PCR Technologies: A Technical Guide
PCR Technologies: A Technical Guide
PCR TECHNOLOGIES
• PCR
• RT-PCR
• qPCR
• RT-qPCR
• dPCR
Foreword
The introduction of the Polymerase Chain Reaction (PCR) This guide contains the material presented during technical
has revolutionized identification and measurement of DNA workshops and therefore covers the questions that are often
sequences and RNA when used in conjunction with reverse raised, and answers the questions we encounter on a day-
transcription. The technique has become ubiquitous across to-day basis when offering technical support. This guide is
all fields of life science and has been adapted to provide presented as a complete solution to those working with PCR-
quantitative analysis (qPCR) and more recently copy number based techniques.
determinations (dPCR). All of these PCR-based techniques are
conceptually and practically simple to implement and, with Editor
appropriate controls, yield highly informative data. However, Tania Nolan, Ph.D.
the vast quantity of information flooding both the peer
reviewed and popular literature, is daunting to those wishing Contributors
to embark on a PCR experiment or adopt a new technique. Anders Bergkvist, Ph.D.
The situation is made more difficult by conflicting advice Carol Carvallo, M.S.
and recommendations. During the preparation of the MIQE Peter H. Chereson, Ph.D.
recommendations1, a publication dedicated to clarifying the Laura Daley, Ph.D.
information required for a qPCR experiment to be evaluated, Ashley Heath, Ph.D.
and the subsequent evaluation of peer reviewed papers Suzanne Hibbs, M.S.
relying on qPCR data2, it became clear that there was a Stacey Hoge, B.S.
desperate need for detailed guidance on the essentials of how Elena Jouravlena, Ph.D.
to carry out PCR techniques and why particular practices may Carol Kreader, Ph.D.
be recommended under specific circumstances. This guide Mudassir Mohammed, Ph.D.
has been written to address that need. Ernie Mueller, Ph.D.
While there are many excellent textbooks and guides available, Genova Richardson, M.S.
this is a unique offering in that it provides detailed technical Tom Russell, Ph.D.
explanations and protocols for PCR and RT-PCR techniques, Brian Ward, Ph.D.
including specific information relevant to qPCR and digital Scott A. Weber, B.S.
PCR. Many popular myths have been addressed and a detailed Marina Wiklander, Ph.D.
troubleshooting guide provided that includes training on the References
appropriate use of controls and how to apply this information 1. Bustin, S.A., Benes, V., Garson J.A., et al. The MIQE guidelines: minimum
to any experiment. It is clear from the requests for support that information for publication of quantitative real-time PCR experiments.
we receive, that data analysis is a bottleneck in the scientific Clin Chem 2009, 55, 611-622.
process and so this is also addressed in a separate chapter. 2. Bustin, S.A., Benes, V., Garson J., et al. The need for transparency and good
practices in the qPCR literature. Nat Methods 2013, 10, 1063-1067.
Table of Contents
Table of Contents
Chapter 1: Introduction and Historical Timelines Chapter 8: Reverse Transcription
Introduction 3 Introduction 53
Historical Timelines 3 Reverse Transcription Linearity 53
Reverse Transcription Priming 54
Chapter 2: Polymerase Chain Reaction Reverse Transcription Efficiency 55
Cycling Procedure 7
PCR Assay Components 9 Chapter 9: Assay Optimization and Validation
Instruments 9 Introduction 59
Application-specific PCR Modifications 10 Validating Primer Design 59
Optimizing Probe Concentration 63
Chapter 3: Quantitative PCR Optimizing Reaction Components and Multiplex Assays 63
Basic Principles 11 Optimizing Mg2+ Concentration 63
Quantification and Analysis of gDNA Targets 14 Probe Fluorophore and Quencher Selection 63
Quantification and Analysis of mRNA Transcripts 14 Guidelines for Optimization of Quantitative Reverse
Quantification and Analysis of ncRNA Transcripts 14 Transcription PCR (RT-qPCR) 64
qPCR Requirements 15 Assay Evaluation 65
The MIQE Guidelines 16
Chapter 10: Data Analysis
Chapter 4: Digital PCR PCR/qPCR Qualitative Analysis 69
Instruments 20 qPCR Data Analysis 69
Instrument Limitations 21 Deriving Accurate Cq Values 69
dPCR Applications 22 Setting the Threshold 70
Digital PCR MIQE 23 qPCR Quantification Strategies 73
Standard Curve Quantification 73
Chapter 5: Quantitative PCR and Digital PCR Detection Methods Relative/Comparative Quantification 73
Introduction 25 Normalization 74
dsDNA-Binding Dyes 25 Reference Gene Selection 75
Probes 26 Analysis of Reference Gene Stability 76
Quenchers 28 Alternative Normalization Methods 78
Nucleic Acid Analogs 29 Statistical Analysis and Data Visualization 80
Summary 30 Statistical Tests 80
Chapter 6: PCR/qPCR/dPCR Assay Design Visualization Techniques for Univariate Analysis 81
Hierarchical Clustering 82
Introduction 31
Principal Component Analysis 83
Amplicon Selection 31
Methylation-specific Assays 33 Chapter 11: Troubleshooting
Primer Design 33 Developing a Troubleshooting Protocol 85
Probe Design 36 Troubleshooting Examples Demonstrating the Use of the
Oligo Synthesis and Handling 38 Diagnostic Tools 88
Oligonucleotide Purification 38 Troubleshooting Case Studies 98
Oligonucleotide Preparation 39 Summary—A Troubleshooting Protocol 99
Chapter 7: Sample Purification and Quality Assessment Chapter 12: Regulatory Agencies and Conclusions
Introduction 41 Regulatory Landscape Overview 101
Nucleic Acid Purification 41 Assay Validation 102
Chaotropic Agents 41 Approved Tests 103
Extraction of Genomic DNA 41 Conclusions 103
Purification of Total RNA 42 Next-generation Sequencing 105
Nucleic Acid Sample Quality Assessment 43 Additional Technical Support 105
Gel Electrophoresis and Capillary Nucleic Acid Quality Analysis Systems 45
Contamination 48
Inhibition 49
An Integrated Example: Analysis of RNA Sample Quality 49
2 sigma.com
Introduction and Historical Timelines
Chapter 1:
Introduction and Historical Timelines
4 sigma.com
Introduction and Historical Timelines
Time PCR Experiments17. These guidelines direct the researcher 7. Mullis, K.B. and Faloona, F.A. Specific synthesis of DNA in vitro via a
through the process of assay quality control. Information polymerase-catalyzed chain reaction. Methods Enzymol. 155: 335-350
(1987).
derived from controls during assay verification is required to
8. Higuchi, R., et al., Kinetic PCR analysis: real-time monitoring of DNA
establish that the experiment is MIQE compliant. As a follow amplification reactions. Biotechnology (N. Y. ) 11: 1026-1030 (1993).
up to the publication of these recommendations, a review 9. Liu, X.K.and Hong, Y. Q-priming PCR: a quantitative real-time PCR system
of qPCR publications was made and an increase in adoption using a self-quenched BODIPY FL-labeled primer. Anal. Biochem. 360:
of the guidelines was shown18. Similar recommendations for 154-156 (2007).
studies containing data derived from dPCR experiments were 10. Holland, P.M., et al., Detection of specific polymerase chain reaction
product by utilizing the 5’----3’ exonuclease activity of Thermus aquaticus
published recently19.
DNA polymerase. Proc. Natl. Acad. Sci. U. S. A 88: 7276-7280 (1991).
11. Tyagi, S. and Kramer, F.R. Molecular beacons: probes that fluoresce upon
References hybridization. Nat. Biotechnol. 14: 303-308 (1996).
1. Kleppe, K., et al., Studies on polynucleotides. XCVI. Repair replications of 12. Whitcombe, D., et al., Detection of PCR products using self-probing
short synthetic DNA’s as catalyzed by DNA polymerases. J. Mol. Biol. 56: amplicons and fluorescence. Nat. Biotechnol. 17: 804-807 (1999).
341-361 (1971).
13. Wittwer, C.T., et al., Continuous fluorescence monitoring of rapid cycle
2. Mullis, K.B. 1997. The Polymerase Chain Reaction (Nobel Prize Acceptance DNA amplification. Biotechniques 22: 130-138 (1997).
Speech). World Scientific Publishing Co, Singapore.
14. Nolan, T., et al., Quantification of mRNA using real-time RT-PCR. Nat.
3. Saiki, R.K., et al., Primer-directed enzymatic amplification of DNA with a Protoc. 1:1559-1582 (2006).
thermostable DNA polymerase. Science 239: 487-491 (1988).
15. Fang, F.C. and Casadevall, A. Retracted science and the retraction index.
4. Lawyer, F.C., et al., High-level expression, purificationand enzymatic Infect. Immun. 79: 3855-3859 (2011).
characterization of full-length Thermus aquaticus DNA polymerase and a
16. Fang, F.C., et al., Misconduct accounts for the majority of retracted
truncated form deficient in 5’ to 3’ exonuclease activity. PCR Methods Appl.
scientific publications. Proc. Natl. Acad. Sci. U. S. A . 109: 17028-33 (2012).
2: 275-287 (1993).
17. Bustin, S.A., et al., The MIQE guidelines: minimum information for
5. Saiki, R. K., Scharf,S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and
publication of quantitative real-time PCR experiments. Clin. Chem. 55:
Arnheim, N. Enzymatic amplification of beta-globin genomic sequences
611-622 (2009).
and restriction site analysis for diagnosis of sickle cell anemia. Science 230:
1350-1354 (1985). 18. Bustin, S.A., Benes, V., Garson, J., et al. The need for transparency and good
practices in the qPCR literature. Nat Methods 10: 1063-1067 (2013).
6. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. Specific
enzymatic amplification of DNA in vitro: the polymerase chain reaction. 19. Huggett, J.F., et al., Guidelines for Minimum Information for Publication of
Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1:263-273 (1986). Quantitative Digital PCR Experiments. Clin. Chem. 59: 892-902 (2013).
Chapter 2:
Polymerase Chain Reaction
The polymerase chain reaction (PCR)1,2,3 has become one of PCR consists of cycles of reaction heating and cooling. Each
the most widely used techniques in molecular biology. It is temperature plateau is used to control a defined stage of
used in applications from basic research to high-throughput the reaction and the incubation times are dependent on
screening. While it is a powerful technique, the universal the instrument, reaction plates or tubes and reagents. These
adoption and diverse range of applications is due to its should be optimized for each experiment, especially if
apparent simplicity and relatively low cost. The technique increased detection sensitivity is required5.
is used to amplify specific, target DNA fragments from low
The initial denaturation phase consists of a period at high
quantities of source DNA or RNA (after a reverse transcription
temperature, during which the secondary structure of the
step to produce complementary DNA (cDNA), see Chapter 8).
complex double-stranded DNA (dsDNA) is melted to become
One major advantage of PCR is that target sequences can be
single-stranded DNA (ssDNA). Since DNA is being subjected
amplified from a single copy of starting material, even when
to high temperature, this phase needs to be long enough to
the template is degraded and contaminated with inhibitors.
separate all strands so that they are available for priming but
For example, studies have been performed on DNA extracted
not so long that the DNA is damaged. Degradation during
from ancient Egyptian mummies to identify the members of
the initial (or subsequent) denaturation steps or incomplete
King Tutankhamun’s family4. PCR even features in major films
denaturation, results in decreased detection sensitivity5.
and in most crime series television dramas at some stage in
the “investigation,” even if somewhat over fictionalized. During the shorter denaturation step that initiates the cycling
(10 sec to 1 min at 95 °C), the DNA strands of the target
sequence separate to form single strands, just as in the initial
Cycling Procedure denaturation stage. The reaction is then cooled to the primer
A typical PCR consists of: annealing temperature.
• Initial Denaturation: The reaction temperature is increased The annealing step (30 sec to 1 min, at temperatures 45–60 °C),
to 95 °C and the reaction is incubated for 2–5 min (up to is required so that the primers bind to the complementary
10 min depending on enzyme characteristics and template sequence on each of the DNA single strands. The primers are
complexity) to ensure that all complex, double-stranded designed such that they bracket the target of interest and the
DNA (dsDNA) molecules are separated into single strands region of sequence that lies between them is referred to as
for amplification. the amplicon. In general, the annealing temperature may be
estimated to be 5 °C lower than the melting temperature of
• Cycling:
the primer-template DNA duplex.
1. Denaturation: The reaction temperature is increased
to 95 °C, which melts (disrupts the hydrogen bonds The final stage is the extension step (20 sec to 1 min at 72 °C),
between complementary bases) all dsDNA into single- which is performed so that the DNA polymerase extends
stranded DNA (ssDNA). the primer sequences from the 3’ of each primer to the end
of the amplicon. A 1 min extension is typically sufficient to
2. Annealing: The temperature is lowered to
synthesize PCR fragments up to 2 kilobases (kb). To amplify
approximately 5 °C below the melting temperature
larger fragments, the elongation step is extended at a rate of
(Tm) of the primers (often 45–60 °C) to promote primer
1 min per kb. During the first extension, the template will not
binding to the template.
be length limiting and so templates will be synthesized that
3. Extension: The temperature is increased to 72 °C, which exceed the amplicon length. In subsequent extension steps,
is optimum for DNA polymerase activity to allow the the amplicon length will be defined by the primer sequence at
hybridized primers to be extended. each end.
• Repeat: Steps 1–3 are performed in a cyclical manner,
resulting in exponential amplification of the amplicon
(Figures 2.1 and 2.2).
Figure 2.2. In a theoretical PCR, the quantity of target amplicon doubles with each
cycle, leading to exponential amplification of the target sequence (X axis shows the Figure 2.3. An example of conventional PCR products resolved through an agarose
PCR cycles, and the Y axis shows total number of amplicon molecules). gel stained with ethidium bromide. A duplex PCR was run to detect 2 targets
simultaneously, each differing in size. Both fragments can be seen as distinct bands
At the start of the second cycle, two forms of template are in (image courtesy of Marion Grieβl).
the reaction; original DNA strands and the newly synthesized
DNA strands, consisting of the primer sequence followed
8 sigma.com
Polymerase Chain Reaction
10 sigma.com
Quantitative PCR
Chapter 3:
Quantitative PCR
As described in Chapters 1 and 2, PCR is currently Alternatively, a probe (or combination of two depending
considered to be the most useful technique that is applied on the detection chemistry) can add a level of detection
to investigations using molecular biology. This is primarily specificity beyond the dsDNA-binding dye, since it binds to
due to its ability to amplify a target nucleic acid sequence a specific region of the template that is located between the
(the template; genomic DNA, gDNA, or complementary primers. The most commonly used probe format is the Dual-
DNA, cDNA) by several million fold. When combined with Labeled Probe (DLP; also referred to as a Hydrolysis or TaqMan®
quantitative PCR (formally quantitative real-time PCR, qPCR) Probe). The DLP is an oligonucleotide with a 5’ fluorescent
detection, it can be used to estimate the quantity of starting label, e.g., 6-FAM™ and a 3’ quenching molecule, such as one
material in a sample. Since the products are detected as of the dark quenchers e.g., BHQ®1 or OQ™ (see Chapter 5).
the reaction proceeds, qPCR has a much wider dynamic These probes are designed to hybridize to the template
range of analysis than conventional, end-point PCR; from between the two primers and are used in conjunction with
a single copy to around 1011 copies are detectable within a DNA polymerase that has inherent 5’ to 3’ exonuclease
a single run. Quantitative real-time PCR and subsequent activity. When the DLP is free in solution, the signal intensity
amplicon detection is carried out in a closed-tube format is low because the reporter dye is in close proximity to the
which eliminates the need for post-PCR manipulation, such quencher moiety. As more of the template is produced during
as gel electrophoresis and significantly reduces the risk of the reaction, more probes hybridize to the template, which
cross contamination. in turn are cleaved by the 5’ to 3’ exonuclease activity of the
advancing DNA polymerase. The fluorescent signal intensity
The basic principles of qPCR will be discussed in this chapter
increases as the 5’ reporter dye is released into solution. The
and the mechanisms of the common detection chemistries
use of probes labeled with different reporter dyes allows for
will be described in Chapter 5.
the simultaneous detection and quantification of multiple
targets in a single (multiplex) reaction.
Basic Principles A typical qPCR run consists of repeated cycles of alternating
When performing qPCR, a fluorescent reporter dye is used temperature incubations, see Cycling Procedure 3.1. This
as an indirect measure of the amount of nucleic acid present profile is often used when dsDNA-binding dyes, Molecular
during each amplification cycle. The increase in fluorescent Beacons, or Scorpion® Probes are the chosen detection
signal is directly proportional to the quantity of exponentially chemistries for qPCR. Primer extension is most efficient at
accumulating PCR product molecules (amplicons) produced 72 °C because this is the optimal temperature for processivity
during the repeating phases of the reaction (see Chapter 2). of most DNA polymerases. At 72 °C, polymerization occurs
Reporter molecules are categorized as; double-stranded at a rate of approximately 100 bases per second. However,
DNA (dsDNA) binding dyes, dyes conjugated to primers, or there is still processivity at lower temperatures that is sufficient
additional dye-conjugated oligonucleotides, referred to as to amplify shorter templates. qPCR amplicons are typically
probes (see Chapter 5). shorter (<200 bases) than conventional PCR products, thus
The use of a dsDNA-binding dye, such as SYBR® Green I, extension is often combined with annealing in a single step at
represents the simplest form of detection chemistry. When 60 °C when working with Dual-Labeled Probles (see Cycling
free in solution or with only single-stranded DNA (ssDNA) Procedure 3.2).
present, SYBR Green I dye emits light at low signal intensity.
As the PCR progresses and the quantity of dsDNA increases,
more dye binds to the amplicons and hence, the signal
intensity increases.
are separated and are single stranded and available for Denaturation: The reaction temperature is increased to
1.
amplification 95 °C for 10 sec to melt all dsDNA.
Annealing and Extension: The temperature is lowered
2.
• Cycling:
to 60 °C for 30 sec to promote primer binding to the
Denaturation: The reaction temperature is increased to
1. template and subsequent elongation occurs due
95 °C for 10 sec to melt all dsDNA. to sufficient activity of the DNA polymerase at this
Annealing: The temperature is lowered to 60 °C for
2. temperature.
30 sec to promote primer and probe (if included) • Repeat: Steps 1–2 are repeated, usually for 40 cycles.
binding to the template.
The change in fluorescence over the course of the reaction
Extension: Subsequent elongation occurs at an
3. is measured by a real-time PCR thermal cycler. Dedicated
increased temperature of 72 °C, which is optimal for Taq real-time PCR instruments combine temperature cycling with
DNA polymerase processivity. Duration of extension will an optical unit. The optical unit provides light at a suitable
be dependent upon amplicon size (30 sec per 1 kb). The wavelength to excite the fluorophore and detects the resulting
period of elongation depends upon the desired length emission. Many modern instruments have an affixed display
of the amplicon and the enzyme used. Since qPCR screen or nearby computer monitor, which allows the reaction
amplicons are short, this is typically 5–30 sec. to be tracked as it progresses (Figure 3.1).
• Repeat: Steps 1–3 are repeated, usually for 40 cycles.
12 sigma.com
Quantitative PCR
14000
A Plateau
13000
12000
11000
10000
Fluorescence (norm)
9000
8000 Linear
7000
6000
5000
4000
3000
Exponential
2000
1000
Baseline
0
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Cycle
14000
13000
B
12000
11000
10000
Fluorescence (norm)
9000
8000
Lower Cq equals Higher Cq equals
7000
abundant starting scarce starting
6000 material materials
5000
4000
3000
2000
1000
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Cycle
Figure 3.1. Example qPCR Assay Data. A) The different phases of the reaction. Baseline: The initial concentration of template is low; therefore, the fluorescence intensity is
too low to be detected and only the background signal is evident. Exponential: After the target yield has reached the detection threshold, shown as the red threshold line,
the course of the reaction can be followed through the exponential phase. Linear: As the concentration of template increases the available DNA polymerase concentration
reduces and the reaction rate decreases. Plateau: The reaction is at the maximum yield. B) Individual reactions are characterized by the cycle at which fluorescence first rises
above the threshold, which is referred to as the Quantification Cycle (Cq). If the starting material is abundant, amplification is observed in earlier cycles and the Cq is lower.
If the starting material is scarce, amplification is observed in later cycles and the Cq is higher. This correlation between fluorescence, Cq and amount of amplified product
enables quantification of the template over a wide dynamic range.
Quantification and Analysis of gDNA Targets qPCR3. As illustrated in Figure 3.2A, the 5’-end of the RT primer
can base-pair with a region several nucleotides from its own
Quantitative real-time PCR can be readily applied to analysis 3’-end to create a base-paired stem separated by an unpaired
of gDNA targets. Such studies may be genotyping/SNP loop. All except the last few nucleotides at the 3’-end of the RT
determination, methylation analysis, screening transgenic primer are universal, that is, they contain the same sequence in
sequences, or monitoring of insertions and deletions. all miRNA primers. The last few nucleotides that extend 3’ from
the stem are complementary to the 3’-end of a target miRNA.
Quantification and Analysis of Extension of the primer along a miRNA template creates a
cDNA that can be amplified with a miRNA-specific forward
mRNA Transcripts primer and a universal reverse primer, the latter of which is
complementary to the 5’-end of the stem-loop RT primer.
A common application of qPCR is gene expression analysis,
e.g., comparing the mRNA concentrations of a gene of interest All other commercial miRNA qPCR methods, including Sigma’s
between control and treated samples. The mRNA can be MystiCq® brand, use poly-A tailing to lengthen the miRNA,
quantified via a two-step or one-step RT-qPCR process (see as described by Shi and Chiang4. Poly(A) Polymerase (PAP),
Chapter 8, Reverse Transcription Quantitative Real-time PCR, a template-independent enzyme, catalyzes the transfer of
for more details of RT reactions). adenosine residues from ATP to the 3’-end of any RNA. As
illustrated in Figure 3.2B, RT can then be performed using
Two-step RT-qPCR an oligo-dT primer. The oligo-dT primer includes an adapter
The reverse transcription and qPCR reactions are carried sequence at its 5’-end, which enables subsequent qPCR
out sequentially in separate tubes. Either total RNA or, less with a forward primer that is complementary to a specific
commonly poly(A)+ RNA, is used as the starting material miRNA and a reverse primer that is complementary to the
and cDNA is produced by elongation from oligo-dT primers, adapter sequence.
random primers, a blend of oligo-dT primers/random primers, miRNA RT-qPCR
or gene-specific primers using a reverse transcriptase enzyme. A. TaqMan/Stem-loop primer B. Sigma, et al./Poly-A Tailing
An aliquot of this reaction is then added to the qPCR. miRNA RT Primer 5’ miRNA
3’
Poly-A polymerase
ncRNA Transcripts
qPCR
Universal PCR
Chen, et al., 20053 Primer
hp://www.quantabio.com/product_mirna.php?base_id=95107
Most non-coding RNAs are longer than 100 nucleotides
and therefore, can be detected and quantified by RT-qPCR Figure 3.2. There are two commercially available methods for RT and qPCR of
miRNA. A) A looped primer is used to prime the RT step after hybridization to the
with the same techniques that are used for mRNA analysis. 3’ end of the miRNA. PCR extension through the loop results in a combined miRNA
In contrast, short non-coding RNAs, such as micro and piwi and universal sequence which is long enough for amplification B) Addition of a
RNAs, are essentially the length of a single PCR primer. As a poly A tail to the miRNA provides a priming site for a primer that is composed of a
oligo-dT tract and a universal priming sequence.
consequence, a technique that lengthens these short RNAs
Nucleic acids research by Oxford University Press. Reproduced with permission
is needed before performing qPCR. Two main approaches are of Oxford University Press in the format reuse in a book/e-book via Copyright
adopted in commercially available systems: 1) use of a stem- Clearance Center
loop RT primer and 2) poly-A tailing followed by RT with an
oligo-dT adapter primer (Figure 3.2). An alternative approach Both commercial approaches have advantages and
developed by Casoldi et al., that is not commercially available, disadvantages. Stem-loop priming allows 2-step RT-qPCR,
uses ligation of an adapter molecule to all RNA in the sample whereas most poly-A tailing methods require an additional
and specific primer design to differentiate between the step for RT before qPCR. There are products that combine
desired targets1,2. poly-A tailing and RT in a single reaction for 2-step PAP tailing/
RT-qPCR. However, detection may be less sensitive with this
The stem-loop RT primer approach was developed and approach (unpublished internal results, Sigma). Conversely,
commercialized by Applied Biosystems (currently Life poly-A tailing followed by RT produces a stable pool of
Technologies/Thermo) for subsequent TaqMan probe-based
14 sigma.com
Quantitative PCR
cDNA that can be used to detect any microRNA, mRNA, or Primers
other RNA, immediately or at any time in the future. With the
stem-loop/TaqMan approach, a different primer is needed for Whether using a dsDNA-binding dye or a probe-based
detection of each miRNA. Multiple stem-loop primers can be detection chemistry, designing high-quality primers is one of
added to the same RT reactions5 and pools of RT primers for the most critical pre-experimental steps in qPCR. For a detailed
multiple miRNAs may be purchased from Life Technologies to discussion of assay design, see Chapter 6.
perform multiplex RT. However, neither option allows for qPCR
detection of miRNAs discovered at a later date, nor do they Probe(s)
allow qPCR to detect mRNA from the same cDNA. The system When using probes as the amplicon detection mechanism,
described by Castoldi et al1,2 is unique in that it does provide primer dimers and nonspecific products are not detected but
the means to detect mRNA, precursor and fully processed should be avoided because they can lower reaction efficiency.
miRNA molecules from the same total RNA sample. To maximize sensitivity and specificity, the appropriate probe
type for the application should be selected and any required
qPCR Requirements modifications, such as Locked Nucleic Acid® (LNA®), included
(see Chapter 5, qPCR Detection Chemistry).
Instruments dNTPs
Many qPCR instruments have been designed to support a
Standard PCR/qPCR master mixes contain dATP, dCTP, dGTP
specific range of applications, e.g., contrast the capability of
and dTTP. However, some mixes are available that replace dTTP
the ABi 7900 high throughput instrument using automatic
with dUTP. Products from previous reactions run with dUTP will
loading of 384-well plates with the Illumina produced and
contain uracil instead of thymine. These are then susceptible
marketed Eco instrument that supports a single 48-well plate.
to cleavage by Uracil-DNA-Glycosylase (UNG). Therefore, prior
Therefore, the most suitable instrument meets the needs of
incubation of subsequent reactions with UNG prevents carry-
the research. It is desirable to select an instrument with user
over contamination between reactions. To be effective, all PCRs
friendly software that performs the most desirable functions
in the laboratory must use dUTP.
and has flexibility in terms of data output so that it can be
easily manipulated in downstream statistical analysis software
packages. This reduces the time required to train personnel
Magnesium
and therefore to begin generating results. Additional features Magnesium chloride (MgCl2) is necessary for reverse
that are required include a PCR block that is absolutely uniform transcriptase, Taq DNA polymerase and Taq DNA 5’ to 3’
(an absolute maximum deviation of 1 Cq = 2-fold across exonuclease activity. Optimum Mg2+ concentrations for
96 wells of replication) and an optical system that excites and reactions containing DLPs are usually between 3–6 mM.
detects emission as sensitively and as evenly as possible across The majority of master mixes contain MgCl2, however, it is
a wide range of wavelengths. This allows for a wide choice sometimes necessary to optimize the concentration, so an
of fluorophores and enables multiplexing. Other features additional tube of pure MgCl2 is typically included with the
to consider are the operating costs associated with specific master mix product (see Chapter 9, Assay Optimization and
consumables, e.g., if a standard microtitre plate is not used for Validation). In some cases, a reaction mix that does not contain
reactions and also the convenience of loading plates/tubes MgCl2 may be required so that a low concentration can be
that are non-standard format. used, e.g., when using Scorpions® Probe detection.
16 sigma.com
Quantitative PCR
Are You MIQE Compliant?
