How does the genetic management and breeding strategies of BI and AL pig breeds differ from other European pig breeds?

Unlike other European pig breeds, BI and AL breeds have not undergone formal genetic improvement programs. Their performance improvements are primarily due to empirical selection by farmers and enhanced production management practices, such as nutritional strategies. This contrasts with other breeds which typically benefit from structured genetic enhancement programs aimed at improving attributes like litter size and growth rates, leading to different production outcomes .

What are the observed effects of sow nutritional strategies on the phenotype of their offspring, such as the muscle fiber characteristics in pigs?

Sow nutritional strategies during gestation have significant effects on the phenotype of their offspring. For example, increased nutrition during gestation has been shown to affect muscle fiber development and meat quality. However, excessive or poorly balanced nutrition does not always lead to beneficial outcomes, as increased maternal nutrition showed no significant effects on offspring's muscle fiber number or postnatal growth. It's crucial to strike a balance in diet to promote favorable outcomes in offspring phenotype .

What role does L-arginine play in swine reproduction and postnatal growth?

L-arginine is a functional amino acid that plays a critical role in swine reproduction and postnatal growth. It serves as a precursor for nitric oxide and polyamines, which are crucial for angiogenesis, embryogenesis, and placental and fetal growth. Studies demonstrate that dietary supplementation with L-arginine can positively influence the development of progeny, promoting conceptus survival and tissue growth, by stimulating placental growth. This facilitates improved health and development of tissues during gestation .

How have economic transformations affected sheep breeding in the Stavropol Territory, and what measures are proposed to improve the industry?

Economic transformations have led to a drastic decline in sheep numbers and outputs in the Stavropol Territory, with sheep numbers reducing by over 7.1 times since 1990, accompanied by decreases in wool and mutton production. To address these challenges, comprehensive state support is essential, which includes regulation of pricing processes, elimination of price disparities for agricultural and industrial products, subsidies to cover production and sales costs, preferential taxation, and lending. These measures are necessary for the stabilization and profitability of the sheep breeding industry .

What are the current challenges and opportunities in the Russian sheep breeding industry?

Current challenges in the Russian sheep breeding industry include a significant reduction in livestock numbers since the pre-reform period, with a 63% decline by 2010. The industry faces restructuring as the distribution of livestock by farm categories changes. However, opportunities exist in leveraging innovation to improve productivity and efficiency, as extensive practices have relied on inefficient technologies. Activating innovation and improving the organizational and economic mechanisms of breeding can aid in addressing these challenges, alongside state support to stabilize the industry .

How did the decline in agricultural organizations' share of sheep and goat management in Russia contribute to changes in the distribution of livestock by farm categories?

The decline in agricultural organizations' share of sheep and goat management, from comprising 70.6% in 1990 to just 20%, significantly altered the distribution of livestock by farm categories in Russia. Household farms increased their share to 52% while peasant (farm) households accounted for 28%. This shift reflects broader economic transformations and affects the production capabilities and economic viability of other enterprises in the livestock sector, leading to a redistribution of roles within the sheep and goat farm sectors .

How does the use of bentonite clay affect milk production and cow health according to studies?

Studies have shown that bentonite clay supplements can positively impact milk production by increasing it from 8.5% to 10.2%, and enhancing the fat content of milk by 0.10% to 0.22%. Additionally, cows receiving these supplements demonstrated healthier characteristics, such as shinier coats and reduced instances of udder diseases, as observed through visual assessments. The blood analysis also indicated higher hemoglobin levels in cows from the treatment group, suggesting more intense metabolic processes. Importantly, the bentonite clay contributed to reducing inflammation, neutralizing toxins, and enhancing overall productivity .

What are the metabolic and biochemical differences observed between the control and treatment groups of cows fed with kaolin E559?

The cows fed with kaolin E559 (treatment group) exhibited higher levels of globulin in their blood by 5 g/l compared to the control group, indicating enhanced resistance (p<0.001). Their platelet count was also increased, signifying more favorable physiological processes in the liver compared to the control group, even though both groups' platelet parameters were within normal limits. This suggests that metabolic processes were more intense in the treatment group, contributing to better overall health and productivity .

Based on the data, how does the outdoor housing environment influence the effectiveness of kaolin E559 supplements on cows?

The use of kaolin E559 supplements did not show significant benefits for cows housed outdoors. The statistical analysis indicated that individual differences between the control and treatment groups were minor and unreliable. This suggests that when cows are fed natural grass, which usually lacks the toxins present in silos or haylage, the effects of clay supplements on milk production and health metrics become less pronounced .

How do protein levels during gestation affect the growth and development of the progeny in pigs?

Protein levels during gestation significantly impact pig progeny development. Unbalanced protein intake, both low and high, can impair myogenesis, restrict muscle growth potential, and affect postnatal lean growth. High dietary protein can retard fetal growth without markedly altering postnatal muscle and adipose tissue phenotype. These conditions may affect the mammary gland development and lactation performance, influencing milk yield and composition. Therefore, managing protein intake is crucial to promote optimal fetal development and subsequent growth .

Open navigation menu

Upload

100% found this document useful (1 vote)

2K views764 pages

Proceedings 2017

Q: Based on the data, how does the outdoor housing environment influence the effectiveness of kaolin E559 supplements on cows?

The use of kaolin E559 supplements did not show significant benefits for cows housed outdoors. The statistical analysis indicated that individual differences between the control and treatment groups were minor and unreliable. This suggests that when cows are fed natural grass, which usually lacks the toxins present in silos or haylage, the effects of clay supplements on milk production and health metrics become less pronounced .

Q: How do protein levels during gestation affect the growth and development of the progeny in pigs?

Protein levels during gestation significantly impact pig progeny development. Unbalanced protein intake, both low and high, can impair myogenesis, restrict muscle growth potential, and affect postnatal lean growth. High dietary protein can retard fetal growth without markedly altering postnatal muscle and adipose tissue phenotype. These conditions may affect the mammary gland development and lactation performance, influencing milk yield and composition. Therefore, managing protein intake is crucial to promote optimal fetal development and subsequent growth .

11th INTERNATIONAL SYMPOSIUM „MODERN TRENDS IN LIVESTOCK PRODUCTION“

Uploaded by

vedadsa

We take content rights seriously. If you suspect this is your content, claim it here.

Available Formats

Download as PDF, TXT or read online on Scribd

Topics covered

economic analysis,
agricultural policies,
meat quality,
autochthonous breeds,
food safety,
animal breeding programs,
organic farming,
crossbreeding,
consumer preferences,
myogenesis

100% found this document useful (1 vote)

2K views764 pages

Proceedings 2017

11th INTERNATIONAL SYMPOSIUM „MODERN TRENDS IN LIVESTOCK PRODUCTION“

Uploaded by

vedadsa

We take content rights seriously. If you suspect this is your content, claim it here.

Available Formats

Download as PDF, TXT or read online on Scribd

Topics covered

economic analysis,
agricultural policies,
meat quality,
autochthonous breeds,
food safety,
animal breeding programs,
organic farming,
crossbreeding,
consumer preferences,
myogenesis

ISBN 978-86-82431-73-2

MODERN
11th TRENDS
INTERNATIONAL IN LIVESTOCK
SYMPOSIUM PRODUCTION

P R O C E E D I N G S
11th - 13th October 2017 - Belgrade, Serbia
ISBN 978-86-82431-73-2

INSTITUTE FOR ANIMAL HUSBANDRY

BELGRADE - SERBIA

MODERN
11th TRENDS
INTERNATIONAL IN LIVESTOCK
SYMPOSIUM PRODUCTION

P R O C E E D I N G S
11th - 13th October 2017 - Belgrade, Serbia
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

EDITORIAL COUNCIL
[Link]. Marjeta andek-Potokar, Agricultural Institute
Prof. Dr. Martin Whner, Faculty of Applied Sciences, of Slovenia, Ljubljana, Slovenia
Bernburg, Germany [Link]. Peter Dov, Department of Animal Science,
Dr. Milan P. Petrovi, Institute for Animal Husbandry, Biotechnical Faculty, University of Ljubljana, Slovenia
Belgrade-Zemun, Serbia Dr. Marjeta andek-Potokar, Agricultural Institute of
Dr. Zorica Tomi, Institute for Animal Husbandry, Slovenia, Ljubljana, Slovenia
Belgrade-Zemun, Serbia Prof. Dr. Wladyslaw Migdal, University of Agriculture,
Prof. Dr. Milica Petrovi, Faculty of Agriculture, Krakow, Poland
University of Belgrade, Serbia Dr Ivan Bahelka, National Agricultural and Food
Prof. Dr. Lidija Peri, Faculty of Agriculture, Centre Research Institute for Animal Production,
University of Novi Sad, Serbia Luianky, Slovakia
Dr Maya Ignatova, Institute of Animal Science, Prof. Dr. Colin Whitehead, Roslin Institute, University
Kostinbrod, Bulgaria of Edinburgh,United Kingdom
Prof. Dr. Kazutaka Umetsu, Obihiro University of Prof. Dr. Sandra Edwards, School of Agriculture, Food
Agriculture and Veterinary Medicine, Obihiro, Japan and Rural Development, University of Newcastle,
Prof. Dr. Dragan Glamoi, Faculty of Agriculture, United Kingdom
University of Novi Sad, Serbia Prof. Dr. Giacomo Biagi, Faculty of Veterinary
Prof. Dr. Vigilijus Jukna, Institute of Energy and Medicine, University of Bologna, Italy
Biotechnology Engineering, Aleksandras Stulginskis Prof. Dr. Stelios Deligeorgis, Aristotle University,
University, Kaunas, Lithuania Thessaloniki, Greece
Dr. Elena Kistanova, Institute of Biology and Prof. Dr. Hasan Ulker, Turkey
Immunology of Reproduction Kiril Bratanov, Sofia, Dr. Catalin Dragomir, National Research and
Bulgaria Development Institute for Animal Biology and
Prof. Dr. Pero Miji, Faculty of Agriculture, University Nutrition (IBNA Balotesti), Balotesti, Ilfov, Romania
of Osijek, Croatia

Publisher
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Editor-in-Chief
Milan M. Petrovi, PhD, Principal Research Fellow
Director of the Institute for Animal Husbandry, Belgrade-Zemun

EDITORIAL BOARD
Editor
Zdenka krbi, PhD, Senior Research Associate
Institute for Animal Husbandry, Belgrade-Zemun
Section Editors
Animal Science
Vlada Panteli, PhD, Senior Research Associate
Milo Luki, PhD, Senior Research Associate
Dragana Rui-Musli, PhD, Senior Research Associate
Duica Ostoji-Andri, PhD, Research Associate
edomir Radovi, PhD, Research Associate
Feed Science
Zorica Bijeli, PhD, Senior Research Associate
Violeta Mandi, PhD, Research Associate
Technology and Quality of Animal Products
[Link]. Marjeta andek-Potokar, Agricultural Institute of Slovenia, Ljubljana, Slovenia
Nikola Stanii, PhD, Research Associate
Food safety and Veterinary Medicine Science
Aleksandar Stanojkovi, PhD, Research Associate

Language editor
Olga Deveerski
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

Address of the Editors office

Institute for Animal Husbandry, Autoput 16, P. Box 23, 11080 Belgrade-Zemun, Republic of Serbia
Tel. 381 11 2691 611, 2670 121; Fax 381 11 2670 164; e-mail: [Link]@[Link]; [Link]
Circulation 200 copies.
The publication of this Proceedings is sponsored by the Ministry of Education and Science of the Republic of
Serbia.
The Proceedings is printed by the Institute for Animal Husbandry, Belgrade, 2017

ISBN 978-86-82431-73-2
PATRON
Ministry of Education, Science and Technological
Development of the Republic of Serbia

ORGANIZER
Institute for Animal Husbandry
Autoput 16, P. Box. 23,
11080, Belgrade-Zemun, Serbia
Tel: +381 11 2691 611; +381 11 2670 121;
+381 11 2670 541;
Fax: + 381 11 2670 164;

[Link]@[Link]
[Link]

EDITOR
INSTITUTE FOR ANIMAL HUSBANDRY
For Editor - Milan M. PETROVI, Ph.D
Editor in Chief - Zdenka KRBI, Ph.D
INTERNATIONAL SCIENTIFIC COMMITTEE

CHAIRMAN Prof. Dr. Martin Waehner,

Anhalt. University of Applied Sciences, Bernburg, Germany

SECRETARY Dr. Milan P. Petrovi,

Institute for Animal Husbandry, Belgrade-Zemun, Serbia

MEMBERS Dr. Milan M. Petrovi,

Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Giuseppe Bee,
Agroscope Posieux, Posieux, Switzerland
Dr. Vlada Panteli,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Yusup A. Yuldashbaev,
Russian State Agrarian University, Moscow Timiryazev Agricultural Academy,
Faculty of Animal Science and Biology, Russia
Dr. Vesna S. Krnjaja,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Giacomo Biagi,
Department of Veterinary Medical Sciences, - University of Bologna, Italy
Prof. Dr. Marjeta andek-Potokar,
Agricultural Institute of Slovenia, Slovenia
Dr. Zdenka krbi,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Elena Kistanova,
Institute of Biology and Immunology of Reproduction
Kiril Bratanov, Sofia, Bulgaria
Prof. Dr. Marina I. Selionova,
FSBSI-All-Russian Scientific Research Institute of Sheep and Goat Breeding,
Stavropol, Russia
Dr. Dragana Rui-Musli,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Mara Muoz,
Centro de I+D en Cerdo Ibrico, Dpto.
Mejora Gentica Animal, INIA, Zafra, Badajoz, Spain
Prof. Dr. Rui Miguel Carracha Charneca,
Universidade de vora, Escola de Cincias e Tecnologia,
Instituto de Cincias Agrrias e Ambientais Mediterrnicas (ICAAM),
vora, Portugal
INTERNATIONAL SCIENTIFIC COMMITTEE
Prof. Dr. Rodne Nastova,
Ss Cyril and Methodius University in Skopje,
Institute of Animal Science, Macedonia
Dr. Milo Luki,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Maya Ignatova,
Institute of Animal Science, Kostinbrod, Bulgaria
Prof. Dr. Vigilijus Jukna,
Institute of Energy and Biotechnology Engineering,
Aleksandras Stulginskis University, Lithuania
Dr. Sneana Mladenovi Drini,
Maize Research Institute Zemun Polje, Zemun Polje, Serbia
Prof. Dr. Pero Miji,
Faculty of Agriculture, University of Osijek, Croatia
Prof. Dr. Wladyslav Migdal,
Department of Animal Product Technology,
University of Agriculture in Krakw, Krakw, Poland
Dr. Violeta Andjelkovi,
Maize Research Institute Zemun Polje, Zemun Polje, Serbia
Prof. Dr. Zoran Lukovi,
University of Zagreb Faculty of Agriculture,
Department of Animal Science and Technology, Croatia
Prof. Dr. Yalin Bozkurt,
Suleyman Demirel University, Department of Animal Science,
Faculty of Agriculture, Isparta, Turkey
Dr. Zorica Bijeli,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Ivan Pavlovi,
Scientific Veterinary Institute of Serbia, Serbia
Dr. Ivan Bahelka,
NPPC - Research Institute for Animal Production Nitra, Slovakia
Dr. Emil Krupa,
Institute of Animal Science, Prague, Czech Republic
Dr. Sneana Ivanovi,
Scientific Veterinary Institute of Serbia, Serbia
ORGANIZING

CHAIRMAN Dr. Milan M. Petrovi,

Institute for Animal Husbandry, Belgrade-Zemun, Serbia

SECRETARY Dr. edomir Radovi,

Institute for Animal Husbandry, Belgrade-Zemun, Serbia

MEMBERS Dr. Duica Ostoji Andri,

Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Zoran Ili,
Faculty of Agricultural Sciences, Leak, Serbia
Dr. Violeta Caro Petrovi,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Aleksandar Simi,
Faculty of Agriculture, University of Belgrade, Serbia
Dr. Violeta Mandi,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Prof. Dr. Milun D. Petrovi
University of Kragujevac, Faculty of Agronomy, aak, Serbia
Prof. Dr. Slava Hristov,
Faculty of Agriculture, University of Belgrade, Serbia
Dr. Aleksandar Stanojkovi,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Nikola Stanii,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Nevena Maksimovi,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Veselin Petrievi,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Dr. Dragan Niki,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
SYMPOSIUM SECRETARIAT

CHAIRMAN Dr. edomir Radovi,

Institute for Animal Husbandry, Belgrade-Zemun, Serbia

MEMBERS Slavko Maleti, [Link].

Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Olga Deveerski, grad. prof.
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Stanislav Marinkov, [Link].
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Nikola Deli, DVM,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Marija Gogi, BSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Maja Petrievi, BSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Marina Lazarevi, BSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Nenad Mii, MSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Bogdan Ceki, MSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Milo Marinkovi, MSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
Vladimir ivkovi, BSc,
Institute for Animal Husbandry, Belgrade-Zemun, Serbia
CONTENTS

INVITED PAPERS

Milan P. Petrovic, Dragana Ruic Muslic, Violeta Caro Petrovic,

Nevena Maksimovic, Bogdan Cekic, Yusup A. Yuldashbaev, Marina
I. Selionova
TRENDS AND CHALLENGES IN THE GENETIC
IMPROVEMENT OF FARM ANIMALS (Serbia Russia)........... 1-14

Martin Whner
ANIMAL BREEDING IN FRONT OF HIGHER GLOBAL NEEDS
AND RESOURCE AND ENVIRONMENT PROTECTION
(Germany)......................................................................................... 15-24

Yalcin Bozkurt, Nazire Mikail, Cihan Dogan

DIGITAL IMAGE ANALYSIS FOR PREDICTION CARCASS
WEIGHT OF SOME BEEF CATTLE BREEDS (Turkey)............... 25-33

Ante Ivankovi, Valentino Drai, Jelena Ramljak, Miljenko

Konjai
ASSOCIATION OF GHR GENE POLYMORPHISMS ON BEEF
CARCASS QUALLITY (Croatia)...................................................... 34-42

Violeta Caro Petrovi, Milan M. Petrovi, Nevena Maksimovi,

Marina Lazarevi, Aleksandar Stanojkovi, Nenad Mii, Milo
Marinkovi
ANALYSIS OF BETA-LACTOGLOBULIN IN SMALL HERD OF
CATTLE BY PCR-RFLP (Serbia)....................................................... 43-49

Vigilijus Jukna, eslovas Jukna, Vaidas Pruseviius, Edita

Mekinyt-Kauilien, ydrn Vyniauskait
THE INFLUENCE OF KAOLIN E559 ON MILK PRODUCTION
AND SOMATIC CELLS COUNT IN MILK DURING THE
INDOOR AND OUTDOOR PERIODS (Lithuania)....................... 50-61

Dragan Niki, Vlada Panteli, Duica Ostoji-Andri, Predrag

Perii, Marina Lazarevi, Nenad Mii, Maja Petrievi
VARIABILITY OF THE BODY DEVELOPMENT TRAITS OF
SIMMMENTAL COWS IN SERBIA (Serbia)............................. 62-70
Yusup [Link], Maria I. Dongak, Ksenia A. Kulikova, Elena
V. Pakhomova, Zhaziraim M. Abenova, Salbak O. Chylbak-
ool, Milan P. Petrovic
THE MODERN STATE OF SHEEP BREEDING IN RUSSIA
(Russia - Serbia )............................................................................. 71-78

Marina I. Selionova, Galina T. Bobryshova

SHEEP BREEDING ECONOMIC, PLUSES AND MINUSES
(Russia)........................................................................................... 79-89

Nevena Maksimovi, Milan P. Petrovi, Dragana Rui-Musli,

Violeta Caro Petrovi, Bogdan Ceki, Marina Lazarevi, Rossen
Stefanov
SHEEP AND GOAT FLOCK BOOK AND HERD BOOK
RECORD KEEPING IN CENTRAL SERBIA (Serbia Bulgaria) 90-98

Vesna Gantner, Pero Miji, Maja Gregi, Vladan Bogdanovi, Tina

Bobi, Dragan Soli, Kreimir Kuterovac
PERSPECTIVES OF PIG BREEDING SECTOR IN EUROPE
(Croatia)............................................................................................ 99-108

Marjeta andek-Potokar, Urka Tomain, Martin krlep, Nina

Batorek Luka, Maja Prevolnik Pove, Peter Dov, Zein Kallas,
Jos M. Gil
KRKOPOLJE PIG IN TREASURE PROJECT: FROM REARING
TO PRODUCT (Slovenia Spain).................................................... 109-120

Giuseppe Bee
GESTATIONAL STRATEGIES AFFECTING SOW
REPRODUCTION AND PIGLET BIRTH WEIGHT (Switzerland) 121-145

Rui Charneca, Amadeu Freitas, Jos Martins, Jos Neves, Miguel

Elias, Marta Laranjo, Jos Nunes
ALENTEJANO AND BSARO PIGS: TRADITION AND
INNOVATION THE TREASURE PROJECT (Portugal)............. 146-155

edomir Radovi, Milica Petrovi, Marija Gogi, Radomir Savi,

Nenad Parunovi, Dragan Radojkovi, Nikola Stanii
TREASURE - MANGALITSA LOCAL PIG BREED IN SERBIA
(Serbia)........................................................................................... 156-168

Zoran Lukovi, Dubravko korput, Danijel Karolyi

PIG WELFARE AT DIFFERENT PRODUCTION SYSTEMS
(Croatia)............................................................................................ 169-177
Thomas Kunze, Martin Whner
NOVEL ASPECTS OF THE TAIL LENGTH IN PIGLETS
CONSIDERING TO THE OCCURANCE OF VERTEBRAL
ABNORMALITIES (Germany)..................................................... 178-188

Wadysaw Migda, edomir Radovi, Vladimir ivkovi, Emilia

Gwiazda, ukasz Migda, Anna Migda, Maria Walczycka, Ewelina
Wsierska, Marzena Zajc, Joanna Tkaczewska, Piotr Kulawik,
Katarzyna Krpa-Stefanik
QUALITY OF MEAT FROM NATIVE PIGS (Poland Serbia).... 189-203

Ivan Bahelka, Ondej Buko, Emlia Hanusov, Martina Gondekov

SENSORY COMPARISON OF MEAT AND FAT FROM ENTIRE
MALE, SURGICALLY CASTRATED AND FEMALE PIGS
DEPENDING ON SEX OF CONSUMERS AND PORK
PREFERENCE (Slovakia)................................................................ 204-210

Martin Whner, Heinz Pingel, Ralf Fischer, Romi Wehlitz

GENETIC PARAMETERS FOR GROWTH AND CARCASS
TRAITS OF PEKIN DUCKS (Germany)...................................... 211-219

Teodora Popova, Evgeni Petkov, Maya Ignatova

CARCASS AND MEAT QUALITY OF MALE LAYER-TYPE
CHICKENS AT DIFFERENT AGE (Bulgaria).. 220-228

Veselin Petrievi, Milo Luki, Zdenka krbi, Maja Petrievi,

Sneana Bogosavljevi-Bokovi, Vladimir Doskovi, Simeon
Rakonjac
THE EFFECT OF GARLIC ON PRODUCTION INDICATORS
AND THE SHARE OF INTERNAL ORGANS IN BROILER
CHICKENS (Serbia)...................................................................... 229-236

Diana Lupulovi, Jasna-Prodanov Radulovi, Tama Petrovi,

Gospava Lazi, Jelena Api, Milena Samojlovi, Sava Lazi
THE MOST COMMON VIRAL INFECTIONS THAT CAN
CAUSE SWINE REPRODUCTIVE PROBLEMS (Serbia).............. 237-252

leksandar Stanojkovi, Marija Gogi, Duica Ostoji-Andri, Maja

Petrievi, Jakov Niavi, Ksenija Nei, Aleksandra Stanojkovi-
Sebi
WILD PIGS - THE SOURCE OF ZOONOTIC STREPTOCOCCUS
SUIS STRAINS (Serbia)................................................................. 253-259
Giacomo Biagi, Carlo Pinna, Carla Giuditta Vecchiato, Monica
Grandi
THE UTILIZATION OF PREBIOTICS AND PROBIOTICS TO
MODULATE THE INTESTINAL MICROBIOTA OF DOGS
(Italy).............................................................................................. 260-267

Duica Ostoji Andri, Slava Hristov, Milan M. Petrovi, Vlada

Panteli, Dragan Niki, Violeta Caro Petrovi, Aleksandar
Stanojkovi
DAIRY COWS HEALTH PARAMETERS IN DIFFERENT
SEASON - AN WELFARE APPROACH (Serbia)........................... 268-277

Aleksandar Simi, eljko Deletovi, Gordana Andreji, Mirjam

Radulaki, Zorica Bijeli, Violeta Mandi
MICRONUTRIENTS AND HEAVY METALS OF
AGROSTIETUM CAPILLARIS IN BALKAN COUNTRIES
(Serbia).............................................................................................. 278-289

Violeta Mandi, Zorica Bijeli, Vesna Krnjaja, Dragana Rui

Musli, Violeta Caro Petrovi, Sneana orevi, Maja Petrievi
EFFECT OF DIFFERENT NITROGEN FERTILIZATION
LEVELS ON MAIZE FORAGE YIELD AND QUALITY (Serbia) 290-303

ORALLY PRESENTED PAPERS

Mara Muoz, Riccardo Bozzi, Alessandro Crovetti, Rui Charneca,

Jose M. Martins, Ana I. Fernndez, Luca Fontanesi, Juan M.
Garca-Casco, Cristina vilo
GENETIC DIVERSITY OF ALENTEJANO AND IBERIAN
BREEDS ASSESED BY POLYMORPHISMS OF MAJOR GENES
(Spain Italy Portugal).................................................................... 304-311

Zuzana Krupov, Emil Krupa, Josef Pibyl, Elika kov

FARROWING INTERVAL IN SELECTION OF DAM PIG
BREEDS IN THE CZECH REPUBLIC (Czech Republic)................. 312-318

Adrin Lpez-Garca, Juan M. Garca-Casco, Mara Muoz, Jos

M. Martnez-Torres, Miguel A. Fernndez-Barroso, Elena
Gonzlez-Snchez
BACKFAT FATTY ACID PROFILE AFTER GROWING PERIOD
IN IBERIAN PIGS FED WITH OLIVE CAKE IN A DRY OR
WET (SILAGE) FORM (Spain)........................................................ 319-326
Vladimir Margeta, Kristina Gvozdanovi, Ivona Djurkin Kuec,
Polonca Margeta, Goran Kuec, arko Radii
THE EFFECT OF THE ACORN IN FEEDING ON THE
PRODUCTIO AND SLAUGHTER TRAITS OF CRNA
SLAVONSKA PIG (Croatia).............................................................. 327-334

Anamaria Ekert Kabalin, edomir Radovi, Ivan Vlahek, Marija

Gogi, Nikola Brlekovi, Sandro Korent, Sven Menik, eljko
Pavii, Mario Ostovi, Velimir Sui
FATTENING RESULTS AND BIOSECURITY LEVEL ON PIG
FARMS WITH DIFFERENT CAPACITY (Croatia Serbia)........ 335-345

ukasz Migda, Konrad Kozio, Wadysaw Migda, Sylwia Paka,

Micha Kmiecik, Anna Migda, Jzef Bieniek
RABBITS BREEDING IN POLAND POSSIBILITY OF
IMPLEMENTATION OF MARKER ASSISTED SELECTION
(MAS) IN BREEDING (Poland)...................................................... 346-355

Jovan Bojkovski, Radia Prodanovi, Ivan Vujanac, Sreten Nedi,

Renata Reli,Danijela Bojkovski Dejan Bugarski, Duica Ostoji-
Andri, Ivan Pavolovi, Dubravka Milanov
BREEDING DISEASE AND WELFARE CALVES ON DAIRY
FARMS TIED BREEDING SYSTEM (Serbia).............................. 356-364

Slava Hristov, Jelena Mioinovi, Branislav Stankovi, Zorica

Radulovi, Duica Ostoji - Andri, Zvonko Zlatanovi
THE MOST IMPORTANT FAILURES IN MAINTAINING THE
HYGIENE OF MILKING, COOLING SYSTEMS AND
TRANSPORTATION OF DAIRY MILK (Serbia)............................ 365-376

Edit Mikn Jns, Sava Atasever, Szabina Szilagyi

RELATIONS OF UDDER HYGIENE WITH QUALITY AND
QUANTITY PARAMETERS OF MILK IN HOLSTEIN COWS
(Hungary Turkey).............................................................................. 377-383

Ivan Pavlovi, Sneana Ivanovi, Boris Pisinov, Zsolt Becskei, Mila

Savi, Danica Todorovi
PARASITES CONTAMINANT OF GOAT MEAT (Serbia)............ 384-395
POSTER SECTION I

Sava Atasever, Szabina Szilgyi, Myrtill Grff, Edit Mikn Jns

EFFECT OF BODY CONDITION AT CALVING ON
LACTATION CURVE OF HOLSTEIN COWS (Turkey-Hungary) 396-405

Milun D. Petrovi, Milan M. Petrovi, Vladan Bogdanovi, Radica

edovi, Simeon Rakonjac, Vladimir Doskovi, Milo . Petrovi
EFFECT OF FIXED AND CONTINUOUS ENVIRONMENTAL
FACTORS ON MILK PRODUCTION IN THE FIRST THREE
STANDARD LACTATIONS IN SIMMENTAL COWS (Serbia).. 406-416

Marina Lazarevi, Vlada Panteli, Dragan Niki, Nevena

Maksimovi, Milo Marinkovi, Nenad Mii, Dragan Stanojevi
VARIABILITY OF MILK TRAITS IN PROGENY TESTING OF
THE SIMMENTAL BULLS (Serbia)........................................... 417-426

Milo Marinkovi, Predrag Perii, Milan M. Petrovi, Vlada

Panteli, Marina Lazarevi, Nenad Mii, Vladimir ivkovi
THE INFLUENCE OF SEASON ON SPERM QUALITY IN
HOLSTEIN BULLS (Serbia)........................................................ 427-437

Bogdan Ceki, Aleksa Boikovi, Dragana Rui-Musli, Nevena

Maksimovi, Violeta Caro Petrovi, Nenad Mii, Vladimir ivkovi
COMPARISON OF DIFFERENT ENERGY SYSTEMS FOR
DETERMINATION OF LUCERNE ENERGETIC VALUE IN
DAIRY CATTLE DIET (Serbia)................................................. 438-449

Nenad Mii, Goran Grubi, Milan M. Petrovi, Vlada

Panteli,Bogdan Ceki, Milo Marinkovi, Marina Lazarevi
BENTONITE IN NUTRITION OF DAIRY COWS (Serbia)............ 450-460

Penka Moneva, Ivan Yanchev, Marina Dyavolova, Dimitar Gudev

TOTAL ANTIOXIDANT CAPACITY AND HEMATOLOGICAL
CHANGES FOLLOWING EXPOSURE TO MODERATE
ALTITUDE IN EWES POSSESSING LOW OR HIGH BASELINE
HEMATOCRIT (Bulgaria)................................................................ 461-474

Penka Moneva, Ivan Yanchev, Marina Dyavolova, Dimitar Gudev

EFFECT OF ALTITUDE HYPOXIA ON LEUCOCYTE COUNT
IN LOW AND HIGH HEMATOCRIT SHEEP (Bulgaria)............. 475-484
Almira Softi, Velija Katica, Vedad aki, Aida Kavazovi, Maja
Varatanovi, Dinaida Tahirovi
EFFECT OF NUTRITION ON PHENOTYPE
CHARACTERISTICS OF CROSS-BRED LAMBS IN
FATTENING (Bosnia and Herzegovina).......................................... 485-493

Dragana Rui-Musli, Milan P. Petrovi, Zorica Bijeli, Violeta

Caro Petrovi, Nevena Maksimovi, Violeta Mandi, Bogdan Ceki
THE INFLUENCE OF NON-DEGRADABLE PROTEIN AND
THE CROSSING SYSTEM ON THE TORTUOSITY, STRENGTH
AND EXTENSIBILITY OF LAMB WOOL FIBER (Serbia)............ 494-504

Stanimira Slavova, Georgi Kalaydzhiev, Jivko Krastanov, Yovka

Popova, Staika Laleva
ECONOMIC VALUES OF THE BASIC PRODUCTION AND
FUNCTIONAL TRAITS OF SHEEP FROM BULGARIAN
DAIRY SYNTHETIC POPULATION (Bulgaria)............................. 505-516

Radomir Savi, Milica Petrovi, Marija Gogi, edomir Radovi,

Dragan Radojkovi, Nikola Stanii, Marjeta andek-Potokar
PRODUCTIVE TRAITS OF MORAVKA BREED - HAS
ANYTHING CHANGED IN LAST SIXTY YEARS? (Serbia)..... 517-527

Urka Tomain, Nina Batorek Luka, Martin krlep, Maja

Prevolnik Pove, Jernej Ogorevc, Peter Dov, Marjeta andek-
Potokar
MEAT QUALITY OF KRKOPOLJE PIGS AS AFFECTED BY
RYR1 GENOTYPE (Slovenia)..................................................... 528-538

Marija Gogi, edomir Radovi, Milica Petrovi, Radomir Savi,

Aleksandar Stanojkovi, Maja Petrievi, Vladimir ivkovi
PHENOTYPIC VARIABILITY OF THE WEIGHT OF WARM
CARCASS SIDE OF FATTENERS (Serbia).................................. 539-548

Vladimir ivkovi, Branislav Stankovi, Bogdan Ceki, Milo

Marinkovi, Saa Obradovi, Marija Gogi, edomir Radovi
REVIEWING THE POSSIBILITY OF THE SUBSTITUTION OF
ANTIBIOTICS WITH PROBIOTICS IN DIET FOR WEANED
PIGLETS (Serbia)............................................................................. 549-556
Ivan Mii, Zoran Raji, Jelena ivkovi, Grujica Vico, Marko
Mii,Ivana Mii, Marija Mii
THE ECONOMICS OF MEAT PRODUCTION ON PIG FARMS
IN SERBIA IN DIFFERENT FARMING SYSTEMS (Serbia-
Bosnia and Herzegovina).................................................................... 557-570
POSTER SECTION II

Nedeljka Nikolova, Dragoslav Kocevski, Rodne Nastova, Nikola

Puvaca, Cyril Hrncar, Tosho Kostadinov
INFLUENCE OF GENOTYPES, AGE, NUTRITION AND
INTERACTIONS GENOTYPE X NUTRITION ON MORTALITY
OF BROILER CHICKENS POSTER SECTION II (Macedonia) 571-584

Teodora Popova, Evgeni Petkov, Maya Ignatova

CARCASS AND MEAT QUALITY OF MALE LAYER-TYPE
CHICKENS AT DIFFERENT AGE (Bulgaria) 585-594

Milo Luki, Zdenka krbi, Veselin Petrievi, Vesna Krnjaja,

Nikola Stanii, Zorica Bijeli
THE INFLUENCE OF THE ADDITION OF NETTLE IN
BROILER FOOD AT THE FINAL STAGE OF THE FATTENING
(Serbia)............................................................................................... 595-601

Ksenija Nei, Sneana Ivanovi, Vladimir Radosavljevi, Jasna

Kureljui, Nikola Rokvi, Aleksandar Stanojkovi, Milan Radovi
IMPACT OF CALCIUM ADMINISTERED THROUGH
DRINKING WATER ON EGG PRODUCTION OF LAYING
HENS (Serbia).................................................................................... 602-608

Vladimir Doskovi, Sneana Bogosavljevi-Bokovi, Zdenka

krbi, Milun D. Petrovi, Veselin Petrievi, Simeon Rakonjac
EFFECT OF PROTEASE ON PRODUCTION PERFORMANCE,
WEIGHTS AND PROPORTIONS OF PRIMAL CUTS AND
WEIGHTS OF EDIBLE BY-PRODUCTS OF BROILERS (Serbia) 609-617

Zdenka krbi, Milo Luki, Veselin Petrievi, Sneana

Bogosavljevi-Bokovi, Vladimir Doskovi, Simeon Rakonjac
MEAT QUALITY OF REDBRO CHICKENS REARED
EXTENSIVE INDOORS AFFECTED BY DURATION OF
FATTENING PERIOD (Serbia).......................................................... 618-626

Mirjana uki Stoji, Lidija Peri, Sinia Bjedov

THE EFFECT OF STORAGE TIME ON THE EGG QUALITY
CHARACTERISTICS IN OLD LAYING HENS (Serbia)................ 627-633
POSTER SECTION III

Maja Petrievi, Aleksandar Stanojkovi, Duica Ostoji-Andri,

Dragan Niki, Veselin Petrievi, Marija Gogi, Violeta Mandi
COMPARATIVE STUDY OF FATTENING AND SLAUGHTER
PROPERTIES OF FEMALE SIMMENTAL CATTLE AND
CROSSES OF SIMMENTAL AND CHAROLAIS (Serbia)...... 634-641

Sneana Ivanovi, Ksenija Nei, Boris Pisinov, Ivan Pavlovi

SLAUGHTERHOUSES, POSSIBLE SOURCE OF BACTERIA
(Serbia).............................................................................................. 642-653

Metin Davut, Sava Atasever

SEASONAL CHANGES OF COMPOSITION AND SOMATIC
CELL COUNT OF BUCKET MILK FROM JERSEY
CROSSBRED COWS IN NORTHERN (TURKEY)........................
654-661
Vujadin Vukovi, Nada Plava, Jelena Kureljui
EXAMINATION OF THE TIME OF EXCRETION OF
PENICILLIN RESIDUES IN COWS MILK BY FORMING
662-671
INTERVAL SERIES AND ABSOLUTE FREQUENCYES (Serbia)

Vujadin Vukovi, Mihajlo Vientijevi, Milan Radovi

EXAMINATION OF THERAPEUTIC EFFECT TIAMULIN IN
672-678
THE TREATMENT OF BLOODY DIARRHEA PIGLETS (Serbia)

Vujadin Vukovi, Mihajlo Vientijevi, Milan Radovi

EXAMINATION OF THERAPEUTIC EFFECTS GENTAMICIN
5% INJ. ad. us. vet. IN THE TREATMENT OF NEONATAL 679-684
COLIBACILLOSIS CALVES (Serbia)...........................................

Aleksandar Saveski, Tatjana Kalevska, Viktorija Stamatovska, Zora

Uzunoska, Elena Josevska
COMPARATIVE ANALYSIS OF FATTY ACIDS IN THE MEAT
OF THE MACEDONIAN AND OHRID TROUT FROM 685-695
AQUACULTURE PRODUCTION (Macedonia).

Vesna Dragievi, Milena Simi, Branka Kresovi, Milan Brankov

CROPPING SYSTEM AND FERTILIZATION REGIME AS
FACTORS OF MAIZE GRAIN QUALITY (Serbia)........................ 696-705
Jordan Markovi, Sneana Babi, Dragan Terzi, Vladimir Zorni,
Tanja Vasi, Jasmina Milenkovi, Ivica Kosti
CARBOHYDRATE CONTENT OF ALFALFA HARVEST AT
DIFFERENT DEVELOPMENT STAGE IN THE SPRING
GROWTH (Serbia)............................................................................ 706-712

Zorica Bijeli, Violeta Mandi, Aleksandar Simi, Vesna Krnjaja,

Dragana Rui-Musli, Bogdan Ceki, Nenad Mii
BENEFITS OF MIXING GRASSES AND LEGUMES FOR
FORAGE YIELD AND IMPACT OF DIFFERENT LEVELS OF
NITROGEN FERTILIZATION (Serbia)........................................... 713-723

Vesna Krnjaja, Aleksandar Stanojkovi, Slavica Stankovi, Zorica

Bijeli, Violeta Mandi, Nenad Mii, Milo Marinkovi
FUNGAL CONTAMINATION OF CATTLE FEEDS (Serbia).... 724-730

Ivana Stanojevi, Sneana Babi, Sneana Andjelkovi, Darko

Jevremovi, Aleksandar Leposavi, Vladimir Zorni, Tanja Vasi
APPEARANCE AND FREQUENCE OF FUNGI ON GRASSES
SEED IN SERBIA (Serbia)............................................................... 731-737
INVITED PAPERS
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

TRENDS AND CHALLENGES IN THE GENETIC

IMPROVEMENT OF FARM ANIMALS

Milan P. Petrovic1, Dragana Ruic Muslic1, Violeta Caro Petrovic1,

Nevena Maksimovic1, Bogdan Cekic1, Yusup A. Yuldashbaev3, Marina
I. Selionova2
1Institutefor Animal Husbandry, Belgrade, Serbia
2 FSBSI -All-Russian Research Institute for Sheep and Goat Breeding, Stavropol, Russia
3 Russian State Agrarian University - Moscow Timiryazev Agricultural Academy, Faculty of Animal

Science and Biology, Moscow, Russia

Corresponding author: milanppet@[Link]
Review paper

Abstract: Animal breeding, in essence, dealing with the variable,

primarily genetic, looks at, above all, the genetic improvement of populations. In
many methods, it is about selecting the parents of the next generation of high
production skills and well acclimatized with appropriate environmental conditions.
With these methods, it is important to carefully collect all the more important
information on the production capabilities of animals and their origin, and this is
ensuring by keeping the basic birth record. Despite the desires of the breeder
through history to improve the desirable properties of animals as soon as possible,
the development of genetics in the twentieth century has opened the perspective of
more effective genetic improvement. The development of molecular biology and
DNA analysis methods over the last two decades opened the door to a new era of
faster and more accurate selection of domestic animals. Aside from a
favorable increase in production, animals in a population that have selected for
high production efficiency seems more at risk for behavioral, physiological and
immunological problems. Genetic selection may lead to loss of the homeostatic
balance of animals, resulting in the occurrence of pathologies and consequently in
impaired animal welfare. There are opinions that physiological and immunological
features should be incorpotated in the selection programs, taking into account their
correlation with the production characteristics. DNA technologies can be useful for
identifying loci responsible for some physiological and immunological
characteristics, or animal health.
Key words: genetic improvement, selection, animal, challenges, animal
health
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
2

Introduction
The livestock sector globally is highly dynamic. In developing countries, it
is evolving in response to rapidly increasing demand for livestock products. In
developed countries, demand for livestock products is stagnating, while many
production systems are increasing their efficiency and environmental sustainability.
Historical changes in the demand for livestock products have been largely driven
by human population growth, income growth and urbanization and the production
response in different livestock systems has been associated with science and
technology as well as increases in animal numbers (Thornton, 2010).
Genetic improvement of domestic animals is undoubtedly based on the
basic genetics laws as the science of heredity and adaptation of species, because the
characteristics of domestic animals are determined by their genotype that is subject
to hereditary and adaptable variability (Petrovic, 2000). Animal breeding, in
essence, dealing with the variable, primarily genetic, looks at, above all, the genetic
improvement of populations. In many methods, it is about selecting the parents of
the next generation of high production skills and well acclimatized with
appropriate environmental conditions. With these methods, it is important to
carefully collect all the more important information on the production capabilities
of animals and their origin, and this is ensured by keeping the basic birth record
(Vidovic, 2013). Bearing all this in mind, it is normal that the application of
statistics in the field of biological sciences becomes more and more important. This
is because this is a large number of data, i.e. Observation, farm and system of
pyramidal model of selection and production of genetic changes from praded to
commercial throat. All data from test, sighting or production needs to be agreed,
assessed, attributed to a particular importance to individual influences, to direct the
tests to an efficient path, as only useful solutions can be obtained. Despite the
desires of the breeder through history to improve the desirable properties of
animals as soon as possible, the development of genetics in the twentieth century
has opened the perspective of more effective genetic improvement (Petrovic et al.,
2001, 2005, 2011). The development of molecular biology and DNA analysis
methods over the last two decades opened the door to a new era of faster and more
accurate selection of domestic animals (Pearson, 2006; Pennisi, 2007; Teneva and
Petrovic, 2010; Petersen et al., 2013; Petrovic and Pantelic, 2015). Improvement
of production traits using DNA technology has been named "Genomic Selection".
However, aside from a favorable increase in production, animals in a population
that have selected for high production efficiency seems more at risk for behavioral,
physiological and immunological problems. Genetic selection may lead to loss of
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
3

the homeostatic balance of animals, resulting in the occurrence of pathologies and

consequently in impaired animal welfare.
Regarding of Grandin (1999), several long-term selection studies using a
variety of small animals have clearly shown that overselection for a single trait
may have adverse or unexpected effects on other traits. Future application of
modern reproduction and DNA-techniques in animal breeding may increase
production levels even faster than at present, which may result in more dramatic
consequences for behavioural, physiological and immunological traits (Rauwa et
al., 1998; Sbardella, and Gaya, 2010).
Demand for livestock products in the future could be heavily moderated by
socio-economic factors such as human health concerns and changing socio-cultural
values. There is considerable uncertainty as to how these factors will play out in
different regions of the world in the coming decades (Thornton, 2010).
The aim of this paper is to review the methods of genetic improvement of
domestic animals, emphasize the importance of selection in animal husbandry and
the consequences of its over-intensification. This would contribute to the
development of awareness of the necessity of balancing between desires and
possibilities, in order to preserve the biological balance and health of animals and
humans in the future.

Genetic improvement by traditional selection

Changing traits in animals, to produce desired characteristic, have resulted
in common food species that are now genetically different from their ancestors.
After domestication, animals were selected in different environments and for
different traits, leading to the modern breeds.
The basics of genetic improvement of domestic animals lie on changes in
the frequency gene, the goal of which is to achieve more productive populations. In
essence, this type of genetic improvement represents a man's deliberate action to
favor or eliminate certain individuals because of their interests.
Selection plays an important role as a method for increasing productivity in
modern animal breeding, since the selected individual of both sexes reproduces and
gives the progeny of the desired type (Petrovic et al., 2009; 2011; 2012; 2014;
Petrovi and Panteli, 2015).
Depending on the breeding goals, in the history of livestock breeding, until
now, there have been various breeding programs. Breeding program is the
combination of recording selected traits, the estimation of breeding values, the
selection of potential parents and a mating program for the selected parents
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
4

including appropriate (artificial) reproduction methods (Oldenbroek and Van der

Waaij, 2015).
Most traits of interest in livestock are multifactorial in nature, affected by a
large number of individual genes along with environmental factors. Quantitative
genetic theory has become the primary basis for the development of methods to
develop model- Quantitative Genetic Model, and evaluate alternative breeding
programs (Falconer and Mackay, 1996).
Genetic improvement of animals by selection takes place in several major
phases:
1. Establishing a breeding goal
2. Collecting data from individuals and their relatives
3. Evaluation of breeding value
4. Choice of pairs for further reproduction
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
5

The assessment of the breeding value is crucial for the success of the
selection. Prediction of breeding values is a fundamental component of modern
breeding programmes, as those with the highest values should be selected. The
most important models for estimating breeding values, Best Linear Unbiased
Prediction (BLUP), is due to Henderson (1950, 1984) and incorporates both fixed
(environmental) effects and random (genetic) effects in a mixed model (Lynch &
Walsh 1998; Sorensen and Gianola 2002).
Selection used the animals with the highest value for the selection criteria.
Regardless of the fact that the selection reaches an optimal or selective limit, in
livestock production, the trend of further increase in production traits continues
with the introduction of new variability (Vidovic, 2013; Petrovic and Pantelic,
2015).

