CRISPR indel patterns of three gRNAs by TIDE in HEK293T cells. Experiments have been
conducted in triplicates and tested with wild-type SpCas9 and the enhanced SpCas9 (eSpCas9)

mediated by MMEJ or SSA, appear much later [24]. These large

indels are more frequently found in clonal gene-edited cells, which
have been prorogated from a single cell to a cell clone. It is thus not
surprising to find large deletions and complex rearrangements after
repair of DSBs introduced by CRISPR Cas9 in a report
recently [66].
24 Lin Lin and Yonglun Luo

Fig. 5 Profiling of CRISPR indel patterns of three gRNAs with wild-type SpCas9 or the enhanced SpCas9
(eSpCas9) by TIDE in HEK293T and Hela cells
 Tracking CRISPR’s Footprints 25

One advantage of DSBs not being repaired randomly is to

predict the indel outcomes for each CRISPR target site. Based on
MMEJ-mediated DSB repair, the CRISPor web tool incorporates
the function for predicting indels [67]. And recently, the first
achievement of predicting CRISPR chromosomal editing events
was reported [68], which is achieved by specific PAM configura-
tions. However, since the overhang cleavage profiles also affect
indel outcome, a full prediction of indel outcome for a single
gRNA is still required and will be extremely useful for increasing
the accuracy of in silico predicting CRISPR activity in the future.

11 Concluding Remarks

The CRISPR gene editing technology has now been broadly

adopted by almost all gene-related applications and research
groups. Many assisting methods developed for CRISPR gene edit-
ing have contributed greatly to the technology’s evolution, such as
in silico web tools for CRISPR design, software for off-target
prediction and data analysis, methods to enhance delivery, modifi-
cations to enhance targeting editing efficiency, methods for track-
ing the CRISPR’s footprints, etc. Currently, most methods for
detecting CRISPR indels or activity are focusing on small indels.
Although compared to these small indels, large indels are much
rarer and occur much later after CRISPR gene editing. Large indels
are more frequently found in cells if the CRISPR gene editing
vectors are stably integrated. Efficient, cost-effective and high-
throughput methods for tracking CRISPR-induced large indels
are required in the future.
Since there are many methods for tracking CRISPR’s foot-
prints, the next question is which one we should choose for our
experiment, also see outstanding questions. This is quite depending
on the expertise and accessibility to the required facilities of each
research group. In our experience, a combination of these methods
is recommended to achieve a successful CRISPR gene editing
outcome. For each CRISPR gene editing project, first, we carefully
designed a few gRNAs, TIDE assay primers, and C-Check vectors.
Second, we measure each gRNA’s activity by TIDE and C-Check in
the actually targeting cells and surrogate cells (HEK293). Finally,
the best gRNA will be selected based on TIDE and C-Check
results. C-Check is further used to enrich cells carrying the desired
mutations by fluorescence-activated cell sorting.
The CRISPR technology is still fast growing and more
improvements are needed to bring the technology to successful
clinical applications. Tracking the CRISPR’s footprints is of great
importance. We have recently discovered that when a piece of
DNA/gene is deleted by CRISPR, this piece of DNA, instead of
just simply degrades, forms a functional extrachromosomal circular
26 Lin Lin and Yonglun Luo

DNA in cells [69]. This discovery expands the genome engineering

applications of CRISPR. A better understanding of how DBSs are
repaired in cells, the outcome of editing loci, and even the faith of
the deleted DNA or genes by CRISPR will continue to contribute
to evolutions of the CRISPR gene editing.

Acknowledgments

L.L. is supported by grants from the Lundbeck Foundation. Y.L is

supported by BGI-Shenzhen, BGI-Qingdao, and grants from the
Shenzhen Sanming Medical Project. We thank the whole team of
Lars Bolund Institute of Regenerative Medicine (LBI), BGI, for
their work and assistance on the CRISPR technologies, and espe-
cially Jun Wang from LBI for assistance with preparing Fig. 1. Y.L.
is also supported by the Guangdong Provincial Key Laboratory of
Genome Read and Write (No. 2017B030301011).
Disclaimer Statement: The views expressed in this article are the
personal views of the author and may not be understood or quoted
as being made on behalf of or reflecting the position of the Lars
Bolund Institute of Regenerative Medicine, BGI, or one of its
working parties.

References
1. Chang HHY et al (2017) Non-homologous recombinational DNA repair. Cold Spring
DNA end joining and alternative pathways to Harb Perspect Biol 6(9):a016428
double-strand break repair. Nat Rev Mol Cell 8. Capecchi MR (2005) Gene targeting in mice:
Biol 18(8):495–506 functional analysis of the mammalian genome
2. McVey M, Lee SE (2008) MMEJ repair of for the twenty-first century. Nat Rev Genet 6
double-strand breaks (director’s cut): deleted (6):507–512
sequences and alternative endings. Trends 9. Epinat JC et al (2003) A novel engineered
Genet 24(11):529–538 meganuclease induces homologous recombi-
3. Ceccaldi R et al (2016) Repair pathway choices nation in yeast and mammalian cells. Nucleic
and consequences at the double-strand break. Acids Res 31(11):2952–2962
Trends Cell Biol 26(1):52–64 10. Arnould S et al (2007) Engineered I-CreI deri-
4. Lahue RS et al (1989) DNA mismatch correc- vatives cleaving sequences from the human
tion in a defined system. Science 245 XPC gene can induce highly efficient gene cor-
(4914):160–164 rection in mammalian cells. J Mol Biol 371
5. Lindahl T (1974) An N-glycosidase from (1):49–65
Escherichia coli that releases free uracil from 11. Boch J et al (2009) Breaking the code of DNA
DNA containing deaminated cytosine residues. binding specificity of TAL-type III effectors.
Proc Natl Acad Sci U S A 71(9):3649–3653 Science 326(5959):1509–1512
6. Sancar A, Rupp WD (1983) A novel repair 12. Jinek M et al (2012) A programmable dual-
enzyme: UVRABC excision nuclease of RNA-guided DNA endonuclease in adaptive
Escherichia coli cuts a DNA strand on both bacterial immunity. Science 337
sides of the damaged region. Cell 33 (6096):816–821
(1):249–260 13. Cong L et al (2013) Multiplex genome engi-
7. Mehta A, Haber JE (2014) Sources of DNA neering using CRISPR/Cas systems. Science
double-strand breaks and models of 339(6121):819–823
 Tracking CRISPR’s Footprints 27

14. Mali P et al (2013) RNA-guided human 29. Dehairs J et al (2016) CRISP-ID: decoding
genome engineering via Cas9. Science 339 CRISPR mediated indels by Sanger sequenc-
(6121):823–826 ing. Sci Rep 6:28973
15. Barrangou R, Doudna JA (2016) Applications 30. Yang Z et al (2015) Fast and sensitive detection
of CRISPR technologies in research and of indels induced by precise gene targeting.
beyond. Nat Biotechnol 34(9):933–941 Nucleic Acids Res 43(9):e59
16. Yeung AT et al (2005) Enzymatic mutation 31. Ramlee MK et al (2015) High-throughput
detection technologies. BioTechniques 38 genotyping of CRISPR/Cas9-mediated
(5):749–758 mutants using fluorescent PCR-capillary gel
17. Zhu X et al (2014) An efficient genotyping electrophoresis. Sci Rep 5:15587
method for genome-modified animals and 32. D’Agostino Y et al (2016) A rapid and cheap
human cells generated with CRISPR/Cas9 sys- methodology for CRISPR/Cas9 zebrafish
tem. Sci Rep 4:6420 mutant screening. Mol Biotechnol 58
18. Liu C et al (2017) Delivery strategies of the (1):73–78
CRISPR-Cas9 gene-editing system for thera- 33. Samarut E et al (2016) A simplified method for
peutic applications. J Control Release identifying early CRISPR-induced indels in
266:17–26 zebrafish embryos using High Resolution
19. Li L et al (2018) Non-viral delivery systems for Melting analysis. BMC Genomics 17:547
CRISPR/Cas9-based genome editing: chal- 34. Findlay SD et al (2016) A digital PCR-based
lenges and opportunities. Biomaterials method for efficient and highly specific screen-
171:207–218 ing of genome edited cells. PLoS One 11(4):
20. Senis E et al (2014) CRISPR/Cas9-mediated e0153901
genome engineering: an adeno-associated viral 35. Pinheiro LB et al (2012) Evaluation of a drop-
(AAV) vector toolbox. Biotechnol J 9 let digital polymerase chain reaction format for
(11):1402–1412 DNA copy number quantification. Anal Chem
21. Schmidt F, Grimm D (2015) CRISPR genome 84(2):1003–1011
engineering and viral gene delivery: a case of 36. Kim H et al (2011) Surrogate reporters for
mutual attraction. Biotechnol J 10 enrichment of cells with nuclease-induced
(2):258–272 mutations. Nat Methods 8(11):941–943
22. Ehrke-Schulz E et al (2016) Quantification of 37. Wen Y et al (2017) A stable but reversible
designer nuclease induced mutation rates: a integrated surrogate reporter for assaying
direct comparison of different methods. Mol CRISPR/Cas9-stimulated homology-directed
Ther Methods Clin Dev 3:16047 repair. J Biol Chem 292(15):6148–6162
23. Sentmanat MF et al (2018) A survey of valida- 38. Zhou Y et al (2016) Enhanced genome editing
tion strategies for CRISPR-Cas9 editing. Sci in mammalian cells with a modified dual-
Rep 8(1):888 fluorescent surrogate system. Cell Mol Life
24. van Overbeek M et al (2016) DNA repair Sci 73(13):2543–2563
profiling reveals nonrandom outcomes at 39. Fu L et al (2016) A simple and efficient method
Cas9-mediated breaks. Mol Cell 63 to visualize and quantify the efficiency of chro-
(4):633–646 mosomal mutations from genome editing. Sci
25. Brinkman EK et al (2014) Easy quantitative Rep 6:35488
assessment of genome editing by sequence 40. Yang Y et al (2016) Highly efficient and rapid
trace decomposition. Nucleic Acids Res 42 detection of the cleavage activity of Cas9/
(22):e168 gRNA via a fluorescent reporter. Appl Biochem
26. Brinkman EK et al (2018) Easy quantification Biotechnol 180(4):655–667
of template-directed CRISPR/Cas9 editing. 41. Ramakrishna S et al (2014) Surrogate reporter-
Nucleic Acids Res 46(10):e58 based enrichment of cells containing
27. Lin L et al (2017) Fusion of SpCas9 to E. coli RNA-guided Cas9 nuclease-induced muta-
Rec A protein enhances CRISPR-Cas9 tions. Nat Commun 5:3378
mediated gene knockout in mammalian cells. 42. Hussmann D et al (2017) IGF1R depletion
J Biotechnol 247:42–49 facilitates MET-amplification as mechanism of
28. Jensen KT et al (2017) Chromatin accessibility acquired resistance to erlotinib in HCC827
and guide sequence secondary structure affect NSCLC cells. Oncotarget 8
CRISPR-Cas9 gene editing efficiency. FEBS (20):33300–33315
Lett 591(13):1892–1901
28 Lin Lin and Yonglun Luo

43. Xue LJ, Tsai CJ (2015) AGEseq: analysis of TALENs using integrase-defective lentiviral
genome editing by sequencing. Mol Plant 8 vectors. Nat Biotechnol 33(2):175–178
(9):1428–1430 58. Crosetto N et al (2013) Nucleotide-resolution
44. Pinello L et al (2016) Analyzing CRISPR DNA double-strand break mapping by next-
genome-editing experiments with CRIS- generation sequencing. Nat Methods 10
PResso. Nat Biotechnol 34(7):695–697 (4):361–365
45. Boel A et al (2016) BATCH-GE: batch analysis 59. Smith C et al (2014) Whole-genome sequenc-
of next-generation sequencing data for ing analysis reveals high specificity of CRISPR/
genome editing assessment. Sci Rep 6:30330 Cas9 and TALEN-based genome editing in
46. Qi LS et al (2013) Repurposing CRISPR as an human iPSCs. Cell Stem Cell 15(1):12–13
RNA-guided platform for sequence-specific 60. Veres A et al (2014) Low incidence of
control of gene expression. Cell 152 off-target mutations in individual CRISPR-
(5):1173–1183 Cas9 and TALEN targeted human stem cell
47. Ran FA et al (2013) Double nicking by clones detected by whole-genome sequencing.
RNA-guided CRISPR Cas9 for enhanced Cell Stem Cell 15(1):27–30
genome editing specificity. Cell 154 61. Slaymaker IM et al (2016) Rationally engi-
(6):1380–1389 neered Cas9 nucleases with improved specific-
48. Hilton IB et al (2015) Epigenome editing by a ity. Science 351(6268):84–88
CRISPR-Cas9-based acetyltransferase activates 62. Kleinstiver BP et al (2016) High-fidelity
genes from promoters and enhancers. Nat Bio- CRISPR-Cas9 nucleases with no detectable
technol 33(5):510–517 genome-wide off-target effects. Nature 529
49. Vad-Nielsen J et al (2018) Simple method for (7587):490–495
assembly of CRISPR synergistic activation 63. Kuscu C et al (2014) Genome-wide analysis
mediator gRNA expression array. J Biotechnol reveals characteristics of off-target sites bound
274:54–57 by the Cas9 endonuclease. Nat Biotechnol 32
50. Xiong K et al (2017) RNA-guided activation of (7):677–683
pluripotency genes in human fibroblasts. Cell 64. Lin L et al (2018) Genome-wide determina-
Reprogram 19(3):189–198 tion of on-target and off-target characteristics
51. Gaudelli NM et al (2017) Programmable base for RNA-guided DNA methylation by dCas9
editing of A*T to G*C in genomic DNA with- methyltransferases. Gigascience 7(3):1–19
out DNA cleavage. Nature 551 65. Kosicki M et al (2017) Dynamics of indel pro-
(7681):464–471 files induced by various CRISPR/Cas9 delivery
52. Kim D et al (2015) Digenome-seq: genome- methods. Prog Mol Biol Transl Sci 152:49–67
wide profiling of CRISPR-Cas9 off-target 66. Kosicki M et al (2018) Repair of double-strand
effects in human cells. Nat Methods 12 breaks induced by CRISPR-Cas9 leads to large
(3):237–243. 1 p following 243 deletions and complex rearrangements. Nat
53. Tsai SQ et al (2017) CIRCLE-seq: a highly Biotechnol 36:765–771
sensitive in vitro screen for genome-wide 67. Haeussler M et al (2016) Evaluation of
CRISPR-Cas9 nuclease off-targets. Nat Meth- off-target and on-target scoring algorithms
ods 14(6):607–614 and integration into the guide RNA selection
54. Cameron P et al (2017) Mapping the genomic tool CRISPOR. Genome Biol 17(1):148
landscape of CRISPR-Cas9 cleavage. Nat 68. Shou J et al (2018) Precise and predictable
Methods 14(6):600–606 CRISPR chromosomal rearrangements reveal
55. Frock RL et al (2015) Genome-wide detection principles of Cas9-mediated nucleotide inser-
of DNA double-stranded breaks induced by tion. Mol Cell 71(4):498–509.e4
engineered nucleases. Nat Biotechnol 33 69. Henrik Devitt Møller LL, Xi X, Petersen TS,
(2):179–186 Huang J, Yang L, Kjeldsen E, Jensen UB,
56. Tsai SQ et al (2015) GUIDE-seq enables Zhang X, Liu X, Xun X, Wang J, Yang H,
genome-wide profiling of off-target cleavage Church GM, Bolund L, Regenberg B, Luo Y
by CRISPR-Cas nucleases. Nat Biotechnol 33 (2018) CRISPR-C: circularization of genes
(2):187–197 and chromosome by CRISPR in human cells.
57. Wang X et al (2015) Unbiased detection of Nucleic Acids Res. https://doi.org/10.1093/
off-target cleavage by CRISPR-Cas9 and nar/gky767
 Chapter 3

Rapid Quantitative Evaluation of CRISPR Genome Editing

by TIDE and TIDER
Eva Karina Brinkman and Bas van Steensel

Abstract
Current genome editing tools enable targeted mutagenesis of selected DNA sequences in many species.
However, the efficiency and the type of introduced mutations by the genome editing method are largely
dependent on the target site. As a consequence, the outcome of the editing operation is difficult to predict.
Therefore, a quick assay to quantify the frequency of mutations is vital for a proper assessment of genome
editing actions. We developed two methods that are rapid, cost-effective, and readily applicable: (1) TIDE,
which can accurately identify and quantify insertions and deletions (indels) that arise after introduction of
double strand breaks (DSBs); (2) TIDER, which is suited for template-mediated editing events including
point mutations. Both methods only require a set of PCR reactions and standard Sanger sequencing runs.
The sequence traces are analyzed by the TIDE or TIDER algorithm (available at https://tide.nki.nl or
https://deskgen.com). The routine is easy, fast, and provides much more detailed information than current
enzyme-based assays. TIDE and TIDER accelerate testing and designing of DSB-based genome editing
strategies.