Minimum Information for Publication of Quantitative Real-time PCR Experiments
The MIQE Checklist for qPCRa Importanceb The MIQE Checklist for qPCRa Importanceb
Experimental Design qPCR Protocol
Definition of experimental and control group Essential Complete reaction conditions Essential
Number within each group Essential Reaction volume and amount of cDNA/DNA Essential
Assay carried out by core lab or investigator’s lab? Desirable Primer, (probe), Mg++ and dNTP concentrations Essential
Acknowledgement of authors’ contributions Desirable Polymerase identity and concentration Essential
Sample Buffer/kit identity and manufacturer Essential
Description Essential Exact chemical constitution of the buffer Desirable
Volume/mass of sample processed Desirable Additives (SYBR Green I, DMSO, etc.) Essential
Microdissection or macrodissection Essential Manufacturer of plates/tubes and catalog number Desirable
Processing procedure Essential Complete thermocycling parameters Essential
If frozen - how and how quickly? Essential Reaction setup (manual/robotic) Desirable
If fixed - with what, how quickly? Essential Manufacturer of qPCR instrument Essential
Sample storage conditions and duration (especially for FFPE samples) Essential qPCR Validation
Nucleic Acid Extraction Evidence of optimization (from gradients Desirable
Procedure and/or instrumentation Essential Specificity (gel, sequence, melt, or digest) Essential
Name of kit and details of any modifications Essential For SYBR Green I, Cq of the NTC Essential
Source of additional reagents used Desirable Standard curves with slope and y-intercept Essential
Details of DNase or RNAse treatment Essential PCR efficiency calculated from slope Essential
Contamination assessment (DNA or RNA) Essential Confidence interval for PCR efficiency or standard error Desirable
Nucleic acid quantification Essential R2 of standard curve Essential
Instrument and method Essential Linear dynamic range Essential
Purity (A260/A280) Desirable Cq variation at lower limit Essential
Yield Desirable Confidence intervals throughout range Desirable
RNA integrity method/instrument Essential Evidence for limit of detection Essential
RIN/RQI or Cq of 3’ and 5’ transcripts Essential If multiplex, efficiency and LOD of each assay Essential
Electrophoresis traces Desirable Data Analysis
Inhibition testing (Cq dilutions, spike or other) Essential qPCR analysis program (source, version) Essential
Reverse Transcription Cq method determination Essential
Complete reaction conditions Essential Outlier identification and disposition Essential
Amount of RNA and reaction volume Essential Results of NTCs Essential
Priming oligonucleotide (if using GSP) and concentration Essential Justification of number and choice of reference genes Essential
Reverse transcriptase and concentration Essential Description of normalization method Essential
Temperature and time Essential Number and concordance of biological replicates Desirable
Manufacturer of reagents and catalogue numbers Desirable Number and stage (RT or qPCR) of technical replicates Essential
c
Cqs with and without RT Desirable Repeatability (intra-assay variation) Essential
Storage conditions of cDNA Desirable Reproducibility (inter-assay variation, %CV) Desirable
qPCR Target Information Power analysis Desirable
If multiplex, efficiency and LOD of each assay Essential Statistical methods for result significance Essential
Sequence accession number Essential Software (source, version) Essential
Location of amplicon Desirable Cq or raw data submission using RDML Desirable
Amplicon length Essential Clinical chemistry Copyright 2009 by American Association For Clinical Chemistry, Inc.
a
Reproduced with permission of American Association For Clinical Chemistry, Inc. in the format
In silico specificity screen (BLAST, etc) Essential Internet posting via Copyright Clearance Center.
Pseudogenes, retropseudogenes or other homologs? Desirable
All essential information must be submitted with the manuscript. Desirable information
b
Sequence alignment Desirable should be submitted if available. If primers are from RTPrimerDB, information on qPCR target,
Secondary structure analysis of amplicon Desirable oligonucleotides, protocols, and validation is available from that source.
Location of each primer by exon or intron (if applicable) Essential Assessing the absence of DNA using a no-reverse transcription assay is essential when first
c
What splice variants are targeted? Essential extracting RNA. Once the sample has been validated as DNA-free, inclusion of no-reverse
transcription control is desirable but no longer essential.
qPCR Oligonucleotides
Primer sequences Essential Disclosure of the probe sequence is highly desirable and strongly encouraged. However,
d
because not all commercial pre-designed assay vendors provide this information, it cannot be
RTPrimerDB Identification Number Desirable
an essential requirement. Use of such assays is discouraged.
d
Probe sequences Desirable
- See more at: http://www.sigmaaldrich.com/life-science/custom-oligos/dna-probes/product-
Location and identity of any modifications Essential lines/miqe-for-qpcr.html#sthash.pkyozwuw.dpuf
Manufacturer of oligonucleotides Desirable
Figure 3.3 The MIQE Guidelines Checklist. Clinical chemistry by American Associa-
Purification method Desirable
tion of Clinical Chemists; American Association for Clinical Chemistry Reproduced
with permission of P.B. Hoeber, in the format Republish in a book via Copyright
Clearance Center.
18 sigma.com
Digital PCR
Chapter 4:
Digital PCR
Digital PCR is an end-point PCR method that is used for reaction-based on the number of cycles required to reach a
absolute quantification and for analysis of minority sequences quantification cycle (Cq); see Chapter 3. When using dPCR,
against a background of similar majority sequences, e.g., the sample is diluted and separated into a large number of
quantification of somatic mutations. When using this reaction chambers, such that each partition contains either
technique, the sample is taken to limiting dilution and one or no copies of target. The number of reaction chambers
the number of positive and negative reactions is used to or partitions varies between systems, from several thousand
determine a precise measurement of target concentration. when using the QX100 Bio-Rad system to millions when using
the RainDrop approach. The PCR is then performed in each
The digital PCR (dPCR) concept was conceived in 1992 by
partition and the amplicon detected using a fluorescent label
Sykes et al.1 and then developed into a nanoscale array format
(see Chapter 5, qPCR and dPCR Detection Methods) such that
by Kalinina et al. in 19972. One of the drivers of continuous
the collected data are a series of positive and negative results.
improvement of dPCR was the demonstration by Vogelstein
In theory, this would result in a positive signal from a partition
and Kinzler3 that rare KRAS mutations could be detected
that originally contained a single copy of target and a negative
and quantified in material extracted from colorectal cancer
(i.e., no signal) from one that did not originally contain
patients. Vogelstein diluted the patient samples such that
template. However, since it is possible that some partitions will
they expected an average of 1 template molecule per 2
contain more than a single copy of template, the dispersal of
wells of a reaction plate. The target sequence around the
the sample into the partitions is considered to obey Poisson
mutation site was amplified and then two Molecular Beacons
distribution.
(see Chapter 5) were used to detect the amplicons. The
first Molecular Beacon was specific to a region that was not In theory, dPCR can be used to overcome some of the
expected to contain a mutation and this assay served as a difficulties that are encountered when using conventional PCR.
PCR amplification positive control. The second Molecular When using dPCR, a sample is partitioned so that individual
Beacon had a different dye label and was specific for the nucleic acid molecules within the sample are localized into
wild type (WT) sequence. In this way, reactions showing a many separate regions and therefore detection of any target
positive signal from both labels were expected to be WT and is not dependent on the number of amplification cycles. This
those showing only the positive control were expected to approach results in a much more sensitive differentiation of
be mutants. Since all the product within a well was expected fold change than that afforded by qPCR; a well-optimized
to be homogeneous as a result of the dilution, an accurate qPCR may differentiate 1.5-fold changes at best, whereas
measure of the ratio of mutant to WT could be made. These dPCR has been reported to differentiate 1.2-fold5. The
experiments provide examples of dPCR being carried out dilution of sample makes this a useful tool for studying
in standard 96-well plates, but higher throughput options minority sequences against a majority of similar but differing
were suggested by others, including Dressman et al.4 who sequences. For example, dPCR can be used to detect a low
introduced the concept of using emulsion beads for dPCR incidence somatic single nucleotide polymorphism (SNP)
(now used in the Bio-Rad QX100™ Droplet Digital™ PCR, against a high concentration of WT sequence. This is because,
ddPCR™ system and RainDance Technologies’ RainDrop™ when the total sample is diluted, the rare sequence is also
instrument). In an alternative format, the reactions are run on diluted to a single copy, so it will be amplified in the absence
integrated fluidic circuits (chips). These chips have integrated of competition from the prominent sequence. Far fewer
chambers and valves for partitioning samples and reaction partitions will contain a positive for the rare SNP than for the
reagents. The first commercial dPCR system using chip WT, so it is possible to make an accurate measurement of the
technology, the BioMark™, was launched in 2006 by Fluidigm. ratio of the two sequences.
When performing conventional PCR, the final concentration Digital PCR has many potential applications, including the
of template is proportional to the starting copy number detection and quantification of low-level pathogens, rare
and the number of amplification cycles. One experiment genetic sequences, copy number variations (CNVs) and relative
of a given number of reactions is performed on a single gene expression in single cells. Clonal amplification enabled by
sample and the result is an analysis of fragment sizes or, single-step dPCR is a key factor in reducing the time and cost
for quantitative real-time PCR (qPCR), the analysis is an of many of the “next-generation sequencing” methods and
estimate of the concentration of the target sequences in the hence enabling personal genomics.
20 sigma.com
Digital PCR
then thermo cycling is performed off-chip. The reaction is then
injected into another chip for analysis. When multiplexing
Instrument Limitations
samples, droplets containing diluted fluorescent probes are Digital PCR offers many advantages over qPCR. These
collected from one chip and injected into another chip where advantages are made possible by partitioning out individual
they are fused with droplets containing primers, master mix reactions, thereby enriching low copy and rare allelic
and DNA. The merged droplets are amplified off-chip and then amplification, while concomitantly enhancing the precision
analyzed for the presence or absence of the desired targets15. and quantification power of dPCR as a result of the increased
number of microscale reactions. Not only can dPCR be used
Bio-Rad to measure absolute copy numbers, CNVs and rare allelic
mutations, but it can also be used to quantify low quantity/
The Bio-Rad QX100™ Droplet Digital™ PCR technology is low quality DNA6,16,18,13,19,5,17. For example, when using next-
the only platform that does not use microfluidic chips at generation sequencing, quantification by dPCR has the
any stage of the process. Instead, this instrument utilizes oil potential to eliminate the need and cost of running titration
emulsification technology in a standard 96-well plate format. analyses on input DNA. This, in turn, allows the use of smaller
Eight samples containing master mix, primers, Dual-Labeled amounts of input DNA, minimizing the need for the seemingly
Probes and DNA can be loaded into a cartridge at the same biased pre-amplification step commonly used in next-
time. Each sample is positioned adjacent to a well containing generation sequencing7.
oil and together they undergo droplet emulsification using a
vacuum-based droplet generator. Each sample is partitioned However, there may be some instances where pre-
into 20,000 reactions. Droplets are transferred from the amplification cannot be avoided. When working with DNA
8-sample cartridge into a standard 96-well plate. A total from a single cell or when the input DNA is already at a low
of 1,920,000 droplets per plate can be generated for dPCR concentration, whole genome amplification may be required
analysis. Once the droplets have been transferred to the 96- before partitioning the sample into thousands of reactions.
well plate, the samples are amplified using PCR and end-point It is important to note that pre-amplification of target DNA
fluorescent signals are read using a flow cytometric based samples may result in biased amplification of input DNA and
droplet reader16,9. this has the potential to skew dPCR results. It may therefore be
necessary to examine whether the method used for this step
The larger number of reactions (20,000 per sample/1.9 million results in amplification bias before assessing absolute copy
per plate) generated with this platform augments the numbers9,11. In addition, the structure of DNA has been shown
precision associated with dPCR in determining absolute to affect copy number measurements in dPCR analysis. This
quantification and CNV measurements. The increased number is especially true for circularized plasmid DNA, which should
of reactions per sample affords the ability to load larger consequently be linearized before use in dPCR applications9.
amounts of template DNA when compared to the other
systems that have fewer partitioned reactions per sample. This One of the more obvious drawbacks of dPCR is the initial cost
becomes increasingly valuable when detecting rare events of of equipment and ongoing requirement for consumable
importance. Digital reads from duplicated wells can also be materials. Relatedly, qPCR instruments are more common in
combined to determine CNVs for rare or low copy mutational laboratory settings and researchers are more comfortable with
events. Lower limits of detection have been reported to handling this platform. Of course, the desired applications
allow identification of 0.001% of the mutant population in of the user will ultimately provide guidance on the type of
partitioned reactions. Bio-Rad’s QX100™ Droplet Digital™ PCR instrument required to carry out those studies.
platform has also been used with maternal plasma DNA to
determine absolute quantification measurements of maternal
and fetal markers, underscoring the advantages of dPCR
technology in measuring CNVs with low quality/low quantity
template DNA17,16. Though the QX100™ Droplet Digital™
PCR instrument offers a substantial number of partitioned
reactions per plate (1.9 million) and is reasonably priced, it is
not compatible with qPCR applications and can be used to
multiplex only two targets per sample.
dPCR Applications CNVs are abnormal copies of DNA due to deletion, insertion,
or rearrangement and are associated with susceptibility
Since dPCR samples are partitioned into individual to disease20,21,22. In cancer, gene copy numbers are often
microreactors, the number of partitions determines the range increased and patient responsiveness to drug treatment
of sensitivity of detection. Quantification relies on counting is correlated to copy number23,24,25,26. Numerous methods
the number of positive partitions at the end point, as opposed have been used to quantify CNVs, including SNP arrays,
to amplification cycles and therefore does not rely heavily on next-generation sequencing and qPCR. Recently, dPCR has
amplification efficiency. To account for the random distribution materialized as an attractive tool for quantifying patient
of target DNA into partitions, the Poisson statistical model is biomarkers due to the greater precision in copy number
applied1 and an absolute quantity is calculated. The quantity determination. Digital PCR has been used to determine
of the target sequence is typically evaluated in comparison accurately the CNV with a resolution of <1.25. Specific qPCR
to a reference sequence of known quantity to determine probes enhanced with the addition of LNA bases (see
a relative quantification. Applications for the absolute and Chapter 5) may be utilized in dPCR to discriminate and detect
relative quantification of target DNA include measuring CNVs, the presence of somatic SNP variations (Figure 4.1). Probes
biomarker analysis and detection of rare events. In addition, are designed such that a mutation-specific probe carries the
reverse transcription may be combined with dPCR to measure fluorophore FAM and a second probe, specific to the wild-type
RNA molecules. This technique is beneficial for quantification sequence (WT), carries the fluorophore HEX. The WT and SNP
of low concentrations of virus from complex, transcription in DNA targets are discriminated in the assay. In some cases, gene
single cells and allele-specific transcription. copies may be “linked” on the same allele and consequently
CNV could be underestimated9. Gene duplication in tandem
may be resolved by digestion of template DNA with a specific
restriction nuclease surrounding the target sequence16
(Figure 4.2).
14000
12000
10000
8000
6000
4000
2000
0
0 1000 2000 3000 4000 5000 6000 7000 8000 9000
Channel 2 Amplitude
Figure 4.1. Detection and determination of the relative copy number of a SNP mutation with droplet digital PCR. A mutation-specific probe was prepared carrying the
fluorescent dye FAM and the probe for unmodified (wild type) sequence carried the fluorophore HEX. The X axis is the HEX signal, generated as a function of the presence
of wild type sequence. The Y axis is the FAM signal, generated as a function of the presence of the SNP mutation sequence. Both modified and wild type sequences were
detected in the target DNA and the relative abundance of each sequence could be directly determined.
6
5
Copy Number
4 3.94
2 1.75
1
0
Digested DNA Undigested DNA
Sample
Figure 4.2. Droplet digital PCR assay to determine CNV. Purified, undigested DNA was used as template to quantify gene copy number relative to reference. The same DNA
sample was also digested with a restriction endonuclease surrounding the target sequence to elucidate linked copies of target sequence. Poisson error bars are shown.
22 sigma.com
Digital PCR
Digital PCR is used to quantify a variant DNA sequence that A)
FAM Amplification Plots HEX Amplification Plots
is present in a background of abundant WT sequence. For
example, somatic mutations that are specific to cancers
may be detected when present in a background of normal Dilution
Sample
genotype in clinical samples. Quantitative PCR is limited to
1
detecting mutant sequences present at 1% or greater. Digital 2
DNA from 100,000-fold WT16 and the RainDrop instrument was 0.8
0.7
used to detect a mutated copy from 200,000 WT copies13. A 0.6
Ratio
typical evaluation of primer/probe sets for use in rare event 0.5 0.484
0.4
detection consists of titrating SNP-containing template DNA 0.3
into WT-template DNA, reducing the SNP-containing template 0.2
0.227
0.115
by half at each dilution. An example of such an experiment 0.1
0
0.0649
0.0319
0.6
be further extended by aggregating data across multiple 0.5
wells in order to increase the number of partitions without 0.4
0.3
increasing the SNP-containing concentration. 0.2
0.1
Due to the often limiting amount of DNA sample available 0 0.0136
7
0.00734
8
0.00341
9
0.00147
10
0.00161
11
0.000442
12
for use in next-generation sequencing, the samples are Sample
typically amplified by PCR or whole genome amplification. Figure 4.3. Evaluation of primer/probe set in droplet digital PCR assay and qPCR
Quantification of DNA molecules post-amplification is critical for rare event detection. A mutation-specific probe was prepared carrying the
to the performance of the sequencing assay and could be fluorescent dye FAM and the probe for unmodified (wild type) sequence carried
the fluorophore HEX. SNP-containing template DNA was titrated into wild-type
done with methods such as spectrophotometry. Recently, the template DNA to evaluate detection of the SNP mutation when present in an
capability of dPCR for absolute DNA quantification has been abundant wild type background. SNP-containing template was reduced by half
applied to next-generation sequencing library preparation7. A at each dilution. A) Primer/probe set was used in qPCR with mutation-titrated
DNA template. B) Primer/probe set was used in single well of droplet dPCR with
universal template fluorescent probe PCR assay was developed mutation-titrated DNA. The ratio of mutant to wild type copies is shown. Digital PCR
such that a probe-specific sequence is designed at the end allowed for detection when the frequency of the mutant sequence was as low as
of one PCR primer for library amplification27. This universal approximately 1 in 2,000, while the qPCR limit of detection was 1 to 10. The limit of
detection for dPCR may be further extended by aggregating data across multiple
template probe-based assay may be utilized in conjunction wells in order to increase the number of partitions.
with dPCR to quantify library molecules accurately.
Expression of genes that control cellular activity, including
cell differentiation, varies among individual members of cell
Digital PCR MIQE
populations and whole population measurements reflect the Previously the “Minimum Information for Publication of
average values28. Although it may be preferable to measure Quantitative Real-time PCR Experiments” (MIQE guidelines30)
transcription in single cells, the amount of RNA present is were published to outline experimental design details that
very small, i.e., <1pg29. The regular workflow for single cell are categorized as essential or desirable for publication of
transcriptome analysis using qPCR requires a pre-amplification qPCR results (see Chapter 3). The addition of dPCR as a new
step to amplify cDNA. Due to the dynamic range and ability tool and the introduction of multiple dPCR instruments,
to quantify low concentrations of template, dPCR is a suitable necessitates development of MIQE standards specific for dPCR.
method for single cell transcript analysis without the use of The published digital PCR MIQE (dMIQE) proposes essential
pre-amplification. and desirable elements to consider for validity of dPCR
data31. In many aspects, including primer/probe design and
optimization, the requirements for dPCR are similar to qPCR.
24 sigma.com
Quantitative PCR and Digital PCR Detection Methods
Chapter 5:
Quantitative PCR and Digital PCR Detection Methods
Probes
In all applications of qPCR, the amplification reaction is driven
by specific forward and reverse primers. However, unlike 5’ Reporter
3’ Quencher 3’ Quencher
assays relying on detection using dsDNA-binding dyes, probe Taq
detection systems do not include a free dye but rather a third DNA
polymerase
oligonucleotide (and sometimes a fourth) conjugated to a
reporter dye and/or a quencher moiety. Amplified Target DNA
Dual-Labeled Probes (also known as hydrolysis or alternatively Figure 5.3. Mechanism of Dual-Labeled Probes. Taq DNA polymerase extends the
TaqMan® probes) are used in the 5’ nuclease assay2,3, which primer situated on the same strand as the probe until it reaches the probe position.
The inherent exonuclease activity hydrolyzes the probe from 5’ to 3’, which releases
is the most popular probe detection chemistry (Figure 5.3; the reporter dye into solution and thereby causes an increase in fluorescence. The
also see the animation of the following web page: measured fluorescence signal is directly proportional to the amount of target DNA.
sigma.com/probe-animation). A Dual-Labeled Probe is
a single-stranded oligonucleotide that is labeled with a Table 5.2. Spectral Characteristics of Common Dual-Labeled Probe
reporter dye and a quencher moiety. The reporter is located Reporter Dyes.
at the 5’ end and the quencher at the 3’ end. The quencher Excitation Emission Compatible
absorbs the natural fluorescence emission of the reporter, Name Maximum (nm) Maximum (nm) Quencher
usually by Forster-type energy transfer, more commonly Reporter Dye
referred to as fluorescence resonance energy transfer (FRET). 6-FAM™ 494 515 BHQ®-1, TAMRA
After amplification from the forward primer, the Taq DNA JOE™ 520 548 BHQ-1, TAMRA
polymerase encounters the probe. The 5’ exonuclease activity TET™ 521 536 BHQ-1, TAMRA
Cal Fluor® Gold 540a 522 541 BHQ-1
inherent in the Taq DNA polymerase then separates the 5’
HEX™b 535 555 BHQ-1, TAMRA
reporter from the 3’ quencher (Table 5.2, Figure 5.3), which
Cal Fluor Orange 560b 540 561 BHQ-1
provides a fluorescent signal that is proportional to the
TAMRA™ 555 576 BHQ-2
amplicon yield. Cyanine 3 550 570 BHQ-2
The hydrolysis probe assay is specific and accurate for Quasar® 570c 548 566 BHQ-2
quantification of low copy number targets. Specificity can Cal Fluor Red 590d 565 588 BHQ-2
be improved even further by the inclusion of modified ROX™ 573 602 BHQ-2
nucleotides such as LNA® in the probe (as described below). Texas Red® 583 603 BHQ-2
Cyanine 5 651 674 BHQ-3
LNA modified probes are particularly useful for differentiating
Quasar 670e 647 667 BHQ-3
between single nucleotide polymorphisms (SNPs) or other
Cyanine 5.5 675 694 BHQ-3
similar sequences. Dual-Labeled Probes require careful design a
JOE/TET alternative c
Cyanine 3 alternative e
Cyanine 5 alternative
(see Chapter 6) and are generally more expensive than b
VIC® alternative d
TAMRA alternative
dsDNA-binding dyes. Furthermore, while amplification of Most real-time PCR thermal cyclers have multiple detection channels enabling flexibility in the
nonspecific products may remain undetected, side reactions choice of probe labels. It is critical to select the reporter dyes that are compatible with the detec-
tion channels for the instrument and ensure that the correct filters and calibration are in place.
may cause the overall reaction to be less efficient and so assays When multiplexing, reporter combinations are required that are as distinct as possible from each
containing probes may still benefit from optimization (see other to minimize optical cross talk. Typical reporters include: FAM, HEX, Texas Red and Cyanine 5.
Under identical conditions, it is usual to observe differences in emission intensity from different
Chapter 7). reporters. For this reason, it is advisable to analyze the data from each reporter combination
independently (using different threshold settings as appropriate for the probe emission).
26 sigma.com
Quantitative PCR and Digital PCR Detection Methods
Molecular Beacons LightCyler® Probes
Molecular Beacons (also known as hybridization probes) A LightCycler Probe or FRET system (also known as dual-
are single-stranded probes that are held in a hairpin-loop hybridization probes) consists of a pair of single-stranded
conformation (20–25 nucleotides) by complementary stem fluorescent-labeled oligonucleotides5,6 (Figure 5.5). Oligo
sequences (4–6 nucleotides) at each terminus4 (Figure 5.4). Probe 1 is labeled at the 3’ end with a donor fluorophore
The hairpin-loop is complementary to the template and the dye and Oligo Probe 2 is labeled at the 5’ end with one of a
hydrogen-bonded stem sequences allow the 3’ quencher to few available acceptor fluorophore dyes (Table 5.4). The free
suppress the fluorescence of the 5’ reporter (Table 5.3) when 3’ hydroxyl group of Oligo Probe 2 must be blocked with a
the probe is free in solution. phosphate group to prevent DNA polymerase extension.
Loop 3’ Donor Fluorophore (FD)
Sequence Loop Sequence
5’ Reporter
Stem 3’ Quencher Oligo Probe 1 5’ Acceptor
Sequence Fluorophore (FA)
Amplifed Target DNA
Oligo Probe 2
5’ Reporter Amplified Target DNA 1. Probes in solution emit 2. Emission through fluorescence
3’ Quencher
low fluorescence resonance energy tranasfer
1. Unbound beacon with 2. Bound beacon with
Figure 5.5. Mechanism of LightCycler FRET Probes. During the annealing step, the
quenched fluorescence unquenched fluorescence
primers and both of the probes hybridize to their specific target regions, bringing
the donor dye into close proximity to the acceptor dye (the probes are usually
Figure 5.4. Mechanism of Molecular Beacons. Molecular Beacons hybridize to their
spaced 1 to 5 nucleotides apart). When the donor is excited by light from the real-
specific target sequence causing the hairpin-loop structure to open, separating
time PCR instrument, energy is transferred by FRET from the donor to the acceptor.
the 5’ reporter from the 3’ quencher. As the quencher is no longer in proximity
The emission wavelength for the dye on the acceptor probe is detected. The
to the reporter, fluorescence emission takes place. Unlike Dual-Labeled Probes,
increase in fluorescence signal is directly proportional to the amount of target DNA.
the mechanism of detection of Molecular Beacons does not rely on degradation
during the reaction. The measured fluorescence signal is directly proportional to the
amount of target DNA. Table 5.4. Spectral Characteristics of LightCycler Acceptor and Donor
Fluorophore Dyes.
Table 5.3. Spectral Characteristics of Common Molecular Beacons Excitation Emission
Reporter Dyes. Name Maximum (nm) Maximum (nm)
Excitation Emission Compatible Oligo Probe 1: Donor Fluorophore
Name Maximum (nm) Maximum (nm) Quencher 3’ Donor Fluorophore (Fluorescein) 495 520
Reporter Dye Oligo Probe 2: Acceptor Fluorophore/Reporter Dye
6-FAM™ 494 515 BHQ®-1, DABYCL 5’ Acceptor Fluorophore N/A 610, 640, 670,
Fluorescein 495 520 BHQ-1, DABYCL (LC Red 610, 640, 670, and 705) and 705
JOE™ 520 548 BHQ-1, DABYCL
TET™
HEX™
521
535
536
555
BHQ-1, DABYCL
BHQ-1, DABYCL
Scorpions® Probes
Cyanine 3 550 570 BHQ-2, DABYCL Scorpions® probes are available in two forms; uni-probe and
ROX™ 573 602 BHQ-2, DABYCL bi-probe. The uni-probe consists of a stem-loop structure,
Texas Red® 583 603 BHQ-2, DABYCL similar to a Molecular Beacon but this is attached to the
Cyanine 5 651 674 BHQ-3, DABYCL forward primer with a PCR blocker located between the two
Cyanine 5.5 675 694 BHQ-3, DABYCL oligo sections7 (the blocker prevents Taq DNA Polymerase from
extending the primer (Figure 5.6A, Table 5.5).
The bi-probe structure is a duplex with the 5’ reporter, probe
sequence, PCR blocker and forward primer on one strand and
the 3’ quencher on the other strand; the quencher strand is
duplexed with the reporter strand (Figure 5.6B).
28 sigma.com
Quantitative PCR and Digital PCR Detection Methods
A) LNA® also provides protection against nuclease digestion
making it suitable for in vivo use12.
CDQ
2600
2200
2000
Fluorescence (norm)
1800
1600
1400
ZNA-modified oligos have been demonstrated to increase
1200
1000
hybridization affinity for their targets by decreasing the
800
600
electrostatic repulsions resulting from the polyanionic nature
400
200
of nucleic acids13. This is achieved by conjugating spermine
0
derivatives as cationic moieties (Z units) to an oligonucleotide
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Cycle
(Figure 5.9). ZNA molecules are versatile as the number
Figure 5.7. Dilutions of an artificial oligo were amplified using 250 nM primers and of Z units is variable and can be placed throughout the
the amplicon detected with a Dual-Labeled Probe at 200 nM. A) The probe was oligonucleotide: 5’, 3’ or internal. By selecting the number of
labeled with FAM and quenched with CDQ or OQA (as indicated) and the raw fluo-
rescence data are shown. B) The probe was labeled with FAM and quenched with cationic units, the global charge of the ZNA molecule can
CDQ or OQA and the baseline corrected data are shown. There are no significant be modulated.
differences between the performances of either probe.
ZNA™ Molecule Single-stranded DNA
Locked Nucleic Acid™ (LNA®) Figure 5.9. ZNA structure and mechanism. A) Structure of oligonucleotide with
LNA® is an RNA analog base (Figure 5.8) that yields enhanced Z unit at the 5’ end. The number and placement of the units is variable.
B) ZNA functions by reducing the charge repulsion between the oligonucleotide
sensitivity and specificity when incorporated into probes9. and target and hence, zips up the molecules.
Probes with LNA bases have greater thermal stability and
therefore hybridize more strongly to the template. Each LNA ZNA oligos are reported to be easy to design and specific,
base may increase the Tm of the probe by up to 8 °C10, which offer improved performance at high annealing temperatures,
makes LNA a powerful tool in SNP discrimination assays11 (a effective at very low concentrations, provide robust
single base mismatch has a greater destabilizing effect on amplification in AT-rich regions and efficient under short
duplex formation than without LNA), multiplexing (allows for cycling conditions14.
simpler Tm optimization) and problematic target sequences
(LNA probes can be shorter, which allows them to be designed
around problems such as AT- or GC-rich regions, repetitive
sequences, or sequences with significant secondary structure).
