CHHATRAPATI SHAHUJI MAHARAJ MEDICAL UNIVERSITY

King George's Medical College (KGMC), Lucknow, is one of the pioneer medical colleges of
India. The college was opened in October 1911, when His Majesty King George V and
Queen Mary visited India. Initially, King George's Medical College was affiliated to the
Allahabad University. In 1921, King George's Medical College and associated King George's
Hospital were formally transferred under the Lucknow University.

By an act passed by the Government of Uttar Pradesh on September 16, 2002, the college
was transferred under a new university, called the Chhatrapati Shahuji Maharaj Medical
University. However, in the year the name of the institute was changed to Chhatrapati
Shahuji Maharaj Medical University. The institution is entrusted with the task of
disseminating advance knowledge in biomedical sciences and establishing itself as a centre of
excellence in tertiary level health care in the state.

THE MICROBIOLOGY DEPARTMENT :

The Department of Microbiology came into existence as an independent department in the
year 1987 with the bifurcation of the combined Department of Pathology & Bacteriology
under the headship of Dr U C Chaturvedi. The department has contributed immensely to the
teaching, patience care services and research in Microbiology. Department handles over
40,000 clinical specimens for various diagnostic procedures per annum.

The laboratory receives clinical specimens from the wards at the reception area or in the
laboratory. Processing of the specimens starts at real time, specifically for cerebrospinal fluid
(CSF) and blood culture. Other specimens, if not processed instantly, are kept in the cool box
or refrigerator to minimize the impact of time gap.

In this department, improvement of laboratory procedures and techniques is a continuous

process. The advancements in processing the specimens and improvement of diagnostic
capacity are coming from the experiments and findings of this laboratory, and published
literature from the other laboratories.

Once the specimens arrive in the Department of Microbiology, they are handled with care
following standard operation procedure (SOP), depending on type of specimens.

Specimens like cerebrospinal fluid (CSF) are handled with high priority. cytology, Gram
stain and antigen detection tests are done and reported at real time.

Bacteriological culture is the main service of the whole department. The specimens are
processed in aerobic and micro-aerophilic conditions. Among the cultures, blood (31%), CSF
(24%) and urine (24%) were the most predominant specimens followed by pus (7%) and
throat swab (2%).

In the recent years, the department introduced enriched blood culture media.

Most of the CSF specimens are culture negative due to prior antibiotic use. Etiology of these
cases is detected by detection of antigen either by latex agglutination test and / or by
Immuno-chromatographic test. Both the tests, for antigen detection, are available in the
microbiology laboratory.

The department has the following functionally independent divisions:

Bacteriology:

This division provides diagnostic service to local hospital. Activities include bacterial culture
media preparation, sterilization of glassware and routine culture, identification and sensitivity
testing of bacterial isolate. locally isolated bacterial strains are stocked and maintained by
lyophilization. Extensive work is being done on isolation and identification of fastidious
bacteria like H. influenzae, pneumococci etc. Research work on GBS, CONS and Enterococci
has been undertaken recently.

Serology:

Various serological tests including VDRL, RPR, WIDAL, ASO titres, CRP and Rh factor are
being done routinely in this laboratory. Numerous ELISAs are carried out including for
Hepatitis B and C, CMV, Rubella, Dengue, Chikungunya, Japanese encephalitis and
Tuberculosis.

Tuberculosis laboratory:

It receives a number of samples for diagnosis of tuberculosis. M. tuberculosis culture and

sensitivity testing for primary drugs by proportion method is done routinely. It has been
identified as Intermediate Reference laboratory for quality control in RNTCP under Govt. of
India/WHO, World Bank.
 INTRODUCTION

Medical microbiology is both a branch of medicine and microbiology which deals with the
study of microorganisms including bacteria, viruses, fungi and parasites which are of medical
importance and are capable of causing diseases in human beings. It includes the study of
microbial pathogenesis and epidemiology and is related to the study of disease pathology and
immunology. In the medical laboratory, these microbiologists also work in a sub department
dedicated to parasitology. The discipline consists primarily of four major spheres of activity:

1. The provision of clinical consultations on the investigation, diagnosis, and treatment

of patients suffering from infectious diseases.
2. The establishment and direction of infection control programs across the continuum
of care.
3. Public health and communicable disease prevention and epidemiology.
4. The scientific and administrative direction of a diagnostic microbiology laboratory.

the development of vaccines against invading organisms, deadly and debilitating diseases
such as small pox, polio, and tuberculosis have been either eradicated or are more treatable
because of the efforts of scientists and researchers in the field of medical microbiology.
 A REVIEW OF LITERATURE

EQUIPMENTS USED IN MICROBIOLOGY LABORATORY:

1) AUTOCLAVE :-

An autoclave is a device to sterilize equipment and supplies by subjecting them to high

pressure saturated steam at 121 °C or more, typically for 15 to 20 minutes depending on the
size of the load and the contents. It was invented by Charles Chamberland in 1879 although a
precursor known as the steam digester was created by Denis Papin in 1679. The name comes
from Greek auto, ultimately meaning self, and Latin clavis meaning key — a self-locking
device.