Genetic improvement by genomic selection

Traditional genetic improvement of livestock, using information on
phenotypes and pedigrees to predict breeding values, has been very successful.
However, breeding values should be able to predict more accurately by using
information on variation in DNA sequence between animals (Goddard and Hayes,
2007).
Genomic selection - is a powerful tool for future use. Currently, the
effectiveness of genomic selection is limited by various interactions between the
locus of quantitative traits, the variability of quantitative features, and the influence
of environmental factors. However, research results in many countries have
confirmed that the use of standard statistical methods along with genomic selection
increases reliability in predicting breeding values of animals (Petrovic i Pantelic,
2015). Meuwissen et al., (2001) proposed a novel approach where the breeding
value could be estimated from markers spanning the entire genome.
Genomic selection should be able to at least double the rate of genetic gain
in the dairy industry (Hayes et al. 2009), as it enables selection decisions to be
based on genomic breeding values, which can ultimately be calculated from genetic
marker information alone, rather than from pedigree and phenotypic information.
Genomic selection is not without its challenges, but it is likely to revolutionize
animal breeding.
In the last decade, low-and high-density genomic tools have been broadly
used to study and characterize the genetic diversity and population. During the last
25 years, a number of Quantitative Trait Loci (i.e. regions of the genome
responsible for a fraction of the genetic variance of a trait) have been mapped with
genetic markers, paving the way to marker-assisted selection -MAS (Boichard et
al., 2016). Despite progress, the MAS did not give the best results in the selection.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
6

Reason of that is small numbers of QTL, and also the low association between
markers and QTL at the population level.
Developing chips for genotyping over 50,000 single nucleotide
polymorphisms (SNP) created a new era in the genomic selection of animals.
Genomic selection can have a major impact on animal breeding
programs, especially where traits that are important in the breeding objective are
hard to select for otherwise. Genomic selection provides more accurate estimates
for breeding value earlier in the life of breeding animals, giving more selection
accuracy and allowing lower generation intervals. From sheep to dairy cattle, the
rates of genetic improvement could increase from 20 to 100 % and hard-to-
measure traits can be improved more effectively (Van Der Werf, 2013).
According to Boichard et al.(2016), genomic selection is a very recent
innovation. Strong evolutions have started, including reduction in genotyping costs,
phenotyping strategies for new traits, approaches for the creation or the
replacement of reference populations, increase in robustness and persistency of
genomic predictions using causal mutations identified from genome sequences, or
genomic prediction of genetic-environment interactions.
In practice, genomic selection will be a reliable "prognosis" for livestock
production and will accelerate the process of selecting the most valuable animals.
Van Der Werf (2013) stated that reference populations for genomic selection need
to be large, with thousands of animals measured for phenotype and genotype. The
smaller the effective size of the breeding population, the larger the DNA
segments they potentially share and the more accurate genomic prediction will
be. The relative contribution of information from relatives in the reference
population will be larger if the baseline accuracy is low, but such information is
limited to closely related individuals and does not last over generations.
The advancement of molecular genetics has enabled the sequencing of the
genome of several species of domestic animals in the last few years, partly or
completely. Information on the whole animal genome becomes more interesting for
researchers and breeders because they provide the ability to identify genetic
variations that produce different production performances (Bai et al., 2012). This
could also increase the chances of resistance to pathogens that slow down the
production of animals and can also provide useful information in the production of
healthy food for human consumption (Bai et al., 2012).
The first genome sequencing was done in poultry (Burt, 2005), followed
by pigs (Archibald et al., 2010), cattle (Zimin et al., 2009), horses (Wade et al.,
2009) and sheep (International sheep Genomics, 2010, Bai et al 2012).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
7

Challenges and negative effects in genetic improvement

Negative effects of animal breeding can arise as a result of the desire to
force only one trait. The experience in genetic improvement has shown that the
selection does not only affect one trait but also changes some other features that are
not planned. This phenomenon is a negative correlation response to the selection
(Van Eerden et al., 2004; Greer, 2008). It is especially important that the results of
this process can not be seen immediately, but gradually from generation to
generation, which practically means that negative effects can be seen when the
process is already moving away.
High variability in domestic animal populations is necessary both for the
continuous genetic improvement of economically important traits, and for adapting
changes in climatic conditions. Unfortunately, an increasingly intense selection
method causes a trend in reducing genetic variability, both within and between the
breeds. From this comes two problems:
1. Greater intensity of selection means the selection of relatively few animals for
breeding. A small animal for breeding results in a greater number of inbreeding,
and therefore a loss of genetic diversity.
2. Loss of small, local populations. Lower genetic potential and lower production
are a key driver for the loss of small breeds, since they replace them with
international high productivity breeds
This trend of genetic improvement of animals is critical for the long-term survival
of small local breeds (Biscarini et al., 2015).
All living organisms and even domestic animals are complex biological
systems. All molecular, biochemical and physiological processes interact with the
inner and outer environment. In addition, most of the biological processes in the
body are in a smaller or higher correlation. In order to better understand the effects
of genetic improvement of domestic animals, it is necessary to bear in mind the so-
called principle of homeostasis or balance, which implies self-regulatory return to
the state before some changes in its composition or functioning have occurred.
For the purpose of genetic improvement of domestic animals, we are
conducting the selection. If the selection is more intensive, the selection pressure is
also greater. It should be known that strong selective pressure can interfere with the
regular biological functions of the abilities, and the individuals can interact
internally during breeding. This influence depends on this selection pressure and
heritability of the selection criterion, and mainly depends on the genetic correlation
between both properties (Pereira, 1999).
There is a different experience regarding the negative effects of the
selection. According to Ferreira et al.(2005) Selection of high production impedes
reproduction as well as cause Insufficient activity of metabolism Endangering
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
8

welfare and health of animals. Therefore, a compromise between the level of

production and animal health is necessary (Van Eerden et al., 2004).
Oldenbroek and Van der Waaij (2015) stated that selection for large
offspring has resulted in a high fraction of difficult births, sometimes requiring
caesarean sections in the Texel sheep, and even almost as a standard way of
delivering in the beef cattle breeds Belgian White-and-Blue cattle and the Dutch
Improved Red-and-White. In the Texel sheep selection against difficult births has
resulted in a decreasing fraction of birth requiring assistance. In this case the
process could be reversed. But in the Belgian White-and- Blue and the Dutch
Improved Red-and-White cattle the situation is more problematic and the repair
process will take many generations.
In selection of high milk yield of cattle production, animals have to be fed
with a diet richer than their normal grass diet

in easily digestible nutrients with a lower content of effective fibres

(Rauwa et al., 1998; Ferreira et al., 2005). However, this leads to disorders in food
digestion. Their
physiology is not well adapted to this new diet, and they were not co-selected for
physiological traits (Rauwa et al., 1998; Sbardella and Gaya (2010).
Selection of high production performance in all types of domestic animals
leads to a reduction in the reproduction power (De Vries and Veerkamp, 2000;
Dechow et al., 2002; Norman et al., 2007).
The progress made in dairy cattle in the selection of genes for productively
desirable traits was not accompanied at the same speed by improvements in foot
and leg stability (Sbardella and Gaya, 2010). According to Madalena (2008),
selection for high milk production of cattle, associated with a reduced heat
tolerance. Selection of the growth rate has a negative effect on the power of
fertilization in pigs. Robinson and Buhr (2005) informed that, males with a higher
growth rate are less able to mate a sow in oestrus than males with an intermediate
growth rate, and the sperm quality is inferior in males with a bigger growth rate.
Animals that are selected on a high gain have weaker bones and here is a
genetic association found between length of productive life and leg soundness
score (Serenius et al., 2006). Selection for muscle deposition increase might be
associated with the arising of the PSE (pale, soft, exudative) phenomenon in meat,
which is caused by recessive homozygosis for the Halothane gene. Pigs with
greater growth rate exhibit high incidences of gastric, cardiac, renal and pulmonary
problems such as pneumonia and pleuritic (Sbardella and Gaya, 2010).
It has long been established that in poultry farming, the selection at high
yields can lead to metabolic problems, reduce reproductive performance, and
increase the number of infertile eggs (Barbato et al., 1984). Many health problems
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
9

have been identified as a result of excessive selection and this has been the trend in
all farm animal species.

Conclusions
Selection is an inevitable method for the genetic improvement of domestic
animals. However, selection is also necessary in order to preserve the genetic
structure of indoor populations, such as domestic animals. Without selection, all
kinds of cultivated animals tend to return to their original "wild" form. The
problem arises when the selection is used to achieve the maximalist demands of
farmers and businessmen. In other words, when we want an animal to produce
several times more milk than the logic of biological reality. For example, milk is a
cubic food and a cow with a production of 10 liters a day can feed its calf. Through
selection, a man got a cow that gives 5-10 times more milk because of business. It's
similar to other animal species. Studies have shown genetic correlation Between
productive traits and undesirable effects. In many cases selection for high
productive efficacy in livestock species is accompanied by undesirable side effects
for some physiological and reproductive traits, endangering the welfare of animals.
There are opinions that physiological and immunological features should be
included in the selection programs, taking into account their correlation with the
production characteristics. DNA technologies can be useful for identifying loci
responsible for some physiological and immunological characteristics, or animal
health. In any case, the future of livestock farming must take into account the
harmony between biological reality and the desire for genetic progress in order to
achieve as much profit as possible.

Trendovi i izazovi u genetikom unapreenju domacih

ivotinja
Milan P. Petrovic, Dragana Ruic Muslic, Violeta Caro Petrovic, Nevena
Maksimovic, Bogdan Cekic, Yusup A. Yuldashbaev, Marina I. Selionova

Rezime
Odgajivanje ivotinja u sutini je bavljenje promenama, odnosno varijacijama
proizvodnih osobina, prvenstveno genetskim, radi poboljanja populacije. U
mnogim metodama se radi o odabiru roditelja sledece generacije visokih
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
10

proizvodnih osobina i dobro aklimatizovanim na uslove sredine. Vano je paljivo

sakupljati sve bitnije informacije o proizvodnim potencijalima ivotinja i njihovom
poreklu, a to se osigurava matina evidencija. Uprkos elji odgajivaa kroz istoriju
da poboljaju poeljna svojstva ivotinja to je pre moguce, razvoj genetike u
dvadesetom veku otvorio je perspektivu efikasnijeg genetskog unapreenja. Razvoj
molekularne biologije i metoda analize DNK tokom poslednje dve decenije otvorio
je vrata novoj eri bre i preciznije selekcije domacih ivotinja. Pored povecanja
proizvodnje, ivotinje u populaciji koja ima visoku efikasnost izloene su vecim
rizikom bihevioralne, fizioloke i imunoloke prirode. Intenzivna selekcija moe
dovesti do gubitka homeostatske ravnotee ivotinja, to dovodi do pojave
patolokih problema, a time i smanjenja dobrobiti ivotinja. Postoje miljenja da bi
fizioloke i imunoloke osobine trebale biti ugraene u programe selekcije
uzimajuci u obzir njihovu korelaciju sa proizvodnim karakteristikama. DNK
tehnologije mogu biti korisne za identifikaciju lokusa odgovornih za neke
fizioloke i imunoloke karakteristike, ili za zdravlje ivotinja.

Kljune rei: genetsko unapreenje, selekcija, ivotinja, izazovi, zdravlje

ivotinja

References

ARCHIBALD A.I., BOLUND I., CHURCHER C., FREDHOLM C., GROENEN

M.A., HARLIZIUS B., LEE K.T., MILAN D., ROGERS J., ROTHSCHILD M.F.,
UENISHI H., WANG J., SCHOOK L.B. (2010). Pig Genome Sequence analysis
and publication strategy. BMC Genomics, 11, 438.
BAI, Y., SARTOR, M., CAVALCOLI, J. (2012). Current status and future
perspectives for sequencing livestock genomes. Journal of Animal Science and
Biotechnology, 3(1), 1-6.
BARBATO G..F., SIEGEL, P.B., CHERRY, J.A., NIR, I. (1984): Selection for
body weight at eight weeks of age. 17. Overfeeding. Poult. Sci., 63: 11-18.
BISCARINI F., NICOLAZZI E.L., STELLA A., BOETTCHER P.J., GANDIN G.
(2015): Challenges and opportunities in genetic improvement of local livestock
breeds. Front Genet., 6: 33.
BOICHARD D., DUCROC V., CROISEAU P., FRITZ S (2016): Genomic
selection in domestic animals: Principles, applications and perspectives. C. R.
Biologies 339 274277.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
11

BURT, D. W. (2005). Chicken genome: current status and future opportunities.

Genome Research, 15(12), 1692-1698.
DE VRIES, M.J. AND VEERKAMP, R.F. (2000): Energy balance of dairy cattle
in relation to milk production variables and fertility. J. Dairy Sci., 83: 62-69.
DECHOW, C.D., ROGERS, G.W. AND CLAYT, J.S. (2002): Heritability and
correlations among body condition score loss, body condition score, production
and reproductive performance. J. Dairy Sci., 85: 3062-3070.
FALCONER, D.S.; MACKAY, T.F.C. ( 1996): Introduction to quantitative
genetics. Harlow, UK: Longman. xii, 438 p. p.
FERREIRA P.M., CARVALHO A.U., FACURY-FILHO E.J., FERREIRA M.G.,
FERREIRA R.G. (2005): Afeces do sistema locomotor dos bovinos.
Proceedings of 2nd Simpsio Mineiro de Buiatria, Belo Horizonte, MG. 26p
GODDARD M.E., HAYES B.J. (2007): Genomic selection. J. Anim. Breed.
Genet. 124 (2007) 323330.
GRANDIN T., DEESING M.J., (1998): Genetics and Animal Welfare. Genetics
and the Behaviour of Domestic Animals, GRANDIN T.(Editor) Academic Press,
San Diego, California, pp 319-341(1998), with 1999 updates.
GREER A.W. 2008. Trade-offs and benefits: implications of promoting a strong
immunity to gastrointestinal parasites in sheep. Parasite Immunol., 30: 123-132.
HAYES B.J., BOWMAN P.J., CHAMBERLAIN A.J., GODDARD M.E. (2009).
Genomic selection in dairy cattle: Progress and challenges. Journal of Dairy
Science. 92, 2, 433443.
HENDERSON C. R. (1950): Estimation of genetic parameters. Ann. Math.
Stat. 21, 309310.
HENDERSON C. R. (1984): Applications of linear models in animal
breeding Guelph, Ontario: University of Guelph.
INTERNATIONAL SHEEP GENOMICS CONSORTIUM1, ARCHIBALD
AL, COCKETT NE, DALRYMPLE BP, FARAUT T, KIJAS JW, MADDOX
JF, MCEWAN JC, HUTTON ODDY V, RAADSMA HW, WADE C, WANG
J, WANG W, XUN X. (2010): The sheep genome reference sequence: a work in
progress. Anim Genet., 41 (5):449-53.
LYNCH M., WALSH B. (1998): Genetics and analysis of quantitative
traits Sunderland, MA: Sinauer Associates.
MADALENA, F.E. (2008):.Efeitos colaterais da gentica de alta produo. In:
Milk
[Link].[online][Link]
dareaID=61andsecaoID =171 (15-2-2008).
MEUWISSEN T.H., HAYES B.J,, GODDARD M.E. (2001). Prediction of total
genetic value using genome-wide dense marker maps. Genetics, 157(4),1819-
1829.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
12

NORMAN, H.D., HUTCHISON, J.L., WRIGHT, J.R., KUHN, M.T. AND

LAWLOR, T.J. (2007): Selection on yield and fitness traits when culling Holsteins
during the first three lactations. J. Dairy Sci., 90: 1008-20.
OLDENBROEK K.,VAN DER WAAIJ L (2015): Textbook Animal Breeding and
Genetics for BSc students. Centre for Genetic Resources The Netherlands and
Animal Breeding and Genomics Centre , 2015.
PEARSON H. (2006):"Genetics: what is a gene?". Nature, 441 (7092): 398401.
PENNISI E. (2007): "Genomics. DNA study forces rethink of what it means to be
a gene". Science 316 (5831): 15561557.
PEREIRA, J.C.C. 1999. Melhoramento gentico aplicado produo animal. Belo
Horizonte: FEPMVZ.
PETERSEN J.L., MICKELSON J.R., RENDAHL A.K., VALBERG S.J.,
ANDERSSON L.S., AXELSSON J., ET AL. (2013): Genome-Wide Analysis
Reveals Selection for Important Traits in Domestic Horse Breeds. PLoS Genet
9(1): e1003211. doi:10.1371/[Link].1003211.
PETROVIC P.M., PETROVIC M.M., CARO PETROVIC V., ZUJOVIC M.,
RUZIC MUSLIC D., TOMIC Z., MAKSIMOVIC N. (2011): Development of
Sustainable Livestock Production Systems in Serbia. Proceedings of The 3rd
International Conference on Sustainable Animal Agriculture for Developing
Countries. July 26-29,2011, Nakhon Ratchasima. Thailand, 2-6.
PETROVIC P.M., PANTELIC V (2015): Savremena selekcija domaih ivotinja
(Modern selection of farm animals). Institute for Animal Husbandry, Belgrade, 320
pp.
PETROVIC P.M., SRETENOVI LJ., RUI MUSLI D., MEKI C.,
MAKSIMOVI N. (2009). The effect of the level of application of selection and
breedeng criteria as factor of sustainable sheep production on productive traits of
sheep in extensive rearing system. Biotechnology in Animal Husbandry, 25(1-2),
111-119.
PETROVI P. M., CARO-PETROVI V., RUI-MUSLI D., ILI Z., SPASI
Z., STOJKOVI J., MILENKOVI M. (2012). Genetic and phenotypic aspects of
the body measured traits in merinolandschaf breed of sheep. Biotechnology in
Animal Husbandry, 28(4), 733-741.
PETROVI P. M., MEKI C., RUI MUSLI D., UJOVI M. (2005):
Investigation Of Heritability and Genetic Corelation of Milk Sheep Traits.
Biotehnologija u stoarstvu, 21, 55-60.
PETROVI P. M., UJOVI M., NEGOVANOVI D, STRSOGLAVEC S.,
RUI D. (2001): The Importance Of New Selection Methods In Modern System
Of Sheep Breeding. VI International Symposium Systems of Animal Breeding of
the new millennium. Biotechnology in Animal Husbandry, 2001; 17 (5-6) 159-
167.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
13

PETROVI P.M, PETROVI M. M., RUI MUSLI D., CARO PETROVI

V., MAKSIMOVI N., ILI Z., VUKOVI S. (2011): Opportunities and
challenges for sustainable sheep production in Serbia. Proceedings of the 3rd
International Congress-New Perspectives and Challenges of Sustainable Livestock
Production, Belgrade, October 5-7. Biotechnology in Animal Husbandry 27 (3), p
463-472
PETROVI P.M. (2000): Genetic and Improvement of Sheep (Book-
Monography). Nauna knjiga, Beograd, 2000; 365 p.
PETROVI P.M. (2000): Genetic and Improvement of Sheep (Book-
Monography). Nauna knjiga, Beograd, 2000; 365 p.p.
PETROVI P.M., CARO PETROVI V., ILI Z., RUIMUSLI D.,
PETROVI M.M., STOJKOVI J., MAKSIMOVI N. (2014). Relationship
Between Birth Weight and Body Growth Characteristics of Lambs. Biotechnology
in Animal Husbandry, 30 (2), 193-201.
RAUWA W.M., KANISB E., NOORDHUIZEN-STASSENC E.N.,
GROMMERSC F.J. (1998): Undesirable side effects of selection for high
production efficiency in farm animals: a review. Livestock Production Science
56:1533.
ROBINSON, J.A.B., BUHR, M.M. (2005): Impact of genetic selection on
management of boar replacement. Theriogenology, 63: 668-678.
SBARDELLA, M. AND GAYA, L.G. (2010): Unfavourable side implications of
animal breeding in ivestock species: a review. zootcnicas: uma reviso. Arch.
Zootec. 59 (R): 157-168.
SERENIUS T., STALDER K.J., BAAS T.J., MABRY J.W., GOODWIN R.N.,
JOHNSON R.K., ROBISON O.W., TOKACH M., MILLER R.K. (2006): National
pork producers council maternal line national genetic evaluation program: A
comparison of sow longevity and trait associations with sow longevity. Journal of
Animal Science 84, 2590-2595.
SORENSEN D., GIANOLA D. (2002): Likelihood, Bayesian and MCMC methods
in quantitative genetics New York, NY: Springer 2002, XVIII, 740 p.
TENEVA A., PETROVI P.M. (2010): Application of Molecular Markers in
Livestock Improvement. Biotechnology in Animal Husbandry, 26, 135-154.
THORNTON P.K (2010): Livestock production: recent trends, future prospects.
Phil. Trans. R. SOC. B BIOL SCI., 365, 28532867.
VAN DER WERF J (2013): Genomic selection in animal breeding programs.
Methods Mol Biol. 1019:543-61.
VAN EERDEN E., VAN DEN BRAND H., PARMENTIER H.K., DE JONG
M.C., KEMP B. (2004): Phenotypic selection for residual feed intake and its effect
on humoral immune responses in growing layer hens. Poult. Sci., 83: 1602-1609.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
14

VIDOVI V., NEME Z., POPOVI-VRANJE A., LUKA D., CVETANOVI

D., TRBAC L., STUPAR M. (2013): Heritability and correlations of milk traits
in the view of kappa-casein genotypes in Vojvodina Holstein-friesian dairy cattle.
Mljekarstvo 63 (2), 91-97.
WADE C. M., GIULOTTO E., SIGURDSSON S., ZOLI M., GNERRE S.,
IMSLAND F., et al. (2009). Genome sequence, comparative analysis, and
population genetics of the domestic horse. Science, 326(5954), 865-867.
ZIMIN A., DELCHER A., FLOREA L., KELLEY D., SCHATZ M., PUIU D., et
al. (2009). A wholegenome assembly of the domestic cow, Bos taurus. Genome
Biology, 10(4), R42.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

ANIMAL BREEDING IN FRONT OF HIGHER GLOBAL

NEEDS AND RESOURCE AND ENVIRONMENT
PROTECTION

Martin Whner

Anhalt University of Applied Sciences Bernburg, Germany

Corresponding author: [Link]@[Link]
Review paper

Abstract: In near future there are a lot of expectations of global plant and
animal breeding.
- More efficient use of available resources (area, water, fertilizer, etc.)
- Optimal use of solar energy for photosynthesis
- Minimize the content of unwanted ingredients in plants
- Effective conversion of feed into food of animal origin (milk, meat, fish,
eggs)
High performance animals produce more excretions in absolute quantity but lower
excretion per unit of products (milk, meat, eggs). Knowledge about the needs of the
animals is essential for excretion.
The consequence can be a lower number of high performance animals. But in
present time this strategy cannot be right as well in the industrialized countries as
in the developing countries generally. There are very high variations in supply of
foodstuffs between different countries all over the world.
Higher performance in animals correlates with animal health and higher manual
and technical effort. In Germany, as a special example, the positive development of
milk yield per cow correlates with higher number of cows per stock and intensity
of manual effort per cow and day positively.

Keywords: farm animal global needs, animal production of meat, milk,

eggs, high performance animals, production of excretions in absolute quantity and
per unit of products, global supply of foodstuffs

Introduction

In 2050 about 9 billion people will live on the earth. It is 20% more than in
current time. In front of this background there are a lot of expectations of global
plant and animal breeding.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
16 October 11-13, 2017

- More efficient use of available resources (area, water, fertilizer, etc.)

- Optimal use of solar energy for photosynthesis
- Minimize the content of unwanted ingredients in plants
- Effective conversion of feed into food of animal origin (milk, meat, fish,
eggs)

The global people development is a challenge to agriculture. In addition to this

development a changes in the eating habits of the population in the developing
countries are to be expected (Figure 1).

Figure 1. Expected change pn per capita consumption per inhabitant for specific food in
developing and industrialized countries between 2001 and 20030 (IAAATD, 2007)

In front of this background there is a challenge for animal production or

Livestocks long shadow (Steinfeld et al., 2006). Table 1 contains informations
about this development.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 17

Table 1. Challenge for animal production or Livestocks long shadow (STEINFELD et al., 2006)

Currently (= 100%) 2050 growth (%)

People on earth (Billion) 6,5 9,0 138
meat production (Mio. t) 229 465 203
Carcass weight
Milk production (Mio. t) 580 1043 130

Meat is is an important part in human diet. It is a preposition for more

balanced nutrition (aminoacids, trace nutrients a.s.e), for higher hedonic value and
meat represents social status. There is a closed correlation between income and
meat consumption.
There is a very great global variability in the supply of animal protein. In
table 2 extreme values are shown.

Table 2. Extreme values of the current protein supply (FAO 2009) and CF for milk (FAO, 2010)

Minimum Maximum
Milk (kg/ head and year) 3,3 (Burundi) 367,7 (Sweden)
Meat (kg/head and year 3,1 (Bangladesh) 125,6 (USA)
Protein from animals (g/head and day 1,7 (Burundi) 69,9 (USA)
Carbon Footprints (kg Co/kg milk) 1,3 (Europe) 7,5 (Subsahara)

Generally, in past and in present time, the possession of farm animals

demonstrated richnes.
Looking at the population development it is interesting to get informations
about average consumption of raw materials for production of different foods
(Table 3)

Table 3. Average consumption of raw materials for production of different foods

Consumption of raw materials

Foods Water (l) Area (m2)
1 bun (50g) 70 0,1
1 glas milk (0,25 l) 100 0,2
1 grilled sausage (120g) 400 0,6

In recent years in the farm animals has a performance increase. This affects the
milk output (Table 4), meat and eggs.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
18 October 11-13, 2017

Table 4. Milk production in Germany

Year Milk kg Fat% Protein %

1990 4.710 4,09 3,33
1995 5.427 4,25 3,40
2000 6.110 4,22 3,41
2010 7.085 4,16 3,42
2014 7.541 4,07 3,41

In Germany, the high levels of animal welfare and animal and environment
protection lead to a reduction in the number of cows and dairy farms generally.
Especially small farms will be closed. There is a contradiction between the political
goal and the reality in dairy cattle farming. In Germany the small family farm agree
on one with the political goal, but not the larger, specialized dairy farm. In front of
this background following investigation is very interesting.
An investigation was carried out to determine the relationship between
stock size and milk yield in Holstein cows. In figure 2 you can see a positive
development of milk yield in farms with more cows per stock.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 19

Figure 2. Milk performance in 305-days depend on number of cows per farm

Additionally an increase in livelihood in dairy cows in larger farms was observed

(Figure 3).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
20 October 11-13, 2017

Figure 3. Milk production per life of cows depend on number of animals per farm

The better management, better health status and higher qualification of the
persons in the larger farms are responsible for this development.

Very often the question is asked whether high performance correlates with
lower animal health. Generally there are only low antagonism between milk
production and traits for animal health (Swalve, 1999). Table 5 contains
correlations between breeding values for milk production, somatic cell score and
longevity.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 21

Table 5. Correlations between estimated breeding values for black-and white Holstein bulls
(VIT-Proofs 8/1999; only bulls with birth years from 1989 onwards and with repeatabilities of EBV
for RZM-Production, RZE-Type, RZS-Somatic Cells Score of >75% and >60% for RZN-Longevity;
n=789 bulls) SWALVE (1999)

RZS RZE RZN

(Somatic Cell Score) (Type) (Longevity)
RZM -0,11 0,21 -0,12
(Milk Production)
RZS 0,15 0,39
(Somatic Cell Score)
RZE 0,07
(Type)

The level of yield in plant production and animal production influences the
need of arable land per people. In FAO-calculation (2006) is demonstrated
influence of higher farm production in plants and animals on need arable land per
person (Table 6).

Table 6. Influence of yield in plant production and performance in farm animals on

requirement of arable land per inhabitant and year for production of milk and meat in 2050 (52
kg meat, 116 kg milk per inhabitant and year FAO 2006)

Level of yield in plant production and performance in Need of arable land/ people
farm animals (m2 / person)
2t DM cereals, 5t DM basic feed / ha
7,5 kg milk / cow & day, daily gain: meat cattle 1.500
500g; pig: 400g/day
4t DM cereals, 10t DT basic feed / ha
15 kg milk / cow & day, daily gain: meat cattle 600
900g; pig: 600g/day
8t DM cereals, 15t DM basic feed / ha
30 kg milk /cow & day, daily gain: meat cattle 300
1300g; pig: 800g/day

Higher performance of the animals results in increased excretion total, but

in reduced excretion per unit with the consequence of a (limited) reduction in the
number of animals. The effect of an increase in output on the issue decreases with
increasing output. Disease incidence and expenses. Knowledge about the needs of
the animals is essential for reducing excretion. The need for optimal ration design
and feed additives can improve the nutrient utilization.
For climate relevant emissions in animal production are methane and
nitrogen or laughing gas (N 2 O). Here is the same situation. High performance cow
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
22 October 11-13, 2017

produces more methane then low performance cow. But high performance cow
produces less methane per unit milk then low performance cow (Figure 4).

Figure 4. Development of production of methane and milk in Germany 1990-2010

Until now, there is a deficit of knowledge about potentials of feed additives

to reduce methane production in the rumen.
There are some main topics for science.
- Reduction of the urine N-content of the N-excretions (scientific question!).
- Improved excrement management - reduction of the absolute gas emission,
reduction of the gas concentration in the excrements
- Urgent improvement of the information situation of all climate-relevant
emissions in the production of food - along the entire food chain.

New ways for the breeding of animals is shown by the genomic selection.
Since the beginning of genomic selection, the increase in breeding progress has
been estimated to be nearly 100%. The effect is based on the shortening of the
generation interval. Functional features of cows and sows are particularly
interesting. This also combines positive effects for robustness and health, life
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 23

performance and longevity. In the end, this is very much important for the issue of
"animal welfare".

Expections for plant and animal breeding are following. More efficient use of
available resources (area, water, fertilizer a.s.e.). Optimal use of solar energy for
photosynthesis. Minimize the content of unwated ingredients in plants and
effective conversion of feed into food of animal origin (milk, meat, fish, eggs).

Conclusion

Higher performance of the animals results in increased excretion but

reduced excretion per unit with the consequence of a (limited) reduction in
the number of animals.

The effect of an increase in output on the issue decreases with increasing

output. Disease incidence and expenses.

Knowledge about the needs of the animals is essential for reducing

excretion.
The need for optimal ration design and feed additives can improve the
nutrient utilization.

Until now there is still lacking knowledge about the potential of feed
additives to reduce methane production in the rumen.

Reduction of the urine N-content of the N-excretions (scientific question!)

Improved excrement management - Reduction of gases with a high
concentration of gases

Urgent improvement of the information situation of all climate-relevant

emissions in the production of food - along the entire food chain.

Uzgoj domaih ivotinja u svetlu rastuih svetskih potreba i

zatite resursa i ivotne sredine
Martin Whner
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
24 October 11-13, 2017

Rezime
U bliskoj budunosti postoji puno oekivanja od globalnog uzgoja biljnih i
ivotinjskih vrsta.
Efikasnije korienje raspoloivih resursa (zemljite, voda, ubrivo, itd.)
Optimalno korienje solarne energije za fotosintezu
Minimiziranje sadraja neeljenih sastojaka u biljkama
Efikasno pretvaranje hraniva u proizvode odn. Hranu ivotinjskog porekla
(mleko, meso, riba, jaja)
ivotinje sa visokim performansama proizvode vie izluevina u
apsolutnoj koliini, ali manje po jedinici proizvoda (mleko, meso, jaja). Poznavanje
potreba ivotinja je neophodno u tom smislu.
Posledica moe biti manji broj ivotinja sa visokim performansama. Ali u
dananjem vremenu ova strategija ne moe biti jednako ispravna i za
industrijalizovane zemlje kao i za zemlje u razvoju. Postoje vrlo velike varijacije u
snabdevanju prehrambenih proizvoda izmeu razliitih zemalja irom svijeta.
Vee performanse kod ivotinja su u korelaciji sa zdravljem ivotinja i
veim runim i tehnikim naporima. U Nemakoj, kao poseban primer, pozitivan
razvoj odnosno poveanje prinosa mleka po kravi korelira pozitivno sa veim
brojem krava po zapatu i intenzitetom rada po kravi i danu.

Kljune rei: globalne potrebe farmskih ivotinja, proizvodnja mesa, mleka, jaja,
visoko proizvodne ivotinje, globalno snabdevanje prehrambenim proizvodima

References

FAO 2006, 2009, 2010: FAO Report

STEINFELD, H., GERBER, P., WASSENAAR, T., CASTEL, V., ROSALES, M.,
DE HAAN, C. (2006): Livestock's long shadow, FAO, Rome 2006.
SWALVE, H.H. (1999): Grenzen in der Zucht auf Milchleistung Aus der Sicht
der Zchtung. Zchtungskunde71, (6), 428 436.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

DIGITAL IMAGE ANALYSIS FOR PREDICTION

CARCASS WEIGHT OF SOME BEEF CATTLE BREEDS
Yalcin Bozkurt1, Nazire Mikail2, Cihan Dogan1
1
Suleyman Demirel University, Faculty of Agriculture, Department of Animal Science, Isparta,
Turkey, 32260.
2
Siirt University, Department of Animal Science, Faculty of Agriculture, Siirt, Turkey
Corresponding author e-mail:yalcinbozkurt@[Link]
Original scientific paper

Abstract: This research aimed to develop prediction models for accurate

estimation of performance and carcass measurements of beef cattle grown in
feedlot beef system by using Digital Image Analysis (DIA). For this purpose, 37
animals were used in total and composed of 20 animals of the Brown Swiss breed
and 17 animals of the Holstein breed with the age of about 4-5 months at the
beginning of the experiment. Animals were fed the same dietary rations throughout
the experimental period of 12 months. When the animals reached 500-550 kg
bodyweights, they were slaughtered. Associations between carcass weights (CW)
and some carcass measurements such as, carcass length (CL) and carcass depth
(CD) were examined for prediction ability. The digital images of each live animal
were taken and the same parameters digital carcass length (DJCL) and digital
carcass depth (DJCD) were also determined from the images, using the data with
137 observations for each trait. Then, prediction models were developed by DIA.
The linear, quadratic and cubic regression models were performed to predict CW
for both breeds and since there were no statistically significant differences (P
>0.05) in carcass measurements between breeds. Therefore, the data of these
breeds were combined and found that DJCL would be the best possible traits in
predicting CW (R2=73.6, 81.3 and 83.5% for linear, quadratic and cubic terms
respectively). All type of regressions showed that addition of quadratic and cubic
terms contributed little benefit in predicting CW. Therefore, all linear terms of all
digital carcass measurements by DIA were considered for analysis and they were
significant and R2 values for equation containing both DJCL and DJCD were 76%.
However, DJCD was poorly performed in estimates with R2 only 4.6%. It can be
concluded that in cases where CW is not measurable, it can be predicted correctly
by measuring DJCL and different models with different parameters such as digital
carcass area may be needed to predict CW in different nutritional and
environmental conditions.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
26 October 11-13, 2017

Key words: prediction, carcass weight, carcass measurements, digital

image analysis

Introduction

The decisions on agricultural activities are first and foremost dependent on

trials and errors at the level of small agriculture in developing countries,
particularly those characterized by small scale farming poor resources and
investments. Ration preparations are based on the body weight of the animal and
are particularly important for predicting body weight, including growth rate, body
condition and conformation, especially for bovine body measurements for many
purposes (Wilson et al., 1997; Fourie et al., 2002)
Estimation of meat products has been the focus of many studies in
developed countries. The value of cattle cut obtained from the carcasses of
different breeds of cattle is very important for marketing standards that emphasize
the quality, uniformity and consistency of both consumers and meat. For this
reason, an evaluation procedure for predicting the weight and yield of carcass and
beef retail segments is of great importance for the beef industry (Cross and Belk,
1994).
In General, animal marketing among farmers is based on visual evaluation,
especially in developing countries. Most veterinary medicines are prescribed
according to live weight criteria. However, prescribing and prescribing drugs are
often made with approximate estimates. The use of ration formulation, drug
estimation, body condition score, and live weight criteria in marketing requires
advanced facilities that are expensive and cost-effective for many small-scale
farmers.
If scientists appreciate the importance of correctly estimating the body
weight of an animal, then a simple and logical technique should be considered in
management decisions. Some studies have indicated a relationship between some
body measurements and body weight (Peters and Ball, 1995; Nesamvuni et al.,
2000). It is also important to know the body weight of cattle, especially for various
reasons related to breeding for selection, nutrition and health services.
The results of the most studies have recognized that the accuracy of
estimating body weight from heart girth or other body traits that may be affected by
breed, type, age, size and condition of the animal (Heinrichs et al., 1992) and as
well as by different environmental conditions (Enevoldsen et al., 1997).
Therefore, the aim of this study was to gain further information about the
relationship between carcass weight and some digital carcass measurements of
different breeds such as Brown Swiss and Holstein cattle and also to determine the
value of using one digital carcass measurement as a single variable entry to the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 27

model to predict carcass weight and to validate the potential of this method as a
means of predicting carcass weight under small scale farming conditions by using
DIA.

Materials and Methods

Animals
The animals carcass used in this study were composed of 20 Brown Swiss and
17 Holstein cattle and 37 animals were used in total, divided into two groups on the
basis of breeds. The average carcass weights were 246 and 262 kg for Brown Swiss
and Holstein groups respectively. The digital images of various measurements
were collected using a digital camera (canon) and a reference card to eliminate the
distance between the object and the camera. Data were collected starting from
December 2012 to March 2013 from the animals experimented. The carcass
measurements of the slaughtered cattle were collected at Gulkoy slaughterhouse
near Isparta province. A total of 37 observations were used for each trait measured.
Carcass weights were recorded to the nearest kilogram (kg) and the digital carcass
measurements in centimetre (cm).

Digital Carcass Measurements

Digital images and digital carcass measurements were taken by the same
person throughout the experimental period to avoid the experimenter error in
measuring the digital parameters which are as follows:
1- Digital Carcass Length (DJCL) - was the distance from the point of the
shoulders to the ischium; in other words, from the sternum (manubrium) to the
aitchbone (tuber ischiadicum),
2- Digital Carcass Depth (DJCD) - from sternum area immediately caudal to the
forelimbs to top of the thoracic vertebra.

Statistical Analysis
1. The best prediction equations for carcass weight as independent variables,
including DJCL and DJCD were determined. Descriptive statistics regression
analysis of CW on each of the independent variables was performed using the
General Linear Models procedure of Minitab, 16 Inc. (Minitab, 2016).
Correlation coefficients were also obtained between digital carcass traits.
Polynomial regression analysis of carcass weight on DJCL and DJCD were
performed.
Linear, quadratic and cubic effects of independent variables on CW were included
in the following model:
y i = b 0 +b 1 X i +b 2 X i 2+e i
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
28 October 11-13, 2017

Where
y i = CW observation of an i' th animal,
b 0 = intercept, b 1 and b 2 = corresponding linear, quadratic and cubic regression
coefficients I,
X i = Digital carcass measurement (DJCL, DJCD) and
e i = residual error term
Several different regression analyses were conducted;
1- Two digital carcass measurements, expressed as linear functions, were
combined in CW prediction equation
2- Each digital carcass measurement was included separately in regression
analysis as linear, quadratic and cubic expressions to predict CW; and
3- The linear regression of each other digital carcass measurement was then
also added to the model as described previously.

Results and Discussions

There were no statistically significant differences in digital carcass
measurements between breeds (P >0.05). Therefore, data of these breeds were
combined for all statistical analysis.
Descriptive statistics of carcass weight and digital carcass traits are shown
in Table 1.
Table 1. Descriptive statistics of carcass weight and digital carcass traits by weight means
CW DJCL DJCD
Weight
(kg) (cm) (cm)
Means
253.85 167.89 68.62
(s.e)
(4.59) (1.60) (2.75)
CW: Carcass Weights, DJCL: Digital Carcass Length, DJCD: Digital Carcass Depth, s.e: Standard
Error

The average values for combined CW 253.85 kg. The corresponding

ranges for DJCL and DJCD were 167.89 cm and 68.62 cm respectively.

Regressions models of animal carcass weight on various digital carcass

measurements using individual observations are shown in Table 2.
Table 2. Prediction equations of carcass weight and the linear effects of digital carcass traits
Models with two variables R2 %
CW = -161+2.36DJCL+0.255DJCD 76
Models with one variable
CW = - 148 + 2.393 DJCL 73.6
CW = 230 + 0.349 DJCD 4.6
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 29

Regression models of animal carcass weight on various digital carcass

measurements using individual observations are shown in Table 2. As Table 2
shows models with one variable with determination coefficients it was found that
DJCL would be the best possible traits in predicting CW (R2=73.6%) the other
digital carcass measurement. In other words, the R2 values in the models with one
predictor shows the proportion of variation in the dependent variable that is
predictable from the independent variable. Therefore, in this study 73.6% of the
variation in CW can be explained by DJCL.
It was observed that in every steps of regression analysis, inclusion of
DJCL in the equation increased R2 greatly. It was also found that when all variables
were included in the regression DJCD was not significant while the rest gave
significant slope values.

However, the highest R2 values were obtained from the equation contained
two digital carcass traits that included DJCL and DJCD (R2=76 %). These results
were in line with the findings of Tuzemen et al. (1993), Ulutas et al. (2001),
Bozkurt et al. (2007), Bozkurt et al. (2008).
In addition, in this study the individual equations with one predictor CD
had the lowest R2 values as 4.6% (Table 2).
Results of regression analysis of carcass weight on the linear, quadratic and
cubic effects of each digital carcass measurement are presented in Table 3.

Table 3. Regressions of carcass weight on the linear, quadratic and cubic effects of each digital
carcass measurement#
Measurements Model Intercept b1 b2 b3 R2 %
Linear -148 2.39 - - 73.6
Digital Carcass
Quadratic -1402 18.12 -0.04898 - 81.3
Length (DJCL)
Cubic 9319 -185.4 1.231 -0.00267 83.5
Linear 230 0.349ns - - 4.6
Digital Carcass
Quadratic -154.9 8.625 -0.03683 - 34.6
Depth (DJCD)
Cubic -1328 53.01 -0.5572 0.001786 38.2
#
Only none significant regression coefficients had superscripts (ns), the rest were significant at
P<0.05.

It was observed in this study that a 1 cm change in DJCL and DJCD

resulted in almost 2.4 and 0.35 kg change in carcass weight respectively (Table 3).
Higher order polynomial equations were examined. The R2 values from the
regression models indicate that digital carcass length to be the most highly related
to carcass weight considering all linear, quadratic and cubic coefficient terms. For
all digital carcass traits, addition of the cubic term increased the R2 slightly.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
30 October 11-13, 2017

However, while all linear, quadratic and cubic terms of DJCL and DJCD
were significant (P <0.05); only the linear terms of DJCD was not significant (P
>0.05). However, Heinrichs et al. (1992) reported that none-significant cubic term
for heart girth and significant term for wither height. In contrast Heinrichs et al.
(1992) found that quadratic term of body length was significant. The results in this
study also showed that linear, quadratic and cubic expressions of DJCL is the most
useful predictors, and support the findings of Wilson et al. (1997), Bozkurt (2006),
Bozkurt et al. (2007) and Bozkurt et al. (2008). These results were in line with
Heinrichs et al. (1992), Wilson et al. (1997), Ulutas et al. (2001), Bozkurt (2006),
Bozkurt et al. (2007) and Bozkurt et al. (2008).
It can be noted that, in the correctness of the carcass weight estimates, the
additional digital carcass measurements of the equations provide a slight increase
except DJCL alone. Correlation coefficients of the traits are shown in Table 4.

Table 4. Pearson correlations between digital carcass traits in both breed cattle
Variables CW DJCL
DJCL 0.86
DJCD 0.22 0.07

Correlation value of DJCL was found to be statistically significant (P

<0.05); but DJCD was found none significant (P >0.05). Amongst two the digital
carcass measurements, the highest correlation was found between DJCL and CW
(r=0.86). The second highest correlation was between DJCD and CW (r=0.22). In
addition the correlation value between DJCL and DJCD (r=0.07) was lower than
the correlation between the rest of the digital carcass traits. It was expected that
DJCL would give higher correlation coefficient value than the other digital carcass
measurements since the R2 value between BW and DJCL was also high.

Conclusions
This study also indicated that digital carcass length can be used with high
precision in predicting the carcass weight for Brown Swiss and Holstein cattle
raised under small-scale farming condition. Digital carcass length exhibited the
highest correlation with the carcass weight of the digital carcass traits examined.
When using any of the other carcass measurements in models with linear,
quadratic, and cubic terms, DJCL usually makes the most significant contribution
when compared to other carcass traits. DJCD can be considered as the second best
predictor.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 31

In conclusion, the use of digital carcass length provides a simple way of estimating
the carcass weight. This is the general aim of applying the model into practice.
However, there is always a need to develop different models in order to define
different model parameters besides the investigations in this area as well as other
breeds, and to predict the carcass weight in different management and
environmental conditions. It is also important to be able to measure carcass
dimensions to reduce experimental errors.