Summary References
1. Ririe, K.M., Rasmussen, R.P., Wittwer, C.T. Product differentiation by analysis
There are many considerations when selecting a detection of DNA melting curves during the polymerase chain reaction. Anal
method for a particular application. While SYBR Green I dyes Biochem 1997; 245: 154-160
and Dual-Labeled Probe assays are popular and generally work 2. Holland, P.M., Abramson, R.D., Watson, R., et al. Detection of specific
polymerase chain reaction product by utilizing the 5’----3’ exonuclease
well, there are situations in which the other detection systems activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A
might be preferable. Table 5.7 can be used as guidance during 1991; 88: 7276-7280
early assay development. 3. Heid, C.A., Stevens, J., Livak, K.J., et al. Real time quantitative PCR. Genome
Res 1996; 6: 986-994
Table 5.7. Relative Effectiveness of Detection Methods for 4. Tyagi, S., Kramer, F.R. Molecular beacons: probes that fluoresce upon
Common Applications. hybridization. Nat Biotechnol 1996; 14: 303-308
Dual- 5. Wittwer, C.T., Herrmann, M.G., Moss, A.A., et al. Continuous fluorescence
SYBR Labeled Molecular LightCycler Scorpions® monitoring of rapid cycle DNA amplification. Biotechniques 1997; 22:
130-138
Application Green I Probes Beacons Probes Probes
6. Bernard, P.S., Ajioka, R.S., Kushner, J.P., et al. Homogeneous multiplex
Mass Screening XX
genotyping of hemochromatosis mutations with fluorescent
Microarray Validation XX x
hybridization probes. Am J Pathol 1998; 153: 1055-1061
Multiple Target Genes/ X X
Few Samples 7. Whitcombe, D., Theaker, J., Guy, S.P., et al. Detection of PCR products
using self-probing amplicons and fluorescence. Nat Biotechnol 1999; 17:
SNP Detection X X XX
804-807
Allelic Discrimination X X XX
8. PCR Technologies: Current Innovations. 3 ed. CRC Press; 2013
Pathogen Detection X X X X XX
9. Costa, J.M., Ernault, P., Olivi, M., et al. Chimeric LNA/DNA probes as a
Multiplexing XX XX X XX
detection system for real-time PCR. Clin Biochem 2004; 37: 930-932
Viral Load X X X XX
Quantification 10. Petersen, M., Wengel, J. LNA: a versatile tool for therapeutics and
genomics. Trends Biotechnol 2003; 21: 74-81
Gene Expression X XX XX XX XX
Analysis 11. Johnson, M.P., Haupt, L.M., Griffiths, LR. Locked nucleic acid (LNA) single
Gene Copy X X X XX nucleotide polymorphism (SNP) genotype analysis and validation using
Determination real-time PCR. Nucleic Acids Res 2004; 32: e55
End-point XX XX 12. Wahlestedt, C., Salmi, P., Good, L., et al. Potent and nontoxic antisense
Genotyping oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci U S A
In vitro Quantification XX 2000; 97: 5633-5638
Blank spaces indicate that the detection method is not recommended; 13. Noir, R., Kotera, M., Pons, B., et al. Oligonucleotide-oligospermine
X = good performance; and XX = better performance. conjugates (zip nucleic acids): a convenient means of finely tuning
hybridization temperatures. J Am Chem Soc 2008; 130: 13500-13505
14. Moreau, V., Voirin, E., Paris, C., et al. Zip Nucleic Acids: new high affinity
oligonucleotides as potent primers for PCR and reverse transcription.
Nucleic Acids Res 2009; 37: e130.
30 sigma.com
PCR/qPCR/dPCR Assay Design
Chapter 6:
PCR/qPCR/dPCR Assay Design
Introduction When using qPCR for the final readout, a smaller amplicon
is selected to ensure accurate quantification at each cycle.
The entire PCR workflow is vulnerable to factors which Ideally a qPCR amplicon size ranges from 75 to 200 bases in
introduce variability. Many of the variable components length, unless design restrictions take the primers beyond
are unavoidable, such as the source of the sample or the this range. In reality, the fragment size may be determined
requirement for a reverse transcription step. Assay design is by consideration of several factors, including the biology
also highly variable and can make the difference between PCR under consideration.
success and failure and also contributes to the reproducibility
and sensitivity of an assay. The process of assay design follows The assay location may be pre-determined by the objectives
a logical flow: The first step is to determine the desired of the experiment: Ideally, assays for the determination of
target location. In some cases the sequence of the oligos the presence or quantity of a mRNA target are located over
is determined by the application and cannot be avoided, an exon–exon junction to avoid detection of contaminating
e.g., SNP detection, in others the entire gene may be used, gDNA sequences. However, these regions are often highly
e.g., copy number determination. Once the approximate assay folded; therefore a pragmatic decision is required as to the
sites are selected, the most suitable primers are identified preference for an exon spanning assay with potentially
and modifications determined. When assays are to be run poorer performance or an exonic assay of higher quality. If
in multiplex it is important to consider the potential for the mRNA is abundant and transcribed from a single copy
interaction of all oligos in the reaction and also the relative gene, the contribution of signal from gDNA contamination
abundance of the targets. In challenging situations, e.g., where will be considerably less significant than when detecting a
the objective is to detect very low copy numbers or small low abundant transcript from a multicopy gene. Detection of
differences in target concentration, it is advisable to select and SNPs requires location of a probe or the 3’ of a primer over the
test several primer combinations and then combine with a mismatch site.
suitable probe. Analysis of splice variants requires a design approach that is
The process of assay design is greatly facilitated by adoption specific to the objective. In some cases it is desirable to detect
of suitable design software. OligoArchitect, provided by all splice variants simultaneously and this is simply achieved
Sigma‑Aldrich (sigma.com/probedesignonline), provides two by selecting an exon boundary that is conserved between all
options for design support. The first is OligoArchitect Online, variants. However, investigations into differential expression
a software design tool with a wide range of options. If the of each splice variant require a more creative approach. In
design requires a specialized capability, the second option is one example experiment, the objective is to examine which
to request the design via OligoArchitect Consultative, utilizing of the alternative transcripts, shown in Figure 6.1, are being
the assistance of Sigma’s expert, molecular biologists. expressed. Since the exons are relatively small, amplification
across all exons results in a product of around 300 bases, with
smaller products resulting from amplification of splice variants.
Amplicon Selection The design options for this study would be:
The amplicon is the region of target sequence that is to be
analyzed and is encompassed by the forward and reverse • Design several assays across each exon junction and probe
each sample with each assay.
PCR primers. The determination of the amplicon size is, in
part, dependent on the method to be used for analysis. When • Design a primer to the 3’ of exon 1 and the 5’ of exon 4.
visualizing PCR fragments by gel electrophoresis, the PCR Amplification of any transcript comprised of any
fragment needs to be large enough to be stained efficiently combination of exons would result in an amplicon of a
using a DNA binding dye and fit within the range of the specific length. The definition of the transcript would be
chosen artificial size marker. Similarly, when resolving the determined using a qPCR, post reaction SYBR Green I dye
fragment through a capillary electrophoresis instrument, the melt curve.
PCR product will be between 100 base pairs and anywhere
over 2 kb (eventually restricted by enzyme performance).
32 sigma.com
PCR/qPCR/dPCR Assay Design
gDNA cDNA General Design Criteria for Primers
For the majority of applications, primers are designed to be
fully complementary to the template DNA sequences that
they are intended to prime. The basic design considerations for
PCR primers include:
• Primers are typically 20–24 nucleotides in length with a
melting temperature (Tm) of approximately 60 °C
(59±2 °C) for qPCR but may vary (55±5 °C) for conventional
PCR. Specific applications may require modifications to
primer length and Tm.
• Primer pairs should possess 40–60% GC content and
should lack significant secondary structure.
Figure 6.3. BLAST alignment of cDNA sequence with genomic DNA sequence.
The complete cDNA sequence for rat p53 from Genbank (accession number
• Primers should not be complementary to themselves or
NM_030989) was used in a megaBLAST search for identical sequences in the rat
partner primers, particularly at the 3’ end. This reduces
genome (http://www.ncbi.nlm.nih.gov/genome/seq/RnBlast.html). The align- the potential for the formation of primer-dimer products
ment of the cDNA to the gDNA on chromosome 10 is shown. Using this informa- during amplification.
tion, the exons of the cDNA can be aligned to the corresponding gDNA regions
and primer design is directed towards exons that are separated by long introns, • Avoid 3’ clamping (examine the 5 bases of the 3’ and
e.g., exons 1 and 2. accept 3 of these as A or T and 2 as G or C).
• Avoid runs of the same nucleotide that are longer than 4
Methylation-specific Assays repeats or palindromic regions.
DNA methylation is a crucial part of cellular differentiation,
causing gene expression to be altered in a stable manner.
SNP-specific Primers
Methylation is important for normal development in higher In some cases, such as when designing single-nucleotide
organisms and can be inherited. Gene regulation via DNA polymorphism (SNP) assays, there is no flexibility for the
methylation involves the addition of a methyl group to location of the assay and the surrounding sequence will
position 5 of the cytosine pyrimidine ring or nitrogen 6 also influence the sequence of the selected oligos. The
of the adenine purine ring. In adult somatic tissues, DNA recognition of the association between clinical conditions
methylation typically occurs in a CpG dinucleotide context and both germline and acquired somatic SNPs continues
whereas non-CpG methylation is prevalent in embryonic stem to drive considerable efforts into the development of
cells. Methylation specific assays require identification of CpG increasingly sensitive and specific detection systems. This
islands within the sequence, often within the gene promoter reflects the challenging nature of SNP discrimination using
region. This information is automatically located when using oligo hybridization. The challenge is due to the differences
Beacon Designer (Premier Biosoft) and is available at in destabilization between different mismatches. Where G:A,
http://www.mybioinfo.info/index.php. C:T and T:T may have a strong destabilizing effect, G:T and
C:A are much weaker because hydrogen bonds can form
and therefore it is difficult to discriminate these pairings from
Primer Design the natural G:C and T:A. Many systems are adaptations of the
While the general primer and probe design suggestions Amplification-Refractory Mutation System (ARMS)1 that has
described in this chapter are applicable to numerous been widely used and was instrumental in screening for cystic
applications including gene expression studies, SNP detection, fibrosis mutations2. ARMS primers are 30 bases long (longer
methylation detection studies, copy number determination, primers, up to 60 bases are functional). The base at the 3’ is SNP
monitoring viral load and splice variant quantification, each specific and therefore specific for the target sequence (normal
application also has specific design considerations which will or mutant base). An additional mismatch is introduced at the
be discussed separately. penultimate position. This is determined with consideration
to the neighboring bases and the SNP mismatch (Table 6.1
adapted from Little, 2001).
34 sigma.com
PCR/qPCR/dPCR Assay Design
of a poly-A tail using polyA polymerase (PAP)17. The addition Primer Design Example
of a tag to each of the miRNA specific primers enables
optimization of hybridization Tm and reactions containing Since target sequences dictate the primer sequences, it may
DNA primers have been shown to be more efficient than not always be possible to achieve the desired design criteria.
those spiked with LNA18. In this report DNA primers specific Therefore compromises to assay design are overcome by
to miRNA were designed using conventional PCR primer assay-specific optimization. Some PCR targets may require
guidelines with additional considerations: special processing before a successful assay may be designed.
A frequently encountered case concerns the detection of
• Examine miRNA sequence and disregard all terminal A pathogens, including viruses. It is well-known that many
bases at the 3’. viruses have high degrees of variability at specific locations
• Identify the forward primer as the longest stretch of in their genomes. A good example is the Hepatitis B virus.
sequence from 5’ to the terminal 4 bases of the 3’ (ignoring In a recent study, to design a successful qPCR assay against
the A bases identified above). the known HBV variants19, it was necessary to conduct an
extensive alignment of all of the available HBV genomic
• It is preferable for one of the 2 bases at the 3’ of the forward
sequences. Several hundred sequences were compared
primer to be A or T.
using ClustalW in an attempt to find significant stretches
• It is preferable for the 3 bases at the 3’ to include 1 or 2 of consensus sequence that might be used for a generic
A or T. assay design. A snippet of the alignment result is shown
• It is preferable for the 5 bases at the 3’ to include 2–3 A or T. in Figure 6.4. The asterisks (*) represent the consensus
• Analyze the Tm of the forward primer using a nearest nucleotides found in the analysis of all of the genomes (a large
neighbor algorithm. If this is below 59 °C, add the following number of other sequences that were a part of this alignment
bases to the 5’ in the given order and calculate the Tm after are not shown due to space restrictions).
each addition: G,A,C,G,C (resulting in a primer of the form
CGCAGN18 where N are the miRNA specific bases). Select
the shortest primer with Tm closest to 59 °C. If it is above
59 °C, remove 5’ bases and calculate Tm after each base
removal. Select the longest primer with Tm closest to 59 °C.
• Select the 3’ bases for the reverse primer ensuring that
these are not complimentary to the forward primer. Assess
the terminal 5 bases as described for the forward primer.
• Add 15×T to the primer (e.g., 5’ T15 N5 3’).
• Analyze the Tm of the forward primer using a nearest
neighbor algorithm. If this is below 59 °C add the following
bases to the 5’ of the primer in the given order and
calculate the Tm after each addition:
G,A,C,C, T,G,G,A,C, C (resulting in a primer of the form
CAGGTCCAG T15 N5 where N are the miRNA specific bases). Figure 6.4: Partial ClustalW analysis of HBV genome data. All known HBV genomic
Select the shortest primer with Tm closest to 59 °C. sequences were aligned using ClustalW and conserved nucleotides identified (*)
• The RT primer is CAGCTCCAG T15 V N (where V=A, C and G When designing primers and probes in such situations, it
and N=A,C,G,T). may be necessary to use oligos that contain mixed bases,
also known as “wobbles” or degenerate bases. For example,
consider the details of the consensus sequence shown for
HBV (Figure 6.5).
Figure 6.5. A selected region of the HBV alignment showing regions of consensus
5‘ T (C/T) CA (C/T) CA (G/A) (G/A) C (C/T/A) (C/G) T (G/T) (T/C) (T/A) (G/A) G A (T/A) (C/A) C G3‘
Figure 6.8. Sequence showing alignment consensus bases and potential primer
location to a consensus region. The consensus primer is shown using wobble codes
Figure 6.6. The permutations of primer sequence to accommodate all base options
for the selected consensus primer region When using degenerate oligos in PCR, a modified amplification
protocol may be necessary. Cycling may be started with 2–5
The positions of ambiguous base can be represented using cycles at a low annealing temperature (35–45 °C). Also, a
standard single letter codes for mixed bases (Table 6.3). When slow ramp from the annealing temperature to the extension
these are applied to the sequence shown in Figures 6.5 and temperature should be incorporated, taking approximately
6.6, the oligo can be described as in Figure 6.7. 3–5 minutes to reach the extension temperature. The protocol
Table 6.3. Single Letter Mixed Base Codes. should then be finished with 25–40 cycles at a more stringent
annealing temperature without the ramp modification.
Code Mixed Bases
B C G T It is preferable, when possible, to avoid nucleotide
D G T A heterogeneity. If is not possible to avoid regions of
H C T A heterogeneity, which is often the case with difficult targets,
K G T then the use of specialized oligo modifications, such as inosine
M C A and other “universal” bases, such as 5-nitroindole, may help
N C G T A reduce the complexity (sigma.com/mods) and addition of
R G A
modifying groups such as ZNA (see Chapter 5) may improve
S C G
performance.
V C G A
W T A
Y C T Probe Design
A = adenosine, C = cytidine, G = guanosine, T = thymidine
As for PCR primers, qPCR probe design also depends largely
5‘ T Y C A Y C A R R C H S T K Y W R G A W M C G 3‘ on the sequence context and the desired application. Single
Figure 6.7. The ambiguous bases of the consensus region oligo are represented by probes such as Dual-Labeled Probes or Molecular Beacons are
standard single letter codes typically 20–30 bases long. Scorpions® Probes have a shorter
This option is unlikely to result in a successful PCR primer, probe length of 15–25 bases. In a LightCycler or FRET system,
because there are additional considerations that need to there are two probes; the sensor (probe 1) and anchor (probe
be addressed concerning the high number of degenerate 2) probes that are situated in close proximity, separated by
bases. In particular, a synthetic oligo manufactured using 1–5 bases.
this sequence would, in fact, result in a mixture of each of • When using Dual-Labeled Probes, the Tm should be 7 °C
the possible single base sequences. The number of possible, to 10 °C higher than that of the primers to ensure that the
individual primer sequences is calculated by multiplying the probe has bound to the target before the primers hybridize
individual base numbers at each position. For this sequence, and are extended. This is also the case for both FRET probes
this means 1×2×1×1×2×1×1×2×2×1×3×2×1×2×2×2×2×1× in the reaction. When used for SNP detection, the sensor
1×2×2×1×1 = 6,144 possible individual oligos. Therefore, the probe (probe 1) is situated over the site of mismatch,
effective concentration of each specific oligo in the reaction avoiding the terminal 3 bases of the probe and has a lower
is reduced proportionally. Empirical analysis has shown that Tm (about 5 °C) than the anchor probe (probe 2). Scorpions®
the number of different sequence permutations in a primer Probes are the exception to this recommendation since
should not be more than 512, therefore this example would the probe binds to the newly synthesized template after
not be an optimal degenerate-base primer. A redesign to extension rather than before, as for other probe systems.
a different location would offer a potential solution. In the • For quantitative studies using Dual-Labeled Probes, aim for
example shown in Figure 6.8, the primer contains 2 bases the probe to be positioned close to the 3’ of the forward
with potential mismatches. However, these each have a single primer but not overlapping (around five bases); for SNP
alternative base, resulting in 4 oligos in the mixed synthesis detection, position a Dual-Labeled Probe or Molecular
and the wobbles are located in the 5’ region of the primer. Beacon in the center of the amplicon and the SNP in the
These factors offer a much higher chance of success than the center of the probe.
primer presented in Figure 6.7.
• Avoid a guanidine at the 5’ end of probes, next to the
reporter, as this causes quenching.
36 sigma.com
PCR/qPCR/dPCR Assay Design
• Ensure there are fewer Gs than Cs in the probe sequence. Probe Modifications
• Avoid runs of the same base (<4) and palindromic When probes are located over a region of sequence with
sequences. undesired heterogeneity, ambiguous bases are managed
• Ensure that the probe cannot adopt secondary structure. as described for PCR primers. In addition, it is also possible
• Ensure that the probe cannot hybridize to the primers. to incorporate modified nucleotides into qPCR probes, a
common example is the addition of a Locked Nucleic Acid®
• When designing probes for multiplex reactions, ensure (LNA®) base. LNA is a modified RNA nucleotide. The ribose
that there are no potential interactions between any of the moiety of LNA is modified with an extra bridge connecting the
probes and primers. 2’ oxygen and 4’ carbon (see Chapter 5). The bridge “locks” the
ribose in the 3’-endo conformation. LNA can be mixed with
Molecular Beacons DNA or RNA bases in the oligonucleotide wherever desired.
After a suitable probe region has been selected, The LNA modification results in increased thermal stability
complementary stems are added to the 5’ and 3’ ends to create allowing for shorter probes to be designed with the equivalent
the Molecular Beacon structure20. The example below shows Tm to a longer, non-modified equivalent probe. LNA-containing
the addition of a stem sequence (in red) to a Dual-Labeled sequences are more specific than oligos comprised of
Probe to create a Molecular Beacon (Figure 6.9 adapted from DNA alone and ideally suited to SNP detection. Additional
Thelwell 200021). applications of LNA modifications include designing oligos
MTHFR Forward BPF 5´-CTGACCTGAAGCACTTGAAGG-3´ for analysis of difficult sequences, such as viruses, where a
Primer high degree of variability can make it difficult to design a
MTHFR Reverse BPR 5´-ATGTCGGTGCATGCCTTCAC-3´ generic assay22.
Primer
The 5’ of a Dual-Labeled Probe, Molecular Beacon or
MTHFR TaqMan MT 5´-FAM TGCGGGAGCCGATTT Quencher -3´
Scorpions® Probe is labeled with a fluorophore, usually 6-FAM™
MTHFR Molecular MMB 5´-FAM GCGAGTGCGGGAGCCGATTTCTCGC Quencher -3´
Beacon for single assays or when multiplexing, typically choosing
these in the order FAM, HEX™/JOE™, Cyanine 5 (it is critical to
Figure 6.9. Adaptation of a Dual-Labeled Probe Assay to a Molecular Beacon
Format. Nucleic acids research by Oxford University Press. Reproduced with permis-
determine compatibility of the label with the instrument). The
sion of Oxford University Press in the format reuse in a book/e-book via Copyright 3’ of a Dual-Labeled Probe or Molecular Beacon and the 3’ end
Clearance Center. of the internal stem region of a Scorpions® Probe are modified
with a quencher molecule. Historically, the dye TAMRA was
Scorpions® Probes used as an acceptor for FAM emissions, resulting in FAM
The Scorpions® Probe requires assembly of the probe with a quenching. Developments in dark quencher technology have
forward primer such that they adopt the structure: 5’ dye- resulted in widespread adoption of Black Hole Quenchers® and
stem–probe-stem–quencher–blocker–primer. The primer and the more recent introduction of the Sigma Onyx Quencher™
probe must be on opposite strands since the probe binds to collection (see Chapter 5).
the newly created template that is on the same strand as the
primer. The example shown in Figure 6.10 shows the addition Template Controls
of label, quencher, PCR blocker and stem sequences to a One advantage of using relatively short-length amplicons
Dual‑Labeled Probe to create a Scorpions® Probe (adapted that are typically less than 150 bases, is that it is then possible
from Thelwell 200021). to synthesize a long oligonucleotide that may be used as a
synthetic amplification target. Use of such a target may help in
MTHFR Forward BPF 5´-CTGACCTGAAGCACTTGAAGG-3´
Primer development and optimization of assays where the intended
MTHFR Reverse BPR 5´-ATGTCGGTGCATGCCTTCAC-3´ target may be rare or in short supply, for example in the
Primer inhibition control assay SPUD23 (see Appendix A) or infectious
MTHFR TaqMan MT 5´-FAM TGCGGGAGCCGATTT Quencher -3´ disease detection studies19.
MTHFR Scorpions MS 5´-FAM CCCGCGG AAATCGGCTCCCGCA CCGCGGG Quencher
HEG CTGACCTGAAGCACTTGAAGG-3´
38 sigma.com
PCR/qPCR/dPCR Assay Design
Table 6.5. Expected Yield for Modified Oligos with Consideration of 4. Vestheim, H., Jarman, S.N. Blocking primers to enhance PCR amplification
of rare sequences in mixed samples - a case study on prey DNA in
Purification Method. Antarctic krill stomachs. Front Zool 2008; 5: 12
Standard Oligos (OD/µg)* 5. Taft, R.J., Pheasant, M., Mattick, J.S. The relationship between non-protein-
Scale (µmol) Desalt Cartridge HPLC PAGE coding DNA and eukaryotic complexity. Bioessays 2007;29: 288-299
0.05 2/60 0.4/12 0.4/12 0.2/6 6. Taft, R.J., Pang, K.C., Mercer, T.R., et al. Non-coding RNAs: regulators of
0.2 5/150 1/30 1/30 0.4/12 disease. J Pathol 2010; 220: 126-139
1.0 16/480 5/150 5/150 2/60 7. Beck, D., Ayers, S., Wen, J., et al. Integrative analysis of next generation
10 160/4,800 N/A 52/1,560 N/A sequencing for small non-coding RNAs and transcriptional regulation in
15 240/7,200 N/A 76/2,280 N/A Myelodysplastic Syndromes. BMC Med Genomics 2011; 4: 19
*Guarantee is for 20mers or longer. Shorter oligos may have fewer ODs. 8. Ponjavic, J., Oliver, P.L., Lunter, G., et al. Genomic and transcriptional
Note: Post-synthesis modifications may yield 50% less than the above stated values. co-localization of protein-coding and long non-coding RNA pairs in the
developing brain. PLoS Genet 2009; 5: e1000617
Table 6.6. Guaranteed Amounts for qPCR Probes. 9. Ponting, C.P., Oliver, P.L., Reik, W. Evolution and functions of long
noncoding RNAs. Cell 2009; 136: 629-641
qPCR Probes
10. Carninci, P., Kasukawa, T., Katayama, S., et al. The transcriptional landscape
Detection Chemistry Quantity (OD)
of the mammalian genome. Science 2005; 309: 1559-1563
Dual-Labeled Probes 1 3 5 10
11. Rozowsky, J., Wu, J., Lian, Z., et al. Novel transcribed regions in the human
Molecular Beacons 1 3 5 10
genome. Cold Spring Harb Symp Quant Biol 2006; 71: 111-116
LightCycler Probes 0.1 0.25 1.5 15
12. Kapranov, P., Cheng, J., Dike, S., et al. RNA maps reveal new RNA classes
Scorpions® Probes 1 5 10 N/A and a possible function for pervasive transcription. Science 2007; 316:
All probes are purified by RP-HPLC. Inquire for 50 and 100 OD quantities. 1484-1488
13. Kato, M., Slack, F.J. microRNAs: small molecules with big roles - C. elegans
to human cancer. Biol Cell 2008; 100: 71-81
Oligonucleotide Preparation 14. Tijsterman, M., Plasterk, R.H. Dicers at RISC; the mechanism of RNAi. Cell
DNA oligonucleotides provided dry are ready for use upon 2004; 117: 1-3
re-suspension. It is recommended that oligonucleotides are re- 15. Benes, V., Castoldi, M. Expression profiling of microRNA using real-time
quantitative PCR, how to use it and what is available. Methods 2010; 50:
suspended in a weak buffer such as TE (10 mM Tris, pH 7.5–8.0, 244-249
1 mM EDTA). In applications where TE is not suitable, sterile 16. PCR Technologies: Current Innovations. 3 ed. Edited by Nolan and Bustin,
nuclease-free water may be used. However, high-grade water CRC Press; 2013
may be slightly acidic and is not recommended for long-term 17. Shi, R., Chiang, V.L. Facile means for quantifying microRNA expression by
storage of oligonucleotides. real-time PCR. Biotechniques 2005; 39: 519-525
18. Balcells, I., Cirera, S., Busk, P.K. Specific and sensitive quantitative RT-PCR of
A 100 µM stock solution may be obtained by using the miRNAs with DNA primers. BMC Biotechnol 2011; 11: 70
following guideline: Take the number of nanomoles (nmol) 19. Heath, Ashley R., Deluge, Norha, de Amorim, Maria Galli, et al.
provided (information found on the tube label and/or quality Development and use of qPCR assays for detection and study of
assurance document supplied with the oligo) and multiply neglected tropical and emerging infectious diseases. In: Tania Nolan,
Stephen A Bustin, eds. PCR Technologies: Current Innovations 3rd Edition
by 10. The result provides the number of microliters of liquid
ed CRC Press; 2013
to add to the tube to achieve a final concentration of 100 µM.
20. Tyagi, S., Kramer, F.R. Molecular beacons: probes that fluoresce upon
For example, if the oligo yield is 43.5 nmol, the volume to add hybridization. Nat Biotechnol 1996; 14: 303-308
for 100 µM stock is 435 µL. Note that this is equivalent to a 21. Thelwell, N., Millington, S., Solinas, A., et al. Mode of action and
stock solution of 100 pmol/µL. The stock solution may then application of Scorpion primers to mutation detection. Nucleic Acids Res
be further diluted as necessary, based upon the application 2000; 28: 3752-3761
requirements. For PCR, 10 µM or 20 µM working concentration 22. Petersen, M., Wengel, J. LNA: a versatile tool for therapeutics and
genomics. Trends Biotechnol 2003; 21: 74-81
is typically used. Store the stock solution in aliquots at –20 °C
23. Nolan, T., Hands, R.E., Ogunkolade, W., et al. SPUD: a quantitative PCR
and avoid multiple freeze–thaw cycles. assay for the detection of inhibitors in nucleic acid preparations. Anal
Biochem 2006; 351: 308-310
References
1. Little, S. Amplification-refractory mutation system (ARMS) analysis of
point mutations. Curr Protoc Hum Genet 2001;Chapter 9
2. Ferrie, R.M., Schwarz, M.J., Robertson, N.H., et al. Development,
multiplexingand application of ARMS tests for common mutations in the
CFTR gene. Am J Hum Genet 1992; 51: 251-262
3. Liu, J., Huang, S., Sun, M., et al. An improved allele-specific PCR primer
design method for SNP marker analysis and its application. Plant Methods
2012; 8: 34
Chapter 7:
Sample Purification and Quality Assessment
Purification of Genomic DNA The isolation of RNA is challenging because of the ubiquitous
presence of ribonuclease enzymes (RNases) in cells and
DNA can be isolated from almost any cellular or tissue source. tissues, which rapidly degrade RNA. Therefore, RNase inhibitors
Purification of gDNA requires removing it from the cell while are included during the purification process. The most
protecting against degradation. Isolation procedures must common method for purification is guanidinium thiocyanate-
also be gentle enough to protect the long DNA strands from phenol/chloroform extraction. This is the principle behind
mechanical stress. The sample is first harvested in a buffer TRI Reagent®, which is a monophase solution containing
such as phosphate buffered saline (PBS), usually containing phenol and guanidine thiocyanate. The tissue or cell sample
a detergent such as Triton™ X-100 or Sodium dodecyl is homogenized or disrupted in the TRI Reagent, chloroform
sulphate (SDS) to lyse the cells and solubilize proteins and is mixed with the lysate and then the mixture is separated
lipids. Proteinase K is added to separate clumped cells and into three phases by centrifugation. The aqueous phase
tissues and inactivate enzymes by proteolytic digestion. containing the RNA is removed and the RNA is precipitated
Ethylenediaminetetraacetic acid (EDTA) is a chelator that acts using isopropanol. GenElute RNA isolation kits (Sigma) capture
as a scavenger for metal ions in solution and is added to DNA the RNA onto silica resin following cell lysis. GenElute kits use
purification buffers to remove magnesium ions (Mg2+). Mg2+ guanidine thiocyanate and 2-mercaptoethanol to inactivate
is an essential co-factor for DNases, therefore removal of Mg2+ RNases when isolating total nuclear and cytoplasmic RNA.
inactivates DNases, preventing DNA degradation. RNase is In the presence of guanidine thiocyanate, proteins dissolve
often included to degrade the RNA present in the cells. readily, cellular structures disintegrate and nucleoproteins
After lysing the cells and degrading the RNA, proteins and dissociate from nucleic acids as protein secondary structure is
lipids, the DNA must be separated from the remaining lost. Furthermore, since guanidine thiocyanate is more potent
remnants of these materials. The classical purification methods than guanidine HCL, RNases are permanently denatured.
use phenol/chloroform3 to remove the proteins, leaving Lysates are spun through a filtration column to remove cellular
DNA and other water-soluble materials behind. TRI Reagent® debris and shear DNA. The filtrate is then applied to a high
(Sigma) uses an adaptation of this method. Alternatively using capacity silica column to bind total RNA, followed by washing
systems such as the GenElute™ (Sigma) gDNA purification and elution with RNase free water or buffer.
kits, DNA is adsorbed onto silica-based membranes (in single Of the total RNA sample, the majority is rRNA (~80%) while
column and 96-well formats), in the presence of chaotropic the mRNA fraction is only 2–5%. For some procedures, it
salts, which disrupt protein structure. When purifying DNA may be desirable to purify the mRNA from the vastly more
from plant material, the tissue must first be mechanically abundant rRNA and tRNA. The GenElute mRNA Kits (Sigma)
disrupted by grinding in liquid nitrogen, whereas whole blood provide convenient procedures for isolating polyadenylated
or bacteria are pre-incubated with enzymes to ensure efficient mRNA from previously prepared total RNA or directly from
cell lysis and DNA release. The DNA is washed while bound mammalian cells and tissues. For direct mRNA preparation,
to the membranes and then eluted by changing the salt cells or tissues are disrupted with SDS/proteinase K digestion
concentration and is subsequently released with detergent to release RNA and eliminate RNases. Oligo dT30 covalently
and a chaotropic agent. Proteins, polysaccharides and cell linked to 1 μm polystyrene beads is then used to capture
debris are eliminated with a precipitation procedure followed polyadenylated mRNA by hybridization. The polystyrene beads
by centrifugation through a filtration column. remain suspended during hybridization, eliminating the need
for mixing or rocking. The mRNA-bead complexes are washed
Purification of Total RNA on a microcentrifuge spin filter and then the purified mRNA
is eluted.