Uses:

Autoclaves are widely used in microbiology, medicine, tattooing, body piercing, veterinary
science, mycology, dentistry, chiropody and prosthetic [Link] loads include
laboratory glassware, surgical instruments, medical waste, patient care utensils, animal cage
bedding, and Lysogeny broth.A notable growing application of autoclaves is in the pre-
disposal treatment and sterilization of waste material, such as pathogenic hospital waste.
Machines in this category largely operate under the same principles as the original autoclave
in that they are able to neutralize potentially infectious agents by utilizing pressurized steam
and superheated water. A new generation of waste converters is capable of achieving the
same effect without any pressure vessels to sterilize culture media, rubber material, gowns,
dressing, gloves etc. It is particularly useful for materials which cannot withstand the higher
temperature of a hot air oven. For all-glass syringes, a hot air oven is a better sterilizing
method.
Air removal - It is very important to ensure that all of the trapped air is removed, as hot air
is very poor at achieving sterility. Steam at 134 °C can achieve in 3 minutes the same sterility
that hot air at 160 °C takes two hours to achieve. Methods of achieving air removal include:

Downward displacement (or gravity type) - As steam enters the chamber, it fills the upper
areas as it is less dense than air. This compresses the air to the bottom, forcing it out through
a drain. Often a temperature sensing device is placed in the drain. Only when air evacuation
is complete should the discharge stop. Flow is usually controlled through the use of a steam
trap or a solenoid valve, but bleed holes are sometimes used, often in conjunction with a
solenoid valve. As the steam and air mix it is also possible to force out the mixture from
locations in the chamber other than the bottom.

Steam pulsing - Air dilution by using a series of steam pulses, in which the chamber is
alternately pressurized and then depressurized to near atmospheric pressure.

Vacuum pumps - Vacuum pumps to suck air or air/steam mixtures from the chamber.

Superatmospheric - This type of cycle uses a vacuum pump. It starts with a vacuum
followed by a steam pulse and then a vacuum followed by a steam pulse. The number of
pulses depends on the particular autoclave and cycle chosen.

Subatmospheric - Similar to superatmospheric cycles, but chamber pressure never exceeds

atmospheric until they pressurize up to the sterilizing temperature

2) INCUBATOR:-
In biology, an incubator is a device used to grow and maintain microbiological cultures or
cell cultures. The incubator maintains optimal temperature, humidity and other conditions
such as the carbon dioxide(CO2) and oxygen content of the atmosphere inside. Incubators are
essential for a lot of experimental work in cell biology, microbiology and molecular biology
and are used to culture both bacterial as well as eukaryotic cells.

The simplest incubators are insulated boxes with an adjustable heater, typically going up to
60 to 65 °C (140 to 150 °F), though some can go slightly higher (generally to no more than
100 °C). The most commonly used temperature both for bacteria such as the frequently used
E. Coli as well as for mammalian cells is approximately 37 °C, as these organisms grow well
under such conditions. For other organisms used in biological experiments, such as the
budding yeast Saccharomyces cerevisiae, a growth temperature of 30 °C is optimal.

More elaborate incubators can also include the ability to lower the temperature (via
refrigeration), or the ability to control humidity or CO2 levels. This is important in the
cultivation of mammalian cells, where the relative humidity is typically >95% and a slightly
acidic pH is achieved by maintaining a CO2 level of 5%.

Most incubators include a timer; some can also be programmed to cycle through different
temperatures, humidity levels, etc. Incubators can vary in size from tabletop to units the size
of small rooms.

3) LAMINAR FLOW CABINET :-

A laminar flow cabinet or laminar flow closet or tissue culture hood is a carefully
enclosed bench designed to prevent contamination of semiconductor wafers, biological
samples, or any particle sensitive device. Air is drawn through a HEPA filter and blown in a
very smooth, laminar flow towards the user. The cabinet is usually made of stainless steel
with no gaps or joints where spores might collect.

Such hoods exist in both horizontal and vertical configurations, and there are many different
types of cabinets with a variety of airflow patterns and acceptable uses. NSF49 is the
commonly accepted regulatory standard for these cabinets.
Laminar flow cabinets may have a UV-C germicidal lamp to sterilize the shell and contents
when not in use. (It is important to switch this light off during use, as it will quickly give any
exposed skin sunburn and may cause cataracts.)

4) COLONY COUNTER :-

A colony counter is an instrument used to count colonies of bacteria or other

microorganisms growing on an agar plate. Early counters were merely lighted surfaces on
which the plate was placed, with the colonies marked off with a felt-tipped pen on the outer
surface of the plate while the operator kept the count manually. More recent counters attempt
to count the colonies electronically, by identifying individual areas of dark and light
according to automatic or user-set thresholds, and counting the resulting contrasting spots
5) LABORATORY WATER BATH :-

A laboratory water bath is a tool used to maintain a very stable temperature much like an
incubator. Water baths can hold often temperatures within a tenth of a degree Celsius. The
water is often circulated and sometimes beads are used as an alternative waterless option .
Scientific water baths are also used in commercial kithens to cook sous vide

6) INOCULATION LOOP :-

An inoculation loop, also called a smear loop, inoculation wand or microstreaker, is a

simple tool used mainly by microbiologists to retrieve an inoculum from a culture of
microorganisms. Its tip is a wire made of platinum or nichrome, the latter being inferior but
less expensive. The wire forms a small loop with a diameter of about 5 mm. This loop is
handy for taking an inoculum from a liquid by using the phenomenon of surface tension.

The loop is used to cultivate microbes in Agar jelly and to use the streak manouvre to transfer
microbes.