Analiza digitalnih slika za predvianje mase trupa kod nekih

tovnih rasa goveda
Yalcin Bozkurt, Nazire Mikail, Cihan Dogan

Rezime
Cilj ovog istraivanja bio je da se razviju modeli predvianja za tanu
procenu performansi i merenje trupova tovnih goveda gajenih u sistemu tovilita
koristei Digital Image Analisis - DIA (Analiza digitalnih snimaka). Za ovu svrhu
ukupno je korieno 37 ivotinja, od kojih 20 grla braon vajcarske rase i 17
ivotinja rase holtajn, starosti od oko 4-5 meseci na poetku eksperimenta.
ivotinje su hranjene istim obrokom tokom eksperimentalnog perioda od 12
meseci. Kada su dostigle 500-550 kg telesne teine, goveda su zaklana.
Veze izmeu mase trupa (CW) i nekih merenja trupa, kao to su duina
trupa (CL) i dubina trupa (CD) su ispitane za mogunost predvianja. Napravljene
su digitalne slike svake ive ivotinje, i isti parametri digitalne duina trupa
(DJCL) i digitalne dubine trupa (DJCD) takoe su odreene iz slika, koristei
podatke sa 137 opservacija za svaku osobinu. Zatim, su razvijeni modeli za
predvianje pomou DIA.
Linearni, kvadratni i kubini regresioni modeli izvedeni su da predvide
CW za obe rase, poto nije bilo statistiki znaajnih razlika (P> 0,05) u merenjima
trupa izmeu rasa. Zbog toga su podaci o ovim rasama kombinovani i ustanovljeno
je da e DJCL biti najbolja mogua osobine u predvianju CW (R2 = 73,6; 81,3 i
83,5% za linearne, kvadratne i kubine termine). Sve vrste regresija pokazale su da
dodavanje kvadratnih i kubinih termina nije imalo koristi u predvianju CW.
Zbog toga su svi linearni izrazi svih digitalnih merenja trupa pomou DIA
razmatrani za analizu i bili su znaajni, a R2 vrednosti za jednainu sa DJCL i
DJCD-om su bile 76%. Meutim, DJCD je imao slabe rezultate u procenama sa R2
od samo 4,6%.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
32 October 11-13, 2017

Moe se zakljuiti da u sluajevima kada CW nije merljiv, moe se

pravilno predvideti merenjem DJCL, a razliiti modeli sa razliitim parametrima,
kao to je podruje digitalnog trupa, mogu biti potrebni za predvianje CW u
razliitim nutritivnim uslovima i okolnostima.

Kljune rei: predvianje, masa trupa, merenja trupa, digitalna analiza

slike

Acknowledgements

This study was presented here as a part of project number 111O269 and project
number 114O778 and the authors thank TUBITAK (The Scientific and
Technological Research Council of Turkey) for financially supporting these
projects.

References

BOZKURT Y. (2006): Prediction of body weight from body size measurements in

Brown Swiss feedlot cattle fed under small-scale farming conditions. Journal of
Applied Animal Research, 29-32.
BOZKURT Y., AKTAN S., OZKAYA S. (2007): Body weight prediction using
Digital Image Analysis for slaughtered beef cattle. J. Appl. Anim. Res. 32:195-198.
BOZKURT Y., AKTAN S., OZKAYA S. (2008): Digital Image Analysis to
predict carcass weight and some carcass characteristics of beef cattle. A. Journal of
Animal and Veterinary Advances, 3(3):129-137.
CROSS, H.R., BELK, K.E. (1994): Objective Measurements of Carcass and Meat
Quality, Meat Science, v.36, pp. 191202
ENEVOLDSEN C., KRISTENSEN T. (1997): Estimation of body weight from
body size measurements and body condition scores in dairy cows. J. Dairy Sci.,
1988-1995.
FOURIE P.J., NESER F.W.C., OLIVIER, J.J., VONDER WESTHUIZEN C.
(2002): Relationship between production performance visual appraisal and body
measurements of young Dorper rams. S. Afr. J. Anim. Sci., 256-262.
HEINRICHS A.J., ROGERS G.W., COOPER J.B. (1992): Predicting body weights
and height in Holstein heifer using body measurements. J. Dairy Sci., 3576-3581.
Minitab, 2016. Minitab Users Guide. Release 13 for windows. Inc.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 33

NESAMVUNI A.E., MULAUDZI J., ROMANYIMI N.D. TAYLOR G.J. (2000):

Estimation of body weight in Nquni-type cattle under communal management
conditions. S. Afr. J. Anim. Sci., 97-98.
PETERS A.R., BALL P.J.H. (1995): Reproduction in Cattle. [Link].
TUZEMEN N., YANAR M., AKBULUT O., OCKERMAN H.W. (1993):
Prediction of body weights from body measurements in Brown Swiss calves reared
in the eastern region of Turkey. World Review of Anim. Prod., 50-54.
ULUTAS Z., SAATCI M., OZLUTRK A. (2001): Prediction of body weights
from body measurements in east Anatolian red calves. Ataturk Unv. Ziraat Fak.
Dergisi, 61-65.
WILSON L.L., EGAN C.L., TEROSKY T.L. (1997): Body measurements and
body weights of special-fed Holstein veal calves. J. Dairy Sci., 3077-3082.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

ASSOCIATION OF GHR GENE POLYMORPHISMS ON

BEEF CARCASS QUALLITY
Ante Ivankovi, Valentino Drai, Jelena Ramljak, Miljenko Konjai
Department of Animal Science and Technology, University of Zagreb Faculty of Agriculture,
Svetoimunska 25, 10 000 Zagreb, Croatia
Corresponding author Ante Ivankovi, e-mail: aivankovic@[Link]
Original scientific paper

Abstract: In last decades selection in cattle breeding use genomics and

direct selection to reveal preferred variants of polymorphic genes to a significant
extent. In competitive beef production an important factor is the optimization of
growth dynamics, quality carcasses production and meat rich in flavor. The aim of
this research was to determine the allele variants of the GHR gene in the population
of fattening beef and their correlation with the growth characteristics, carcasses and
meat quality. In the studied population, dominance of the allele A variant (0.588) of
the GHR gene was determined. Correlation between GHR gene allele variants with
growth characteristics, slaughter weight, hot and cold carcasses weight, and
dressing percentage was not determined. Significant relation was observed between
AA genotype of GHR gene with a higher fat content (p<0.01) and a lower content
of muscle tissue (p<0.05). Also, significant correlation between A allele with the
body fat coverage (p<0.05) was observed. The results suggests on potential of the
GHR gene polymorphism in the immediate cattle selection assisted by genetic
markers. Favouring the allele G of GHR gene, it is possible to reduce the
proportion of fat tissue in young bulls and increase the proportion of muscles. It is
desirable to continue monitoring allele variants effects of the GHR gene on
phenotypic characteristics and interaction with other candidate genes.

Key words: polymorphism, GHR gene, carcass quality, beef quality

Introduction
Sustainable beef production is conditioned with genetic basis and
numerous non-genetic factors which affects growth dynamics, body conformation
and meat quality. Consumers, especially in economically developed countries, put
greater emphasis on meat quality, its origin and respect the principles of good
agricultural practice in production technologies. Koknaroglu et al. (2005) suggests
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
35

that fattening performance and profitability are quite complex and are affected by
housing type, season, initial weight, concentration level, sex, and pen cattle
population. Inherited combinations of genes considerably determine the growth,
conformation and carcass efficiency, and nutritive meat quality.
Therefore, increasing of the competitiveness in beef production is possible
by adjusting non-genetic factors and production technologies (available resources)
and selecting favorable genotypes and alleles of desirable genes. Cattle breeds and
genotypes for meat production are significantly different in their dynamics of
growth, development and accumulation of tissue, expected optimal carcass weight,
dressing percentage and other important characteristics. Optimal slaughter ages and
final weights vary widely among cattle breed types (Alberti et al., 2008).
Improvement of the genetic characteristics of bovine breeds for meat production is
carried out by selection measures, primarily using genetically more favorable
variants. By the nineties of the twentieth century, cattle selection was based on the
achievements of population genetics, measurement of phenotypes and using
individuals of better breeding values. The development of molecular genetics has
enabled direct insight into the gene structure, understanding their expression on
proteins, and interaction of genetic variants with some of phenotype characteristics.
Current selection methods in cattle breedig use precision genotyping of individuals
at the nucleotide level using high-resolution HD Chip's (genomic selection) to a
great extent. Also, a whole set of candidate genes has been noted with indications
of direct interaction with fattening and/or dairy cattle phenotype. Observed gene
polymorphisms together with genomic selection (SNP Chip methodology) can be
utilized in genetic improvement of cattle production characteristics.
One of the candidate gene for which it is assumed to play a significant role
in cattle metabolism is the gene encoding the growth hormone receptor (GHR, Gen
Bank [Link]: AF140284, Ge et al., 1999). GHR gene is in direct interaction with
cattle growth hormone and thus affects the metabolic processes and growth of the
organism (Di Stasio et al., 2005; Waters et al., 2011). Ge et al. (1999; 2000)
determined on the chromosome 20 in codogenic sequence of the GHR gene several
polymorphic positions. In the exon 10 there are four nucleotide (SNP) substitutions
at positions 76 (T/C), 200 (G/A), 229 (T/C) and 257 (A/G). The polymorphism at
position 257 in exon 10 induced serine/glycine substitution at protein position 555
(S555G) of the GHR gene (Di Stasio et al., 2005). The S555G polymorphism has
been associated with performance traits (Di Stasio et al., 2005; Sherman et al.,
2008; Waters et al., 2011) and meat quality (Reardon et al., 2010). Ardicli et al.
(2017) did not find association between the GHR polymopphysms on 257 position
and carcass/fattening performance traits. Since some research has point on
potential influence of GHR gene polymorphism on cattle growth dynamics and
meat quality, the aim of the study was to determine the polymorphism of the GHR
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
36

gene in the fattening beef population and correlation of A and G allele variants with
growth characteristics.

Material and methods

The research included sample of forty animals of both sexes (23 young
bulls and 17 heifers). Given the genetic profile of fattening animals, fifteen (15)
individuals were Simmental (11, 4) and twenty-five (25) were crosses of
Simmental x Holstein (12, 13). Calves are weighted after calving and next day
were placed in individual boxes where they were kept for two weeks. From the
third to the tenth week, calves are placed in group boxes. Up to 10 weeks they were
fed with liquid feed (milk substitute up to 6 L/day), hay and concentrate (up to 2
kg/day), and from eleven weeks with forage (silage, hay, concentrate). Water was
available ad libitum. Calves old 16 to 18 weeks were moved to farm where they
were kept until the end of the fattening period under same accommodation and
feeding conditions, and in group boxes with ten animals. Young bulls and heifers
are kept in separate fattening facilities. During the completely fattening period,
animals were fed with a total mixed ratio (TMR). The average meal consisted of
maize silage (~ 32% dry matter, DM), maize of high humidity (~ 35% DM),
concentrate (34% crude protein, CP) and straw in mass ratio of 45: 40: 10: 5. The
TMR meal was available for the whole day. Transportation of animals to
authorized abattoirs, slaughter, processing and cutting of carcasses were carried out
according to standard procedure. After the primary processing on the warm
carcasses EUROP classification of conformation (E, U, R, O, P) and estimation of
the coverage of the carcasses with fat tissue (score from 1 to 5) was made. Warm
carcasses are weighed and placed in the cooling chambers (24 h/+ 4C) and then
weighed again to determine the mass of the cold carcass and the cooling loss. On
the rib eye area (between the 10th and 12th ribs), dissection of muscle,
bone/cartilage and fatty tissue was performed to estimate their ratio in carcass.
From each individual tissue sample was taken for isolation of DNA
under manufacturer's protocol (Sigma-Aldrich, USA). Using the oligonucleotide
primers 5'-GCTAACTTCATCGTGGACAAC-3' and
5'-CTATGGCATGATTTTGTTCAG-3', a DNA strand length of 342 base pairs
was multiplied. Polymerase Chain Reaction (PCR) was performed according to the
manufacturer's protocol (Takara Bio Inc., Otsu, Shiga, Japan) in a total volume of
15 L including 1.2 L of genomic DNA, 7.5 L EmeraldAmp MAX HS PCR
Master Mix, 0.45 L of each oligonucleotide primers and 5.4 L of water.
Multiplication of the sequence involved activation of the Taq polymerase (98C/3
min), 35 cycles for multiplying DNA sequence (98C/10 s, 53C/30 s, 72C/50 s)
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
37

and its final extension (72C/5 min). Determination of GHR allele variants was
done by restriction with AluI enzyme (Promega Corporation, USA). Visualization
of DNA sequences after enzymatic restriction was performed on 3% agarose gel
with standard of 50 base pairs. Statistical analysis of the results was done using the
GLM procedure and SAS statistical program (SAS STAT, V8, 1999).

Results and discussion

Body weight at birth of male and female calves did not differ
significantly (33.7 vs. 37.3 kg). Fattening period of young bulls lasted 16.2 months
( 495 days) while heifers were fattened up to the age of 15.5 months (474 days).
Bulls compared to the heifers during fattening period reached higher average daily
gains (1176 vs. 901 g/day, p<0.01). During that time bulls were kept 21 days
longer than heifers and reached a higher body weight of 103.1 kg (598.8 vs. 495.7
kg). The mass of hot and cold beef carcasses compared to the heifers carcasses was
significantly higher (p<0.01) what was expected. Differences in dressing
percentage and carcasses chilling loss between young bulls and heifers were not
significant. The effect of sex on the EUROP class and the level of body fat
coverage was significant (p<0.01; p<0.05). Influence of the sex on bone ratio in the
loin eye rib was less pronounced (p<0.05) than the influence on the ratio of muscle
and fat tissue (p<0.01). The slaughtering indicators of young bulls and heifers are
shown in Table 1.

Table 1. Production and slaughter indicators of young bulls and heifers in this research (X SD)

Category of animals Young bulls Heifers Average

Carcass traits (n=23) (n=17) (n=40)
Birth weight (kg) 37.70 6.88 37.33 7.48 37.55 7.03
Fattening period (days) 495.0 27.47 473.9 28.62 486.7 27.89
Average daily gain (kg) 1.176 0.324a 0.901 0.112b 1.07 0.293
Final live weight (kg) 598.8 55.58a 495.7 38.08b 558.1 70.67
Hot carcasses weight (kg) 353.9 33.86a 290.5 31.13b 328.9 45.11
Carcasses chilling loss (%) 1.50 0.335 1.60 0.337 1.54 0.335
Cold carcasses weight (kg) 348.6 33.21a 285.8 30.69b 323.8 44.54
Dressing percentage (%) 58.2 1.634 57.9 7.348 58.1 4.69
EUROP carcass score 3.70 0.470a 3.27 0.458b 3.53 0.506
EUROP coverage with fat tissue 2.78 0.422A 3.20 0.561B 2.95 0.517
Share of muscle tissue (%) 67.1 3.067 a 61.42 4.15b 64.9 4.47
Share of fat tissue (%) 13.0 2.553a 20.92 3.79b 16.1 4.95
Share of bone tissue (%) 19.9 2.193 A 17.67 2.60 B 19.0 2.57
Different large A-B letters in row indicate p<0.05; different small a-b letters in the row indicate p<0.01
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
38

GHR gene polymorphism analysis was performed by restriction of 342 bp long

GHR codogene sequence with AluI restriction enzyme and product visualization on
3% agarose gel (Figure 1). The homozygous AA genotype was identified by three
fragments (191 pb, 101 bp and 50 bp), GG genotype by two fragments (191 bp and
151 bp), and heterozygous AG genotype by four GHR gene fragments (191 bp, 151
bp, 101 bp, and 50 bp). In the investigated sample of 40 animals, 19 homozygous
and 21 heterozygote individuals were observed (Table 2).
Table 2 Frequency of genotypes and allele variants of the GHR gene, observed and expected
heterozygosity in the studied population of fattening cattle

No. observed Genotype HO Frequency

Genotype 2 Allele s.d.
genotype frequency HE of allele
AA 13 0.325
0.525 A 0.588
AG 21 0.525 0.736 0.0541
0.485 G 0.412
GG 6 0.150
Ho/He observed/excepted heterozygosity; 2 Chi square; s.d. standard deviation

Allele variant A in relation to G allele dominates in the studied population

of cattle (0.588: 0.412). Hadi et al. (2015) in the Holstein population observe
frequency of A and G allele variants of the GHR gene (0.65: 0.35) while Hradecka
et al. (2008) in the Holstein population notice dominance of A versus the G allele
variant (0.95: 0.05). Di Stasio et al. (2005) for the Piedmontese breed suggests a
uniform distribution of A and G allele variants of the GHR gene (0.49: 0.51).
Higher value for observed than expected heterozigosity can be explained by the
disequilibrium because of crossing Simmental and Holstein breeds in the sample.

Figure 1 Identification of genotypes of GHR gene (M - standard with spacing of 50 base pairs )
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
39

Considering the observed genotypes of GHR gene and production

indicators in the sample, certain interactions can be found. It has been observed
that the genotype AA has a higher degree of fat cover and a lower ratio of muscle
tissue (p<0.05). Association of the AA genotype of GHR gene with a higher
proportion of fatty tissue in the loin eye rib was also observed (p<0.01; Table 3).
Table 3 Indicators of carcass quality and meat of fatty young bulls and heifers considering
observed GHR genotypes (X SD)

Genotype AA GA GG
Carcass traits (n=13) (n=21) (n=6)
Average daily gain (kg) 1.001 0.203 1.106 0.346 1.052 0.234
Final live weight (kg) 537.09 57.94 575.04 76.16 537.16 65.82
Hot carcasses weight (kg) 315.35 37.94 336.63 47.99 313.33 50.23
Carcasses chilling loss (%) 1.673 0.329 1.515 0.353 1.530 0.363
Cold carcasses weight (kg) 310.06 37.19 331.53 47.38 308.62 49.97
Dressing percentage (%) 59.50 8.251 57.58 1.824 57.23 2.704
EUROP carcass score 3.307 0.480 3.667 0.483 3.333 0.516
EUROP coverage with fat tissue 3.076 0.640 A 3.000 0.316 A 2.501 0.548 B
Share of muscle tissue (%) 62.12 5.238 A 65.74 3.495 B 66.22 4.243 B
Share of fat tissue (%) 19.60 5.648a 14.85 3.857 b 14.60 3.467 b
Share of bone tissue (%) 18.28 2.535 19.41 2.459 19.16 2.780
Different large A-B letters in order signify p<0.05; different small a-b letters in order signify p<0.01

Comparing data of fattening beef production with regard to the presence of

A and G allele variants of GHR gene, a significant influence of A allelic variation
on a higher proportion of fatty tissue in the loin eye rib was observed (Table 4).
Thus, individuals with AA genotype with respect to GA/GG genotypes have
significantly higher proportion of fatty tissue (19.6 vs. 14.8; p<0.01) and a lower
proportion of muscle tissue (62.1 vs. 65.8; p<0.05). It was observed that the GG
genotype with respect to AA/GA genotypes has lower body fat coverage (3.03 vs.
2.50; p<0.05).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
40

Table 4 Quality indicators of carcass and beef carcass in view of the observed combinations of
GHR genotypes (X SD)

Genotype AA/AG GG AA GG/GA

Carcass traits (n = 34) (n = 6) (n = 13) (n = 27)
Average daily gain (kg) 1,067 0.306 1,053 0.234 1,001 0.203 1,094 0.322
Final live weight (kg) 562.0 71.84 537.2 65.82 537.1 57.94 566.6 74.52
Hot carcasses weight (kg) 328.5 45.05 313.3 50.23 315.3 37.94 331.4 48.53
Carcasses chilling loss (%) 1.576 0.348 1.530 0.363 1.673 0.329 1.519 0.348
Cold carcasses weight (kg) 323.3 44.45 308.6 49.97 310.1 37.19 326.4 47.97
Dressing percentage (%) 58.24 4.996 57.23 2.704 59.50 8.251 57.51 1.997
EUROP carcass score 3.529 0.506 3.334 0.516 3.308 0.480 3.593 0.501
EUROP cov. with fat tissue 3.029 0.46A 2.501 0.55B 3.071 0.641 2.889 0.424
Share of muscle tissue (%) 64.36 4.537 66.23 4.243 62.12 5.23A 65.85 3.59B
Share of fat tissue (%) 16.66 5.111 14.60 3.467 19.60 5.65a 14.79 3.71b
Share of bone tissue (%) 18.98 2.513 19.17 2.781 18.28 2.536 19.36 2.480
Different large A-B letters in row indicate p<0.05; different small a-b letters in the row indicate p<0.01

There was no correlation of the GHR gene polymorphisms with the

dynamics of animal growth, but there were significant correlation with proportion
of muscle and fat tissue in loin eye rib. Reardon et al. (2010) have also determined
the association of polymorphism of GHR gene with meat quality. In some earlier
studies, the correlation of the polymorphism of GHR genes with performance traits
was observed (Di Stasio et al., 2005; Sherman et al., 2008; Waters et al., 2011).
However, in this study, such association was not observed. Since the share of fatty
tissue in the carcasses and meat is an important factor of the quality (market prices,
nutritional and sensory quality of meat, consumer perception), the apparent
association of the GHR gene allelic variants with the share of fatty tissue indicates
the need for further research to ensure the safety of observed interactions and
eventual confirmation of the GHR as a valuable gene candidate.

Conclusion
In the investigated sample of beef carcass the dominance of A allele of the
GHR gene was observed. Significant association between the AA genotype of GHR
gene and the higher body fat content in the beef carcasses and higher coverage with
fat was observed. Results indicate the potential utilization of GHR gene variants in
cattle selection related to carcass and meat quality of beef carcasses.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
41

Povezanost polimorfizma GHR gena sa kvalitetom trupova

junadi
Ante Ivankovi, Valentino Drai, Jelena Ramljak, Miljenko Konjai

Rezime

Odgajivako-selekcijski rad u govedarstvu zadnjih decenija u sve

znaajnijoj meri koristi prednosti genomike i neposredne selekcije na poeljne
varijante polimorfnih gena. U konkurentnoj proizvodnji goveeg mesa vana je
optimizacija dinamike rasta, proizvodnja kvalitenih trupova i mesa bogatog ukusa.
Cilj istraivanja je utvrivanje alelnih varijanti GHR gena u populaciji tovnih
goveda te njihove povezanosti s odlikama rasta, kvalitetom trupa i mesa. U
istraenoj populaciji goveda utvrena je dominacija alelne A varijante GHR gena
(0,588). Nije zapaena povezanost alelnih varijanti GHR gena s odlikama rasta,
klaninom masom ivotinja, masom toplih i hladnih polutki i randmanom. Uoena
je znaajna povezanost AA genotipa GHR gena s veim udelom masnog tkiva
(p<0,01) i manjim udelom miinog tkiva u trupu (p<0,05). Takoe, zapaena je
povezanost alelne A varijante GHR gena sa prekrivenosti trupa masnim tkivom
(p<0,05). Istraivanje ukazuje na potencijal polimorfizma GHR gena u neposrednoj
selekciji goveda kao genetskog markera. Proteiranjem alelne G varijante GHR
gena moe se umanjiti udeo masnog tkiva u juneim trupovima te poveati udeo
miinog tkiva. Pri tome je poeljno nastaviti praenje uinaka alelnih varijanti
GHR gena na fenotipske odlike goveda te interakciju s drugim selekcijskim
kandidat genima.

Kljune rei: polimorfizam, GHR gen, kvalitet trupa, kvalitet govedine

References
ALBERTI P., PANEA B., SANUDO C., OLLETA J., RIPOLL G., ERTBJERG P.,
CHRISTENSEN M., GIGLI S., FAILLA S., CONCETTI S. (2008): Live weight,
body size and carcass characteristics of young bulls of fifteen European breeds.
Livestock Science, 114: 19-30.
ARDICLI S., DINCEL D., SAMLI H., BALCI F. (2017): Effects of
polymorphisms at LEP, CAST, CAPN1, GHR, FABP4 and DGAT1 genes on
fattening performance and carcass traits in Simmental bulls. Arch. Anim. Breed.,
60: 61-70.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017
42

DI STASIO L., DESTEFANIS G., BRUGIAPAGLIA A., ALBERA A.,

ROLANDO A. (2005): Polymorphism of the GHR gene in cattle and relationships
with meat production and quality. Animal Genetics, 36: 138-140.
GE W., DAVIS M.E., HINES H.C., IRVIN K.M. (1999): Twoallelic DGGE
polymorphism detected in the promoter region of the bovine GHR gene. Animal
Genetics, 30: 161-168.
GE W., DAVIS M.E., HINES H.C., IRVIN K.M. (2000): Rapid communication:
single nucleotide polymorphisms detected in exon 10 of the bovine growth
hormone receptor gene. Journal of Animal Science, 78: 2229-2230.
HRADECKA E., CITEK J., PANICKE L., REHOUT V., HANUSOVA L. (2008):
The relation of GH1, GHR and DGAT1 polymorphisms with estimated breeding
values for milk production traits of German Holstein sires. Czech Journal of
Animal Science, 53: 238-245.
HADI Z., ATASHI H., DADPASAND M., DERAKHSHANDEH A.,
GHAHRAMANI SENO M.M. (2015): The relationship between growth hormone
polymorphism and growth hormone receptor genes with milk yield and
reproductive performance in Holstein dairy cows. Iran Journal of Veterinary
Research, 16: 224-248.
KOKNAROGLU H., LOY D., WILSON D., HOFFMAN M., LAWRENCE J.
(2005): Factors affecting beef cattle performance and profitability. Prof. Anim.
Sci., 21: 286-296.
REARDON W., MULLEN A., SWEENEY T., HAMILL R. (2010): Association of
polymorphisms in candidate genes with colour, water-holding capacity, and
composition traits in bovine M. longissimus and M. semimembranosus. Meat
Science, 86: 270-275.
SAS (1999): OnlineDoc Software Release 8. SAS Institute Inc., Cary, NC, USA.
SHERMAN E.L., NKRUMAH J.D., MURDOCH B.M., LI C., WANG Z., FU A.,
MOORE S.S. (2008): Polymorphisms and haplotypes in the bovine neuropeptide
Y, growth hormone receptor, ghrelin, insulin-like growth factor 2, and uncoupling
proteins 2 and 3 genes and their associations with measures of growth,
performance, feed efficiency, and carcass merit in beef cattle. Journal of Animal
Science, 86: 1-16.
WATERS S., MCCABE M., HOWARD D., GIBLIN L., MAGEE D., MACHUGH
D., BERRY D. (2011): Associations between newly discovered polymorphisms in
the Bos taurus growth hormone receptor gene and performance traits in Holstein
Friesian dairy cattle. Animal Genetics, 42: 39-49.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

ANALYSIS OF BETA-LACTOGLOBULIN IN SMALL

HERD OF CATTLE BY PCR-RFLP

Violeta Caro Petrovi, Milan M. Petrovi, Nevena Maksimovi, Marina

Lazarevi, Aleksandar Stanojkovi, Nenad Mici, Milos Marinkovi

Institute for Animal Husbandry, 11080 Belgrade, Serbia

Corresponding author: violycaro@[Link]
Original scientific paper

Abstract: The Beta-lactoglobulin loci affecting the milk production traits

as well as the milk quality and their polymorphisms describe a part of the genetic
variance and improve the breeding value estimation of breeding value. The study
aim was to identify the Beta-Lactoglubulin genotypes of one small herd of cows
Simmental breed. For the preliminary investigation had utilized 10 Simmental
cows from a private farm (small herd). The detection of the genetic polymorphism
of the bovine Beta-Lactoglobulin was performed by digestion the PCR products of
262 bp with restriction endonuclease Hae III. The Beta-Lactoglobulin genotype of
all the cows tested showing that they belong to an AA genotype having the lengths
of restriction fragments of 153 and 109bp. PCR-RFLP is an efficient method that
can be used to determine the dairy cattle genotype and the use of molecular
markers is the substitute to the current methods of interest traits in animals.

Keywords: Beta-lactoglobulin, genotyping, PCR-RLFP

Introduction
The milk protein comprises of casein and whey protein. Beta-lactoglobulin
gene is situated on bovine chromosome 11 and encodes the main protein of whey
(Karimi et al., 2009). Beta-lactoglobulin is 1 of 2 major whey proteins found in the
mammals milk, mainly ruminants (Remus-Alexandru et al., 2010; Alim et al.,
2015) and exists in different allelic forms which are controlled by co-dominant
autosomal genes (Madureira et al., 2007; Meignanalakshmi S. et al., 2013). Beta-
lactoglobulin (b-LG) is a globular protein member of the lipocalin family (large
group of small extracellular proteins) and is the main whey protein of ruminant
milk consisting around 50% of total whey proteins (Flower, 1996; Badola 2003;
Selvaggi et al., 2014). Polymorphism of -lactoglobulin gene was discovered in
1955 and a total of 15 alleles are known (Threadgill and Womack,1990; Mat et al.,
2007). The common alleles are A, B, C and D, with alleles A and B being the most
frequent (Farrell et al., 2004). The Beta-Lactoglobulin loci affecting the milk
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
44 October 11-13, 2017

production traits as well as the milk quality and their polymorphisms describe a
part of the genetic variance and improve the breeding value estimation of breeding
value (Alim et al., 2015). Genetic polymorphism of milk protein received
considerable research interest in the past years due to the probable associations
between milk protein genotypes and economically important traits in dairy cattle
(Tsiaras et al., 2005; Rachagani et al., 2006; Ilie et al., 2010; Selvaggi et al. 2014).
The study aim was to identify the Beta-Lactoglubulin allele A and allele B
and Beta-Lactoglubulin genotypes AA; AB and BB in one small herd of Simmental
cows.

Materials and Methods

For the preliminary investigation has utilized 10 Simmental cows from a
private farm (small herd). The blood samples are having stored at -200C in a
vacutainer tubes EDTA Lavender top. Isolation of DNA was done using the Quick
DNA universal Kit (Epigenetics) from thawed blood samples. The isolated DNA
was then placed in a micro centrifuge tube and stored in freeze at -200C until used
for amplification.
Primers sequences used for amplification of beta-Lactoglobulin: 5
GTCCTTGTG CTGGACACCGACTACA-3 (forward) and 5-
CCCAGGACACCGGCTCCCGGTATAT -3 (reverse). The PCR amplification
reactions carried out containing 1 l of DNA, 10 l mastermix, 1 l of each primer
(forward and reverse) and 7 l distilled water with a final volume of 20 l.
The study of Beta-Lactoglobulin genotyping has performed through a plain
polymerase chain reaction using of the Qantarus Q Cycle. The following applied
steps includes primary denaturation step at 950C for 5 minutes followed by 40
cycles of which include the denaturation at 950C at 30 seconds, annealing at 570C
at 30 seconds, elongation at 720C for 1 minute and 10 minutes extension at 720C.
The PCR products are having analyzed with electrophoresis of 2% agarose
gel and visualizing under UV rays. For the genotyping identification, the PCR
products are having digested with the endonuclease Hae III and incubated for 3
hours at 370 C.

Results and Discussions

For the evaluation of beta-Lactoglobulin genotypes distribution was used
the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism
method with certain designed sequences of interest. A 262bp have acquired after
electrophoresis in agarose gel having stained with advance blue (Figure 1).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 45

Figure 1. Electrophoresis pattern of amplified bovine genomic DNA with beta- Lactoglobulin
specific primers separated on 2% agarose gel stained with advance blue.

The Lane 1 (Figure 1), indicating the molecular size marker. Lane 2-11
were the fragments amplified for Beta-Lactoglobulin gene. (100bp DNA Step
Ladder).

Table 1. Milk production for 305 days lactation period of the 10 cows
ID No./Name Milk yield % Milk fat Milk fat (kg) % Milk Milk Protein
Protein (kg)
7154374170 6,031 4.10 247.565 3.42 206.370
Lana
7165188741 5,122 4.05 207.594 3.40 174.225
Marija
7134770915 6,806 4.09 278.340 3.42 232.952
Lisa
7124770911 6,822 4.08 278.315 3.42 233.544
Cakana
7175602711 5,910 4.09 241.796 3.41 201.588
Neda
7102827406 4,683 4.10 192.016 3.38 158.296
Vanda
7113407791 4,998 4.08 203.930 3.40 169.941
Lela
7175565172 5,213 4.08 212.620 3.39 176.909
Majda
7185601216 5,705 4.06 231.658 3.41 194.810
Cura
7155602712 5,312 4.05 214.923 3.41 180.920
Mona
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
46 October 11-13, 2017

The detection of the genetic polymorphism of the bovine Beta-

Lactoglobulin was performed by digesting the PCR products of 262 bp with
restriction endonuclease Hae III (Medrano and Aguilar-Cordova, 1990). The
lengths of restriction fragments are 153 and 109bp for the AA genotype, 109 and
79 bp for BB genotype. Three fragments of 153, 109 and 79bp for heterozygous
AB genotype (combination of the two alleles A and B). The result of the study,
revealing that all the cows tested are having a homozygous Beta-Lactoglobulin AA
genotype (Figure 2).

Figure 2. Electrophoresis pattern for beta-Lactoglobulin digested with Hae III enzyme. (100bp
DNA Step Ladder).

The milk fat and protein percent (Table 1) of the tested cows used in this
study precisely connected with the acquired Beta-Lactoglobulin genotype.
A lot of studies were performed to investigate the effect of B-LG genotypes on
milk production traits, milk composition and quality (Gouda et al., 2011; Selvaggi
et al. 2014; Dogru 2015). Some authors informed the association of Beta-
Lactoglobulin protein variants A and B in bovine milk. Remus-Alexandru et al.
(2010) informed that the AA homozygote supply milk with a low percentage of fat
but in a larger quantity. On the other hand, Ali at al. (2015) stated that the -LG
protein variants A and B are having associated with different amounts of -LG
protein in the bovine milk of which the variant A has a higher LG protein
concentration than variant B. According to Medrano and Aguilar-Cordova (1990)
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 47

the cows with the AA BLG genotype produced more milk with higher protein as
compared to the BB homozygote. Zaglool et al., (2016) found that the genotype
AA produced significantly higher milk yield, protein % in Holstein Friesian cattle
breed. The AA genotype cows compared to cows with AB and BB genotypes
produced milk with a higher milk fat content and more favorable share of protein in
milk with cows AB and BB genotype however the mentioned differences were not
significant (Dokso et al., 2014). The milk fat and protein percent (Table 1) of the
tested cows used in this study precisely connected with the acquired B-Lg
genotype.
We do agree with the notes of Rachagani et al. (2006) that the use of
polymorphic genes as detectable molecular markers is an alternative way to the
current methods of trait selection that associated with traits of interest in animals.

Conclusion

The results of Rapid Fragment Length Polymorphism (RFLP) analysis

indicating that the cows tested are all homozygous AA genotype for Beta-
Lactoglobulin. The Polymerase Chain Reaction- Rapid Fragment Length
Polymorphism (PCR-RFLP) is an efficient method that can be used to determine
the dairy cattle genotype. Thus, the use of molecular markers is the substitute to the
current methods of interest traits in animals.

PCR-RFLP analiza Beta-laktoglobulina malog stada krava

Violeta Caro Petrovi, Milan M. Petrovi, Nevena Maksimovi, Marina Lazarevi,

Aleksandar Stanojkovi, Nenad Mii, Milo Marinkovi

Rezime

Beta-laktoglobulinski lokusi koji utiu na osobine proizvodnje mleka, kao i

na kvalitet mleka i njihovi polimorfizmi opisuju deo genetike varijacije i
poboljavaju procenu priplodne vrednosti. Cilj istrazivanja je bio da se identifikuju
genotipovi beta-laktoglobulina jednog malog stada krava Simentalske rase goveda.
Za preliminarnu analizu korien je uzorak od 10 Simentalskih krava sa privatne
farme (malog stada). Detekcija genetskog polimorfizma goveeg beta-
laktoglobulina obavljena je digestijom PCR proizvoda od 262 bp sa restrikcionom
endonukleazom Hae III. Genotip beta-laktoglobulina svih testiranih krava pokazuje
da pripadaju genotipu dominantnog homozigota AA koji ima duinu restrikcionih
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
48 October 11-13, 2017

fragmenata od 153 i 109 bp. PCR-RFLP je efikasna metoda koja se moe koristiti
za odreivanje genotipa muznih krava i upotreba molekularnih markera je zamena
za savremene metode u analizama osobina ivotinja koje su od interesa.

Kljune rei: Beta-laktoglobulin, genotipizacija, PCR-RLFP

Acknowledgement

This study is part of the project TR 31053 Modern biotechnology

solutions in the breeding and feeding of cattle and sheep and goats for the
production of valuable and safety food supported by the Ministry of Education,
Science and Technological Development, Republic of Serbia.

References
ALIM M.A., SUN D., ZHANG Y., ZHANG Y., ZHANG Q., LIU L. (2015):
DNA Polymorphisms in the -lactoglobulin and casein Genes Associated with
Milk Production Traits in Dairy Cattle Bioresearch Communications, 1 (2): 82-86.
BADOLA S., BHATTACHARYA T.K., BISWAS T.K., SHIVAKUMAR B.M.,
KUMAR P., MISTRA S.S., SHARMA A. (2003): Bubaline beta-lactoglobulin
gene polymorphism: A contrast from its bovine counterpart. Buffalo J., 19 (4):
291-298.
DOGRU U. (2015): -Lactoglobulin Genetic Variants In Brown-Swiss Dairy
Cattle And Their Association With Milk Yield And Quality Traits. The Journal of
Animal & Plant Sciences, 25(2): 595-598.
DOKSO A., IVANKOVI A., BRKA M., ZEEVI E., IVKI Z. (2014): Utjecaj
genetskih varijanti -laktoglobulina, -kazeina i s1-kazeina na koliinu i kvalitetu
mlijeka holstein, simentalske i smee pasmine goveda u Hrvatskoj. Mljekarstvo 64
(1), 49-56.
FARRELL JR H.M., JIMENEZ-FLORES R., BLECK G.T., BROWN E.M.,
BUTLER J.E., CREAMER L.K., HICKS C.L., HOLLAR C.M., NG-KWAI-
HANG K.F. & SWAISGOOD H.E. (2004): Nomenclature of the proteins of cows'
milk-- sixth revision. Journal of Dairy Science 87, 1641-74.
FLOWER D.R. (1996): The lipocalin protein family: structure and function.
Biochem J., 15; 318(Pt 1): 114.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 49

GOUDA E.M. , GALAL M.K., WASFY M.A.,, ABDELAZIZ S.A. (2011):

Phenotypes, Genotypes and Allele Frequencies of B-lactoglobulin in Egyptian
Cattle and Buffalo. Journal of Agricultural Science, 3( 4):203-210.
ILIE D.E., SLJEANU A., MAGDIN A., NEAM R., VINTILA I. (2010):
Early Determination of Animals with Favorable Genes in Milk Production for
Profitable Private Farms. Animal Science and Biotechnologies, 43 (1): 279-282.
KARIMI K., BEIGI NASIRI M.T., FAYYAZI J., MIRZADEH K.H.,
ROUSHANFEKR H. (2009): Allele and genotype frequencies of _-lactoglobulin
gene in Iranian Najdi cattle and buffalo populations using PCR-RFLP. African
Journal of Biotechnology 8 (15): 3654-3657.
MADUREIRA A.R., PEREIRA C.I., GOMES A.M.P., PINTADO M.E.,
MALCATA F.X. (2007): Bovine whey proteinsOverview on the main biological
properties, Food Research International, 40, 11971211.
MEDRANO J.F., AGUILAR E. (1990). Genotyping of bovine kappa casein loci
following DNA sequence amplification. Biotechnology, 8, 144-146.
MEIGNANALAKSHMI S., GOPI H. AND MAHALAINGA NAINAR A. (2013):
Effect of Genotypes of Beta Lacto Globulin on Milk yield and Milk composition
during four Lactation Periods in Red Sindhi cows Research Journal of Animal,
Veterinary and Fishery Sciences, 1(11): 1-4.
RACHAGANI S., GUPTA I.D., GUPTA N., GUPTA S.C. (2006). Genotyping of
beta-lactoglobulin gene by PCR-RFLP in Sahiwal and Tharparkar cattle breeds.
BMC Genet. 7: 31-34
REMUS-ALEXANDRU V.B., GEORGESCU S. E., MANEA M. A.,
DINISCHIOTU A., COSTACHE M. (2010): University of Bucharest, Faculty of
Biology, Molecular Biology Center, Bucharest.
[Link]
SELVAGGI M., LAUDADIO V., DARIO C., TUFARELLI V. (2014):
Investigating the genetic polymorphism of sheep milk proteins: a useful tool for
dairy production. Journal of the Science of Food and Agriculture, 94 (15): 3090
3099. doi: 10.1002/jsfa.6750.
THREADGILL D.W., WOMACK J.E. (1990): Genomic analysis of the major
bovine milk protein genes. Nucleic Acids Research 18 (23): 6935-6942.
TSIARAS A.M., BARGOULI G.G., BANOS G., BOSCOS C.M. (2005): Effect of
kappaCasein and betaLactoglobulin loci on milk production traits and reproductive
performance. J Dairy Sci., 88: 324-334.
ZAGLOOL A.W., AWAD A., EL SAYED EL ARABY I., EL-BAYOMI K.M.
(2016): Association of Lactoglobulin Gene Polymorphism with Milk Yield, Fat
and Protein in Holstein-Friesian Cattle. World Vet J, 6(3): 117-122.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

THE INFLUENCE OF KAOLIN E559 ON MILK

PRODUCTION AND SOMATIC CELLS COUNT IN MILK
DURING THE INDOOR AND OUTDOOR PERIODS
Vigilijus Jukna1, eslovas Jukna2, Vaidas Pruseviius3,
Edita Mekinyt-Kauilien4, ydrn Vyniauskait5
1
Institute of Energy and Biotechnology Engineering, Aleksandras Stulginskis University
Student str. 11, Akademija, Kaunas distr., Lithuania
2
Veterinary Academy, Lithuanian University of Health Sciences
Tils str. 18, Kaunas, Lithuania
3
The Ministry of Agriculture of the Republic of Lithuania
Gedimino str. 19, Vilnius, Lithuania
4
Center of Animal Husbandry Selections, Breeding Values and Dissemination,
Aleksandras Stulginskis University
Student str. 11, Akademija, Kaunas distr., Lithuania
5
Center of Animal Husbandry Selections, Breeding Values and Dissemination,
Aleksandras Stulginskis University
Student str. 11, Akademija, Kaunas distr., Lithuania
Corresponding author: [Link]@[Link]
Original scientific paper

Abstract: The effect of kaolin E559 was studied on dairy cattle during
the indoor and outdoor periods. Cows were divided into the control and treatment
groups each including 40-45 cows. Cows were selected on the basis of their age,
the phase of lactation, productivity, and parents. During the study, cows were fed a
ration of indoor. Cows in both groups received the same concentrated feeding with
respect to produced milk, 350 grams per one kilogram. Cattle in the treatment
group received 1.5 kg of kaolin powder. The somatic cells count was lower in milk
produced by cows fed the clay supplement as compared to the control group
(p<0.001). During the indoor period, cattle fed mix of combined food kaolin E559
produced 10.3% more milk, the level of fat content was 0.09 % higher, and the
level of protein was 0.28% higher as compared to the control group. At the end of
the study, the level of leukocytes was significally higher in the blood of cows from
the control group. The blood of cows from the treatment group was higher in
hemoglobin by 9.7 g/l (p<0.005) and in globulin by 5 g/l (p<0.001). The clay
supplements did not significantly affect cows housed outside (p<0.05).

Key words: kaolin E 559, milk, production, somatic cells

Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 51

Introduction
The dairy cattle breeding is one of the most challenging branches of
agriculture. Grass feeding is very beneficial to cattle, but bad weather conditions
and technological failures can cause the growth of fungi in feed which can be toxic
to cattle. As a result, fungi reduce animals productivity, weakens the immune
system, and cause sexual dysfunctions. Eventually, a wide range of reproduction,
food consumption, and productivity problems occur (Bakutis, 2007; Zainukov et
al., 2008). Moldy feed and toxins affect the developing fetus. Mold toxins also
accumulate in milk and pose a potential risk to a human health. Moreover, feeding
calves moldy milk causes severe diarrhea which leads to death (Ani et al., 2014).
The growing interest in organic food production encourages farmers to use
natural resources in livestock farming systems. Nowadays, one can find
information that bentonite clays can be used not only as a supplement, but as
absorbents as well. Morozo et al., (2009) claimed that feed supplemented with
crushed grains and bentonite had a positive effect on milk yield and milk fat
content. Trckova et al., (2006) and Demirel et al. (2011) stated that 1.5 % of zeolite
on a dry matter had increased milk production. Andrejkoviov et al. (2016) stated
that 1.5 % of zeolite on a dry matter improved the digestibility of 12 to 18 months
old bulls by 4.7-9.1 %.
Aluminosilicates (e.g., zeolite, bentonite, kaolin, etc.) can absorb toxins,
toxic metals, radionuclides (U, Ra, Cs, I), ammonia, carbon dioxide, methane, and
other organic pollutants (Adamovi et al., 2011; Liang et al., 2013). Kaolin is a
soft, plastic clay mainly composed of the mineral kaolinite which is a hydrated
aluminum silicate Al 2 O 32 SO 22 H 2 O (Murray, 2002). It was identified that kaolin
and other silicate clays have a positive effect on calves (Lee et al., 2010; Sidorova,
2009; Kardiauskas et al., 2015), pigs (Trckova et al., 2004), and poultry (Owen et
al., 2012; Ani et al., 2014).
Bentonite clays contain all the basic macro- and microelements necessary
for the normal development of an organism. Bentonite clays absorb bodily toxins,
bacteria, poisons. Bentonite also gently covers the mucous membrane of the
stomach and helps reduce inflammations (Huwig et al., 2001; Trskova et al., 2004;
Liang et al., 2013). The effectiveness of clay depends on the amount of clay added
to feed which is different for each animal (Katouli et al., 2001).
The aim of this study was to investigate the influence of kaolin E559 on
milk production and somatic cells count in milk during the indoor and outdoor
periods.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
52 October 11-13, 2017

Material and methods

While analyzing the influence of kaolin E559 on dairy cattle during the
indoor period, cows were divided into the control and treatment groups each
including 40-45 cows. Cows were selected on the basis of their age, the phase of
lactation, productivity, and parents. During the study, cows were fed a ration of
indoor. The study was carried out at Agriculture Company in Grikabdis. Cattle in
the control and treatment groups were fed and treated equally during the indoor and
outdoor periods. Cows in both groups received the same concentrated feeding with
respect to produced milk, 350 grams per one kilogram. Cattle in the treatment
group received 1.5 kg of kaolin powder. The chemical composition of kaolin E559
used in the study was as follows: the dry matter, 95,14; Ca, 0,304; Mg, 0,141; Fe,
0,962; P, 0,086; Mn, 0,007; Na, 0,097; K, 1,382; Cu, 0,024; Se, 0,00011; C, about
30; aluminum silicates, 67,00; Al 203, 29,70 (g/100g). During the indoor period,
cows were tied up and during the outdoor period cows were grazed outside. Cattle
in the treatment group received 1.5 kg of kaolin E559 powder per 100 kg of the
body weight. During the indoor period, the concentrate feed was distributed
manually according to the individual productivity of each cow, while during the
outdoor period, feed was distributed during milking.
The energy value and composition of feed (Table 2) were determined
while using AgroSoft analyzer. The concentrate for dairy cows was K-7340410-
64.
During the indoor period, cows received the following feed (Table 1).