Purification of cellular RNA is required for studies of gene
expression or other cellular functions that are regulated by Many of the extraction methods used for purification of “total
RNA. Total RNA is the RNA that is transcribed from cellular RNA” specifically select larger molecules and so are not suitable
DNA (gDNA and mitochondrial DNA, mtDNA) and generally for isolation of smaller ncRNAs, including miRNAs. There are
refers to a sample containing: Ribosomal, transfer and specifically designed kits for purification of fractions of smaller
messenger RNA (rRNA, tRNA and mRNA) and does not include RNA species, which may be selected when these are the
microRNA (miRNA) or smaller non-coding RNAs (ncRNA). template of interest.
Total RNA is the fraction of interest which is isolated for gene
expression analysis.
42 sigma.com
Sample Purification and Quality Assessment
Purification of Micro RNA (miRNA) and Non-coding Nucleic Acid Quantification
RNA (ncRNA) UV Spectroscopy
Purification of miRNA and other, smaller ncRNA molecules is Nucleic acids have traditionally been quantified by measuring
more challenging due to their short lengths. It is important UV absorption using a spectrophotometer. The absorbance of
to select an appropriate RNA isolation method that retains a diluted sample of DNA or RNA is read at 260 nm and 280 nm.
small RNA and avoid using a total RNA purification kit The Optical Density (OD) at 260 nm is used to determine
unless the manufacturer specifically states that total RNA the RNA or DNA concentration in a solution using the Beer-
includes small RNAs <100 bases. Extraction methods for Lambert law, which predicts a linear correlation between
ncRNA target differences between RNA molecules and any absorbance and concentration.
other contaminating factors, using specific column binding
or precipitation. RNAzol® (Sigma) is an acidic guanidine Beer-Lambert Law
thiocyanate-phenol mixture that disrupts cells and tissues
and, with the addition of chloroform or bromochloropropane, A = εbc
separates all RNA species from proteins and DNA. Purification A = absorbance
methods then allow separate preparation of small RNA,
b = path length of the cuvette in cm (typically 1 cm)
mRNA or total RNA samples such that each of these fractions
can be analyzed in parallel in downstream applications. The c = analyte concentration
miRPremier® microRNA Isolation kits (Sigma) are silica-based ε = extinction coefficient
bind-wash-elute kits specifically designed for small RNA
recovery. The miRPremier kit uses a salting out approach to For RNA, ε = 40 μg/mL
remove larger molecules before binding small RNA to the For DNA, ε = 50 μg/mL
column, because the amount of ethanol needed to bind small
RNA to silica (silicon dioxide) will also precipitate proteins An OD at 260 nm (A260) reading of 1.0 is equivalent to
and other macromolecules, creating a viscous suspension approximately 40 μg/mL of pure RNA and 50 μg/mL of pure
that can clog columns and prevent efficient recovery of RNA. double-stranded DNA. However, the Beer-Lambert law is only
An alternative approach to circumvent this problem is to valid for OD readings up to 2 and the stated OD/concentration
use a pre-clearing step to remove macromolecules, such as relationship relies upon the samples being pure. Evidently,
by extracting with RNAzol or a pre-binding column, so that contaminating substances with absorption at 260 nm or
sufficient alcohol can be added to bind small RNA without 280 nm will affect the estimated OD reading. Pure RNA has an
clogging the RNA binding column. A260/A280 of 2.1, whereas pure DNA will have an A260/A280 of 1.8.
44 sigma.com
Sample Purification and Quality Assessment
Automated systems such as the QuBit® 2.0 fluorometer
1 2 3 4
(Life Technologies) can be used with a range of different
fluorescence based quantification assays for the measurement
of nucleic acid concentration in solution. The assays
demonstrate a wide dynamic range for detection and are
capable of accurately analyzing small samples.
28S rRNA
It is critical to observe that the OD reading is a measure of
absorption and cannot be used as a complete evaluation 18S rRNA
of sample quality. Similarly fluorescent-based systems
provide a measure of quantity and not quality. For example,
these cannot be used as a test for sample integrity and a
suitable analysis must also be performed, such as a capillary Figure 7.1. Evaluation of RNA integrity by agarose gel analysis. Samples of total
electrophoresis, gel resolution, or the 3’/5’ ratio assay (as RNA (2 μg) were fractionated on a 1% agarose gel in TBE buffer and stained with
ethidium bromide. Lanes 1 and 2 show RNA of high quality while lanes 3 and 4
described below). show degraded RNA.
46 sigma.com
Sample Purification and Quality Assessment
For this reason it is important to apply caution to interpretation component of the RIN algorithm) is not a reliable indicator of
of RIN and other automatically generated measures of sample the integrity of the mRNA. However, the reliability of the 3’/5’
integrity and consider an additional, transcript-specific assay as a measure of overall sample quality depends upon the
investigation. One such approach relies on measurement of a rate at which individual transcripts degrade11. To examine this,
target using two independent assays. The integrity assay relies RNA extracted from HT29 cells was subjected to degradation
on measuring the ratio of the quantities of the target located by incubation for 72 hr at room temperature, or alternatively
towards the 5’ and at the 3’ of the same transcript (Figure 7.4)10. for 2 hr at 62 °C. All sample quality was analyzed using the
This provides a relative measure of transcript-specific RNA Agilent 2100 BioAnalyzer. Assays were also designed to the
integrity (for a 3’/5’ assay protocol, see Appendix A). 3’ and 5’ regions of 13 ubiquitously expressed genes and the
FAM HEX
quantity of these targets was determined in the purified, high
5’ assay 3’ assay
quality undegraded RNA sample (HT29) using both assays for
AA each gene (Figure 7.6A).
RIN vs Integrity
Figure 7.4. Diagram to represent the 3’/5’ integrity assay. cDNA is produced from
total RNA using oligodT primed RT. Two qPCR assays are designed to target the
same transcript and the probes are labeled with different fluorophores, to facilitate
multiplex detection. If the RNA is intact, detection of 5‘ and 3’ assays should be
equal, whereas if the RNA is degraded there would be a higher detection of the 3’
assay relative to the 5’ assay.
In this way, the 3’/5’ ratio assay is used to evaluate the quality
of RNA samples. The use of this approach is demonstrated
in Figure 7.5, by testing the state of the GAPDH transcript
(the specific targets under examination should be tested in
any given experiment) in the RNA sample that was shown
in Figure 7.3. After an oligo-dT primed cDNA synthesis, the
GAPDH transcript is quantified using both a 5’ and 3’ assay. If
the RNA is intact an equal concentration is expected using Figure 7.6A. RNA Quality Determination using 3’/5’ Assay a) RNA samples from
each assay (ratio = 1), whereas if the RNA is degraded a higher HT29 cells with RIN approximately 10 were reverse transcribed using oligo-dT and
the 3’/5’ ratio (y axis) determined for each of 13 genes (X axis). There is a general
copy number is expected for the 3’ assay relative to the 5’ assay. 3’ bias in quantification when both assays are used for the same target and the
5’ RNA is high quality. The degree of bias differs between genes, thus influencing the
3’ determination of ratios between genes, such as when normalizing to a reference
40
gene. (Data kindly provided by Prof. Stephen Bustin, UK.)
Cq=36
35
Cq=27 RIN vs Integrity
30
25
HEX
20
FAM
15
10
5
0
Intact 1’ Degradation
Figure 7.5. Demonstration of 3’/5’ Assay for Identification of Degraded RNA Samples.
Although the Agilent 2100 BioAnalyzer analysis returned a RIN of 10 for both of
these RNA samples, the 3’/5’ assay was used to demonstrate a 9 Cq (approximately
1,000-fold) loss in the 5’ assay for the sample after incubation for 1 minute on the
human hand (1’ degradation) while the 3’ remained constant.
Analysis of the RNA using the Agilent 2100 BioAnalyzer led to Figure 7.6B. RNA samples from HT29 cells with RIN approximately 7 were reverse
the conclusion that the RNA shown in Figure 7.3 was intact, transcribed using oligo-dT and the 3’/5’ ratio (y axis) determined for each of 13
recording a RIN of 10 for both the RNA after 1’ incubation on genes (X axis). There is a strong 3’ bias in quantification when both assays are used
for the same target and the RNA is high quality and a clear 3’ shift from the ratio
the naked human hand and the same purified sample prior demonstrated in Figure 7.6A. The degree of the shift differs significantly between
to degradation. When applying the 3’/5’ assay, the 3’ assay genes, indicating that different genes degrade at different rates. (Data kindly
showed the same Cq for both samples, whereas the 5’ assay provided by Prof. Stephen Bustin, UK.)
shows a loss of 9 cycles, indicating 1,000-fold loss of GAPDH 5’
and that the transcript is degraded. This observation supports
the demonstration that the status of the rRNA (a significant
Template Contamination
PCR assays are especially vulnerable to amplicon contamina-
tion with the specific target sequence of interest because the
process of PCR generates copies of the amplicon exponen-
Figure 7.6C. RNA samples from HT29 cells with RIN approximately 5 were reverse
transcribed using oligo-dT and the 3’/5’ ratio (y axis) determined for each of 13
tially. Consequently, the process of performing a PCR assay
genes (X axis). There is a wide spread of data for replicates. (Data kindly provided by produces the perfect contaminant for future PCR assays. In
Prof. Stephen Bustin, UK.) a molecular biology laboratory, it is essential to separate the
When using high quality RNA, the data for replicates are space in which the reaction is set up and run from the post-
very close, but it is clear that for many genes there is a bias PCR analysis area where the PCR product will be analyzed and
in the assay of up to 10 fold, usually towards the 3’ with a further manipulated. It is preferable, where possible, to use
more dramatic 100-fold bias seen for UBC. This may reflect separate rooms with dedicated equipment and laboratory
degradation or differential detection by the assays due to coats such that nothing from the post-PCR analysis space is
template folding or other RT-PCR influencing factor. Some ever in contact with the clean, (pre-PCR) space. Many labora-
targets appear to have a 5’ bias in detection which may be tories also introduce further controls for personnel access to
due to assay efficiency differences or other components of these areas to prevent reaction carry over. Quantitative PCR
the RT-qPCR assay. The assays were then used to quantify assays are particularly vulnerable to amplicon contamina-
the same targets using cDNA from RNA with RIN of 7.3 and tion because they are capable of detecting a single template
5.3 (Figures 7.6B and 7.6C, respectively). There were clear molecule and contaminating template will confound measure-
signs of degradation when using RNA samples of moderate ments of quantity.
degradation (RIN 7), with most genes showing a 3’ shift of In addition to PCR generation of the specific amplicon, care
between 10 and 1,000-fold indicating degradation of these is needed in the laboratory setup to ensure that original
transcripts between the 3’ and 5’ assays. Interestingly, three template material is not transferred from one sample to
genes showed a 5’ shift which may indicate that degradation another (cross-contamination) or, in the case of analysis of
has resulted in a conformation change making the RT or 5’ human samples, that material is not introduced from the
qPCR more efficient. Since the changes for each gene are personnel performing the analysis.
different it is clear that a ratio between genes measured
Adopting a standard experimental procedure with appropriate
using RIN 9 RNA would differ significantly from that measured
controls to identify potential sources of contamination is
using RIN 7 RNA. When using RNA of RIN 5 there is a higher
highly recommended.
degree of variability and the 3’/5’ ratio for each gene
averages around 1. Since an average of 3’/5’ =1 would also
be expected from high quality intact RNA, it is recognized
Contamination of RNA with gDNA
that this system is applicable for integrity determination of When analyzing RNA, it is important to ensure that there
RNA samples of moderate to apparently no degradation is no gDNA contamination. Enzymatic treatment of the
and is an improvement when used in addition to gel or samples with DNase I in solution is recommended for
capillary electrophoresis. removing contaminating gDNA and is particularly important
for investigations of intron-less genes or when the assay
The observation of 5’ bias in the assays was intriguing.
design does not distinguish between the gDNA and cDNA
In theory, for assays of identical efficiency, it should not
sequences. Wherever possible, it is advisable to design assays
be possible to generate more 5’ than 3’ amplicon. Clearly
over the intron/exon boundary such that only the processed
additional factors are affecting the differential performance
mRNA sequences can be amplified and/or detected. This
of these assays. A further sample quality consideration is the
does not always prevent amplification from gDNA, as there
presence of contaminants, which may inhibit or even enhance
are sequences that exist as processed pseudo genes which
RT or qPCR performance and whether these may be gene-
are effectively genomic cDNA sequences (see Chapter 6). It
target specific.
is also worth considering that DNA exists in the reagents and
potentially, can cause contamination issues12.
48 sigma.com
Sample Purification and Quality Assessment
(A260/A280)
B
1.5
causing the assay to fail completely. C
1 D
Using all of the information, it can be concluded that there
0.5 E
was an equal concentration of nucleic acid material in each
0
sample (NanoDrop) and the samples contained undetectable 1 2
contaminants that absorbs at 280 nm (protein) (other Figure7.8. NanoDrop Quality Assessment (A260/A280).
50 sigma.com
Sample Purification and Quality Assessment
Delta Rn vs Cycle
GAPDH 5’
Samples A, B, C
E
GAPDH 3’
Chapter 8:
Reverse Transcription
Introduction 300
n
op
n
op
er
ec
oA zer
ec
ee
rio
ee
rio
lyz
Sp
Sp
Dr
Dr
ly
global cDNA representation of many transcripts is produced
gr
gr
pe
pe
na
na
no
no
bo
bo
Ex
Ex
oA
Na
Na
Ri
Ri
(usually via a two-step protocol) or in a gene-specific approach
Bi
Bi
in which only the RNA of interest is converted to cDNA (usually Figure 8.1. The concentration of five samples of total RNA (A–E) was measured
following a one-step protocol). using Nanodrop, conventional UV spectrophotometry, Bio-Rad Experion, the Agilent
2100 BioAnalyzer (all duplicate measurements) or Ribogreen (single measurement).
Since it has been demonstrated that the two-step RT reaction As can be seen, the absolute concentration as well as the relative concentration
is not always linear with respect to input RNA and cDNA yield1, varied between the samples. This was because sample C was degraded and
samples D and E contained EDTA, which caused inaccurate measurements in the
it is important to determine and control the total amount of Experion and BioAnalyzer systems.
RNA extracted and included in RT reactions. Measuring the
concentration of RNA presents uncertainty and the absolute
value is dependent on the instrument or system used to make Reverse Transcription Linearity
the measurement. As can be seen in Figure 8.1, there is a large The relative concentration of total RNA can influence the
variability between concentration measurements of 5 samples efficiency of the RT and the concentration of cDNA produced
of RNA (A–E) (see Chapter 7) when using the Nanodrop, from a given transcript. Therefore, it is desirable to include the
conventional UV spectrophotometry, Ribogreen, the Agilent same or a very similar concentration of RNA into all two-step
2100 BioAnalyzer, or the Bio-Rad Experion. Note that the cDNA synthesis reactions, unless the RT system has been
presence of EDTA (samples D and E), which would inhibit verified to have a linear response. As can be seen in Figure 8.2,
downstream RT and PCR, and degradation (sample C) have using a conventional RT protocol, the 100-fold dilutions of
different effects on concentration measurements depending input RNA do not result in a corresponding 100-fold difference
on which system is used. This observation is illustrative of the in cDNA yield for the templates tested. Interestingly, the data
importance of performing additional quality control steps prior presented are duplicate qPCR run on duplicate RT reactions. As
to using samples in downstream reactions (see Chapter 7). shown, the lack of linearity is reproducible between the two
RT reactions.
4000
a two-step assay, a reverse gene-specific primer, oligo-dT,
random hexamers, nonamers, decamers, dodecamers or
3000 pentadecamer2 or a combination of oligo-dT and random
primers may be used. Gene-specific priming is usually
2000
run in separate reactions for each target RNA. These
1000 separate reactions may have very different efficiencies, thus
complicating comparisons between RNA concentrations. On
0
the other hand, when using gene-specific primers, all of the
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
RT product will encode the gene of interest and may allow
quantification of very low abundance mRNAs that could
Figure 8.2. Total RNA was diluted through 100-fold and reverse transcribed using not be detected using nonspecific RT primers. To avoid the
two-step random priming; two independent RT reactions were performed. β-actin
was detected in duplicate qPCRs for each RT reaction. The RT is reproducible, potentially high inter-assay variations in RT that can occur with
but cDNA yield is not proportional to input RNA concentration. Therefore, if the gene-specific primers, nonspecific primers may be used to
experimental restraints require that a variable concentration of RNA is included in generate a pool of cDNA. Separate qPCR assays for each target
the RT, it is critical to verify that the protocol and reagent combination result in a
linear response. can be performed subsequently with aliquots from the cDNA
pool. If all qPCR targets are near the 3’-end of polyadenylated
In the example shown in Figure 8.3, the Sigma ReadyScript® mRNAs, oligo-dT is a suitable primer choice. On the other
RT reagent was used to reverse transcribe total RNA from a hand, if the qPCR targets are more than a few kilobases from
2-fold and a 10-fold serial dilution of template using a two- the 3’-end or if the RNA is not polyadenylated, random primers
step protocol and a combination of oligo-dT and random will result in more reliable detection. If the relative 3’ location
priming (described below). The CANX gene was detected in of qPCR targets varies or the desired transcripts contain a
both dilution series with a direct proportionality to the input combination of polyadenylated and non-polyadenylated
RNA concentration. RNAs, a mixture of oligo-dT and random oligomers will give
the best results
2-Fold Dilution of RNA 10-Fold Dilution of RNA
Amplification Amplification
3000 3000 Reverse Transcription Priming for Two‑step RT
2500 2500 Reactions
2000 2000 Two approaches are commonly utilized for two-step RT
priming; oligo-dT and random priming. The oligo-dT method
RFU
RFU
1500 1500
1500
54 sigma.com
Reverse Transcription
To benefit from the advantages of the respective techniques,
some protocols call for a combination of both primer types.
Reverse Transcription Efficiency
A specific primer to the target sequence may also be used in It is generally assumed that all the RNA/mRNA in a RT reaction
a two-step RT protocol but is more often used in a one-step is converted to cDNA and that all transcripts are converted in
procedure (see below). a 1:1 ratio or proportionally to the starting RNA concentration.
Recent studies have been performed to investigate each of
Reverse Transcription Priming for One‑step RT these assumptions. It is clear that that the amount of RNA
that is converted into cDNA is highly variable. The two-step
Reactions RT process is variable and specifically dependent on RNA
In a one-step RT protocol, gene-specific primers are used to concentration, enzyme, buffer composition and priming
reverse transcribe a single target. The design of the gene- protocol. Since the process is variable, it is important to
specific primer is critical; it must lie within an open, accessible maintain as many constant conditions as possible1,3,5.
region of the mRNA target when predicted at the temperature For two-step RT reactions, in general it is necessary to aim
of the RT reaction. Under these conditions there is a linear for the same input RNA concentration as well as to keep the
relationship between input RNA and cDNA (Figure 8.4). This priming conditions, RT enzyme and buffer constant. When
primer may be (and usually is) common to the PCR primer. a constant input concentration cannot be determined, it is
advisable to use a one-step process, include a carrier such
1
as Polyethylene Glycol (PEG)6, or select a commercial kit that
has been validated to result in a linear response, such as
ReadyScript® RT (Sigma).
Fluorescence (dRn)
101 Priming
need to be measured and accuracy is paramount. However, 100
the contrary consideration is that the determination of the 106
gene of interest (GOI) to reference gene ratio (see Chapter 10) 105
104
requires two separate one-step RT reactions rather than a 103
single cDNA from a two-step reaction and the two targets 102 Random
101
cannot be detected using a multiplex qPCR approach. Priming
100
1 2.5 5 7.5 1 2.5 5 7.5 1 2.5 5 7.5
Min
Figure 8.5. Total RNA was incubated on a naked human hand for the times
indicated (1, 2.5, 5 and 7.5 min). cDNA was prepared using gene specific, random
or oligo-dT priming. The copy number of three genes was determined, as indicated
by the purple, turquoise and orange histograms. It is clear that the different priming
strategies influence the detection of each gene with oligo-dT priming resulting in
no detection of gene 3 (orange) which is clearly apparent in the RNA sample since
it is detected using gene specific priming (data provided by Prof. Stephen Bustin,
Anglia Ruskin University, UK).
1400
300 A) 1300 B) nonspecific
1-step qRT-PCR nonspecific 1200 1-step qRT-PCR product specific
10 U MMLV RT product 1100 20 U MMLV RT product
37 °C, 30 min 1000 45 °C, 30 min
Fluorescence, -R’(T)
900
Fluorescence, -R’(T)
200 800
700
600
500
specific 400
100 product 300
200
100
0
-100
0 -200
-300
56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C) Temperature (°C)
12000
D)
C) specific specific
300 11000 2-step qRT-PCR
1-step qRT-PCR product product
10000 200 U MMLV RT
2 U MMLV RT
37 °C, 50 min
45 °C, 30 min 9000
Fluorescence, -R’(T)
Fluorescence, -R’(T)
8000
200
7000
6000
5000
100
4000
nonspecific product 3000
2000
nonspecific product
0 1000
56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C) Temperature (°C)
Figure 8.6. Optimization of RT. (A–C) Melt curves of RT-qPCR products produced with one-step or (D) two-step RT-qPCR. Reactions A–C each contained 10 µL of Sigma’s
SYBR® Green JumpStart™ Taq ReadyMix™, 0.02 µL of Reference Dye, both gene-specific primers at 0.4 µM, and 10 ng human total RNA in a final volume of 20 µL. Gene-
specific primers were 5’-CGGGCTTCAACGCAGACTA-3´and 5´-CTGGTCGAGATGGCAGTGA-3´ for c-fos (Accession NM_005252). Reactions A and B also contained 20 units
of MMLV- RT, whereas reaction C contained 2 units. Reaction A was incubated at 37 °C for 30 min before qPCR, whereas B and C were incubated at 45 °C for 30 min before
qPCR. In D, the RT reaction contained 1x MMLV buffer (Sigma product code D8559), 0.5 mM dNTPs, 1 µM Oligo-dT, 0.8 units/µL RNase inhibitor, 200 units MMLV-RT, and 10
ng human total RNA in a final volume of 20 µL. The reaction was incubated at 25 °C for 10 min, 37 °C for 50 min, and 80 °C for 10 min. 2 µL of the RT reaction product were
added to qPCR containing 10 µL of Sigma’s SYBR® Green JumpStart™ Taq ReadyMix™ 0.02 µL of Reference Dye, and both gene-specific primers at 0.4 µM as for the one-step
reactions (A–C). All qPCR reactions were incubated at 94 °C for 3 min to denature, then for 40 cycles of 94 °C for 15 sec and 60 °C for 1 min.
56 sigma.com
Reverse Transcription
The amount of RT enzyme per reaction can also affect RT-qPCR References
results. As shown in Figure 8.6, one-step reactions with 2 units 1. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
of MMLV-RT (Figure 8.6C) were more specific than reactions RT-PCR. Nat Protoc 2006; 1: 1559-1582
with 20 units (Figure 8.6B). Two-step RT-PCR using oligo-dT 2. Stangegaard, M., Dufva, I.H., Dufva, M. Reverse transcription using random
pentadecamer primers increases yield and quality of resulting cDNA.
or random primers for RT, resulted in greater specificity than Biotechniques 2006; 40: 649-657
one-step RT-PCR (Figure 8.6D). This could be attributed to 3. Stahlberg, A., Hakansson, J., Xian, X., et al. Properties of the reverse
the fact that the gene-specific primers are not present during transcription reaction in mRNA quantification. Clin Chem 2004; 50:
the low temperature RT reaction, thus preventing formation 509-515
of nonspecific products. Higher concentrations of RT may 4. Stahlberg, A., Kubista, M., Pfaffl, M. Comparison of reverse transcriptases in
give better results in two-step reactions, but because the RT gene expression analysis. Clin Chem 2004; 50: 1678-1680
enzyme can interfere with Taq DNA polymerase activity7, the 5. Tichopad, A., Kitchen, R., Riedmaier, I., et al. Design and optimization of
reverse-transcription quantitative PCR experiments. Clin Chem 2009; 55:
amount of RT product transferred to qPCR should be limited to 1816-1823
no more than 10% of the final reaction volume. The exception 6. Kubista, M., Andrade, J.M., Bengtsson, M., et al. The real-time polymerase
to this recommendation would be when using ReadyScript, chain reaction. Mol Aspects Med 2006; 27: 95-125
in which 25% of the PCR volume can be RT reaction without 7. Chandler, D.P., Wagnon, C.A., Bolton, H., Jr. Reverse transcriptase (RT)
affecting the PCR efficiency. inhibition of PCR at low concentrations of template and its implications
for quantitative RT-PCR. Appl Environ Microbiol 1998; 64: 669-677
This description of the variables that are inherent in the 8. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
RT process demonstrates that the determination of gene information for publication of quantitative real-time PCR experiments.
expression from RT is dependent on the RT method used, Clin Chem 2009; 55: 611-622
the quantity and quality of the samples, in addition to the
consideration of template quantity and should be carefully
reported, as described in the MIQE guidelines8 (see Chapter 3).
Bioconvenient.
Available through Sigma’s state-of-the-art gene
search tool, KiCqStart Primers are perfect for
two-step and one-step SYBR® Green I RT-qPCR.
Together with our ReadyScript™ cDNA Synthesis
Mix and KiCqStart SYBR Green qPCR ReadyMix™
for two-step reactions, Sigma ensures the success
of every SYBR qPCR assay—every time.
Chapter 9:
Assay Optimization and Validation
Assay optimization and validation are essential, even when • Optimizing Reaction Components and Multiplex
Conditions
using assays that have been predesigned and commercially
obtained. Optimization is required to ensure that the assay is • Validating Performance with a Standard Curve and Melt
as sensitive as is required and that it is specific to the target Curve Analysis
of interest. For example, pathogen detection or expression
profiling of rare mRNAs require high sensitivity; SNP detection
requires high specificity and viral quantification needs
Validating Primer Design
both high specificity and sensitivity. Assays requiring high Validation of primer design is particularly important when
specificity are particularly vulnerable when performed without adopting primers from a previous publication or using a
optimization and adequate controls. Similarly, when multiple commercially supplied assay. The primer design can be
targets are to be detected simultaneously in multiplex reviewed with respect to the assay design guidance provided
reactions, assay conditions must be optimized to detect all in Chapter 6. It is critical to ensure that:
targets equally. Validation provides the data required to justify • Primers are homologous to the desired target sequence.
the continued use of the assay in further research projects1.
• The reverse complement primer is correct. Carefully
There are a number of factors that can be altered to obtain check reverse complement base orders (using
optimum assay performance and thereby lead to higher http://www.bioinformatics.org/sms/rev_comp.html).
molecular sensitivity, specificity and precision. Assays • Appropriate splice variants are detected.
purchased from skilled commercial providers still require
validation within the laboratory in which they are being used. • SNPs have been avoided unless required for the assay.