Key words CRISPR-Cas, Genome editing, Indel mutation, Mutagenesis, DNA mutational analysis/
methods, Sanger sequencing, Web tool, Algorithm

1 Introduction

CRISPR-based systems are popular and widely used for genome

editing in the field of molecular biology. CRISPR endonuclease
Cas9 introduces a DSB into the genomic DNA with high precision.
Due to the error-prone repair mechanisms of the cell, this often
results in insertions or deletions at the targeted site [1]. This is
exploited to make functional knock-outs of specific genes and
regulatory elements [2–4]. Alternatively, to gain more control
over the nature of the mutations, strategies have been developed
that introduce small nucleotide changes around a precisely targeted
site by using a donor template [5, 6]. In the latter approach the
genomic DNA around the DSB break is replaced by the DNA of
the donor template through homology-directed repair (HDR),

Yonglun Luo (ed.), CRISPR Gene Editing: Methods and Protocols, Methods in Molecular Biology, vol. 1961,
https://doi.org/10.1007/978-1-4939-9170-9_3, © The Author(s) 2019

29
30 Eva Karina Brinkman and Bas van Steensel

resulting in the introduction of a designed mutation with high

accuracy [7, 8]. This precise editing creates the possibility to gen-
erate and study specific disease-causing nucleotide variants
[6, 9]. Typically, one starts with a homogeneous cell line and
ends up with a pool of cells with a complex mix of indels and/or
designer mutations [10–12]. To study a mutation of interest, clonal
mutant lines need to be isolated from the cell pool. Because this is a
very labor-intensive process it is important to know a priori the
efficiency in which the desired mutation(s) have been introduced.
However, a complicating factor is that the efficacy of the program-
mable nucleases can vary dramatically depending on the sequence
that is targeted. In addition, different cell types have a varying
performance in transfection capability. These factors make the effi-
cacy of CRISPR experiment difficult to predict. For this reason it is
usually necessary to test several guide RNAs (gRNAs) that lead the
endonuclease to the site of interest. This is even more critical when
a template-directed strategy is applied, which often has a low effi-
ciency because HDR repair pathways are generally less active than
error-prone non-templated repair [10, 12]. Hence, a quick and easy
assay to estimate the frequencies of the diverse introduced muta-
tions in the cell pool is of key importance.
We developed two methods that can accurately quantify the
efficiency of either indels or template-directed mutations in a pool
of cells. Both methods are rapid and cost-effective. The method
TIDE (Tracking of Indels by DEcomposition) identifies and quan-
tifies indels. It requires only a pair of standard Sanger sequence
traces of two PCR products [13]. The sequence traces are then
analyzed using an easy-to-use web tool. Note that TIDE can only
detect overall indel frequencies, but not nucleotide substitutions or
specifically designed indels. For the latter purpose we developed
TIDER (Tracking of Insertions, DEletions, and Recombination
events) [14]. This method can estimate the incorporation frequency
of template-directed mutations, including point mutations, and
distinguish them from a background of additional indels that origi-
nate from competing erroneous repair pathways. Although TIDER
can also quantify indels alone, TIDE is slightly simpler to implement
and therefore more suited for the assessment of non-templated
editing experiments. The corresponding web tools for both TIDE
and TIDER are freely accessible at http://tide.nki.nl.

2 Materials

2.1 Guide RNA TIDE and TIDER are suitable for any species in which genomic
Design editing experiments can be performed. CRISPR guide RNAs can
be designed using various online design web tools (e.g., http://
crispr.mit.edu/, https://chopchop.rc.fas.harvard.edu/, https://
www.deskgen.com/).
 CRISPR Editing Evaluation by TIDE/TIDER 31

2.2 DNA Purification Usually, 1–3 days after transfection genomic DNA is isolated.
Buffers and Solutions Genomic DNA of a minimum of 1000 cells should be isolated to
get a comprehensive sampling of the complexity of the mutations
that are introduced by the repair of the CRISPR-Cas9 double
strand break. A standard genomic DNA isolation Kit (e.g., BioLine
ISOLATE II Genomic DNA Kit) can be used according to the
manufacturer’s protocol. DNA can also be isolated with the proto-
col for isolation of high-molecular-weight DNA from mammalian
cells using proteinase K and phenol/chloroform extraction [15].

2.3 PCR PCR reactions are carried out with primers surrounding the
Amplification expected break site. We advise to amplify and sequence a stretch
of Control of DNA 500–1500 bp enclosing the designed editing site. The
and Experimental projected break site should be located preferably ~200 bp down-
Sample DNA stream from the sequencing start site.
1. Genomic DNA.
2. PCR primers (see Note 1).
3. PCR master mix (example makes 50 μL):

21-
μL H2O
2 μL Primer a (10 μM stock)
2 μL Primer b (10 μM stock)

μL Genomic DNA (~50 ng)
25 μL 2
pre-mix of buffer, Taq polymerase, and dNTPs
(e.g., BioLine MyTaq)

4. PCR program:

Step Temperature Time (min:s) Number of cycles

Initial denaturation 95  C 1:00 1

Denaturation 95 C 0:15 25–30

Annealing 55–58  C 0:15
Extension 72  C 0:10
Final extension 72  C 1:00

4 C Hold

5. Check an aliquot of the PCR product on 1–2% agarose gel. A

sharp single band should be visible.
6. Purify the PCR product using a kit according to manufacturer’s
instructions (e.g., BioLine ISOLATE II PCR and Gel Kit).
32 Eva Karina Brinkman and Bas van Steensel

2.4 Two-Step PCR 1. Genomic DNA.

Amplification 2. PCR primers (see Notes 2 and 3).
of Reference DNA
3. PCR master mix (example makes 50 μL):
(TIDER Only)

PCR mix1 PCR mix2

21-
μL H2O H2O
2 μL Primer a (10 μM stock) Primer d (10 μM stock)
2 μL Primer c (10 μM stock) Primer b (10 μM stock)

μL Genomic DNA (~50 ng) Genomic DNA (~50 ng)
25 μL 2
pre-mix of buffer, Taq 2
pre-mix of buffer
polymerase, and dNTPs
(e.g., BioLine MyTaq)

4. PCR program:

Step Temperature Time (min:s) Number of cycles

Initial denaturation 95  C 1:00 1
Denaturation 95  C 0:15 25

Annealing 55–58  C 0:15
Extension 72  C 0:10
Final extension 72  C 1:00
4 C Hold

5. Purify PCR product using kit and manufacture instructions

(e.g., BioLine ISOLATE II PCR and Gel Kit).
6. Anneal the following two PCR products for 1 min 95  C, cool
down to 20  C (0.1 degrees/s).

48 μL Annealing buffer (¼10 mM Tris, 50 mM NaCl, 1 mM EDTA)

1 μL PCR mix1
1 μL PCR mix2

7. Extend the annealed products and amplify the joined product.

18 μL H2O
2 μL Primer a (10 μM stock)
2 μL Primer b (10 μM stock)
3 μL Annealed oligo mix
25 μL 2
pre-mix of buffer, Taq polymerase, and dNTPs (e.g., BioLine
MyTaq)
 CRISPR Editing Evaluation by TIDE/TIDER 33

8. PCR program:

Step Temperature Time (min:s) Number of cycles

Initial denaturation 95  C 1:00 1

Denaturation 95 C 0:15 25

Annealing 55–58  C 0:15
Extension 72  C 0:10
Final extension 72  C 1:00

4 C Hold

9. Check the PCR product on 1–2% agarose gel. A sharp single

band should be visible.
10. Purify the PCR product using a kit and manufacturer’s instruc-
tions (e.g., BioLine ISOLATE II PCR and Gel Kit).

2.5 Sanger We strongly recommend that all PCR products (control, experi-
Sequencing mental sample(s), and for TIDER also the reference) are sequenced
in parallel. Purified PCR samples are prepared for Sanger sequenc-
ing with the following protocol or can be send for commercial
Sanger sequencing.
1. Purified PCR samples (100 ng).
2. PCR primers. Similar primers as in Subheading 2.3 can be used
(see Notes 1 and 3).
3. PCR master mix (example makes 20 μL):

15.5-
μL H2O
0.5 μL Primer a or primer b (10 μM stock)

μL Purified PCR samples (100 ng)
4 μL BigDye (e.g., BigDye® terminator v3.1 of Applied Biosystems)

PCR program:

Step Temperature Time (min:s) Number of cycles

Initial denaturation 96  C 1:00 1
Denaturation 96  C 0:30 30

Annealing 50  C 0:15
Extension 60  C 4:00
4 C Hold
34 Eva Karina Brinkman and Bas van Steensel

4. Samples are analyzed by a Sanger sequence instrument (e.g.,

Applied Biosystems 3730
l DNA Analyzer). Sequence trace
files must be saved in .ab1 or .scf format.

2.6 Equipment 1. Cell counter.

2. Microcentrifuge.
3. PCR cycler.
4. Nanodrop.

2.7 Software The TIDE and TIDER web tools are both available at https://tide.
nki.nl or https://deskgen.com.

3 Methods

3.1 Control For both methods genomic DNA is isolated from the cell pool that
and Experimental was transfected with the nuclease or guide RNA alone (control) and
Sample Generation from cells exposed to both Cas9 and guide RNA (experimental
sample). For TIDER the experimental sample is also
co-transfected with the donor template. Then a region of about
500–1500 base pairs around the target site is amplified by PCR
from DNA of the control and experimental sample (Fig. 1a, b).
Next, the PCR amplicons are subjected to conventional Sanger
sequencing. In the PCR product of the experimental sample, the
sequence trace may consist of a combination of multiple sequences
derived from unmodified DNA and DNA that has acquired a
mutation (Fig. 2a).

3.2 Reference TIDER is required for genome editing experiments in the presence
Sample Generation of a donor template. In addition to the control and experimental
(TIDER Only) sample trace (see Subheading 3.1), TIDER requires one extra San-
ger sequencing trace called “reference.” The reference is similar to
the control sequence, except that it carries the desired base pair
changes as designed in the donor template (Fig. 2e). There are two
paths to obtain the reference sequence as described below.
The reference sequence can be easily created in a 2-step PCR
protocol based on site-directed mutagenesis [16]. Here, two addi-
tional primers are required that overlap and carry the desired muta-
tion(s) (mutated primers c, d, which are reverse complement of
each other) (Fig. 1c). These primers are used in combination with
the primers used for the amplification of the control and experi-
mental sample (control primers a, b). The control forward primer a
is combined with the reverse mutated primer c and the forward
mutated primer d with the control reverse primer b, resulting in
two PCR amplicons that incorporate the designed mutations. Then
the two amplicons are denatured and hybridized at the comple-
mentary ends in an annealing reaction. The second PCR uses the
 CRISPR Editing Evaluation by TIDE/TIDER 35

TIDE
TIDER

a control = wild type b sample = mixed pool c reference = designed mutations

primer a primer a primer a primer c

gDNA
primer b primer b primer d primer b

PCR PCR PCR PCR

mix, denature,
anneal, extend

primer a

primer b

PCR
designed bp changes
mutations after DSB repair

Fig. 1 Method to generate the required input samples for TIDE and TIDER. Control and test samples can be
obtained by PCR using primers spanning the CRISPR target site (primers a, b). The reference sequence (TIDER
only) can be created in a similar way as site-directed mutagenesis [16] (see Subheading 3.2 for detailed
explanation)

annealing mixture as a template and the control forward and reverse

(primers a and b) as primers. This PCR starts with an extension step
followed by exponential amplification. This results in a PCR prod-
uct carrying the designed mutations (see Notes 2 and 3).
Alternatively, the reference DNA can be ordered as synthesized
DNA. The design should include a similar DNA code as the PCR
product of the control sample, except that it should carry the
designed mutation(s) as in the donor template. The annealing
sequences for the forward and reverse primers (a, b) should also
be present in the synthesized fragment. Similar to the control and
test sample, the reference can be amplified with primer a, b (see
Note 3).

3.3 Web Tool The PCR products of the control, optional reference, and experi-
mental sample are processed by conventional Sanger sequencing.
The resulting sequence trace files (.ab1 or .scf format) are then
uploaded into the TIDE or TIDER web tool (both available at
http://tide.nki.nl and https://deskgen.com). In addition, a char-
acter string representing the guide RNA sequence (20 nt) is
required as input (see Notes 4 and 5). Then, the software will
perform several calculations. First, the guide RNA sequence is
36 Eva Karina Brinkman and Bas van Steensel

input output

a
wild type sgRNA

b c d
GGGATCACTCTCGGCATGGA

expected break site expected break site

20 40 60 80 100

20 30 40
trace decomposition
C

% aberant sequence
alignment decomposition window 34%

% of sequence
window 31% T
A
TIDE

G
17 %
14 %
mixed pool

10
0

0
alignment window decomposition window 200 300 400 500 −10 −5 0 5 10
e
sgRNA

basepair
GGGATCACTCTCGGCATGGA deletion insertion

f g h
mixed pool donor template wild type

expected break site

0 20 40 60 80 100
% designed nucletoide(s)

40

40
alignment decomposition window 35%

trace decomposition
window

% of sequence

% of sequence
30

30
TIDER

24%

20
20
16%
14%
10%

10
10
bp changes

0
0
200 300 400 500 −10 −5 0 5 HDR
basepair deletion insertion

alignment window decomposition window

Fig. 2 Overview of TIDE and TIDER algorithm. Due to imperfect repair (and repair by homology-directed repair
with a donor template) after cutting by a targeted nuclease, the DNA in the cell pool consists of a mixture of
indels (and designed mutations). The various introduced mutations in the pool are disentangled by TIDE or
TIDER. (a) TIDE requires as input a guide RNA sequence string and two sequences are required: (1) wild-type
control, (2) composite test sample. (b) For quality control the aberrant sequence signal is visualized in control
(black) and treated sample (green), the expected break site (vertical dotted line), region used for alignment
(pink bar), and the region used for decomposition (gray bar). A constant composite sequence signal is yielded
after the break site. (c) Trace decomposition yields the spectrum of indels with their frequencies. (d) In
presence of þ1 insertions, the base composition is estimated. (e) Input files for TIDER are identical to TIDE and
one additional sequence file with designed mutations in the used donor template. (f) Quality plot showing only
the proportion of desired mutated nucleotide(s) as designed in donor template that is/are present in the control
(black) and treated sample (green). The region for alignment (pink bar) and decomposition (gray bar) as used in
TIDER are represented. (g and h) Decomposition gives the spectrum of indels (g) and the HDR events (h) with
their frequencies

aligned to the control sequence in order to determine the position

of the expected Cas9 break site. Next, in all Sanger sequence traces
an alignment window is automatically selected that runs from
100 to 15 bp upstream of the break site. The sequence segment
in this window of the experimental sample (and the optional refer-
ence) is aligned to that of the control in order to determine any
offset between the sequence reads. Users may change the default
settings for these calculations, which is necessary when alignment
problems occur with these settings (see Notes 6 and 7). Subse-
quently, two output plots are generated: one plot that can help with
quality control and one that displays the indel/HDR spectrum.