Table 1. The type and amount of feed cows were fed during the indoor period

Feed Amount per day

Grass silage 12 kg (4.65 kg of DM*)
Corn silage 17 kg (6.22 kg of DM)
Wheat straw 0.7 kg (0.595 kg of DM)
Saladin 4 kg (2.0 kg of DM)
Compound feed 8 kg (7.15 kg of DM)
*Amount of the dry matter
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 53

Table 2. Feed composition

Parameters Values
Dry matter kg 21.625
Net energy for lactation (NEL) 139.40
Crude protein g 2689
Crude fat g 648
Sugars g 2260
Starch g 3082
NDF g 1320
ADF g 965
Ca g 140
Pg 92
Mg g 50
Kg 143
Na g 34
Sg 49
Fe mg 1240
Cu mg 253
J mg 16
Vitamin D3, thousand IU 100
Vitamin A, thousand IU 18
Vitamin E mg 710

Cows were milked twice a day. The milk production was recorded while
using a standard milk recording method A4. The control milking was done by
control assistants. The composition and quality of milk were evaluated by the State
Enterprise Pieno tyrimai. Cows productivity and fat, protein, glucose, and urea
content were calculated according to the data obtained by Pieno tyrimai.
In order to analyze the influence of kaolin E559 on cows grazing outdoors,
cows were divided into two groups, namely, the control and treatment groups, each
including 20 cows. The selection was based on the similar level of productivity and
the phase of lactation. Both groups were kept together. Concentrates of 100 kg
were mixed with 1.5 kg of kaolin E559 powder. Cows received concentrated feed
during milking. Cows were milked twice a day. Milk production was recorded
while using a standard milk recording method, A4. The composition and quality of
milk were evaluated by the State Enterprise Pieno tyrimai. The study was carried
out in July, August, and September.
In order to evaluate the health status of cows, blood samples from cows of
similar characteristics were taken at the end of the study. Biochemical and
morphological indices of blood had been studied. Blood samples were analyzed
while using a blood analyzer. Moreover, the health status of cows was observed
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
54 October 11-13, 2017

throughout the entire study period. Data was processed while using the R Stats
Package.

Results and discussion

The findings of the study revealed that kaolin E559 has a positive effect on
the productivity of dairy cattle and the quality of milk during the indoor period.
The findings also showed that kaolin helps reduce the number of somatic cells (SC)
(Table 3).

Table 3. Milk production during the indoor period

Control group Treatment group

Parameters Months Months
In the In the
I II III I II III
beginning beginning
x 11,42 11,55 12,05 11,85 11,48 12,70 13,40 13,01
Milk
Sx 0,22 0,20 0,29 0,32 0,15 0,21 0,25 0,29
production, kg
lim 7,5-16,3 7,0-14,5 6,7-17,6 7,6-19,2 7,8-15,9 8,0-18,5 7,0-19,5 5,2-19,8
x 3,61 3,37 3,42 3,37 3,54 3,71 3,60 3,72
Milk proteins,
Sx 0,062 0,036 0,030 0,028 0,024 0,020 0,041 0,051
%
lim 2,89-5,17 2,81-4,15 3,08-4,19 2,98-4,02 3,13-5,08 2,98-4,71 2,90-4,41 3,21-5,79
x 4,17 4,31 4,39 4,36 4,11 4,38 4,47 4,62
Milk fat, % Sx 0,066 0,046 0,046 0,075 0,054 0,060 0,042 0,065
lim 3,13-5,59 3,38-5,10 3,54-5,24 3,19-5,96 3,48-5,49 3,35-6,35 3,75-5,87 3,55-6,81
x 0,41 0,40 0,41 0,40 0,41 0,47 0,48 0,48
Milk proteins,
Sx 0,017 0,014 0,014 0,015 0,016 0,117 0,008 0,018
kg
lim 0,21-0,84 0,20-0,59 0,21-0,73 0,23-0,77 0,24-0,81 0,24-0,87 0,20-0,61 0,17-1,15
x 0,48 0,50 0,53 0,52 0,47 0,56 0,59 0,60
Milk fat, kg Sx 0,075 0,013 0,015 0,009 0,162 0,018 0,018 0,023
lim 0,36-0,64 0,39-0,59 0,43-0,63 0,38-0,71 0,27-0,87 0,27-1,17 0,26-1,14 0,18-1,34
x 526 542 471 406 875 535 367 183
Somatic cell
Sx 45,9 40,7 15,1 402 33,0 38,4 36,4 24,8
count/ ml
lim 54-1848 40-1547 53-615 29-1515 23-1674 31-1956 31-1852 43-1284
x 4,22 4,31 4,31 4,35 4,30 4,46 4,37 4,36
The amount of
Sx 0,024 0,022 0,031 0,017 0,028 0,022 0,016 0,021
lactose, %
lim 3,60-4,49 3,77-4,58 3,46-4,62 3,94-4,59 3,50-4,75 3,77-4,58 3,69-4,49 3,41-4,48
x 0,48 0,50 0,52 0,51 0,49 0,58 0,58 0,57
The amount of
Sx 0,012 0,011 0,016 0,015 0,009 0,011 0,016 0,014
lactose kg
lim 0,27-0,73 0,26-0,66 0,23-0,81 0,30-0,88 0,27-0,75 0,30-0,84 0,26-0,87 0,18-0,88
x 44,50 27,10 26,80 23,61 45,9 24,3 24,5 19,97
Urea, mg % Sx 0,59 0,31 0,29 0,27 0,52 0,48 0,50 0,42
lim 29-52 19,38 19,37 17,33 32-58 16-40 16-41 15-36

The data presented in the table above shows that 1.5 kg of kaolin E559
powder added to 100 kg of concentrated feed affected milk production during the
first month of the study. The treatment group cows produced more milk that the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 55

control group cows; milk production increased by 1.22 kg (10.6%) and 0.13 kg
(1.0%), respectively. During the second month of the study, the treatment group
cows increased milk production by 0.70 kg (5.5%). It is 1.35 kg (1.7%) more as
compared to the control group. During the third month of the study, milk
production for the treatment group cows decreased by 0.39 kg (2.9%) and for the
control group cows decreased by 0.20 kg (1.7%) as compared to the second month.
During the whole study period, the average amount of milk produced by the control
group was larger by 11.82 kg and the amount of milk produced by the treatment
group was larger by 13.04 (10.32%). Throughout the study period, the average
amount of milk produced by each cow from the treatment group was 1081.53 kg,
whereas, from the control group it was 1193 kg; that is 111.63 kg (10.3%) more of
the amount.
The addition of clay to food affected milk protein composition. Although
in the beginning of the study milk protein level was higher by 0.07% (p>0.05) in
milk from the control group cows, it has increased when food included clay
supplements. During the first month of the study, milk protein level in milk
produced by cows from the treatment group was higher by 0.34%, during the
second month, by 0.24%, and during the third month, by 0.23%, as compared to
milk produced by the control group cows. Clays also had a positive effect on fat
content of milk. During all months of the study, cows fed with kaolin E559
produced milk with a higher fat content as compared to the control group. During
the first month, the difference was 0.07%, during the second month, 0.08%, and
during the last month, 0.26%.
The increase in milk production and improved milk composition resulted
in increased fat and protein levels. During the study, cows from the treatment
group produced 43.61 kg of protein, whereas cows from the control group
produced 37.21 kg. The difference was 6.4 kg (17.2%). The total amount of protein
in milk produced by one cow from the treatment group was 53.34 kg, whereas in
the control group it was 47.27 kg. The difference was 6.07 kg (12.84%).
Cows from the treatment group produced milk having a higher level of
lactose (p>0.05). Clay supplements affected the somatic cell count (SCC); it was
lower. Even though, milk produced by cows from the treatment group had 349 000
more somatic cells before the study, one month later the somatic cell count was a
bit lower as compared to the control group. During the last month of the study, the
somatic cell count in milk produced by cows from the treatment group was
significantly lower as compared to the count of the control group. The difference
was 223 000 (54.93%) (p<0.001).
The findings of urea in milk have shown that the ration for cows was not
balanced correctly before the study. When the ration was balanced, the level of
urea in milk produced by cows of both groups normalized as well. However, the
analysis of urea levels of an individual cow revealed that the ration of cows was
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
56 October 11-13, 2017

not balanced correctly according to the protein levels. Thus, proteins were not
properly used. Other authors, (for example, Zainukov and Mironova, 2008;
Morozov et al., 2009) have also found out that bentonite clay has a positive effect
on milk production. According to their studies, bentonite clay supplements
increased milk production from 8.5% to 10.2% and fat content increased from
0.10% to 0.22%.
Koba (2008) have found out that natural zeolite-based additives in cattle feeding
have significantly reduced the amount of heavy metals stored in their bodies.
The health status of cows was determined by visual assessments and blood
samples which presented morphological and biochemical parameters. Visual
observations of cows revealed that the hair coat of cows fed with kaolin E559 was
shinier as compared to the control group. What is more, cows were more active and
udder diseases rarely occurred. The morphological data of blood is presented in the
table below (Table 4).

Table 4. The morphological data of the cattle blood

Treatment group Control group

Parameters Norm
x Sx lim x Sx lim
9
Leukocytes (WBC), x 10 /L 12,72 2,78 9,0-22,9 23,56 5,04 11,9-55,60 5,0-16,0
Lymphocytes (LYMPH), x 109
5,36 1,84 2,6-14,2 15,42 4,40 1,0-44,5 1,5-9,0
/L
Monocytes (MON), x 109 /L 0,88 0,10 0,6-1,3 1,08 0,16 0,3-1,8 0,3-1,6
Granulocytes (GRAN), x 109
6,48 0,66 4,9-8,2 7,06 1,50 2,3-9,8 2,3-9,1
/L
Lymphocytes (LYMPH), % 37,52 7,22 25,8-61,9 49,34 10,16 29,1-79,9 20,0-60,3
Monocytes (MON), % 7,36 0,62 5,9-9,0 6,24 1,16 3,3-9,1 4,0-12,1
Granulocytes (GRAN), % 57,54 6,94 32,2-66,9 44,42 11,01 16,8-63,0 30-65,0
Erythrocytes (RBC), x 1012 /L 6,94 0,38 5,30-7,2 6,63 0,34 5,6-7,3 5,0-10,1
Hemoglobin (HGB), g/L 107,3 3,10 93-109 97,6 3,40 98-117 90-139

As presented in the Table 4, cows from the control group had an increased
number of white blood cells (p<0.05). The analysis of leukocytes revealed that
several cows from the control group were experiencing severe inflammatory
processes. These findings explain why the somatic cells count was significantly
higher in milk produced by cows from the control group. The fact that the number
of somatic cells in milk produced by cows from the treatment group was
significantly higher before the study than in milk produced by the control group
must be consider as well. This confirms the assumption that bentonite clay helps
reduce inflammation, neutralizes toxins and heavy metals, improves live functions,
and increases productivity. The blood of cows from the treatment group was higher
in hemoglobin as compared to the blood of cows from the control group. It
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 57

contained 9.7 g/l (p<0.05). This suggests that metabolic processes were more
intense for cows from the treatment group.
The biochemical data of blood is presented in the table below (Table 5). It
shows that parameters of cows from both groups were within normal limits.
However, there were some differences between both groups. The level of globulin
in blood of cows from the treatment group was 5 g/l higher that in blood of cows
from the control group (p<0.001). It suggests that their resistance is higher.

Table 5. The biochemical data of the cattle blood

Treatment group Control group

Parameters Norm
x Sx lim x Sx lim
Glucose (GLU), mmol/L 10,3 3,01 0,60-18,21 6,5 0,53 4,6-9,9 0-34
Cholesterols (CHL),
7,73 0,35 6,0-8,09 7,32 0,36 5,66-9,26 1,16-5,17
mmol/L
Hematocrits (HCT), % 29,07 1,06 27,9-1,06 32,20 0,80 29,0-35,6 28-46
Mean platelet volume
50,40 1,20 46,0-54,3 48,8 1,44 42,9-53,3 38-53
(MPV), t/L
Cell hemoglobin mass
16,50 0,48 15,0-17,0 16,40 0,70 14,2-17,5 13-19
(MCH), pg
Mean corpuscular
hemoglobin concentration 328,2 3,20 324,0-340,0 331,2 1,03 327-337 300-370
(MCHC), g/L
Red blood cell distribution
16,1 0,22 15,1-16,7 16,1 0,34 15-16,7 14,0-19,0
width (RDW), %
Platelets (PLT), 109 /L 200,4 7,60 121-309 172,8 2,80 119-233 120-600
Mean platelet volume
6,60 0,26 5,9-7,1 6,40 0,10 6,5-6,6 -
(MPV), t/L
Thrombus volume (PCI) 0,130 0,021 0,076-0182 0,110 0,015 0,074-0,151 -
Globulin (SLOB), g/L 48,0 0,83 39,10-43,25 413,0 0,75 45,0-48,90 30-49
Besoin protein (TP), g/L 77,0 1,05 70,6-77,3 75,0 0,85 74,3-79,0 62-80
Liver enzyme (ALKP), u/l 64,1 2,10 58,0-67,5 51,8 1,10 49,0-54,3 28-233

Cows from the control group had a lower platelet count as compared to the
cows from the treatment group (p<0.05). The platelet count decreases because of
liver, blood, and oncological diseases. Increased levels of platelet count in blood of
cows from the treatment group shows that physiological processes in livers were
more favorable to cows from the treatment group, even though the parameters of
platelet from both groups were within normal limits.
The data of clay usage for cows housed outdoors is presented in the table
below (Table 6).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
58 October 11-13, 2017

Table 6. The data of kaolin E559 usage for cows housed outdoors.

Control group Treatment group

Parameters Month
X Sx X Sx
I 12,52 0,61 12,99 0,51
Milk production, kg II 12,29 0,67 12,96 0,49
III 10,76 0,56 12,02 0,63
I 4,19 0,18 4,27 0,16
Milk fat, % II 3,95 0,22 4,09 0,18
III 4,17 0,42 4,16 0,09
I 3,39 0,08 3,45 0,04
Milk protein, % II 3,36 0,07 3,33 0,07
III 3,84 0,14 3,80 0,08
I 5,24 - 5,54 -
Milk fat, kg II 4,85 - 5,30 -
III 4,49 - 5,00 -
I 4,24 - 4,48 -
Milk protein, kg II 4,13 - 4,31 -
III 4,49 - 4,56 -
I 9,48 - 10,02 -
Milk protein and fat,
II 8,98 - 9,61 -
kg
III 8,98 - 9,56 -
I 4,31 0,03 4,37 0,03
Lactose, % II 4,35 0,02 4,28 0,05
III 4,26 0,02 4,25 0,04
I 5,40 - 5,67 -
Lactose, kg II 5,35 - 5,54 -
III 4,58 - 5,11 -
I 13,60 0,89 18,30 0,84
Urea, % II 24,60 0,70 22,20 0,45
III 18,86 0,70 21,05 0,75
I 213 42,51 207 31,12
Somatic cells,
II 235 40,80 229 21,15
thousand/ml.
III 207 30,00 201 22,36

According to the data presented in the table above, the individual

differences between the control and treatment group are small and statistically
unreliable. It can be suggested that cows eating natural grass increase their level of
micronutrients. The fresh grass usually does not contain toxins which may appear
in silos or haylage, thus, the usage of clay had no significant benefits.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 59

Conclusions
During the indoor period, cattle fed 1 kg of combined food and 1.5 kg of
kaolin E559 produced 10.3% more milk, the level of fat content was 0.09 % higher,
and the level of protein was 0.28% higher as compared to the control group. The
level of protein in milk produced by cows from the treatment group was 6.07 kg
(12.8%) higher than in milk produced by the control group.
The somatic cells count was lower in milk produced by cows fed the clay
supplement as compared to the control group (p<0.001).
At the end of the study, the level of leukocytes was significally higher in
the blood of cows from the control group. This suggests that due to inflammatory
processes, the SCC had increased as well. The blood of cows from the treatment
group was higher in hemoglobin by 9.7 g/l (p<0.005) and in globulin by 5 g/l
(p<0.001). Cows from the control group had a lower platelet count suggesting that
physiological processes in livers were less favorable to the control group cows.
The clay supplements did not significantly affect cows housed outside
(p<0.05).

Uticaj kaolina E559 na proizvodnju mleka i broj somatskih

elija tokom perioda boravka mlenih goveda u zatvorenom i
otvorenom prostoru

Vigilijus Jukna, eslovas Jukna, Vaidas Pruseviius, Edita Mekinyt-Kauilien,

ydrn Vyniauskait

Rezime

Efekat kaolina E559 je prouavan na mlenim govedima u toku perioda

njihovog boravka u objektu, znai zatvorenom prosotru, i na otovorenom. Krave su
podeljene u grupe za kontrolu i tretmane, od kojih svaka sadri 40-45 krava. Krave
su odabrane na osnovu starosti, faze laktacije, produktivnosti i roditelja. Tokom
ispitivanja, krave su hranjene obrocima u zatvorenom prostoru.
Krave u obe grupe su hranjene istim koncentrovanim obrokom, prema
proizvodnji mleka, 350 grama po kilogramu. Goveda u oglednoj grupi su dobijala
1,5 kg kaolinskog praha. Broj somatskih elija u mleku bio je nii kod krava koje
su u obroku dobijale dopunu u obliku gline u odnosu na kontrolnu grupu
(p<0,001).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
60 October 11-13, 2017

Tokom perioda boravka u zatvorenom prostoru, krave koje su dobijale

obrok smeu u kombinaciji sa proizvodom kaolin E559, proizvele su 10,3% vie
mleka, nivo sadraja masti je bio vei za 0,09%, a nivo proteina je bio vii za
0,28% u odnosu na kontrolnu grupu.
Na kraju ispitivanja, nivo leukocita je znaajno bio vei u krvi krava iz
kontrolne grupe. Krv krava iz ogledne grupe je imala veu vrednost za hemoglobin
za 9,7 g/l (p<0,005) i globulin za 5 g/l (p<0,001). Dodatak gline nije znaajno
uticao na krave smetene na otvorenom (p<0,05).

Kljune rei: kaolin E 559, mleko, proizvodnja, somatske elije

References

ADAMOVI M., STOJANOVI M., GRUBII M., ILE D., MILOJKOVI J.

(2011): Importance of aluminosili cate minerals in safe food production.
Macedonian Journal of Animal Science. Vol. 1. No. 1. P. 175180.
AKAHOSHI, A., KOBA, K., ICHINOSE, F., KANEKO, M., SHIMODA, A.,
NONAKA, K., IWATA, T., YAMAUCHI, Y., TSUTSUMI, K., AND SUGANO,
M. (2004): Dietary protein modulates the effect of CLA on lipid metabolism in
rats. Lipids 39, 25-30.
ANDREJKOVIOV, S., SUDAGAR, A., ROCHA, J., PATINHA, C., HAJJAJI,
W., FERREIRA DA SILVA, E., VELOSA, A., ROCHA, F., (2016): Theeffect of
natural zeolite on microstructure, mechanical and heavy metals adsorption
properties of metakaolin based geopolymers. Appl. Clay Sci. 126, 141152.
ANI A. O., OGBU C. C., ILOH E. A. (2014): Response of broiler chicks to diets
containing graded levels of clay. Journal of Animal and Plant Sciences. Vol. 24.
No. 1. P. 3034.
BAKUTIS B. Gyvuli auginimo slyg taka produktyvumui. Monografija. (2007):
P. 126.
DEMIREL R., YOKUS B., SENTURK D., KETANI M., BARAN S. (2011):
Effects of dietary zeolite on serum contents and feeding performance in rats.
International Journal of Agriculture & Biology. P. 345355.
HUWIG A., FREIMUND S., KAPPELI O., DUTLER H. (2001): Mycotoxin
detoxication of animal feed by different adsorbents. Toxicology Letters. Vol. 122.
P. 179188.
KARDIAUSKAS A., KREGDYT K. Paarinio papildo kaolino E559 poveikis
telyi auginimui, vystymuisi ir reprodukcijai. ems kio mokslai. (2015): T. 22.
Nr. P. 93 98.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 61

KATOULI M., SAFAEI JAFARIAHANGARI Y., BAHARLOUEI A. (2011): An

evaluation on the effects of dietary kaolin and zeolite on broilers blood parameters,
T4, TSH and growth hormones. Pakistan Journal of Nutrition. Vol. 10. No. 3.
P. 233237.
LEE S., KIM Y., KWAK W. (2010): Effects of dietary addition of bentonite on
manure gas emission, health, production and meat characteristics of Hanwoo (Bos
Taurus Coreanae) steers. AsianAustralasian Journal of Animal Sciences. Vol. 23.
No. 12. P. 15941600.
LIANG X., GAN Q., LIN J., QI B., LIU Q., DU Y., KE F., ZHENG S. (2013):
Effects of bentonite on rat growth and organ microstructure. Journal of Animal and
Veterinary Advances. Vol. 12. No. 6. P. 664670.
MOROZOV, V., A. MOROZOV, AND S. LAGAYE. (2009): Endogenous JSRV
like proviruses in domestic cattle: analysis of sequences and transcripts. Virology
367:59-70.
MURRAY H. (2002): Industrial clays case study. Mining, Minerals and
Sustainable Development. Vol. 64. P. 19.
SIDOROVA O. J., NODU M. B., DIKE U. A., IDEOZU H. M. (2012): The effects
of dietary kaolin (clay) as feed additive on the growth performance of broiler
chickens. Greener Journal of Agricultural Sciences Vol. 2. No. 6. P. 233236.
TRCKOVA M., MATLOVA L., DVORSKA L., PAVLIK I. (2004): Kaolin,
bentonite and zeolites as feed supplements for animals: health advantages and
risks. Veterinary Medicine Czech. Vol. 49. No. 10. P. 389399.
WAFAR R. J., GABDO I. I., BILHAM D. Y., ONALEYE K. J., OJINNAKA E.,
BILHAM R. Y. (2014): Effects of kaolin supplementation on growth performance,
carcass characteristics and hematological indices of weaner rabbits. International
Journal of Applied Sciences and Engineering Research. Vol. 3. No. 1. P. 9198.
ZAINUKOV R.S., MIRONOVA I.V. (2008): Milk productivity and milk quality of
bestuzhev firstcalf heifers fed rations supplemented with natural alumosilicate
glauconite //
. . 1. Nr. 22-2. . 98-101.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

VARIABILITY OF THE BODY DEVELOPMENT TRAITS

OF SIMMMENTAL COWS IN SERBIA
Dragan Niki1, Vlada Panteli1, Duica Ostoji-Andri1, Predrag
Perii2, Marina Lazarevi1, Nenad Mii1, Maja Petrievi1
1
Institute for Animal Husbandry, Autoput 16, P. Box 23, 11080, Belgrade-Zemun, Republic of Serbia
2
Faculty of Agriculture, Nemanjina 6, 11080, Belgrade-Zemun, Republic of Serbia
Corresponding autor:draganniksic84@[Link]
Original scientific paper

Abstract: Assessment of cows' exterior is important because of the

assessment of the capability of animals to guarantee, through their overall exterior
appearance as well as the appearance of certain parts of the body, not only their
good health but also long production life (longevity). The main goal of measuring
of domestic animals is to determine the body dimensions, to compare animals of
the same or different species, to understand the numerous physiological and
biochemical processes that occur in the animal organism. Only by measuring, the
accurate and reliable data on the general physical development of the animal and
the harmony of its structure are obtained. In the present study, most of the physical
measures were taken on total of 954 animals. The average height of the cow of the
Simmental breed was 141.95 cm, the length of the pelvis was 51.44 cm, the width
of the pelvis was 50.45 cm and the body depth was 78.84 cm. By analyzing the
impact of the unified factor of the rearing system and origin, its very significant
influence (p <0.001) was determined on all four properties of body development.

Key words: Simmental breed, body development, rearing system, origin

Introduction

The Simmental breed of cattle is most common in the Republic of Serbia.

At the beginning of 2013, preliminary results of the Agricultural census carried out
in the Republic of Serbia in 2012 were announced. According to the results of the
census, Serbia has a total of 908,990 cattle, of which about 450,000 cows and
heifers. In the breed structure of cattle in Serbia, it is estimated that the Simental
breed makes about 85%, or about 360,000 cows and heifers (Periic et al., 2009
and Petrovi et al., 2013). Simental cattle are reared increasingly in intensive
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 63

conditions of housing, care and nutrition, i.e., the number of farms in Serbia with
more than 50 females is increasing (Bogdanovi et al., 2012).
In some areas of Serbia, semi-intensive rearing in the herds of several cows is still
present. The genetic improvement of this breed is mainly performed by breeding
and selection in pure breed (Petrovi et al., 2009). The improvement of the genetic
basis of the Simmental cattle population in our conditions is mainly done through
quality bulls (Germany, Austria, etc.) and in recent years, the number of genetically
high quality heifers imported from the best European populations of this breed has
not been negligible.
The experience of the breeders shows that health, resistance, constitution,
fertility, length of exploitation and productive characteristics largely depend on the
development of the body, its structure and the individual parts of the body (Perii
et al., 2008). Deficiencies in the type characteristics lead to poorer production, poor
health status and premature culling of cows from the herd (Panteli et al., 2007).
Romevi (1999) in his monograph "Simental Cattle in Serbia" presents the
morphometric measurements of bull dams of the Simental breed for 1995 and
1996: the height to withers for both years was 136 cm, the chest circumference
(girth) 199 and 202 cm, and the body weight 697 and 692 kg, respectively.
The Institute for the Application of Science in Agriculture (1999), in the
report on the conducted livestock breeding measures in Serbia for 1999, provides
information on the exterior measures of 610 selected bull dams of Simmental
breed: height to withers 136 cm, chest depth 72 cm, body length 163 cm, chest
circumference (girth) 197 cm and body weight 697 kg.
According to the Report on the implementation and results of the Breeding
program in 2014, the Institute of Animal Husbandry (2015) the values of body
measures taken on bull dams were as follows: 143 cm (137-150 cm) height to
rump, 81 cm (71-92 cm) for body depth, 59 cm (43-77 cm) length of the pelvis, 55
cm (41-62 cm) width of the pelvis and 201 cm (188-218 cm) for chest
circumference (girth). The average weight of bull dams was 689 kg (551-822 kg).
Examining the morphometric properties and the incidence of foot deformities in
cows in tied system of rearing, Stojanovi (2012) states the following data on the
average body dimensions of Simmental cows in Kolubara district: height to withers
134.3 cm, height to rump 137.1 cm, body length 157.1 cm, chest width 47.8 cm,
chest depth 86 cm, chest circumference (girth) 200.5 cm, pelvis width 47.5 cm and
tibia circumference of 20.6 cm.
In the breeding programs of European countries for Simmental breed,
different traits are given and different values for them. Thus, in Croatia, the
breeding objective for height to withers is 138 cm to 148 cm, and the body weight
of an adult cow 650 kg to 750 kg; in Germany: height to withers 136-142 cm,
height to rump 138-145 cm, body weight 550-650 kg, etc.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
64 October 11-13, 2017

Material and methods

Basic data on morphometric properties, as well as data on the origin of all
examined cows, were collected in cooperation with the dairy farm "Lazar" Blace,
which housed certain number of animals included in this research. For animals
reared on individual farms, data on these characteristics were collected in
cooperation with the breeding organizations, which carry out all activities in the
implementation of the breeding program in the area of Toplica district.
The total animals (n = 954) included in the study of morphometric traits
were divided into four groups based on origin and rearing system, in the following
way:
Group 1: animals of domestic origin reared by individual agricultural producers (n
= 436);
Group 2: imported animals reared by individual agricultural producers (n = 68);
Group 3: domestic animals reared on farms (n = 282);
Group 4: imported animals reared on farms (n = 168).
The following traits of body development were taken after the first calving: height
to rump, pelvis length, and body depth and pelvis width.

The analysis of the collected data consisted of determining the parameters

of descriptive statistics (average, minimum, maximum, standard deviation,
standard error of average and 95% confidence interval), while the analysis of
variance, using the single factorial analysis model, examined the influence of the
unified factor of the rearing system and the origin of the animals on their body
development:
The model with a fixed unified influence of the rearing system and origin (NP):
Yij = + NPi + eij
Yij: examined trait,
: population average for a given trait,
NPi: a fixed unified influence of the rearing system and origin (i = 1,2,3,4),
E ij : a random error

Subsequent to the analysis of the variance and determination of the basic

parameters of descriptive statistics by the least significant difference test (LSD),
the differences were determined by groups individually for all body development
traits.
For statistical data processing and application of the specified model, the
software SPSS Statistics for windows, Version 23.0 was used.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 65

Results and Discussion

On the basis of the obtained results shown in Table 1, it can be concluded

that the average height of the Simmental cows was 141.95 cm, the length of the
pelvis was 51.44 cm, the pelvis width was 50.45 cm, and the body depth was 78.84
cm.
The highest height to rump was observed in imported cows reared on the
farm (143.56 cm), and the lowest in domestic cows reared by individual
agricultural producers (140.76 cm). The results obtained are lower than the results
from the Report on the implementation of the Breeding program in Serbia, and
higher than the results reported by Stojanovi (2012). The results presented agree
with the breeding goal in Germany for the Simmental cows. The difference
between the groups was statistically very significant (p0.001) in the comparison
of groups 1 and 2, 1 and 3, 1 and 4, 2 and 4, statistically significant (p0.05)
between groups 3 and 4, while between groups 2 and 3, 2 and 4, no statistically
significant (p> 0.05) difference was found (Table 2).
The value for the length of the pelvis was the highest among the cows of
domestic origin reared on the farm (53.72 cm), and the lowest among the imported
cows from reared by individual producers (51.11 cm). Comparing the obtained
values according to the Report on the implementation of the Breeding program in
Serbia in 2014 of the Institute for Animal Husbandry (2015), it can be concluded
that the first heifers from the import reared by individual agricultural producers had
the length of the pelvis as bull dams in Serbia, and other three groups, individually,
had lower values for pelvic length. Statistically very significant (p0.001)
difference between all observed groups was established by the LSD test, except for
groups 1 and 3 where the presence of statistically significant (p> 0.05) difference in
pelvic length (Table 2) was not established.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
66 October 11-13, 2017

Table 1. Mean value and variability of body development traits by groups of first calving heifers

95% confidence
No. of
Trait Group SD SE interval Min. Max.
calvings
LB UB
1 436 140.76 3.163 0.151 140.46 141.06 134 151
Rump 2 68 142.72 3.570 0.433 141.86 143.58 136 152
height
(cm) 3 282 142.65 4.229 0.252 142.16 143.15 134 151
4 168 143.56 3.562 0.275 143.02 144.10 135 155
Total 954 141.95 3.775 0.122 141.71 142.19 134 155
F=31.554*** p=0.000
1 436 51.14 1.681 0.081 50.99 51.30 42 57
Pelvis 2 68 53.72 2.072 0.251 53.22 54.22 46 57
length
(cm) 3 282 51.11 2.401 0.143 50.83 51.39 44 59
4 168 51.83 2.094 0.162 51.51 52.15 46 57
Total 954 51.44 2.128 0.069 51.30 51.57 42 59
F=36.579*** p=0.000
1 436 50.05 1.820 0.087 49.88 50.22 39 54
Pelvis 2 68 52.69 2.160 0.262 52.17 53.21 45 56
width
(cm) 3 282 50.02 2.675 0.159 49.70 50.33 41 61
4 168 51.30 2.490 0.192 50.92 51.68 43 58
Total 954 50.45 2.377 0.077 50.30 50.60 39 61
F=38.568*** p=0.000
1 436 77.83 3.401 0.163 77.51 78.15 66 87
Body 2 68 83.72 3.709 0.450 82.82 84.62 75 90
depth
(cm) 3 282 78.84 4.169 0.248 78.35 79.33 69 85
4 168 79.51 2.624 0.202 79.11 79.91 75 90
Total 954 78.84 3.850 0.125 78.60 79.09 66 90
F=56.552*** p=0.000
***- p0.001; ** - p0.01; * - p0.05; nz - p>0.05

As well as the length, both the width of the pelvis was the highest among
the cows of domestic origin reared on the farm (52.69 cm), and the lowest among
the imported cows reared by the individual producers (50.02 cm). Based on the
obtained results, it can be concluded that all four groups had significantly lower
values than the values for the pelvis width of bull dams in Serbia, as stated in the
Report on the implementation of the Breeding program in Serbia in 2014 by the
Institute for Animal Husbandry (2015), significantly higher than the values stated
by Stojanovic (2012) for cows in the Kolubara district. A statistically significant
(p0.001) difference between all observed groups was established by the LSD test,
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 67

except between groups 1 and 3 where the presence of statistically significant (p>
0.05) difference was not established, Table 2.
The greatest depth of the body was recorded for imported first calvers
reared by individual producers (83.72 cm), and the lowest for domestic cows reared
by individual producers (77.83 cm). If the obtained results are compared with the
results stated in the Report and the results of the implementation of the breeding
program in 2014 of the Institute for Animal Husbandry (2015), only imported cows
reared by individual agricultural producers have greater body depth than bull dams,
while all four groups have much lower values for body depth than stated by
Stojanovi (2012). The least significant difference test (LSD) established
statistically very significant (p0.001) difference between all observed groups in
regard to the trait of body depth, Table 2.
The statistically very significant impact (p <0.001) on all observed
properties was determined in the analysis of the influence of the unified factor (the
rearing system, the origin) on the variability of the body development traits, which
can be seen in Table 1.

Table 2. Differences of average for observed traits by groups of the first calving
heifers (LSD test)

Rump height Pelvis length

group 2 3 4 group 2 3 4
nz
1 -1.959*** -1.891*** -2.798*** 1 -2.576*** 0.031 -0.683***
nz nz
2 -0.068 -0.839 2 2.607*** 1.893***
3 -0.907* 3 -0.714***
Pelvis width Body depth
group 2 3 4 group 2 3 4
1 -2.641*** 0.033 nz -1.247*** 1 -5.893*** -1.012*** -1.678***
2 2.673*** 1.394*** 2 4.880*** 4.215***
3 -1.280*** 3 -0.666***
***- p0.001; ** - p0.01; * - p0.05; nz - p>0.05

Conclusion

On the basis of the obtained results, it can be concluded that all the
observed traits of body development were the most pronounced in imported cows
reared by individual producers, with the exception of the height to rump which was
the highest in the nimported first calvers reared on the farm.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
68 October 11-13, 2017

By analyzing the effect of the unified factor (rearing system x origin) on

the variability of the body development properties, a statistically very significant
influence (p <0.001) was established for all observed traits.
The least significant difference test (LSD) established statistically very
significant (p0.001) difference to absence of difference (p>0.05) among all
observed groups.
Assessment of cows' exterior is important because of the assessment of the
capability of animals to guarantee, through their overall exterior appearance as well
as the appearance of certain parts of the body, not only their good health but also
long production life (longevity). The main goal of measuring of domestic animals
is to determine the body dimensions, to compare animals of the same or different
species, to understand the numerous physiological and biochemical processes that
occur in the animal organism. Only by measuring, the accurate and reliable data on
the general physical development of the animal and the harmony of its structure are
obtained.

Varijabilnost osobina telesne razvijenosti krava simentalske

rase u srbiji
Dragan Niki, Vlada Panteli, Duica Ostoji-Andri, Predrag Perii, Marina
Lazarevi, Nenad Mii, Maja Petrievi

Rezime

Procena eksterijera krava je vana zbog ocene sposobnosti grla da svojim

ukupnim spoljanjim izgledom kao i izgledom pojedinih delovima tela garantuju
pored dobrog zdravlja i trajnu proizvodnju (dugovenost). Osnovni cilj merenja
domaih ivotinja jeste utvrivanje telesnih dimenzija, meusobno poreenje
ivotinja iste ili razliitih vrsta, razumevanje brojnih fiziolokih i biohemijskih
procesa koji se deavaju u ivotinjskom organizmu. Jedino se merenjem dobijaju
tani i sigurni podaci o optoj telesnoj razvijenosti grla i harmoninosti njegove
grae. U radu je veina telesnih mera utvrena na ukupno 954 prvotelki. Prosena
visina krsta krava simentalske rase iznosila 141,95 cm, duina karlice 51,44 cm,
irina karlice 50,45 cm i dubina tela 78,84 cm. Analizom uticaja objedinjenog
faktora naina dranja i porekla, utvren je njegov vrlo visoko znaajan uticaj
(p<0,001) na sve etiri osobine telesne razvijenosti.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 69

Kljune rei: simentalska rasa, telesna razvijenost, nain dranja,

poreklo

Acknowledgment
Research was financed by the Ministry of Education and Science, Republic
of Serbia, project TR- 31053.

References
BOGDANOVI V., EDOVI R., PERII P., STANOJEVI D., PETROVI
M.D., TRIVUNOVI S., KUEVI D., PETROVI M.M. (2012): An assessment
of dairy farm structure and characteristics of dairy production systems in Serbia.
Biotechnology in Animal Husbandry, 28(4):689-696.
INSTITUT ZA PRIMENU NAUKE U POLJOPRIVREDI (1999): Selekcija stoke
u Srbiji za 1999. godinu, Beograd.
INSTITUT ZA STOARSTVO (2015): Struni izvetaj i rezultati o sprovoenju
odgajivakog programa u 2014. godini, Beograd-Zemun.
PANTELI V., SKALICKI Z., PETROVI M.M., ALEKSI S., MIEVI B.,
OSTOJI-ANDRI D. (2007): Phenotypic correlations of productive and
reproductive traits of Simmental cows. Biotechnology in Animal Husbandry, 23(3-
4):11-17.
PERII P., SKALICKI Z., PETROVI M.M., BOGDANOVI V., RUII-
MUSLI D. (2009) : Simmental cattle breed in different production system,
Biotehnologija u stoarstvu 25 (5-6), str. 315-326, Institut za Stoarstvo, Beograd-
Zemun.
PERII P., SKALICKI Z., PETROVI M. M., BOGDANOVI V.,
TRIFUNOVI G. (2008): Simentalska rasa u kombinovanoj i specijalizovanoj
proizvodnji, Biotehnologija u stoarstvu, izdanje 25, posebno izdanje str. 25-37.,
Institut za stoarstvo Beograd-Zemun.
PETROVI M.M., ALEKSI S., PETROVI M.P., PETROVI M., PANTELI
V., NOVAKOVI ., RUI-MUSLI D. (2013): Potentials of Serbian livestock
production: Outlook and future Biotechnology in Animal Husbandry, 29(1):1-17
PETROVI M.M., SRETENOVI LJ., ALEKSI S., PANTELI V.,
NOVAKOVI ., PERII P., PETROVI M.D. (2009): Investigation of the
heritability of phenotypes of fertility and milk performance of Simmental cattle
breed in Serbia. Biotechnology in Animal Husbandry, 25(5-6-1):285-292.
ROMEVI, LJ. (1999): Simentalska goveda u Srbiji. Beograd.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
70 October 11-13, 2017

STOJANOVI M. (2012): Morfometrijske karakteristike i uestalost pojave

deformacija nogu krava simentalske rase u vezanom sistemu dranja.
Specijalistiki rad. Poljoprivredni fakultet, Zemun. Univerzitet u Beogradu.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

THE MODERN STATE OF SHEEP BREEDING IN

RUSSIA
Yusup A. Yuldashbaev1, Maria I. Dongak1, Ksenia A. Kulikova, Elena
V. Pakhomova1, Zhaziraim M. Abenova1, Salbak O. Chylbak-ool1,
Milan P. Petrovic2
1
Russian State Agrarian University - Moscow Timiryazev Agricultural Academy, Faculty of Animal
Science and Biology, Moscow, Russia
2
Institute for Animal Husbandry, Belgrade, Serbia
Corresponding author: Yusup. A. Yuldashbaev, zoo@[Link]
Review paper

Abstract: Sheep farming in Russia is developing dynamically in farms,

but it is unable to compensate for the decline in production in the public sector. In
years 2010 - 2016 import of mutton to the country has increased by 3.3 times,
reaching 11 thousand tons (comparable to the volume of mutton production in
agricultural organizations of the country). Compared with the pre-reform period
the number of sheep and goats in the country in 2010 declined by 63% (36.4
million head). The negative trend of relief stock, which lasted until 2000, is now
overcome by 2010 was able to increase the number of animals of 7 million head.
Now the number of sheep and goats in farms of all categories totals 24 million
heads. Giving new impetus to the development of sheep breeding is an important
national economic task, in the course of solving which it is necessary to perform
not so much a restoration as an update of the industry on the basis of the necessary
structural, pedigree, technological changes. An important condition for its
implementation is the activation of innovation. Scientists of academic, sectoral and
university science make certain efforts in this area.

Key words: sheep breeding, farming, production, wool, meat, innovative

activity

Introduction
Russia in the priority the national project "Development of the agro-
industrial complex", the State program "The development of agriculture and the
regulation of markets for agricultural products, raw materials and foodstuffs"
emphasizes that it is possible to solve the accumulated problems in agriculture, to
restore the disturbed reproduction processes, to overcome the gap from developed
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
72 October 11-13, 2017

industrial countries to reorient the industry to an innovative path of development,

which will increase production efficiency, reduce the country's dependence on food
imports, to ensure the competitiveness and sustainability of domestic agriculture.
Sheep breeding requires special approaches to solving the tasks. This
branch is traditional for the agriculture of Russia, especially the regions of the
North Caucasus (Aboneev et al., 2013) and Kalmykia. For many years sheep
breeding has been working extensively with the use of inefficient technologies. In
this regard, there is a need to deal with issues related to the validity of the priority
directions of the further development of the industry, the use of more efficient
organizational and economic mechanism in the manufacturing and sales of
products. An essential condition for their solution is the activation of innovation.
Problems of activization of innovative activity in modern sheep breeding
have studied by Yuldashbaev and Leshcheva (2011). Management of industry in
the small farms of ownership was studied by Kiryanov (2013). Problem production
of sheep meat were investigated by Trukhachev et al. (2012), Kubatbekov and
Mamaev (2013). Activization of the main problems of innovative activity in
modern sheep farming was also reflected in the researches (Yuldabashev, Lescheva,
2013). Foreign experience in efficient production of sheep products was studied in
the works of Scherbakova (2006), Petrovic et al. (2013).
Sheep breeds and their productivity depended by considerable variety of
climatic, social and economic conditions of various Russian regions. Special
attention should be given to sheep breeding development not only because of
valuable products (mutton, milk, wool, etc.) but also as a factor ensuring the
employment in regions not suitable for breeding other farm animals because of
unfavourable climatic conditions (Erohin et al.,1985;2001; 2013).
The study aim was to analyze the modern state of sheep breeding in Russia
and provide scientific views on the further development of this important sector of
animal husbandry.

Status and prospects of sheep breeding

Analyzing the changes that have occurred in the domestic sheep industry in
recent years, in the first place, it should be noted a significant reduction in the
number of livestock and the restructuring of the sheep breeding complex.
Compared with the pre-reform period the number of sheep and goats in the
country in 2010 declined by 63% (36.4 million head). The negative trend of relief
stock, which lasted until 2000, is now overcome by 2010 was able to increase the
number of animals of 7 million head. Now the number of sheep and goats in farms
of all categories totals 24 million heads.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 73

The distribution of livestock by categories of farms has changed

significantly. If in 1990 70.6% of sheep were kept in agricultural organizations
and 29.4% in personal part-time farms of the population, at present the share of
sheep and goats in agricultural enterprises had only 20%, in households was 52%,
28 % in peasant (farm) households. Currently, the population's economy produces
54% of wool and 72% of lamb, the share of K (F) X is 26% and 19% respectively,
of agricultural organizations - only 20 and 9%.
Agricultural organizations have lost a leading role in the production of
wool and sheep meat. Many of the breeding farms lost their significance, a
significant part of the genetically most valuable livestock was sold as commodity
animals.
Agricultural organizations have completely reduced the number of sheep
in Ascania, Vyatka; Gorky; Kuchugurov breeds. On the verge of extinction are
Kuibyshev, Russian long-haired breeds. The Salsk breed of sheep has 2.1 thousand
heads, and the Lincoln is the Kuban type with only 800 heads. The small number
of these breeds of sheep can be in the coming years lead to their complete
disappearance from the territory of the Russian Federation and will cause damage
to the gene pool of sheep country.
More than half of the sheep are concentrated in private farms of the
population with very limited possibilities for breeding work, the intensification of
production, the use of science. Reproduction in them is carried out on an extensive
basis and does not provide acceptable rates of growth and production volumes.
On average, over the past 10 years, the average annual growth rate of wool
production was 3.3%; Mutton - 2.7%.
Sheep farming is developing dynamically in farms, but it is unable to
compensate for the decline in production in the public sector. In 2010 - 2016
years, import of mutton to the country has increased by 3.3 times, reaching 11
thousand tons (comparable to the volume of mutton production in agricultural
organizations of the country).
With 80.4 million hectares of natural hayfields, pastures and fallow land,
Russia imports not only wool, lamb, 95% of which comes in frozen form, but also
by-products. The production of sheep products for commodity producers is
unprofitable, the organizational, economic, technological and technical
backwardness of the industry takes place. The negative consequences of this are
manifested not only in economic, but also social aspects, lead to incomplete use of
pasture lands, and in some cases, loss of control over the territories. The current
situation does not meet national interests.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
74 October 11-13, 2017

Scientific aspects for improvement of sheep breeding

Giving new impetus to the development of sheep breeding is an important

national economic task, in the course of solving which it is necessary to perform
not so much a restoration as an update of the industry on the basis of the necessary
structural, pedigree, technological changes. An important condition for its
implementation is the activation of innovation.
Scientists of academic, sectoral and university science make certain efforts
in this area.
In recent years, researchers of scientific institutions have created fourteen
fundamentally new types and breeds of sheep with increased productivity and
consumer properties of the products: southern meat; Buubei; Aginskaya;
Kulunda; Tashlin breeds; Type solar (tsigay breed); Mountain type (Tuva short-
tailed rock); Steppe type (Tuva short-tailed rock); Aksaray type (Soviet meat and
wool breed); Udmurt type (Soviet meat and wool breed); Dogoy type
(Transbaikalian rock); Argument type (Transbaikalian rock); Kadutun type
(Mountain Altai breed).
New resource-saving technologies have been created, recommendations
have been developed for the modernization of existing methods of production of
sheep breeding, which significantly improve the profitability of the industry,
namely: innovative technologies for the production of broiler lamb; System of
feeding young sheep with intensive cultivation and fattening; Low-cost technology
of pasture-stables maintenance of sheep; A system for assessing the hereditary
qualities of breeding animals using genetic markers and DNA technologies.
Methodical provisions have been developed for obtaining, staining, and creating a
cryobank of epididymal seed of rare, endangered species of argali, snow sheep,
Siberian ibex, Edilbaev, Hissar and Romanov sheep breeds; Method of integrated
assessment of sheep-producers on the quality of offspring; A method for
estimating and predicting meat productivity at an early age on the basis of blood
groups of DNA markers of sheep; Biotechnological methods for assessing the
productivity of sheep, methodological and methodological recommendations for
the creation of sheep maintenance and feeding systems, biotechnological
approaches to product control and selection assessment using computer programs,
cryopreservation of sperm of rare and endangered sheep and goat breeds, mobile
chip systems, improved machine systems and Equipment, etc.
However, the efforts of Russian scientists are minimized by an ineffective
system for managing the innovative development of the industry. Branch
government bodies, scientific, educational institutions, agricultural producers are a
poorly coordinated community. The lack of a centralized directing influence from
the sectoral research institute and the necessary infrastructure hampers the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 75

introduction of innovations in practical sheep breeding, the rate of promotion of

new products and processes in sheep breeding is very low compared with the
potential one.
In these conditions, it is required to form a certain system-structured
education of an organizational and information character in the management of
various aspects of innovation activity, as well as the use of mechanisms and tools
to expand innovation that provide the opportunity for practical implementation of
this task based on the integrated use of information technology.
The National Union of Sheep-breeders was created, the program
"Development of sheep breeding for 2010-2020 was developed. And the plan for
the breed placement of sheep for the federal districts, the organizational and
economic assessment of standard models of industrial-type sheep farms, farms and
households is given, organizational and economic normative indicators of effective
sheep breeding are determined, the information-analytical system "Selex-sheep" is
prepared for implementation; The software is developed and the base of selection-
genetic data is formed. To strengthen the capacity of the industry in the country's
universities, the Master's program is being prepared according to the program
"Intensive technologies in sheep breeding".
However, the gap between the scientific provision of sheep breeding and
the practical implementation of innovations has not been overcome. The main
problem of implementing the innovative strategy for the development of the
industry is that, even with new breeds and technologies in the industry, channels
for their introduction into practical sheep breeding are not developed and there are
no qualified personnel for their development. The level of financial, personnel,
logistical and information support of the industry is extremely low. This
determines the low susceptibility of rural commodity producers to innovations. Of
great importance in this regard is the organizational and economic support for the
development of innovations in the mass production of sheep products by improving
the organization of the innovation process and the economic stimulation of
innovation.
Innovative activity by country is as follows: USA - 50%; Netherlands -
62%; Austria - 67%; Germany - 69%; Denmark - 71%; Ireland - 74%; Russia -
5-7%.
It should be borne in mind, however, that successful innovation activity is
far from always associated with own extraction and development of new
knowledge. In the agro-industrial complex, the financing of new developments is
limited by the shortage of financial resources, the lack of the necessary institutional
infrastructure for the development of innovative institutions, and a weak market
infrastructure, so innovations, as such, are not of a mass nature, their share in the
cost of domestic agri-food products is very small. In this regard, the most relevant
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
76 October 11-13, 2017

for the industry is the use of a broader approach, according to which, by

innovation, we mean not only investing in the creation of something new, but also
investing in the acquisition of innovations, including the practical implementation
of the world knowledge base.
The main directions of activization of innovative activity in modern
domestic sheep breeding are:
Improvement of the organization of the industry as a whole, since until
the general issues are resolved, the introduction of innovations will not be
effective;
Development and implementation of integrated scientific and technical
programs for the development of sheep breeding;
improving the organizational forms of innovation; Development of
management and increasing the manageability of the innovation process.
economic stimulation of innovation activity, consisting in the formation
and effective functioning of the market of scientific and technical products;
Strengthening the work on the commercialization of scientific and technical
developments, increasing the interest of research institutes and scientists in this;
Support of innovative activity on the part of the state; Granting benefits to business
entities for the introduction of innovations.
Scientific developments should be more focused on the actual state and
requirements of the industry. To increase the susceptibility of agricultural
producers to innovations, it is required to understand that the main sphere of
realization of innovation activity in sheep breeding is now the rural farmstead. In
view of this, it is necessary to implement measures of an organizational and
economic nature that ensure the activation of innovative activity, in particular, at a
qualitatively new level, organize the work of the tribal service, and more fully
implement the principles of cooperation and integration in the forms of
management, which make it possible to accelerate the advancement of innovations
in the business environment.