Claims relating to the performance of assays should be verified • The oligos and amplicon do not adopt a secondary
under the conditions of the study, including test samples, structure.
specific reagents and the instrument of choice. • There is low potential for the oligos of the reaction to
An assay that has been designed such that all desirable hybridize to each other.
design criteria were met (see Chapter 6, Assay Design) is The ability of primers to hybridize to one another, especially
likely to perform well under a wide range of conditions. at the 3’-end, may lead to primer extension during PCR and
However, all assays have a set of optimal conditions and the formation of target-independent products, known as
these are dependent on the instrument, selected reagents primer dimers. Whenever primer dimer products are produced
(buffer conditions), primer concentration and/or annealing and amplified, they divert reaction components away from
temperature (Ta), magnesium concentration and even ramp synthesis of the desired product, thereby reducing assay
rate. Since it is usual to run the assay on a selected instrument efficiency and sensitivity. Therefore, primer dimers are an
and under standard buffer conditions, most optimization issue in reactions using both probe-based and SYBR Green I
procedures are focussed on modification of primer binding dye-based detection. With dye-based detection such as SYBR
kinetics using primer concentration or annealing temperature Green I, primer dimers also affect assay specificity because the
(Ta)/melting temperature (Tm). nonspecific DNA-binding dye will bind to the primers and be
Regardless of whether the target is DNA (qPCR) or RNA detected along with the desired product. Therefore, primers
(RT-qPCR), the following preliminary steps will help ensure that are likely to form primer dimers should be avoided.
successful quantification: To determine the potential for primer-dimer formation,
use primer design software to analyze duplex formation.
• Validating Primer Design
OligoArchitect (sigma.com/probedesignonline) provides
• Optimizing Primer Concentrations details of the strength of self-dimer and cross dimer
• Optimizing Primer Annealing Temperature hybridization (Figure 9.1). Any 3’-terminal dimers formed by
a. 8 µM 4 µM 2 µM 1 µM 0.5 µM
fwd fwd fwd fwd fwd
rev A
4 µM B
Figure 9.1. Analysis of primers for primer-dimer potential. Primer sequences were rev
analyzed with OligoArchitect design software to determine their ability to form 2 µM C
rev
duplexes. A self dimer and cross dimer potential is shown for the best primer
option. 1 µM D
rev
Multiplex qPCR will give the best results if all primers in the 0.5 µM
rev
E
Temperature (Ta) Figure 9.2. Primer optimization example. Layout of 8-tube strips (top and left side)
and PCR plate for diluting and dispensing primers.
When optimizing assay conditions using primer concentration,
a fixed Ta (usually 60 °C) is selected and the optimal conditions The combination of concentrations yielding the lowest Cq,
for each primer are addressed independently. This is critical lowest variation in replicates and a negative NTC is chosen
when designing an assay to be run in multiplex, since all (see Figure 9.3)2.
reactions must run at the same annealing temperature, and
is a tactic that can also be used to rescue poorly performing
assays for which an alternative design is unavailable. A
technically simpler approach is to select a fixed primer
concentration and then optimize the Ta selecting the best
result for those primers in combination. This is the preferred
approach when using several assays and dsDNA-binding dye
detection, such as SYBR® Green I. However, this approach does
require an instrument that can simultaneously run reaction
programs utilizing different Ta options.
60 sigma.com
Assay Optimization and Validation
A) All Primer Concentrations 50 nM to 600 nM – Same Target Concentration the sensitivity is unacceptable in multiplex reactions. Decrease
3000
primer concentrations for those primer pairs that result in low
2800
2600
Cq values and/or increase concentrations for those that yield
2400 high Cq values, within the range of 50–500 nM.
2200
2000
Optimizing Primer Annealing Temperature
Fluorescence (norm)
1800
1000
with 35–40 cycles. Two-step reactions cycle between two
800 temperatures, usually 95 °C (typically for 10–15 sec) and 60
600 °C (typically for 30–60 sec or 5–10 sec under fast conditions).
400
Two-step temperature reactions are selected when running
200
0
Dual-Labeled Probe (TaqMan or hydrolysis) assays because
ΔCq = 22 the lower temperature elongation promotes exonuclease
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
60
method is that it reduces the potential options for primer
55
design and limits assay optimization to primer concentration
50 alone because no annealing temperature (Ta) optimization
Fluorescence
45 is possible.
40
35
100/50 A three-step cycling protocol is preferable when the target
30
50/50
sequences are complex and either the chosen primers are
25 50/400
difficult to optimize or the detection system in use is not
20 200/400
15
dependent on the use of a hydrolysis probe. Three-step
10 Δ Cq = 9 50/100
strategies cycle between: 95 °C (typically for 10 sec), an
400/400
5 annealing temperature (between 55 °C and 65 °C, typically for
5 10 15 20
Cycle
25 30 35 40
10–20 sec or 5 sec under fast conditions) and 72 °C (typically
for 20–30 sec or 15–20 sec under fast conditions). In this case,
Figure 9.3. Results from a PCR primers concentration optimization from a SYBR
Green I dye assay. A) Established guidelines recommend that a variety of forward (F)
the Ta may be optimized to further improve assay performance
and reverse (R) primer concentrations are tested. In this example 50 nM to 600 nM using the following protocol:
was tested in combination to determine the optimal concentration for the assay.
In this experiment, there is an enormous difference in Cq due to different primer • Start at the low end of the Ta range to be tested, which
concentrations, illustrating how this can impact the final data (data from Jens is determined by the Ta of the primers, and increase the
Stolte, EMBL). B) This experiment shows optimization of a well-designed assay and temperature stepwise in gradual increments (usually
variability due to primer concentration. The 400 nM forward and reverse primer
combination was chosen as optimal because this combination represented the testing between 55 °C and 65 °C). Some instruments have
lowest primer concentrations that reproducibly yielded the earliest Cq values while gradient blocks that facilitate temperature optimization in
retaining a sigmoidal curve. a single run.
If one target in a multiplex reaction is significantly more • Test each reaction product for specificity, either by post-
abundant than the other(s) or if one primer pair yields a much PCR melt curve analysis or agarose gel electrophoresis, as
lower Cq than the other(s), amplification of that target may described below.
dominate the reaction, using up reaction components before
other targets are detectable. Adjusting the concentrations
• The optimal annealing temperature is the one that results
in the lowest Cq, a negative NTC, a melt curve analysis
of primers may allow for a more balanced amplification of all revealing detection of a specific product and high
targets. To determine if such adjustments will be beneficial, reproducibility between replicate reactions.
prepare standard curves (see Assay Evaluation) that cover
the range of targets expected for each primer pair alone If the annealing temperature is too low, the reaction will be
(singleplex) and with all primers combined (multiplex). If nonspecific. However, if the temperature is too high, the
multiplex and singleplex reactions give similar results, the stringency may affect reaction efficiency, resulting in a lack
primer concentrations are suitable. On the other hand, of amplification or very high Cq values, very poor yields and
optimizing primer concentrations is likely to improve results if low reproducibility.
from the two primer pairs (61.7 °C in LuminoCt and 58.4 °C in Although most commercial assays are supplied with standard
KiCqStart, both Sigma reagents). PCR assay conditions, individual assays may benefit from
A) TBP gene Ta gradient (LuminoCt Reagents Fast Cycling) further optimization to identify conditions that are specific
7500
Ta for the particular primer combination. This may be due to
primer dimers, nonspecific amplification, or sub-optimal
7000
6500
6000
61.7
reaction efficiency under the default conditions selected.
Upon completion of optimization, assay efficiency should
5500 64.8
5000
Fluorescence (norm)
58.4
4500 be calculated by applying the chosen conditions to the
4000
62 sigma.com
Assay Optimization and Validation
Optimizing Probe Concentration increases the rate of DNA hybridization, enabling efficient
hybridization during the rapid cycling conditions used by
A final concentration of 250 nM probe may be used for most many instruments. Optimization of MgCl2 concentrations
assays. However, if maximum sensitivity is not required, becomes more important when running multiplex reactions.
lower concentrations of probe may suffice, thereby reducing
the assay cost. To optimize the probe conditions, test it at Salts, such as KCl or (NH4)2SO4, will also change DNA duplex Tm,
several concentrations, ranging from 50 to 500 nM final, in but the effect is less drastic for these monovalent cations.
combination with the optimized concentrations of primers Graphed Samples 0.5
Fluorescence
0
lowest concentration of probe that allows the most sensitive
detection (Cq ≤ 30 with best reproducibility) may be used. –0.25
–0.5
Multiplex Assays
Melting Curve Graph
Cycle
Fluorescence
reaction conditions. For these assays further modification
of reaction buffers by optimization of MgCl2 concentration,
addition of PCR enhancers (Mueller in PCR Technologies;
Current Innovations, 20135) or adjustment of instrument 70 75 80 85
ramp rates can result in improved performance. In addition Temperature
to the assay optimization guidelines provided in the previous Figure 9.5. Effects of magnesium concentration.
sections, these factors are particularly important when
The effects, shown in Figure 9.5, are magnified when
optimizing multiplex reactions.
performing multiplex PCR. Running multiple reactions
concurrently introduces competition for reagents and
Optimizing Mg2+ Concentration exacerbates any sub-optimal conditions, creating major
changes in PCR efficiency.
Magnesium plays several roles in PCR. It is a required
divalent cationic counter-ion for dNTPs and a co-factor for
all polymerases. Divalent cations strongly affect DNA double Ramp Rates
strand hybridization. Increasing magnesium concentration There are rare occasions when a difficult reaction requires
raises the stability, or melting temperature, of a DNA duplex. further modification. When all other options have been
It follows that high magnesium levels increase the affinity exhausted, it may be possible to recover a lost situation by
of primers toward hybridization, including mis-priming empirical testing and modification of the PCR ramp rate.
events and primer-primer interactions. The mis-primed DNA
duplexes become substrates for the DNA polymerase, in
effect creating side products and sapping PCR efficiency. Probe Fluorophore and Quencher Selection
Therefore, the concentration of MgCl2 has an impact on both When running multiplex assays, it is also important to
the specificity and yield of PCR because magnesium affects maximize the spectral separation of the multiple emissions
the hybridization of the primer to the target, the processivity from different fluorophores to facilitate signal isolation and
of Taq DNA polymerase, as well as the rate of hydrolysis by the data analysis. Therefore, fluorophores with narrow, well-
exonuclease moiety when used for probe cleavage in qPCR. resolved bandwidths that are widely separated are useful
Hence, insufficient MgCl2 results in poor yields due to low for multiplex applications. However, in reality the choice
polymerization rate of DNA polymerase, compromised primer of fluorophore is restricted by the optical system of the
binding and inefficient probe cleavage. If the concentration instrument. Chapter 5 contains further information pertaining
of MgCl2 is too high, the specificity of the reaction will be to selection of fluorophores and quenchers.
compromised because this will lead to greater stability of
nonspecific primer hybridization.
In contrast to conventional PCR assays which use 1.5–2 mM
standard MgCl2 concentrations, hydrolysis probe qPCR assays
require higher concentrations of around 3–5 mM to achieve
efficient cleavage of the probe. The presence of MgCl2 also
Guidelines for Optimization of Quantitative both RNA and RT enzyme (Figure 9.6). DNA amplification
is regarded as acceptable in qPCR if the Cq values for no-RT
Reverse Transcription PCR (RT-qPCR) reactions are at least 5 cycles greater than those for reactions
with RT6. However, if there are fewer than 5 cycles between Cq
When performing RT-qPCR, it is not only important to consider
values for reactions with and without RT, DNA amplification
the guidelines for standard qPCR as discussed previously and
may contribute to mRNA quantification.
optimize the RT as discussed in Chapter 8, but also to address
the following points that are specific to the RT step: A B
MW + – + – +/– RT
• Verify RNA Quality (see Chapter 7).
• Confirm that Primers Span or Flank Long Introns (see 2,000
Chapter 6). 1,500
64 sigma.com
Assay Optimization and Validation
5 the number and approximate size of the products. An assay
with high specificity will result in a single melt peak at a
4 high temperature in reactions containing only target with
nothing, or very little, detected in the no-template controls
(Figure 9.8A). If the melt curve has more than one major peak,
Fluorescence (dRn)
3
as in Figures 9.8B and 9.8C, the identities of the products can
be further investigated by resolving them on an ethidium
2
bromide-stained agarose gel. As shown in Figures 9.8D
and 9.8E, reactions B and C contain excessive amounts of
1 primer-dimer or other nonspecific products. Lowering the
primer concentrations will often reduce the amount of
nonspecific products. If nonspecific products are still detected
0
in significant amounts with low primer levels, it is best to
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles redesign the primers.
Figure 9.7. Comparison of on-column DNase digestion (OC) with post-preparation A) B) C)
DNase digestion. Total RNA was prepared from 30 mg pieces of mouse liver with
either the Sigma GenElute™ Total RNA Kit or a column purification procedure
from an alternative supplier, both according to the manufacturers’ instructions.
Two RNA samples were prepared with the respective manufacturer’s on-column
DNase product and two were prepared without DNase digestion. After purifica-
tion, aliquots of the four RNA samples prepared without on-column DNase were
digested with Sigma’s Amplification Grade DNase I according to the manufacturer’s
instructions. Equal proportions of all were used in one-step RT-qPCR. Fluorescence
plots for two of the RNA samples are shown. Similar results were obtained with both D) E) F)
manufacturers’ products and only the procedure requiring the post purification
DNAse treatment removed all gDNA.
Assay Evaluation
Once the assay has been optimized so that the most sensitive
conditions have been identified, it is important to determine
Figure 9.8. Evaluation of melt curves. Melt, or dissociation, curves showing a sharp
the assay specificity, efficiency and technical dynamic range. peak of specific product at >80 °C with very little nonspecific product at lower
temperatures (A) or significant amounts of nonspecific, lower melting product
Determine Specificity Using Melt Curve Analysis (B and C). D to F show PCR products from as shown on the melt curves A to C,
respectively, resolved on ethidium bromide-stained 2% agarose gels.
Specificity can be determined by the use of a melt curve
analysis. Performing a melt curve requires incorporation of a An example of a melt curve analysis revealing gDNA and
reporter dye such as SYBR Green I dye or the use of a non- NTC primer-dimer contamination of RNA is shown in
hydrolyzing probe such as a Molecular Beacon or Scorpions® Figure 9.9. In Figure 9.9A, a specific product is evident from
Probe (see Chapter 5). After the amplicon is produced during the test reactions and a smaller product, melting at lower
qPCR, it is subjected to incubation at increasing temperatures, temperature, is present in the NTC. This is indicative of the
usually between 55 °C to 95 °C. However, the user should verify formation of primer-dimers in the absence of template. This
that the theoretical melt point of their amplicon falls within is commonplace and is only a concern when these primer-
this range since this will be dependent upon the size and dimer products are evident in the test samples as shown in
GC content. The experimental Tm will vary slightly between Figure 9.8. The example in Figure 9.9B shows detection of the
different runs and reagents, primarily due to variations in unprocessed gDNA gene in a DNA sample using the same
MgCl2 and other ion concentrations. assay (in this case, primers were located in exons spanning
the intron) that had also been used for mRNA detection. The
The change in fluorescence is determined and plotted as products are distinguished by their melt profile with the gDNA
rate of change of fluorescence vs. temperature. Since SYBR product melting at a higher temperature because this also
Green I is a nonspecific dye that binds to any double-stranded contains the intron.
DNA, it is important to verify that the qPCR produces only
the desired product when using this detection chemistry.
Melt, or dissociation, curve analysis can be used to determine
Fluorescence (dR)
Figure 9.9. Example of a melt curve analysis A) primer dimers in no template control
and B) the amplification across the intron of gDNA. Theoretical Sensitivity
a single reaction against a template that is known to Figure 9.10. An example of high reproducibility and wide range of detection using
contain the specific matched sequence and against the a serial dilution of linearized plasmid. Eight replicates were run for each dilution
mismatched sequence. and amplification of the target detected using SYBR Green I dye. Quantification is
possible between 3×1010 and 3 copies.
Determination of Efficiency and Limit of Detection Assay efficiency is determined by measurement of the
The most effective means to measure assay performance is gradient of a standard curve that is a plot of the log of the
via the construction of a standard curve from a serial dilution target concentration against the Cq (Figure 9.10). An assay
of template. Assay efficiency can be measured as a factor with an efficiency of 100% would demonstrate doubling at
of the standard curve gradient. A wide range of sample each cycle (E=2) and a gradient of –3.323.
concentrations is run, ensuring that these reach a limiting Efficiency can be calculated according to the equation:
dilution, thus allowing determination of the technical assay
Efficiency = 10(–1/slope) –1. Note: the software for many
dynamic range from the same experiment.
instruments provides an efficiency measure as a percentage.
Any suitable template material is appropriate for these This value is the percentage of E=2; therefore, an efficiency
technical determinations of assay performance. Selection of a of 95% equates to E=1.9
standard, transferable reference material allows for inter- and
The slope = m and is determined from the standard curve of
intra-laboratory validation. Therefore, this stage of validation
equation y=mx+C.
can be carried out on linearized or nicked plasmid (supercoiled
DNA does not amplify efficiently and results in low C is the theoretical intercept on the y-axis and provides a
reproducibility), cloned fragment or synthetic oligo. However, relative measure of the sensitivity of the assay.
it must be recognized that validation on these targets is a Slopes between –3.1 and –3.6 result in efficiencies between
measure of the assay function and does not accommodate 90% and 110% and are typically accepted, but it is important
variability introduced by the complexity of a biological sample. to strive for as close to 100% as the assay will permit. The data
presented in Figure 9.11 are illustrative of the normal range
of variation in efficiency and sensitivity of a series of different
assays. This serves to demonstrate how important it is to report
these data in publications1,6-8.
66 sigma.com
Assay Optimization and Validation
45.00
The value of R2, or how well the data fit on the standard curve
straight line, is a measure of reproducibility and is influenced
40.00
by pipetting accuracy and by the dynamic range of the assay.
35.00
Therefore, when assessing assays, it is critical to use a minimum
30.00 of three technical replicates for each dilution. If R2 is ≤0.985,
25.00 the assay may not give reliable results because reproducibility
Cq
CDC single
Cq
y = -2.3993x + 31829
R2 = 0.9648
cmyc duplex
y = -3.4387x + 30.482
R2 = 0.9863
cmyc single
y = -3.2114x + 29.872
R 2 = 0.9939
Log ng DNA
Figure 9.12. Singleplex Reaction vs Duplex Reaction.
References
1. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments.
Clin Chem 2009; 55: 611-622
2. Nolan, T., Hands, R.E., Ogunkolade, W., et al. SPUD: a quantitative PCR
assay for the detection of inhibitors in nucleic acid preparations. Anal
Biochem 2006; 351: 308-310
3. Ramakers, C., Ruijter, J.M., Deprez, R.H., et al. Assumption-free analysis of
quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett
2003; 339: 62-66
4. Ruijter, J.M., Ramakers, C., Hoogaars, W.M., et al. Amplification efficiency:
linking baseline and bias in the analysis of quantitative PCR data. Nucleic
Acids Res 2009; 37: e45
5. PCR Technologies: Current Innovations. 3 ed. Editors Nolan and Bustin,
CRC Press; 2013
6. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
RT-PCR. Nat Protoc 2006; 1: 1559-1582
7. Bustin, S.A. Why the need for qPCR publication guidelines?--The case for
MIQE. Methods 2010; 50: 217-226
8. Huggett, J. and Bustin, S.A. Standardisation and reporting for nucleic acid
quantification. Accredit Qual Assur 2011; 399-405
9. Ruijter, J.M., Pfaffl, M.W., Zhao, S., et al. Evaluation of qPCR curve analysis
methods for reliable biomarker discovery: bias, resolution, precision, and
implications. Methods 2013; 59: 32-46
68 sigma.com
Data Analysis
Chapter 10:
Data Analysis
Fluorescence
applications, a qPCR will be run with the end-point data used Detection limit
for analysis, such as for SNP genotyping. In each case, end- Baseline
B)
Amplification Plots
Figure 10.2A–B. A) Typical example of data dropping below the zero normalized fluorescence reading when the baseline setting is incorrect (blue amplification plot).
B) Raw data of the same amplification plots showing the limit of the linear baseline and that the data are not at fault.
C)
D)
Amplification Plots
Figure 10.2C–D. C) The limits of the start and end of the baseline are defined using the appropriate software settings. D) Application of the corrected baseline setting results
in good quality data.
70 sigma.com
Data Analysis
log-linear phase of the amplification may be disturbed by the The process of threshold setting is demonstrated in
background fluorescence baseline drifting, the plateau phase, Figure 10.3. In Figure 10.3A, the amplification plots are viewed
or differences in assay efficiency and therefore amplification on a Y axis log scale, thus providing a visual expansion of
plot gradient at higher cycles. It is recommended that the the log phase of amplification and presenting this as a linear
threshold is set as follows: portion of the amplification plot. The threshold is set at the
highest fluorescence intensity (refer to Y axis) that is within
• Sufficiently above the background fluorescence baseline to
this log phase and where all amplification plots are parallel.
be confident of avoiding the amplification plot crossing the
The scale is then returned to the linear view (Figure 10.3B)
threshold prematurely due to background fluorescence .
showing the highest setting that fulfils the threshold setting
• In the log phase of the amplification plot where it is requirements. Alternatively the threshold may be set at the
unaffected by the plateau phase (this is most easily lower end of this log phase (Figures 10.3C and 10.3D). As long
seen by viewing the amplification plots on a log view, as the log phase of the amplification plots are parallel, the ΔCq
Figure 10.3A). between samples is unaffected by the threshold setting.
• At a position where the log phases of all amplification plots
are parallel.
30000
10000
Fluorescence (dR)
Fluorescence (dR)
20000
1000
10000
100
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles
30000
10000
Fluorescence (dR)
Fluorescence (dR)
20000
1000
10000
100
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles
Figure 10.3 The threshold setting influences the absolute Cq recorded and can influence ΔCq between samples. A). Using a log vs linear plot of the data, the threshold is set
at the highest fluorescence intensity but where the amplification plots show parallel log phases. B). The threshold setting is maintained from A) and is displayed on the linear
vs linear plot. C). Using a log vs linear plot of the data, the threshold is set at the lowest fluorescence intensity but where the amplification plots show parallel log phases.
D). The threshold setting is maintained from C) and is displayed on the linear vs linear plot. In each case, the ΔCq values between samples are the same.
(Figure 10.4). The ΔCq values and therefore the estimate 37.38 6.71 35.17 6.4 39.31 6.98
35.03 4.36 32.99 4.22 36.88 4.55
30000
10000
Fluorescence (dR)
Fluorescence (dR)
20000
1000
10000
100
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles
10000
Fluorescence (dR)
Fluorescence (dR)
20000
1000
10000
100
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles
Figure 10.4 The analysis that was performed and demonstrated in Figure 10.3 was repeated using a different data set. In this case, the amplification plots are not parallel
due to a difference in efficiency of the reaction at high Cq. The lowest settings for A) and B) result in different ΔCq values than the highest settings for C) and D) (Summarized
in Table 10.1).
72 sigma.com
Data Analysis
1.0
0.8
0.6
0.4
0.2
3×1010 target
copies
0.0
3 target
copies
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
Figure 10.5. Construction of a Standard Curve. The Cq recorded for each sample of a dilution series is plotted on a log linear scale against the relative concentration.
74 sigma.com
Data Analysis
concentration on the RT reaction and the effect of the sample measured by qPCR by comparing the copies of HER-2 with
quality on data after normalization. Normalization will not another genomic target that is acting as a control.
counter the effect of low quality assays or samples (see
When measuring gene expression, reference genes are targets
Chapter 9).
with mRNA concentrations that do not change as a result of
the experiment. An example study would be one in which the
Normalization Approaches effect on the expression of gene X is being measured after
Ideally, normalization methods counteract variability that may addition of a mitogenic compound to a cell monolayer. A
be introduced during the multi-step process that is required reference point is required in order to measure the change in
to perform a qPCR analysis (Figure 10.6). However, applying gene X. Therefore, another gene (or genes) that are known not
normalization at any one stage in the process may not control to be affected by the mitogen in question is also measured.
for technical error and/or bias that was, or will be, introduced This provides the researcher with the immediate challenge of
at an earlier or later stage, respectively. Normalization methods finding a mRNA target that is not affected by the experimental
are not mutually exclusive and so adopting a combination of procedure, before being able to study the GOI. This process of
controls is recommended11. validation of reference genes is fundamental for an accurate
measurement of the GOI. The most widely used approach to
Factors Process
normalization is to ignore this process and normalize the gene
Sample
Sampling expression data to a single, unvalidated reference gene. This
Storage practice is not recommended and is in direct opposition to
Quality the MIQE guidelines1. The quantification of mRNA by RT-qPCR
Extraction
has routinely been compromised by the incorrect choice of
Normalization
Analysis of Reference Gene Stability Table 10.3. Example Reference Gene Panel for Validation of Reference
Genes. For accurate performance it is important to avoid reference gene
The reference gene is literally the pivot point for qPCR relative candidates that are co-regulated.
quantification assays. It is therefore critical for the reliability
Reference Gene Accession No.
of the entire assay that the reference gene is stable. If the
1 18S NR_03286
reference gene expression varies between samples, the 2 ACTB NM_001101
variation will be directly transferred to the quantification 3 ATP5B NM_001686
results and the added variability may obscure the desired 4 B2M NM_004048
observable biological effect or, even worse, may create an 5 CANX NM_001024649
entirely artificial appearance of a biological effect, one that 6 EIF4A2 NM_001967
is unrelated to the actual gene of interest. For these reasons, 7 CAPDHa NM_002046
it is strongly recommended that several safety measures are 8 GAPDHb NM_002046
followed to render reference gene variability insignificant and 9 GUSB NM_000181
make measures of biological effects as significant as possible. 10 PPIA NM_021130
11 SDHA NM_004168
Arguably, the most important safety measure is to use not 12 TBP NM_003194
only one, but two or more, reference genes. The expression of 13 TUBB NM_178012
several reference genes can be averaged to reduce technical 14 UBC NM_021009
variability due to normalization. This can be useful to improve 15 YWHAZ NM_003406
significance in measurements of small biological effects.
However, more importantly, two or more reference genes The list of reference gene candidates shown in Table 10.3 was
provide mutual controls for maintained stability and control specifically chosen to select genes that belong to different
for unexpected occurrences that may influence the expression functional classes, reducing the chance that the genes may
levels of one of the reference genes. With a single reference be co-regulated. A notable exception is GAPDH, which is
gene, there is a risk that unexpected influences of gene present here in two versions. Although this does not affect this
expression may be undetected in the assay. analysis, it is best practice is to avoid multiple entries of genes
that may be suspected of being co-regulated.
Another safety measure is to use more than one method of
identifying stable reference genes. The following is an example The first algorithm to be demonstrated is geNorm. This
to illustrate several aspects of reference gene normalization, provides an evaluation of gene stabilities by calculating a
including a possible advantage of using both geNorm and gene stability measure called the M-value, which is based
NormFinder methods on the same data set. on pairwise comparisons between the analyzed reference
gene candidate and all other reference gene candidates in
Table 10.3 holds a list of reference gene candidates that were
the data set. It is performed in an iterative fashion, meaning
evaluated during a workshop that Sigma previously conducted
that in this example, the procedure is first performed on all
with EMBL. Samples were collected from a human cell culture
15 reference gene candidates, the least stable is removed,
in two different treatment groups. This data set will be used to
the process is repeated on the remaining 14, the second least
demonstrate aspects of reference gene validation.
stable candidate is removed, and so on until two reference
Both the NormFinder and geNorm algorithms have been genes remain.
developed with the assumption that testing a multitude of
There may be times when identification of the most stable
reference gene candidates can be used to rank the stability
reference gene may be particularly challenging. One case
of individual reference gene candidates. The assumption may
may be when all reference gene candidates perform poorly.
be true if, for example, all reference gene candidates vary
Another case may be if all reference gene candidates perform
stochastically around stable expression levels. However, this
well. To distinguish between these two cases, a useful
may not necessarily be true in reality. To avoid misleading
guideline is that reference genes with an M-value below 0.5
results, it is therefore prudent to avoid regulated and in
may be considered stably expressed.
particular co-regulated reference gene candidates.
The second algorithm to be demonstrated is NormFinder,
which is a freely available reference gene analysis package (see
Appendix B, Additional Resources). The underlying algorithm
takes a ANOVA-like approach to reference gene stability
evaluation in that the whole and subgroups are analyzed for
variations. One advantage of this is that the obtained measures
are directly related to gene expression levels. A standard
76 sigma.com
Data Analysis
deviation of 0.20 in Cq units therefore represents about 15% The bar diagrams shown in Figure 10.7 illustrate reference
variation in copy number expression levels of the particular genes ranked according to their respective stability measures
reference gene candidate. using both algorithms. In addition, a graph showing the
accumulated standard deviation from NormFinder indicates
For convenience, in this demonstration, both of these analysis
that a combination of up to the three best reference genes
packages are accessed using GenEx (MultiD) data analysis
may yield stability improvements.
software, but they are also available as independent packages
(see Appendix B, Additional Resources).
geNorm NormFinder
Genes Genes
Figure 10.7. Bar diagrams showing stability measures: M-values for geNorm and standard deviations for NormFinder. In addition, a graph showing the accumulated standard
deviation from NormFinder indicates that a combination of up to the three best reference genes may yield stability improvements. The data set was generated from assays
designed for the reference gene candidates shown in Table 10.3 and measured on a human cell culture in two different treatment groups. Notice that, in this instance, the
reference gene stability algorithms geNorm and NormFinder do not agree about the best reference genes.
Figure 10.8. Mean centered expression profile of the reference gene candidates of the two samples in each treatment group. Samples 1 and 2 belong to the first treatment
group and samples 3 and 4 belong to the second treatment group. Expression profiles of SDHA and CANX are indicated in red. Expression profile of UBC is indicated in
yellow. The table lists the measured Cq values in the data set.