3.4 Quality Control For generation of the quality control plot the signals of all
nucleotides: A, G, T, C at each position in the sequence file are
used. In general, each position in the sequence trace is represented
 CRISPR Editing Evaluation by TIDE/TIDER 37

by one predominant nucleotide signal indicative of the actual nucle-

otide. The minor signals from the other three nucleotides are
normally considered as background. In TIDE(R) the percentage
of these aberrant nucleotides is plotted along the sequence trace of
the control and the experimental sample. Thus, a value of 0% at a
position indicates that the detected nucleotide does not differ from
the control sequence while a value of 100% indicates that the
expected nucleotide was not detected at all (and instead only one
or more of the other three nucleotides) (Fig. 2b). The percentages
of aberrant nucleotides in the control should be low along the
whole sequence trace. However, the experimental sample consists
of a mixture of multiple sequences due to the presence of indels and
possible point mutations. Around the break site the sequences start
to deviate from the control, which is visible with consistently ele-
vated signal of the aberrant sequence signal. Note that there is a
25% chance that an identical nucleotide in a mutated sequence is
found as is present in the control sequence at the same position,
because there are only 4 different nucleotides available. This plot
allows the user to visually inspect the sequence deviation caused by
the targeted nuclease and enables to verify the alignments and
quality of the data. It is important to confirm that (1) the break
site is located as expected, (2) the aberrant signal is only increasing
around the break site and (3) remains elevated downstream of the
break site. The sequence trace downstream of the break site is
decomposed into its individual sequence components. The region
used for this purpose is marked as the decomposition window. All
parameters in TIDE(R) have default settings but can be adjusted if
necessary. The user can interactively change the alignment and
decomposition windows. Choosing a different decomposition win-
dow is often a remedy to circumvent locally poor sequence traces,
which should be avoided (see Notes 8–10).
For TIDER two additional quality plots are generated. In one,
the aberrant signal of the reference trace compared to the control
trace is plotted. This can be used to verify whether the designed
mutation(s) is/are present at the expected location. In the second
one, the percentage of the designed mutation(s) present in the
experimental sample is plotted, representing the relative incorpora-
tion of the donor template (Fig. 2f).

3.5 Mutation For the detection of individual mutations with the corresponding
Detection by frequencies, the TIDE and TIDER software perform a decomposi-
Decomposition tion of the mixed sequence signal in the experimental sample. This
composite sequence trace is a linear combination of the wild type
(control) and the mutated sequences. For TIDE, the decomposi-
tion is performed on a sequence segment downstream of the break
site. As a rule of thumb, the larger the decomposition window
38 Eva Karina Brinkman and Bas van Steensel

is chosen, the more robust the estimation of mutations is (see

Note 9). To perform the decomposition, a set of sequence trace
models are generated that contain all possible indels of size {0..n}
(n is by default set to 10). The models are derived from the control
trace and contain all nucleotide peak signals of the decomposition
window shifted by the appropriate number of positions to the left
or right. A wild-type trace (shift 0) is also added as a model. Then,
using non-negative linear modeling the combination of trace mod-
els that can best explain the composite sequence trace in the experi-
mental sample is determined (Fig. 2c) (see Note 11). An R2 value is
calculated as a measure of the goodness of fit (see Notes 10 and 12),
and the statistical significance of the detection of each indel is
calculated.
For TIDER the mutation detection is more complex. It is
mandatory that the decomposition window in TIDER covers the
location of the designed mutation(s) in the donor template (see
Notes 9 and 13). In contrast to TIDE, the decomposition window
of TIDER spans by default only 100 bp. In case only few base pair
changes are introduced, the sequence with the designed mutation
will be very similar to the wild-type sequence. The smaller decom-
position window of TIDER emphasizes the difference between the
control and reference better. Simulations of all possible insertions
and deletions are generated from the control file and placed in a
decomposition matrix together with the control and reference.
Subsequently, decomposition of the experimental sample is per-
formed thereby choosing the best combination of the models in
the decomposition matrix. This results in an estimation of the
incorporation frequency of template-directed mutation(s) and dis-
tinguishes these from the background of indels that are introduced
by error-prone repair (see Note 14).
The reliability of TIDE and TIDER depends on the quality of
the input samples (see Note 15). For an accurate TIDE
(R) estimation it is recommended that (1) R2 > 0.9 and (2) aber-
rant signals upstream of the break site are below 10% in the quality
plot. This applies to all files: control, reference, and experimental
sample. To verify the results the samples can be sequenced from the
opposite strand (see Note 13).

3.6 Sequence During repair of CRISPR-Cas9 a single base pair is frequently

Determination inserted at one of the DNA ends of the break [13, 17, 18]. TIDE
of the þ1 Insertion provides an estimate of the base composition of this insertion. This
(TIDE Only) may be of interest if one wishes to obtain a particular sequence
variant (Fig. 2d). For longer insertions this base calling is compu-
tationally complicated and currently not implemented.
 CRISPR Editing Evaluation by TIDE/TIDER 39

4 Notes

1. Primer design recommendations for control and experimental

sample. Primers a, b need to cover the CRISPR target site.
The length of the PCR product can vary, but there should be
at least >50 bp up- and downstream of the break site for the
alignment (see Notes 6 and 7) and decomposition windows
respectively (see Note 9).
2. Primer design recommendations for reference sample. Primer c, d
should carry the designed mutation(s) as present in the donor
template (see Subheading 3.2, Note 3). It is advised to include
at least 10 complementary nucleotides on the 30 side of the
mutation(s).
3. Donor plasmid contamination in isolated genomic DNA.
Potentially, a donor template that was transfected into the
cells could co-purify with genomic DNA and be co-amplified
in the PCR if it contains the primer sequences. This could result
in an overestimation of the HDR events. This is generally not a
problem with short ssODN donors, but with plasmid tem-
plates with long homology arms the primers a, b should be
chosen outside of these homology arms. Alternatively, the
donor plasmid may be cleared from the cells by a few passages
of culturing.
4. Nuclease type. TIDE(R) is currently designed for regular Cas9.
But it can be used to analyze data from another nuclease, by
entering in the web tool the DNA sequence around the
expected cut site. The TIDE(R) web tool assumes that the
DSB is induced between nucleotides 17 and 18 of the guide
RNA sequence string (Fig. 3f). Note that if the exact break-
point is unknown, TIDE will estimate the amount of the indels
correctly, but the nucleotide composition of the þ1 insertion
will not be reliable. TIDER will only work when the exact
cutting position is known and when the nuclease is a blunt
cutter.
5. No guide RNA match. Sometimes a mismatch occurs in the
control sequence at the location of the sgRNA. This will stop
the TIDE(R) analysis. In this case, edit the base annotation in
the chromatogram file into IUPAC nucleotides of the expected
control sequence (Fig. 3g). The peak signals in the chromato-
gram should not be altered. Viewing and editing of chromato-
gram files can be performed with Snapgene or Chromas
software.
6. Alignment cannot be performed. By default, the alignment
window begins at nucleotide number 100, because the first
part of the sequence read tends to be of low quality. The end
of the alignment window is set automatically at 15 bp upstream
a expected break site
e f underlined sequence = guide upload

20 40 60 80 100
| = expected break site

20
decomposition window
% aberant sequence R2=0.80
Cas9:

% of sequence
PAM

15
12 12 GTACGGCTCTCACTAGG|GCCTCC
11
CATGCCGAGAGTGATCC|CGGAGG

10
9.5 9.5
9
8 Cpf1:
7
PAM

5
TTTCGAGAAGTCATCTAATAAGG|CCACTGTTA
AAAGCTCTTCAGTAGATTATTCCGGTG|ACAAT
0

0
100 200 300 400 500 −10 −5 0 5 −10
basepair deletion insertion
b
expected break site
20 40 60 80 100

20
decomposition window
% aberant sequence

R2=0.94

% of sequence
15
14
13
11 11 11

10
9 9 8.5
6.5

5
0

100 200 300 400 500 −20 −15 −10 −5 0 5 10 15 20

basepair deletion insertion

c g
expected break site CGGACATCCTCCTTTTCCCA
20 40 60 80 100

rc gRNA:
T C
% aberant sequence

CCAATGGGAACCACGGACATCCTCCYTTTWCCAGCAGGAAGAGCAG
0

100 200 300 400 500

h
basepair
d
expected break site
20 40 60 80 100
% aberant sequence

ACCCCCAA MGCACCTCCAASTTTAACCCC GAAAAAAAT A AAT

i
0

100 200 300 400 500

basepair

Fig. 3 Troubleshooting with TIDE and TIDER. All parameters in TIDE(R) have default settings but can be
adjusted if necessary. Different settings are often a remedy to solve error messages. (a–i) Examples of most
common error messages with the recommended setting changes. (a, b) Avoid the decomposition window to
overlap with high aberrant signal in the control. This occurs often near the ends of the sequence traces (a) or in
a stretch of repetitive sequences (b). (c, d) Alignment problems can occur when the alignment window is too
small (default is from 100 until 15 bp upstream break site) (c) or when the wrong nucleotides in the files are
aligned (d). The alignment window can be changed closer or further to 1 in the sequence trace. (e) The
presence of indels larger than the default of 10 is not included in decomposition and can result in low R2 score.
Indel size can be changed. (f) The use of other nucleases than Cas9 in TIDE(R) works when the guide RNA
string is mimicked to the 20 nt Cas9 guide RNA that cuts between nucleotide 17 and 18. (g) A mismatch in the
IUPAC nucleotide annotation that prevents the recognition of guide RNA in the control sequence can be solved
by editing the chromatogram file to the expected nucleotides. (h, i) Poor sequence quality will not give reliable
results in TIDE(R)
 CRISPR Editing Evaluation by TIDE/TIDER 41

of the break site. When this window is too small or when the
break site is located upstream of nucleotide 100, the alignment
cannot be performed correctly. Then the start of the alignment
window should be set manually closer to nucleotide number
1 (Fig. 3c).
7. Incorrect alignment. When the beginning of the sequence trace
is of poor quality, the alignment function can make a mistake.
This results in a quality plot with a high aberrant sequence
signal along the whole length of the sequence trace (Fig. 3d).
The aberrant sequence signal should only increase around the
expected cut site (blue dashed line). In case of poor alignment,
the start of the alignment window needs to be adjusted until a
proper alignment is achieved (default of 100).
8. Quality plot recommendations. In the experimental sample,
around the break site a consistently elevated signal is expected,
which is due to indels introduced at the break site. The starting
position of this elevated signal may be used to verify that breaks
were induced at the expected location. The control trace
should have a low and equally distributed aberrant sequence
signal along the whole trace. The reference trace in the case of
TIDER should only have high scores at the positions of the
altered nucleotides. Fluctuations in the control and reference
signal reflect local variation in the quality of the sequence trace.
Near the end of the sequencing traces the aberrant signal is
often high, typically due to the lower quality of the trace
toward the end (Fig. 3a). When a sequence stretch of poor
local quality is present in the decomposition window the calcu-
lations of TIDE(R) are compromised. The boundaries of the
decomposition window can be manually adjusted to remove
the region that is of low quality; this will improve the estima-
tions. Another area to avoid in the decomposition window is a
stretch of repetitive sequences. These regions can be recog-
nized in the quality plot as a sudden stretch without aberrant
nucleotides (Fig. 3b). Such region might confound the decom-
position of the sequence trace.
9. Decomposition window recommendations. For TIDE, the
default decomposition window spans the entire sequence
trace from the break site until the end of the sequence minus
the size of the maximum indel. When the boundaries of the
decomposition window cannot fulfill this constraint, the soft-
ware will report that the boundaries are not acceptable. For
example, this can occur when the break site is too close to the
end of sequence trace. To address this, the decomposition
window boundaries should be set further apart or a smaller
indel size should be chosen. Alternatively, new primers have to
be designed according to Note 1. For TIDER the decomposi-
tion window is by default 20 bp upstream of the break to 80 bp
42 Eva Karina Brinkman and Bas van Steensel

downstream from the break. This smaller window compared to

TIDE has more discriminatory power for subtle designed base
pair changes.
10. Goodness of fit. R2 is a measure for the reliability of the esti-
mated values. For example, if the R2 value is 0.95, it means that
95% of the variance can be explained by the model; the remain-
der 5% consists of random noise, very large indels,
non-templated point mutations, and possibly more complex
mutations. Decomposition results with a low R2 must be inter-
preted with caution. A low R2 can be caused when the settings
are not optimal or when the sequence quality is not good (see
Note 15). A low R2 value can also arise when a sequence
stretch with a poor local quality is present in the decomposition
window (see Note 8). Furthermore, the presence of indels
larger than the maximum indel size that is considered can affect
the R2 (default of 10). By default these are not modeled, which
may result in a low R2 score. The size range of indels that are
modeled can be manually changed to larger number to test if
this improves the fit (Fig. 3e).
11. Allele-specific indels. The different bars in the plot represent the
insertions, deletions, and/or template-directed mutations in
the cell population. These mutations are not specific of an
allele. To determine allele-specific information a cell clone
needs to be isolated and analyzed again by TIDE(R). A diploid
cell gives a percentage of ~50% per mutation.
12. Overall efficiency. The overall efficiency refers to the estimated
total fraction of DNA with mutations around the break site. It
is calculated as R2
100% wild type.
13. Distal designed mutations. It has been reported that the incor-
poration of donor template sequence is less efficient when the
designed point mutations are further away from the break site
[19]. This often leads to a variation in incorporation frequently
of the distal and proximal designed mutations as can be
observed in the quality plots. Such a situation may confound
TIDER estimates. The decomposition window can be
restricted to either the proximal or the distal mutations to
resolve the individual efficiencies.
14. Natural versus designed mutations. In general, TIDER is able
to discriminate “naturally” occurring deletions and insertions
from templated “designed” indels. Only in the presence of a
small designed deletion (1, 2) near the expected break site
the designed mutation may be underestimated [14]. In case
the designed mutation consists of an insertion larger than þ1,
TIDER does not consider natural insertions of the same size,
because the decomposition becomes less robust. This is gener-
ally acceptable, because natural insertions larger than þ1 are
rarely observed [13, 17].
 CRISPR Editing Evaluation by TIDE/TIDER 43

15. Poor sequence quality. When the sequence has poor quality
overall, TIDE(R) will yield poor results with a low R2 value
(see Note 10) since too much noise is present in the data. The
quality plot will show an overall high aberrant sequence signal
in the control (the reference) and the experimental sample,
before and after the break site (see Note 8). It is recommended
to check the chromatograms of the samples (Fig. 3h) for poor
sequencing quality. If so, these samples cannot be analyzed
reliably by TIDE(R). Note that sometimes the peak signals in
the chromatogram appear normal, but the file can contain
wrongly unannotated or additional annotated nucleotides
(Fig. 3i). TIDE(R) gives a warning when the spacing between
the nucleotides in the chromatogram of the sequence trace is
not consistent, which is often an indication for wrongly unan-
notated or additional annotated nucleotides. In case of this
warning, the chromatograms should be carefully investigated
(use Snapgene or Chromas software).

Acknowledgments

We thank Marcel de Haas, Stefano Manzo, and Ruben Schep for

critical reading of the manuscript. This work was supported by the
Netherlands Organization for Scientific Research ZonMW-TOP
grant 91211061, and European Research Council Advanced
Grant 694466.
Competing Interests: EKB and BvS declare competing financial
interests: As inventors of TIDE and TIDER software, they receive
licensing payments under their employer’s rewards-to-inventors
scheme.