The inoculation loop is always sterilized in a flame until it becomes red hot before and after
each use. By doing this, the same tool can be reused in different experiments without fear of
cross-contamination. After flame sterilization, the loop must be cooled so that the next cells
to touch the loop don't instantly die.

7) COMPOUND MICROSCOPE :

Compound means a microscope that has more than one lens and Microscope, if divided in to
two different words as it is, "micro" means small and "scope" means view. Therefore in a
whole the meaning is a device that would facilitate the viewing of small organisms with the
help of multiple lenses. Simple Microscopes and Compound Microscope differ in the sense
that Simple microscopes used a single lens and Compound Microscope uses more than one.

Principle of Compound Microscope:

  Principle of the compound microscope which uses two lenses for the greater strengthening.
The upper lens is the eye piece and the lower lens is at the opposite end of the tube which is
called the objective. The image will be seen upside down, and then the upper lens called the
eyepiece takes over and enlarges the image once again. As a result of this we always see the
image reversed. The compound microscope works by first the first the magnified image has
been formed by the objective lens and has been projected up into the tube.

The beam passes through the stage window and through the specimen, and then the light
brightens the area through the specimen. The compound microscope consists of convex
lenses fitted at either end of the tube. The light source can be a mirror or a lamp in the
microscope base. The level of the contrast is controlled by controlling the amount of the
illumination.

.
Components :

Eyepiece Lens:  the lens at the top that you look through.  They are usually 10X or 15X
power. 

Tube:  Connects the eyepiece to the objective lenses

Arm:  Supports the tube and connects it to the base

Base:  The bottom of the microscope, used for support

Illuminator:  A steady light source (110 volts) used in place of a mirror.  If your microscope
has a mirror, it is used to reflect light from an external light source up through the bottom of
the stage.

Stage:  The flat platform where you place your slides.  Stage clips hold the slides in place.  If
your microscope has a .echanical stage, you will be able to move the slide around by turning
two knobs.  One moves it left and right, the other moves it up and down

Revolving Nosepiece or Turret:  This is the part that holds two or more objective lenses and
can be rotated to easily change power.

Objective Lenses:  Usually you will find 3 or 4 objective lenses on a microscope.  They
almost always consist of 4X, 10X, 40X and 100X powers.  When coupled with a 10X (most
common) eyepiece lens, we get total magnifications of 40X (4X times 10X), 100X , 400X
and 1000X.

Condenser Lens:  The purpose of the condenser lens is to focus the light onto the specimen. 
Condenser lenses are most useful at the highest powers (400X and above).

Diaphragm or Iris:  Many microscopes have a rotating disk under the stage.  This
diaphragm has different sized holes and is used to vary the intensity and size of the cone of
light that is projected upward into the slide.

Working Principle of Lenses:

When an object is in focus the lower lens called the objective lens form a real inverted image
of the object. The upper lens called the eyepiece treat the inverted image as an object and
produces an image of that object. This image is the enlarged image that has been seen by the
observer.

8) FLUORESCENCE MICROSCOPE :

A fluorescence microscope is an optical microscope used to study properties of organic or

inorganic substances using the phenomena of fluorescence and phosphorescence instead of,
or in addition to, reflection and absorption. Many biological objects are large enough to be
seen through a microscope but their optical properties are so similar to the surrounding
environment that the optical microscope cannot detect them. When such objects are made
fluorescent, they can be readily detected by a fluorescence microscope. For instance,
endosomes in a microphage cannot be distinguished from other small objects, like granules,
fat droplets, etc. They can be visualised, however, when loaded with a red fluorescing dye:
Principle of Fluorescence

1. Energy is absorbed by the atom which becomes excited.

2. The electron jumps to a higher energy level.
3. Soon, the electron drops back to the ground state, emitting a photon (or a packet of light) -
the atom is fluorescing dye.

Fluorescent molecules absorb light of a given wavelength and subsequently emit light of a
longer wavelength. A good example is a popular fluorescent dye, fluorescein. It absorb
absorbs blue light and emits green fluorescence (with some yellow and red emission). It is
possible to attach molecules of fluorescein to an antibody which binds to microtubuls in a
fibroblast, and subsequently illuminate this cell with blue light. In a cell treated that way only
microtubules emit green light. If the blue excitation light which excites fluorescence is
removed from the final image, microtubules appear as green threads against black
background. This method of fluorescently labelling subcellular structures is called
immunofluorescence.

WORKING OF FLUORESCENCE MICROSCOPE :

The sample of interest is labeled with a fluorescent substance known as a fluorophore and
then illuminated through the lens with the higher energy source. The illumination light is
absorbed by the fluorophores (now attached to the sample) and causes them to emit a longer
lower energy wavelength light. This fluorescent light can be separated from the surrounding
radiation with filters designed for that specific wavelength allowing the viewer to see only
that which is fluorescing.