78 sigma.com
Data Analysis
Normalization to RNA Concentration Biological and Technical Replicates
As a minimum, an estimation of template concentration The purpose of normalization is to avoid systematic errors and
(DNA for qPCR or RNA for RT-qPCR) is important and, as to reduce data variability for the eventual statistical analysis.
mentioned in Chapter 7, it is critical to ensure that the Another important aspect of setting up data for statistical
same instrument is used for all measurements because the analysis is the use of data replicates.
determination of nucleic acid concentration is also variable
Biological replicates are absolutely necessary for statistical
and technique dependent.
analysis. Statistical significance levels are often set at a 5%
When measuring total RNA concentration, the vast majority significance cut-off. For biological effects close to such a
of the sample is composed of rRNA, with only a small fraction significance level, it may be necessary to have at least 20
consisting of the mRNA of interest when examining gene biological replicates to determine the assays significance level
expression, or the sncRNA when examining gene expression (1:20 corresponding to 5%). In fact, it has been suggested that
regulation. This means that if the rRNA concentration increases at least 50 times the number of observations are required
a small amount but the mRNA remains constant, the total RNA to be recorded for an accurate estimate of significance25,
concentration will increase. The mRNA concentration must i.e., on the order of a thousand biological samples. Naturally,
increase a significant amount to cause an apparent increase practical limitations seldom allow for biological replicates at
in the total RNA concentration. Hence, rRNA concentration these levels. Furthermore, accurate estimates of the number
is an unreliable measure of the mRNA concentration, but for of necessary biological replicates to meet a given significance
many protocols, equal RNA concentration is required to ensure level also depend on the level of variability of the data.
accurate reverse transcription (see Chapter 8). Nevertheless, it is important to realize that a common mistake
is to underestimate the necessary number of biological
Normalization to Global Gene Expression replicates to be able to arrive at reliable conclusions. It is
When measuring large numbers of targets, the analyst can recommended to perform an initial pilot study to evaluate
estimate the global mean of the total gene expression and the assay’s inherent variability and the potential size of the
identify regulated RNA sequences that deviate from this observable biological effect in order to have a good basis to
mean. This approach is conventionally used for normalization estimate the necessary number of biological replicates26.
of gene expression arrays. It is a valuable alternative to using Technical replicates are not used directly for the statistical
reference genes and may be preferable where many targets analysis. Instead, technical replicates are used to backup
are being measured. samples (in case some samples are lost in the technical
Another recently explored approach is the measurement handling process) and to improve assessment of data
of endogenously expressed repeat elements (ERE) that are accuracy. Technical replicates can improve data accuracy
present within many of the mRNAs. Many species contain if the assumption holds true that they vary stochastically
these repeat elements (ALU in primates, B elements in mice), around the accurate measurement at each stage of the
which can provide an estimation of the mRNA fraction. technical handling process. The average of the technical
Measurement of these target sequences has been shown replicates is closer to the accurate measurement. The effect
to perform as conventional normalizing systems9 (Le Bert, of averaging technical replicates can be illustrated by noting
et al., in preparation) and may offer a universal solution or an the size of the confidence interval in a simulated data set
alternative for complex experiments where stable reference with a predetermined variability, i.e., standard deviation set at
gene combinations are unavailable. one. As seen in Table 10.4, the confidence interval becomes
smaller with an increasing number of technical replicates
(samples), indicating a more precise estimate of the accurate
Normalization of miRNA Data measurement. Furthermore, the narrowing of the confidence
As yet there have been no reports of a miRNA universal interval is most dramatic at the low number of technical
reference gene. Therefore, the selection of normalization replicates. Increasing the replicate number from 2–3 decreases
system is still rather empirical. When possible, stable invariant the confidence interval from 8.99–2.48, i.e., a more than 3-fold
miRNAs may be identified from genome-wide approaches, improvement of the precision in the estimate of the accurate
i.e., microarrays. Small nucleolar RNAs (snoRNAs) have also measurement. While additional replicates continue to improve
been used as reference genes. Global gene expression is also the estimate of the accuracy of the measurement, the effect
a useful method of normalizing miRNA expression when a is at a decreasing magnitude. Therefore, it is apparent that in
stable reference is unknown and several hundred targets have cases where technical handling variability is an issue, it may be
been analyzed21,22,23. This method is more appropriate for those a great advantage to use triplicates rather than duplicates.
using approaches resulting in capture of all miRNAs as cDNA in
a multiplexed form, e.g., Exiqon and miQPCR systems (refer to
Castoldi et al. in PCR Technologies, Current Innovations24).
80 sigma.com
Data Analysis
signed-rank test which is used to compare two paired groups). The presence of the SEM can be recognized in the equation
Non‑parametric statistical tests, such as the Wilcoxon rank- for the confidence interval as the ratio between the standard
sum test, have an advantage over parametric statistical tests, deviation (SD) and the square root of the number of samples
such as the Student’s t-test, in that they do not depend on (N) and thus it is evident that the confidence interval is
prior assumptions of the data set distributions. A Kolmogorov- based upon the SEM. The lower limit of the confidence
Smirnov’s test for normal distribution may be used to decide interval is constructed by subtracting the SEM multiplied by
whether to apply the Student’s t-test or one of the non- a percentile of a t-distribution from the mean. The upper limit
parametric tests of the confidence interval is constructed by adding the SEM
multiplied by a percentile of a t-distribution from the mean.
In addition to the choice of algorithm for p-value calculation,
The confidence level of the confidence interval is set by the
data sets that are fed into the p-value calculation algorithm
confidence level associated with the critical value t*; typically a
may be manipulated to facilitate observation of desired
95% confidence level.
properties in the data set. The combination of raw data
manipulation steps and choice of p-value calculation Figure 10.11 shows a bar graph with error bars denoting the
algorithm is part of building a hypothesis model. 95% confidence interval within each experimental group,
highlighting the uncertainty associated with the mean
There is a high level of freedom in building hypothesis models
estimate for an example gene expression in samples from
in the exploratory phase of a statistical analysis and this is an
different organs after treatment with several drug doses. In
important part of scientific inquiry. However, a hypothesis
addition, the t-test statistical significance p-values are shown
is never proven using a scientific, statistical approach. A
for the difference in gene expression between the control
correct scientific approach is to formulate a Null hypothesis,
samples and each of the three different samples from different
use an independent (preferably a newly collected) data set,
drug dose responses, indicated by means of an asterisk
and accept or reject the Null hypothesis according to the
notation. It is customary to have one asterisk correspond to
confirmatory study flowchart (Figure 10.10).
a p-value below 0.05, two asterisks correspond to a p-value
below 0.01 and three asterisks correspond to a p-value
Visualization Techniques for below 0.001.
Univariate Analysis 2
Gene Expression Dose Response
determined. Secondly, the precision by which the mean value Figure 10.11. Fold change (log2) expression of a gene of interest relative to a pair
has been determined can be illustrated in different ways, of reference genes, relative to the expression in the sample with lowest expression
within each organ type. Bar heights indicate mean expression of the gene in several
but it ultimately depends on a combination of the inherent samples in groups of non-treated (Dose 0) samples or samples treated at one of
variability of the data together with the number of samples (N) three different drug doses (Dose 1, Dose 2, and Dose 3). Error bars indicate 95%
and in its raw form, it is called the standard error of the mean confidence interval estimates of the mean expressions. One asterisk indicates statis-
tically significant difference between the means of a treated sample set compared
(SEM, Equation 1): to the mean of the non-treated sample set to 5%; two asterisks indicate statistically
SD significant difference to 1%; three asterisks indicate statistically significant difference
SEM = (Equation 1)
to 0.1%.
N
PCR Technology, Current Innovations-3rd ed. by Taylor and Francis Group LLC Books.
Equation 10-1. SEM Reproduced with permission of Taylor and Francis Group LLC Books in the format
reuse in a book/e-book via Copyright Clearance Center.
However, the SEM is not a very intuitive measure and it is not
straight forward to compare SEM’s from different experiments Given that the asterisk notation hides the absolute value of
in a meaningful way. A more popular way of illustrating the p, it is often encouraged to include a table with the absolute
precision of the estimated mean and indicating statistical values of p, as shown in the example in Table 10.5. One reason
significance in a graphical way, is the confidence interval (CI, behind this is that a p-value of for example 0.032 is only slightly
Equation 2): more “significant” than a p-value of 0.055. Borderline cases like
SD SD this can lead to some confusion when deciding precisely what
CI = (Cq − t * ⋅ ) to (Cq + t * ⋅ ) (Equation 2)
cut-off to use when classifying data as significant. In realistic
N N
Equation 10-2. Cl
cases, a p-value of 0.051 could be just as significant as a p-value
82 sigma.com
Data Analysis
84 sigma.com
Troubleshooting
Chapter 11:
Troubleshooting
As with any technique, it is critical that all of the processes of When switching master mix products, it is critical to
the PCR, RT-PCR/RT-qPCR are fully understood so that data are recognize that some assays are particularly sensitive to buffer
reliable and any problems can be addressed with confidence. composition/annealing temperature (Ta)/primer concentration
When developing a troubleshooting protocol, it is important combinations. Changing any one of these may result in
to be open to any possible sources of error, however different performance. Therefore, all assays should be verified
insignificant they may seem, to explore each potential in selected master mixes and on all desired instruments before
problem independently (if two assays are failing, try to treat making radical changes. It is also essential to review the
each separately and not assume that there is a single reason), instructions provided with each master mix since these specify
to recognize the value of your time and to be pragmatic the recommended conditions that are optimized for the given
about getting the assays working without necessarily having enzyme, Hot Start mechanism and buffer components.
a full understanding of what went wrong. Most importantly,
JumpStart™ Taq ReadyMix™ (Sigma) doesn’t work as well as a
troubleshooting is simply a logic problem and like any skill,
Problem similar product from a different supplier
improves with practice and experience.
Possible • An incorrect initial incubation of 95 °C for 15 min was used as the Hot
Start/denaturation protocol before cycling (inappropriately applying
Causes
the established ones are solved. More often than not, the • Adjust primer concentration or annealing temperature (T ). a
of the postdoctoral fellow who ran several failing PCRs before • Aa probe
ReadyMix designed for use with probes was used without including
in the reaction.
realizing that the dNTPs were missing from the PCR master
mix is a reminder that even the best over-worked scientists are
Diagnostic • Check ReadyMix choice and color of qPCR mix.
Test
vulnerable to simple errors. Solutions • Use appropriate ReadyMixes for the desired PCR application. Red dye
will interfere with fluorescence detection in most qPCR instruments.
Master Mix
It is good laboratory practice to ensure that sufficient reaction
Mistakes or problems with the master mix blend of reaction
master mix is prepared for all samples that are to be run
components may be the source of a catastrophic failure of
together. Ensure that all components are carefully thawed and
amplification in all samples and positive controls. Before
mixed well and that the experiment master mix is very well
repeating the experiment, all components should be checked
mixed before aliquoting to samples. This is particularly relevant
along with the concentrations. If a new batch of reagent is
to some of the 2× buffers such as KiCqStart® that are more
being used, it is a useful precaution to run the new against
viscous than normal PCR buffers.
the old before launching into a major series of experiments.
(see Chapter 9). When using a probe for the first time, collect
fluorescent data for as many potential wavelengths as possible 0.07
0.05
Inadequate Optimization
The effect of assay optimization was described and 0.04
Figure 11.1A. The assay has an unusual amplification plot profile with a pronounced
drift of the baseline.
Figure 11.1B. The sequence for the probe that was included in the assay was
entered into mfold folding prediction software. It is clear that the probe could
adopt a stable folded structure in solution and this is likely to result in the
observed problem.
86 sigma.com
Troubleshooting
Template Template quantity is also an important consideration.
The effect of template quality on assay performance was Including too much or too little template into the PCR will
described in Chapter 7. Template quality encompasses result in failed reactions and qPCR amplification plots that
consideration of quantity, integrity and the presence of appear abnormal. Figure 11.3A shows a reaction containing
inhibitors. It is critical to ensure that RNA quality is matched a 10-fold serial dilution of artificial oligo template. The lower
to the most appropriate RT priming protocol (see Chapter 8) dilutions are too concentrated for the reaction to be efficient
and to use the best quality template possible. Similarly, or for the instrument to effectively process the baseline data
the quantity of RNA that is added to RT reactions must be (Figure 11.3B), resulting in abnormal amplification plots and
within the scope of the protocol and, in many cases, this unreliable data.
should be the same for all reactions. ReadyScript® is a notable
A) Amplification Plots
exception to this guideline because adoption of this reagent
and protocol yields a linear cDNA concentration that is
proportional to the input RNA quantity. When troubleshooting 0.2
Fluorescence (dRn)
a sample which is yielding a higher than expected Cq, run the
SPUD assay or dilute the sample through a 1:5 or 1:10 dilution
series and repeat the assay (Figure 11.2) to identify samples 0.1
Causes • There are errors in the dilutions of the template for the standard curve.
• The sample contains an inhibitor. B)
9000
Amplification Plots
• Check
Fluorescence, R (Multicomponent View)
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
0.5
Cycles
0.4 Figure 11.3. A) Amplification of a 10-fold serial dilution of an artificial template with
specific primers and a FAM-labeled probe. The Cq is very low for the concentrated
samples, the amplification plots are not regularly spaced and are abnormal.
Fluorescence (dRn)
0.3 B) Shows the raw data for these amplification plots. The reactions containing
the highest concentration of target also have a significantly higher background
107 106 105 104 fluorescence and minimal fluorescence yield through the reaction.
0.2
After running a well-planned PCR there are several diagnostic Control Samples/Reactions
tools available for troubleshooting:
The use of controls is strongly recommended. It is almost
• Control samples and assays impossible to troubleshoot a failed assay without information
• End-point gel/SYBR Green I dye reagent from an appropriate suite of controls.
Cq compared to
positive control). • The assay is nonspecific and requires
optimization or re-designing.
Assay heterozygote control Heterozygote template or a 1:1 blend of
each homozygote detected with WT assay
Positive with both
assays.
Correct • There was an error during assay
preparation.
and with mutant assay.
• The assay needs re-designing.
• There is a problem with one of the
component oligos.
• The assay requires further
optimization.
• Analyze results alongside single
template/assay controls.
88 sigma.com
Troubleshooting
The positive control amplifies but there are no amplification Is the
Problem results from a sample known to contain target (Figure 11.4A) Yes PCR experiment No Correct plan
Diagnostic • Test amplification with a diluted sample. Spike the reaction with a low
level of exogenous target and test for amplification of the exogenous Has this
Test PCR No PCR assay design
target (see Chapter 8; follow the SPUD Protocol, Appendix A). ☺ No Verify design
Product Product previously been used in silico
Solutions • Add up to 0.3% BSA to the PCR (Figure 11.4B) or purify the input
nucleic acid.
successfully?
Yes
A) • Check primer
3 Was the Has this oligo concentration
same master mix used Yes synthesis been used No • Test a new
Standard qPCR mix DNA diluted 1:25 previously ? previously ? synthesis of primers
0 Undiluted DNA & NTC Figure 11.5. The basic troubleshooting process for PCR.
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
B)
Cycles When a qPCR experiment completely fails, the first step is
to check assay design, the oligo sequences and the QC data
qPCR mix + 0.3% BSA
from the oligo manufacturer. Although the assay may have
failed, qPCR multicomponent/raw data can be used to provide
DNA diluted 1:5 DNA diluted 1:25
further information. Figure 11.6A shows the raw data plot
Fluorescence (dRn)
10000
the experiment set up and then repeat the PCR. If this fails, 4000
Figure 11.6. A) The raw data plots of a duplex assay containing a FAM and a HEX-
labeled probe. The FAM probe naturally yields higher fluorescence. B) The agarose
gel showing that equal quantities of product were produced in each reaction and
confirms the qPCR Cq observation.
Fluorescence (dRn)
concentration in the reaction or a fault with the probe such 0.6
ensuring that the probe has a compatible label and quencher 0.3
0.0
-0.1
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
Figure 11.8. Identical reactions were run containing either a qPCR probe or SYBR
Green I dye (as indicated). The SYBR Green I reaction was approximately eleven
cycles more sensitive and yielded much higher end-point fluorescence. This is
indicative of a fault in the probe or problem with the probe design (data kindly
provided by Prof. Stephen Bustin, UK).
22000
the initial failure. If the SYBR Green I experiment provides 20000
data, it is possible that the original probe failure was due to 18000
2
either a technical error or probe fault. To differentiate between 16000
14000
experimental error or a fault with the probe, repeat the probe 12000
experiment; if the reaction fails again, replace the probe. This 10000
6000
producing poor data. In the example shown in Figure 11.8, the 4000 3 and water
probe reaction was sub-optimal and when compared to the 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
blank
Cycles
reaction run using SYBR Green I, it can be seen that the probe
signal does not reflect the experiment. In such cases the assay Figure 11.9. Three genes were detected in the same template sample. Two
design should be verified and a new probe tested. reactions resulted in amplification (1 and 2), however the 3rd was negative. An
examination of the multicomponent view reveals that the background fluorescence
for the 3rd reaction is equivalent to the water control indicating an absence
of signal.
90 sigma.com
Troubleshooting
A further check of the probe labeling can be performed (Figure 11.10B) such that the fluorescent yield is measured
using a DNase I digestion. This must be performed with with respect to time or alternatively, the initial and end point
extreme care to ensure that probe and primer stocks are not (after 10 min) reading provide sufficient information. When
contaminated with enzyme, which would lead to catastrophic performing this test it is important to compare the data to a
results. An aliquot of a failing probe (Figure 11.10A) equivalent probe that is functioning well and has the same fluorescent
to that included in a reaction, e.g., 300 nM is incubated with label and quencher (Figure 11.10B).
and without DNase I. This can be carried out in real time
A) B)
15000 Probe 1
14000
0.5
13000
11000
0.3 10000
9000
0.2 8000
Probe 2 has less than
7000 half the label intensity
of Probe 1
0.1 6000
5000
0.0 Probe 1 and Probe 2
4000
no enzyme control
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 10 20 30 40
Cycles Cycles
Figure 11.10. A) Two templates were detected using different probes, both FAM labeled. While detection using one probe resulted in a high fluorescent signal, the second
was much weaker. B) A control and a test probe (300 nM) were incubated at 37 °C in a real time instrument in DNase I buffer in the presence or absence of DNase I enzyme.
The fluorescent release from probe 1 was approximately twice that from probe 2, demonstrating that probe 2 labeling was inadequate.
Low or absent fluorescence in both the test sample and in the positive control. The correct PCR product is visible on the gel
Problem and the design is verified
SYBR Green Dye-Based Detection Probe Detection
Possible Bad SYBR Green I binding dye. • High/low background fluorescence. • Degraded probe.
Cause • Incorrect probe concentration. • Poor probe labeling.
• Incorrect collection of fluorescent data.
Diagnostic • Compare fluorescence of the SYBR Green I binding • Check the raw fluorescence (multicomponent plot). • Digest 5 fmoles of probe with DNase I. Collect
Test dye mix ±1 µg DNA.
• Fluorescence should increase at least 10,000 units fluorescent yield using all wavelengths.
• Fluorescence should be at least 10,000 units higher
with DNA added than without.
between cycles 1 and 40. • Fluorescence should be at least 10,000 units greater
than without DNase digestion.
Solutions Purchase new SYBR Green I binding dye or a new • Use correct concentration. Purchase a new probe.
qPCR mix with SYBR Green binding dye.
• Purchase a new probe.
Amplification Plots
The structure of the amplification plots and the reproducibility Similarly, the amplification plots in Figure 11.12A are clearly
of technical replicates provide a wealth of information abnormal and could not be used as they are presented. An
regarding the quality of the qPCR assay and may also provide amplification plot which dips below zero dR (Figure 11.12A)
the first warning indications that all is not as it should be. is a classic indication of inappropriate baseline settings having
The amplification plots in Figure 11.11A are non-typical, very been applied. Examination of the raw data for this reaction
noisy and would be difficult to interpret accurately. A further (Figure 11.12B) shows that the actual amplification plots
examination of the dR fluorescence values reveals that the have a normal profile, confirming that the analyzed data are
end-point fluorescent yield is only 400 units, indicating that the result of an instrument software issue. The appropriate
the reaction is inadequate but the amplification plots have baseline can be deduced from the raw data and applied in the
been generated by the instrument software and autoscaled. software. In this case cycles 6 to 16 represent the initial linear,
Similarly, the data in Figure 11.11B have a pronounced foxtail baseline phase of the reaction and when applied, result in
(decreasing curve) at the beginning of the profile, before normal amplification plots (Figure 11.12C).
increasing again after a baseline section. The appearance of A)
the foxtail is consistent across two reactions, but one reaction
has a much lower end-point (Figure 11.11C) resulting in an 2000
Fluorescence (dRn)
1000
A) 400 400
300
Fluorescence (dRn)
–1000
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
200 Cycles
B)
13000
12000
100
11000
Fluorescence, R (Multicomponent View)
10000
9000
0
8000
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 7000
Cycles
6000
B) 5000
4000
3000
2000
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles
C)
1000 0.6
0.5
Fluorescence (dRn)
0.4
0.3
C)
0.2
14000
0.1
0.0
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles
Figure 11.12. A) Amplification plots were clearly abnormal with a section of the
profile dipping below the baseline. B) Examination of the raw data plot reveals that
the reaction data are as expected. C) Setting the instrument baseline according
to the appropriate cycles restores the normal profile to the data of analyzed
amplification plots
Figure 11.11. A) Amplification plots that are noisy due to autoscaling by the instru-
ment software of poor data with low fluorescence. B) Reactions yielding low end
point dR have a pronounced initial foxtail. C) The foxtail is seen as a normal effect
when in proportion to the high quality assay.
92 sigma.com
Troubleshooting
The amplification plot profile can also be interpreted to give
information about the quality of the assay and optimization.
Figure 11.13 shows the attempted amplification of a 10‑fold
serial dilution of template with each concentration run in
duplicate qPCR. The reproducibility between replicates is
poor, the cycle difference (ΔCq) between the data is not
constant and it is not 3.323 cycles, as expected for a 10-fold
serial dilution. Examination of the amplification plots, with
consideration to this being a standard curve, reveals that the
assay is below standard and could not be used for analysis.
The reasons would need further investigation but could be the
result of; poor assay design (see Chapter 6), sub-optimal assay
conditions (see Chapter 9), or poor pipetting (repeat assay). Figure 11.14. During a standard qPCR the data suddenly spike upward with a
non-typical profile.
200 200
180 180
PCR Base Line Subtracted CF RFU
160 160
0.001 140 140
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 120 120
Cycles
100 100
Figure 11.13. A cDNA sample was diluted through a 10-fold serial dilution and the 80 80
specific template detected using duplicate qPCR for each dilution. The replicates are 60 60
poor, indicating a problem with pipetting or with assay optimization. 40 40
20 20
The fluorescence plots suddenly spike upwards 0 0
Problem (Figure 11.14). –20 –20
Possible Bad reference dye or instrument error (e.g., door was opened during run). –40
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48
–40
Cause Cycle
Diagnostic • Disable reference dye normalization or look at the results for ΔR
(fluorescence increase from cycle 1 to 40) instead of ΔRn (the relative Figure 11.15. The hooked amplification plot profile may occur in later reactions
Tests
fluorescence increase after normalization to the reporter dye intensity). as a result of competitive hybridization between the complementary strand and
• For instruments which can tolerate analysis without the reference dye,
the plots should become corrected if fluorescence is not normalized to
primer/probe.
NTC
negative control. This is confirmed using an ethidium bromide
stained agarose gel (Figure 11.16B) which also shows that the
primer dimers become apparent when the template is present
at low concentration. This causes an over estimate of the amplicon
target when detected in samples of low target concentration. primer dimer
Therefore, the assay should be optimized or re-designed. In
contrast, Figure 11.16C shows that the melt profile for the Figure 11.16B. Primer dimers are evident on a gel resolution of these samples
product in the no template control is identical to the melt (along with others), with primer dimer formation being inversely proportional to
input template concentration.
profile for the positive control and test sample. This is a clear
indication of contamination of the no template control with 4000
amplicon derived from gDNA is longer and, therefore, has a Positive Control/
Fluorescence, -R’ (T)
2000
NTC
1000
58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (ºC)
94 sigma.com
Troubleshooting
0.8
0.7
Amplification of -RT
0.6 control indicates gDNA
0.5
Fluorescence (dRn)
0.4
0.3
Dissociation Curve
0.2
700
600
0.1
500
0.0
200
100
–100
54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C)
Figure 11.16D. Identifying a larger amplicon that has resulted from PCR of gDNA.
optimum concentration.
is specific. Continue to use the
primers. • Perform annealing temperature
gradient to select the optimum
70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (ºC)
annealing temperature for the PCR.
• Design unique primers. Figure 11.17. A) A melt profile and B) agarose gel analysis of a SYBR green I reaction.
Although the melt profile suggests products of varying Tm, the gel image indicates
that a single amplicon is present. This is indicative of an amplicon sequence that
contains AT or GC rich regions or a repetitive element resulting in irregular melting
Cq
20
Detection of a serial dilution allows the experimental linear
dynamic range of the assay to be defined. Figure 11.18A
15
shows a standard curve with low concentration data points
that do not fit the linear profile. The most usual reason for
10
this pattern of data is that primer dimers have been formed
in samples of low concentration (as shown in Figure 11.18B). 5
This is the standard curve generated from the data shown in –5 –4 –3 –2 –1 0
Figure 11.2. Figure 11.18C shows a standard curve with highly Log of DNA Dilution
concentrated samples falling out of the linear range. The most Figure 11.18C. The samples with high concentrations of template do not lie on the
usual reasons for this are template inhibition of the reaction or standard curve. This is typical of reactions that are inhibited by template concentra-
that the baseline settings are inappropriate. tion or due to incorrect baseline setting.
32
Possible Sub-optimal PCR conditions. Poorly designed primers.
30
Causes
Diagnostic Check the primer design. Test the PCR mix with a set of primers known to
Test work well and a positive control template.
28
Solutions • Optimize PCR conditions.
26 • Prepare or purchase fresh PCR mix.
24
• Design new primers.
–3 –2 –1 0
3
Log of DNA Dilution
B)
Standard Curve
Fluorescence (dRn)
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles
Figure 11.19A. A template nucleic acid was diluted through a 10-fold series. The
amplification plots have an abnormally shallow gradient and the ΔCq is 4 cycles
rather than the expected 3.3.
Figure 11.18. A) The data points relating to the lower concentrations of target do
not lie on the standard curve. B) This is typical of a reaction resulting in primers
dimers as illustrated. In this case there is no observed increase in Cq for the samples
at low concentration.
96 sigma.com
Troubleshooting
Standard Curve 24
23
Log fit values
22
FAM Standards, RSq:0.997
Cq (R Multicomponent View)
FAM, Y = -6.481*LOG(X) + 23.20, Eff. = 42.7% 21
20
36 19
18
34
17
32 16
15
Cq (dRn)
30
14
28 13
12
26 0.001 0.01 0.1 1
Initial Quantity (relative)
24
• Inhibition. 10000
Tests 8000
6000
(see Appendix A).
• Try lower primer concentrations.
5000
Solutions
• With
4000
RT-PCR, try using less RT enzyme, doing 2-step and/or using a 3000
higher incubation temperature for the RT step.
• Ensure
2000
pipettes are calibrated. If the pipettes are properly calibrated,
1000
practice pipetting accurately.
• Purify sample. Use a higher dilution in the assay. 0
56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C)
0.8
Figure 11.20C. An examination of the melt curve profile reveals that the samples
0.7
of lower concentration (yellow and blue traces) also contain signal from amplified
primer dimers (peak at lower Tm).
0.6
Fluorescence (dRn)
0.5
0.4
0.3
5-fold serial dilutions
ΔCq < 1.5
0.2
0.1
0.0
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
Figure 11.20A. A template nucleic acid was diluted through a 10-fold series. The
ΔCq between amplification plots is 1.5 cycles rather than 3.3.
∆RN
A probe-based assay was designed to detect EIFB1 in human 1
0.001
0.0001
both oligo batches on the ABi StepOne instrument, by the 0.00001
first operator. The reaction failed with the original reagents 0.000001
0.0000001
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42
but gave good amplification with LuminoCt (Figure 11.24). Cycle
Figure 11.24. The EIFB1 primer and probe assay was run in two different reagents
(Original ABi or Sigma LuminoCt). Data was only acquired from this assay when run
in Sigma LuminoCt reagents.