References

1. Brinkman EK, Chen T, de Haas M, Holland 4. Mali P, Esvelt KM, Church GM (2013) Cas9 as
HA, Akhtar W, van Steensel B (2018) Kinetics a versatile tool for engineering biology. Nat
and fidelity of the repair of Cas9-induced dou- Methods 10:957–963
ble-strand DNA breaks. Mol Cell 70:801–813 5. Yoshimi K, Kunihiro Y, Kaneko T,
2. Cong L, Ran FA, Cox D, Lin S, Barretto R, Nagahora H, Voigt B, Mashimo T (2016)
Habib N, Hsu PD, Wu X, Jiang W, Marraffini ssODN-mediated knock-in with CRISPR-Cas
LA et al (2013) Multiplex genome engineering for large genomic regions in zygotes. Nat
using CRISPR/Cas systems. Science Commun 7:10431
339:819–823 6. Inui M, Miyado M, Igarashi M, Tamano M,
3. Jinek M, Chylinski K, Fonfara I, Hauer M, Kubo A, Yamashita S, Asahara H, Fukami M,
Doudna JA, Charpentier E (2012) A program- Takada S (2014) Rapid generation of mouse
mable dual-RNA-guided DNA endonuclease models with defined point mutations by the
in adaptive bacterial immunity. Science CRISPR/Cas9 system. Sci Rep 4:5396
337:816–821 7. Storici F, Snipe JR, Chan GK, Gordenin DA,
Resnick MA (2006) Conservative repair of a
chromosomal double-strand break by single-
44 Eva Karina Brinkman and Bas van Steensel

strand DNA through two steps of annealing. of genome editing by sequence trace decompo-
Mol Cell Biol 26:7645–7657 sition. Nucleic Acids Res 42:e168
8. Wang Z, Zhou ZJ, Liu DP, Huang JD (2008) 14. Brinkman EK, Kousholt AN, Harmsen T,
Double-stranded break can be repaired by Leemans C, Chen T, Jonkers J, van Steensel B
single-stranded oligonucleotides via the (2018) Easy quantification of template-
ATM/ATR pathway in mammalian cells. Oli- directed CRISPR/Cas9 editing. Nucleic Acids
gonucleotides 18:21–32 Res 46(10):e58
9. Ma H, Marti-Gutierrez N, Park SW, Wu J, 15. Green MR, Sambrook J (2012) Molecular
Lee Y, Suzuki K, Koski A, Ji D, Hayama T, cloning: a laboratory manual. Cold Spring
Ahmed R et al (2017) Correction of a patho- Harbor Laboratory Press, Cold Spring Harbor,
genic gene mutation in human embryos. NY
Nature 548(7668):413–419 16. Kunkel TA (1985) Rapid and efficient site-
10. Richardson CD, Ray GJ, DeWitt MA, Curie specific mutagenesis without phenotypic selec-
GL, Corn JE (2016) Enhancing homology- tion. Proc Natl Acad Sci U S A 82:488–492
directed genome editing by catalytically active 17. van Overbeek M, Capurso D, Carter MM,
and inactive CRISPR-Cas9 using asymmetric Thompson MS, Frias E, Russ C, Reece-Hoyes
donor DNA. Nat Biotechnol 34:339–344 JS, Nye C, Gradia S, Vidal B et al (2016) DNA
11. Horlbeck MA, Witkowsky LB, Guglielmi B, repair profiling reveals nonrandom outcomes at
Replogle JM, Gilbert LA, Villalta JE, Torigoe Cas9-mediated breaks. Mol Cell 63:633–646
SE, Tjian R, Weissman JS (2016) Nucleosomes 18. Dorsett Y, Zhou Y, Tubbs AT, Chen BR,
impede Cas9 access to DNA in vivo and Purman C, Lee BS, George R, Bredemeyer
in vitro. Elife 5:e12677 AL, Zhao JY, Sodergen E et al (2014)
12. Yang L, Guell M, Byrne S, Yang JL, De Los HCoDES reveals chromosomal DNA end
Angeles A, Mali P, Aach J, Kim-Kiselak C, structures with single-nucleotide resolution.
Briggs AW, Rios X et al (2013) Optimization Mol Cell 56:808–818
of scarless human stem cell genome editing. 19. Beumer KJ, Trautman JK, Mukherjee K, Car-
Nucleic Acids Res 41:9049–9061 roll D (2013) Donor DNA utilization during
13. Brinkman EK, Chen T, Amendola M, van gene targeting with zinc-finger nucleases. G3
Steensel B (2014) Easy quantitative assessment 3:657–664

Open Access This chapter is licensed under the terms of the Creative Commons Attribution 4.0 International
License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution
and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the
source, provide a link to the Creative Commons licence and indicate if changes were made.
The images or other third party material in this chapter are included in the chapter’s Creative Commons
licence, unless indicated otherwise in a credit line to the material. If material is not included in the chapter’s
Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the
permitted use, you will need to obtain permission directly from the copyright holder.
 Chapter 4

Fast and Quantitative Identification of Ex Vivo Precise

Genome Targeting-Induced Indel Events by IDAA
Saskia König, Zhang Yang, Hans Heugh Wandall, Claudio Mussolino,
and Eric Paul Bennett

Abstract
Recent developments in gene targeting methodologies such as ZFNs, TALENs, and CRISPR/Cas9 have
revolutionized approaches for gene modifications in cells, tissues, and whole animals showing great promise
for translational applications. With regard to CRISPR/Cas9, a variety of repurposed systems have been
developed to achieve gene knock-out, base editing, targeted knock-in, gene activation/repression, epige-
netic modulation, and locus-specific labeling. A functional communality of all CRISPR/Cas9 applications is
the gRNA-dependent targeting specificity of the Cas9/gRNA complex that, for gene knock-out
(KO) purposes, has been shown to dictate the indel formation potential. Therefore, the objective of a
CRISPR/Cas9 KO set up is to identify gRNA designs that enable maximum out-of-frame insertion and/or
deletion (indel) formation and thus, gRNA design becomes a proxy for optimal functionality of CRISPR/
Cas9 KO and repurposed systems. To this end, validation of gRNA functionality depends on efficient,
accurate, and sensitive identification of indels induced by a given gRNA design. For in vitro indel profiling
the most commonly used methods are based on amplicon size discrimination or sequencing. Indel detection
by amplicon analysis (IDAA™) is an alternative sensitive, fast, and cost-efficient approach ideally suited for
profiling of indels induced by Cas9/gRNA with similar sensitivity, specificity, and resolution, down to single
base discrimination, as the preferred next-generation sequencing-based indel profiling methodologies. Here
we provide a protocol that is based on complexed Cas9/gRNA RNPs delivered to primary peripheral blood
mononuclear cells (PBMCs) isolated from healthy individuals followed by quantitative IDAA indel profiling.
Importantly, the protocol described benefits from a short “sample-to-data” turnaround time of less than 5 h.
Thus, this protocol describes a methodology that provides a suitable and effective solution to validate and
quantify the extent of ex vivo CRISPR/Cas9 targeting in primary cells.

Key words Indel detection by amplicon analysis (IDAA™), NGS, Ex vivo precise genome targeting,
PBMCs, Indel “finger print”, Primary cells, CD34+, CRISPR/Cas9, RNP, Synthetic gRNA,
ProfileIt™

1 Introduction

Precise genome targeting events mediated by designer nucleases

(DNs) such as CRISPR/Cas9, zinc finger nucleases (ZFNs), tran-
scription activator-like effector nucleases (TALENs), or

Yonglun Luo (ed.), CRISPR Gene Editing: Methods and Protocols, Methods in Molecular Biology, vol. 1961,
https://doi.org/10.1007/978-1-4939-9170-9_4, © Springer Science+Business Media, LLC, part of Springer Nature 2019

45
46 Saskia König et al.

meganucleases (MNs) [1] induce formation of double-strand DNA

breaks (DSBs) that are mostly repaired by the cellular error-prone
non-homologous end joining (NHEJ) pathway [2] leaving small
insertions or deletions (indels) or a combination of both at the
repaired DSB site. The simplicity and efficiency of gene editing
methodologies make them ideally suited to be employed for inacti-
vation of gene function in any cellular context. By definition, indels
are less than 1 kb in length while larger sized indels are referred to as
copy number variants [3]. In the context of DN-induced indels,
their sizes are commonly smaller than 30 bp. However, indel
formation is a complex process guided not only by the nature of
the induced DSB (blunt or staggered) but also by the primary
targeted sequence that may contain microhomology regions
driving the repair process [4]. Notwithstanding, the use of DN
based on the widely used S. pyogenes Cas9 (in the following referred
to as Cas9) generally results in predominant single base indels
[5–9], which imposes important requirements to the indel detec-
tion methodology used [10, 11]. The ability to detect indels is
relatively new, and “gold standards” for indel detection are not
yet established [3]. Up to now, indel detection has primarily been
accomplished by polymerase chain reaction (PCR) followed by
direct size discrimination by electrophoretic or sequence-based
methodologies [10]. Regarding the latter, indel detection by
next-generation sequencing (NGS) approaches has been widely
adopted. However, the choice of sequencing platform can have a
profound effect on indel detection accuracy and heavily depends on
technically challenging bioinformatic alignment analysis of the mas-
sive amount of output sequence data generated [3, 12, 13]. In this
context, a critical issue is how to evaluate the sensitivity and speci-
ficity of indel detection by NGS. While each of the different NGS
platforms, including the various bioinformatic algorithms used, has
strengths and limitations, a common issue is the lack of “gold
standards” for detection and annotation. In short of such reference
standards, it is difficult to assess the indel detection sensitivity and
specificity of a given NGS assays. Manual review of NGS indel calls
is laborious and time consuming. With increasing application of
NGS methods for evaluation of editing events in the context of
precise genome targeting, rigorous and standardized methods for
indel detection that do not require extensive manual review will be
required. To this end the recently described TIDE [14] and ICE-D
methodologies [15] have provided an alternative sequencing solu-
tion to NGS-based indel detection. These methods are however
based on Sanger sequencing which limits the indel detection sensi-
tivity to 5–10% [16, 17] and their sensitivity and resolution for
complex cell pool indel profiling still remains to be determined.
IDAA methodology [11] provides a fast and accurate alternative to
sequence-based indel detection (Fig. 1). IDAA depends neither on
laborious amplicon library preparation followed by NGS nor on
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 47

A
Donor
PBMCs
2. Cas9/RNP
1.

ex vivo PBMCs

B Precise Genome Targeng

2 days
DSB

NHEJ

deleon
inseron

C * Tri-primer PCR

3 hours
* wt
* deleons
* inserons

D IDAA
TM

2 hours
deleons wt inserons
+1
-10
-9
-1
-12

Fig. 1 Schematic outline of the ex vivo IDAA indel profiling workflow. (a) Human
healthy donor PBMCs are isolated, cultured ex vivo (1) followed by CRISPR/Cas9
RNP delivery (2). (b) Designer nucleases precisely targeted to a defined genomic
locus introduce DNA DSBs that are repaired by cellular repair mechanisms and
result in indel formation at the targeted site. (c) Tri-primer amplification across
the targeted site by use of the universal fluorophore labeled FAMfor primer
enables uniform labeling of amplicons. (d) Fluorophore labeled amplicons are
analyzed by capillary electrophoretic fragment analysis, followed by quantitative
indel identification by ProfileIt™. The illustration depicts the indel “finger print,”
with WT/unmodified amplicon peak shown in yellow and indels out-of-frame or
in-frame shown in blue and white respectively

extensive bioinformatic data deconvolution, but is based on abso-

lute unbiased and direct identification of fragments amplified from
individual indel events in a given sample. The simplicity of IDAA
enables cost-effective indel analysis, superior throughput, and
48 Saskia König et al.

A B 285 315 345 amplicon size/bp

400000 wt 30000

Relative fluorescence units

350000 wt
25000
Sequence reads

300000 1 1
250000 20000

200000 15000
150000
10000
100000 2 2
3 5000 3
50000 5 4 5 4
0
-30 -28 -26 -24 -22 -20 -18 -16 -14 -12 -10 -8 -6 -4 -2 0 2 4 6 8 10 12 14 16 18 20 -15 -11 -8 -4 01
Indel size/bp Indel size/bp

C
wt
1
Relative fluorescence units

3
4
5

Ampliconl size/bp

Fig. 2 Comparative profiles for indel detection of a sample by NGS and IDAA™/ProfileIt™ quantitative
analysis. (a) MiSeq NGS profile of amplicons derived from a cell lysate 2 days post COSMC Cas9 nucleofection
as previously described [11]. The five most dominant indel events are labeled 1–5 with indication of
unmodified wild type peak (WT). (b) IDAA profile derived from analysis of the same cell lysate as displayed
in (a), analyzed by GeneMapper software (ThermoScientific, USA), and with labeling of the same dominant
indel events. (c) Depicts the indel “finger print” of the same IDAA sample as shown in panel A and B, but
analyzed by ProfileIt™, with quantification of the five most dominant indels shown as % of total indels
including unmodified/WT product (shown in yellow) and with all out-of-frame indels shown in blue. The
quantitative results for the profile shown are presented in Table 1

importantly with quantitative detection and sensitivity similar to

NGS [8, 10] (Fig. 2 and Table 1). The core of IDAA is based on
two simple principles: a tri-primer amplicon labeling step that
allows for uniform fluorophore amplicon labeling (Fig. 1) and
standard capillary electrophoretic analysis of labeled amplicons
using commonly available standard sequenator instrumentation.
The complete turnaround time for IDAA is 4–5 h from targeted
cell sample preparation to quantitative indel profiling. IDAAs high-
throughput amenability has been described for in vitro cell line
engineering and Cas9-induced germline indel transmission rates
estimation in whole animals [7–9, 18]. This protocol focuses on
the use of IDAA for indel profiling of primary human cells manipu-
lated ex vivo, with particular emphasis on its applicability as an indel
profiling step in ex vivo gene editing applications [19] (Fig. 3). In
addition, by comparing the indel profiles of the same gRNA in a
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 49

Table 1
ProfileIt quantification of indels shown in Figs. 2c and 3

Out-of- First Second Third Fourth Fifth

Figure WT/bp Total/% frame/% indel/% indel/% indel/% indel/% indel/%
2c 339 62.2 59.6 +1/32.0
4/10.6
8/4.3
11/2.9
1/2.1
3a (lower) 431 38.3 34.6 +1/29.3
13/2.5
279/2.1
21/1.6
16/1.4
3b (upper) 431 76.5 67.2 +1/44.5
1/5.0 +2/4.3
279/3.9
16/3.8
3b (lower) 431 66.7 54.5 +1/25.1
1/7.6
16/6.7
32/6.1
21/5.5
3c (upper) 431 66.3 34.5
15/13.1
5/6.9 1/5.2
1/5.0
12/4.2
3c (lower) 431 89.0 42.3
5/27.9
15/22.0
3/7.0
6/5.4
12/5.1
NB! 5 most frequent indel events are given as % relative to total indels, including unmodified allele

Fig. 3 IDAA™/ProfileIt™ analysis of ex vivo delivered Cas9 RNP to human cells. An in vitro transcribed gRNA
(gRNA #1) and two different synthetic gRNA designs (synCCR5 gRNA #1 and #2), targeting the human CCR5
between the corresponding amino acids 80 and 120, were complexed with Cas9 and delivered to K562 cell
line, isolated donor PBMCs, or purified CD34+ cells respectively. (a) Depicts the indel “finger print” from
in vitro transcribed gRNA#1, as described in the protocol, complexed with Cas9 delivered to K562 cells (lower
panel). Out-of-frame indel formation monitored three days post nucleofection as compared to untreated K562
cells (upper panel) of 34.6% was achieved. (b) Depicts the indel “finger print” derived from RNP complexed
with synCCR5 gRNA#1 delivered to PBMCs isolated from different human healthy donors (A or B). Similar indel
profiles (“indel finger prints”) are observed three days post nucleofection in PBMCs from two different donors,
marked by black arrow heads. Relative difference in WT allele presence is attributed to differences in
nucleofection efficiency. (c) Depicts the indel “finger print” from RNP complexed with synCCR5 gRNA#2
delivered either to PBMCs or CD34+ cells isolated from the same human healthy donor A. Similar indel “finger
prints” are observed 3 days post nucleofection in PBMCs and CD34+ cells. Relative difference in WT allele
presence is attributed to differences in nucleofection efficiency. In the three panels, the quantification of the
five most dominant indels is shown as % of total indels including unmodified/WT product (shown in yellow)
and out-of-frame indel % is indicated and the respective indels shown in blue. Indel quantification for all
profiles shown can be found in Table 1
50 Saskia König et al.

human cell line and primary cells, we show that the indel profile
serves as an “finger print” that is strictly dependent on gRNA
design and on the target sequence.