The basic task of the fluorescence microscope is to let excitation light radiate the specimen
and then sort out the much weaker emitted light from the image. First, the microscope has a
filter that only lets through radiation with the specific wavelength that matches your
fluorescing material. The radiation collides with the atoms in your specimen and electrons are
excited to a higher energy level. When they relax to a lower level, they emit light. To become
detectable (visible to the human eye) the fluorescence emitted from the sample is separated
from the much brighter excitation light in a second filter. This works because the emitted
light is of lower energy and has a longer wavelength than the light that is used for
illumination.
APPLICATION OF FLUORESCENT MICROSCOPE :

 Imaging structural components of small specimens, such as cells

 Conducting viability studies on cell populations (are they alive or dead?)
 Imaging the genetic material within a cell (DNA and RNA)
 Viewing specific cells within a larger population with techniques such as FISH
 BACTERIOLOGY LABORATORY

BASIC LAB TECHNIQUES :-

 STREAKING –

Streaking is a technique used in microbiology to

isolate a pure strain from a single species of microorganism, often bacteria. A
microbiological culture can be grown so that the organism can be identified, studied, or
tested. A sterile cotton swab or inoculation loop is sterilized and dipped in a broth or patient
specimen containing many species of bacteri a. The
loop is then spread across one quadrant of an agar plate containing a growth medium which
has been sterilized in an autoclave. This introduces a solution of the bacteria or fungi to a
substrate which provides them nutrients. Choice of which growth medium to use depends on
which microorganism is being cultured, and which are being selected for, if any. Growth
media are usually based on agar, a gelatinous substance derived from seaweed.

The loop is re-sterilized and dragged across the inoculated quadrant of the streak plate. This
is done to collect some bacteria on the loop. The loop is spread around another fourth of the
plate much like the previous step. The loop is sterilized and the procedure is repeated. Each
time the loop gathers fewer and fewer bacteria until it gathers just one single bacterial cell
that can grow into a colony.

The streak plate is then incubated, usually for 24 to 36 hours, to allow the bacteria to
reproduce. At the end of incubation there should be enough bacteria

to form visible colonies in the areas touched by the inoculation loop. From these mixed
colonies, single bacterial or fungal species can be identified based on their morphological
(size/shape/colour) differences, and then sub-cultured to a new media plate to yield a pure
culture for further analysis.

Purpose

The streaking procedure is used in order to check

1) whether a culture consists of only one organism ( a "pure culture") or if there are more
than one organisms in it (contaminated)
2) whether a culture is viable, i.e. able to grow (perhaps a "stock" culture kept for some time
in the fridge)

Background

The basic tools used in this procedure include a (sterile) "loop", and a Petri dish containing an
appropriate agar, well cooled and set, with a dry surface. The principle is that individual
microbial cells can be separated by dragging them over the surface of the agar, and then
given a chance to grow into individual colonies

Culture Media for the Growth of Bacteria

For any bacterium to be propagated for any purpose it is necessary to provide the appropriate
biochemical and biophysical environment. The biochemical (nutritional) environment is
made available as a culture medium, and depending upon the special needs of particular
bacteria (as well as particular investigators) a large variety and types of culture media have
been developed with different purposes and uses. Culture media are employed in the isolation
and maintenance of pure cultures of bacteria and are also used for identification of bacteria
according to their biochemical and physiological properties.

The manner in which bacteria are cultivated, and the purpose of culture media, vary widely.
Liquid media are used for growth of pure batch cultures while solidified media are used
widely for the isolation of pure cultures, for estimating viable bacterial populations, and a
variety of other purposes. The usual gelling agent for solid or semisolid medium is agar, a
hydrocolloid derived from red algae. Agar is used because of its unique physical properties (it
melts at 100 degrees and remains liquid until cooled to 40 degrees, the temperature at which
it gels) and because it cannot be metabolized by most bacteria. Hence as a medium
component it is relatively inert; it simply holds (gels) nutrients that are in aquaeous solution.

Culture media may be classified into several categories depending on their composition or
use. A chemically-defined (synthetic) medium (Table 4a and 4b) is one in which the exact
chemical composition is known. A complex (undefined) medium (Table 5a and 5b) is one
in which the exact chemical constitution of the medium is not known. Defined media are
usually composed of pure biochemicals off the shelf; complex media usually contain complex
materials of biological origin such as blood or milk or yeast extract or beef extract, the exact
chemical composition of which is obviously undetermined. A defined medium is a minimal
medium (Table4a) if it provides only the exact nutrients (including any growth factors)
needed by the organism for growth. The use of defined minimal media requires the
investigator to know the exact nutritional requirements of the organisms in question.
Chemically-defined media are of value in studying the minimal nutritional requirements of
microorganisms, for enrichment cultures, and for a wide variety of physiological studies.
Complex media usually provide the full range of growth factors that may be required by an
organism so they may be more handily used to cultivate unknown bacteria or bacteria whose
nutritional requirement are complex (i.e., organisms that require a lot of growth factors).

Most pathogenic bacteria of animals, which have adapted themselves to growth in animal
tissues, require complex media for their growth. Blood, serum and tissue extracts are
frequently added to culture media for the cultivation of pathogens. Even so, for a few
fastidious pathogens such as Treponema pallidum, the agent of syphilis, and Mycobacterium
leprae, the cause of leprosy, artificial culture media and conditions have not been established.
This fact thwarts the the ability to do basic research on these pathogens and the diseases that
they cause.