98 sigma.com
Troubleshooting
The Reaction Efficiency Was Incorrect and Variable 0.5
FAM/BHQ1 vs FAM/OQA
oligo, using a standard primer and probe assay. The assay 0.4
FAM-BHQ1 Tube E
had originally been developed and optimized on a different 0.35 FAM-OQA Tube E
∆R
0.25
when transferred to a different test lab and instrument FAM-BHQ1 Tube G
0.2 FAM-OQA Tube G
(Figure 11.25A). All assay conditions were re-optimized to 0.15
FAM-BHQ1 Tube H
be specific to the new lab but with no change to the data. 0.1
FAM-OQA Tube H
FAM-BHQ1 Tube I
The operator observed that the effect was more pronounced 0.05
FAM-OQA Tube I
when the assay was repeated within a few hours, using the 0
1 6 11 16 21 26 31 36
same dilution series. As part of the troubleshooting process, Cq
the assay was run on a different instrument by a different
operator who again, generated the expected standard curve. Figure 11.25B. An artificial oligo template was diluted 10-fold (these are the
dilutions that are detected in Figure 11.25A) and left at 4 °C for several hours before
This lead to the suggestion that the initial problem was due being detected using a specific probe-based assay. There are inconsistent differ-
to; operator error, instrument failure, or some subtle variation ences between the amplification plots which are exacerbated by the time between
in experimental procedure. Since both operators are highly dilution and testing.
experienced and the instrument was functioning well for other FAM/BHQ1 vs FAM/OQA
experiments, the subtle differences option was examined. An 0.5
from the same dilution series after a period of storage of the 0.4
FAM-BHQ1 Tube E
samples at 4 °C (Figures 11.25A and 11.25B). This lead to an 0.35
FAM-OQA Tube E
examination of the tubes used for the dilution series and a test 0.3 FAM-BHQa Tube F
∆R
FAM-OQA Tube F
0.25
of alternatives. After switching to Eppendorf 1.5 mL reaction FAM-BHQ1 Tube G
0.2 FAM-OQA Tube G
tubes for the dilution series, the predicted standard curve was 0.15
FAM-BHQ1 Tube H
for PCR and that these assays are sensitive to subtle variations 0
1 6 11 16 21 26 31 36
in protocol. Cq
FAM/BHQ1 vs FAM/OQA Figure 11.25C. An artificial oligo template was diluted 10-fold into molecular
0.45
biology grade tubes (Eppendorf ) and then detected using a specific probe-based
0.4 assay. There are consistent differences between the amplification plots, as expected.
0.35
FAM-BHQ1 Tube E
0.3
Summary—A Troubleshooting Protocol
FAM-OQA Tube E
FAM-BHQa Tube F
0.25 FAM-OQA Tube F
∆R
0.2
FAM-BHQ1 Tube G
FAM-OQA Tube G
• Check quality of sample (degraded material will cause
0.15 FAM-BHQ1 Tube H erroneous results).
•
FAM-OQA Tube H
0.1 FAM-BHQ1 Tube I Check RT protocol is compatible with design (e.g., an
FAM-OQA Tube I
0.05
Oligo-dT primed RT must have a qPCR assay in the 3’ 1 kb
0
1 6 11 16 21 26 31 36 of sequence).
Cq
• Check assay design.
Figure 11.25A. An artificial oligo template was diluted 10-fold and detected using
a specific probe based assay. There are inconsistent differences between the • Check all controls.
amplification plots. • Check primers using SYBR green I dye/run a gel.
• Ensure correct software settings (baseline, dye detection,
concentrations for standards).
• Ensure ROX concentration is applicable for instrument (and
not interfering with multiplex).
• Check background fluorescence levels.
• Check probe labeling with DNase I assay or repeat
probe synthesis.
Chapter 12:
Regulatory Agencies and Conclusions
102 sigma.com
Regulatory Agencies and Conclusions
There is often confusion regarding terminology, particularly Evaluated together with other clinical data tests support a
pertaining to assay validation versus qualification. personalized choice of appropriate therapy since different HCV
genotypes respond differently to available drugs.
Prior to validation, each assay should undergo a set of
assay optimization experiments that will establish assay Table 12.2. PCR-based Medical Devices Cleared or Approved by
performance. These data will be used for establishing the FDA in 2013.
assay validation protocol. Well-conducted optimization
Device Name Companion Diagnostic Date
experiments will greatly reduce the chance of assay failure
therascreen® EGFR RGQ PCR Kit– Yes, GILOTRIF® (afatinib) is a drug 7/12/2013
during validation. P120022 used to treat patients with NSCLC
Abbott RealTime HCV Genotype II; No, laboratory test that can 6/20/2013
Assay Validation: Full set of evaluation experiments (for Abbott RealTime HCV Genotype II determine certain genetic types
the parameters listed above) performed in accordance Control Kit; and Uracil-N-Glycosylase of the hepatitis C virus (HCV)
(UNG)–P120012
with a validation protocol to demonstrate and document
THxID®–BRAF Kit for use on the Yes, Mekinist® (tramatenib) and 5/29/2013
performance of an assay and set specifications and criteria of ABI 7500 Fast Dx Real-Time PCR Tafinlar® (dabrafenib) are drugs
acceptance for expected assay performance during testing. Instrument–P120014 used to treat patients with
advanced (metastatic) melanoma
Assay Qualification: Assay qualification is a reduced set of cobas® EGFR Mutation Test–P120019 Yes, TARCEVA® (erlotinib) is a drug 5/14/2013
evaluation experiments that mostly focus on demonstrating used to treat patients with NSCLC
that an established assay will produce expected results for Despite fast technological advances, regulatory approval
the intended role (for example, specific type of samples process for new assays may take several years and currently
or conditions). PCR-based applications are taking a more prominent role in
assays that are passing the approval process and replacing
Approved Tests classical methods, such as culture, not only in the diagnostic
arena but also for release testing of biologics.
PCR-based techniques are considered by industry and
regulatory agencies as one of the “gold standard” technologies The MycoTOOL® PCR Mycoplasma Detection Kit-based test
that are used for validation of results obtained by different was approved by FDA on November 1st, 2012. It is the first
assays and technologies when applicable, during 510(k) and commercially available Mycoplasma PCR test approved by
PMA applications. For example, for validation of array-based FDA that can replace conventional and time-consuming
genotyping assays or platforms, polymorphism, genotype call mycoplasma detection assays (culture methods as well as
validation can be performed by PCR amplification of the target indicator cell culture method) for the testing of biologics and
region followed by sequencing and/or by detection with qPCR biopharmaceuticals12. This test can be performed in a few
probe or primer-specific assays. There are multiple regulatory hours and replaces up to 28 days processing, thus significantly
guidelines that address specific assay types. improving time for lot release of biopharmaceuticals and
vaccines.
The majority of PCR-based tests that are being approved for
diagnostics are focusing on detection of viral agents and
mutations associated with genes involved in cancer pathways. Conclusions
During the initial nine months of 2013, four out of 22 FDA Polymerase Chain Reaction (PCR) based methods are powerful
approved medical devices and tests were PCR-based assays techniques that can provide scientifically sound data, even
(18%), all of them were supporting personalized medicine within the budget constraints that researchers are currently
and three out of four were companion diagnostic tests experiencing. This manual provides an introduction to PCR,
(Table 12.2)8-11. By identifying patients who have particular qPCR, RT-PCR and digital PCR with an overview of technical
mutations, such as EGFR exon 19 deletion or exon 21 (L858R) options and related applications, alongside guidance for
substitution in non-small-cell lung carcinoma (NSCLC) cells, troubleshooting PCR-based data. This handbook has been
the test results are used to stratify the subpopulation of designed to support scientists who have different degrees
patients who will have a higher chance of responding to of familiarity with PCR-based methods and serve as an
GILOTRIF®, a drug that is directed towards blocking abnormal introduction to the technology, a reference guide and a tool
function of the mutant EGFR protein. for daily use for researchers in academic, as well as industrial
and diagnostic laboratories.
Laboratory tests that are applied to identifying which
particular strain of Hepatitis C virus (HCV) the patient is Different PCR-based methods are used by the scientific
infected with9 are an important factor in ensuring better community and the choice of technique adopted is based on
treatment outcomes for patients with chronic HCV infections. application, which range from a classical end-point PCR when
and these need to be considered during the experimental Figure 12.2. Example of a Laboratory Workflow: Division of functional areas and the
design to balance sensitivity, specificity, cost of reagents workflow direction in the PCR assay process.
and resources and time available for assay optimization. The
The importance of the quality of template and choice of
same consideration should be applied when evaluating
appropriate QC assays is discussed in Chapters 7 and 8.
experimental design using individual vs. multiplex assays.
Comparing RNA samples that have undergone different
This manual also provides options for appropriate degrees of degradation can lead to erroneous biological
experimental design and workflow. All steps in the process, conclusions about RNA expression signatures. Similarly,
from the quality of the sample to data analysis method, as well different samples may have different concentrations of
as a choice of normalizing genes for determination of relative inhibitors that will impact RT or PCR efficiency and may
RNA expression, must be considered and addressed during produce false-negative results or inaccurate ratios of
experimental design to reduce variability. A primary concern expression. For example, there is a vast diversity of sample
when working with PCR is to control for cross contamination types that are being interrogated with PCR-based techniques;
to avoid false positive results because these techniques are multiple environmental samples tested to evaluate biodiversity
highly sensitive. or to detect pathogens, different human and animal tissues
There are different approaches to the laboratory set up and bodily fluids to evaluate RNA expression signatures or
that can assist in addressing that concern, including use DNA vaccines. Each of these can have a plethora of unique
of proper laboratory practices with a focus on cleaning, inhibitors that may impact different assays in the same sample
physical segregation with dedicated equipment and gowns to a variable degree.
and a unidirectional workflow. Proper cleaning must be Different biological questions can be answered by utilizing
performed with nucleic acid destroying agents such as a multiple workflows, reagents, instruments and applications,
simple 10% bleach solution and UV irradiation (not to be as discussed throughout this guide. The choice of an optimal
replaced with common hospital disinfectants like Amphyl® technique, reagent, method of analysis, types and number of
that only have antimicrobial properties). Segregation can replicates and controls will be dependent on multiple factors
104 sigma.com
Regulatory Agencies and Conclusions
and constraints of individual projects as well as the researcher’s References
experience and personal preferences. However, as discussed 1. Points to consider in the manufacture and testing of monoclonal
in Chapters 3 and 4, significant emphasis must be placed on antibody products for human use (1997). U.S. Food and Drug
Administration Center for Biologics Evaluation and Research.
maintaining compliance with MIQE guidelines15 through all J Immunother. 1997 May; 20(3): 214-43.
phases of the experiment to assure scientific integrity of the 2. Griffiths, E. WHO requirements for the use of animal cells as in vitro
data and validity of biologic conclusions that will withstand substrates for the production of biologicals: application to influenza
the test of time and follow up experiments16. vaccine production. In: Brown F, Robertson JS, Shcild GC, Wood JM,
editor. Inactivated Influenza Vaccines Prepared in Cell Culture. Dev Biol
Stand. Basel, Karger, 1999 vol 98, pp 153-157.
Next-generation Sequencing 3. European Union (2001) Position statement on the use of tumourigenic
cells of human origin for the production of biological and
All PCR-based techniques are applied to targeting known biotechnological medicinal products, The European Agency for the
sequences, as discussed in Chapter 6. While sequencing Evaluation of Medicinal Products: Evaluation of medicinal products for
methods can generate and detect “unknown” sequence, PCR- human use. CPMP/BWP/1143/00.
based amplification is an important step in the generation of 4. OECD Principles of Good Laboratory Practice (as revised in 1997)”. OECD
Environmental Health and Safety Publications (OECD) 1. (1998).
template for massively parallel sequencing (MPS). Quantitative
5. Facts About Current Good Manufacturing Practices (cGMPs). http://
PCR approaches are used for QC and optimization of DNA www.fda.gov/Drugs/DevelopmentApprovalProcess/Manufacturing/
libraries and this is a key step in the generation of high-quality ucm169105.htm.
data. This approach is highly sensitive and requires a very small 6. Validation of Analytical Procedures: Text and Methodology Q2(R1). ICH
amount of material, compared to other methods. In addition, Harmonized Tripartite Guideline. Current Step 4 version Parent Guideline
qPCR evaluation assures a high efficiency and thus cost dated 27 October 1994 (Complementary Guideline on Methodology
dated 6 November 1996, incorporated in November 2005).
effectiveness of sequencing data. PCR is also a corner stone
7. Guideline on bioanalytical method validation 21 July 2011 EMEA/CHMP/
for template generation for popular technologies used for re- EWP/192217/2009 Committee for Medicinal Products for Human Use
sequencing of DNA and RNA. These applications are supported (CHMP).
by design tools that allow multiplexing of over 6,000 primers 8. therascreen® EGFR RGQ PCR Kit - P120022 Approval Letter: http://www.
per pool and 10 ng of starting material, making interrogation accessdata.fda.gov/cdrh_docs/pdf12/P120022a.pdf.
of limited human samples such as FFPE material feasible. 9. Abbott RealTime HCV Genotype II; Abbott RealTime HCV Genotype II
Control Kit; and Uracil-N-Glycosylase (UNG) - P120012. Approval Letter:
However, together with the trend of reduction of cost of http://www.accessdata.fda.gov/cdrh_docs/pdf12/P120012a.pdf.
MPS and increase in depth of coverage per sample, next- 10. THxID® - BRAF Kit for use on the ABI 7500 Fast Dx Real-Time PCR
generation sequencing instruments are rapidly evolving. Instrument - P120014. Approval Letter: http://www.accessdata.fda.gov/
RNASeq applications are approaching not only sequence cdrh_docs/pdf12/p120014a.pdf.
determination, but also quantification of transcripts and new 11. cobas® EGFR Mutation Test - P120019 Approval Letter: http://www.
accessdata.fda.gov/cdrh_docs/pdf12/p120019a.pdf.
platforms are approaching sequencing of single molecules
12. Roche’s Rapid Mycoplasma Detection Test MycoTOOL Receives FDA
without amplification. When the technology reaches this Acceptance for Release Testing of Biopharmaceutical Roche Product.
point, it may well replace PCR-based diagnostics (rapid point PR Newswire Clinical Trials/Medical Discoveries News <img src=”http://
of care detection of infectious pathogens or known cancer pharmalicensing.com/public/img/prnewswire.gif” alt=”PR Newswire”
mutations such as in EGFR gene for example). However, that align=”center” class=”nitflogo” /— PENZBERG, Germany, December 19,
2012 PENZBERG, Germany, December 19, 2012 /PRNewswire/.
is still in the future. PCR-based applications continue as a
13. NCBI PubMed database http://www.ncbi.nlm.nih.gov/pubmed/.
significant work engine supporting research, development
14. Centre for Disease Control and Prevention. Good laboratory Practices for
and diagnostics. Molecular Genetic Testing for Heritable Disease and Conditions. Morbidity
and Mortality Weekly Report, June 2009, Vol. 58, p.1-37, No. RR-6 www.cdc.
Appendix A:
Protocols
108 sigma.com
Protocols
Controls Loading PCR/qPCR plates
It may appear to be cost effective to neglect controls in When using a PCR plate, follow a plate schematic system to
favor of samples, but in the long term, experimental validity ensure that the reaction mix, samples and controls are added
is compromised and attempts to troubleshoot will be futile. to the correct wells. Briefly spin the reaction plate or tubes
In any experiment, appropriate controls serve two major to collect the samples at the bottom and to remove bubbles
purposes; ensuring the experimental results are a result of before running the reactions.
the test procedure and providing diagnostic data when an
There is debate as to whether to first load the sample or the
experiment fails.
reaction mix into the plate. Since opinions are divided, the
The actual definition of “appropriate control” will be governed choice will be personal preference, but there are several things
by the specifics of the experiment. Some suggestions include: to keep in mind.
• Positive control: A sample of DNA or cDNA known to When loading the master mix (containing all reaction
contain the target sequence of interest. If the amplicon components except DNA target) first, there is reduced chance
is short (<130 bases), an artificial oligo that matches the of cross contamination of sample from well to well and a
target of interest can be used as a positive control. single tip can be used safely. However, most conventional
• Negative control: A sample of DNA or cDNA that does not reactions consist of 15–25 μL with 2–5 μL of DNA template.
This means that when adding the template to the wells there
contain the target sequence of interest.
is little opportunity to check sample loading. One solution is
• Water/contamination control or No Template to cover the plate with a clean film and pierce the seal to add
Control (NTC): A water or NTC is a useful control to add to the sample, thus pierced wells can be tracked during plate
the plate as a monitor of potential contamination of the loading. In contrast, if the small volume of sample is added to
reactions with template. the wells before the master mix, it is possible to verify visually
• RT minus control: To identify contaminating genomic that each well contains sample and the volume is correct.
DNA (gDNA) in mRNA samples, each RNA sample is However, prior to the subsequent addition of master mix, the
incubated in a RT reaction mix that does not contain samples must be collected into the bottom of the wells and
RT enzyme. addition of master mix must be performed carefully to prevent
The final results of an experiment are only valid if the carry-over template contamination.
accompanying controls also show the correct results.
110 sigma.com
Protocol 1: OligoArchitect Assay Design
with blue and red fonts, respectively, in the target sequence.
Second, the primers are listed below the target sequence
window together with GC content, temperature characteristics
and other oligo properties (Figure P1‑3). The property “Rating”
is the estimate that is calculated by the design algorithm for
the design quality. Ratings above 50 are considered “good” and
normally pass the algorithm criteria for approval to use. Ratings
above 75 are listed as “best” and, thus, give extra confidence in
the design quality.
Clicking the “View All Results” button allows the user to
consider other alternative designs (Figure P1‑4). This may be
useful if the user has specific preferences that are not covered
by the design parameters. Selection of the design is done by
toggling the check box on the left-hand side of the design
parameters table. Once satisfied with the selection, results
can be exported to a local Microsoft® Excel file by clicking Figure P1-4. Alternative Primer Options.
“Export for Synthesis” or entered directly into the Sigma online
ordering tool for immediate ordering by clicking “Place an
Order for Synthesis”.
End-point PCR Assay Design
Like SYBR Green I assay designs, end-point PCR assay designs
are also based on two, usually non-modified, oligos that prime
PCR amplification events. The difference is that amplification
detection occurs by identification on a gel or by a fragment
analysis instrument for end-point PCR. This means that the
length of the amplification product may need to be larger than
for SYBR Green I qPCR assays. To modify the amplicon length,
rather than clicking on “Search” immediately (as described
above), the “Primer Parameters” link is opened, then scroll
down and adjust the parameter for “Amplicon Length” from the
default setting to a range from 300 to 2,000 nucleotides long
(Figure P1‑5) before selecting “Search”. In the example of the
human GAPDH (NM_002046) design, the resulting assay has
an amplicon of 352 nucleotides long (Figure P1‑6).
Figure P1-6. Longer Amplicon Indicated by Primers (Blue and Red) Suitable for
End-point PCR. Figure P1-7. Adding Target Sequence for Dual-Labeled Probe Design.
112 sigma.com
Protocol 1: OligoArchitect Assay Design
increases exponentially with the number of oligos in the assay.
Therefore, it is prudent to avoid higher orders of multiplex
assay, if possible, considering other limitations of the assay.
Figure P1-12B. Potential Oligo Interactions for Three Genes in Multiplex (cont’d).
114 sigma.com
Protocol 1: OligoArchitect Assay Design
Figure P1-14. Error Message Indicating that No Suitable Probe Could be Summary
Designed (Gs > Cs). In this protocol, the application of OligoArchitect Online
has been demonstrated for the design of primers suitable
for use with SYBR Green I and end-point-PCR assays; Dual-
Labeled Probes for single as well as multiplex assays and
assays targeting a specific SNP. More features are available
within OligoArchitect Online that are beyond the scope of
this protocol, including application of Molecular Beacons,
LightCycler® Probes and Scorpions® Probes. For specific
capabilities outside those available in OligoArchitect Online,
consult the Sigma Custom Products design teams.
Oligo technical team: [email protected]
Consultative design team: sigma.com/probedesignonline
— 100
Table P2-1. Hot Start DNA Polymerase Enzymes and Buffers (Sigma).
Hot Start DNA Polymerase
Standard Format–Separate Components ReadyMix–Premixed PCR Master Mix
Separate MgCl2
Containing MgCl2 (for MgCl2 Optimization) Containing MgCl2
With red dye for direct Clear formulation Clear formulation Clear formulation With red dye for direct
load on gels without dye without dye without dye load on gels
JumpStart™ REDTaq® DNA JumpStart™ Taq DNA JumpStart™ Taq DNA JumpStart™ Taq JumpStart™ REDTaq®
Polymerase Polymerase, with MgCl2 Polymerase, without MgCl2 ReadyMix™ ReadyMix™
Cat. No. D8187 Cat. No. D9307 Cat. No. D4184 Cat. No. P2893 Cat. No. P1107
116 sigma.com
Protocol 2: Antibody–Enzyme Mediated Hot Start PCR
• PCR grade water (Sigma W1754 or dispense Sigma W4502 Table P2-2B. Reaction Master Mix Components for ReadyMix Format
into 20 mL aliquots and freeze; use a fresh aliquot for each Hot Start DNA Polymerases.
reaction). Final Concentration Master Mix Volume (μL)
• DNA/cDNA template: Component (in a 25 μL Reaction) per Single 25 μL Reaction
JumpStart Taq ReadyMix (2×) 1× 12.5
• cDNA reaction diluted 1:10 to detect medium to
Forward/reverse primer 50–500 nM 0.1 to 1
highly expressed targets or between 1:2 to 1:5 for (10 μM stock)
rare transcripts. PCR grade water Up to 20 μL Up to 20
118 sigma.com
Protocol 3: dNTP-Mediated Hot Start PCR
Supplies Table P3-4A. Reaction Master Mix Components for Hot Start dNTPs
Using Standard Cycling Conditions.
• Sterile filter pipette tips Volume (µL) per
• Sterile 1.5 mL screw-top microcentrifuge tubes Component Final Concentration Single 25 µL Reaction
(Sigma CLS430909) 10× PCR Buffer without MgCl2 1× 2.5
• PCR tubes and plates, select one of the following to match MgCl2 (25 mM) 2.5 mM 2.5
desired format: Forward Primer (10 µM) 20–500 nM 0.04 to 0.1
Reverse Primer (10 µM) 20–500 nM 0.04 to 0.1
• Individual thin-walled 200 µL PCR tubes Hot Start dNTP solution 0.4 mM 1
(Sigma Z374873 or P3114) Taq DNA polymerase 5 units/µL 0.05 units/µL 0.25
• Strip tubes, 200 µL (Sigma Z374962) PCR grade water Up to 20 µL
• 96-well plates (Sigma Z374903) Note: Cat. No. D4545 includes Taq DNA polymerase (D6677), 10× PCR buffer (P2317) and
25 mM MgCl2.
• 384-well plates (Sigma Z374911)
• CleanAmp™ dNTPs (Sigma DNTPCA2 or DNTPCA10). Table P3-4B. Reaction Master Mix Components for Hot Start dNTPs
Enzyme and compatible buffer, for example one of Using Fast Cycling Conditions.
the following: Volume (µL) per
• D4545 (Sigma) which is supplied with a 10× PCR buffer Component Final Concentration Single 25 µL Reaction
10× PCR Buffer without MgCl2 1× 2.5
and separate MgCl2
MgCl2 (25 mM) 4.0 mM 4
• D1806 (Sigma) which is supplied with a 10× PCR buffer Forward Primer (10 µM) 20–500 nM 0.04 to 0.1
containing MgCl2 Reverse Primer (10 µM) 20–500 nM 0.04 to 0.1
Hot Start dNTP solution 0.4 mM 1
Method Taq DNA polymerase 5 units/µL 0.20 units/µL 1
PCR grade water Up to 20 µL
1. With the exception of the Hot Start dNTPs and DNA
polymerase, thaw the reaction components, vortex to mix, Note: Cat. No. D4545 includes Taq DNA polymerase (D6677), 10× PCR buffer (P2317) and
25 mM MgCl2.
centrifuge briefly and store on ice.
2. Prepare Hot Start dNTPs: Table P3-4C. Reaction Master Mix Components for Hot Start dNTPs for
a. Thaw at room temperature or on ice. Muliplexed Reactions.
b. Vortex and pulse centrifuge to thoroughly mix. Volume (µL) per
Component Final Concentration Single 25 µL Reaction
c. If necessary, remove an aliquot of the stock solution
10× PCR Buffer without MgCl2 1× 2.5
and dilute with water or buffer (pH 8–10.5) to desired MgCl2 (25 mM) 2.5 mM 4
working concentration. Forward Primer (10 µM) 20–500 nM 0.04 to 0.1
3. Prepare a master mix containing all components except for Reverse Primer (10 µM) 20–500 nM 0.04 to 0.1
the DNA template sample. Add each of the components as Hot Start dNTP solution 0.4 mM 1
shown in Tables P3-4A, P3-4B or P3-4C (select appropriate Taq DNA polymerase 5 units/µL 0.05–0.10 units/ µL 0.25–0.5
experiment and cycling conditions; multiply amounts by PCR grade water Up to 20 µL
the number of reactions needed) in a microcentrifuge Note: Cat. No. D4545 includes Taq DNA polymerase (D6677), 10× PCR buffer (P2317) and
tube, on ice. 25 mM MgCl2.
*Note: Dependent upon amplicon size: 30 sec for up to 500 bp. Add 1 min for each
additional 1 kb.
Table P3-5B. PCR Cycling Conditions for Use with Hot Start dNTPs
Under Fast Cycling Conditions.
Hot Start dNTP Fast Cycling Conditions Temp (°C) Time
Initial Hot Start/denaturation 98 5min
Steps 1–2 are repeated through 30–40 cycles
Step 1 95 5 sec
Step 2 65 5 sec
120 sigma.com
Protocol 4: SYBR Green I Dye Quantitative PCR
122 sigma.com
Protocol 4: SYBR Green I Dye Quantitative PCR
Method 4. Setup reactions:
Assays run in KiCqStart ReadyMix are optimal when using a a. For NTC reactions, add 5 μL of water to the reaction
higher primer concentration than in conventional PCR. In the tubes.
protocols below, 450 nM final concentration is used. This has b. For experimental reactions, add 5 μL of cDNA/gDNA
been observed to be the optimal concentration for several solution to the reaction tubes.
independent assays. However some assays may benefit from c. Visually confirm that all tubes or wells contain sample at
further optimization and procedures for this are described in the bottom at the correct volume.
Protocols 13 and 14. d. Carefully aliquot 15 μL of reaction master mix into each
1. Place all reaction components on ice. qPCR tube or plate well.
2. Mix and briefly centrifuge to collect contents at the bottom e. Cap tubes or seal the PCR plate and label (according to
of the tube. instrument requirements). (Make sure the labeling does
3. Prepare sufficient master mix to run all samples in not obscure instrument excitation/detection light path.)
duplicate. f. Mix reactions well and spin if needed.
a. Include duplicate No Template Negative Controls (NTC). 5. Run samples according to the cycling protocol in
b. Calculate amount of reagents to mix. Add 10% volume Table P4‑9 and repeat the run of steps 1–3 for 40 cycles.
to allow for pipetting error. (Note: These conditions are specific for FAST cycling
protocols).
c. Mix well, avoiding bubbles.
Table P4-9. Fast PCR Cycling Conditions.
Table P4-8. Reaction Master Mix for KiCqStart Reagents. FAST Cycling Conditions Temp (°C) Time (sec)
Target Final Volume (µL) per Initial Hot Start/denaturation 95 30
Reagent Concentration Single 20 μL Reaction Steps 1–3 are repeated through 40 cycles
2× KiCqStart SYBR Green qPCR ReadyMix 1× 10 Step 1 95 5
Forward primer (10 µM stock) 0.45 µM 0.9 Step 2 58 15
Reverse primer (10 µM stock) 0.45 µM 0.9 Step 3 72 10
PCR grade water - 3.2
Note: Use standard dissociation curve protocol (data collection)
• PCR grade water: PCR grade water (W1754 or W4502) as PCR grade water 3.8
124 sigma.com
Protocol 5: qPCR Using a Single Detection Probe
11. Note: For reactions containing Scorpions® Probes or
Molecular Beacons, a three-step protocol (Table P5-12)
may result in more efficient/sensitive detection. When
adopting this protocol, the annealing temperature of
step 2 can be optimized (see Protocol 14). Cycle steps 1–3
through 40 cycles.
12. See Chapter 10 and the instrument manual for guidance
on data analysis.
Table P5-11. Fast PCR Cycling Conditions.
FAST Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1 and 2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30
126 sigma.com
Protocol 6: Multiplex qPCR
5. Add 5 μL of water to the NTC reaction tubes.
6. Add 5 μL of cDNA/gDNA solution to the appropriate
tubes/wells.
7. Aliquot 15 μL template master mix remaining from step 4
into the PCR tubes.
8. Cap tubes or seal the PCR plate and label (according to
instrument requirements). (Make sure the labeling does not
obscure instrument excitation/detection light path.)
9. Centrifuge briefly and visually check that all tubes/wells
contain sample at the bottom at the correct volume.
10. Run samples according to the two-step protocol
(Table P6‑15), repeating steps 1–2 through 40 cycles.
(Note: These conditions are specific for FAST cycling
protocols).
11. For reactions containing Scorpions® Probes or Molecular
Beacons, a three-step protocol (Table P6‑16) may result
in more efficient/sensitive detection. When adopting this
protocol, the annealing temperature of step 2 can be
optimized. Cycle steps 1–3 through 40 cycles.
Table P6-15. Fast PCR Cycling Conditions.
FAST Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1–2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30
Protocol 7: dPCR
dPCR is a relatively new technology and each platform and
application has specific requirements (see Chapter 4 for
Sample Requirements
further details). The protocols are specific for each system • Template Quality: Template should be high quality purified
and are provided, with excellent support, by the instrument gDNA free from inhibitors. It is recommended to digest
manufacturers. Therefore, the information provided below is template gDNA with appropriate restriction endonucleases
a starting point from which specific assays can be developed (1 µg DNA/40 µL reactions) and heat inactivate enzymes
or optimized. after digestion at 65 °C for 20 minutes. Following heat
inactivation, the template DNA should be diluted at least
Bio-Rad QX100 System 7.5× to ensure proper template partitioning.