2 Materials

2.1 Primary Human 1. Leukocyte reduction system (LRS) chamber containing the
PBMC Isolation and blood sample for further processing.
Culture 2. 50 mL Falcon Conical Centrifuge Tubes.
3. PBS.
4. T75 Tissue Culture Flasks.
5. Biocoll Separating Solution (Biochrom, Berlin, Germany).
6. RPMI 1640 with GlutaMAX (Thermo Fisher Scientific, Wal-
tham, USA) + 10% FCS (PAA, Pasching, Austria).
7. Human interleukin 2 improved sequence (IL-2 IS), premium
grade (Miltenyi Biotec, Bergisch Gladbach, Germany).
8. Tissue culture plates.
9. NucleoCounter NC250 (ChemoMetec, Allerod, Denmark) or
similar device.
10. Humidified incubator at 37  C and 5% CO2.

2.2 Thawing and 1. Primary human peripheral blood mononuclear cells (PBMCs;
Activation of Primary see Note 1).
Human PBMCs 2. RPMI 1640 with GlutaMAX (Thermo Fisher Scientific, Wal-
tham, USA) + 10% FCS.
3. Human T cell activation kit (Miltenyi Biotec, Bergisch Glad-
bach, Germany).
4. Human interleukin 2 improved sequence (IL-2 IS), premium
grade (Miltenyi Biotec, Bergisch Gladbach, Germany).
5. Anti-CD25 antibody, human (Miltenyi Biotec, Bergisch Glad-
bach, Germany).
6. Tissue culture plates.
7. NucleoCounter NC250 (ChemoMetec, Allerod, Denmark) or
similar device.
8. DynaMag15 (Invitrogen, Carlsbad, USA) or similar.
9. Humidified incubator at 37  C and 5% CO2.

2.3 PCR-Template 1. Eukaryotic expression vectors containing a U6-driven gRNA

Preparation for In Vitro targeting the gene of interest (e.g., gRNA#1 or gRNA#2 used
Transcription of the in this study, targeting the human CCR5 coding sequence
gRNA Targeting the between the corresponding amino acids 80 and 120). As an
Human CCR5 Gene example use the MLM3636 Addgene, cat. no. 43860 for clon-
ing the desired gRNA.
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 51

2. Forward and reverse oligonucleotides (100 μM; see Note 2).

3. Q5® Hot Start High-Fidelity DNA Polymerase and 5 Q5
Reaction Buffer (New England Biolabs, Ipswich, USA).
4. 10 mM dNTP Solution Mix (New England Biolabs, Ipswich,
USA).
5. QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
6. RNaseZAP (Sigma, St. Louis, USA).
7. Nuclease-free water (Ambion, Austin, USA).
8. 10 mg/mL ethidium bromide (Roth, Karlsruhe, Germany).
9. 6 Orange Loading dye: 100 mg Orange G (Roth, Karlsruhe,
Germany), 10 mL Glycerol, 40 mL dH2O. Aliquot and store at

20  C.
10. Agarose.
11. TAE gel running buffer: 40 mM Tris–HCl pH 8.0, 20 mM
acetic acid, 1 mM EDTA.
12. RNase free 1.5 mL safe-lock tubes (Eppendorf, Hamburg,
Germany).
13. PCR Cycler.
14. Nanodrop1000 (PEQLAB, Erlangen, Germany) or other
DNA quantification device.
15. Agarose gel electrophoresis apparatus.
16. Fusion FX (Vilber, Eberhardzell, Germany) or other UV
imager.
17. Benchtop centrifuge.

2.4 In Vitro 1. HiScribe T7 High Yield RNA Synthesis Kit (New England
Transcription and Biolabs, Ipswich, USA).
Purification 2. DNase I 2000 units/mL (Rnase free; New England Biolabs,
Ipswich, USA).
3. MEGAclear Transcription Clean-Up Kit (Ambion, Austin,
USA).
4. DEPC-treated water.
5. 10 TBE buffer: 890 mM Tris, 890 mM boric acid, 20 mM
EDTA (see Note 3).
6. Urea.
7. Acrylamide 30% (29:1) (Biorad, Hercules, USA).
8. TEMED (Carl Roth, Karlsruhe, Germany).
9. APS (Carl Roth, Karlsruhe, Germany).
10. Low range ssRNA ladder (New England Biolabs, Ipswich,
USA).
52 Saskia König et al.

11. 2 RNA loading dye (New England Biolabs, Ipswich, USA).

12. Mini-PROTEAN Tetra Vertical Electrophoresis Cell (Biorad,
Hercules, USA).

2.5 CRISPR-Cas9 1. Recombinant Streptococcus pyogenes Cas9 (spCas9) protein,

Components Delivery high concentration (PNA Bio, Thousand Oaks, USA).
into PBMCs 2. In vitro transcribed gRNA from Subheading 2.4 or in alterna-
tive synthetic gRNA chemically modified to include 20 -O-
methyl analogs and 30 phosphorothioate internucleotide lin-
kages at the first three 50 and 30 terminal RNA residues (e.g.,
Synthego CRISPRevolution sgRNA EZ Kit).
3. P3 Primary Cell 4D Nucleofector  kit (Lonza, Basel,
Switzerland).
4. 4D Nucleofector X device (Lonza, Basel, Switzerland).
5. Flow cytometry device such as the Accuri C6 (BD Biosciences,
Allschwil, Switzerland).

2.6 Cell Lysis and 1. CoboExtract DNA extraction solution (Cobo Technologies).
DNA Extraction

2.7 Tri-primer 1. FAMFOR, Fwd and Rev IDAA primers can be ordered in a kit
IDAA PCR format from TAG Copenhagen (http://www.TAGC.com) or
custom-synthesized on a 10-nmol scale, desalted, or reverse-
phase column purified by standard oligo service providers (see
Note 4).
2. Design IDAA Fwd and Rev primers to amplify a 200–550 bp
product spanning the nuclease cut site using Primer3 or similar
software. Add the following 50 extension to the IDAA Fwd
primer: 50 -AGCTGACCGGCAGCAAAATTG-30 (see Note 5).
3. PCR plates, 96 wells.
4. Axygen 8-strip PCR tubes (Fischer Scientific).
5. Thermocycler with programmable temperature stepping func-
tionality, 96 wells, for tri-primer fluorophore labeling of ampli-
cons a Veriti Thermocycler is recommended or Eppendorf
Mastercycler with vapo.protect.
6. Benchtop microcentrifuge.
7. Eppendorf Thermomixer R, dry block heating and cooling
shaker.
8. Agarose gel electrophoresis system.
9. Novex XCell SureLock Mini-Cell.
10. Blue-light transilluminator and orange filter goggles.
11. TEMPase Hot Start DNA Polymerase with 10 ammonium
buffer and MgCl2 (Ampliqon).
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 53

12. dNTP 100 mM (Ampliqon).

13. UltraPure DNase/RNase-free dH2O.
14. TAE buffer, 10.
15. UltraPure agarose.
16. MassRuler Low Range DNA Ladder.
17. TrackIt CyanOrange loading buffer (Life Technologies).
18. SYBR Safe DNA Gel Stain (Thermo Fisher Scientific).

2.8 Amplicon 1. A capillary electrophoresis instrument that supports denaturing

Analysis by Capillary capillary electrophoresis (see Note 6).
Electrophoresis 2. Hi-Di Formamide (Thermo Fisher Scientific).
3. Prepare aliquots and store them at
20  C for up to 3 months
(see Note 7).
4. GS500LIZ or GS600LIZ size standard (Thermo Fisher
Scientific).

2.9 ProfileIT Indel 1. ProfileIt™ software will work on any modern PC or mobile
Profiling and device supporting one of the following web browsers: Google
Quantification Chrome 32+, Firefox 45+, Safari 10+, Microsoft Edge 12+.
2. License to Viking ProfileIt™ indel profiling software analysis
program (https://viking.sdu.dk/pages/software/profileit/).

3 Methods

3.1 Primary Human Estimated time required: 5 h.

PBMC Isolation and
1. Transfer the blood sample from the leukocyte reduction system
Culture
(LRS) chamber to a 50 mL Falcon tube and note the volume
(see Note 8).
2. Wash the chamber with 30 mL PBS (PAN Biotech, Aidenbach,
Germany) by adding it directly to the cells in the 50 mL Falcon
and transfer the solution into a T75 culture flask.
3. Add 29 mL PBS for each 6 mL of cell suspension (see Note 9).
4. Prepare 50 mL Falcon tubes with 15 mL of Biocoll (Biochrom,
Berlin, Germany) for the density gradient separation (see Note
10).
5. Carefully overlay Biocoll with 35 mL cell suspension and cen-
trifuge at 400  g for 30 min at 20  C (see Note 11).
6. Discard the supernatant and transfer the cellular layer into a
new 50 mL Falcon tube.
7. For washing, fill up to 50 mL with PBS and centrifuge at
300  g for 10 min at 20  C.
54 Saskia König et al.

8. Discard the supernatant and repeat the washing step once.

9. Resuspend the pellet of freshly isolated human PBMC in
40 mL PBS and determine the cells concentration using a
Nucleocounter or a similar device.
10. Use the cells immediately for further experiments or freeze
them down in FCS + 10% DMSO and store cells in liquid
nitrogen in appropriate aliquots.
11. Prepare a suitable amount of culture medium (RPMI 1640
with GlutaMAX, 10% FCS, 50 U/mL IL-2).
12. Culture PBMCs in the freshly prepared medium from Sub-
heading Subheading 3.1, step 11 and keep the cells at a con-
centration not lower than 2  106 cells/mL and
1.3  106 cells/cm2 at 37  C with 5% CO2.

3.2 Thawing and Estimated time required: 1 h.

Activation of Primary
1. To metabolically activate PBMCs prepare CD2, CD3, and
Human PBMCs
CD28 coupled magnetic beads according to the manufac-
turer’s instructions and store at 4  C. The final beads concen-
tration is 1  108 beads/mL (see Notes 12 and 13).
2. If using freshly isolated PBMCs, proceed directly to step 4. If
using frozen PBMCs, before thawing them, prepare 9 mL pre-
warmed medium indicated in Subheading 3.1, step 11 and
thaw the cells in a 37  C water bath.
3. Immediately add the cell solution into the prewarmed medium.
Subsequently, centrifuge for 5 min at 300  g and resuspend
the cells in an appropriate volume of medium, depending on
the estimated cell amount (see Note 14).
4. Determine the cells concentration using a cell counter or
equivalent device.
5. Take the required amount of beads based on the number of
PBMCs to be activated (cells:beads ratio of 2:1), and wash the
beads by gently resuspending them in 100–200 μL of medium.
6. Centrifuge at 300  g for 5 min, discard the supernatant, and
resuspend the beads in a volume of medium corresponding to
the initial volume of the beads suspension. Add the beads to the
cells and seed them in the cell concentration mentioned above
(Subheading 3.1, step 12).
7. Incubate the cells at 37  C with 5% CO2 for 3 days.
8. Monitor PBMCs activation via flow cytometry, using a device
such as Accuri C6, upon staining the cells with an anti-human
CD25 antibody (diluted 1:50) following manufacturer’s
instructions (see Note 15).
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 55

9. After three days, remove beads using a commercially available

magnet system as the DynaMag15 (Invitrogen, see Note 16)
following manufacturer’s instructions. Determine the cell con-
centration and culture as suggested in Subheading 3.1, step 12
to recover the cells before nucleofection.

3.3 PCR-Template Estimated time required: 1 h.

Preparation for In Vitro
1. Mix 1 μL of 10 μM forward and reverse primers (see Note 2)
Transcription of the
with 1 μL of 10 mM dNTPs, 10 μL 5 Q5 Reaction Buffer,
gRNA Targeting the 0.5 μL Q5 Hot Start High-Fidelity DNA Polymerase, 1 ng of
Human CCR5 Gene plasmid template, and fill up to 50 μL with nuclease-free water.
Cycling conditions: 30 s—98  C, 30 (5 s—98  C, 30 s—
69  C, 20 s—72  C), 2 min—72  C (see Notes 17 and 18).
2. Check the PCR reaction on a 1% agarose gel in 1 TAE buffer
with ethidium bromide by mixing 3 μL of PCR reaction, 9 μL
water, and 2 μL 6 orange loading dye. Let the gel run for
30 min at 100 V and visualize with a UV light device.
3. If the reaction is successful, purify the rest of the PCR reaction
using QIAquick PCR Purification Kit and follow the manufac-
turer’s instructions (see Note 19).
4. Determine the DNA concentration using a Nanodrop or an
equivalent device.
5. The purified PCR amplicons can be used immediately for the
in vitro transcription or stored at
20  C (see Note 21).

3.4 In Vitro Estimated time required: 1 day.

Transcription and
1. Perform the in vitro transcription using the HiScribe T7 High
Purification
Yield RNA Synthesis Kit following the manufacturer’s protocol
for short transcripts (see Notes 18 and 20). Briefly, mix 1.5 μL
Reaction Buffer (10), 1.5 μL ATP (100 mM), 1.5 μL UTP
(100 mM), 1.5 μL CTP (100 mM), 1.5 μL GTP (100 mM),
1.5 μL T7 RNA Polymerase Mix, 1 μg of PCR template from
Subheading 3.3, step 5 and fill up to 20 μL with nuclease-free
water. Incubate for at least 16 h overnight at 37  C.
2. To remove the DNA amplicons add 70 μL H2O, 10 μL DNase
Buffer I, and 2 μL DNase I. Incubate for 15 min at 37  C.
3. For purifying the gRNA use the MEGAclear Transcription
Clean-Up Kit and follow the manufacturer’s protocol (see
Notes 22–24).
4. Measure the concentration and check the quality of RNA with
a Nanodrop or equivalent device (see Note 25) and aliquot the
gRNA in suitable amounts for later analysis. Store at
80  C.
56 Saskia König et al.

5. As additional quality control the gRNAs can be visualized on a

denaturing PAGE. Therefore prepare a 10% PAGE gel with
8 M Urea. For 10 mL mix 1 mL of 10 TBE, 4.8 g Urea,
3.35 mL Acrylamide 30%, 29:1 and fill up to 10 mL with
ddH2O. Mix at 37  C until everything is dissolved.
6. Add 10 μL TEMED and 100 μL of 10% APS, pour immediately
and insert a suitable comb.
7. After polymerization is complete (generally about 30 min)
remove the comb and any bottom spacers from the gel. Fill
the lower reservoir of the electrophoresis tank with 1 TBE
buffer and place the gel into the lower tank (see Note 26).
8. For sample preparation, mix 500 ng of gRNA in 5 μL H2O and
5 μL loading dye (2). To properly evaluate the length of the
RNA, use 2 μL low range ssRNA ladder mixed with 8 μL
loading dye (2). Incubate the samples and the ladder at
70  C for 10 min, to denature the RNA and avoid the forma-
tion of secondary structures, and put immediately on ice. Wash
the wells with 1 TBE buffer to remove residual urea and gel
pieces and load the samples and the ladder. Run the gel at
220 V for 30–60 min to 1 h until the lower dye front reaches
the end of the gel. Afterwards stain the gel with EtBr by mixing
20 mL H2O with 7.5 μL EtBr and incubating for about
20 min. Afterwards wash 2–3 times with water and visualize
the bands using a UV light device.