Conclusion

Analyzing the situation and development opportunities of sheep breeding

in Russia, we can conclude the following.
Our country has enormous natural and human resources for the
development of sheep production. New trends of economic development have
caused a new approach to the organization and management of sheep production.
After the fall of the number of sheep in the nineties, the trend is turning positive,
especially in the last few years. There are new and modern private farmers. Many
of our agricultural universities and institutes have the knowledge, scientific
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 77

experience and capacity to introduce modern technological solutions open up new

prospects for development of sheep breeding Russia, as one of the World's leading
countries in this field of sheep production.

Moderno ovarstvo u Rusiji

Yusup [Link], Maria I. Dongak, Ksenia A. Kulikova, Elena V. Pakhomova,
Zhaziraim M. Abenova, Salbak O. Chylbak-ool, Milan P. Petrovic

Rezime
Ovarstvo u Rusiji se dinamiki razvija na farmama, ali nije mogue
nadoknaditi pad proizvodnje u javnom sektoru. U periodu od 2010. 2016. godine,
uvoz ovijeg mesa u zemlju porastao je za 3,3 puta i dostigao 11 hiljada tona (u
poredjenju sa obimom proizvodnje ovetine u poljoprivrednim organizacijama
zemlje). U poreenju sa periodom pre reforme, broj ovaca i koza u zemlji u 2010.
smanjen je za 63% (36,4 miliona grla). Negativni trendovi u stoarstvu, koji su
trajali do 2000. godine, sada su prevazieni, do 2010. godine broj ivotinja je
povean za 7 miliona. Sada je broj ovaca i koza na farmama svih kategorija ukupno
24 miliona grla. Davanje novih podsticaja razvoju ovarstva je vaan nacionalni
ekonomski zadatak, u toku reavanja kojih je neophodno izvriti ne toliko
restauraciju, koliko auriranje industrije na osnovu potrebnih strukturalnih, kao i
tehnolokih promena. Vaan uslov za njegovu implementaciju je aktiviranje
inovacija. Naunici akademskih, sektorskih i univerzitetskih nauka vre odreene
napore u ovoj oblasti.

Kljune rei: uzgoj ovaca, poljoprivreda, proizvodnja, vuna, meso,

inovativna delatnost

References

AMERKHANOV KH.A. (2010): Comparative characteristics of productive

qualities of different types of Tuvan short-tailed sheep // Kh.A. Amerkhanov, S.I.
Biltuev, L.D. Shimit, B.B. Mongush, Yu.A. Yuldashbaev Sheep, goats, woolen
business, 2, 16-17.
.., .. (2001): O / . ...
M. - , 480 .
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
78 October 11-13, 2017

EROHIN A.I, RIBIN G.I, YULDASHBAEV YU.A., LECEVA M.G. (2013):

Development of meat sheep breeding in central Russia. Sheep goat and wool, 1, 2-
9.
KUBATBEKOV TS, MAMAEV [Link]. (2013): Slaughter indicators of the sheep
of the Kirghiz fine-fleeced breed of different ages // Sheep, goats, woolen business,
No.3, 30-31.
On the current situation in the agro-industrial complex of the Russian Federation in
October 2016 [Electronic resource]. - Access mode: [Link] - The
title from the screen. - (Date of circulation: 14.11.2016). 8. Sheep population in
different countries [Electronic resource] - Access mode: FAOSTAT database.
PETROVA, T. A. (2012):

, Ph.D. dissertation, Saratov State Agrarian University n.a. N.I.
Vavilov, Saratov, Russia.
PETROVIC, M. P., PETROVIC, V. C., ILIC, Z. G., MILOSEVIC, B.,
MILENKOVIC, M., SPASIC, Z.,STOIKOVIC, J. (2013):
, Sheep, goats and wool production, vol. 1,
pp. 13-15.
TRUKHACHEV VI, LESHCHEVA MG, YULDASHBAEV YU.A. (2012): Meat
market of Russia: analysis of the state and prospects of development //
Achievements of science and technology of agroindustrial complex, 11, 3-9.
Yearbook (2016): Breeding work in sheep breeding and goat breeding in Russian
farms / VNIIPLEM Publishing House, p.42; p. 71.
YULDASHBAEV YU. A., LESHCHEVA M.G. (2011): Problems of activization
of innovative activity in modern sheep breeding // Achievements of a science and
engineering of agrarian and industrial complex, No. 11, 6-8.
YULDASHBAEV YU.A., ARILOV A.N., NEZOVANA V.F., BACHAEV B.T.
(2010): Kurdjuchevoe sheep breeding - the factor of increase of meat resources of
Kalmykia // Zootechnics, 5, 12-13.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

SHEEP BREEDING ECONOMIC, PLUSES AND

MINUSES
Marina I. Selionova, Galina T. Bobryshova

FSBSI -All-Russian Research Institute for Sheep and Goat Breeding, Stavropol, Russia
Corresponding author: Marina I. Selionova, m_selin@[Link]
Review paper

Abstract: In the article the comparative analysis of economic and industrial

parameters in sheep breeding of the Stavropol Territory in the period from 1976 to
1990 and now is resulted. The role of state support in the stabilization of sheep
breeding and its further development is considered. Over the years of economic
transformations, the number of sheep in the Stavropol Territory has declined by
more than 7.1 times since 1990, and in agricultural organizations it has amounted
to 11.8 times. Wool and mutton volumes of output have decreased by 10.5 and 6.7
times, respectively. The number of sheep for this period was reduced in 3 times as
a whole across Russia. If in 1990 the sown area of cereal crops in the Stavropol
Territory was 1792.2 thousand hectares, then in 2010 it was 2138.9 thousand
hectares. The area of fodder crops for this time has decreased in 6 times and has
made in 2010 only 216.5 thousand hectares. In addition to reducing the number of
sheep, the ownership structure has changed and profit is the main driver of the
development of this business. Today it is quite clear that sheep breeding in Russia
cannot become a profitable branch without balanced comprehensive state support.
The package of measures should include the regulation of pricing processes, the
elimination of prices disparity for agricultural and industrial products, subsidies in
amount covering production and sales costs, preferential taxation and lending, and
protection of domestic market from foreign commodity producers.

Key words: sheep breeding, sheep breeding products, wool, mutton, proceeds,
production costs, selling price, profitability, state support.

Introduction
Sheep is the most profitable animal A man only can have
Fitzherbert
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
80 October 11-13, 2017

A large number of factors of genetic and external nature affect the

development of sheep farming Petrovic et al., (2013), Selionova et al.,(2015),
Vershinin (2015).
The state and the prospects of sheep breeding depend in many respects on
the economic conditions of branch conduct, the conjuncture of domestic and
foreign markets for sheep breeding products. The general law of economic
efficiency that is products realization at the price exceeding the cost of its
production, to the full relates to sheep breeding. At the same time, it is well known
that not all branches and sub-sectors of the AIC are profitable and favorable from
the economic point of view. There are a number of objective reasons, primarily
such as protection of domestic market, employment of the population and others,
on which the state subsidizes the production of agricultural products, in order to
bring it to a profitable level. Analysis of schemas and mechanisms of state support
and their effectiveness in the stabilization and development of sheep breeding in
Russia over the past period has determined the relevance of this article.

Economic indicators of sheep breeding

One of the economic advantages that make sheep breeding attractive to

other types of farm animals is the small amount of initial financial investments
(Table 1).

Table 1. Charges on one animal in a year, rubles

(According to data of agricultural organizations of the Stavropol Territory)

Years
Species of animal 2013 2014 2015
In total For 1kg of In total For 1kg of In total For 1kg of
live weight live weight live weight
Horned cattle
(dairy direction) 94221 57.0 107284 178.8 116050 193.4
Horned cattle
(meat direction) 19184 38.4 20703 41.4 19251 38.5
Pigs 9458 47.3 11103 55.5 11998 60.0
Sheep 1831 36.6 1980 39.6 1950 39.0

The ability of sheep to use all year round pasture forage almost free of
charge, transforming it to wool, meat and milk, reduces expenses of production to a
minimum. For the keeping of sheep, you can use any cattle barns, and depending
on the weather conditions you can manage without them at all. The sheep uses
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 81

those areas of agricultural land, where plowing of land by natural topographical

conditions is impossible and grazing is the only possible means for its use.
Recently, the important factor, to which the increasing importance is
attached, is the ecological purity of the resulting cattle-breeding products. And in
this sense, meat and milk of sheep have certain advantages, since sheep are kept
almost everywhere on natural pastures, and in their feeding hormones and other
biological active substances of anabolic character are not used. Milk of sheep is an
excellent and sometimes irreplaceable raw material for the production of elite
cheese grades and other kinds of dairy products. In its nutrition, sheeps milk is far
superior to cows milk, contains a large number of substances and minor elements
useful for the human body, and at the same time can be assimilated by more than
90.0 percent. Among other things, sheep feel perfectly near to other farm animals.
Nevertheless, all these advantages are not reflected in the price of sheep
products, and up to now this branch is unprofitable as a whole (Table 2).

Table 2. The main economic indicators of sheep breeding in the Stavropol Territory (according
to data of agricultural organizations of the Stavropol Territory)

Indicators Years
2013 2014 2015
Expenses for production of products,
thousand rubles 760666.0 766333.0 853564.0
Gain from sales of production, thousand
rubles 438269.0 395782.0 518046.0
Profit from sales of production,
thousand rubles -205645.0 -273304.0 -251507.0
Profitability, % -32.0 -41.0 -33.0

In the current economic conditions, agricultural organizations continue to

decline in the number of sheep and falling-off of production, since with the existing
ratio of costs and incomes agricultural producers cannot carry out extended
reproduction.
Over the years of economic transformations, the number of sheep in the
Stavropol Territory has declined by more than 7.1 times since 1990, and in
agricultural organizations it has amounted to 11.8 times. Wool and mutton volumes
of output have decreased by 10.5 and 6.7 times, respectively. The number of sheep
for this period was reduced in 3 times as a whole across Russia.
Sheep breeding recession is also promoted by reduction of the fodder areas
as a result of plowing of hayfields and pastures for growing grain crops, which
profitability unlike sheep breeding is high (Table 3).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
82 October 11-13, 2017

Table 3. Profitability of grain and industrial crops production in the Stavropol Territory
(according to the data of the Territorial Body of the Federal State Statistics Service for the Stavropol
Territory)

Appellation Years
1990 1995 2005 2010 2015
Grain 292.0 115.0 18.1 19.9 47.0
Sunflower 208.0 181.1 47.6 95.6 83.0
Sugar beet 89.3 43.2 18.3 48.7 56.0

If in 1990 the sown area of cereal crops in the Stavropol Territory was
1792.2 thousand hectares, then in 2010 it was 2138.9 thousand hectares. The area
of fodder crops for this time has decreased in 6 times and has made in 2010 only
216.5 thousand hectares.
The situation that develops in the sheep breeding of the Stavropol Territory
repeats the events of 100 years ago. In 1902, there were 3.5 million sheep in the
Stavropol province, and in 1911 there were 1.9 million sheep left. In 1912,
Mordvin L.N., the senior animal husbandry specialist of the Stavropol province
wrote:... with the development of agriculture and communication lines, sheep
breeding becomes an unprofitable occupation, and the number of sheep begins to
decline faster, ... at best, the sheep gives the gross income from 3 to 4 rubles per
tithe; the value of the pure rent for plowing in most of our regions is about 15-18
rubles for corn, about 25 rubles for sunflower sowing, and 40 rubles for beet
sowing. My visit to the sheep farms of the Stavropol province, undertaken in
this year (1912), revealed that these farms are in the period of gradual elimination
of sheep breeding and the transition to grain crops; sheep breeders, who had tens of
thousands of heads have left now 1500-2000 sheep at themselves, and then they
want to stop sheep breeding. Fine-fleeced sheep breeding in the Stavropol province
remains only on unsuitable lands or as a by-product branch at a large grain
economy for the purpose of using the waste of this economy (Mordvin, 1912).
Speaking about the period of the greatest development in sheep breeding,
scientists and practitioners often turn to the golden 70-80 years of the last
century, when the number of sheep in the Stavropol Territory reached a maximum,
and it was profitable to engage with sheep breeding. In order to understand what
factors contributed to this, we will analyze the situation that has developed in the
sheep breeding of the Stavropol Territory since 1976.
In those years, the number of sheep in the Stavropol region exceeded 6.5
million heads. More than 3.0 million heads of sheep were kept only in the east of
the region. All sheep inventory were kept in agricultural organizations, and only
10.0 percent, or about 800.0 thousand heads, were kept at the farmstead of the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 83

population. Annually more than 30.0 thousand tons of wool, which was the main
product of sheep breeding at that time, was produced in physical weight.

Table 4. Economic indicators of wool production in the Stavropol Territory (according to the
data of the Territorial Body of the Federal State Statistics Service for the Stavropol Territory)

Indicators Years
1976 1980 1985 1990 1995 2000 2005 2010 2015
Profitability level, % -24.4 -8.3 11.3 35.6 -65.7 -69.0 -72.5 -61.0
Cost of 1 centner
production, rubles 609 742 862 995 1351000 9227 11977 22290
Selling price of
1centner, rubles 509.6 672.0 951.8 1325.0 410145.3 2810.4 4254.8 8741.0
Number of sheep,
thousand heads 5858,3 6192.5 6433.7 6337.6 3408.2 1352.9 1500.0 2212.9 2276.9
Wool production, 27.7 28.3 30.7 33.3 14.0 6.2 6.0 7.0 6.8
thousand tons
Wool clip from 1 sheep 4.3 4.3 4.4 4.5 3.6 3.8 3.8 3.7 3.9
in physical weight, kg
Lambs dropped per 100 73 86 82 84 64 77 77 82 82
ewes, heads

Table 5. Economic indicators of mutton production in the Stavropol Territory (according to the
data of the Territorial Body of the Federal State Statistics Service for the Stavropol Territory)

Indicators Years
1976 1980 1985 1990 1995 2000 2005 2010 2015
Profitability level, % -0.8 -31.0 -30.4 26.8 -40.3 -6.3 -4.9 -10.0
Cost of 1 centner
production, rubles 109.0 152.0 187.0 226.0 339547.0 3245 4382 9452.0
Selling price of 1 centner,
rubles 72.8 97.2 161.9 338.3 122784.4 2313.1 4077.6 7023.2
Mutton production in live 39.7 25.7 35.6
weight, thousand tons

The data in Tables 4 and 5 show that in the best of their years, as in today,
the situation in the economy of the Stavropol Territory was ambiguous. The
production of both wool and mutton was and still is unprofitable.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
84 October 11-13, 2017

The situation in other sheep-breeding regions of the country is similar. In

the Republic of Dagestan (according to the data of the agricultural organizations) in
2015, the production cost of 1kg of wool was 29.7 rubles, and the selling price was
24.1 rubles, as a result, the loss ratio amounted to minus 18.9 percent. The
profitability level of mutton production has made 4.8 percent at the cost price of
54.4 rubles per 1kg and the selling price of 57.0 rubles. In 13 districts of Dagestan
mutton production was unprofitable.
The Republic of Kalmykia, the second for the number of sheep and
production of sheep-breeding products region, also has ambiguous indicators on
the sheep breeding economy. In 1995, the profitability of wool production has
made minus 67.0 percent, and in 1999 it reached almost 0.13 percent. The
profitability of mutton fluctuated within 45.0-50.0 percent (Taunova, 2000).
As a whole, the sheep breeding in Kalmykia continues to be profitable, but
a certain proportion of sheep farms has a negative economy or is unprofitable. In
2006, the profitability of sheep breeding in this republic has made 9.6 percent,
according to the result of 2015 it was X percent.
In various years, analysis of the sheep breeding economy in the Trans-
Baikal Territory shows significant fluctuations. Thus, in the early nineties of the
last century, the profitability indicators of the branch in agricultural enterprises
were very high; the profitability of wool production has made 27.8-139.8%, while
for mutton production it was 53.0-93.5%. However, since the md-nineties the
situation has changed drastically and the profitability of the wool has dropped to
minus 85.6%, while the profitability of mutton decreased to minus 66.7%; in 2013-
2014, it has made minus 47.3-48.1%, respectively, and for mutton it is minus 0.17-
9.1%. Over the period from 1990 to 2000, the sheep population in the province
decreased by almost 5 million or 80 percent (Vershinin, 2015).
Thus, the analysis of the sheep breeding economy shows that the best
period for the development of the branch falls at 1985-1990. In this regard, it is
important to determine, what economic conditions were created by the state, how
the sheep breeding yielded a high income under various climatic conditions and
other factors in different regions of the country, and sheep farms were millionaires.

Measures of the Government

One of such factors in the pre-reform period was the regulation of the
sheep breeding profitability in agricultural organizations by surcharges to purchase
prices. Thus, in the Resolution No. 1032 of the Council of Ministers of the USSR
from November, 14th, 1980 On Improving Planning and Economic Incentives for
the Production and Procurements of Agricultural Products it is stated: To
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 85

establish that in 1981-1985 collective farms, state farms, other agricultural

enterprises and associations are paid a surcharge in a size of 50 percent of purchase
prices for sale of wool to the state over the middle level achieved in the tenth five-
years period.
In addition, the procurement prices included all operating differentiated
extra charges, surcharges for sale to the state of products above the average level
achieved in the previous five-year plan, and so on. (Resolution of the Council of
Ministers of the USSR No. 792 from August, 9th, 1990 On the Introduction of
New State Procurement Prices for Agricultural Products)
In 1993, the Government of the Russian Federation adopted Resolution No.
629 On Measures of State Support for Sheep Breeding in the Russian Federation,
which provided for the establishment from July, 1st, 1993 of a subsidy for wool
sold to the state resources in the amount of 600 rubles per 1 kg in terms of pure
fiber (300 rubles per 1 kg in physical weight). At the same time, the cost of 1 kg of
wool has made 4933.1 rubles in physical weight, and the selling price was 4559.7
rubles. However, the amount of state support did not cover the difference between
the cost price and the sale price and did not allow the production of wool to be
profitable.
The same resolution stipulated that from centralized credit resources for
1993, a preferential loan at a rate of 25 milliard rubles should be allocated to the
enterprises of primary processing of wool for the purchase of a haircut of 1992 and
50 milliard rubles for the purchase of haircut of 1993. And with the purpose of
ensuring the protection of the Russian wool market, starting from July, 1st, 1993,
the rates of import customs duties on wool import should be increased meaning an
establishment of the price for imported wool for 10-15 percent higher than on wool
of domestic production.
However, these measures also did not have a stimulating effect on the
stabilization of sheep breeding. In 1993-1995, the sheep population in the
Stavropol Territory decreased by 2.0 million heads, including 1.9 million heads in
agricultural organizations, where an array of the best fine-fleeced sheep was
concentrated. The volume of wool production decreased by 6.2 thousand tons or by
30.0 percent. As a whole, in Russia, the reduction in the number of sheep since the
year has made 48.0 percent, and in production of wool it was 40.0 percent.
The new Resolution No. 1092 of the Government of the Russian
Federation On Measures of the State Support for Sheep Breeding was adopted in
1995. The resolution provided for the following: To pay agricultural producers
differentiated on subjects of the Russian Federation subsidies for the wool sold in
1995 to state resources at the expenses of the funds provided for in the federal
budget for 1995 for these purposes, as well as for providing state support to the
agrarian industrial complex. It was also made provision for the allocation to the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
86 October 11-13, 2017

enterprises of primary wool processing on a return basis 100 milliard rubles for the
wool purchase.
Unfortunately, this decision also did not have that effect which the state
counted on; the sheep population in Russia continued its reduction to 13.2 million
heads by the year 2000. In the current economic conditions, the enterprises could
not overcome the trend of a decline in production, since with the existing ratio of
expenses and incomes agricultural commodity producers could not carry out
extended reproduction.
And only the implementation of the national project Development of the
AIC, and then the State program for the development of agriculture and regulation
of markets for agricultural products, raw materials and food, providing subsidies on
charges for ewes stock keeping, has stopped the catastrophic decline in the
number of sheep. In the period from 1990 to 2015, the number increased by xx
million sheep, and currently there are almost 25 million in Russia, including 2.2
million in the Stavropol region.
At the same time, it should be noted that in this period there have been
significant changes in the breed structure of sheep breeding in Russia. Specific
weight of fine-fleeced sheep decreased from 90% in 1990 to 56.0% in 2015,
respectively, the specific weight of sheep with coarse-woolen direction of
productivity and crossbreds number increased from 3.5% to 38.4% or more than 10
times. A significant reduction in the number of fine-woolen sheep, a decrease in
their productivity against the background of widespread deterioration of selection
and breeding work and a general culture of sheep breeding conducting led to
destabilization of primary processing enterprises and the textile industry of the
country. In addition, the volatility of the Russian ruble in the past two years has
contributed to an even greater competitiveness of Russian merino wool in the
world market, and the domestic wool processing industry has practically remained
without high-quality wool raw materials. Considering this circumstance, the state
introduced a new type of support in 2015, it was subsidizing of fine and half-fine
wool production. In particular, the Stavropol sheep breeders have received on 37.0
rubles for each kilogram of certified wool with a thinness of up to 23 micrometers
realized for domestic processing. However, this support has not yet made the
production of wool cost-effective. Perhaps, the envisaged increase in the size of
subsidy will allow sheep breeders to reach profitable production and will serve as
an incentive for increasing the number of Merino sheep in agricultural
organizations and peasant farms.
However, leading economists note that direct subsidization of products in
the agricultural sector cannot be an endless process. It is necessary to search for
other incentive measures, at which consumer prices for agricultural products cover
the costs of their production (Vershinin, 2015, Amerkhanov [Link]., 2015).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 87

One approach, on our opinion, can be the state control of prices for animal
husbandry products, in particular, wool and mutton. In most developed countries,
indirect subsidy measures prevail, including price intervention in the food market
through supporting domestic prices for agricultural products, setting quotas, tariffs,
taxes on exports and imports of food. We are talking about the so-called price
corridor, when the minimum price for products brings profitability of production to
zero or minimum level, and the maximum price does not allow us to receive super-
profit. If the minimum price falls below the zero mark of profitability, then there
are subsidies for products that allow agricultural producers to conduct breakeven
production.

Conclusion
The foregoing allows us to conclude that the state always and to date to a
greater or lesser extent supported sheep breeding, searched for most optimal and
effective measures for stabilizing and developing the branch, regulating the
production volumes of wool and mutton. Today it is quite clear that sheep breeding
in Russia cannot become a profitable branch without balanced comprehensive state
support. The package of measures should include the regulation of pricing
processes, the elimination of prices disparity for agricultural and industrial
products, subsidies in amount covering production and sales costs, preferential
taxation and lending, and protection of domestic market from foreign commodity
producers.
This is relevant today and was relevant one hundred and two hundred years
ago. P.N. Kuleshov wrote in 1907: One cannot expect, of course, that the peasant
himself will pay serious attention to the improvement of wool and meat qualities of
simple sheep, but it is regrettably that for the last decade neither the government
nor the agricultural societies have done anything either for the past century.

Ekonominost ovarske proizvodnje, prednosti i nedostaci

Marina I. Selionova, Galina T. Bobryshova

Rezime
U radu je prikazana uporedna analiza ekonomskih i industrijskih parametara u
ovarstvu na teritoriji Stavropola, u periodu od 1976. do 1990. godine i sada.
Razmatra se uloga dravne podrke u stabilizaciji uzgoja ovaca i njenom daljnjem
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
88 October 11-13, 2017

razvoju. Tokom godina ekonomskih preobraaja, broj ovaca na teritoriji Stavropola

je opao za vie od 7,1 puta od 1990. godine, a u poljoprivrednim organizacijama
11,8 puta. Koliine proizvedene vune i ovijeg mesa su smanjene za 10,5 i 6,7
puta, respektivno. Broj ovaca za ovaj period smanjen je 3 puta u cijeloj Rusiji. Ako
je 1990. godine posejana povrina itarica na teritoriji Stavropola iznosila 1792,2
hiljada hektara, onda je u 2010. godini iznosila 2138,9 hiljada hektara. Povrina
pod krmnim biljkama za ovo vreme smanjena je za 6 puta, e u 2010. godini
posejano je samo 216,5 hiljada hektara. Pored smanjenja broja ovaca, vlasnika
struktura se promenila i profit je glavni pokreta razvoja ovog posla. Danas je
sasvim jasno da uzgajanje ovaca u Rusiji ne moe postati profitabilna grana bez
uravnoteene sveobuhvatne dravne podrke. Paket mera bi trebalo da ukljui i
regulaciju procesa utvrivanja cena, eliminaciju dispariteta cena za poljoprivredne i
industrijske proizvode, subvencije u iznosu koji pokriva trokove proizvodnje i
prodaje, preferencijalno oporezivanje i pozajmljivanje i zatitu domaeg trita od
stranih robnih proizvoaa.

Kljune rei: uzgoj ovaca, proizvodi ovarstva, vuna, ovije meso, prihodi,
trokovi proizvodnje, prodajna cena, profitabilnost, dravna podrka.

References
VERSHININ A.S. (2015): Scientific and technical and selective aspects of
improving the efficiency in sheep breeding in the Trans-Baikal Territory. Thesis
Doctor of Agricultural Sciences. Chita, 343 p.
MORDVIN L.N. A short outline of the present situation of sheep breeding in the
Stavropol province and the reasons for its decay. Materials of the All Russian
congress on sheep breeding. 1912. P.95-101.
AMERKHANOV H.A., EGOROV M.V., SERDEYUKOV V.N. Sheep and goat
breeding of the Russian Federation in figures. National Union of Sheep Breeders.
Stavropol. 2015. 111 p.
The main indicators of the development of the state complex in the Stavropol
Territory. Issue 8. Information and Computing Center of the Agro-Industry
Committee of the Stavropol Territory. Stavropol. 1987. 476 p.
Agriculture of the Stavropol Territory for the years 1976-1997. (Statistical Digest).
State Statistics Committee of Russia. Stavropol Committee of State Statistics.
Stavropol. 1998. 29 p.
Agriculture in the Stavropol Territory for 2005-2010. Federal Service of State
Statistics. Territorial body for the Stavropol Territory. Stavropol. 2011. 144 p.
TAUNOVA A.I. (2000): Development of sheep breeding in the system of the AIC
in the Republic of Kalmykia. Elista: APP Dzhangar.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 89

PETROVIC P.M, ILIC Z., CARO PETROVIC V. (2013): Sheep and goat breeding
(Biology and technics of small ruminants breeding). Institute for animal
Husbandry, Belgrade, 365pp.
SELIONOVA, M.I. (2015): Effective scientific support of production domestic
sheep and goat breeding - a worthy response to global challenges modernity.
Sheep, goats, woolen business. -2015. - 1. - P. 2-5.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

SHEEP AND GOAT FLOCK BOOK AND HERD BOOK

RECORD KEEPING IN CENTRAL SERBIA
Nevena Maksimovi1, Milan P. Petrovi1, Dragana Rui-Musli1,
Violeta Caro Petrovi1, Bogdan Ceki1, Marina Lazarevi1 , Rossen
Stefanov2
1
Institute for Animal Husbandry, Belgrade Zemun, 11080 Zemun, Serbia
2
Institute of Biology and Immunology of reproduction, Bulgarian Academy of Science, 1113 Sofia,
Bulgaria
Corresponding author: Nevena Maksimovi, nevena_maksimovic@[Link]
Review paper

Abstract: Traditionally, Serbia has always been directed toward sheep and
goat raising and the use of products of these animals. Geographically, the area of
Central Serbia, as the hilly-mountainous area, is rich in natural pastures, and
therefore the most suitable area for small ruminant production. There are varieties
of sheep and goat breeds raised in Serbia, both domestic and imported. In Central
Serbia, both flock and herd books are kept for sheep and goats raised on this
territory. Quality breeding animals are registered at Central flock and herd book
and are under the control of productive and reproductive traits. According to the
Institute for animal husbandrys annual report for Central Serbia in 2016, there
were 76,877 heads of sheep and 4,040 heads of goats under performance recording.
This makes 5.25% of total sheep and 2.35% of total goats raised in this area. All
sheep and goat breeds that are of national interest for breeding in Central Serbia are
included in breeding-selection programs which are implemented through
collaboration of farmers and breeding organizations. Presently, there are 146 (of
which 112 are active) breeding organizations for sheep and goats registered on the
territory of Central Serbia. In order to improve small ruminant production,
government is funding breeders for implementation of breeding programs and
production of high quality breeding animals.

Key words: sheep, goats, record keeping, Central Serbia

Introduction
In the past, Serbia was traditionally directed toward sheep and goat
breeding and the use of products of these animals. This is primarily due to the
natural environment that is particularly favourable for sheep and goat production,
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 91

but also to the fact that these animals can produce highly valued products even in
the humblest conditions. Geographically, the area of Central Serbia, as the hilly-
mountainous area, is rich in natural pastures, and therefore the most suitable area
for small ruminant production. Also, small individual land holdings/farms were not
adequate for the organization of economically efficient cattle production in which
farmers had to provide high quantity of quality food. In former Yugoslavia, 50%
of agricultural population lived in hilly-mountainous area and raised 60% to 80%
of total sheep in the country (Miti, 1984). However, in recent decades, along with
rapid industrialization, colonization of cities and emptying of villages, as well as
unfavourable political and economic situation in the country, sheep and goat
production was significantly neglected, even abandoned, especially in mountainous
regions.
Mountains as traditional centres for breeding of sheep and goats have been
abandoned, and the small ruminants were moved to lowland areas and raised in
expensive and non-organic way (Petrovi, 2015). In addition, the Law on the
prohibition of goat keeping, which was adopted in 1954 (Anonymous, 1954), led to
destruction of about 80% of the goats. It was not until the last decade of twentieth
century, that the lack of goat products on the market and a new understanding and
knowledge about the quality of the food for people, led to tacit abolition of the
controversial Law of 1954 (Krajinovi and Pihler, 2014).
Unfortunately, at about the same time, the disintegration of Yugoslavia was
in process, and large state agricultural conglomerates which had large farms of
sheep and other domestic species, were closed.
All of this negatively contributed to the small ruminant production in the
country, and centres of sheep and goat breeding, once very much active and
operational, were completely devastated. In recent years, the government has been
trying to revitalize and prevent further deterioration of this type of production,
mostly by funding breeders for production of quality breeding animals.

Sheep and goat breeds in Central Serbia

All sheep breeds raised in Central Serbia can be divided into two mayor
groups, of which one constitutes of domestic sheep breeds and the other group
includes imported breeds.
All domestic sheep breeds in Serbia are in fact different strains of one
larger group which is called Pramenka. These strains were formed in different
environmental and nutrition conditions and are different in terms of morphology
and production. Due to significant differences among individual strains raised in
different conditions, strains acquired the status of the breed (Rui-Musli et al.,
2015). These strains/breeds were named after the regions or towns were they were
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
92 October 11-13, 2017

originally formed. Most of these breeds are still raised in their original form, while
some of them were somewhat modified using different imported breeds. However,
originally they were all characterized by triple combined production ability (for
meat, milk and wool), they are low productive, but well adapted and biologically
resistant (Miti, 1984; Maksimovi et al., 2011; Savi et al., 2014). Presently, there
are seven domestic sheep breeds/strains raised in Central Serbia: Sjenica strain
(Sjenika pramenka) which is the most numerous strain of Pramenka, Svrljig strain
(Svrljika pramenka), Lipe strain (Lipska pramenka), Pirot strain (Pirotska
pramenka) and Pirot improved sheep, Krivovir strain (Krivovirska pramenka),
Karakachan strain (Karakaanska pramenka) and Bardoka (White Metohian
sheep). There is also one population of sheep called Mis sheep (Meat, Institute,
Sheep), a meat type of sheep of good fertility (Maksimovi et al., 2015a), which
was formed as a result of crossing of three different sheep breeds (Wurttemberg, Ile
de France and Pirot pramenka), but it is still in experimental stage (Maksimovi et
al., 2016).
As for imported sheep, there are several different breeds, including:
Wurttemberg, Ile de France, Bergamo, Suffolk, Texel, Charollais and Romanov
sheep. The most popular of all imported breeds, and the largest in number, is
Wurttemberg breed, which started to be imported to Serbia after the Second World
War. Thanks to its exceptional ability for adaptation in unfavourable conditions
and very good wool quality, Wurttemberg sheep was used to improve domestic
sheep breeds in hilly-mountainous regions (Miti, 1984). However, it soon became
popular amongst sheep breeders in Serbia who began raising it as purebred sheep.
Nowadays, it is the most numerous imported breed raised in Central Serbia. All of
the other imported sheep breeds are much less in number and are raised in small
flocks.
There is much less variety in goat breeds raised in Central Serbia compared
to sheep. There are two domestic and three imported goat breeds.
Balkan goat and Serbian white goat are domestic, low productive breeds
with combined production ability for milk and meat, usually raised in high lands.
Balkan goat is indigenous breed, well adapted to modest conditions of care,
housing and nutrition (ujovi et al., 2011). It is included in the program of
protection and preservation of animal genetic resources on the territory of Serbia.
Serbian white goat was created as a result of crossing Balkan goat does with
Saanen bucks. This improved the milk yield, as well as fertility and body weight of
domestic goats (Memii and Bauman, 2003). However, this crossing was usually
random and not planned, which resulted in pronounced variability of the breeds
productive traits.
Imported goats are of dairy breeds, such as Alpine, Saanen and Bunte
Deutsche Edelziege goat. Alpine goat is the most dominant and preferred by
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 93

breeders in Central Serbia. Alpine goats can be found all over Central Serbia, in
different regions, from lowlands to hilly-mountainous areas (Maksimovi et al.,
2015b). It is well adapted to both off-grazing production system and pasture. Other
two breeds are represented in small number and are practically very rare in the
territory of Central Serbia.

Flock and herd book record keeping

In Central Serbia, both flock and herd books are kept for sheep and goats
raised on this territory. Quality breeding animals are registered in the Central flock
and herd book and are under the control of productive and reproductive traits.
However, only small number of animals are registered. Census of agriculture,
which was conducted in 2012, showed that there are total of 1,464,666 heads of
sheep and 171,774 heads of goats raised in Central Serbia (RZS, Statistical Office
of the Republic of Serbia). According to the Institute for Animal Husbandrys
annual report for Central Serbia in 2016, there were 76,877 heads of sheep and
4,040 heads of goats under performance recording. This makes 5.25% of total
sheep and 2.35% of total goats raised in this area. In Republic of Croatia, for
example, in 2015 there were 600,000 heads of breeding sheep and 65,000 heads of
breeding goats, of which 39,883 sheep (around 7%) and 6,277 goats
(approximately 10%) were under productivity control (HPA, Annual report for
sheep, goats and small animals, 2015). In 2016 Republic of Slovenia had
approximately 14% (15,600 out of 109,406 heads) of sheep and almost 17% (4,500
out of 26,959 heads) of goats under control (Statistical office RS). Although this
number of registered animals is not very high, there was a positive trend in recent
years indicating a certain increase (Table 1). In five year period, percentage of
registered sheep increased from 1.59% to 5.25%, while in goats that increase was
from 0.68% to 2.35%.

Table 1. Number of sheep and goats under performance recording in Central Serbia for the
period of five years

Years
2012 2013 2014 2015 2016
Heads of sheep 23,378 27,157 36,683 52,724 76,877
Heads of goats 1,179 1,228 1,817 3,050 4,040
Activities report and results of the control of realization of breeding programs in 2016.

Within breed structure, the most dominant amongst registered sheep is

Sjenica strain, followed by Wurttemberg breed. In 2016 there were 36 582 heads of
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
94 October 11-13, 2017

Sjenica strain and 25 341 heads of Wurttemberg sheep, and these two breeds
accounted for 80% of all registered sheep.

Table 2. Breed structure of registered sheep in Central Serbia in 2016

Genotype No of heads in
2016
Sjenica strain 36,582
Wurttemberg 25,341
Svrljig strain 8,866
Ile de France 3,750
Lipa strain 591
Pirot improved sheep 511
Krivovir strain 476
MIS sheep population 336
Karakachan strain 132
Pirot strain 89
Bardoka 86
Texel 47
Bergamo 46
Romanov 12
Charollais 12
Activities report and results of the control of realization of breeding programs in 2016.

Of the total number of goats registered in Central heard book on the

territory of Central Serbia in 2016, the Alpine breed is the most dominant with
92%, local breeds Balkan goat and Serbian white goat are represented with 3% and
4%, while the least is Saanen breed with only 1%. This breed structure has been
more or less similar throughout the years (Table 3), with Alpine goat remaining the
most dominant breed amongst registered animals.

Table 3. Breed structure of registered goats in Central Serbia for the period of five years

Genotype/year 2012 2013 2014 2015 2016

Alpine (in heads) 839 967 1583 2733 3712
Serbian White goat (in heads) 150 144 155 150 116
Balkan goat (in heads) 152 100 37 129 154
Saanen (in heads) 38 17 42 38 58
Activities report and results of the control of realization of breeding programs in 2016.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 95

Selection programs and breeding organizations

Programmed selection is one of the prerequisites for successful farm
animal production, especially on national level. Therefore, for the purpose of
unique methodology of productivity control, testing and recording data and the
scientific principle of assessment of animals breeding value on the basis of
objective measurement of their productivity, there is one Main breeding program
for sheep and goats in Central Serbia.
The purpose of the Main breeding program is the implementation of
organized breeding and selection practices, with a goal of achieving the selection
progress for sheep and goats raised in Serbia. It defines breeding objectives,
population size, breeding methods and selection programs, all for the purpose of
increasing the efficiency of program implementation and successful breeding of
sheep and goats. In this way, it provides genetic improvement of animals and the
improvement of the quality of their products, in accordance with the zootechnical
standards (Rui-Musli, 2015).
In the implementation of breeding-selection program, central place take
breeding organizations which are formed in hierarchical organizational structure.
Main breeding organization, which is the official holder of Main breeding program,
coordinates the functioning of regional breeding organizations for different districts
and breeding organizations which act directly with farmers. At the moment, there
are 146 (of which 112 are active) breeding organizations for sheep and goats
registered on the territory of Central Serbia. They represent a link between farmers,
scientific organizations and government in the field of sheep and goat breeding.
The main role of these breeding organizations is to directly implement basic
breeding programs, which must be in accordance with the Main breeding program.
They participate in the selection of quality breeding animals, they are engaged in
animal productivity control and manage record keeping.
All sheep and goat breeds that are of national interest for breeding in
Central Serbia are included in these breeding-selection programs. In order to
revitalize and improve small ruminant production, government is funding breeders
for implementation of breeding programs and production of high quality breeding
animals. These funding propose lower limit of 10 breeding heads of sheep and 5
breeding heads of goats that are under productivity control. In 2017, the funding
for production of male breeding animals (rams and bucks) was implemented as a
new stimulating measure. The importance of using only highly fertile, healthy rams
in breeding programs cannot be over emphasized, which is particularly important
in the case of small producers who use only one ram in the flock (Maksimovi,
2014). This also applies for bucks in goat herds.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
96 October 11-13, 2017

Conclusion
Sheep and goat production in Central Serbia went through some difficult
period in last few decades, which resulted in decrease in number of these animals
and consequently led to lack of their products on the market. Luckily, in recent
years that negative trend has stopped and some stimulating measures were taken in
order to revitalize small ruminant production. As a result, number of quality
breeding animals raised, and breeders are more interested in this type of domestic
animal production. However, there is still a need for improvement. Average flocks
and herds are small, genetic potential of animals is not fully utilized and the market
for their products is still uncertain. In this process, goat production is in far more
need for help and improvement, since it was neglected for a very long time. Present
status of goat breeding in Central Serbia is not favourable, despite the recent rise in
the number of quality breeding goats. Government funding of breeders is very
important, but it is only the beginning as the improvement of wider economic and
social environment is as necessary

Matina evidencija u ovarstvu i kozarstvu u Centralnoj

Srbiji
Nevena Maksimovi, Milan P. Petrovi, Dragana Rui-Musli, Violeta Caro
Petrovi, Bogdan Ceki, Marina Lazarevi , Rossen Stefanov

Rezime
U prolosti, Srbija je imala izraenu tradiciju u gajenju ovaca i koza i
korienju proizvoda od ovih ivotinja. Geografski posmatrano, podruje Centralne
Srbije, kao brdsko-planinsko podruje, bogato je prirodnim panjacima, te najvie
pogoduje upravo ovoj vrsti proizvodnje. Na teritoriji centralne Srbije gaji se vei
broj razliitih rasa ovaca i koza, kako autohtonih tako i uveenih, a za sve ove rase
ovaca i koza vodi se matina evidencija. Kvalitetne priplodne ivotinje
registrovane su u glavnoj matinoj evidenciji i nalaze se pod kontrolom
proizvodnih svojstava. Prema strunom izvetaju Instituta za stoarstvo i
rezultatima sprovoenja odgajivakog programa u 2016. godini na teritoriji
centralne Srbije, ukupno je bilo 76.877 kvalitetnih priplodnih grla ovaca i 4.040
kvalitetnih priplodnih grla koza u matinom zapatu. To ini 5,25% od ukupnog
broja ovaca i 2,35% od ukupnog broja koza koje se gaje na ovoj teritoriji Sve rase
ovaca i koza koje su od nacionalnog interesa za gajenje na teritoriji centralne Srbije
ukljuene su u odgajivako-selekcijske programe koji se implementuju kroz
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 97

saradnju farmera i odgajivakih organizacija. Trenutno, na teritoriji centralne

Srbije postoji 146 registrovanih odgajivakih organizacija, od kojih 112 aktivno
uestvuje u sprovoenju odgajivako-selekcijskih programa u ovarstvu i
kozarstvu. U ciju unapreenja proizvodnje malih preivara, drava uestvuje
davajui odreena finansijska sredstva odgajivaima za implementaciju
odgajivakih programa i proizvodnju kvalitetnih priplodnih grla.

Kljune rei: ovce, koze, matina evidencija, centralna Srbija

Acknowledgment
Research was financed by the Ministry of Science and Technological
Development, Republic of Serbia, project TR 3105.