Other concepts employed in the construction of culture media are the principles of
selection and enrichment:

A selective medium is one which has a component(s) added to it which will inhibit or
prevent the growth of certain types or species of bacteria and/or promote the growth of
desired species. One can also adjust the physical conditions of a culture medium, such as pH
and temperature, to render it selective for organisms that are able to grow under these certain
conditions.
A culture medium may also be a differential medium if it allows the investigator to
distinguish between different types of bacteria based on some observable trait in their pattern
of growth on the medium. Thus a selective, differential medium for the isolation of
Staphylococcus aureus, the most common bacterial pathogen of humans, contains a very high
concentr ation of salt (which the staph will tolerate) that inhibits most other bacteria,
mannitol as a source of fermentable sugar, and a pH indicator dye. From clinical specimens,
only staph will grow. S. aureus is differentiated from S. epidermidis (a nonpathogenic
component of the normal flora) on the basis of its ability to ferment mannitol. Mannitol-
fermenting colonies (S. aureus)produce acid which reacts with the indicator dye forming a
colored halo around the colonies; mannitol non-fermenters (S. epidermidis) use other non-
fermentative substrates in the medium for growth and do not form a halo around their
colonies.
An enrichment medium employs a slightly different twist. An enrichment medium (Table
5a and 5b) contains some component that permits the growth of specific types or species of
bacteria, usually because they alone can utilize the component from their environment.
However, an enrichment medium may have selective features. An enrichment medium for
nonsymbiotic nitrogen-fixing bacteria omits a source of added nitrogen to the medium. The
medium is inoculated with a potential source of these bacteria (e.g. a soil sample) and
incubated in the atmosphere wherein the only source of nitrogen available is N2. A selective
enrichment medium (Table 5b) for growth of the extreme halophile (Halococcus) contains
nearly 25 percent salt [NaCl], which is required by the extreme halophile and which inhibits
the growth of all other prokaryotes.

NUTRIENT AGAR

Bacteriological media come in a wide range of types. Nutrient Agar is a complex medium
because it contains ingredients with contain unknown amounts or types of nutrients. Nutrient
Agar contains Beef Extract (0.3%), Peptone (0.5%) and Agar (1.5%) in water. Beef extract is
the commercially prepared dehydrated form of autolysed beef and is supplied in the form of a
paste. Peptone is casein (milk protein) that has been digested with the enzyme pepsin.
Agar is purified from red algae in which it is an accessory polysaccharide (polygalacturonic
acid) of their cell walls. Agar is added to microbiological media only as a solidification
agent. Agar for most purposes has no nutrient value. Agar is an excellent solidification agent
because it dissolves at near boiling but solidifies at 45oC. Thus, one can prepare molten
(liquid) agar at 45oC, mix cells with it, then allow it to solidify thereby trapping living cells.
Below 45oC agar is a solid and remains so as the temperature is raised melting only when
>95oC is obtained.

CHOCOLATE AGAR:-
A non-selective medium for the isolation and cultivation of many pathogenic and non-
pathogenic microorganisms like Neisseria, Streptococci etc. The medium is often used to
observate the forms of haemolysis from pathogenic microorganisms.
This culture medium can be used without blood for setting up blood cultures and as a base for
preparing special culture media.
Principle and Interpretation:
Blood Agar Base formulation has been used as a base for preparation of blood agar and to
support good growth of a wide variety of fastidious microorganisms. Because it is a highly
nutritious medium it can also be used as a general purpose growth media without adding
blood.
For example it was used for studying irradiated Escherichia coli, phages of Clostridium
perfringens.
Meat extract and Peptone provide nitrogenous compounds, vitamins, carbon, sulphur and
amino acids in Blood Agar Base. The medium contains sodium chloride for the osmotic
balance. Blood Agar Bases are relatively free of reducing sugars, which have been reported to
adversely influence the hemolytic reactions of beta-hemolytic streptococci.
Sheep blood gives best results for Group A Streptococci. When horse blood is used,
Haemophilus haemolyticus colonies produce haemolysis and mimic Streptococcus.
Haemolytic patterns may vary with the source of animal blood or type of base medium used.
Norton found that slight acidic pH (6.8 ± 0.2) favours distinct haemolytic reaction and is
advantageous for cultivation of Streptococci and Pneumococci. The low pH helps in
stabilization of red blood corpuscles and favours the formation of clear haemolysis zone.
Boiled blood agar (“chocolate agar“) is prepared by heating after the blood has been added to
the Blood Agar Base.
Chocolate agar supplemented with 10% sterile defibrinated blood is suited for isolating
Haemophilus and Neisseria species. The blood agar can be used with added phenolphthalein
phosphate for the detection of phosphatise producing Staphylococci, with added salt and agar
for assessment of surface contamination on equipment and carcasses and to determine salinity
range of marine flavabacteria. lt was used for preparation of Salmonella typhi antigens.
For the selective isolation of tubercle bacilli the addition of 1 % glycerol and 25 % human
blood is recommended.
According to Hosty 0.1 % glycerol and 2.5 % human blood together with 100 IU/mol of
penicillin is sufficient. Sondag et al. and Black et al recommend an addition of 5 mg/l
gentamycine (e.g. 0.1 ml gentamycine solution Fluka 48755) to blood agar for the selective
cultivation of Streptococcus pneumonia and other Streptococci as weIl as bacterioides,
Clostridium and yeasts. Mishra et al. recommend an addition of ampicillin (30mg/l Fluka
10045) for the selective cultivation of Aeromonas (ampicillin sheep blood agar or ASB agar).