The Bio-Rad digital droplet system is based on oil • Template Quantity: The amount of template to be
emulsification technology and uses a standard 96-well plate included in each experiment depends on the relative
format. Each sample is partitioned into 20,000 reactions, abundance of the target gene and the amount of droplets
yielding a total of 1.9 million reactions per plate. Reactions are partitioned. The Bio-Rad ddPCR system partitions reactions
set up using Dual-Labeled Probes containing a 5’ fluorescent into 20,000 droplets and it is therefore recommended to
label and a 3’ quencher, standard to qPCR reactions. The use 100 ng gDNA in a 20 µL reaction when the target gene
droplet reader is capable of reading end-point fluorescent is represented by a single copy. It may be necessary to
signals in the FAM and HEX channels allowing reactions to be reduce input DNA in cases where the target gene exceeds
multiplexed with 2 targets per sample. 8 copies per diploid sample.
http://www.bio-rad.com/webroot/web/pdf/lsr/
Requirements literature/bulletin_6277.pdf
• QX100 Droplet Generator (186-3002; Bio-Rad) Standard Protocol
• QX100 Droplet Reader (186-3003; Bio-Rad) A 20× primer/probe mix is prepared as described below. The
• C100 Touch Thermal Cycler with 96-well Fast Reaction standard ddPCR master mix is a 25 µL mix that includes the
Module (185-1196; Bio-Rad) aforementioned primer/probe mix, template DNA and 2×
• Semi skirted 96-well PCR plate (Eppendorf Cat# 951020362) ddPCR super mix.
• Bio-Rad 2× ddPCR supermix (186-3010; Bio-Rad) Table P7-17. dPCR Primer and Probe Mix.
• Droplet generation oil (186-3005; Bio-Rad) 20× Primer/Probe Mix Volume (μL) per 100 μL
• Cartridge holder (186-3051; Bio-Rad) 100 µM F1 primer 10
100 µM R1 primer 10
• 8-chamber cartridges (186-3008; Bio-Rad) 100 µM labeled probe 5
• Rubber gaskets (placed over cartridge to create vacuum PCR grade water 75
seal; 186-3009; Bio-Rad)
• Pierceable foil heat seal (181-4040; Bio-Rad) Table P7-18. dPCR Reaction Master Mix.
• Primers and probes(100 μM stocks): Available from Volume (μL) per Single
sigma.com/oligos Reagent 25 μL Reaction
2× ddPCR super mix 12.5
20× Primer/Probe Mix 1.25
Template (100 ng/µL) 1
PCR grade water 10.25
128 sigma.com
Protocol 7: dPCR
Samples are loaded into an 8 chamber cartridge using 20 µL
of the prepared qPCR sample followed by 70 µL of droplet
generation oil in the adjacent wells. A rubber gasket is
stretched across the top of the chambers to ensure a vacuum
seal. Each 8 chamber cartridge is loaded onto the QX100
droplet generator producing 20,000 droplets per sample.
Using a 50 µL multichannel pipette, 40 µL of the generated
droplets are transferred to a 96-well plate and heat sealed
with pierceable foil. The plate is placed in a thermal cycler
using standard 2-step qPCR thermal cycling conditions with
a 50% (3 °C/sec) ramp rate. Prior to running thermal cycling
conditions, it is recommended to test new primer/probe
sets using a temperature gradient to optimize the anneal/
extend temperature.
130 sigma.com
Protocol 8: The SPUD Assay for Detection of Assay Inhibitors
Method
1. Place all reaction components on ice.
2. Mix and then centrifuge briefly to collect contents at the
bottom of the tube.
3. Determine the total number of samples to be tested in
duplicate and also allow for two No Test Sample Controls.
4. Prepare master mix for all samples and controls according
to Table P8-21 allowing 10% extra to allow for pipetting
error. Mix well.
Table P8-21. qPCR Master Mix for SPUD Inhibitor Test.
Volume (µL) per
Reagent Single 25 μL Reaction
2× KiCqStart ReadyMix 12.5
SPUD Primer F (10 μM stock) 0.25
SPUD Primer R (10 μM stock) 0.25
SPUD template (pre diluted to 20,000 copies/µL) 1
Reference dye (instrument specific, see Table P4-7) 1
PCR grade water 5
132 sigma.com
Protocol 9: The 3’/5’ Assay for Analysis of RNA Integrity
5. Aliquot 20 μL of qPCR master mix into the PCR tubes/wells.
If using a PCR plate, follow a plate schematic to ensure that
the reagents and controls are added to the correct wells.
6. Add 5 μL cDNA sample into qPCR tubes/wells.
7. Cap tubes or seal the PCR plate and label. (Make sure the
labeling does not obscure instrument excitation/detection
light path.)
8. Samples should be run according to the three-step
protocol provided in Table P9-25. Following the initial hot
start, steps 1–3 are repeated through 40 cycles.
Note: The conditions on Table P9-25 are optimal for the
human GAPDH example assay given. However it may be
appropriate to run alternative assays using the two-step
protocol as described in Table P5-11, Protocol 5.
Table P9-25. qPCR Cycling Conditions for the 3’/5’ Integrity Assay.
Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1–3 are repeated through 40 cycles
Step 1 95 5
Step 2 55 15
Step 3 72 10
Reverse Transcription
Reverse transcription (RT) is the process of converting RNA to The following experiments can be used as basic RT protocols
cDNA using a reverse transcriptase enzyme and dNTPs. that can be modified to suit particular requirements. It is
customary to either prepare cDNA using a two-step process
The RT step may be performed on total RNA such that a global
with subsequent dilution of the cDNA prior to adding it to
cDNA is produced that is representative of all of the RNA
the PCR/qPCR, or to prepare a one-step reaction where both
transcripts in the sample (usually via a two-step protocol), or in
processes are carried out sequentially.
a gene-specific approach such that only the RNA of interest is
converted to cDNA (usually following a one-step protocol).
• Sterile filter pipette tips 2. After sealing each reaction, vortex gently to mix contents.
• Sterile 1.5 mL screw-top microcentrifuge tubes Centrifuge briefly to collect components at the bottom of
(Sigma CLS430909) the reaction tube.
• PCR tubes and plates, select one to match desired format: 3. Incubate reaction mix according to Table P10-27.
• Individual thin-walled 200 µL PCR tubes Table P10.27. ReadyScript® cDNA Synthesis Reaction Temperature
(Sigma Z374873 or P3114) Incubation Profile.
• Plates Temperature (°C) Time (min)
- 96-well plates (Sigma Z374903) 25 5
42 30
- 384-well plates (Sigma Z374911)
85 5
• Plate seals or caps 4 Hold
- ThermalSeal RTS™ Sealing Films (Sigma Z734438)
4. After completion of cDNA synthesis, use 1:5 to 1:10 of the
- ThermalSeal RT2RR™ Film (Sigma Z722553)
first-strand reaction (2–4 μL) for PCR amplification.
Method Note: when using ReadyScript® reagents, 2–4 μL undiluted
cDNA can be added to PCR without causing inhibition.
Preparation If desired, cDNA product can be diluted with 10 mM Tris-
1. Place ReadyScript® kit components and RNA samples HCl (pH 8.0), 0.1 mM EDTA and stored at –20 °C.
on ice.
2. Mix and then centrifuge briefly to collect contents at the
bottom of the tube.
134 sigma.com
Protocol 11: Reverse Transcription Protocol (One-step SYBR Green I Dye Detection)
• Sterile 1.5 mL screw-top microcentrifuge tubes 5. Add 1 μL total RNA (250–2500 ng total per reaction)
(Sigma CLS430909) to each PCR tube. If using a PCR plate, follow a plate
• PCR tubes and plates, select one to match desired format: schematic to ensure that the reaction mix, samples and
• Individual thin-walled 200 µL PCR tubes controls are added to the correct wells.
(Sigma Z374873 or P3114) 6. Add 24 μL master mix to each well, adding the No RT mix
to the minus RT control samples.
• Plates
7. After sealing each reaction or the plate, vortex gently to
- 96-well plates (Sigma Z374903)
mix contents.
- 384-well plates (Sigma Z374911)
8. Centrifuge briefly to collect components at the bottom of
• Plate seals the reaction tubes.
- ThermalSeal RTS™ Sealing Films (Sigma Z734438) 9. Set the real-time qPCR according to Table P11-29.
- ThermalSeal RT2RR™ Film (Sigma Z722553)
Table P11-29. RT PCR Cycling Parameters for One-step SYBR Green I
Method RT-qPCR.
Cycling Conditions Temp (°C) Time
In the example given below, the primer concentrations can be
First strand synthesis 42–44 30 min
adjusted according to the results of optimization procedures Denaturation/RT inactivation 94 30 sec
(see Protocols 13 and 14 and Chapter 9). Steps 1–3 are repeated through 40 cycles
1. Place kit components and RNA samples on ice. Step 1 95 5 sec
Step 2 55 15 sec
2. Mix and then centrifuge briefly to collect contents at the
Step 3 72 10 sec
bottom of the tube.
10. Run post-reaction melt analysis.
136 sigma.com
Protocol 13: Primer Concentration Optimization
Reagents 400
600
• Suitable assay template, e.g., cDNA diluted 1:10, gDNA, or 800
synthetic oligo template. NTC
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/ Figure P13-18. Schematic Representation of the Primer Optimization Plate Layout.
KCQS01/KCQS02/KCQS03—depending on instrument, see
Table P4-6 for instrument compatibility).
Method
• PCR grade water: PCR grade water (W1754 or W4502) as
Note: 2.0 μL of each primer will be added to the reaction
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
of 20 μL total volume. For this reason, primer stocks are 10
• Forward and reverse primers concentration stocks (10 µM times the required concentration to achieve the desired final
working stocks). concentration.
• Custom oligos can be ordered at sigma.com/oligos. 1. Using the 10 μM primer stock, make a dilution of both
primer stocks to 0.5, 1, 2, 4, 6 and 8 μM as shown in
Supplies Table P13-32.
• Sterile filter pipette tips Table P13-32. Primer Dilution Scheme for Primer Concentration
• Sterile 1.5 mL screw-top microcentrifuge tubes Optimization.
(Sigma CLS430909)
Final Volume (μL) Volume (μL) Total
• PCR tubes and plates, select one to match desired format: Concentration (μM) H2O 10 μM Stock Volume (μL)
0.5 47.5 2.5 50
• Individual thin-walled 200 µL PCR tubes
1 45 5 50
(Sigma Z374873 or P3114)
2 40 10 50
• Plates 4 30 20 50
- 96-well plates (Sigma Z374903) 6 20 30 50
8 20 80 100
- 384-well plates (Sigma Z374911)
• Plate seals 2. Prepare a qPCR master mix according to Table P13-33
- ThermalSeal RTS™ Sealing Films (Sigma Z734438) (Note: Template and cDNA are added separately in step 5).
Mix well.
- ThermalSeal RT2RR™ Film (Sigma Z722553)
138 sigma.com
Protocol 14: Primer Optimization Using Temperature Gradient
• PCR grade water: PCR grade water (W1754 or W4502) as Forward primer (10 µM)
Reverse primer (10 µM)
0.9
0.9
50.4
50.4
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
PCR grade water 4.2 235.2
• Forward and reverse primers concentrated stocks (10 µM
working stocks: GOI). 2. Remove 448 μL of master mix from step 1 (i.e., half ) into a
• Custom oligos can be ordered at sigma.com/oligos. separate tube for setting up the No Template Control (NTC)
reactions.
Supplies 3. Add 112 μL of template to the remaining master mix from
• Sterile filter pipette tips step 2. Set Template master mix on ice.
• Sterile 1.5 mL screw-top microcentrifuge tubes 4. Add 112 μL of water to the other half of the master mix
from step 2. Set NTC master mix on ice.
(Sigma CLS430909)
5. Aliquot 20 μL Template master mix from step 3 into two
• PCR tubes and plates, select one to match desired format:
rows of the PCR plate labeled GOI.
• Individual thin-walled 200 µL PCR tubes
6. Aliquot 20 μL NTC master mix from step 4 into two rows of
(Sigma Z374873 or P3114)
the PCR plate labeled NTC.
Temperature Gradient
54 TM TM TM TM TM TM TM TM TM TM 70
GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1
GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1
NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC
NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC
Note: The distribution of the samples and controls across the temperature gradient. If the
instrument has a temperature gradient that varies vertically down the plate column, the samples
and controls will need to be re-arranged accordingly.
Figure P14-19. Plate Layout for Ta Optimization With Identical Ta for Each Column.
140 sigma.com
Protocol 15: qPCR Reference Gene Selection
• Quantitative PCR instrument • Test a wide range of genes that may be potential reference
genes. These should be expressed in different functional
• Laminar flow hood for PCR set up (optional) gene pathways. A selection of potential KiCqStart SYBR
Primers for some model organisms (sigma.com/ksprimers)
Reagents is given in Table P15-37. OligoArchitect (sigma.com/
• cDNA diluted 1:100 (the more dilute cDNA is usually probedesignonline) is a suitable design tool for alternative
sufficient to detect highly expressed reference genes, for primer designs (see Protocol 1 and Chapter 6).
medium expressed genes use 1:10 dilution).
Table P15-37. Potential Reference Gene Candidates and KiCqStart
• KiCqStart SYBR Green ReadyMix™ (Sigma KCQS00/ Product Codes.
KCQS01/KCQS02/KCQS03—depends on instrument, see
Table P4-6). Reference Gene Mouse Human Rat
CANX M_Canx_1 H_CANX_1 R_Canx_1
• PCR grade water: PCR grade water (W1754 or W4502) as HPRT1 NA H_HPRT1_1 R_Hprt1_1
20 mL aliquots; freeze; use a fresh aliquot for each reaction. PGK1 M_Pgk1_1 H_PGK1_1 R_Pgk1_1
Supplies PPIA
GUSB
NA
M_Gusb_1
H_PPIA_1
H_GUSB_1
R_Ppia_1
R_Gusb_1
• Sterile filter pipette tips GAPDH NA H_GAPDH_1 NA
Method
1. Calculate the number of reactions required for
each reference gene. Prepare sufficient mix for two
reactions per sample. For example if testing 5 test and
5 control samples, two No Template Controls (NTC) =
22 reactions. Calculate sufficient for 10% extra to allow for
pipetting error.
2. Prepare qPCR master mix for each Reference Gene primer
pair according to Table P15-38. Do not add cDNA to the
master mix. Mix well and avoid bubbles.
Table P15-38. qPCR Master Mix for Reference Gene Selection.
Volume (µL) per Single
Reagents 20 μL Reaction
2× KiCqStart SYBR Green qPCR ReadyMix 10
Forward primer (10 μM) 0.9
Reverse primer (10 μM) 0.9
PCR grade Water 3.2
142 sigma.com
Protocol 16: qPCR Efficiency Determination
Protocol 16: qPCR Efficiency Determination
Once an assay has been optimized, it is important to verify
the reaction efficiency. This information is important when
Supplies
reporting and comparing assays. In this example protocol, the • Sterile filter pipette tips
assay efficiency is compared over a wide and narrow dynamic • Sterile 1.5 mL screw-top microcentrifuge tubes
range of cDNA concentrations. In practice, it is common to (Sigma CLS430909)
select a single range to test depending on the expected range • PCR tubes and plates, select one to match desired format:
of target in the samples, so the protocol given can be adjusted
according to the requirements of the experiment. In this • Individual thin-walled 200 µL PCR tubes
example the efficiency is calculated using both 10-fold and (Sigma Z374873 or P3114)
2-fold dilution series. The standard curve should encompass • Plates
the expected range of expression for the genes of interest - 96-well plates (Sigma Z374903)
Note that the proportionality of the cDNA yield with respect to - 384-well plates (Sigma Z374911)
RNA input is linear when using the ReadyScript® RT kit, so this • Plate seals
experiment can be adapted to RT-qPCR if using that system
- ThermalSeal RTS™ Sealing Films (Sigma Z734438)
by 1) diluting the RNA and running the RT reactions and 2)
then running qPCR on each of the resulting cDNA samples - ThermalSeal RT2RR™ Film (Sigma Z722553)
(see Chapter 8 for examples). However, this is not always the
case and does not apply for all Reverse Transcription kits or Notes for this Protocol
protocols. This should be verified before adapting this protocol • cDNA is generated using random priming or oligo-dT
to an alternative kit method (see Protocol 10). The RT product is diluted to
prepare the standard curves (1:2 and 1:10 are given as
Equipment examples). RNA can also be diluted and cDNA synthesized
from each dilution using the ReadyScript® kit or a one-step
• Quantitative PCR instrument RT-qPCR approach can be adopted by diluting RNA and
• Laminar flow hood for PCR set up (optional) following the one-step RT-qPCR approach in Protocols 11
and 12. Alternatively, DNA templates can be substituted
Reagents such that the expected Cq range is within Cq 15 to Cq 38.
• DNA to be used as the standard curve template (e.g., cDNA, • Each concentration of the serial dilutions will be run as
gDNA or a synthetic template). duplicate reactions.
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/
KCQS01/KCQS02/KCQS03—depends on instrument, see Method
Table P4-6). 1. Prepare a qPCR master mix that is sufficient for 40
• PCR grade water: PCR grade water (W1754 or W4502) as reactions following Table P16-40. This allows for extra to
20 mL aliquots; freeze; use a fresh aliquot for each reaction. accommodate pipetting errors since 32 reactions will be
run (Table P16-41).
• Forward and reverse primers for test genes (stock at
10 μM). Table P16-40. Reaction Master Mix for Generation of 1:2 and
1:10 Standard Curve.
Volume (µL) per Volume (µL) for
Reagents Single 20 μL Reaction 40 Reactions
2× KiCqStart SYBR Green qPCR 10 400
ReadyMix
Forward primer (10 µM) 0.9 36
Reverse primer (10 µM) 0.9 36
PCR grade water 3.2 128
144 sigma.com
Protocol 17: qPCR Gene Expression/Copy Number Analysis Using SYBR Green I Dye Detection
• Laminar flow hood for PCR set up (optional) • If using a PCR plate, follow a plate schematic to ensure that
the reaction mix, samples and controls are added to the
Reagents correct wells.
• gDNA 10ng to 100ng or cDNA to be used as template • All tests will be run as duplicate reactions.
(diluted 1:2 for low expressed genes to 1:10 to 1:100 for
medium to high expressed genes).
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/
KCQS01/KCQS02/KCQS03—depends on instrument, refer
to Table P4-6).
• PCR grade water: PCR grade water (W1754 or W4502) as
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
• Forward and reverse primers for test genes (stock at
10 μM).
Method
1. Prepare a different qPCR master mix for each primer pair
to be run. Prepare sufficient mix for the samples, standard
curve reactions (described as six dilutions below), No
Template Controls, all in duplicate plus calculate an extra
10% to allow for pipetting error.
For example, if there are five test samples, prepare a mix for
samples (5×2) plus standard curve (6×2) plus No Template
Control (NTC) (1×2) = 24 reactions. Therefore prepare a mix
for 26.4 or 27 reactions per primer pair.
Table P17-43. Reaction Master Mix for SYBR Green I Detection.
Volume (µL) per Single
Reagents 20 μL Reaction
2× KiCqStart SYBR Green qPCR ReadyMix 10
Forward primer (10 μM) 0.9
Reverse primer (10 μM) 0.9
PCR grade water 3.2
146 sigma.com
Protocol 18: qPCR Gene Expression/Copy Number/SNP Analysis Using Probe Detection
Method
1. Prepare a different qPCR master mix for each primer pair to
be analyzed. Calculate sufficient mix for the standard curve
reactions (described as six dilutions below), No Template
Controls (NTC) and for each sample, all in duplicate plus an
extra 10% to allow for pipetting errors (Table P18-45).
Note: Adjust water volume to accommodate addition of
additional primers and probes for multiplex reactions or
add blended, concentrated stocks (see Protocol 6).
Table P18-45. Reaction Master Mix for Probe Detection.
Volume (µL) per Single
Reagents Reaction 25 μL
2× LuminoCt qPCR ReadyMix 12.5
Forward primer GOI (10 μM) 1.125
Reverse primer GOI (10 μM) 1.125
Forward primer REF (10 μM) 1.125
Reverse primer REF (10 μM) 1.125
Probe GOI (10 μM) 0.625
Probe REF (10 μM) 0.625
PCR grade water 1.75
148 sigma.com
Protocol References
Protocol References
1. Kitchen, R.R., Kubista, M., Tichopad, A. Statistical aspects of quantitative 6. Koukhareva, I., Lebedev, A. 3’-Protected 2’-deoxynucleoside
real-time PCR experiment design. Methods 2010; 50: 231-236. 5’-triphosphates as a tool for heat-triggered activation of polymerase
2. Tichopad, A., Kitchen, R., Riedmaier, I., et al. Design and optimization of chain reaction. Anal Chem 2009; 81: 4955-4962.
reverse-transcription quantitative PCR experiments. Clin Chem 2009; 55: 7. Koukhareva, I., Haoqiang, H., Yee, J., et al. Heat activatable 3’-modified
1816-1823. dNTPs: synthesis and application for hot start PCR. Nucleic Acids Symp Ser
3. Manly, B. Randomization, Bootstrap and Monte Carlo Methods. Methods (Oxf ) 2008; 259-260.
in Biology 2nd ed Chapman Hall; 1998: 8. PCR Technologies: Current Innovations. 3 ed. Edited Tania Nolan and
4. Francis, A. Glove me Tender. The Scientist 15th May, 2000: Stephen Bustin CRC Press; 2013.
5. Kellogg, D.E., Rybalkin, I., Chen, S., et al. TaqStart Antibody: “hot start” PCR 9. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
facilitated by a neutralizing monoclonal antibody directed against Taq RT-PCR. Nat Protoc 2006; 1: 1559-1582.
DNA polymerase. Biotechniques 1994; 16: 1134-1137.
Bioflexible.
Whether you need to know molecular weight
and melting temperature or the correct
resuspension and dilution volumes, OligoEvaluator
has the functionality to help you make critical
experimental decisions. Together with our custom
oligonucleotide portfolio, Sigma ensures the
success of every assay — every time.
Appendix B:
Additional Resources
152 sigma.com
Books, Seminars and Tools
General Information • NCBI Probe Database
Contains basic, well-illustrated tutorials of different probe
• AutoPrime technologies and their uses in research and medicine.
http://www.autoprime.de/AutoPrimeWeb http://www.ncbi.nlm.nih.gov/projects/genome/probe/
• Genome Web doc/Overview.shtml
http://www.genomeweb.com/tech-guide-archive
• Online Discussion Groups
• qPCR and REST Data Analysis Such as the Facebook groups MIQE Users Forum (Facebook
All things qPCR and REST data analysis login required)
www.gene-quantification.info/ https://www.facebook.com/groups/201060783292371/
• MIQE Users Forum • MIQE_qPCR and qPCR Technology Hub
LinkedIn groups MIQE Users Forum http://www.technologynetworks.com/qPCR/
http://www.linkedin.com/groups/MIQE-Users-Forum-
3897295?trk=my_groups-b-grp-v (Real Time qPCR and
• Textbooks
A series of technical textbooks
Digital PCR dPCR and NGS) www.qpcrexpert.com
• miRNA Analysis Sigma-Aldrich provides these links as a courtesy for our
A collection of resources for miRNA analysis miRNAtool customers. Inclusion on this list does not imply endorsement
https://sites.google.com/site/mirnatools2/introduction or validation of applications or results.
Sigma-Aldrich will neither collect nor make available any data,
analysis or content information.
154 sigma.com
Products and Support
GenElute™ HP Plasmid Prep Kits LuminoCt® qPCR ReadyMix™
GenElute™ HP Plasmid Prep Kits offer a simple, rapid, cost LuminoCt qPCR ReadyMix is designed to deliver unsurpassed
effective solution for plasmid preparation from E. coli cultures. assay speeds without sacrificing accuracy, precision, or
These kits combine silica-based membrane technology and sensitivity. Inclusion of JumpStart™ Taq antibody in the
the convenience of spin or vacuum format. The recovered ReadyMix eliminates polymerase activity at ambient
plasmid DNA is ready for immediate use in applications such temperatures without causing the performance issues
as restriction digest, cloning, PCR, transfection and sequencing. associated with chemically modified hot start Taq. This allows
Mini, 96-well, Midi, Maxi and Mega formats are available. for very rapid activation of the Taq and delivers unparalleled
assay sensitivity, while allowing for benchtop reaction setup.
For more information, visit
sigma.com/hpplasmid • Cat. No. L6669: For fast probe-based quantitative PCR
156 sigma.com
Products and Support
OligoEvaluator™
OligoEvaluator is a free, online calculator of oligonucleotide
sequence analysis, re-suspension and dilution requirements
that is powered by PREMIER Biosoft. In addition to providing
information such as melting temperature and molecular
weight, additional features include secondary structure
analysis and BLAST searching.
Sigma is pleased to offer OligoArchitect for all of your primer and probe design requirements. OligoArchitect is complimentary
and includes both our online design tool (complete a design by yourself ) and our consultative service (have an expert
complete a design for you).
158 sigma.com
Design Your Probe Online with OligoArchitect™
Do Your Own Design
Open the design tool with the click of a
button.
Reference documents found here
include a Glossary of Parameters and the
Exon Design Protocol. Both are available
in PDF format.
This tool has been enhanced for a third
time and is now able to create designs
with Locked Nucleic Acid® (LNA®).
Easy to Use
Type in the name of your assay, enter
your sequence, and click Search (see
Protocol 1).
All reported sequences, associated
properties, and assay parameters
are available for export to Excel and
convenient email ordering.
The following trademarks and registered trademarks are accurate to the best of our knowledge at the time of publicaton.
Trademarks noted as registered are registered in the United States and possibly other jurisdictions. For the latest information on
a specific product, see our website, sigma-aldrich.com, or consult individual manufacturers.
Agilent Technologies, Inc. — Mx3000P®, Mx3005P®, Mx4000™ Microsoft Corporation — Excel®, Microsoft®
Applied Biosystems — VIC® Molecular Research Center, Inc. — RNAzol®, TRI Reagent®
BioMark Technologies Inc. — BioMark™ OSI Pharmaceuticals, Inc. — TARCEVA®
bioMérieux Société anonyme à conseil Polyplus Transfection — ZNA®
d’administration — THxID®
Premier Biosoft International — Beacon Designer™
Bio-Rad Laboratories, Inc. — Bio-Rad®, CFX384™, CFX96™,
Qiagen Group — Rotor-Gene®, Scorpions®, therascreen®
Chromo4™, ddPCR™, Droplet Digital™, iQ™, MiniOpticon™, MyiQ™,
Opticon™, QX100™ Quanta BioSciences Inc. — KiCqStart®, MystiCq®
Bio-Rad QL, Inc — Quantasoft® RainDance Technologies, Inc. — RainDrop™
Biosearch Technologies, Inc— BHQ®, Black Hole Quencher®, Roche Diagnostics GmbH — MycoTOOL®
Cal Fluor®, Quasar® Roche Diagnostics Operations, Inc. — cobas®
Boehringer Ingelheim International GmbH — GILOTRIF® Roche Molecular Systems, Inc. — LightCycler®, Roche®, TaqMan®
Cepheid, Inc. — SmartCycler® Sigma-Aldrich Co. LLC — BlueView™, DirectLoad™,
Eppendorf AG — Eppendorf®, Mastercycler® Extract-N-Amp™, GenElute™, JumpStart™, LuminoCt®, miRPremier®,
MISSION®, OligoArchitect™, OligoEvaluator™, Onyx Quencher™, OQ™,
Excel Scientific, Inc. — ThermalSeal RT2RR™,
ReadyMix™, ReadyScript®, REDTaq®
ThermalSeal RTS™
The Dow Chemical Company or an affiliated company
Exiqon A/S — LNA®, Locked Nucleic Acid™
of Dow — Triton®
GE Healthcare — Cy®
Thermo Fisher Scientific, Inc. — NanoDrop®
GlaxoSmithKline LLC — Mekinist®, Tafinlar®
TriLink BioTechnologies, Inc. — CleanAmp™
Lehn & Fink, Inc. — Amphyl®
Life Technologies — Applied Biosystems®, FAM™, HEX™,
JOE™, OpenArray®, Oregon Green®, QuantStudio®, QuBit®,
Rhodamine Green™, ROX™, StepOne ™, StepOnePlus™, SYBR®,
TAMRA™, TET™, Texas Red®
160 sigma.com
OligoArchitect™ Online v4.0
The most comprehensive online qPCR Assay
Design Tool from Sigma® Life Science.
Bioconfident.
OligoArchitect Online is now able to create
designs with Locked Nucleic Acid™ (LNA®) for
Dual-Labeled Probes, Molecular Beacons, and
LightCyler® Probes. Together with our custom
qPCR probes portfolio, Sigma ensures the
success of every qPCR assay—every time.
©2014 Sigma-Aldrich Co. LLC. All rights reserved. SIGMA, SAFC, SIGMA-ALDRICH, ALDRICH and SUPELCO are trademarks of Sigma-Aldrich Co. LLC, registered in the US and other countries. FLUKA is a trademark of
Sigma-Aldrich GmbH, registered in the US and other countries. Sigma-Aldrich, Sigma, Aldrich, Supelco, Fluka and SAFC brand products are sold by affiliated Sigma-Aldrich distributors. Purchaser must determine QXN
the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Please see product information on the Sigma-Aldrich website at www.sigmaaldrich.com and/or on the reverse 81636-510152
side of the invoice or packing slip. 1064