3.5 CRISPR-Cas9 Estimated time required: 2 h.

Components Delivery
1. Prepare a 48-wells plate with 500 μL/well of the PBMCs
into PBMCs
culture medium and equilibrate the plate in the incubator at
37  C with 5% CO2 until nucleofection.
2. Prepare a master mix of nucleofection solution for all reactions
by mixing the solution and supplement (see Note 27).
3. Count the cells using a device such as NucleoCounter NC250
(ChemoMetec, Allerod, Denmark) or equivalent and aliquot
1  106 cells for each planned reaction (see Note 28). Place the
reaction tubes into an incubator at 37  C with 5% CO2 until
further procedure.
4. Prepare the RNPs by mixing the gRNA from Subheading 3.4
(or a synthetic gRNA as indicated in Subheading 2.5, item 2)
and the spCas9 protein in a 5:1 ratio (e.g., for 1  106 cells, use
100 pmol gRNA and 20 pmol spCas9 protein). Mix the two
components by gentle pipetting and incubate the reaction tube
for 10 min at 37  C in the incubator (see Notes 28–32).
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 57

5. While precomplexing the RNPs, centrifuge the aliquoted cells

for 5 min at 300  g and resuspend them in 20 μL nucleofec-
tion solution.
6. Add the 20 μL of cell solution to the RNP mix and gently pipet
the whole mixture into the nucleofection cuvette without cre-
ating any bubble. Perform the nucleofection using the EO-115
program (see Note 33).
7. Immediately after nucleofection, transfer the solution to one
well of the 48-wells plate from Subheading 3.5, step 1 and use
100 μL of this medium to recover all remaining cells from the
nucleofection cuvette.
8. Incubate the cells at 37  C with 5% CO2 until further analysis.
9. The viability of the cells can be assessed one day after nucleo-
fection by flow cytometric analysis and staining with a viability
marker like 7AAD, by using a small aliquot of cells (e.g.,
50 μL). If needed cells can be further cultured as explained in
Subheading 3.1, step 12 (see Note 34).
10. Indel profiling can be performed three days post nucleofection
for an optimal result. Due to the enhanced dynamics in indel
formation for RNP Cas9 delivery indel profiling can effectively
be done 1 day post RNP delivery [9]. To this end, transfer
the cells to 1.5 mL tubes and pellet them by centrifugation
at 300  g for 5 min at room temperature. Proceed to IDAA
profiling or store the cells at
20  C for later analysis (see
Note 35).

3.6 Cell Lysis and Estimated time required: 30 min.

DNA Extraction
1. Add CoboExtract solution to the cell pellets isolated in Sub-
heading 3.5, step 10, to yield a lysate of 20–10,000 cells μL
1
(see Note 36). Transfer lysates to Eppendorf or PCR tubes and
incubate in heat block or a thermocycler for 20 min at 65  C
followed by 10 min at 98  C.
2. CoboExtracted cell lysates are now ready for IDAA tri-primer
amplification or can be stored at
20  C (see Note 37).

3.7 Tri-primer Estimated time required: 3 h.

IDAA PCR
1. Resuspend the IDAA Fwd primer to a final concentration of
2.5 μM and the IDAA Rev and FAMFOR primers to 25 μM in
10 mM Tris (pH 8.0) (see Note 4).
2. Setting up the IDAA PCR. Set up the following IDAA reaction
for each sample to be analyzed. Include a nontransfected con-
trol sample.
58 Saskia König et al.

Amount Final
Component (μL) concentration
Ammonium PCR buffer (Ampliqon), 10 1.25 1
(Important Note 39)
dNTP, 100 mM (25 mM each) 0.125 1 mM
IDAA Fwd primer, 2.5 μM 0.125 0.025 μM
IDAA Rev primer, 25 μM 0.125 0.25 μM
FAMFOR primer, 25 μM (see Note 38) 0.125 0.25 μM
DNA polymerase (Ampliqon) (see Note 0.12 0.5 U
39, important)
MgCl2, 25 mM 0.7 2.5 mM
DMSO (see Note 39, important) 0.625 5%
CoboExtract cell lysatea from Subheading 3.6, 1 20–20,000
step 2 (see Note 37) cells
ddH2O 8.33
Total 12.5
a
Alternatively, 1–100 ng purified genomic DNA may be used

3. Perform PCR using the following “touch down”a cycling

conditions:

Cycle number Denature Anneal Extend

1 95  C, 15 min
2–16 atouch down 95  C, 30 s a
72  C, 30 s 72  C, 30 s
17–41 95  C, 30 s 58  C, 30 s 72  C, 30 s
42 72  C, 30 min
a
Decrease annealing temperature by 1  C in each subsequent touch down cycles

4. Run 2.5 μL of the PCR product on a 1.5% (w/v) agarose gel to

check amplification. There should be only one clear band and
no smear (see Notes 40 and 41).
5. Proceed with amplicon analysis of tri-primer PCR product by
capillary electrophoresis in the following section. Alternatively,
tri-primer PCR products can be shipped to certified IDAA
analysis custom service providers (see Note 42).

3.8 Amplicon Estimated time required: 2 h.

Analysis by Capillary
1. Create a master mix of the size standard and formamide as
Electrophoresis
detailed below and aliquot 10.3 μL into separate wells of a
96-well plate. Add 0.5 μL of each appropriately diluted IDAA
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 59

PCR from Subheading 3.7, step 5 to each separate well of the

96 plate (see Note 43).

Component Amount (μL)

Hi-Di Formamide (ABI) 10
GS500LIZ size standard (ABI) 0.3

2. Denature for 5 min at 98  C.

3. Mix by vortexing and spin down briefly.
4. Load plate(s) onto sequenator instrument and run fragment
analysis according to manufacturer’s instructions (see Note 44).

3.9 ProfileIT Indel Estimated time required: 30 min.

Profiling and
1. After capillary electrophoretic run completion, all run files (.fsa
Quantification files), containing the individual raw sample data, are uploaded
into profileIt™.
2. Log on to ProfileIt with username/password provided.
3. Go to Projects in the header.
4. Select new.
5. Add “Project Name.”
6. Select Project and click create.
7. Select new project from the list.
8. Click the button new task.
9. Select ProfileIt.
10. Add a “Task name” and click next.
11. Upload .fsa files.
12. Any of the uploaded files may be marked as the “control
sample” and “negative control” may be specified.
13. Click run task.
14. View Results.
15. Select a normalization/WT peak by clicking on the desired
peak in the control sample profile and select set as normaliza-
tion peak. Normalization peak will be shown in yellow as shown
in Figs. 1, 2c, and 3. Select marking of out-of-frame INDELs,
which will be shown in blue as in Figs. 1, 2c, and 3.
16. Click the button export data. Save or show overall statistics
(download in XLXS format). All quantitative information is
presented as shown in Table 1.
17. Display individual sample profiles to see detailed info of pro-
files, zoom-in on peak areas, and to download images.
60 Saskia König et al.

4 Notes

1. PBMCs can be used fresh or aliquoted as required and frozen in

FCS containing 10% DMSO in liquid nitrogen.
2. In vitro transcription of the gRNA is performed with a com-
mercially available T7 RNA polymerase-based kit. Thereby, the
PCR template used for transcription has to contain a T7-driven
gRNA. One can use the following general primers to generate
gRNAs targeting the sequence of choice by replacing the “x”
with the target site: T7_TargetX_fw:
0
5 ttaatacgactcactataGGxxxxxxxxxxxxxx; T7_gRNA_rv:
50 aaaagcaccgactcggtgccac. Importantly, for the proper
T7-driven transcription, the target site should begin with a
50 GG as highlighted in bold capital letter.
3. Weighing and mixing of boric acid should be performed under
a fume hood.
4. The 6-FAM fluorophore is light-sensitive and should be stored
in the dark at
20  C, where it will be stable for at least
6 months.
5. Test new IDAA primers in the tri-primer setup on control
samples (non-nuclease treated cells) with roughly same cell
concentration as the samples to be genotyped. There should
be only one clear band and no smear, when analyzed by 1.5%
(wt/vol) agarose gel electrophoresis.
6. The resolution of IDAA™ enables the discrimination of DNA
fragments down to single base pairs. This performance is met
by instruments such as ABI’s 310, 3100, 3130, 3500, or 3730
Genetic Analyzers (Applied Biosystems/Thermo Fisher Scien-
tific). The examples shown in this protocol have all been gen-
erated using the ABI3500L instrument, but similar results
can be obtained using older models such as an ABI3130 instru-
ment [11, 18].
7. Only freeze–thaw twice.
8. Generally the blood sample is collected in a leukocyte reduction
system (LRS) chamber that is used to separate the white blood
cells from blood products such as platelets and red blood cells.
9. Include the 30 mL PBS used for washing the chamber into the
calculation.
10. To further separate PBMCs from, e.g., Erythrocytes and Gran-
ulocytes a density gradient is applied using a hydrophilic
polymer.
11. Don’t use the break for the centrifugation to avoid mixing of
the cellular layers.
12. The beads can be stored up to 4 months at 4  C.
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 61

13. Generally we recommend not to vortex the loaded beads and

only mix by flicking the tube.
14. The cell concentration should not be lower than 2  106 cells/
mL.
15. By looking at the forward and sideward scatter, activated cells
increase in size and granularity. Expression levels of the CD25
marker on the cell surface can be analyzed as its higher expres-
sion correlates with a higher activation status.
16. Use a magnet suitable for the volume of the cell suspension.
17. Optimize PCR conditions for each primer pair to avoid any
unspecific band.
18. The input material for in vitro transcription should be 1 μg of
PCR template with a final concentration of at least 90 ng/μL.
Thereby, more than one PCR reaction might be needed.
19. PCR reactions from the same plasmid template can be pooled
and eluted from one column to increase the concentration.
20. Change gloves regularly to avoid contaminations. All steps
should be performed under RNase-free conditions by using
RNase-free material (e.g., safe-lock tubes, pipette tips) and the
working area and equipment (e.g., pipettes, tip boxes, racks)
should be cleaned with RNaseZAP prior to start working.
However, use RNaseZAP sparingly as it can lead to the degra-
dation of the in vitro transcribed RNA. For reproducible
results, make aliquots of kit components.
21. Prolonged storage or repeated freeze and thaw might reduce
the quality of the PCR amplicon. This will subsequently impact
on the yield and quality of the resulting gRNA.
22. Perform all centrifugation steps at maximum speed in bench-
top centrifuge.
23. For elution use option 1 and incubate the filter cartridge in the
elution tube at 70  C for 10 min before centrifugation.
24. Immediately after elution, store the RNA on ice until further
processing.
25. For pure RNA the expected ratios are: about 2 for 260 nm/
280 nm and about 2.0–2.2 for 260/230 nm.
26. Try to remove bubbles by using a syringe and fill the upper
reservoir with 1 TBE to cover the wells. Pre-run and warm
the gel for at least 30 min at 200 V.
27. For each sample, mix 16.4 μL of nucleofection solution with
3.6 μL of supplement solution. Prepare a master mix according
to the total number of samples to transfect. The nucleofection
solution should be kept at room temperature prior to use.
62 Saskia König et al.

28. Perform the procedure under RNase-free conditions and use

RNase-free material.
29. The gRNAs and Cas9 protein should be stored in suitable
aliquots to avoid repeated freeze and thaw cycles which might
lead to a decreased activity of the nucleases.
30. All reactions should contain the same volume and the volume
of the nucleofected reagents should not exceed 10% (means a
maximum of 2 μL for a 20 μL reaction) of the total volume.
RNase-free water can be used to fill up the volume.
31. Cells should not be longer than 5–10 min in the nucleofection
solution as this may impact on cell viability. When having many
samples, prepare the cells and RNPs in several steps.
32. Transfection efficiency can be monitored by adding a sample
transfected with an mRNA encoding for a green fluorescent
protein. Lower cell numbers might lead to increased toxicity.
33. Do not perform more than two reactions at once as RNPs
might degrade and viability of the cells impaired when keeping
them for too long in the nucleofection solution.
34. If the cells should be maintained and expanded for a longer
time, repeat the activation every seven days and remove the
beads after 3 days of activation. Depending on the application,
cells can be harvested for analysis, such as qPCR, T7 Endonu-
clease 1 (T7E1) assay, or IDAA assay, every 7 days after
reactivation.
35. Cell pellets are stable at
20  C for extended periods of time,
more than several months.
36. The cell number required for indel profiling by IDAA™ has a
large dynamic range going from thousands of cells down to
10 cells or less [9]. The CoboExtract cell lysate template input
volume into the tri-primer PCR reaction should be limited to
1–2 μL, since excessive content of lysate affects the perfor-
mance and fidelity of the PCR reaction. However, depending
on the objective, a broad range of cell numbers can be used in
the tri-primer PCR reaction as described in this protocol.
37. CoboExtracted cell lysates are stable for extended periods of
time, more than several months.
38. Importantly, observe the 10:1:10 molar ratio of FAMFOR
primer:IDAA Fwd primer:IDAA Rev primer for optimal ampli-
con labeling and yields.
39. DNA polymerases, including Taq, possess a template-
independent 30 nucleotide extension activity [20–22]. Most
commonly a single base (preferentially adenine) is added to
the 30 end of the amplicon. This activity should be maximized
to completion as illustrated in Fig. 4. As recently noted [23],
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 63

Fig. 4 Illustration of the 30 -template independent Taq DNA polymerase activity. The 30 template independent
activity of several DNA polymerases is well documented [20–22]. Indel profiles shown are derived from
ST6GALNAC1 locus amplified from human genomic DNA [7]. From top to bottom the panels show how
optimization of PCR buffer, from standard KCl buffer, ammonium buffer, standard KCl buffer plus 5% DMSO,
ammonium buffer plus 5% DMSO, and in the latter case followed by ProfileIt™ correction can improve the 30
template independent activity from split “stutter” peak formation to a single peak. The fully 30 elongated
fragment/peak is indicated with an arrow head. Importantly, careful inspection of WT peak profile and optimal
30 extension of amplicons by use of optimal 5’- “end base” design [24] is required for reliable IDAA
quantification
64 Saskia König et al.

decreased level of amplicon extension may for some targets be

observed when strict ammonium buffer, addition of 5% DMSO
(as previously recommended [8] and shown herein) and/or
optimal reverse primer 5’-end base design, preferrable G [24],
are not used. Thus, inclusion of a nontargeted control sample is
highly recommended, in order to assess the level of potential
residual un-extended amplicon, which ultimately can be
resolved using ProfileIT™ as shown in Fig. 4.
40. PCR product may be stored in the dark at 4  C for up to
2 weeks or at
20  C for up to 6 months.
41. The tri-primer product should be a single clear product when
analyzed by standard agarose gel; however, minor amounts of
unspecific product in most cases do not interfere with the
results.
42. Tri-primer PCR products are stable at room temperature and
may directly be shipped to custom service providers certified
for IDAA analysis, such as Cobo Technologies (https://
coboscientific.com/genome-editing/indel-detection-by-
amplicon-analysis-IDAA/). The turnaround time for Quanti-
tative IDAA analysis will depend on service provider and may
range from 1 to 14 days.
43. In order not to exceed the upper threshold limit of the instru-
ment, the amount of product generated in the IDAA tri-primer
PCR, amount of diluted tri-primer PCR product may need to
be diluted up to 1:150 fold. Normally PCR product may be
stored in the dark at 4  C for up to 2 weeks or at
20  C for up
to 6 months. The optimal amount of IDAA PCR to analyze
may vary from 0.1 to 1 μL. If analyzing other than 200–450 bp
IDAA PCR amplicons, choose the size standard accordingly,
but optimal resolution is achieved for tri-primer amplicons
smaller than 600 bp.
44. The 6-FAM fluorophore is unstable in formamide and IDAA
PCRs should therefore be analyzed within 1–2 days after prep-
aration for the analytical run.