Mac CONKEY AGAR

MacConkey Agar is based on the bile salt-neutral red-lactose agar of MacConkey.8
The original MacConkey medium was used to differentiate strains of Salmonella typhosa
from members of the coliform group. Formula modifications improved the growth of
Shigella and Salmonella strains. These modifications included the addition
of 0.5% sodium chloride, decreased agar content, and altered bile salts and neutral red
concentrations. The formula improvements gave improved differential reactions between
these enteric pathogens and the coliform group.
MacConkey Agar contains crystal violet and bile salts that inhibit gram-positive organisms
and allow gram-negative organisms to grow. Isolated colonies of coliform bacteria are brick
red in color and may be surrounded by a zone of precipitated
bile. This bile precipitate is due to a local pH drop around the colony due to lactose
fermentation. Colonies that do not ferment lactose (such as typhoid, paratyphoid and
dysentery bacilli) remain colorless. When lactose non-fermenters grow in proximity to
coliform colonies, the surrounding medium appears as cleared areas.

 MacConkey agars are slightly selective and differential plating media mainly used for
the detection and isolation of gram-negative organisms from clinical,1 dairy,2
food,3,4 water,5 pharmaceutical6 and industrial7 sources.
 MacConkey Agar is used for isolating and differentiating lactose fermenting from
lactose-nonfermenting gram-negative enteric bacilli.
 MacConkey Agar Base is used with added carbohydrate in differentiating coliforms
based on fermentation reactions.
 MacConkey Agar without Crystal Violet is used for isolating and differentiating
enteric microorganisms while permitting growth of staphylococci and enterococci.
 The medium can be used also to separate Mycobacterium fortuitum and M. chelonae
from other rapidly growing mycobacteria.
  MacConkey Agar without Crystal Violet or Salt and MacConkey Agar without Salt
are used for isolating and differentiating gram-negative bacilli while suppressing the
swarming of most.

Principles of the Procedure

Peptones are sources of nitrogen and other nutrients. Lactose is a fermentable carbohydrate.
When lactose is fermented, a local pH drop around the colony causes a color change in the
pH indicator (neutral red) and bile precipitation. Bile salts, bile salts no. 3, oxgall and crystal
violet are selective agents that inhibit growth of gram-positive organisms. Agar is the
solidifying agent.

SEROLOGY LABORATORY
 Enzyme-Linked Immuno Sorbent Assay ( ELISA)

PRINCIPLE :

Enzyme-linked immunosorbent assay (ELISA), also known as an enzyme immunoassay

(EIA), is a biochemical technique used mainly in immunology to detect the presence of an
antibody or an antigen in a sample. The ELISA has been used as a diagnostic tool in medicine
and plant pathology, as well as a quality control check in various industries. In simple terms,
in ELISA, an unknown amount of antigen is affixed to a surface, and then a specific antibody
is applied over the surface so that it can bind to the antigen. This antibody is linked to an
enzyme, and in the final step a substance is added that the enzyme can convert to some
detectable signal. Thus in the case of fluorescence ELISA, when light of the appropriate
wavelength is shone upon the sample, any antigen/antibody complexes will fluoresce so that
the amount of antigen in the sample can be inferred through the magnitude of the
fluorescence .Performing an ELISA involves at least one antibody with specificity for a
particular antigen. The sample with an unknown amount of antigen is immobilized on a solid
support (usually a polystyrene microtiter plate) either non-specifically (via adsorption to the
surface) or specifically (via capture by another antibody specific to the same antigen, in a
"sandwich" ELISA). After the antigen is immobilized the detection antibody is added,
forming a complex with the antigen. The detection antibody can be covalently linked to an
enzyme, or can itself be detected by a secondary antibody which is linked to an enzyme
through bioconjugation. Between each step the plate is typically washed with a mild
detergent solution to remove any proteins or antibodies that are not specifically bound. After
the final wash step the plate is developed by adding an enzymatic substrate to produce a
visible signal, which indicates the quantity of antigen in the sample.

TYPES OF ELISA :-

1) DIRECT ELISA :

The direct ELISA uses the method of directly labeling the antibody itself. Microwell plates
are coated with a sample containing the target antigen, and the binding of labeled antibody is
quantitated by a colorimetric, chemiluminescent, or fluorescent end-point.

Advantages of Direct Detection Quick methodology since only one antibody is used. Cross-
reactivity of secondary antibody is eliminated. Disadvantages of Direct Detection
Immunoreactivity of the primary antibody may be reduced as a result of labeling. Labeling of
every primary antibody is time-consuming and expensive. No flexibility in choice of primary
antibody label from one experiment to another. Little signal amplification. e.
2) INDIRECT ELISA :

The indirect ELISA utilizes an unlabeled primary antibody in conjunction with a labeled
secondary antibody. Since the labeled secondary antibody is directed against all antibodies of
a given species (e.g. anti-mouse), it can be used with a wide variety of primary antibodies
(e.g. all mouse monoclonal antibodies).

Advantages of indirect detection Wide variety of labeled secondary antibodies are available
commercially. Versatile, since many primary antibodies can be made in one species and the
same labeled secondary antibody can be used for [Link] of the primary
antibody is not affected by labeling. Sensitivity is increased because each primary antibody
contains several epitopes that can be bound by the labeled secondary antibody, allowing for
signal amplification
3) Sandwich ELISA:
A sandwich ELISA. (1) Plate is coated with a capture antibody; (2) sample is added, and any
antigen present binds to capture antibody; (3) detecting antibody is added, and binds to
antigen; (4) enzyme-linked secondary antibody is added, and binds to detecting antibody; (5)
substrate is added, and is converted by enzyme to detectable form.