References

ACTIVITIES REPORT AND RESULTS OF THE CONTROL OF

REALIZATION OF BREEDING PROGRAMS IN 2016. Institute for animal
husbandry, 109-133 135-156
ANONYMOUS (1954): Zakon o zabrani dranja koza. Slubeni glasnik Narodne
Republike Srbije 37, 269.
HPA. Annual report for sheep, goats and small animals, 2015.
[Link]
i-male-%C5%[Link]
KRAJINOVI M., PIHLER I (2014): Tehnologija kozarske proizvodnje.
Univerzitet u Novom Sadu, Poljoprivredni fakultet, pp 237.
MAKSIMOVI N. (2014): Variability of testosterone concentration evaluation and
relationship to the primary and secondary sexual characteristics and behaviour of
rams. Ph.D. Dissertation, University of Belgrade, Faculty of agriculture.
MAKSIMOVI N., DELI N., STANKOVI B., HRISTOV S., PETROVI
P.M., CARO-PETROVI V., RUI-MUSLI D., MII N. (2015a): Oestrus
synchronization efficiency and fertility in ewes of MIS sheep population during
anoestrous and breeding season. Invited Paper. Proceedings of the 4th International
Congress New Perspectives and Challenges of Sustainable Livestock Production,
October 7 9, Belgrade, Serbia, 104-112
MAKSIMOVI N., BAUMAN F., PETROVI P.M., CARO PETROVI V.,
RUI-MUSLI D., MII N., MILOEVI-STANKOVI I. (2015b):
Productive characteristics and body measurements of Alpine goats raised under
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
98 October 11-13, 2017

smallholder production systems in central Serbia. Biotechnology in animal

husbandry 31, 2, 245-253.
MAKSIMOVI N., HRISTOV S., STANKOVI B., PETROVI P.M., MEKI
C., RUZI-MUSLI D., CARO-PETROVI V. (2016): Investigation of serum
testosterone level, scrotal circumference, body mass, semen characteristics, and
their correlations in developing MIS lambs. Turkish Journal of Veterinary and
Animal Sciences, 40, 53-59.
MAKSIMOVI N., UJOVI M., PETROVI P.M., HRISTOV S.,
STANKOVI B., RUI-MUSLI D., STANII N., (2011): Reproductive
indicators and development of lambs of Sjenica pramenka breed from birth to
weaning: The effect of non-genetic factors. 2nd Conference of the Balkan Network
for the Biotechnology in Animal reproduction, Sofia, Bulgaria, Proceeding, 23-26.
MEMII N., BAUMAN F. (2003): Domae rase koza. Poljoprivredne aktuelnosti,
5-6, 41-56.
MITI N. (1984): Ovarstvo. Zavod za udbenike i nastavna sredstva, Beograd.
PETROVI P.M. (2015): Glavni odgajivaki program u ovarstvu. Institut za
stoarstvo, Beograd, 77-119.
RUI-MUSLI D. (2015): Glavni odgajivaki program u kozarstvu. Institut za
stoarstvo, Beograd, 121-148.
RUI-MUSLI D., BIJELI Z., CARO-PETROVI V., KRBI Z., CIVIDINI
A., BOJKOVSKI D., SIMI M., KOMPAN D. (2015): Conservation of
autochthonous sheep breeds in Serbia and Slovenia. Proceedings of the 4th
International Congress New Perspectives and Challenges of Sustainable Livestock
Production, October 7 9, Belgrade, Serbia, 83-103.
RZS (2012): Statistiki godinjak Republike Srbije.
SAVI M., BALTI M., BECSKEI Z., DIMITRIJEVI B.,
DIMITRIJEVI V., SAVI ., VEGARA M. (2014): Evaluation of Zackel lamb
meat quality with the aim of increasing the conservation value of the breed. Acta
veterinaria 64 (4), 438-446.
UJOVI M., MEMII N., IVANOVI S. (2011): Present status, possibilities and
perspective of development of goat production in republic of Serbia.
Biotechnology in Animal Husbandry 27, 3, 431-443.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

PERSPECTIVES OF PIG BREEDING SECTOR IN

EUROPE
Vesna Gantner1, Pero Miji1, Maja Gregi1, Vladan Bogdanovi2, Tina
Bobi1, Dragan Soli3, Kreimir Kuterovac4
1
Josip Juraj Strossmayer in Osijek, Faculty of Agriculture in Osijek, Vladimira Preloga 1, Osijek,
Croatia, e-mail: vgantner@[Link]
2
University of Belgrade, Faculty of Agriculture, Institute of Zootechnics, Nemanjina 6, 11080
Belgrade Zemun, Serbia
3
HPA, Ilica 101, 10000 Zagreb, Croatia
4
Inagra Ltd, Biljska cesta 27, 31000 Osijek, Croatia
Corresponding author: vgantner@[Link]
Review paper

Abstract: Agriculture worldwide in future period will face with a number

of major challenges: rapid population growth, climate change, an increasing
demand for energy, resource shortages, accelerated urbanisation, dietary changes,
ageing populations in rural areas in developed countries, increased competition on
world markets, and lack of access to credit developing countries. Agriculture in the
European Union is characterised by the gradually declining of the area of land
available for agriculture due to increased forestry, biogas production and
urbanisation. Furthermore, it is characterised by a long-term decline in the number
of holdings with a corresponding increase in the area per holding. Currently,
European Union is self-sufficient in cereals, total meat production and milk and
dairy products. Forecasts indicate similar level of self-sufficiency in future (till
year 2025). Analysis and forecasts of pig meat market development in Europe in
year 2025 indicate increase of net production (amount of increase will vary
regarding the state), slightly increase of consumption in Europe, significant
increase of export (mainly in China) while import remains unchanged.
Croatia and Serbia together breed about 3% of total pig production in
Europe. Can we do better? Lets review the advantages: natural resources
(agricultural land; cereal production; water), educated stakeholders, and possibility
for investments (CAP II. Pilar, SAPARD, IPARD). Lastly, for sustainable
development of pig breeding it is necessary to ensure: government support
(simplification and price cuts of administration; simplification and price cuts of
cost of capital as well as institutional support (scientific community, advisory
service). The question is, will we organize?

Key words: pig breeding, challenges, perspectives, Europe

Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
100 October 11-13, 2017

Introduction
Agriculture State of the Art
In accordance to the forecasts, agriculture worldwide in future period will
face with a number of major challenges: rapid population growth, dietary changes,
accelerated urbanisation, ageing populations in rural areas in developed countries,
an increasing demand for energy, resource shortages, increased competition on
world markets, lack of access to credit developing countries as well as climate
change (EPRS, 2016).
EU agriculture is characterised by the gradually declining of the area of
land available for agriculture due to increased forestry and urbanisation (EPRS,
2016). Currently, the total utilised agricultural area is 174 million hectares (ha),
which comprises 40% of the EU land area. During the period between 2005 and
2013 the agricultural land area fell by 0.7% (Figure 1). Due to this trend, in order
to maintain or increase output, the productivity must be increased.

Figure 1. Agricultural land-use developments in the EU in million ha (EC, 2013)

Other important characteristics of EU agriculture is a long-term decline in

the number of holdings with a corresponding increase in the area per holding. In
the period between 2005 and 2013, the average rate of decline was 3.7% per year,
resulting in the number of holdings reducing by 1.2 million and average holding
area rising from 14.4 to 16.1 ha (EPRS, 2016). In year 2013 there were 10.8
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 101

million farm holdings (farms) in the EU employing about 22.2 million people
(excluding seasonal workers).
Currently, European Union is self-sufficient in cereals, total meat
production and milk and dairy products. Forecasts indicate similar situation in
future (till year 2025, EC, 2015).

Challenges of European agriculture

Climate change
In the last decades we have witnessed increasingly pronounced climate
change worldwide. These changes are transforming the environment in different
regions by making them not convenient for living and agricultural production. FAO
experts (FAO, 2013) stated that aiming to hold the increase in global temperature
below 2oC and by that to avoid dangerous climate change, global GHG emissions
need to be significantly decreased worldwide.
Currently, agriculture plays an important role in global environmental
issues, such as climate change, land degradation, water pollution and biodiversity
loss. Therefore, future production growth in must be accommodated within the
growing insufficiency of natural resources, including land, water and nutrients.
Furthermore, waste and greenhouse gasses (GHG) emissions must be significantly
reduced. Possible impacts of climate change on EU agriculture in presented of
Figure 2.

Figure 2. Possible impacts of climate change on European regions (EC, 2013)

Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
102 October 11-13, 2017

Political changes
Recent political movements (USA - election of Donald Trump, Britains
Brexit, current elections in different EU states, China - President Xi - who has
moved toward nationalistic policies) clearly indicate that the idea of globalization
becomes questionable. It is obvious that the world is changing.

The Common Agricultural Policy (CAP)

European Union has Common Agricultural Policy (CAP) that applies for all
member states and amounts more than 40% of the EU budget (DG, 2013). CAP
addresses following challenges:
economic,
environmental (climate change),
territorial.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 103

Figure 3. How to address challenges (DG, 2013)

Figure 4. CAP instruments (DG, 2013)

Main statistics
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
104 October 11-13, 2017

Population and meat production Europe

Table 1. Livestock population, 2015 (million Table 2. Production of meat, by type of animal,
head, Eurostat, 2017) 2015 (1 000 tonnes of carcass weight, Eurostat,
2017)

Total livestock population in Europe in year 2015 is shown in the Table 1.

Total number of pigs in 2015 amounted 148.7 million head. Less than 1% of pig
population was breed in Croatia (1.2 million), while on pig farms in Serbia slightly
more than 2% was breed.

Perspectives in Europe in period 2025 2015

The future trends in Europe regarding the consumption of meat, production
and export of pig meat as well as pig market development are shown in following
Figures.

Consumption
The forecasted changes in the meat consumption in EU in year 2025 in
regard to 2015 indicate increase of total meat consumption in amount of 0.1% per
year with different patterns regarding the meat product (EC, 2015). The highest
increase in consumption is expected in poultry products (Figure 5).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 105

Figure 5. EU changes in consumption (000 t) 2025 vs. 2015 (EC, 2015)

Production and export

In EU in year 2025 expected increase in pig production amount more than
4000000 t that is 1.7% more than in 2015 (Figure 6). Regarding the export of pig
meat even higher increase in amount more than 550000 t (26.3% more than in
2015) is forecasted (EC, 2015).

Figure 6. EU changes in production and exports (000 t) 2025 vs. 2015 (EC, 2015)
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
106 October 11-13, 2017

Pig meat market development

Forecasts indicate in year 2025 (Figure 7)
increase of net production (amount of increase will vary regarding the
state)
slightly increase of consumption in Europe
increase of export (mainly in China)
import remains unchanged (EC, 2015).

Figure 7. EU pig meat market developments (million t) 2025 vs. 2015 (EC, 2015)

Conclusion
The Perspectives of pig breeding sector in Europe? Currently, European
Union is self-sufficient in cereals, total meat production and milk and dairy
products. Forecasts indicate similar situation in future (till year 2025). Also,
forecasts indicate significant increase of production and export. Croatia and Serbia
together breed about 3% of total pig production in Europe. Can we do better?
Lets review the advantages: natural resources (agricultural land; cereal
production; water), educated stakeholders, and possibility for investments (CAP
II. Pilar, SAPARD, IPARD). Lastly, for sustainable development of pig breeding
it is necessary to ensure: government support (simplification and price cuts of
administration; simplification and price cuts of cost of capital as well as
institutional support (scientific community, advisory service).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 107

The question is, will we organize?

Perspektive u sektoru uzgoja svinja u Evropi

Vesna Gantner, Pero Miji, Maja Gregi, Vladan Bogdanovi, Tina Bobi, Dragan
Soli, Kreimir Kuterovac

Rezime
Poljoprivreda u svetu u buduem periodu e se suoiti s brojnim velikim
izazovima: brz rast populacije, klimatske promene, sve vea potranja za
energijom, nedostatak resursa, ubrzana urbanizacija, promene u ishrani, starenje
populacije u ruralnim podrujima u razvijenim zemljama, poveana konkurencija
na svetskim tritima, i nedostatak pristupa kreditima za zemlje u razvoju.
Poljoprivredu u Evropskoj uniji karakterie postepeno opadanje zemljinih
povrina raspoloivih za poljoprivredu zbog poveanog umarstva, proizvodnje
biogasa i urbanizacije. Nadalje, karakterie ga dugorono smanjenje broja
gazdinstava sa odgovarajuim poveanjem povrine po gazdinstvu. Trenutno,
Evropska unija je samodovoljna u itaricama, ukupnoj proizvodnji mesa i mleku i
mlenim proizvodima. Prognoze ukazuju na slian nivo zadovoljavanja sopstvenih
potreba u budunosti (do 2025. godine).
Analize i prognoze razvoja trita svinjskog mesa u Evropi do 2025.
godine ukazuju na poveanje neto proizvodnje (koliina poveanja e se razlikovati
od drave do drave), blago poveanje potronje u Evropi, znaajan porast izvoza
(uglavnom u Kinu), dok uvoz ostaje nepromenjen.
Hrvatska i Srbija zajedno ine oko 3% ukupne proizvodnje svinja u Evropi.
Moemo li bolje? Razmotrimo prednosti: prirodni resursi (poljoprivredno
zemljite, proizvodnja itarica, voda), obrazovani akteri i mogunost ulaganja
(CAP - II. Pilar, SAPARD, IPARD). Na kraju, za odrivi razvoj uzgoja svinja
potrebno je osigurati: podrku vlade (pojednostavljenje i smanjenje cena
administracije, pojednostavljenje i smanjenje trokova kapitala, kao i
institucionalna podrka (nauna zajednica, savetodavna sluba). Pitanje je da li
emo uspeti da se organizujemo?

Kljune rei: uzgoj svinja, izazovi, perspektive, Evropa

Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
108 October 11-13, 2017

References
DG Agriculture and Rural Development, European Commission (2013): The CAP
towards 2020 Political agreement.
EC European Commission (2013): Prospect of Agricultural Markets and Income
in the EU 2013 2023.
EC European Commission (2015): EU Agricultural Outlook, Prospects for EU
agricultural markets and income 2015 2025.
EPRS European Parliament Research Service (2016): Precision agriculture and
the future of farming in Europe. Scientific Foresight Study.
EUROSTAT (2017). [Link]
Food and Agriculture Organization of the United Nations. FAO. (2013):
Greenhouse gas emissions from pig and chicken supply chains A global life cycle
assessment, by MacLeod, M., Gerber, P., Mottet, A., Tempio, G., Falcucci, A.,
Opio, C., Vellinga, T., Henderson, B., Steinfeld, H. Rome.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

KRKOPOLJE PIG IN TREASURE PROJECT: FROM

REARING TO PRODUCT
Marjeta andek-Potokar1,2, Urka Tomain1, Martin krlep1, Nina
Batorek Luka1, Maja Prevolnik Pove1,2, Peter Dov3, Zein Kallas4,
Jos M. Gil4
1
Agricultural Institute of Slovenia, Hacquetova ulica 17, SI-1000 Ljubljana
2
University of Maribor, Faculty of Agriculture and Life Sciences, Pivola 10, SI-2311 Hoe
3
University of Ljubljana, Biotechnical faculty, Department of Animal Science, Groblje 3, SI-1230
Domale
4
Centre for Agro-food Economy & Development, CREDA-UPC-IRTA, Castelldefels 08860, Spain
Corresponding author: Marjeta andek-Potokar, [Link]-potokar@[Link]
Original scientific paper

Abstract: Krkopolje pig, a Slovenian autochthonous breed, is poorly

studied and exploited, as is the case in many autochthonous (local) pig breeds.
More knowledge about various aspects of breed as characterisation, performances,
product quality and socio-economic relevance is needed for the development of
sustainable pork value chains. To answer these challenges, the studies are
conducted within H2020 project TREASURE spanning from rearing to product
evaluation. In this work, an overview of the first partial and preliminary results are
presented for Krkopolje pig which concern the evaluation of growth performance
in different rearing systems, effect of the incidence of RYR1 gene mutation and
sensory quality and consumer acceptability of new traditional product (dry-cured
sausage salami type) from Krkopolje pigs.

Keywords: autochthonous breed, Krkopolje pig; growth performance,

RYR1 mutation, sausages, consumer test

Introduction

Slovenia has only one preserved autochthonous (local) pig breed, the
Krkopolje pig which has a black coat colour with a white belt across shoulders
and forelegs. In the seventies of the last century, the breed was gradually
abandoned and became endangered. In the early nineties of the 20th century in situ
gene bank and herd book were created. An important milestone was also the year
2003 when individual marking of all newborn piglets was introduced (Kastelic and
andek-Potokar, 2013). The interest for Krkopolje breed has been revived in the
last years, esp. on organic farms and on family farms with direct product sales. The
Proceedings of the 11th International Symposium
110 Modern Trends in Livestock Production
October 11-13, 2017

public aid for the conservation of this breed contributes to its wider use. Presently,
Krkopolje breed is not at risk of extinction, however the breed is far from being
safe. In order to develop a sustainable use of Krkopolje pig and thus its
preservation, it would be necessary to develop economically sustainable
exploitation through valorisation of its products. As is the case for other local pig
breeds, Krkopolje pig is reared in very diverse conditions adapted to the specific
local environment. Typically, farmers are rearing these pigs on a small scale basis
in rather extensive conditions, often using a combination of indoor and outdoor
system. The breed is reputed for excellent meat quality and used for traditional
pork products appreciated by consumers. However in terms of the scientific
substantiation, there is practically no information about nutritional requirements of
this breed, the performances, productive traits and quality of products are
practically untapped and studies dealing with this breed are lacking. Studies are
thus needed to acquire more knowledge as the basis and essential for the
development of sustainable pork value chains. In light of this, experiments and
studies on Krkopolje breed are conducted within H2020 project TREASURE from
rearing to product development and an overview of the first partial or preliminary
results are presented in this paper.

Materials and Methods

Growth performance of piglets in lactation phase
Piglets (n=156; 68 females and 88 castrated males) from 7 organic and 11
conventional farms were weighed at weaning (4-6 weeks). Daily gains were
calculated based on weaning weight and average birth weight (1.2 kg). Details of
the study (experimental design and statistical analysis) are described in Tomain et
al. (2016).

Growth performance in the growing phase

Three piglets (castrates) per litter were selected from 12 farms/litters at the
average age of 55 days and average weight of 14 kg, and assigned within litter to
three groups. One group (two pens of 6 pigs) received organic (ECO) feed mixture
(12.8 MJ ME/kg, 17.8% crude protein (CP), 0.8% lysine and 11.9 MJ ME/kg, 15%
CP, 0.6% for growing and fattening diets, respectively) while the other group (four
pens of 6 pigs) received conventional (CON) feed mixture (13.6 MJ/kg, 16.8%
crude protein, 1.0 lysine and 11.6 MJ ME, 15.3% CP, 0.9% lysine for growing and
fattening diets, respectively). The pigs were given an ad libitum access to feed and
were weighed every 2 weeks until the average age of 155 days and daily gains
were calculated.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
111
October 11-13, 2017

Fattening trial in conventional and organic system

Pigs were assigned within litter to three treatment groups; ECO (n=12),
CON (n=12) and CON+L (n=12). Two barley based diets were prepared. For ECO
pigs (n=12), the diet (12.4 MJ ME/kg, 12.9% CP, 0.7 % Lys) was based on
organically produced crops whereas for CON and CON+L pigs, the diet (13.2 MJ
ME/kg, 13.6% CP, 1.2 % Lys) was based on the same ingredients but from
conventional crop production. ECO pigs were supplemented with lucerne hay,
CON+L pigs were supplemented with pelleted lucerne and received 10% less feed
mixture than CON and ECO. Pigs in CON and CON+L were housed indoors,
whereas ECO pigs were reared respecting the rules for organic production. Details
of the study design are described in Batorek et al. (2016).

Fattening performance of Krkopolje pigs in extensive and intensive system

The growing and fattening of pigs was conducted on two farms. Twelve
pigs from twelve farms/litters were delivered to both farms at similar age (85.92.5
days) and live weight (26.32.1 kg). On the extensive (EXT) farm, the pigs (n=6)
were housed in a pen (15 m2) with access to outdoor area (50 m2) and fed cooked
potatoes and root crops supplemented with mixture of cereals, whereas on the
intensive farm, the pigs (n=6) were housed indoors (in a pen of 7.5 m2) and fed
complete feed mixture. Pigs were monitored for 138 days and were weighed 4
times (at 86, 129, 195, 224 days) with 4 growth stages (25-45, 45-75, 75-90 and
90-120 kg) considered (for more information see Tomain et al., 2017a).

Effect of the RYR1 mutation in Krkopolje pigs

Unrelated Krkopolje castrates reared in equivalent conditions (at the same
farm and fed complete feed mixtures adapted to the stage of growth) were
genotyped for recessive mutation c. C1843T (p. Arg615Cys) at RYR1 locus
(recessive allele further denoted as n; N stands for wild type allele). Carcass
traits and meat quality were compared between N/n (n=15) and N/N pigs (n=20)
(more information in Tomain et al., 2017b).

The quality of salami from Krkopolje pigs as compared to standard product

The effect of raw material (meat and back fat) from Krkopolje pigs on
quality parameters of non-smoked dry-cured sausage (salami) was assessed. Salami
was produced by the same producer with the same processing procedure (additives,
temperature and relative humidity regime, dry-curing and ripening duration) using
either standard raw material (meat, subcutaneous back fat in proportion 80:20) or
using meat and subcutaneous back fat (in proportion 80:20) from Krkopolje pigs.
Proceedings of the 11th International Symposium
112 Modern Trends in Livestock Production
October 11-13, 2017

Consumer acceptance for salami from Krkopolje pigs as compared to standard

product
Consumer sensory test were performed in order to determine the consumer
acceptability and preferences for non-smoked dry-cured sausage (salami) made
from Krkopolje pig as compared to standard product (salami made of
conventional modern pig meat). For that purpose products (salami) were made
using the same processing method but different raw material (meat and fat of
Krkopolje vs. meat and fat of standard pig). Following the Expectation
Disconfirmation Theory (EDT) (Olson and Dover, 1979; Oliver 1997), the sensory
test included three phases, a blind sensory test with no information; an evaluation
of the expected liking based on product description; a sensory test with complete
information on the samples. The sensory evaluation was carried out in controlled
environment with different sessions of 15 consumers by session. Participants
evaluated the overall acceptability using a nine-point category scale from 1 dislike
extremely; to 9 like extremely.

Results and Discussion

Growth rate of piglets in the lactation
Weight at weaning and growth rates of Krkopolje piglets raised on
organic farms were approximately 20% lower than of piglets raised on
conventional ones, however, the differences were not significant when taking into
account the random effect of farm (Figure 1). Such results are expected in
Slovenian pig farming conditions as Krkopolje pigs are most often reared on
unspecialised, small extensive farms, there are often no big differences between
conventionally and organically raised pigs, explaining the small differences
between growth rates in lactation period between the two farming systems. The
lactation periods practiced are generally longer (4-6 weeks; 38 days in average in
the present study) and in such system piglets need to be supplemented with
complete feed mixtures to grow well. Diets in organic pig production are often
deficient in essential amino acids due to the legislation on organic farming
(Council Regulation (EC) No 834/2007) which does not allow the use of synthetic
amino acids, genetically modified organisms and feed materials processed with the
aid of chemically synthesised solvents in organic diets (the latter two are
particularly referring to soybean meal, which is one of the main protein sources
used in conventional feed for pigs).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
113
October 11-13, 2017

Figure 1: Weaning weight (a) and average daily gain in lactation (b) of conventionally and
organically raised Krkopolje piglets

Growth performance in the growing phase (from weaning until 70 kg)

There was no major difference in weight of pigs (Figure 2a) at the
beginning of the study whereas after 100 days of fattening, the pigs receiving CON
diet were slightly heavier (their growth rate being 10% greater) but the difference
was not significant (P>0.05). Daily gain steadily increased with growth, except in a
period between 83 and 97 days which could be due to high ambient temperatures
(Figure 2b). Average daily gain of pigs in the period from 55 to 155 days was
slightly (but not significantly) lower in ECO than CON pigs. These results suggest
that no major differences in growth rates of Krkopolje pigs fed organic or
conventional diet are to be expected in the case of similar nutritional value of the
diet and similar rearing conditions (as was the case in the present study).

Figure 2: Weight (a) and average daily gain (ADG) (b) of pigs fed conventional (CON) or
organic (ECO) feed mixtures
Proceedings of the 11th International Symposium
114 Modern Trends in Livestock Production
October 11-13, 2017

Fattening trial under conventional and organic system

At the beginning of the experiment there were no differences between
experimental groups of pigs in body weight (P=0.325, Figure 3), but pigs in group
ECO had thinner back fat than pigs in group CON (P=0.019, Figure 3). After 73
days of fattening, no differences among groups in body weight or backfat thickness
(Figure 3) were observed. ECO pigs had 13% higher daily gain than pigs in group
CON. This could be ascribed to high consumption of lucerne hay and possibly less
feed dissipation. Pigs in group CON+L did not compensate slight dietary restriction
with consumption of lucerne pellets, consequently leading to lower daily gains
(11%) compared to CON pigs. No differences in backfat thickness (Figure 3) at the
end of the trial and carcass traits (Figure 4) between treatment groups were noted.
There were also no differences in carcass traits between the experimental groups.

a) b)

Figure 3: Gain of body weight (a) and backfat (b) in Krkoplje pigs during the experiment
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
115
October 11-13, 2017

Figure 4: Dressing, meat %, loin eye area (LEA) and loin eye fat area (LEFA) of experimental
Krkopolje pigs
Performance of Krkopolje pigs in extensive and intensive system
Pigs fed complete feed mixture achieved in total 49% higher daily gain and
were heavier at slaughter than pigs fed traditional meal with root crops and cereals
(88 vs. 120 kg, P=0.000). In the first observational period (25-45 kg) similar daily
gain was observed for both groups, whereas pigs fed traditional meal with root
crops and cereals grew slower than pigs fed complete feed mixture in the periods
from 45 to 90 kg. In the last period (90-120 kg) only the pigs fed complete feed
mixture were monitored, and they exhibited lower growth rate than in the previous
two periods (Figure 5a). Slower growth of pigs fed traditional meal with root crops
and cereals can be explained with lysine deficiency of their meal (data not shown;
details about nutritional value of both diets are described in Tomain et al., 2017a)
As a result, owing to a greater live weight (BW) at slaughter, pigs fed complete
feed mixture had thicker backfat than pigs fed traditional meal with root crops and
cereals, however at equal BW (88 kg), no differences were observed. With regard
to meat quality the results are indicative of more oxidative muscle metabolism of
slower growing pigs fed a meal deficient in lysine (they exhibited lower CIE L*
and higher CIE a* colour parameters of LD (i.e. darker, redder LD colour).
Proceedings of the 11th International Symposium
116 Modern Trends in Livestock Production
October 11-13, 2017

Figure 5: Daily gain (a) and backfat thickness (b) of pigs according to rearing system

Effect of the RYR1 mutation in Krkopolje pigs

Pigs of N/n and N/N genotype at RYR1 locus reared under the same
conditions were compared. Pigs that carry mutated n allele exhibited slower
growth rate, were more muscular, leaner and less fat and had reduced water
holding capacity and increased hardness than N/N pigs (Figure 6) which agrees
with the impact of the mutated n allele on muscularity and meat quality traits
reported for modern white breeds (Monin et al., 1999; Fisher et al., 2000; Salmi et
al., 2010).

For variables presented in the Figure 6, the effect of n allele was significant (P<0.05).
Figure 6: Effect size (of N/n vs. N/N) for carcass and meat quality traits
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
117
October 11-13, 2017

The quality of salami from Krkopolje pigs as compared to standard product

Using the same processing method, dry-cured sausages, made from meat
and back fat of Krkopolje pigs differed from the sausages using usual raw material
(conventional pig). Sausages from Krkopolje pigs had higher a w than standard
sausages (0.892 vs. 0.830, P<0.001) despite similar moisture content (28.7 vs.
29.6%, P=0.090). Value of pH was slightly lower in the sausages of Krkopolje
pigs than the standard ones (6.00 vs. 6.09, P=0.109). The sausages of Krkopolje
pigs had less protein (23.1 vs. 29.9 %, P<0.001), more fat (44.0 vs. 33.8 %,
P<0.001) but also less salt (3.9 vs. 5.5%, P<0.001) than standard sausages.
Differences in chemical composition were consistent with the sensory evaluation
results showing that Krkopolje sausages were scored lower for colour intensity,
mature smell and saltiness and their texture perceived as softer, more juicy,
crumbly and pasty (Figure 7).

Figure 7: Differences in sensory profile of salami from Krkopolje pig and standard salami
Consumer preferences for salami from Krkopolje pigs

In a blind sensory test, standard salami was rated with a higher average
rating scores compared to the salami from Krkopolje pig (P=0.003; Figure 8). On
the contrary, respondents showed a significantly better expected acceptability for
Krkopolje salami (P<0.001; Figure 8). When a sensory test with information about
the product was applied (informed test), no difference in acceptability between the
products was noted. According to the disconfirmation model, comparing results of
blind and expected acceptability tests showed a negative disconfirmation for
Krkopolje salami (the product is worse than expected; Figure 8). On the other
hand, according to the assimilation model, higher scores of informed than of blind
test for Krkopolje salami (P<0.001; Figure 8) are showing a positive assimilation
and putting in evidence that information about the breed can have a positive impact
Proceedings of the 11th International Symposium
118 Modern Trends in Livestock Production
October 11-13, 2017

on consumers expectations about the tested product. Consumers showed higher

acceptance when were informed about the product tasted. This finding highlights
the importance of direct promotion and advertisement campaign that may give
consumers the opportunity to know more about the breed.

Figure 8: Results of sensory test and differences between expected (E) and blind (B), informed
(I) and B, and I and E scores between standard salami and salami from Krkopolje pig

Conclusion

Preliminary results presented provide some basic information about the

performances, productive traits and product quality of Slovenian local pig breed
Krkopolje. Further studies are needed with regard to the growth potential
according to the production system as well as for the purposes of developing
adapted fattening systems. Krkopolje breed is facing a big challenge with the
problem of high incidence of RYR1 mutated allele that needs to be dealt with for
the benefit of meat quality assurance. Studies with consumers show, that
Krkopolje breed can have a positive impact on their expectations which highlights
the importance of direct promotion.

Krkopoljska svinja u projektu TREASURE: od uzgoja do

proizvoda
Marjeta andek-Potokar, Urka Tomain, Martin krlep, Nina Batorek Luka,
Maja Prevolnik Pove, Peter Dov, Zein Kallas, Jos M. Gil

Rezime
Krkopoljska svinja, slovenaka autohtona rasa, slabo je istraena i
eksploatisana, kao to je sluaj kod mnogih autohtonih rasa svinja. Potrebno je vie
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
119
October 11-13, 2017

saznanja o razliitim aspektima od karakterizacije rase, performansama i kvalitetu

proizvoda, te drutveno-ekonomskom znaaju za razvoj odrivih lanaca njihovih
proizvoda. Da bi odgovorili na ove izazove, studije se sprovode u okviru projekta
H2020 TREASURE koji se protee od praenja do procene proizvoda. U ovom
radu prezentovani su prvi parcijalni i preliminarni rezultati za krkopoljsku svinju
koji se odnose na procenu performanse rasta u razliitim sistemima uzgoja, efekat
mutacije RYR1 gena i senzornog kvaliteta i prihvatljivosti novog tradicionalnog
proizvoda (suva kobasica u tipu salame) od Krkopoljskih svinja.

Kljune rei: autohtona rasa, krkopoljska svinja, performanse rasta,

RYR1 mutacija, suva kobasica, test potroaa

Acknowledgment

The study was conducted within the project TREASURE, which has
received funding from the European Unions Horizon 2020 research and
innovation programme under grant agreement No 634476. The content of this
paper reflects only the authors view and the European Union Agency is not
responsible for any use that may be made of the information it contains.
Authors would also like to acknowledge the core financing of Slovenian
Agency of Research (grant P4-0133) and Krkopolje pig breeders for their
cooperation.

References

BATOREK LUKA N., TOMAIN U., KRLEP M., PREVOLNIK POVE M.,
ANDEK-POTOKAR M. (2016): Effect of production system (organic vs.
conventional) and roughage supplementation in diet on performance of growing-
finishing Krkopolje pigs. Book of Abstracts of 9th International Symposium on
Mediterranean Pig, Instituto Politcnico de Portalegre, Portalegre, Portugal, p. 36.
COUNCIL REGULATION EC (2007): Council Regulation (EC) No 834/2007 of
28 June 2007 on organic production and labelling of organic products and
repealing Regulation (EEC) No 2092/91. Official Journal of the European Union, L
189/1.
FISHER P., MELLETT F.D., HOFFMAN L.C. (2000): Halothane genotype and
pork quality. 1. Carcass and meat quality characteristics of three halothane
genotypes. Meat Science, 54, 97105.
Proceedings of the 11th International Symposium
120 Modern Trends in Livestock Production
October 11-13, 2017

KASTELIC A., ANDEK-POTOKAR M. (2013): Application of quality labels in

support of conservation of local breeds a challenge for Slovenian Krkopolje pig.
8th International Symposium on the Mediterranean Pig, (Acta Agriculturae
Slovenica), Biotechnical Faculty, Ljubljana, Slovenia, suppl. 4, 205209.
MONIN G., LARZUL C., LE ROY P., CULIOLI J., MOUROT J., ROUSSET-
AKRIM S., TALMANT A., TOURAILLE C., SELLIER P. (1999): Effects of the
halothane genotype and slaughter weight on texture of pork. Journal of Animal
Science, 77: 408415.
OLSON, J.C., DOVER P.A. (1979). Disconfirmation of consumer expectations
through product trial. Journal of Applied Psychology, 64(2), 179-189.
OLIVER, R.L. (1997). Satisfaction: A behavioral perspective on the consumer.
New York, NY: McGraw-Hill.
SALMI B., TREFAN L., BLOOM-HANSEN J., BIDANEL J.P., DOESCHL-
WILSON A.B., LARZUL C. (2010): Meta-analysis of the effect of the halothane
gene on 6 variables of pig meat quality and on carcass leanness. Journal of Animal
Science, 88, 28412855.
TOMAIN U., BATOREK LUKA N., KRLEP M., PREVOLNIK POVE M.,
MEAN A., ANDEK-POTOKAR M. (2016): Growth of Krkopolje piglets
during lactation and the first rearing period. Book of Abstracts of 9th International
Symposium on Mediterranean Pig, Instituto Politcnico de Portalegre, Portalegre,
Portugal, p. 43.
TOMAIN U., KRLEP M., BATOREK LUKA N., PREVOLNIK POVE M.,
ANDEK-POTOKAR M. (2017a): Performance of Krkopolje pigs in extensive
and intensive production system. 25th International Symposium Animal Science
Days, September 20 to 22, 2017, Brandlucken, Austria.
TOMAIN U., BATOREK LUKA N., KRLEP M., PREVOLNIK POVE M.,
OGOREVC J., DOV P., ANDEK-POTOKAR M. (2017b): Meat quality of
Krkopolje pigs as affected by RYR1 genotype. 11th International Symposium
Modern Trends in Livestock Production, 11th 13th October 2017, Belgrade,
Serbia.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

GESTATIONAL STRATEGIES AFFECTING SOW

REPRODUCTION AND PIGLET BIRTH WEIGHT
Giuseppe Bee
Agroscope Posieux, Posieux, 1725, Switzerland
Corresponding author : [Link]@[Link]
Review paper

Abstract: Nowadays it is becoming a great challenge for pig producers to deal

with the increasing number of low birth weight piglets born from hyperprolific
sows as underprivileged piglets suffer from increased pre-weaning morbidity and
mortality primarily due to impaired in-utero development. As postnatal muscle
growth and ultimately overall growth is determined not only by postnatal
hypertrophy (increase in myofiber size) but also byprenatal hyperplasia (increase in
myofiber number), the positive relationship between birth weight and myofiber
number and myofiber number and growth efficiency, meat and carcass quality is of
relevance. Therefore, nutritional strategies during gestation need to focus on
improving muscle development of embryos and foetuses with the ultimate goal of
minimizing the numbers of underprivileged low birth weight piglets. The first part
of the review, will focus on myogenesis and its significance for postnatal growth
performance, carcass characteristics, and pork quality. In addition, the
inconsistency in the reported results with respect to low birth weight, postnatal
growth, and carcass and pork quality will be discussed. The final part of the review
will show known nutritional approaches to optimize the intrauterine environment
via supplementing the sow during gestation with specific ingredients. In
conclusion, some future research approaches will be proposed in order to further
fill the knowledge gap with respect to prenatal development.

Key words: piglet, myofiber, birth weight, growth performance, growth

efficiency, feeding strategy

Introduction
Both birth weight of the individual piglet and the intra-litter variation of
birth weight are of considerable economic interest for pork production. Piglets
birth weight is highly correlated with the survival rate within the first days after
birth. The latter dependson the ability of the newborns to ingest colostrum and of
the dam to produce colostrum (Theil et al., 2014; Quesnel et al., 2015). Ultimately,
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
122 October 11-13, 2017

this will affect the growth performance in the pre-weaning, nursery and grower-
finisher period (Quiniou et al., 2002; Pardo et al., 2013a; Jourquin et al., 2016).
The phenotype of the newborn piglet is determined by prenatal growth and
development, which is under the control of intrinsic and extrinsic factors. These
include maternal nutrition, maternal intestinal malabsorption, inadequate provision
of amniotic and allantoic fluid nutrients, the ingestion of toxic substances,
disturbances in maternal or fetal metabolic and homeostatic mechanisms,
insufficiency or dysfunction of the uterus, endometrium, or placenta,
environmental temperature and stress, and poor management (reviewed by Wu et
al. (2006)).
Over the last decade, selection for improved prolificacy has resulted in a
marked increase of piglets born per litter. In Switzerland, the number of piglets
born alive has increased in the last 10 years from 11.5 to over 13 per litter and
therefore over 30.6 piglets born alive and 26.3 piglets weaned (SUISAG, 2014).
Slightly greater litter sizes have been reported in France with on average 13.6
piglets born alive (IFIP-GTTT, 2015). The selection for sows ability to give birth
to a greater number of piglets has led to an increased within-litter variation in
piglet birth, as well as to an overall decrease in birth weight (Foxcroft et al., 2007).
A possible cause for these observations is the increased competition among
littermates for maternal nutrients in utero, because fetal and placental weight and
birth weight have been shown to be inversely related with litter size (Town et al.,
2004).
This non-exhaustivereview will focus on: 1) the consequences of impaired
prenatal growth on myogenesis (prenatal skeletal muscle development), 2) the
impact of differences in birth weight on postnatal development, carcass
characteristics and meat quality traits and 3) possible feeding strategies in sows to
affect fetal and early postnatal development of the offspring.

GENERAL CONSIDERATIONS ON THE SIGNIFICANCE OF MYOGENESIS FOR

POSTNATAL GROWTH PERFORMANCE

EMBRYONIC MUSCLE DEVELOPMENT

In the pig, myogenesis is a biphasic phenomenon and involves determination,
migration, proliferation, differentiation, and fusion of myoblasts to form myotubes
(Picard et al., 2002). In the first phase, lasting from d 35 to 55 of gestation, a
primary generation of myotubes (the so-called primary myofibers) develop. In the
second phase, which lasts until d 90 of gestation, the formation of a second
generation of myotubes (secondary myofibers) occurs. Over 20 secondary
myofibers appear around each primary myotube, using them as a scaffold
(Lefaucheur et al., 1995; Brard and Bee, 2010; Brard et al., 2010b). Based on
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 123

their findings, Wigmore and Stickland (1983) suggested that in the pigmyofiber
hyperplasia ceases by around d 90 of gestation. Thus, the number of formed
primary and secondary myofibers during gestation ultimately determines the total
number of myofibers at birth. Recently, this hypothesis has been questioned as an
increase in the total number of myofibers was observed within the first weeks after
birth (Loesel et al., 2009; Lopez et al., 2010; Brard et al., 2011). These
observations give raise to the opportunity to develop feeding strategies that could
affect hyperplasia after birth. Rather consistent among studies is the fact that the
number of secondary myofibers, as well as the total number of myofibers, formed
is lower in lighter compared with heavier newborn piglets (Wigmore and Stickland,
1983; Rehfeldt and Kuhn, 2006; Brard et al., 2010b; Pardo et al., 2013b).
Wigmore and Stickland (1983) gave for the lower hyperplasia in low birth weight
newborn pigs the following explanation: since primary myofibers serve as a
scaffold for the formation of secondary myofibers, the available smallersurface
area of primary myofibers restrict the secondary myofiber formation.

POSTNATAL MUSCLE DEVELOPMENT

The increase in skeletal muscle weight during postnatal growth results
from myofiber hypertrophy and elongation. Furthermore, the extent of myofiber
hypertrophy and, thus, the capacity of the muscle to grow depends also on the total
number of myofibers within a muscle. It has been shown that myofiber size is
inversely correlated (r=-0.3 to -0.8) with myofiber number, which means that
growth rate of the individual myofiber is lower when there are greater numbers of
myofibers and greater when there are fewer myofibers (Rehfeldt et al., 2000). On
the other hand, both number and size of myofibers are positively correlated with
the cross-sectional area of the muscle (r=0 to 0.6 and r=0.3 to 0.5, respectively).
This raises the question whether hypertrophy or total number of myofibers is more
important for lean tissue growth. Because myofiber hypertrophy islimited by
genetic and physiological constraints, potential for lean tissue growth depends
primarily on the number of the prenatally formed myofibers (Rehfeldt and Kuhn,
2006). Based on this assumption, one can conclude that impaired postnatal growth
can be expected in low birth weight piglets displaying low myofiber numbers.

LOW BIRTH WEIGHT AND ITS IMPACT OR LACK OF IMPACT ON POSTNATAL

GROWTH PERFORMANCE, CARCASS AND MEAT QUALITY

Recent results from various experiments demonstrate the close relationship

between birth eight, carcass characteristics, and meat quality traits. Rehfeldt and
Kuhn (2006) determined that at birth, compared with the heavier littermates the
lightest piglets exhibited the lowest percentages of muscle mass, total protein, total
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
124 October 11-13, 2017

fat, the lowest semitendinosus muscle weight and total number of myofibers,
whereas the percentages of internal organs, skin, bone, and total water were
highest, compared to their heavier littermates. At 182 d of age, pigs of low birth
weight were lighter, had lower meat percentages, and loin area was smaller
compared to pigs of high birth weight, whereas the percentage of mental fat tended
to be greater. The pigs of low birth weight exhibited the lowest myofiber numbers,
the largest myofiber size, and the highest percentages of abnormal giant
myofibers in both muscles under investigation. With respect to meat quality, higher
drip losses were determined in the longissimus muscle of low birth weight pigs.
Rehfeldt and Kuhn (2006) explained the difference in adipose tissue accretion
between low and high birth weight pigs with the faster myofiber hypertrophy due
to the low myofiber number and the plateau of myofiber growth is attained earlier
compared to high birth weight pigs. Consistent with these earlier results, Bee
(2004) reported larger myofibers and fatter carcasses in low compared with high
birth weight pigs slaughtered at 105 kg body weight. Gondret et al. (2005); (2006)
found that compared to heavy birth weight pigs, low birth weight pigs reached 12 d
later the same slaughter weight of 112 kg. Not only was growth rate impaired, but
also feed efficiency was inferior in low birth weight pigs. Accordingly, these pigs
exhibited a fatter carcass, associated with markedly greater activity of enzymes
involved in lipogenesis, such as fatty acid synthase and malic enzyme. Again, the
total myofiber number was lower in the semitendinosus muscle, and the myofibers
were larger in both the semitendinosus and longissimus muscles of low compared
to high birth weight pigs. Of great importance with respect to consumers
satisfaction with pork, was the finding that low birth weight pigs exhibited a lower
score for loin meat tenderness compared with high birth weight pigs. These results
also indicated that the birth weight effect on meat tenderness could be partly
attributed to the myofiber hypertrophy, because tenderness score was negatively
correlated (r= -0.34) with myofiber size of the longissimus muscle. However, other
could only partly confirm the negative relationship between birth weight and
carcass and meat quality traits (Brard et al., 2008; Pardo et al., 2013a; Smit et al.,
2013). Again, others did not observe any impact on performance and quality traits
(Beaulieu et al., 2010). The discrepancy between results of different studies
regarding the impact of birth weight can be explained by the fact that different
ranges of birth weights were studied (Table 1).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 125

Table 1. Impact of birth weight range and litter size on differences in growth performance,
carcass, and meat quality traits
Birth weight range Litter size Effects1 Study
(kg) (pigs born alive)
1.27 vs. 1.76 kg not specified pre-weaning growth Bee (2004)
adipose tissue yield
0.94 vs. 1.34 kg not specified growth performance Rehfeldt and Kuhn
(2006)
carcass quality
water holding capacity
1.05 vs. 1.89 kg not specified growth performance Gondret et al.(2006)
carcass quality
meat tenderness
1.23 vs. 1.90 kg 14 growth performance Brard et al.(2008)
1.60 vs. 2.02 kg 10 = carcass characteristics
= meat quality
1.26 vs. 1.49 kg > 10 and < 15 2
pre-weaning growth Pardo et al.(2013a)
1.40 vs. 1.79 kg > 10 and < 15 3
feed efficiency
belly
< 1.20 vs. > 1.70 kg not specified growth performance Beaulieu et al. (2010)
= carcass characteristics
intramuscular fat content
1.12 vs. 1.79 kg >9 and < 16 growth performance Smit et al. (2013)
1
Effects on growth performance, carcass characteristics and meat quality are reported against
the high birth weight category = no effect; increased; impaired
2
average litter birth weight of this experimental group was < 1.3 kg
3
average litter birth weight of this experimental group was > 1.7 kg

Except for the study of Brard et al. (2008) and Pardo et al. (2013a), where
the litter size from which the pigs were selected from was reported, this
information is lacking or not clearly mentioned in the other studies. That litter size
may have an impact on the effect of birth weight on growth, carcass characteristics
and meat quality was recently suggested by Brard et al. (2010a). The authors
reported that the superiority of pigs born with a high compared to a low birth
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
126 October 11-13, 2017

weight regarding carcass and meat quality were less evident when pigs originate
from large litters.

SOW REPRODUCTION AND PHENOTYPIC TRAITS OF OFFSPRING AS AFFECTED

BY THE FEEDING STRATEGY DURING GESTATION

Commonly, gestating sows have access to a restricted diet. The daily

energy requirements vary between 30.5 and 42.2 MJ DE for multiparous sows and
between 25.6 and 36.3 MJ DE for gilts, respectively (Agroscope, 2015), depending
on the gestation period, that can be divided into an early (d 1-28), middle (d 29-84)
and late (d 85-115) gestation period. The greater energy allowance in late gestation
targets the exponential fetal growth and development of the mammary gland
(Noblet et al., 1990; Dourmad et al., 2008). As fetal growth is largely affected by
the nutrients fed to gestating sows, ideally, nutrient allowance should also take into
account the number of fetuses in the uterus, which as previously mentioned,
increased in the last decades. To our knowledge, nowadays in gestating sows the
correct prediction of the litter size is not possible, which limits the possibility to
feed the fetuses adequately. Nevertheless, various dietary approaches were made to
positively affect fetal development, piglet vitality, birth weight and litter size.