Acknowledgments

We thank Vasili Korol and Ilia A. Solov’yov from the University of

Southern Denmark, Department of Physics, Chemistry and Phar-
macy, for development of ProfileIt™ and Camilla Andersen from
Copenhagen Center for Glycomics, Department of Odontology,
University of Copenhagen, for excellent technical assistance. This
work was supported by the Witten/Herdecke University internal
research promotion Grant No. IFF2017-12, the German Duch-
enne Foundation “Aktion Benni & Co.” starting grant to E.E.-S.,
 Ex vivo CRISPR/Cas9 Induced Indel Quantification by IDAA 65

the Danish National Research Foundation [DNRF107], the Euro-

pean Union’s Horizon 2020 research and innovation programme
under the Marie Sklodowska-Curie grant agreement No. 765269,
and the German Federal Ministry of Education and Research
(BMBF). Z.Y. received support from the Lundbeck Foundation
and H.H.W. received support from ERC-2017-COG Type of
action: ERC-COG; 772735; GlycoSkin.
Conflict of Interest Statement: E.P.B. declares that a patent applica-
tion covering the IDAA™ method is pending, and acts as scientific
advisor for Cobo Technologies Aps.

References
1. Chandrasegaran S, Carroll D (2016) Origins of various CRISPR/Cas9 delivery methods. Prog
programmable nucleases for genome engineer- Mol Biol Transl Sci. Elsevier Inc 152:49–67
ing. J Mol Biol 428:963–989 10. Bennett EP, Jacobi AM, Garrett RR, Behlke
2. Sfeir A, Symington LS (2015) MA (2018) Detection of insertion/deletion
Microhomology-mediated end joining: a (indel) events after genome targeting: pro’s
back-up survival mechanism or dedicated path- and con’s of the available methods. In: Appa-
way Trends Biochem Sci 40:701–714 sani K (ed) GENOME EDITING and ENGI-
3. Sehn JK (2014) Insertions and deletions NEERING: from Talens, ZFNs and CRISPRs
(Indels). In: Clinical genomics. Elsevier, to molecular surgery. Cambridge University
Amsterdam, pp 129–150 Press, Cambridge, pp 181–194
4. Deriano L, Roth DB (2013) Modernizing the 11. Yang Z, Steentoft C, Hauge C, Hansen L,
nonhomologous end-joining repertoire: alter- Thomsen AL, Niola F, Vester-Christensen
native and classical NHEJ share the stage. MB, Frodin M, Clausen H, Wandall HH et al
Annu Rev Genet 47:433–455 (2015) Fast and sensitive detection of indels
5. van Overbeek M, Capurso D, Carter MM, induced by precise gene targeting. Nucleic
Frias E, Russ C, Reece-Hoyes JS, Nye C, Acids Res 43:e59. 1–8
Vidal B, Zheng J, Hoffman GR et al (2016) 12. Sandmann S, De Graaf AO, Karimi M, Van Der
DNA repair profiling reveals nonrandom out- Reijden BA, Hellström-Lindberg E, Jansen JH,
comes at. Mol Cell 63:633–646 Dugas M (2017) Evaluating variant calling
6. Paquet D, Kwart D, Chen A, Sproul A, tools for non-matched next-generation
Jacob S, Teo S, Olsen KM, Gregg A, sequencing data. Sci Rep 7:1–12
Noggle S, Tessier-Lavigne M (2016) Efficient 13. Loman NJ, Misra RV, Dallman TJ,
introduction of specific homozygous and het- Constantinidou C, Gharbia SE, Wain J, Pallen
erozygous mutations using CRISPR/Cas9. MJ (2012) Performance comparison of bench-
Nature 533:125–129 top high-throughput sequencing platforms.
7. Narimatsu Y, Joshi H, Zhang Y, Gomes C, Nat Biotechnol 30:434–439
Yen H, Lorenzetti F, Furukawa S, 14. Brinkman EK, Chen T, Amendola M, van
Schjoldager K, Hansen L, Clausen H, Bennett Steensel B (2014) Easy quantitative assessment
EP et al (2018) A validated gRNA library for of genome editing by sequence trace decompo-
CRISPR/Cas9 targeting of the human glyco- sition. Nucleic Acids Res 42:e168–e168
syltransferase genome. Glycobiology 28 15. Hsiau T, Maures T, Waite K, Yang J, Kelso R,
(5):295–305 Holden K, Stoner R (2018) Inference of
8. Lonowski LA, Narimatsu Y, Riaz A, Delay CE, CRISPR edits from sanger trace data. bioRxiv
Yang Z, Niola F, Duda K, Ober EA, 1101:10. https://doi.org/10.1101/251082
Clausen H, Wandall HH et al (2017) Genome 16. Jamuar S, Lam A-TN, Kircher M, D’Gama A,
editing using FACS enrichment of nuclease- Wang J, Barry BJ, Zhang X, Hill RS, Partlow
expressing cells and indel detection by ampli- JN, Topcu M et al (2014) Somatic mutations in
con analysis. Nat Protoc 12:581–603 cerebral cortical malformations. N Engl J Med
9. Kosicki M, Rajan SS, Lorenzetti FC, Wandall 371:733–743
HH, Narimatsu Y, Metzakopian E, Bennett EP 17. Mohamed S, Penaranda G, Gonzalez D,
(2017) Dynamics of indel profiles induced by Camus C, Khiri H, Boulmé R, Sayada C,
66 Saskia König et al.

Philibert P, Olive D, Halfon P (2014) Compar- 30 end of a DNA fragment. DNA Cell Biol
ison of ultra-deep versus Sanger sequencing 12:763–770
detection of minority mutations on the 22. Smith JR, Carpten JD, Brownstein MJ,
HIV-1 drug resistance interpretations after Ghosh S, Magnuson VL, Gilbert DA, Trent
virological failure. AIDS 28:1315–1324 JM, Collins FS (1995) Approach to genotyping
18. Yang Z, Wang S, Halim A, Schulz MA, errors caused by nontemplated nucleotide
Frodin M, Rahman SH, Vester-Christensen addition by Taq DNA polymerase. Genome
MB, Behrens C, Kristensen C, Vakhrushev SY Res 5:312–317
et al (2015) Engineered CHO cells for produc- 23. Sentmanat MF, Peters ST, Florian CP, Con-
tion of diverse, homogeneous glycoproteins. nelly JP, Pruett-Miller SM (2018) A survey of
Nat Biotechnol 33:2014–2017 validation strategies for CRISPR-Cas9 editing.
19. Cornu TI, Mussolino C, Cathomen T (2017) Sci Rep 8(1):888
Refining strategies to translate genome editing 24. Magnuson VL, Ally DS, Nylund SJ, Karanja-
to the clinic. Nat Med 23:415–423 wala ZE, Rayman JB, Knapp JI, Lowe AL,
20. Clark JM (1988) Novel non-templated nucle- Ghosh S, Collins FS (1996) Substrate nucleo-
otide addition reactions catalyzed by procaryo- tide-determined non-templated addition of
tic and eucaryotic DNA polymerases. Nucleic adenine by Taq DNA polymerase: implications
Acids Res 16:9677–9686 for PCR-based genotyping and cloning. Bio-
21. Hu G (1993) DNA polymerase-catalyzed addi- techniques 21(4):700–9
tion of nontemplated extra nucleotides to the
 Chapter 5

Functional Evaluation of CRISPR Activity by

the Dual-Fluorescent Surrogate System: C-Check
Lin Lin and Yonglun Luo

Abstract
Rapid evaluation of the CRISPR gRNA activity is an essential step of employing the technology in editing
genes. Through machine learning strategy, the rule sets for in silico designing gRNAs with high activity has
greatly improved. However, there are still discrepancies between different prediction rule sets, and between
the predicted and actual gRNA activities. Thus, experimentally validating gRNA activity is still the gold
standard in defining the best gRNAs for gene editing experiments. One such approach for experimentally
selecting gRNAs with high activity is fluorescent surrogate reporter vectors. We had previously developed a
dual-fluorescent surrogate system, called C-Check, which based on single-strand annealing repair of the
DNA double-strand breaks introduced by CRISPR-Cas9 to generate a functional EGFP. The system offers
a tool for rapid functional evaluation of CRISPR gRNA activity, as well as for enrichment of gene edited
cells. In this chapter, we will give a step-by-step instruction on the design, generation, and application of the
C-Check system for quantifying gRNA activities.

Key words CRISPR, Cas9, Reporter vector, Surrogate vector, C-Check, Gene editing

1 Introduction

The discovery of programmable DNA endonucleases (ZFNs,

TALENs, and CRISPR-Cas9) has greatly accelerated both aca-
demic and industrial applications that involves the modification of
the genetic codes [1–3]. The ease of vector design, generation and
efficiency undoubtedly and rapidly made CRISPR-Cas9 as the most
popular selection in the tool box of gene editing enzymes. Just
through changing the typically 20 nt guide sequences of the small
guide RNA (gRNA), the sole Cas9 protein can be redirected to the
targeted site which is complementary to the 20 nt guide sequences
and comprises a proximity DNA motif, known as protospacer
adjacent motif (PAM). The PAM for Cas9 protein from Strepto-
coccus pyogenes (SpCas9), the most broadly used CRISPR-Cas9
system, is 50 -NGG-30 where “N” represents any nucleotide fol-
lowed by two guanine (G). The evolutionary requirement of

Yonglun Luo (ed.), CRISPR Gene Editing: Methods and Protocols, Methods in Molecular Biology, vol. 1961,
https://doi.org/10.1007/978-1-4939-9170-9_5, © Springer Science+Business Media, LLC, part of Springer Nature 2019

67
68 Lin Lin and Yonglun Luo

PAM gives CRISPR-Cas9 a unique and powerful feature of dis-

criminating self and none-self target sites. This PAM-dependent
feature contributes greatly to the specificity of CRISPR-Cas9 [4].
One common question that every user of the CRISPR-Cas9
technology encounters is that what is the activity of the selected
gRNA. During the last few years, several methods have been devel-
oped to streamline the quantification of CRISPR-Cas9 activity
[5–8]. When an active Cas9-gRNA component is delivered to the
cells, a DNA double-strand break (DSB) will be introduced to the
target site. Mammalian cells have evolved several DSB repair path-
ways to repair these lethal DNA lesions, such as non-homologous
end joining (NHEJ), homology-directed repair (HDR),
microhomology-mediated end joining (MMEJ), and Single-Strand
Annealing (SSA). One way of quantifying the CRISPR-Cas9 activ-
ity is through harnessing the cellular DSB repair pathway to gener-
ate a functional surrogate vector, which contains the same locus as
the intended target site in the genome. To simplify the cloning as
well as quantifying CRISPR-Cas9 activity, we have generated a
dual-fluorescent reporter vector, called C-Check [7]. This vector
employs the SSA-mediated repair of two truncated EGFP genes,
which contains 500 bp homologous sequences. The C-Check vec-
tor contains several unique features (Fig. 1): (1) Golden-Gate
Assembly technology was employed to simplify the cloning proce-
dure and increase efficiency; (2) A Lac-Z expression cassette was
included in the cloning site to enable blue-and-white selection of

bp 1 100 600 720

EGFP-CDS

PGK EGFP100-600 lacZ EGFP100-600 pA CMV asRED pA

stop* stop*

AGTCGTGAGACC Golden-Gate GGTCTCAACCGT

TCAGCACTCTGG Cloning site CCAGAGTTGGCA
BsaI BsaI
SpecRes

Fig. 1 Schematic illustration of the C-Check vector. The C-Check vector contains two expression cassettes.
First, a consecutive AsRED expression cassette is used as a reference control for normalization. Second, a
truncated EGFP expression cassette, of which the EGFP genes is splitted into two parts with 500 nt in
homology. A BasI-based golden-gate cloning site is used for insertion of any surrogate DNA for C-Check-
based CRISPR activity assay. Upon introduction of double-stranded DNA breaks (DSB) at the surrogate DNA by,
e.g., CRISPR, DSB repaired by single-strand annealing with the 500 nt homologous sequences will generate a
functional EGFP expression cassette
 CRISPR Activity Quantification by C-Check 69

positive clones; (3) A constitutive AsRed expression cassette was

included for normalization of transfection and expression normal-
izations (Fig. 1). We demonstrated that the CRISPR-Cas9 activity
quantified by C-Check correlates well with the functional readouts
of indel frequency in cells [9–11].
Although the C-Check vector described here is for quantifying
CRISPR-Cas9 activity, the system can be used to quantify the
activity of any programmable DNA nucleases that can introduce
DSBs. In this method chapter, we provide a detail instruction and
guideline of how to design, generate, and quantify the C-Check-
based CRISPR-Cas9 activity.

2 Materials

2.1 Generation 1. P119_C-Check (Addgene Plasmid #66817) (see Note 1).

of C-Check Vector 2. Restriction enzymes: BsaI (Eco31I), BsmBI, BbsI, BamHI,
KpnI (see Note 2).
3. T4 DNA ligase.
4. 10 T4 DNA ligase buffer.
5. LB medium.
6. LB agar plates with 50 μg/mL spectinomycin.
7. 0.5 M IPTG.
8. 100 mg/μL X-gal.
9. Chemically competent E. coli cells (see Note 3).
10. 5 KCM buffer.
11. DNA oligonucleotides.
12. C-Check screening primer (Forward): 50 -TGGTGAGCAA
GGGCGAGGAGCTG
13. DreamTaq DNA polymerase.
14. 10 mM dNTP.
15. ddH2O.
16. 10 NEBuffer2.
17. NucleoSpin Gel and PCR Clean-up kit.
18. Plasmid miniprep kit.
19. Plasmid midiprep kit.
20. 1% Agarose gel.
21. Heating block.
22. Thermal cycler.
23. Gel electrophoresis system.
70 Lin Lin and Yonglun Luo

2.2 C-Check 1. Human embryonic kidney 239T (HEK293T) cells.

Transfection 2. D10 medium: DMEM (high glucose), 10% FBS, 1 Gluta-
MAX, and 1 P/S.
3. Fetal bovine serum (FBS).
4. 0.05% Trypsin-EDTA.
5. PBS without calcium and magnesium.
6. Tissue culture tested plasticwares: 6-well, 24-well.
7. X-tremeGENE 9 transfection reagent.

2.3 Evaluate 1. Fetal bovine serum (FBS).

C-Check by Flow 2. 0.05% Trypsin-EDTA (phenol red free).
Cytometry
3. 4% formaldehyde.
4. PBS without calcium and magnesium.
5. 96-well round well plates.
6. Flow cytometry.
7. Software for analyzing FCS data file.

3 Methods

Carry out all procedures at room temperature in a classified labora-

tory unless otherwise specified.

3.1 The Principle The C-Check vectors can be generated through (1) assembly of
of Choosing synthesized oligonucleotides (synthetic approach) or (2) PCR
the Optimal C-Check amplification of the targeted region (PCR approach). The principal
Design Approach of choosing synthetic or PCR approach depends on the number of
gRNAs to be evaluated and how the gRNA target sites are
distributed in the genome. Please follow these principles to choose
the optimal approach:
1. Number of gRNAs (1–3), use the synthetic approach.
2. Number of gRNA (over 3), if all gRNAs target the same
genomic locus within a very close region (less than 500 bp),
use PCR approach.
3. Number of gRNA (over 3), if all gRNAs are located in a broad
genomic region (over 500 bp), use a combination of synthetic
and PCR approach.
4. Design one C-Check vector for each gene/locus.