A less-common variant of this technique, called "sandwich" ELISA, is used to detect sample
antigen. The steps are as follows:

1. Prepare a surface to which a known quantity of capture antibody is bound.

2. Block any non specific binding sites on the surface.
3. Apply the antigen-containing sample to the plate.
4. Wash the plate, so that unbound antigen is removed.
5. Apply enzyme linked primary antibodies as detection antibodies which also bind
specifically to the antigen.
6. Wash the plate, so that the unbound antibody-enzyme conjugates are removed.
7. Apply a chemical which is converted by the enzyme into a color or fluorescent or
electrochemical signal.
8. Measure the absorbency or fluorescence or electrochemical signal (e.g., current) of
the plate wells to determine the presence and quantity of antigen.

The image above includes the use of a secondary antibody conjugated to an enzyme, though
technically this is not necessary if the primary antibody is conjugated to an enzyme.
However, use of a secondary-antibody conjugate avoids the expensive process of creating
enzyme-linked antibodies for every antigen one might want to detect. By using an enzyme-
linked antibody that binds the Fc region of other antibodies, this same enzyme-linked
antibody can be used in a variety of situations. Without the first layer of "capture" antibody,
any proteins in the sample (including serum proteins) may competitively adsorb to the plate
surface, lowering the quantity of antigen immobilized. Use of the purified specific antibody
to attach the antigen to the plastic eliminates a need to purify the antigen from complicated
mixtures before the measurement, simplifying the assay, and increasing the specificity and
the sensitivity of the assay.

4) Competitive ELISA:
A fourth use of ELISA is through competitive binding. The steps for this ELISA are
somewhat different than the first two examples:

1. Unlabeled antibody is incubated in the presence of its antigen (Sample)

2. These bound antibody/antigen complexes are then added to an antigen coated well.
3. The plate is washed, so that unbound antibody is removed. (The more antigen in the
sample, the less antibody will be able to bind to the antigen in the well, hence
"competition.")
4. The secondary antibody, specific to the primary antibody is added. This second
antibody is coupled to the enzyme.
5. A substrate is added, and remaining enzymes elicit a chromogenic or fluorescent
signal.

For competitive ELISA, the higher the sample antigen concentration, the weaker the eventual
signal. The major advantage of a competitive ELISA is the ability to use crude or impure
samples and still selectively bind any antigen that may be present.

(Note that some competitive ELISA kits include enzyme-linked antigen rather than enzyme-
linked antibody. The labeled antigen competes for primary antibody binding sites with your
sample antigen (unlabeled). The more antigen in the sample, the less labeled antigen is
retained in the well and the weaker the signal).

5) Reverse ELISA:

A new technique uses a solid phase made up of an immunosorbent polystyrene rod with 4-12
protruding ogives. The entire device is immersed in a test tube containing the collected
sample and the following steps (washing, incubation in conjugate and incubation in
chromogenous) are carried out by dipping the ogives in microwells of standard microplates
pre-filled with reagents.

The advantages of this technique are as follows:

1. The ogives can each be sensitized to a different reagent, allowing the simultaneous
detection of different antibodies and different antigens for multi-target assays;
2. The sample volume can be increased to improve the test sensitivity in clinical (saliva,
urine), food (bulk milk, pooled eggs) and environmental (water) samples;
 3. One ogive is left unsensitized to measure the non-specific reactions of the sample;
4. The use of laboratory supplies for dispensing sample aliquots, washing solution and
reagents in microwells is not required, facilitating ready-to-use lab-kits and on-site
kits.

VDRL TEST
Venereal Disease Research Laboratory (VDRL) Test is a slide flocculation test employed in
the diagnosis of syphilis. Since the antigen used in this test is cardiolipin, which is a lipoidal
extracted from beef heart, it is not a specific test. This test is also classified as non-specific or
non-treponemal or standard test. The antibodies reacting with cardiolipin antibodies have
been traditionally (but incorrectly) termed “regain”.
Principle: Patients suffering from syphilis produce antibodies that react with cardiolipin
antigen in a slide flocculation test, which are read using a microscope. It is not known if the
antibodies that react with cardiolipin are produced against some lipid component of
Treponema pallidum or as a result of tissue injury following infection.

CSF VDRL:
VDRL test may also be performed on CSF samples in the diagnosis of neurosyphilis.
Quantitative VDRL is the test of choice on CSF specimens. However, there are some
variations in this test. The antigen is diluted in equal volumes with 10% saline, CSF must not
be heated (or inactivated), the volume of antigen solution
taken is 0.01 ml (or 1 drop from 21 gauge needle) and rotation time is 8 minutes. Rest of the
procedure remains same.