IMPACT OF DAILY FEED ALLOWANCE IN DIFFERENT GESTATION PERIODS

Several authors investigated the effects of increasing the feed allowance of
sows during gestation on sow reproduction, phenotypic traits of the offspring at
birth and their postnatal performance (e.g. Dwyer et al., 1994; Nissen et al., 2003;
Bee, 2004; Heyer et al., 2004; Musser et al., 2004; Nissen et al., 2005; Lawlor et
al., 2007; Cerisuelo et al., 2009). In all those studies, where the quantity of
provided nutrients and the treatment window during gestation varied, the effect on
sows reproductive performance and litter birth weight were negligible. However,
Dwyer et al. (1994) reported that by doubling feed allowance (5 vs 2.5 kg) from
25-80 d of gestation hyperplasia of secondary myofibers tended to increase
(expressed as secondary-to-primary myofiber ratio) in the semitendinosus muscle
of these offspring and in the grower period they grew faster and were more feed
efficient. Musser et al. (2004) observed marked changes in fetal compartment
when ad libitum feed was provided to sows during an important period of fetal
myogenesis (d 28 to 56 of gestation). The elevated fetal IGF-I level could have
been partly mediated effects of maternal feed intake on the aforementioned fetal
myogenesis (Oksbjerg et al., 2004). By contrast, limited or no impact on myofiber
formation and postnatal growth were reported when compared to the control diet
the amount of feed offered to gestating sows was increased by up to +100% in the
treatment window varying from 0 to 85 d (Nissen et al., 2003; Bee, 2004; Lawlor
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 127

et al., 2007; Cerisuelo et al., 2009). Negative long-term effects on the performance
of their offspring were reported by Heyer et al. (2004) when sows feed intake was
increased by up to 100% compared to the control. Based on the low performance in
the suckling period, Heyer et al. (2004) hypothesized that mammary gland
development and therefore milk synthesis was impaired by the elevated feed
allowance during gestation. In line with this hypothesis, Dourmad (1991) reported
that increased feed intake throughout gestation negatively affected feed intake
during lactation and concomitantly colostrum and/or mature milk synthesis
(Decaluw et al., 2014). However, Nissen et al. (2003) did not observe any
relationship between feed intake in the gestation and lactation period as well as
with mature milk yield. Taken together, the results of the various studies do not
indicate that increasing feed intake in the first half of gestation affects reproduction
or phenotypic traits of the offspring.

IMPACT OF SPECIFIC SUPPLEMENTS IN THE GESTATION DIET

DIETARY FAT AND FATTY ACID COMPOSITION
Instead of increasing the amount of feed, one can specifically increase the
dietary energy density by adding additional fat. In addition this strategy has the
advantage of having a low heat increment associated with digestion and
metabolism (Kleiber, 1961). Under certain environmental conditions such as heat
stress and when average daily energy intake needs to be increased the lower heat
increment might be of relevance. The main and most consistent effect of feeding
additional fat during gestation is the increase in milk yield and depending on the fat
source the modulation of the fatty acid profile (Farmer and Quesnel, 2009;
Quesnel et al., 2015). With respect to litter size and birth weight of the piglets,
increasing the dietary energy content by adding fat to the gestation diet seems not
to have any note worthy positive effects. Conversely, at the molecular level
Fainberg et al. (2014) found that greater fat supply during gestation accelerates the
muscle maturation of offspring, reflected in increased glycolytic metabolism and
fibre cross sectional area in the biceps femoris muscle. Apart from the role as an
energy source, the fatty acid composition of the dietary fat, especially the
proportion of essential n-6 and n-3 polyunsaturated fatty acids (PUFA) attracted a
great deal of interest on their possible effect on sow reproduction and foetal
development. The reason for this increased awareness is the primordial role PUFA
have on structural functions in the phospholipid bilayer of cell membranes, which
ultimately affect membrane fluidity and intracellular signal transduction. Gerfault
et al. (1999) found that whatever their chain length or their degree of un saturation,
dietary fatty acids cross the placental barrier in the pig. Thus, attempts have been
undertaken to use various sources of fats differing in their amounts of PUFA to
affect litter size, birth weight and vitality of newborn pigs. As reviewed by Tanghe
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
128 October 11-13, 2017

and De Smet (2013) and Quesnel et al. (2015) little evidence exist that feeding
PUFA enriched diets increase litter size and litter weight. Rooke et al. (2001b)
even reported that feeding salmon oil, a long chain n-3 rich fat source, to sows
throughout pregnancy significantly decreased individual piglet birth weight.
However, in the same study despite having no impact on litter size, pre-weaning
mortality of offspring born from sows fed the salmon oil fortified gestation diet
was reduced. Regarding number of total and live born piglets, Corson et al. (2008)
found that a gestation diet enriched with n-6 PUFA fat (soy oil) offered in the first
half of pregnancy compared with a gestation diet containing medium-chain fatty
acids (palm oil) resulted in smaller and lighter litters at birth. The authors
hypothesized that the fatty acids present in palm oil are more easily combusted,
thus providing a readily available source of energy. In contrast, the diets
supplemented with soy oil, tend to promote pro-inflammatory responses, which can
have deleterious effects on foetal survival especially when offered in the first half
of gestation. The authors could make this latter statement because when applying
the same feeding strategy in the second half of gestation, the negative effect on
litter weight was not observed.
Long chain n-3 fatty acid, especially docosa hexaenoic acid, can be found
in high concentrations in the brain and is thought to act at the level of nerve
growth, synaptogenesis and to be involved in interactive processes between nerve
cells and cell signal transduction (Innis, 2007). Since dietary fatty acid cross the
placental barrier and during lactation affect the fatty acid composition of sow milk,
the latter being the sole dietary source of the new born piglet, it was hypothesized
that cognitive development and as a consequence behaviour of the new born piglet
could be modulated by dietary means. Promising results were reported by Rooke et
al. (2001a) who observed increased piglet vigour at birth when originating from
sows receiving in the last third of gestation a tuna oil fortified compared to a soy
oil supplemented diet. The greater vitality allowed them to reach the udder and
suckle more quickly. However, the same authors reported in an earlier study that
despite the proportions of long-chain n-3 fatty acid in tissues of new-born piglets
were increased by feeding tuna oil, various vitality indicators such as heart rate at
birth, onset of respiration and standing time were not improved (Rooke et al.,
1998). The reasons for these differences are unknown but may explain that the
effects of n-3 PUFA supplemented gestation diets on pre- and post-weaning
growth of the offspring are inconsistent and no clear evidence exits to support the
fact that increased piglet vitality will positively affect postnatal growth. It is
noteworthy to mention that many of the studies cited in various reviews were
carried over a decade ago (Tanghe and De Smet, 2013; De Vos et al., 2014;
Quesnel et al., 2015). Because litter size increased dramatically over this time span
and concomitantly the portion of less vital/underprivileged newborn piglets per
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 129

litter increased, additional research on this important topic is warranted. Future

research should focus on crucial factors, which affect the development of the
growing foetus and, postnatally, impact growth performance such as type, timing
and dietary oil source (De Vos et al., 2014).

DIETARY PROTEIN INTAKE

Availability, amount and quality of dietary protein play a key role for the
developing embryo and foetus (Metges and Hammon, 2005). For instance, a
50%lower dietary protein supply (compared with requirement; 121 g/kg) during
gestation reduced birth weight, impaired myogenesis, persistently restricted muscle
growth potential and reduced the potential of postnatal lean growth of the offspring
(Rehfeldt et al., 2012a). Feeding un physiologically elevated concentrations of
dietary protein retards foetal growth as well but had little effect on foetal
programming of postnatal muscle and adipose tissue phenotype of the progeny
(Rehfeldt et al., 2012b). Surprisingly, either a protein-free diet throughout or during
specific periods of gestation, and increased or decreased protein intake at different
stages of pregnancy affected litter size at birth and the number of piglets born alive
(Pond et al., 1987; Rehfeldt et al., 2011). However, the available data show also
that unbalanced protein intake has consequences on body weight and backfat gain
of the dams during gestation; low and high dietary protein supply significantly
lowered the cumulative body weight gain and lowered the backfat gain,
respectively (Kusina et al., 1999; Rehfeldt et al., 2011). It has been emphasized
that these changes might affect mammary gland development and lactation
performance (Vadmand et al., 2015) and weaning-to-oestrus interval. Kusina et al.
(1999) showed that milk yield and pig weight gain increased as protein intake
moderately increased during gestation and lactation. Not only the yield but also the
composition of the milk seems to be partly affected by the protein intake. Rehfeldt
et al. (2011) reported that colostrum lactose and fat levels tended to be lower when
gestation diet contained either very low or very high protein levels, whereas no
dietary effect was determined in crude protein and immunoglobulin concentrations.

FUNCTIONAL AMINO ACIDS

Based on a growing body of literature a new concept of functionality in
addition to the classical concept of essentiality and non-essentiality with respect to
amino acid requirement has been proposed. Wu (2010) defined functional amino
acids as those amino acids that regulate key metabolic pathways to improve health,
survival, growth, development, lactation, and reproduction of organisms. One of
those amino acids, which with respect to reproduction and early postnatal growth
attracted recently a lot of attention, is L-arginine (Figure 1). This amino acid is the
common precursor for nitric oxide and polyamines, which are key regulators of
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
130 October 11-13, 2017

angiogenesis, embryogenesis, and placental and foetal growth (Wu et al., 2006). As
arginine is particularly abundant in porcine allantoic fluid and is associated with
high rates of synthesis of nitric oxide and polyamines in the placenta during the
first half of pregnancy, the hypothesis was formulated that increasing dietary L-
arginine supply to sows may stimulate placental growth thereby promote conceptus
survival, growth and development of some tissues. Results of various studies
demonstrated that additional dietary supplementation with L-arginine positively
affected the development of progeny (Ramaekers et al., 2006; Mateo et al., 2007;
Wu et al., 2010; Li et al., 2014). Interesting was the study of Ramaekers et al.
(2006) who showed that when sows were offered a diet supplemented with 25 g/d
of L-arginine between d 14 to 28 of gestation litter size increased by 0.8 extra
piglet/litter without any increase in within-litter birth weight variation. The positive
impact of L-arginine supplementation during the peri-implantation period of
gestation is due to the nitric oxide synthase-3 dependent production of nitric
oxideby the conceptus trophectoderm and consequently the availability of arginine
in conceptus tissues for synthesis of polyamines that are essential for conceptus
survival and development (Wang et al., 2014). Mateo et al. (2007) and Wu et
al.(2010) found increased number of live-born piglets and total litter weight by up
to 23 and 28%, respectively, when gilts were offered a 1 or 0.83% L-arginine
supplemented diet also from d 30 (post-implantation) until parturition. One
possible reason for this outcome is the enhanced placental angiogenesis through
the arginine-nitric oxide pathway (Hazeleger et al., 2007) resulting in greater
vascularization, which is a prerequisite for an efficientplacental transport of O 2 and
nutrients from mother to embryo/foetus (Figure 1).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 131

Figure 1. Roles of arginine, nitric oxide (NO), and polyamines in foetal growth
Both maternal under- and over-nutrition may impair placental synthesis of NO and polyamines, and
therefore placental development and uteroplacental blood flows. This may result in reduced transfer
of nutrients and O2 from mother to foetus, and thus restrict foetal growth. The ornithine used for
polyamine synthesis is derived from proline catabolism via proline oxidase in porcine placental and
other tissues as well as from arginine hydrolysis via arginase in a variety of porcine tissues, including
the small intestine, liver, and kidneys. Glutamine is a common substrate for the synthesis of both
citrulline and proline in pigs [published in Wu et al. (2006)]
Arg = arginine; AS-AL= argininosuccinate synthase and argininosuccinatelyase; BH4 = tetra-
hydrobiopterin; Cit = citrulline; Gln = glutamine; mTOR = mammalian target of rapamycin; GTP-CH
= GTPcyclohydrolase-I; ODC = ornithine decarboxylase; NOS = nitric oxide synthase; Orn =
ornithine; PO-OAT = proline oxidase and ornithine aminotransferase; and SAM = S-
adenosylmethionine.

The suggested greater foetal nutrient supply may further explain

hyperplasia of primary myofibers in the semitendinosus muscle of 75 d old foetuses
(Brard and Bee, 2010). Madsen et al. (2016b) showed that the myofiber
hyperplasia in the semitendinosus muscle of offspring of prolific sows fed an L-
arginine fortified gestation diet around the peri-implantation period was greater
compared to control sows. The greater number of formed myofibers resulted
primarily from the greater number of secondary myofibers formed in the second
wave of myofiber ontogenesis. Dietary supplementation with L-arginine may also
benefit piglets, irrespective of the L-arginine given to the lactation sow (Mateo et
al., 2008) or directly to the piglet (Kim et al., 2004; Yao et al., 2008). Mateo et al.
(2008) found that on d 7 of lactation milk yield and the concentrations of most
amino acids in milk were greater in response to arginine supplementation during
lactation compared with the control. This increase could result from a positive
effect of L-arginine on vascularity, enhanced blood flow and, therefore, the uptake
of nutrients by the lactating mammary gland (Rezaei et al., 2016). In addition,
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
132 October 11-13, 2017

weight gain from birth to 21 d of age of these piglets was also greater. The study of
Kim et al. (2004) and Yao et al. (2008) reported that artificially reared piglets fed a
milk replacer supplemented with 0.4% L-arginine had greater plasma
concentrations of insulin and growth hormone as well as protein synthesis, which
may explain the faster growth from d 7 to 21 of age. Madsen et al. (2016a) could
not confirm faster growth when L-arginine was add to the milk replacer of low
birth weight pigs to cover at least the requirement of 1.08 gkg body weight-1d-1.
However, the greater lactate dehydrogenase to citrate synthase and -hydroxyacyl-
CoA dehydrogenase ratio indicated that the relative importance of the glycolytic
compared with the oxidative pathway in the the semitendinosus musclewas greater
in these piglets compared to those of the control group. The greater glycolytic
potential can be interpreted as greater muscle maturity.
Recent advances in research revealed that L-glutamine, a member of the
arginine family of amino acids, is an abundant amino acid in physiological fluids
and proteins, is utilized in multiple metabolic pathways (Figure 2) and has many
regulatory functions (Figure 3). In recent years, glutamine has gained some interest
in pregnancy as it is an abundant amino acid in fetal tissue proteins and a major
energy substrate for the fetus (Wu, 2010). Therefore, on can conclude that L-
glutamine plays a key role in many metabolic processes such as cell proliferation,
differentiation, and embryonic development (Wu et al., 2011). The importance of
glutamine for placental and fetal growth was deduced from the observation that
among all amino acids, uterine and umbilical uptake of glutamine was the greatest
(Wu et al., 2015).To control energy intake of gestating sows, restricted feed
allowance is a common management practice. Such a restricted feeding program
limits maternal protein intake, resulting in protein deficiency, particularly during
late gestation when absolute fetal growth is most rapid (Noblet et al., 1985). In
pigs, 60% of fetal growth occurs from d 90to 114 of gestation, which is a
development stage where fetal glutamine requirement is increasingly elevated. In
agreement, Wu et al. (2011) reported markedly lower concentrations of plasma
glutamine in gilts at d 110 than at 10 d of gestation (0.30 0.02 and 0.52 0.04
mM; means SEM). The same authors hypothesized that glutamine deficiency
may partly contribute to low birth weight pigs due to intra-uterine growth
retardation. In support of this hypothesis, Wu et al. (2011) found that feeding gilts
between d 90 and 114 of gestation a gestation diet fortified with 1% glutamine
significantly increased maternal plasma level of glutamine (486 vs 354 M),
arginine (194 vs 176 M), ornithine (82 vs 73 M) and proline (277 vs 240 M),
the average birth weight (1.41 vs 1.33 kg) and litter birth weight of live-born
piglets (14.7 vs 13.7 kg). Concomitantly, the percentage of low birth weight pigs
(< 1.1 kg; 15.2 vs 24.8%), the variation in birth weight (11.0 vs 16.4%), and pre-
weaning mortality of live-born piglets (6.1 vs 11.3%) decreased when compared
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 133

Figure 2. Multiple metabolic pathways for Figure 3. Regulatory functions of L-glutamine

L-glutamine (Gln) utilization in animals (Gln) in animals.
Synthesis of ornithine (Orn), citrulline (Cit), and Gln can regulate multiple physiological processes in
arginine (Arg) from Gln occurs exclusively in the diverse cell types, including gene expression, cell
small intestine. Other metabolites of Gln include signalling, and protein turnover. These effects of
pyruvate, urea, and possibly glycin. The asterisk Gln are cell and tissue specific, indicating that
indicates that the reaction cannot be replaced by interorgan cooperation is necessary for Gln to exert
any other amino acid incells [published in Wu et its beneficial actions on the whole body. [published
al. (2011)]. in Wu et al. (2011)]
Lact = lactate mTOR = mammalian target of rapamycin

with the isonitrogenous control. These results seem promising although it has to be
taken into account that only gilts were used and the number of total born and born
alive per litter were with 11.5 and 10.3, respectively, rather low.
It would be interesting to assess if this strategy would be as successful
when prolific gilts and sows would be included.
In addition to the aforementioned amino acids, there is emerging evidence
of the functional importance of branched-chain amino acids (leucine, isoleucine,
and valine) throughout pregnancy. Their relevance are linked to the fact that these
amino acids are substrates for the synthesis of glutamate, the immediate precursor
of L-glutamine, and of arginine, which is important for the synthesis of citrulline,
ornithine and proline (Rezaei et al., 2013). Furthermore, branched-chain amino
acids activate the mammalian target of rapamycin signaling pathway and protein
synthesis and concomitantly decrease proteolysisand by that positively affect
muscle growth (Davis et al., 2010). Placental transport and fetal utilizationof
branched-chain amino acidsis drastically reduced (Lin et al., 2014) whereas
fractional rates of protein synthesis and its response to feeding are unaffected by
intra-uterine growth restriction in newborn pigs (Davis et al., 1997).Thus, there
seems to be a possibility of accelerating lean mass growth in these fetuses through
dietary intervention. Unpublished data from Yuan et al. (2015) suggest that this
hypothesis could be valid because feeding gestating sows a branched-chain amino
acid supplemented diet increased litter size, weights of piglets as well as of the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
134 October 11-13, 2017

placentas. In line with these finding, traits relevant for survival and growth of the
concept us such as embryonic hepatic IGF-I level, estrogen receptor- and
progesterone receptor in the uterus, and IGF-II level in the placenta and expression
of key enzymes involved in gluconeogenesis in embryonic livers were increased.

IMPACT OF L-CARNITINE IN SOW PRODUCTION

L-Carnitine is an important compound in mammals because itserves as an
essential cofactor for mitochondrial fatty acid oxidation by transferring medium-
and long-chain fatty acids as acyl-carnitine esters across the innermitochondrial
membrane. Moreover, carnitine shuttles acylmoieties out of peroxisomes in the
liver. It also regulates theintra-mitochondrial acyl-CoA/CoA ratio and acts as a
CoA buffer in mammalian cell. Increased protein accretion and reduced backfat
thickness with greater rates of palmitate oxidation, more rapid fluxthrough
pyruvate carboxylase, and reduced fluxthrough branched-chain -keto acid
dehydrogenase suggests that growing pigs fed L-carnitine are more able to use fat
for energy, divert carbon toward synthesis of amino acids, and spare branched-
chain amino acids for protein synthesis (Owen et al., 2001).Various authors tested
whether these changes in metabolism induced by L-carnitine would be beneficial
for sow reproduction and for fetal development and growth. Supplementing the
gestation diet with L-carnitine (100 mg/d) increased the number of viable fetuses
(15.5 vs 10.8) and tended to increase their total weight (1450vs 989 g) but not the
individual fetal weight at d 57 of gestation compared with controls (Waylan et al.,
2005). When L-carnitine (125 mg/d) was fed for the whole gestation period,
Ramanau et al. (2004) observed that L-carnitine-treated primiparous and second
parity sows gave birth to larger (parity 1 and 2: 12.9 vs 10.2 and 13.5 vs 10.8,
respectively) and heavier litters(parity 1 and 2: 16.8 vs 14.2 kg and 19.6 vs 17.3 kg,
respectively) compared with control [Link] positive effect of L-carnitine (100
mg/d) on litter size was not confirmed in the study of Musser et al. (1999).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 135

However, in the same study they observed increased total litter (15.5 vs
14.6 kg) and pig (1.53 vs 1.49 kg) birth weight. These findings concur with results
of other studies where litter weight and pig weight increased by 1.0 to 2.6 kg and
70 to 110 g, respectively (Eder et al., 2001; Ramanau et al., 2002; Musser et al.,
2007; Ramanau et al., 2008).In addition, several studies concurred that L-carnitine
supplementation of sows during pregnancy reduces the number of stillborn (from
0.76 to 0.49 per litter in Musser et al., 1999; from 0.97 to 0.68 per litter in
Ramanau et al., 2008) and very low birth weight piglets (< 800 g: 0.9 vs 0.4%;
Eder et al., 2001). As reviewed by biochemical mechanisms underlying the
favorable effect of L-carnitine on intra-uterine growth have not been fully
elucidated. However, there is some evidence that L-carnitine influences the IGF-
axis in sows and leads to greater placentae, which in turn improves intra-uterine
nutrition, and stimulates oxidation of glucose in the fetuses (Figure 4). These
effects may, at least in part, be responsible for the aforementioned heavier litters.
IGF-1 is a key hormone forintra-uterine fetal development and promotes muscle
development (Oksbjerg et al., 2004). Data of Waylan et al. (2005) suggest that L-
carnitine induced changes in the IGF-axis decreased IGF-II, IGFBP-3, and
myogenin mRNA levels in porcine embryonic myoblasts and delayed their
differentiation to existing myofibers and prolonged their proliferation. Ultimately,
this could give riseto increased myofiber numbers at birth due to increased number

Figure 4. Proposed mechanism by which L-carnitine supplementation of sows increases birth

weights of their offspring.
Carnitine supplementation of sows improves the development of the placenta and increases glucose
transport protein (GLUT-1) concentration in the chorion, likely due to increased maternal plasma
insulin-like growth factor (IGF)-1 and IGF-2 concentrations. This leads to an increased transfer of
glucose from maternal to fetal blood. Carnitine moreover stimulates oxidation of glucose in fetal
cells, which enhances the efficiency of energy production. This effect is based on the ability of
carnitine to shuttle acetyl groups out of the mitochondrion as acetylcarnitine (formed by the action
of carnitine acetyl transferase (CAT)), resulting in a reduction in the acetyl-CoA:CoA ratio, which
in turn activates pyruvate dehydrogenase (PDH).[published in Eder (2009])
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
136 October 11-13, 2017

of embryonic myoblasts. In accordance, Musser et al. (2007) reported that piglets

of L-carnitine-supplemented sows had a greater number of primary myofibers in
the semitendinosus muscle than piglets of control sows. Surprisingly, in the second
wave of myofiber formation the number of secondary myofibers was not increased
as the secondary: primary myofiber ratio was lower.

Conclusion and outlook

It is a fact that due to targeted selection for reproduction performance and
despite rather low heritability, sow prolificacy markedly increased in the last
decade. When expressed per kg of gestation feed more piglets are born, which at
first sight might suggest that sow production efficiency increased. However, with
increasing litter size it is evident that the number of underprivileged low birth
weight pigs increases as well. This sub-population of offspring are known to be
less vital and more prone to perish within the first days and weeks of life. From a
production point of view, this circumstance decreases reproduction efficiency but
also causes some ethical challenges. Furthermore, there is enough evidence that
low birth weight pigs will not express their innate genetic potential for growth,
carcass and meat quality to the same extent as their heavier littermates, which
ultimately will further decrease the overall production efficiency. One of the main
causes for low birth weight is the impaired uterine environment, which affect fetal
nutrient supply and result in intra-uterine growth retardation. As presented in this
review, various promising feeding strategies that target the uterine environment
and fetal nutrient supply have been proposed. One main issue is that the published
experiments were not carried out with prolific or hyper prolific sows and therefore
it isnt clear to what extent the proposed strategies are effective. Furthermore, often
only primiparous and not multiparous sows were used and only the impact of a
given feeding strategy was studied in one parity. Thus, future studies should be
designed, which specifically accounts for these facts.
The author believes that in the future one should aim at improving the
quality (reduced heterogeneity) of the offspring rather than increase their
number. We have evidence that for instance in the current Swiss Large White sow
population there are prolific sows (> 15 pigs born alive), which are repeatedly able
to give birth to large very homogenous litters, with almost none of the offspring
displaying a birth weight <1.3kg. Thus, it appears that in the sow population the
genetic potential exists to obtain large litters and concomitantly circumvent the
problem of underprivileged low birth weight pigs. This potential should be
considered in future selection programs. Nevertheless, feeding hyperprolific sows
will remain a great challenge in swine production. As previously mentioned in this
review various feeding strategies have been proposed. In the authors opinion,
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 137

future studies should target at improving fetal nutrient supply and thus fetal
development in the post-implantation periods of gestation by combining the current
knowledge on the effects of n-3 fatty acids, functional amino acids and L-carnitine.
To exploit the full genetic potential of all littermates these kind of studies are
necessary because it seems unlikely that postnatal feeding strategies exits which
are effective in overcoming the effects of low birth weight.
What was not discussed in this review is the fact that besides optimizing
intrauterine environment, both feeding and management strategies should also
focus on increasing the survival chance and improve the early postnatal growth
performance of underprivileged pigs. In this context, future research efforts should
focus on colostrum, transient milk and mature milk production (yield and
composition) and intake. In addition, from our study in the ECO-FCE project it is
evident that future scientific work is required to improve the nutritional quality of
milk replacer (offered either in the farrowing pen or in rescue decks) in order to
boost piglet growth and ultimately efficiency.

Uticaj gestacionih strategija na reprodukciju i masu prasadi

na roenju

Giuseppe Bee
Rezime
Veliki izazov za proizvoae svinja, danas, predstavlja sve vei broj
prasadi niskih telesnih masa na roenju, koja potiu od hiperprolifinih krmaa, i
koja, kao nerazvijena pate od poveanog morbiditeta i smrtnosti pre odbijanja,
prvenstveno zbog slabog razvoja u uterusu. Poto se postnatalni rast miia i
konano ukupan rast ne odreuje samo postnatalnom hipertrofijom (poveanjem
veliine miofibera) ve i biprenatalnom hiperplazijom (poveanjem broja
miofibera), pozitivna veza izmeu mase na roenju i broja miofibera, kao i broja
miofibera i brzine porasta, mesa i kvaliteta trupa je veoma relevantna. Prema tome,
nutritivne strategije u toku gestacije bi trebalo da se usredsrede na poboljanje
razvoja miia embriona i fetusa sa krajnjim ciljem da se minimizira broj prasadi
sa niskim telesnim masama na roenju. Prvi deo preglednog rada e se fokusirati
na miogenezu i njen znaaj za postnatalne performanse porasta, karakteristike
trupa i kvalitet svinjskog mesa. Pored toga, bie diskutovano o nedoslednosti u
izvetavanim rezultatima u pogledu niske teine pri roenju, postnatalnog rasta i
kvaliteta trupova i svinjskog mesa. Zavrni deo preglednog rada e pokazati
poznate prehrambene pristupe za optimizaciju intrauterinog okruenja pomou
dopuna hrane za svinje tokom gestacije sa specifinim sastojcima. U zakljuku e
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
138 October 11-13, 2017

biti predloeni neki budui istraivaki pristupi u cilju daljeg popunjavanja

nedostatka znanja u pogledu prenatalnog razvoja.

Kljune rei:

References
AGROSCOPE (2015): Ftterungsempfehlungen und Nhrwerttabellen fr
Schweine. Lehrmittel Zentrale, Zollikofen, Switzerland.
BEAULIEU A.D., AALHUS J.L., WILLIAMS N.H., PATIENCE J.F. (2010):
Impact of piglet birth weight, birth order, and litter size on subsequent growth
performance, carcass quality, muscle composition, and eating quality of pork.
Journal of Animal Science 88, 2767-2778.
BEE G. (2004): Effect of early gestation feeding, birth weight, and gender of
progeny on muscle fiber characteristics of pigs at slaughter. Journal of Animal
Science 82, 826-836.
BRARD J., BEE G. (2010): Effects of dietary L-arginine supplementation to gilts
during early gestation on foetal survival, growth and myofiber formation. Animal
4, 1680-1687.
BRARD J., KREUZER M., BEE G. (2008): Effect of litter size and birth weight
on growth, carcass and pork quality, and their relationship to postmortem
proteolysis. Journal of Animal Science 86, 2357-2368.
BRARD J., KREUZER M., BEE G. (2010a): In large litters birth weight and
gender is decisive for growth performance but less for carcass and pork quality
traits. Meat Science 86, 845-851.
BRARD J., PARDO C.E., BETHAZ S., KREUZER M., BEE G. (2010b): Intra-
uterine crowding decreases average birth weight and affects muscle fiber
hyperplasia in piglets. Journal of Animal Science 88, 3242-3250.
BRARD J., KALBE C., LSEL D., TUCHSCHERER A., REHFELDT C.
(2011): Potential sources of early-postnatal increase in myofibre number in pig
skeletal muscle. Histochemistry and Cell Biology 136, 217-225.
CERISUELO A., BAUCELLS M.D., GASA J., COMA J., CARRION D.,
CHAPINAL N., SALA R. (2009): Increased sow nutrition during midgestation
affects muscle fiber development and meat quality, with no consequences on
growth performance. Journal of Animal Science 87, 729-739.
CORSON A.M., LAWS J., LITTEN J.C., DODDS P.F., LEAN I.J., CLARKE L.
(2008): Effect of dietary supplementation of different oils during the first or second
half of pregnancy on the glucose tolerance of the sow. Animal 2, 1045-1054.
DAVIS T.A., FIOROTTO M.L., BURRIN D.G., POND W.G., NGUYEN H.V.
(1997): Intrauterine growth restriction does not alter response of protein synthesis
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 139

to feeding in newborn pigs. American Journal of Physiology - Endocrinology and

Metabolism 272, E877-E884.
DAVIS T.A., SURYAWAN A., ORELLANA R.A., FIOROTTO M.L., BURRIN
D.G. (2010): Amino acids and insulin are regulators of muscle protein synthesis in
neonatal pigs. Animal 4, 1790-1796.
DE VOS M., CHE L., HUYGELEN V., WILLEMEN S., MICHIELS J., VAN
CRUCHTEN S., VAN GINNEKEN C. (2014): Nutritional interventions to prevent
and rear low-birthweight piglets. Journal of Animal Physiology and Animal
Nutrition 98, 609-619.
DECALUW R., MAES D., COOLS A., WUYTS B., DE SMET S., MARESCAU
B., DE DEYN P.P., JANSSENS G.P.J. (2014): Effect of peripartal feeding strategy
on colostrum yield and composition in sows. Journal of Animal Science 92, 3557-
3567.
DOURMAD J-Y., ETIENNE M., VALANCOGNE A., DUBOIS S., VAN
MILGEN J., NOBLET J. (2008): InraPorc: A model and decision support tool for
the nutrition of sows. Animal Feed Science and Technology 143, 372-386.
DOURMAD J.Y. (1991): Effect of feeding level in the gilt during pregnancy on
voluntary feed-intake during lactation and changes in body-composition during
gestation and lactation. Livestock Production Science 27, 309-319.
DWYER C.M., STICKLAND N.C., FLETCHER J.M. (1994): The influence of
maternal nutrition on muscle fiber number development in the porcine fetus and on
subsequent postnatal growth. Journal of Animal Science 72, 911-817.
EDER K. (2009): Influence of l-carnitine on metabolism and performance of sows.
Br J Nutr 102, 645-654.
EDER K., RAMANAU A., KLUGE H. (2001): Effect of Lcarnitine
supplementation on performance parameters in gilts and sows. Journal of Animal
Physiology and Animal Nutrition 85, 73-80.
FAINBERG H.P., ALMOND K.L., LI D., RAUCH C., BIKKER P., SYMONDS
M.E., MOSTYN A. (2014): Impact of maternal dietary fat supplementation during
gestation upon skeletal muscle in neonatal pigs. BMC Physiology 14, 1-12.
FARMER C., QUESNEL H. (2009): Nutritional, hormonal, and environmental
effects on colostrum in sows. Journal of Animal Science 87, 56-65.
FOXCROFT G.R., BEE G., DIXON W., HAHN M., HARDING J., PATTERSON
J., PUTMAN T., SARMENTO S., SMIT M., TSE W-Y., TOWN S.C. (2007):
Consequences of selection for litter size on piglet development. In Paradigms in
Pig Science (eds. J Wiseman, MA Varley, S McOrist and B Kemp), pp. 207-229,
Nottingham Univ. Press, Nottingham, UK.
GERFAULT V., MOUROT J., ETIENNE M., MOUNIER A. (1999): Influence de
la nature des lipides dans le rgime de gestation de la truie sur ses performances et
la composition corporelle des porcelets la naissance. In pp. 191-197.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
140 October 11-13, 2017

GONDRET F., LEFAUCHEUR L., JUIN H., LOUVEAU I., LEBRET B. (2006):
Low birth weight is associated with enlarged muscle fiber area and impaired meat
tenderness of the longissimus muscle in pigs. Journal of Animal Science 84, 93-
103.
GONDRET F., LEFAUCHEUR L., LOUVEAU I., LEBRET B., PICHODO X.,
LE COZLER Y. (2005): Influence of piglet birth weight on postnatal growth
performance, tissue lipogenic capacity and muscle histological traits at market
weight. Livestock Production Science 93, 137-146.
HAZELEGER W., RAMEAKERS P., SMITS C., KEMP B. (2007): Influence of
nutritional factors on placental growth and piglet imprinting. In Paradigms in Pig
Science (eds. J Wiseman, MA Varley, S McOrist and B Kemp), pp. 309-327.
HEYER A., ANDERSSON H.K., LINDBERG J.E., LUNDSTRM K. (2004):
Effect of extra maternal feed supply in early gestation on sow and piglet
performance and production and meat quality of growing/finishing pigs. Acta
Agriculturae Scandinavica, Section A Animal Science 54, 44-55.
IFIP-GTTT (2015): Gestion technique des troupeaux de truies. In gestion technique
des troupeaux de truies (Ed. IFIP).
INNIS SM (2007): Dietary (n-3) fatty acids and brain development. Journal of
Nutrition 137, 855-859.
JOURQUIN J., MORALES J., BOKENKROGER C.D. (2016): Impact of piglet
birth weight increase on survivability and days to market, a simulation model. In
Journal of Animal Science, pp. 34-34. Des moines.
KIM S.W., MCPHERSON R.L., WU G. (2004): Dietary arginine supplementation
enhances the growth of milk-fed young pigs. Journal of Nutrition 134, 625-630.
KLEIBER M. (1961): The fire of life. An introduction to animal energetics. John
Wiley & Sons, Inc., New York: London
KUSINA J., PETTIGREW J.E., SOWER A.F., WHITE M.E., CROOKER B.A.,
HATHAWAY M.R. (1999): Effect of protein intake during gestation and lactation
on the lactational performance of primiparous sows. Journal of Animal Science 77,
931-941.
LAWLOR P.G., LYNCH P.B., O CONNELL M.K., MCNAMARA L., REID P.,
STICKLAND N.C. (2007): The influence of over feeding sows during gestation on
reproductive performance and pig growth to slaughter. Archives Animal Breeding
50, 82-91.
LEFAUCHEUR L., EDOM F., ECOLAN P., BUTLER-BROWNE G.S. (1995):
Pattern of muscle fiber type formation in the pig. Developmental Dynamics 203,
27-41.
LI X.L., BAZER F.W., JOHNSON G.A., BURGHARDT R.C., FRANK J.W., DAI
Z.L., WANG J.J., WU Z.L., SHINZATO I., WU G.Y. (2014): Dietary
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 141

supplementation with L-arginine between days 14 and 25 of gestation enhances

embryonic development and survival in gilts. Amino Acids 46, 375-384.
LIN G., WANG X., WU G., FENG C., ZHOU H., LI D., WANG J. (2014):
Improving amino acid nutrition to prevent intrauterine growth restriction in
mammals. Amino Acids (Vienna) 46, 1605-1623.
LOESEL D., KALBE C., REHFELDT C. (2009): L-Carnitine supplementation
during suckling intensifies the early postnatal skeletal myofiber formation in
piglets of low birth weight. Journal of Animal Science 87, 2216-2226.
LOPEZ J.M.R., PARDO C.E., BEE G. (2010): Hyperplastic muscle growth occurs
from birth to weaning in pigs. Journal of Animal Science 88 (suppl. 2), 364-364.
MADSEN J.G., KREUZER M., BEE G. (2016a): Potential to improve muscle
maturation in low birth weight piglets fed milk replacers supplemented with either
L-arginine or L-carnitine for 21 days. (unpublished).
MADSEN J.G., KREUZER M., BEE G. (2016b): Impact of dietary L-arginine
supply during early gestation on myofiber development in newborn pigs exposed to
intra-uterine crowding. (unpublished).
MATEO R.D., WU G., MOON H.K., CARROLL J.A., KIM S.W. (2008): Effects
of dietary arginine supplementation during gestation and lactation on the
performance of lactating primiparous sows and nursing piglets. Journal of Animal
Science 86, 827-835.
MATEO R.D., WU G., BAZER F.W., PARK J.C., SHINZATO I., KIM S.W.
(2007): Dietary L-arginine supplementation enhances the reproductive
performance of gilts. Journal of Nutrition 137, 652-656.
METGES C.C., HAMMON H. (2005): Nutritional programming: prenatal
nutritional effects on the regulation of growth and metabolism. Journal of Animal
and Feed Sciences 14, 15-30.
MUSSER R., DRITZ S., DAVIS D., TOKACH M., NELSSEN J., GOODBAND
R., OWEN K. (2007): Effects of L-carnitine in the gestating sow diet on fetal
muscle development and carcass characteristics of the offspring. Journal of
Applied Animal Research 31, 105-111.
MUSSER R.E., DAVIS D.L., DRITZ S.S., TOKACH M.D., NELSSEN J.L.,
MINTON J.E., GOODBAND R.D. (2004): Conceptus and maternal responses to
increased feed intake during early gestation in pigs. Journal of Animal Science 82,
3154-3161.
MUSSER R.E., GOODBAND R.D., TOKACH M.D., OWEN K.Q., NELSSEN
J.L., BLUM S.A., DRITZ S.S., CIVIS C.A. (1999): Effects of L-carnitine fed
during gestation and lactation on sow and litter performance. Journal of Animal
Science 77, 3289-3295.
NISSEN P.M., DANIELSEN V.O., JORGENSEN P.F., OKSBJERG N. (2003):
Increased maternal nutrition of sows has no beneficial effects on muscle fiber
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
142 October 11-13, 2017

number or postnatal growth and has no impact on the meat quality of the offspring.
Journal of Animal Science 81, 3018-3027.
NISSEN P.M., SRENSEN I.L., VESTERGAARD M., OKSBJERG N. (2005):
Effects of sow nutrition on maternal and foetal serum growth factors and on foetal
myogenesis. Animal Science 80, 299-306.
NOBLET J., DOURMAD J.Y., ETIENNE M. (1990): Energy utilization in
pregnant and lactating sows: modeling of energy requirements. Journal of Animal
Science 68, 562-572.
NOBLET J., CLOSE W., HEAVENS R., BROWN D. (1985): Studies on the
energy metabolism of the pregnant sow. British Journal of Nutrition 53, 251-265.
OKSBJERG N., GONDRET F., VESTERGAARD M. (2004): Basic principles of
muscle development and growth in meat-producing mammals as affected by the
insulin-like growth factor (IGF) system. Domestic Animal Endocrinology 27, 219-
240.
OWEN K.Q., JIT H., MAXWELL C.V., NELSSEN J.L., GOODBAND R.D.,
TOKACH M.D., TREMBLAY G.C., KOO S.I. (2001): Dietary L-carnitine
suppresses mitochondrial branched-chain keto acid dehydrogenase activity and
enhances protein accretion and carcass characteristics of swine. Journal of Animal
Science 79, 3104-3112.
PARDO C.E., KREUZER M., BEE G. (2013a): Effect of average litter weight in
pigs on growth performance, carcass characteristics and meat quality of the
offspring as depending on birth weight. Animal 7, 1884-1892.
PARDO C.E., BRARD J., KREUZER M., BEE G. (2013b): Intrauterine
crowding in pigs impairs formation and growth of secondary myofibers. Animal 7,
430-438.
PICARD B., LEFAUCHEUR L., BERRI C., DUCLOS M.J. (2002): Muscle fibre
ontogenesis in farm animal species. Reproduction Nutrition Development 42, 415-
431.
POND W.G., YEN J.T., MERSMANN H.J. (1987): Effect of severe dietary
protein, nonprotein calories or feed restriction during gestation on postnatal growth
of progeny in swine. Growth 51, 355-371.
QUESNEL H., GONDRET F., MERLOT E., FARMER C. (2015): Sow influence
on piglet colostrum intake and neonatal survival. Inra Productions Animales 28,
295-304.
QUINIOU N., DAGORN J., GAUDR D. (2002): Variation of piglets' birth
weight and consequences on subsequent performance. Livest. Prod. Sci 78, 63-70.
RAMAEKERS P., KEMP B., VAN DER LENDE T. (2006): Progenos in sows
increases number of piglets born. In Journal of Animal Science, pp. 394-394.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 143

RAMANAU A., KLUGE H., SPILKE J., EDER K. (2002): Reproductive

performance of sows supplemented with dietary L-carnitine over three
reproductive cycles. Archives of Animal Nutrition 56, 287-296.
RAMANAU A., KLUGE H., SPILKE J., EDER K. (2004): Supplementation of
sows with L-carnitine during pregnancy and lactation improves growth of the
piglets during the suckling period through increased milk production. Journal of
Nutrition 134, 86-92.
RAMANAU A., KLUGE H., SPILKE J., EDER K. (2008): Effects of dietary
supplementation of L-carnitine on the reproductive performance of sows in
production stocks. Livestock Science 113, 34-42.
REHFELDT C., KUHN G. (2006): Consequences of birth weight for postnatal
growth performance and carcass quality in pigs as related to myogenesis. Journal
of Animal Science 84, E113-E123.
REHFELDT C., FIEDLER I., DIETL G., ENDER K. (2000): Myogenesis and
postnatal skeletal musle cell growth as influenced by selection. Livest. Prod. Sci
66, 177-188.
REHFELDT C., LEFAUCHEUR L., BLOCK J., STABENOW B., PFUHL R.,
OTTEN W., METGES C.C., KALBE C. (2012a): Limited and excess protein
intake of pregnant gilts differently affects body composition and cellularity of
skeletal muscle and subcutaneous adipose tissue of newborn and weanling piglets.
European Journal of Nutrition 51, 151-165.
REHFELDT C., STABENOW B., PFUHL R., BLOCK J., NUERNBERG G.,
OTTEN W., METGES C.C., KALBE C. (2012b): Effects of limited and excess
protein intakes of pregnant gilts on carcass quality and cellular properties of
skeletal muscle and subcutaneous adipose tissue in fattening pigs. Journal of
Animal Science 90, 184-196.
REHFELDT C., LANG I.S., GORS S., HENNIG U., KALBE C., STABENOW B.,
BRUSSOW K.P., PFUHL R., BELLMANN O., NURNBERG G., OTTEN W.,
METGES C.C. (2011): Limited and excess dietary protein during gestation affects
growth and compositional traits in gilts and impairs offspring fetal growth. Journal
of Animal Science 89, 329-341.
REZAEI R., WU Z., HOU Y., BAZER F.W., WU G. (2016): Amino acids and
mammary gland development: nutritional implications for milk production and
neonatal growth. Journal of Animal Science and Biotechnology 7, 1-22.
REZAEI R., WANG W., WU Z., DAI Z., WANG J., WU G. (2013): Biochemical
and physiological bases for utilization of dietary amino acids by young pigs. J
Anim Sci Biotechnol 4.
ROOKE J.A., BLAND I.M., EDWARDS S.A. (1998): Effect of feeding tuna oil or
soyabean oil as supplements to sows in late pregnancy on piglet tissue composition
and viability. British Journal of Nutrition 80, 273-280.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
144 October 11-13, 2017

ROOKE J.A., SINCLAIR A.G., EDWARDS S.A. (2001a): Feeding tuna oil to the
sow at different times during pregnancy has different effects on piglet long-chain
polyunsaturated fatty acid composition at birth and subsequent growth. British
Journal of Nutrition 86, 21-30.
ROOKE J.A., SINCLAIR A.G., EDWARCS S.A., CORDOBA R., PKIYACH S.,
PENNY P.C., PENNY P., FINCH A.M., HORGAN G.W. (2001b): The effect of
feeding salmon oil to sows throughout pregnancy on pre-weaning mortality of
piglets. Animal Science 73, 489-500.
SMIT M.N., SPENCER J.D., ALMEIDA F.R., PATTERSON J.L., CHIARINI-
GARCIA H., DYCK M.K., FOXCROFT G.R. (2013): Consequences of a low litter
birth weight phenotype for postnatal lean growth performance and neonatal
testicular morphology in the pig. Animal 7, 1681-1689.
SUISAG 2014. 2014 - Zahlen und Projekte. In.
TANGHE S., DE SMET S. (2013): Does sow reproduction and piglet performance
benefit from the addition of n-3 polyunsaturated fatty acids to the maternal diet?
Veterinary Journal 197, 560-569.
THEIL P.K., LAURIDSEN C., QUESNEL H. (2014): Neonatal piglet survival:
impact of sow nutrition around parturition on fetal glycogen deposition and
production and composition of colostrum and transient milk. Animal 8, 1021-1030.
TOWN S.C., PUTMAN C.T., TURCHINSKY N.J., DIXON W.T., FOXCROFT
G.R. (2004): Number of conceptuses in utero affects porcine fetal muscle
development. Reproduction 128, 443-454.
VADMAND C.N., KROGH U., HANSEN C.F., THEIL P.K. (2015): Impact of
sow and litter characteristics on colostrum yield, time for onset of lactation, and
milk yield of sows. Journal of Animal Science 93, 2488-2500.
WANG X., FRANK J.W., XU J., DUNLAP K.A., SATTERFIELD M.C.,
BURGHARDT R.C., ROMERO J.J., HANSEN T.R., WU G., BAZER F.W.
(2014): Functional role of arginine during the peri-implantation period of
pregnancy. II. Consequences of loss of function of nitric oxide synthase NOS3
mRNA in ovine conceptus trophectoderm. Biology of Reproduction 91, 59, 51-10.
WAYLAN A.T., KAYSER J.P., GNAD D.P., HIGGINS J.J., STARKEY J.D.,
SISSOM E.K., WOODWORTH J.C., JOHNSON B.J. (2005): Effects of L-
carnitine on fetal growth and the IGF system in pigs. Journal of Animal Science 83,
1824-1831.
WIGMORE P.M., STICKLAND N.C. (1983): Muscle development in large and
small pig fetuses. Journal of Anatomy 137 (Pt 2), 235-245.
Wu G. (2010): Functional amino acids in growth, reproduction, and health.
Advances in Nutrition: An International Review Journal 1, 31-37.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 145

WU G., BAZER F.W., WALLACE J.M., SPENCER T.E. (2006): Board-invited

review: intrauterine growth retardation: implications for the animal sciences.
Journal of Animal Science 84, 2316-2337.
WU G., BAZER F.W., BURGHARDT R.C., JOHNSON G.A., KIM S.W., LI X.L.,
SATTERFIELD M.C., SPENCER T.E. (2010): Impacts of amino acid nutrition on
pregnancy outcome in pigs: mechanisms and implications for swine production.
Journal of Animal Science 88, E195-204.
WU G., BAZER F.W., JOHNSON G.A., KNABE D.A., BURGHARDT R.C.,
SPENCER T.E., LI X.L., WANG J.J. (2011): TRIENNIAL GROWTH
SYMPOSIUM: Important roles for L-glutamine in swine nutrition and production.
Journal of Animal Science 89, 2017-2030.
WU X., XIE C., ZHANG Y., FAN Z., YIN Y., BLACHIER F. (2015): Glutamate-
glutamine cycle and exchange in the placenta-fetus unit during late pregnancy.
Amino Acids (Vienna) 47, 45-53.
YAO K., YIN Y.L., CHU W., LIU Z., DENG D., LI T., HUANG R., ZHANG J.,
TAN B., WANG W., WU G. (2008): Dietary arginine supplementation increases
mTOR signaling activity in skeletal muscle of neonatal pigs. Journal of Nutrition
138, 867-872.
YUAN T.L., ZHU Y.H., SHI M, LI T.T., LI N., WU G.Y., BAZER F.W., ZANG
J.J., WANG F.L., WANG J.J. (2015): Within-litter variation in birth weight:
impact of nutritional status in the sow. Journal of Zhejiang University-Science B
16, 417-435.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

ALENTEJANO AND BSARO PIGS: TRADITION AND

INNOVATION THE TREASURE PROJECT

Rui Charneca1, Amadeu Freitas1, Jos Martins1, Jos Neves1, Miguel

Elias1, Marta Laranjo2,3, Jos Nunes1
1
Universidade de vora, Escola de Cincias e Tecnologia, Instituto de Cincias Agrrias e
Ambientais Mediterrnicas (ICAAM), apartado 94, 7006-802 vora, Portugal
2
ICAAM, apartado 94, 7006-802 vora, Portugal
3
Instituto de Investigao e Formao Avanada (IIFA), Universidade de vora, apartado 94, 7002-
554 vora, Portugal
Corresponding author: Rui Charneca, rmcc@[Link]
Review paper

Abstract: The Alentejano pig (AL) and the Bsaro pig (BI) are the two
main autochthonous swine breeds of Portugal. Originated from different ancestors
they have a similar history across the last century. One hundred years ago AL was
the most common swine breed in Portugal, but in the second half of the 20th
century both Portuguese pig breeds undertook a strong population decline that
almost lead to their extinction. However, since the late 80s of last century local
breeds were rescued and their populations recovered over the last 30 years.
Breeding recovering led to the protection of pork itself and dry products by
European protections PDOs and PGIs. In the framework of TREASURE project,
a study is in progress aiming to investigate the opportunity of a crossbreeding
program involving both breeds with the goal to obtain new products with potential
commercial interest and to improve the knowledge on the pure breeds and to
protect them against future threats. This paper includes a revision about AL and BI
breeds and presents some preliminary original data from Treasure project study.