3.2 C-Check Vector 1. Design C-Check oligonucleotides according to Table 1 (see

Generation—Synthetic Note 4).
Approach 2. Synthesize C-Check oligonucleotides, desalt purification. For
oligos longer than 70 nt, use HPLC purification.
 CRISPR Activity Quantification by C-Check 71

Table 1
Guide for designing C-Check oligonucleotides by synthetics

Oligo name 50 linker Target sequencesa 30 linker Oligo to be order

GOI-CC-For GTCGGAt (target strand:NNN) ataGGT GTCGGAt(target strand:NNN)
ataGGT
GOI-CC-Rev CGGTACCtat (reverse compliment aTC CGGTACCtat(reverse
strand:NNN) compliment strand:NNN)aTC
a
Each target site should contain the 20 nt protospacer sequences and the PAM (NGG for SpCas9). Multiple sites can be
placed in a tandem manner, so one C-Check vector can be used to evaluate the activity of several gRNAs

3. Dilute oligos to 100 μM with TE buffer.

4. Prepare oligo annealing mixture in a 200 μL PCR tube: 1 μL
each of 100 μL C-Check oligos (sense and antisense), 2 μL 10
NEBuffer 2, 16 μL ddH2O.
5. Mix the oligos thoroughly and quick spin using a bench top
centrifuge.
6. Place the tube in a thermal cycler.
7. Denature the oligos at 95  C for 5 mins, then decrease the
temperature to 25  C by about 2 degrees per minute using the
ramping rate of delta C (see Note 5).
8. Save the annealed oligos at 4  C before use. For long-term
storage, save annealed oligos at 20  C.
9. Digest 1 μg of the P119 C-Check plasmid with BsaI restriction
enzyme.
10. Separate the digested P119 C-Check vector with 1% agarose
Gel electrophoresis.
11. Purify the C-Check plasmid backbone band (6693 bp) using a
gel clean-up kit.
12. Prepare an ice box and a 200 μL PCR tube.
13. Place the PCR tube on ice, and prepare the C-Check ligation
reaction containing: 50 ng of the C-Check plasmid backbone,
1 μL of the anneal C-Check oligos, 1 μL T4 DNA ligase, 2 μL
10 T4 ligase buffer, and add ddH2O to a total volume of
20 μL.
14. Place the ligation mixture in a thermal cycler, set to the right
temperature and time for the ligase used.
15. Once the ligation is completed, save the ligation product at
20  C until use.

3.3 C-Check Vector Most steps of the PCR approach are the same as the synthetic
Generation—PCR approach. Here we highlight those steps unique for the PCR
Approach approach.
72 Lin Lin and Yonglun Luo

Table 2
Primer designing scheme for PCR-based generation of C-Check vectors

For BsaI-based cloning of C-Check vector Notes

C-Check-F: ATAAGGTCTCAGTCGGAt---SS---- Target sites should not contain BsaI
C-Check-R: ATAAGGTCTCACGGTACCtat---AS---- recognition site.
For BsmbI-based cloning of C-Check vector
C-Check-F: ATAACGTCTCAGTCGGAt---SS---- Target sites should not contain BsmbI
C-Check-R: ATAACGTCTCACGGTACCtat---AS---- recognition site.
For BbsI-base cloning of C-Check vector
SSA-F: ATAAGAAGACATGTCGGAt----SS---- Target sites should not contain BbsI
SSA-R: ATAAGAAGACATCGGTACCtat---AS---- recognition site.

1. Design PCR primers using the primer designing scheme

provided in Table 2.
2. Synthesize DNA oligos using any certificated supplier.
3. Perform PCR using isogenic genomic DNA template from cells
which will be used for subsequent gene editing (see Note 6).
4. Analyze the PCR specificity with a 1.5% agarose gel electropho-
resis. The PCR should give a unique and intense band of
expected size. If not, pre-optimization of the PCR should be
carried out.
5. Purify the PCR product using a PCR clean-up kit.
6. Digest 200–500 ng of PCR product using the corresponding
restriction enzyme (see Table 2).
7. Purified digested PCR product using a 1.5% agarose gel.
8. Ligate the PCR product to the purified P119 C-Check back-
bone from Subheading 3.2 and carry out the ligation steps
accordingly.

3.4 Transformation 1. Transform chemically competent E. coli cells using 1–2 μL of

and PCR Screening the C-Check ligation product.
of C-Check Vector 2. Spread transformed cells on a LB agar plate containing 50 μg/
mL spectinomycin, IPTG and X-Gal (see Note 7).
3. For PCR-based screening of the C-Check vector, prepare two
sets of 200 μL PCR tubes (lysate set and LB set). The positive
rate of C-Check cloning is over 95%, pick up to 3 maximum
colonies (white clones) for PCR-based screening.
4. Add 50 μL LB medium (50 μg/mL spectinomycin) to each
well of the LB set tubes, mark the tubes as LB1, LB2, LB3.
5. Add 30 μL ddH2O to each well of the lysate set, mark the tube
as LS1, LS2, LS3.
 CRISPR Activity Quantification by C-Check 73

6. Use a sterile 100 μL pipette tip, pick one white clone, firstly dip
into LB1, gently swirl for 1 s.
7. Then place the tip in LS1 of the lysate tube.
8. Repeat pick the rest of colonies as steps 6 and 7.
9. Cap the lysate set and LB set tubes.
10. Place the LB set tubes at 37  C incubator.
11. Place the lysate set tubes in a thermal cycler, lyse the cells at
98  C for 10 min.
12. Save the lysate at 4  C, and use 1 μL lysate as template for PCR
screening.
13. If using the synthetic approach for generating C-Check vector,
PCR screening is carried out using the C-Check screening
primer (Forward) and the antisense C-Check oligo (see Note 8).
14. If using the PCR approach for generating C-Check vector,
PCR screening can be carried out using the same condition as
amplifying the fragment as in Subheading 3.3, step 3.
15. Analyze PCR with a 1.0% agarose gel. For synthetic approach,
the length of PCR product should be 600 bp + the length of
C-Check antisense oligo. For PCR approach, the length of
PCR product will be the same as the cloning fragment.
16. Set up LB culture of the PCR positive clones, 5 mL
LB + 50 μg/mL spectinomycin.
17. Purify C-Check plasmid using a miniprep kit.
18. Validate the C-Check plasmids with restriction enzymes
(RE) digestion: BamHI and KpnI. Positive clones will result
in two bands: one of 6.6 kb and the other of 600 bp+C-Check
oligo/fragment.
19. Set up LB culture of one RE positive clone for midi-prep.
20. Purify plasmid using a commercial midi-prep kit.
21. Save plasmid at 4  C until used.

3.5 Transfection 1. Seed 50,000 HEK293T cells per well to a 24-well plate, pre-
of HEK293T Cells pare triplicate for each transfection and enough wells of cells
with C-Check (see Note 9).
and CRISPR 2. Transfect HEK293T cells with X-tremeGENE 9 or other trans-
fection reagents. For each transfection, use a molar ratio of
Cas9:gRNA:C-Check ¼ 1:1:1.
3. Inspect cells using a fluorescent microscope 48 h post transfec-
tion (Fig. 2).

3.6 Analysis 1. Prepare 5% FBS-PBS.

of Transfected Cells by 2. Wash cells with PBS twice.
Flow Cytometry
74 Lin Lin and Yonglun Luo

Fig. 2 Fluorescent microscopy pictures of C-Check-based measurement of CRISPR activity. Un-transfected

HEK293T cells, HEK293T cells transfected with C-Check only, C-Check + Cas9, and C-Check+Cas9+gRNA
targeting the surrogate region. Magnification, 100

3. Add 100 μL 0.05%Trypsin-EDTA (phenol red free) to each

well (see Note 10).
4. Incubate at 37  C for 4–5 mins.
5. Add 500 μL 5% FBS-PBS to each well to stop trypsin.
6. Pipette up and down a few times and transfer the cells to tubes
or 96-well round-well plate that is compatible with flow cyto-
metry analysis, kept on ice until analysis.
7. If the cells are not analyzed immediately, fixed the cells with 4%
formaldehyde for 10 min.
8. Wash cells twice with PBS.
 CRISPR Activity Quantification by C-Check 75

Fig. 3 FACS analysis of C-Check-based measurement of CRISPR activity. Gatings for transfected cells
(AsRED+) and for cells that underwent SSA-mediated repair (EGFP+AsRED+) are presented

9. Resuspend the cells in 500 μL PBS and save at 4  C until flow

cytometry analysis. The cells can be kept at 4  C for one week.
10. To set up the flow cytometry, use the un-transfected cells, cells
transfected with C-Check plasmid only, and cells transfected
with C-Check, Cas9 and gRNA (see Note 11).
11. The C-Check fluorescence intensity will give a hook effect;
analyze the data using the gating principles shown in Fig. 3.

4 Notes

1. The C-check plasmid can be ordered from Addgene or can be

requested directly from us.
2. We used FastDigest restriction enzymes from Thermo Scien
tific to shorten the waiting time of digestion. Restriction
enzymes from other suppliers will also work but require longer
digestion time.
3. The chemically competent cells we used for our study is made
by ourselves. If using commercially made ones, it is important
to use competent cells that are recombination deficient. The
C-Check vector contains internal homologous sequences. If
the competent cells are proficient in recombination, this will
greatly decrease the success of generating the C-Check vector.
4. Artificial stop codons were added as linker to the C-Check
oligos to prevent both the read through and the introduction
of alternative start codon.
5. The denaturing step should be controlled to minimum length,
as the triphosphate stability is not great at 95  C. If not using a
thermal cycler, the anneal oligos can be prepared using a
76 Lin Lin and Yonglun Luo

heating block, but prepare the annealing mixture in a 1.5 mL

EP tube instead. First denature at 95  C for 5 min, then turn
off the heating block and let it cool down naturally.
6. It’s crucial to use isogenic genomic DNA from the cells (not
the HEK293T cells used for C-Check assay) which will be used
for the subsequent targeting. SNPs are highly frequent in cells.
The use of isogenic genomic DNA ensures that the gRNAs
activity measured exactly reflect that in the targeted cells.
Proofreading DNA polymerase should be used to avoid the
introduction of mutations by PCR.
7. The addition of IPTG and X-Gal to the LB plate is to exclude
negative clones. We observed that approximately 1–2 blue
clones (negative) can be observed for a good digestion.
8. Instead of using the antisense C-Check oligo as the reverse
primers for PCR, one of the CRISPR oligos can also be used
as reverse primer.
9. For each C-Check transfection, the following control groups
should be prepared: (1) Un-transfected cells; (2) C-Check
plasmid only; (3) C-Check + Cas9 expression plasmid.
10. The reason of using phenol red free trypsin is to avoid the steps
of washing the cells after trypsinization.
11. Use the 488 nm laser and 530/30 filter for EGFP, 561 nm
laser and 586/15 filter for AsRED. The voltages for 488 nm
laser and 561 nm laser have to be optimized for according to
the instrument used.

Acknowledgments

This work is partially supported by the Lundbeck Foundation

(R219–2016-1375, R173–2014-1105), the Danish Research
Council for Independent Research (DFF–1337–00128), the
Sapere Aude Young Research Talent Prize (DFF-1335–00763A),
the Innovation Fund Denmark (BrainStem), and Aarhus University
Strategic Grant (AU-iCRISPR). Y.L is also supported by
the Guangdong Provincial Key Laboratory of Genome Read and
Write (No. 2017B030301011).

References
1. Mali P et al (2013) RNA-guided human 3. Henrik Devitt Møller LL, Xi X, Petersen TS,
genome engineering via Cas9. Science 339 Huang J, Yang L, Kjeldsen E, Jensen UB,
(6121):823–826 Zhang X, Liu X, Xun X, Wang J, Yang H,
2. Boch J et al (2009) Breaking the code of DNA Church GM, Bolund L, Regenberg B, Luo Y
binding specificity of TAL-type III effectors. (2018) CRISPR-C: circularization of genes
Science 326(5959):1509–1512 and chromosome by CRISPR in human cells.
 CRISPR Activity Quantification by C-Check 77

Nucleic Acids Res. https://doi.org/10.1093/ 8. Yang Y et al (2016) Highly efficient and rapid
nar/gky767 detection of the cleavage activity of Cas9/
4. Leenay RT, Beisel CL (2017) Deciphering, gRNA via a fluorescent reporter. Appl Biochem
communicating, and engineering the CRISPR Biotechnol 180(4):655–667
PAM. J Mol Biol 429(2):177–191 9. Jensen KT et al (2017) Chromatin accessibility
5. Brinkman EK et al (2014) Easy quantitative and guide sequence secondary structure affect
assessment of genome editing by sequence CRISPR-Cas9 gene editing efficiency. FEBS
trace decomposition. Nucleic Acids Res 42 Lett 591(13):1892–1901
(22):e168 10. Liu B et al (2018) STAT3 associates with vacu-
6. Yang Z et al (2015) Fast and sensitive detection olar H(+)-ATPase and regulates cytosolic and
of indels induced by precise gene targeting. lysosomal pH. Cell Res 28(10):996–1012
Nucleic Acids Res 43(9):e59 11. Lin L et al (2017) Fusion of SpCas9 to E. coli
7. Zhou Y et al (2016) Enhanced genome editing Rec A protein enhances CRISPR-Cas9
in mammalian cells with a modified dual- mediated gene knockout in mammalian cells.
fluorescent surrogate system. Cell Mol Life J Biotechnol 247:42–49
Sci 73(13):2543–2563
 Part II

Methods for CRISPR Delivery

 Chapter 6

CRISPR-Cas9 Delivery by Artificial Virus (RRPHC)

Suleixin Yang, Qinjie Wu, Yuquan Wei, and Changyang Gong

Abstract
Since its first harnessing in gene editing in 2012 and successful application in mammalian gene editing in
2013, the CRISPR-Cas9 system exerted magnificent power in all gene-editing-related applications, indi-
cating a sharp thrive of this novel technology. However, there are still some critical drawbacks of the
CRISPR-Cas9 system that hampered its broad application in gene editing. Efficient delivery of the Cas9
protein and its partner small guide RNA (sgRNA) to the target cells or tissue is one of the technical
bottlenecks. CRISPR-Cas9 delivery via DNA plasmids still plays the big role in gene editing methods. With
regard to the disadvantages of CRISPR-Cas9 plasmids, the most acute barrier lies in its large size (>10 kb)
and the subsequent low transfection efficiency by conventional transfection method. In this chapter, what
we present is an easy method by fabricating CRISPR-Cas9 plasmids into nanoparticle system and efficiently
delivered into target cells to achieve gene editing.

Key words CRISPR-Cas9, Transfection, Artificial virus, Branched polyethylene imine, Heptafluor-
obutyric anhydride

1 Introduction

Technical revolutions always lead to an outbreak of research and

applications in both academic and industrial communities. Gene
editing has attracted massive attentions due to its broad applica-
tions in science, biology, and health. Over the last few decades,
there has been a great shortage of efficient gene editing tools. But
with the discovery of TALENs and especially the third-generation
gene editing tool Clustered Regularly Interspaced Short Palin-
dromic Repeats (CRISPR)-Cas9 [1–4], gene editing technology
was universally utilized in laboratories around the world and play a
valuable and indispensable role in molecular botany[5–7], genetics
[8, 9], and pharmacology [10]. With the booming of scientific
research applying these gene editing tools, most researchers noticed
some tough merits that hampered the CRISPR-Cas9’s perfor-
mance to be fully brought out, such as off-target effect, gene-
correction efficiency, and difficulty of delivery [11]. The large size
of CRISPR-Cas9 plasmids were broadly discussed [12, 13] which

Yonglun Luo (ed.), CRISPR Gene Editing: Methods and Protocols, Methods in Molecular Biology, vol. 1961,
https://doi.org/10.1007/978-1-4939-9170-9_6, © Springer Science+Business Media, LLC, part of Springer Nature 2019

81
82 Suleixin Yang et al.

affects packaging efficiency. Different kinds of methods have been

tried to circumvent the inherent weakness that led to low efficiency
of transfection. Virus-mediated CRISPR-Cas9 delivery, such as
adeno-associated virus, lentivirus, and adeno virus [14–18], were
mostly adopted, while the innate immune responses or DNA sens-
ing mechanism can often affect the long-term performance. Never-
theless, none of them sharply improved the condition [19].
In this chapter, we describe a simple method of fabricating a
kind of powerful “artificial virus” nanoparticle [20] with high-
transfection efficiency to deliver CRISPR-Cas9 plasmids [21],
known as RRPHC. The nanoparticle is based on the amphiphobi-
city of fluorinated compounds and phase-separation [22], which
augmented affinity to lipid membranes like cell lipid bilayer mem-
branes and lysosomal/endosomal membranes. The fluorinated
branched polyethylene imine (bPEI) was used as the core material
to condense the CRISPR-Cas9 plasmids, followed by furtherly
wrapped with the cell penetrating peptide R8-RGD modified h