BIOL 1100 Survey of Biological Science
Lab: DNA Structure and Function
Part I: Build a DNA Molecule
Access the virtual lab here: http://learn.genetics.utah.edu/content/basics/builddna/
Adenine (A) pairs with ____Thymine_______________
Guanine (G) pairs with ________Cytosine___________
Thymine (T) pairs with _______Adenine____________
Cytosine (C) pairs with ________Guanine___________
How long will it take you to transcribe DNA in one human cell? _______1
minute_______________
Part II: DNA Extraction
Access the virtual lab here: http://learn.genetics.utah.edu/content/labs/extraction/
1. Why would you need to extract human DNA?
Answer: DNA is extracted from human cells for a variety of reasons. With a pure sample of DNA
you can test a newborn for a genetic disease, analyze forensic evidence, or study
a gene involved in cancer. Try this virtual laboratory to perform a cheek swab and extract
DNA from human cells.
2. Where in the human cell is DNA located?
Answer: It is located in the nucleus but also found in the mitochondria in small amounts.
3. What are the four steps for DNA extraction?
Answer: Following are enlisted the four steps involved in the DNA extraction:
Lysis: In this step, the cell and the nucleus are broken open to release the DNA inside
and there are two ways to do this; mechanical breakdown or lysis through the usage of
enzymes or detergents.
Precipitation: Precipitation separates DNA from this cellular debris. First, Na+ ions
(sodium) neutralize the negative charges on the DNA molecules, which make them more
stable and less water soluble.
Purification: Now that DNA has been separated from the aqueous phase, it can be
rinsed with alcohol to remove any remaining unwanted material and cellular debris.
Cleaning: Any debris left is excluded in this step.
4. The salt solution causes ___DNA strands_____ to clump together.
5. Is DNA soluble in the alcohol?
Answer: No, DNA is not soluble in alcohol.
Part III: Gene Expression
Access the virtual lab here: : http://learn.genetics.utah.edu/content/basics/transcribe/
DNA: ATTACGATCTGCACAAGATCCT
BIOL 1100 Survey of Biological Science
Lab: DNA Structure and Function
RNA: _______UAAUGCUAGACGUGUUCUAGGA______________________________________
Start codon is: AUG
Polypeptide: Polypeptide will be made as a result of these sequences that mRNA corresponds to bring
up.