Key words: Alentejano, Bsaro, autochthonous pigs, reproduction,

production.

Origin and geographical distribution

The Alentejano pig (AL) and Bsaro pig (BI) are the main local Portuguese
pig breeds. The AL pig belongs to the Mediterranean group (Porter, 1993) and
share the origin from the Sus mediterraneus with nowadays Iberian pig. In the
southern Portugal and Spain, mainly Alentejo, Extremadura and Andaluca regions,
the extensive swine production is historically associated to the use of AL and
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 147

Iberian breeds perfectly adapted to the environment and to the use of natural
resources namely the Quercus forest known as Montado in Portugal and Dehesa in
Spain (Freitas, 2014). The BI pig belongs to the Celtic group (Porter, 1993),
originated from the Celtic wild boar. It presents similar characteristics to the Celta
pig breed (Carolino et al., 2009), being both breeds manly raised in the northern
regions of the Iberian Peninsula (Minho and Trs-os-Montes e Alto Douro in
Portugal and Galicia in Spain).

Production systems
The AL pig is mostly raised under extensive conditions in an integrated
agro-sylvo-pastoral system where the montanheira, the fattening period based on
acorns, from Quercus forest since late October to the end of February is a strategic
element of the production system. The herd size is, presently on average, of 35
sows (ANCPA, data base). Most Bsaro pig were raised in small nucleus, but the
number of sows per farm has increased from 10 sows in 2003 (Alves, 2003) to 30
sows more recently (Santos Silva and Tirapicos Nunes, 2013). The animals, are
reared in intensive outdoor or semi-extensive systems (Santos Silva and Tirapicos
Nunes, 2013).
Traditionally, AL herds were separated in 3 categories: breeding sows,
growing pigs and fattening pigs. Formerly the breeding sows (even when in
lactation) and growing pigs, graze during day and were supplement with cereal
grains or leguminous even seasonal agriculture by-products only when necessary
(Pvoas Janeiro, 1951). Nowadays, in order to improve and to standardize
performance most sows and pigs receive concentrated balanced feeds. The BI pigs
feeding has always been based on the feeds produced at the farms, and nowadays
the pigs diet is a mix of cereals complemented with other farm products (tubers,
horticultural by-products, fruits). Some farmers use commercial complete feeds for
specific phases, as lactation or weaned piglets (ANCSUB, 2017).
In AL farms, now that the old traditional concrete facilities (malhadas)
are almost abandoned, in most cases farrowing occurs in outdoors conditions, in a
camping environment with farrowing huts. In BI breed the farrowing and
lactation were also in man-made facilities (with stone and/or wood) but there is
also a tendency to increase the camping system in the last years (Santos Silva and
Tirapicos Nunes, 2013). Traditionally, the AL piglets are usually weaned with 45-
60 days of age and 10-14 kg of LW (live-weight) (Freitas, 2014). The weaning of
the BI piglets occurs at 40-45 days of age. Traditional consumption of roast piglets
is common. Seventy per cent of the weaned piglets are slaughtered at young age,
weighing 812 kg (Santos Silva and Tirapicos Nunes, 2013).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
148 October 11-13, 2017

The AL piglets born between April and September go to Montanheira

the following year (Santos Silva and Tirapicos Nunes, 2013) while piglets born
during Autumn and Winter season go to other markets (roasted piglets, fresh meat),
either they can be used to replace cull animals in farms or, in many cases they
come from crossbreed AL x Duroc. The slaughter age and weight dependents on
the product/market target. Considering pork market pigs are usually slaughtered
with 8-14 months of age and 90-100kg LW. For protected (IGP) dry-cured
products the average age and weights are 15-24 months and 120-140kg live-
weight, respectively. Finally, for the ham industry both in Portugal and also in
Spain (main destination) the slaughter age and weight vary from 14-18 months and
weights of 140-170kg LW (Freitas, 2014). Typically, Bsaro pig have two growing
phases. The first one of moderate growth until 7075 kg LW and a finishing phase
with variable diets depending on the availability of food resources on each farm
(flour, fruits, vegetables, chestnuts and acorns). During finishing period of Bsaro
pigs, the rate of growth depends on feeding management and availability of
pasture. The animals can be slaughtered from 120 to 180 kg LW, depending on
tradition of each region (Santos Silva and Tirapicos Nunes, 2013).

Historical evolution, demographics and products

Alentejano and Bsaro breeds were the main pig raised in Portugal at the
beginning of the XX. In fact, by the 50s of that century the AL pig represented
about 45% of the total pig population in Portugal (Carvalho, 1964). However, due
to several reasons both breeds suffered a clear decline in their populations that
almost lead to their extinction on the 80s. The reasons were various and most of
them common for both breeds: emigration and migration (to littoral regions)
phenomena, new dietary habits and diet health concepts, sanitary problems (mostly
African swine fever), introduction of exotic lean breeds (sometimes promoted by
state policy) and their crosses with our breeds (Carolino et al., 2009; Freitas,
2014; Tirapicos Nunes, 1998). From that decade onwards, a recovery of both
breeds and their traditional production systems was recorded, enhanced by grants
of several agents with the purpose of saving them. Presently, there were 6559 sows
and 436 boars registered in the Alentejano breed Herd book distributed by 162
breeders (February 2017, ANCPA database). The correspondent values for Bsaro
breed are 5460 females, 520 boars and 189 breeders (March 2017, ANCSUB
records). During last decade of XX Century tree breeders associations were
registered (AL:1990 - ACPA and 1991 ANCPA; BI: 1994 - ANCSUB). Presently
(DGADR, 2017), the AL breed has 27 protected products (4 PDOs and 23 IGPs)
whereas the BI breed (or crosses) has 17 protected products (16 PGIs and 1 PDO).
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 149

Breeds reproductive and productive characteristics

Unlike other European pig breeds, both AL and BI breeds were not
submitted to genetic improvement programs (Gama et al., 2013). Therefore, any
performance improvement is mainly connected to empirical selection made by
farmers and/or some improvement on production management (e.g. nutritional).
The gestation length in BI sows is similar to the recorded in other pig breeds (115
days; Outor-Monteiro et al., 1998), however AL breed presents a shorter gestation
length (111-112d; Nunes, 1993; Charneca et al., 2012).
The AL breed present low prolificacy (7-8 piglets per litter; Marques,
2001; Charneca et al., 2012). The BI breed can be considered a medium prolific
breed with reported values for litter size from 8 to 12 (Carolino et al., 2009;
ANCSUB, 2017). In both breeds the pre-weaning mortality is high, 24-27% in AL
(Marques et al., 1996; Charneca et al., 2012) and higher than 20% in BI (Outor-
Monteiro et al., 1998).
AL sows produces less colostrum than commercial genotypes but
colostrum is richer in IgG (Charneca et al., 2015). The composition of BI
colostrum and milk was reported by Lopes et al. (1998).
The AL piglets born with 1,1 1,2kg LW (Marques, 2001; Charneca et
al., 2012) and their growth rate (average daily gain- ADG) varies between 130 -
163g/d until 21 days (Marques, 2001; Charneca et al., 2012). The LW of BI
piglets at birth is 1,3 to 1,4kg (Carolino et al., 2009; Outor-Monteiro et al., 1998).
The values found for growth rate of BI piglets in nursing period (45d) range
between 220-260g/d (Outor-Monteiro et al., 1998; ANCSUB report, 2006). In the
post-weaning period, Freitas (1998) reported ADG values of 320 to 360g/d in AL
piglets between 20 and 50kg LW.
The AL growth performance in pre-finishing phase (60-100kg) most
reported values of ADG are between 400-600g/d (Freitas et al., 2007; Martins et
al., 2012; Martins et al., 2015). During fattening period montanheira when the
daily intake of acorns can reach 10kg, depending on the animal density and fruits
production (Santos Silva and Tirapicos Nunes, 2013) a higher growth rate can be
observed 700-950g/d (Nunes, 1993; Freitas, 1998). An interesting knowledge on
this breed is that it presents a compensative growth when submitted to feeding
restriction before finishing period (Freitas, 1998). In the BI pig the growth rate
between 35 and 100kg LW is ~592/d in indoor facilities but it is lower (460g/d) in
outdoor conditions (Figueiredo et al., 2007). At higher weights, between 100 -
140kg LW the observed ADG is ~530g/d (Santos e Silva et al., 1999). More recent
results in a study concerning the type of pig facilities Arajo et al. (2016) reported
an ADG between 25-80kg LW around 555g/d and from 80-120kg about 520g/d.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
150 October 11-13, 2017

TREASURE project study

Justification and goals
Before intensification of indoors pig production, AL and BI were the main
pig breeds in Portugal. It can be considered that Tagus river, including confined
fields, separate each breed homeland. In the South, AL was predominant, while the
dominance of BI in Northern territories was evident. Nevertheless, for some time
they cohabited in Ribatejo region. In the contact zones, according to ancient
testimonies (Bernardo Lima, 1865; Miranda do Vale 1949) the cross between both
breeds was a common practice, and the result (animal, meat and products) was
rather appreciated. However, no scientific data is available about the crossed
animals or their products. The study and possible use of crosses between these pig
breeds, whose former name Ribatejano Pig (RI) we have resumed, can help to
increase the revenue of pig producers by creating new and economically interesting
products, but it can also help to maintain or increase the two pure breed
populations, therefore contributing to the conservation of animal biodiversity. The
trial aimed to study the performance, the carcasses and meat quality, and also the
quality of processed dry cured products of Ribatejano (RI) pigs obtained by the
cross between AL males x BI females (ALBI piglets) and between BI males x AL
females (BIAL piglets). Besides the crossbred, AL and BI pure breed pigs were
used as controls in the trial.

Reproductive results
The mating, gestation, farrowing and lactation supervision of AL and BI
females mated on crossbreeding allowed us to observe that, as expected, AL sows
had a shorter gestation (111 vs 114d) and smaller litter size (6.7 vs 10 born alive
piglets) than BI (Charneca et al., 2016). Colostrum intake of piglets was similar
between genotypes being on average of 289g for ALBI and 281g for BIAL piglets.
The mortality rate until 28d averaged 12%, value much lower than the reported for
both breeds in pure line (Charneca et al., 2016). The reasons for the low mortality
rate in the study may be related to a closer supervision during the lactation period,
mainly during the first days post-farrowing and/or by a heterotic effect on the
piglets viability. The BI females weaned more piglets than AL, 8.5 vs 6 piglets.
The growth rate of crossbred piglets and weight at 28d of age was similar between
genotypes with average values of 195g and 6.8kg, respectively (Charneca et al.,
2016).

Productive results
First period (occurred mostly during spring season)
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 151

On this phase 20 castrated males of each genotype (AL, BI, ALBI and
BIAL) were reared outdoor (similar conditions to those of observed in private
farms), animals were feed ad libitum in group, and followed from to about 30kg to
65kg LW. The ADG of AL pigs (344g/d) was lower than all other genotypes that
were similar among them (401- 414g/d). Overall, carcass length, carcass yield, and
lean cuts weight were higher in BI than AL pigs, with intermediate values for both
crosses. Conversely, fat cuts percentage, ZP fat depth and average backfat
thickness were higher in AL than in BI, and ALBI and BIAL pigs. At 65kg LW, RI
crosses presented intermediate characteristics between fatter (AL) and leaner (BI)
genotypes (Neves et al., 2016).
Second period (occurred mostly during summer season)
After the first slaughter, the 10 remaining pigs per genotype remained in
the same outdoor system but began to be fed individually, in order to control
individual feed intake. The final slaughter weight was ~150kg. The preliminary
results of this period showed no differences in growth rate, and ADG varied
between 550 and 601g/d. In the carcasses the only clear differences between AL
and the other genotypes are fat related traits. The AL carcasses had higher
percentage of fat cuts, average backfat thickness and ZP fat depth. Again, RI
animals (ALBI and BIAL) present, in most cases, intermediate values between the
2 pure breeds. After animal slaughtering a traditional dry-cured product (Alves et
al., 2017) of pig (paio), was made using meat and fat of animals of each
genotype.
The so far observed and analyzed results of the Treasure experiment show
that the RI pig can be raised in outdoor conditions, during summer season without
performance loss, the carcasses present equal or intermediate values of those from
the pure breed animals what can be an advantage in some markets and/breeding
seasons when the pure breed animal is not so valorized. Regarding our particular
interest of the BIAL cross because most AL sows are in Alentejo region we
forecast future studies of this RI pig eventually in a more comparative study with
the most usual cross with Duroc made by farmers.

Alentejano i bisaro svinje: tradicija i inovacija - Treasure

projekat
Rui Charneca, Amadeu Freitas, Jos Martins, Jos Neves, Miguel Elias, Marta
Laranjo, Jos Nunes
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
152 October 11-13, 2017

Rezime
Alentejano svinja (AL) i bisaro svinja (BI) su dve glavne autohtone rase
svinja u Portugaliji. Od razliitih pretaka, oni imaju slinu istoriju tokom prolog
veka. Pre sto godina AL je bila najea rasa svinja u Portugaliji, ali su u drugoj
polovini 20. veka obe portugalske rase svinja doivele snaan pad populacije koji
gotovo dovodi do njihovog izumiranja. Meutim, od kraja 80-tih godina prolog
veka, lokalne rase su spaene i njihova populacija se oporavila u posljednjih 30
godina. Oporavak uzgoja dovodi do zatite svinjskog mesa i suvih proizvoda od
svinjskog mesa pod evropskim programima zatite PDO i PGI. U okviru
TREASURE projekta, u toku je studija sa ciljem da se ispita mogunost programa
ukrtanja koji ukljuuju obe rase sa ciljem dobijanja novih proizvoda sa
potencijalnim komercijalnim interesima i poboljanjem znanja o istim rasama i
njihovoj zatiti od buduih pretnje. Ovaj rad obuhvata reviziju znanja i podataka o
AL i BI rasama kao i neke preliminarne originalne podatke iz studije Treasure
projekta.

Kljune rei: Alentejano, Bisaro, autohtone svinje, reprodukcija,

proizvodnja.

Acknowledgements

This work has been made in the scope of TREASURE project. This project
has received funding from the European Unions Horizon 2020 research and
innovation programme under grant agreement No 634476 (Project acronym:
TREASURE). The content of this paper reflects only the authors view and the
European Union Agency is not responsible for any use that may be made of the
information it contains.
This work was funded by National Funds through FCT- Fundao para a
Cincia e a Tecnologia under the Project UID/AGR/00115/2013.
M. Laranjo acknowledges a Post-Doc research grant from FCT
(SFRH/BPD/108802/2015).

References
ALVES C.M.G. (2003): O porco Bsaro: Recuperao e valorizao. Suinicultura,
60, 52-63.
ALVES S.P., FERNANDES M.J., FERNANDES M.H., BESSA R.J.B.,
LARANJO M., SANTOS A.C.A., ELIAS M., FRAQUEZA M.J. (2017): Quality
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 153

and acceptability of dry fermented sausages prepared with low value pork raw
material. Journal of Food Processing and Preservation, 41: n/a, e12823.
doi:10.1111/jfpp.12823
ANCSUB (2006): Associao Nacional de Criadores de Sunos de Raa Bsara.
Boletim informativo n7, Julho 2006. Available at:
[Link]
ANSUB (2017): Associao Nacional de Criadores de Sunos de Raa Bsara.
[Link] Consulted in 28 June 2017.
ARAJO J.P.P., CERQUEIRA J.O.L., PIRES P., AMORIM I., DURO J.,
CADAVEZ V., SANTOS E SILVA J., DOMINGUEZ R., BERMDEZ R.,
LORENZO J.M. (2016). Growth performance on Bsaro pigs: hoop barn model vs
confinement. Book of Abstracts of IX International Symposium on the
Mediterranean Pig, 3-5 November, Portalegre, Portugal, 33.
BERNARDO LIMA, S. (1865): Histria Natural e Econmica do Porco. O
Arquivo Rural, VIII, 91-96.
CAROLINO N., SANTOS E SILVA J., VICENTE A.A., TIRAPICOS NUNES, J.
(2009): La Produccin Porcina a Campo: Portugal. In: Produccion Porcina a
Campo Un Modelo Alternativo e Sostenible. Eds. Miguel ngel Aparcio Tovar
and Carlos R. Gonzalez Arajo, Caja Rural de Extremadura, 67-86.
CARVALHO, J. O. (1964): Contribuio para o Estudo Econmico da
Montanheira. Edition: Junta Nacional dos Produtos Pecurios, Lisboa.
CHARNECA R., NUNES, J., LE DIVIDICH, J. (2012): Reproductive and
productive traits of sows from Alentejano compared to sows Large-White x
Landrace genotype, Revista Portuguesa de Zootecnia (edio electrnica), Ano
XIII n 1, 10-29.
CHARNECA R., REQUETIM C., FREITAS A., NEVES J., MARTINS J.M.,
NUNES J.T. (2016): First reproductive and productive results on Ribatejano pig.
Book of Abstracts of IX International Symposium on the Mediterranean Pig, 3-5
November, Portalegre, Portugal ,73.
CHARNECA R., VILA-VIOSA M.J., INFANTE P., NUNES, J., LE DIVIDICH
J. (2015): Colostrum production of Alentejano and Large-White Landrace sows:
consumption, passive immunity and mortality of piglets, Spanish Journal of
Agricultural Research, 8, 317-25.
DGADR (2017): Portuguese Traditional Products. Available in:
[Link] Consulted in 28 june 2017.
FIGUEIREDO F.O., SANTOS E SILVA J., ABREU J.M.F., PIRES DA COSTA
J.S. (2007) : Influence du systme d'alimentation et de logement (traditionnel et de
plein air) sur la performance des porcins de la race Bsaro. Options
Mditerranennes: Srie A. Sminaires Mditerranens,76, 95-104.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
154 October 11-13, 2017

FREITAS A. (1998): Influncia do nvel e regime alimentar em pr-acabamento

sobre o crescimento e desenvolvimento do porco alentejano e suas repercusses
sobre o acabamento em montanheira e com alimento comercial. PhD Dissertation,
Universidade de vora. Portugal.
FREITAS A. (2014): A raa suna Alentejana: passado, presente e futuro. In: Las
razas porcinas Iberoamericanas: un enfoque etnozootcnico. Captulo III. Instituto
Federal de Educao, Cincia e Tecnologia (IF Baiano). Salvador. Brasil.
FREITAS A.B., NEVES, J., LANA M., CHARNECA R., TIRAPICOS NUNES
J. (2007): Influence of the feeding level on growth and carcass characteristics of
Alentejano pigs. Options Mditerranennes Serie A: Sminaires
Mditerranennes, 76, 105-108.
GAMA L.T., MARTNEZ A.M., CAROLINO I., LANDI V., DELGADO J.V.,
VICENTE A.A., VEGA-PLA J.L., CORTS O., SOUSA C.O. (2013): Genetic
structure, relationships and admixture with wild relatives in native pig breeds from
Iberia and its islands, Genetics, Selection, Evolution : GSE, 45, 1, 18-.
JANEIRO J.P. (1944): A Suinicultura em Portugal: Subsdios biomtricos para o
estudo do gado suino nacional, Boletim Pecurio, XII, n 2, 3-192.
LOPES A.F., OUTOR-MONTEIRO D., PINHEIRO V.M.C. (1998): Contribution
to the Characterization of Colostrum and Milk Composition of the Bsara Breed
Sows. Revista Portuguesa de Zootecnia, Ano V, n 2, 43-49.
MARQUES P. (2001). Caractersticas produtivas e reprodutivas do Porco
Alentejano. Influncias genticas e ambientais. PhD Dissertation. Universidade de
vora. Portugal.
MARQUES P., TIRAPICOS NUNES J.L., COLAO J., ALMEIDA J.A. (1996):
Influence de la mortalit dans la productivit de la truie Alentejana, Produzione
Animale, vol. IX III Srie Numero Speciale, 19-22.
MARTINS J.M., NEVES J.A., FREITAS A., NUNES, J.L. (2012): Effect of long-
term betaine supplementation on chemical and physical characteristics of three
muscles from the Alentejano pig. Journal of the Science of Food and Agriculture,
92, 10, 2122-2127.
MARTINS J.M., NEVES J.A., FREITAS A., TIRAPICOS J.L. (2015): Rearing
system and oleic acid supplementation effect on carcass and lipid characteristics of
two muscles from an obese pig breed, Animal, 9, 10, 1721-1730.
MIRANDA DO VALE J. (1949): Sunos. In: Gado Bissulco. Coleco a Terra e o
Homem. Livraria S da Costa. 35-78.
NEVES J.A., MARTINS J.M., SERRANO A., ABECASSIS I., FREITAS A.,
NUNES J.T., CHARNECA R., ALBUQUERQUE A. (2016): The Ribatejano pig
rebirth of a local pig population? First results on growth, carcass and meat
parameters. In IX International Symposium on the Mediterranean Pig - Book of
Abstracts pp. 74, 3-5 November, Portalegre, Portugal.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 155

NUNES. J.L.T. (1993): Contributo para reintegrao do porco Alentejano no

Montado. PhD Dissertation. Universidade de vora. Portugal.
OUTOR-MONTEIRO D., CARDOSO M.A.S., MESTRE R.B. (1998): Contributo
para a caracterizao produtiva de sunos da raa Bsara. Actas das 1as Jornadas
Internacionais de Suinicultura. 26-28 Maro, Vila Real, Portugal. 163-70.
PORTER V. (1993): Spain and Portugal. In: Pigs: A Handbook to the Breeds of the
World 1st edition, Eds. V Porter & TJ Mountfield (eds). Cornell University Press,
Ithaca, United States, 137-40.
PVOAS JANEIRO (1951): Ritmo de crescimento, em peso, dos leites
Alentejanos, at s 8 Semanas. Revista de Medicina Veterinria, XLVI, 495-502.
SANTOS SILVA J., TIRAPICOS NUNES J.L. (2013): Inventory and
characterization of traditional mediterranean pig production systems. Advantages
and constraints towards its development. Acta Agriculturae Slovenica, Supplement
4, 61 67.
SANTOS E SILVA J., FERREIRA-CARDOSO J., BERNARDO A., PIRES DA
COSTA J. (1999): Conservation and development of the Bsaro pig.
Characterisation and zootechnical evaluation of the breed for production and
genetic management. In: Quality of Meat and fat in pigs as affected by genetics and
nutrition Ed. European Association for Animal Production by Caspar Wenk , ETH
Zurich, N 100, 2000.
TIRAPICOS NUNES J. (1998): Produo Extensiva Porco Alentejano. Actas das
1as Jornadas Internacionais de Suinicultura, Vila real, 26 28 Maro, 153 162.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017

TREASURE - MANGALITSA LOCAL PIG BREED IN

SERBIA
edomir Radovi1, Milica Petrovi2, Marija Gogi1, Radomir Savi2,
Nenad Parunovi3, Dragan Radojkovi2, Nikola Stanii1
1
Institute for Animal Husbandry, Autoput 16, RS-11080 Belgrade-Zemun
2
Faculty of Agriculture, University of Belgrade, Nemanjina 6, RS-11080 Belgrade-Zemun,
3
Institute of Meat Hygiene and Technology, Kaanskog 13, 11000, Belgrade, Republic of Serbia
Corresponding author: [Link]@[Link]
Review paper

Abstract: The main objective of this paper is to present the results of the
research of the Swallow belly Mangalitsa genotype in the last six decades.
According to the research, females reach the full maturity the age of 9-10 months,
but they are mated at the age of 1-1.5 years. Average age at first farrowing is 556
days. Reproductive ability is poorly expressed, with a strong maternal instinct.
Fertility of the Mangalitsa is relatively poor because it gives birth to 1-12 piglets,
on average 4 to 5 piglets, with an average body weight of 1.25 kg with a variation
of 0.8 to 1.8 kg. The suckling period is about 50 days (from 47 to 53 days). At
lactation duration of 60 days, the piglet weight at the weaning ranges from 6-13 kg
(average 9.61 kg) for piglets born in the spring, and from 7-15 kg (average 9.50 kg)
for piglets born in fall. Depending on the rearing system, the start of fattening and
final body weight, gains range 268 g to 830 g. The fat thickness (average
measurements) at the ridge was 10.2 cm, the middle of the back 7.9 cm and the
rump 8.1 cm, in previous studies, while in recent studies these values of fat
thickness are somewhat lower, with the pre-slaughter body weight also being lower
(the ridge 6.18 cm, the middle of the back 4.38 cm and at the rump 5.19 cm). The
recent research of the Longissimus dorsi muscle shows an intramuscular fat content
of 13.5%, protein content of 21.1% with specific qualitative properties pH45=6.11;
pH24=5.50; CIE L*=40.13; a*=11.77; b*=3.73). In the musculus longissimus
lumborum and thoracis, Mangalitsa (Swallow-bellied) pigs show higher levels of
monounsaturated fatty acids (MUFA 55.1%) and lower levels of saturated fatty
acids (SFA 35.3%) in comparison with Swedish Landrace pigs.

Key words: autochthonous breed, Swallow belly Mangalitsa, reproductive

traits, growth, carcass and meat quality
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 157

Introduction
Autochthonous breeds of farm animals are breeds that originated in the territory of
the Republic of Serbia and which have economic, scientific and cultural significance for
our country. They contain in their genes information from the environment, they have been
created over a long period of time, under the influence or without the influence of man.
Their genes represent safety in the production of food in future times, in which the greater
importance will be attributed to the resistance and adaptability of the breed. Bearing this
fact in mind, autochthonous breeds represent the TREASURE that we need to preserve for
future generations. Pig production in the Republic of Serbia has a long tradition.
During the 19th century, pigs were the main export product. In that time, the pig
farming was based on local indigenous breeds with the dominant breeds ika and
umadinka. ika and umadinka was the most primitive breed of pigs, created by
domestication of wild pigs Sus scrofa ferus (Beli, 1951). Today in Serbia there are
three local indigenous pig breeds: Mangalitsa, Moravka and Resavka while ika
and umadinka breeds are lost in their original form. Mangalitsa was very popular
in Vojvodina (especially in Srem) and Hungary in the period from the 19th century
until the fifties, and recently farming of this breed has been restored. In the
Republic of Serbia there are three Mangalitsa breed strains, the Swallow-belly
strain (Srem black Mangalitsa or Buanovci pig), white and Subotica strain. In
Hungary and Romania there is also so called red strain of this breed. Swallow belly
Mangalitsa developed in the area of Srem near Ruma, village of Buanovci (Beli
1949). Mangalitsa is a native primitive breed, originated from former umadinka
breed and is so called "fat" pig breed type. In addition to their genetic merit for
agro-biodiversity, they are the basis for a sustainable local pig production chain,
and are particularly important for regions where arable land and grain production
are limited. Autochthonous breeds of pigs provide security for the sustainable
production of food in the future and form part of the genetic and cultural heritage.
Since in Serbia the largest population is the Swallow-belly strain, the aim of this
paper is to describe this variety, from the literary sources available, to the most
important production traits.

Description of the breed and population size

Exterior: The head is relatively small in length and width, with ears that
are not too large and always facing in the direction of the snout. The length of the
ear is 2/3 of the length of the head. The body is short and rather rounded, while the
ridge is of the medium width and usually seamlessly crosses into the backline
(Beli 1951). The cheast is wide and deep. The back, loin and sides are of the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
158 October 11-13, 2017

medium width. Shoulders and ham are quite well expressed. The legs are of
medium length with plenty of thin bones and often soft pastern bones. The skin is
dark in colour, with dense, luminous and curly bristles that are shorter in the
Swallow-belly strain. The colour of the bristles can be from gray-yellow to reddish
(ginger). Briznej (1948) states that there are two varieties of which one from the
western breeding region is called "Buanovac" variety named after the village
Buanovci, which has a greater part of the pigmented body (entire head, body and
the sides of the body and the legs from the outer-lateral side to the claws). The
second variety - "Otok" and "Lasa" named after the village of Otok in the western
part of the Srem region, with the legs pigmented only to the hock joint and the
lower part of the papilla is white. The Otok variety has regularly strongly
developed bristles or "feathers" which the "Buanovac" variety lacks ot are not so
developed (Briznej 1948). Claws, teats and snout tip are pigmented (Beli, 1951).
The number of animals of mangalits breed has increased over years (Table 1). In
2016, only on the territory of Central Serbia, 321 sowes and 32 boars were
registered (in the records of the Main Breeding Organization).

Table 1. Population size

Year 2004 2008 2009 2012 2013 2014 2014* 2015*
Population 55- 400- 400- 1000- 100-
300-1000 300-1000 300-1000
100 1000 1000 2000 1000
N sows 19 200 350 600 90(90 ) 203 (153#) 247(247#) 345 (345#)
#

N boars 9 20 20 50 2 24 35 50
Source of data-DAD-FAO ([Link]) access 29/06/2016
#
Registered animals in Herdbook.
*Source of data of Institute for Animal Husbandry (Main Breeding Organisation), Annual Report
(2014, 2015)-animals under the control of productivity.

Mangalitsa is very resistant and well adapted to extensive conditions of housing,

where the needs are only for a simple shelter from rain and snow. It is located in
the municipalities of Subotica, Sremska Mitrovica, Baka Palanka, Vrac, Panevo,
Ub, Obrenovac, Ljig, Valjevo, Novi Sad, Kuzmin, id, Surin and Kovilj
(Kredinska ada). It can also be found in traces on Stara Planina Mountain
(Municipality of Dimitrovgrad), around aak and Kraljevo. When it comes to
Mangalitsa, which is the most common of all the indigenous breeds in Serbia, it is
necessary to make efforts to increase the number of animals in the population and
control its productivity. This is the only way the breed can be preserved as an
important genetic resource in pig production and breeding not only of Serbia, but
also the entire region (Petrovi et al. 2007).

Reproductive performance
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 159

Mangulica is a late maturity breed. It reaches the full maturity at the age of 9-10
months, but is not mated until the age of 1-1.5 years, and it is fully grown and
mautre at the age of 3-4 years (Briznej 1948). In controlled herds in the four years
(2011-2014), the average age at first farrowing was 556 176.65 days (Radovi et
al. 2015). Reproductive ability is poorly expressed, with a strong maternal instinct.
The number of dairy nipples is most often 10. Fertility of the Mangalitsa females is
relatively poor because it gives birth to 1-12 piglets, on average 4 to 5 piglets with
an average of 1.25 kg body weight, varying from 0.8 to 1.8 kg (Beli 1951). Pigs at
birth have characteristic stripes, which disappear in 10 days in white strain piglets,
and in swallow belly strain in 3-4 months. Low productivity of the Mangalitsa is
also reflected in the low farrowing index (1.21-1.81 litters/year). The poor rearing
conditions and uncontrolled mating contribute to the poor reproductive parameters
of this breed of pigs in Serbia (Table 2). However, the variability of fertility traits
indicates the possibility for genetic improvement. Regardless of the low fertility
properties, this breed should be preserved as an important genetic resource and be
included in the selection program (Petrovi et al., 2013). It is also necessary to
have a plan of mating in a more precise manner so as to avoid inbreeding.

Table 2. Reproductive traits

Reference / Annual Annual Study Study Study
Report Report
Reproductive traits UNIBG, 2010 IAH, 2015 Brinzej Szab Petrovi et al. (2013)
(MeanSD) (MeanSD) (1949) (2002) (MeanSD)
Number of sows 70 sows 74 53 sows
28 litters 10 litters
recorded (85 litters) litters (129 litters)
1
Sow parity 3.45
(508.92127.5
2.04
6 age at first
farrowing)
Litters/sow and year 1.21 1.81 1.77
Litter weight (kg) 6.99
Piglets/litter 5.321.78
4.961.81 6.20 6.64 4.601.65
(1-9)
Piglets alive/litter 4.822.31
(0-9)
1of#
4.452.23 4.731.78
2of
4.501.69
3of
5.112.89
Piglets 4.922.24 5.90
4.481.84 4.091.91
weaned/litter (0-9)24 litters (88.90%)
Duration of
50 days 47.058.38 52.5715.24
lactation (d)
Weaning to 92.3161.66 period
conception interval farrowing-mating
(d) => WCI=92.31-
52.57=39.74)
1
Keep records classified according to this parameter, #-order of farrowing
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
160 October 11-13, 2017

BW body weight of sow must indicate also the stage i.e. weaning, end gestation

Observing the size of the litter, there are no significant differences between the
number of piglets in the litter established in the middle of the 20th century (Briznej
1949) and the beginning of the 21st century (Szab 2002). Research of Petrovi et
al. (2013) as well as the Annual Report (2009 and 2014) show that a somewhat
lower number of piglets per litter has been registered, which may be the result of
inbreeding. Petrovi et al. (2013) found the average number of piglets in the litter
of 4.60, of which 4.09 weaned pigs with a suckling period of 52.57 days. The same
group of authors calculated the duration of the weaning-conception period obtained
by subtracting the farrowing-mating period (92.31 days) and the duration of
lactation (52.57 days), which amounted to 39.74 days (Table 2).

Growth traits

Literary data on the production performance of the breed are shown in various
production systems (open and closed, extensive, semi-intensive and intensive
system of rearing), of nutrition and gender (Table 3 and 4).

Table 3. Production system, nutrition, gender and number of animals in the trial
Literature source

Radovi et al.
Brinzej (1949) Beli and Miti (1954) Brinzej (1956)
(2017)
10 litters
Number of pigs 74 animals in each group 12 32
(62 piglets)
castrated animals
(after weaning) and
castrated
castrated animals
Pol / / animals and
(one month before the
animals
beginning of the
fattening)
Milk and Two weeks after birth, the
Semi-Intensive
Production supplemental diet piglets are fed at will, barley
System Intensive nutrition with
system/ (peas and wet and fresh green alfalfa
(grazing and maize and barley
Nutrition barley) from 4 during the summer or alfalfa
maize)
weeks of age flour in winter.

Depending on the intensity of the rearing system and the nutrition, there are
differences in the rate of growth within and between gender of piglets/fatteners
(Table 4). Differences in the growth characteristics exist among groups of piglets
born in different seasons. The birth weight varies in the range of 700 to 2000 g,
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 161

which is similar to today's allochthonous breeds. The average daily gain during the
suckling period is around 120-130 g, which depends on the lactation period, the
piglets gender and the season of birth. In the intensive rearing system, mangalitsa
animals can achieve high average daily gains of 830 g, as demonstrated by the
results of the research by Brinzej (1956). Unlike the above mentioned research,
study by Radovi et al. (2017) conducted on fatteners grown in semi-intensive
system, show much lower potential in terms of the growth rate (about 267 g).
Possible reasons for this difference in gain are differences in the intensity of
rearing, in the final body weight, but also in the differences in the genetic structure
of fatteners, since the time distance of the conducted researches is about 60 years.

Table 4. Body weight at birth and gain

Literature source
Trait Radovi et Brinzej
Brinzej (1949) Beli and Miti (1954)
al. (2017) (1956)

1205 1170
Body weight 158
At birth 1130g At birth (g) 1220 1270 133*
(BW) (132-174)*
At weaning 9.61 9.97
(kg) 9.50 9.54
1-4 weeks 120
Average daily 5-8 weeks 130 137 spring 146spring
267,86 830
gain (ADG),g Total suckling 138 autumn 137autumn
125
period
*slaughter BW

Brinzej (1949) states in his study that the average body weight of piglets at birth
was 1130 g (females - 1080 g while males have a slightly higher birth weight of
1180 g); average daily gain of piglets in the first 4 weeks of life is 120 g, from 5 to
8 weeks of age - 130 g, i.e. for the total suckling period of 8 weeks on average it is
125 g; from 5-8 weeks, the average daily gain is from 84-153 g, with the female
animals showing gain of 77-150 g and a males 100-157 g. According to Beli and
Miti (1954), the body weight of the male piglets at birth is 1205 g, with variations
of 800-1900 g for piglets born in the spring, and 1220 g with variation of 700-1900
g for piglets born in autumn, whereby on the day 60 (weaning), the body weight
ranged from 6 to 13 kg (average 9.61 kg) for piglets born in the spring, and in the
range of 7-15 kg (average 9.50 kg) for piglets born in autumn. The average daily
gain from birth to weaning at body weight of 1.22-9.48 kg was 137 g for piglets
born in the spring and 138 g for piglets born in autumn. At birth, the average
weight of female piglets is 1170 g, with variations of 700-1800 g for piglets born in
the spring, and 1270 g with an interval of variation of 700-2000 g for piglets born
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
162 October 11-13, 2017

in autumn, whereby on day 60 (weaning), body weight ranged between 6-13 kg

(average 9.97 kg) for piglets born in the spring, and 7-14 kg (average 9.54 kg) for
piglets born in autumn. The average daily gain from birth to weaning at body
weight of 1.22-9.48 kg is 146 g for piglets born in the spring and 137 g for piglets
born in autumn. Radovic et al. (2017) examined animals with pre-slaughter body
weight of 133 kg, with a gain of 267.86 g (the animals were 30 kg at the start of the
trial, and the final body weight reached 150 kg) and the fat thickness of 50.0 mm.
Contrary to this study, Brinzej (1956) examined animals with pre-slaughter weight
of 158 kg (132-174 kg) and obtained the following results: gain of 830 g (59 to 158
kg).

Carcass and meat quality traits

The Mangalitsa is an extremely fatty pig breed (Teodorovi and Radovi, 2004).
While adipose tissue is about 6570% of the carcass, lean meat is less than 35%
Rtky et al (2013). The carcass side quality traits vary depending on the nutrition
and the housing system (Table 5). The slaughter weight is different and ranges
from about 101 to 150 kg. In the earlier period, pigs were fattened to higher body
weights, which affected the higher content of fat tissue in the carcass. Today
consumers' demands are focused on the higher meat content of the carcass sides,
which caused pigs to be fattened to lower body weights, similar to those in the
intensive rearing system (about 100-110 kg). The slaughter yield ranges from 76 to
83%. The fat thickness varied in the presented researches depending on the body
weight of the pigs at slaughter and the location on the carcass on which it was
measured. Petrovi et al. (2010) found the thickest fat on the ridge - 61.85 mm
while the lowest was measured in the middle of the back - 43.78 mm. In the
research of Petrovi et al. (2012) the maximum values of fat thickness at withers
determined was 85 mm and the lowest value was 48 mm, while for fat thickness at
the middle of the back (between 13th and 15th vertebrae) max. value was 55 mm
and the lowest measured value was 27 mm.
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
October 11-13, 2017 163

Table 5. Carcass traits

Petrovi et Parunovi et al. Petrovi et al. (2014)
Petrovi et Brinzej
Reference al. (2012) (2012)* LSMSE
al. (2010) (1956)
LSM LSMSE
23 22 16 (balanced ratio of
N pigs recorded 10 32
CO-12+FR-10 gender)
Production system open & conventional (CO) farm free range
semi-
(extensive, intensive, intensive closed & free range (FR) (conventional
intensive
mixed)2 mixture)
CO (six pigs per surface of 150 m2: 110
Type of housing/ cage, 4 m2 per m2 open + 40 m2 cover
no. of animals per 10 animals) section (4.8 m2 of
group FR surface area per
animal)
Slaughter weight 103.83 CO 102.063.70 107.142.85
101,22 158
(kg) FR 98.064.06 337.17.83age (days)
82.31 CO 800.43warm
Carcass weight warm; FR 76.80.47warm
73,90
(kg) 80.22 CO 78.10.46cold
cold FR 74.70.49cold
Carcass yield (% CO 77.40.46
73
live weight) FR 73.90.51
Carcass length (cm)
88,74 92.78 CO 89.30.63
os pubis-atlas
72,80 76.26 FR 89.20.69
os pubis-1st rib
*CO-conventional mixture, FR-pasture, acorns and grains; After reaching a 60 kg of live weight both
groups fed with conventional mixture.

Table 6. Total mass in four major carcasses parts and backfat thickness
Brinzej Petrovi et Parunovi et al.
Reference Petrovi et al. (2012)
(1956) al. (2010) (2012)*
open 8.25
7.760
Ham weight (kg) closed 7.83
Shoulder weight
4.170 open 4.45 closed 4.82
(kg)
Loin weight (kg) 6.268 open 6.52 closed 6.62
Belly-rib (kg) 4.73 open 4.60 closed 4.38
ridge 10.2; ridge 6.18; ridge 6.17;
Backfat thickness CONV #6.19; 5.46; 6.01
loins 7.90; loins 4.38; loins 4.27;
(cm) FR #5.84; 5.18; 5.65
rump 8.10 rump 5.19 rump 4.78
*CONV-conventional mixture, FR-pasture, acorns and grains; after reaching a 60 kg of live weight
both groups fed with conventional mixture.
#Above the M. gluteus medius at the carcass split-line, on the three positions.

Petrovi et al. (2012) found in the open system the thigh weight (Table 6) of 8.25
kg (with 3.75 kg of muscle tissue), while in the closed system the weight of the
thigh is 7.83 kg (with 3.75 kg muscle). The weight of the shoulder is 4.45 kg in the
open system (2.13 kg muscle tissue) and 4.82 kg (muscle tissue 2.19 kg) in the
Proceedings of the 11th International Symposium
Modern Trends in Livestock Production
164 October 11-13, 2017

closed system. The wight of back-loin section in the open system is 6.52 kg with
1.76 kg of muscle, in the closed system 6.62 kg with 1.91 kg of muscle tissue. The
backfat thickness at the ridge is 6,17 cm, at the middle of the back 4,27 cm and on
the sides 4.78 to 5.37 cm (Petrovi et al., 2012). Parunovi et al. (2012) state that
the thickness of backfat in conventional nutrition at three points respectively is:
6.19; 5.46; 6.01, and in the free farm system 5.84; 5.18; 5.65 cm.
Table 7. Meat quality traits longissimus dorsi muscle
Study Study Study Study Study
Radovi Tomovi et
Stanii et al. Petrovi et al. Parunovi et
et al. al. (2016)
Reference (2015)# ## (2007) al. (2012)###
(2017) MeanSD
MeanSD LSMSD LSMSE
LSMSE
N pigs recorded 7 12 13:10 12:10 15
Production system conventional intensive
open (O) &
(extensive, intensive intensive (CON) & free
closed (C)
intensive, mixed) range (FR)
O 6.040.10 CON-6.120.05
pH 45 6.110.13
C 6.320.32 FR-5.890.06
CON-5.800.06 5.56
pH 24 5.470.66 5.500.06
FR-5.410.06
40.131.4 48.39
CIE L* 38.191.92
8
11.771.0 10.13
CIE a* 10.582.50
4
CIE b* 2.680.88 3.730.45 4.14
Drip loss %
Cooking
29.601.82
loss
Tenderness
5.051.13
(kg)
Water
holding 13.202.15
capacity
WBSF: Warner-Bratzler shear force test; IMF intramuscular fat content
#
Water Holding Capacity measured according to the method of Weiss et al. (1953). Cooking loss was
determined in the following manner: a sample size of 3 x 4 x 2 cm is weighed and placed into a
beaker of boiling water and cooked for 10 minutes; the difference in mass of the sample before and
after cooking is the mass loss during the heat treatment, expressed as a percentage. The samples used
to determine the mass loss and the cooking were used to determine the meat cutting force (kg):
muscles are cut into pieces the size of 1 x 1 cm in the direction of extension of the muscle fibers;
tenderness of meat, expressed forcibly cutting, measured Volodkevich instrument (Volodkevich,
1938); read more value on the instrument representing more cutting force values, and firmer flesh.
Surface