Significance of VDRL test:

 VDRL test becomes positive 1-2 weeks after appearance of (primary lesion) chancre. The
test becomes reactive (50-75%) in the late phase of primary syphilis, becomes highly reactive
(100%) in the secondary syphilis and reactivity decreases (75%) thereafter. Treatment in the
early stages of infection may completely suppress production of antibodies and result in non-
reactive tests. Effective treatment in the primary or secondary stages results in rapid fall in
titre and the test may turn non-reactive in few months. Treatment in latent or late syphilis has
very little effect on the titre and the titres may persist at low levels for long periods. Since the
titre falls with effective treatment, it can be used for assessment of prognosis. VDRL test is
more suitable as a screening agent than a diagnostic tool.
VDRL test is also helpful in the diagnosis of congenital syphilis. Since passively transferred
antibodies through placenta may give false reactive test in serum of the infant, a repeat test
after a month showing no increase in titre may help rule out congenital syphilis.
Since the test employs a non-treponemal antigen, there are many chances of false positive
results. False positivity (other than technical) may be due to physiological of pathological
conditions. These are called biological false positives (BFP). If the remain positive for less
than 6 months it is considered acute and they remain positive for longer than 6 months it is
called chronic BFP. The physiological reasons for BFP include pregnancy, menstruation,
repeated blood loss, vaccination, severe trauma etc while the reasons for pathological BFP
include malaria, infectious mononucleosis, hepatitis, relapsing fever, tropical eosinophilia,
lepromatous leprosy, SLE, rheumatoid arthritis etc.
A reactive VDRL test does not necessarily imply that the person is syphilitic. The diagnosis
must be made in conjunction with clinical findings. Any reactive VDRL test must be
confirmed with a specific or treponemal test such as TPHA, FTA-ABS test.

TUBERCULOSIS LABORATORY
TUBERCULOSIS

What is Tuberculosis (TB)?

Tuberculosis (TB) is a disease caused by bacteria called Mycobacterium tuberculosis. The bacteria
usually attack the lungs. But, TB bacteria can attack any part of the body such as the kidney, spine,
and brain. If not treated properly, TB disease can be fatal.
TB is spread through the air from one person to another. The bacteria are put into the air when a
person with active TB disease of the lungs or throat coughs or sneezes. People nearby may breathe
in these bacteria and become infected.
However, not everyone infected with TB bacteria becomes sick.

People who are not sick have what is called latent TB infection. People who have latent TB
infection do not feel sick, do not have any symptoms, and cannot spread TB to others. But, some
people with latent TB infection go on to get TB disease.

People with active TB disease can be treated and cured if they seek medical help. Even better,
people with latent TB infection can take medicine so that they will not develop active TB disease.

How is TB spread?
TB is spread through the air from one person to another. The bacteria are put into the air when a
person with active TB disease of the lungs or throat coughs or sneezes. People nearby may breathe
in these bacteria and become infected.
When a person breathes in TB bacteria, the bacteria can settle in the lungs and begin to grow. From
there, they can move through the blood to other parts of the body, such as the kidney, spine, and
brain.

TB in the lungs or throat can be infectious. This means that the bacteria can be spread to other
people. TB in other parts of the body, such as the kidney or spine, is usually not infectious.

People with active TB disease are most likely to spread it to people they spend time with every
day. This includes family members, friends, and coworkers.

What is latent TB infection?

In most people who breathe in TB bacteria and become infected, the body is able to fight the
bacteria to stop them from growing. The bacteria become inactive, but they remain alive in the
body and can become active later. This is called latent TB infection. People with latent TB
infection

  have no symptoms
  don't feel sick
  can't spread TB to others
  usually have a positive skin test reaction
   can develop active TB disease if they do not receive treatment for latent TB infection

Many people who have latent TB infection never develop active TB disease. In these people, the
TB bacteria remain inactive for a lifetime without causing disease. But in other people, especially
people who have weak immune systems, the bacteria become active and cause TB disease.

What is active TB disease?

TB bacteria become active if the immune system can't stop them from growing. The active bacteria
begin to multiply in the body and cause active TB disease. The bacteria attack the body and
destroy tissue. If this occurs in the lungs, the bacteria can actually create a hole in the lung. Some
people develop active TB disease soon after becoming infected, before their immune system can
fight the TB bacteria. Other people may get sick later, when their immune system becomes weak
for another reason.

Babies and young children often have weak immune systems. People infected with HIV, the virus
that causes AIDS, have very weak immune systems. Other people can have weak immune systems,
too, especially people with any of these conditions:

  substance abuse
  diabetes mellitus
  silicosis
  cancer of the head or neck
  leukemia or Hodgkin's disease
  severe kidney disease
  low body weight
  certain medical treatments (such as corticosteroid treatment or organ transplants)
  specialized treatment for rheumatoid arthritis or Crohn's disease

Symptoms of TB depend on where in the body the TB bacteria are growing. TB bacteria usually
grow in the lungs. TB in the lungs may cause symptoms such as

  a bad cough that lasts 3 weeks or longer

  pain in the chest
  coughing up blood or sputum (phlegm from deep inside the lungs)

Other symptoms of active TB disease are

  weakness or fatigue
  weight loss
  no appetite
  chills
  fever
  sweating at night

MYCOBACTERIUM TUBERCULOSIS

Mycobacterium tuberculosis (MTB) is a pathogenic bacterial species in the genus

Mycobacterium and the causative agent of most cases of tuberculosis.[1] First discovered in
1882 by Robert Koch.

The physiology of M. tuberculosis is highly aerobic and requires high levels of oxygen.
Primarily a pathogen of the mammalian respiratory system, MTB infects the lungs, causing
tuberculosis.

The M. tuberculosis genome was sequenced in 1998.

Treatment

Treatment is usually administered on an outpatient basis and it consists mainly of medication.

Usually, the treatment is given for six to nine months according to a therapy regimen
consisting of two months of isoniazid, rifampin, and pyrazinamide, four months of isoniazid
and rifampin and ethambutol or streptomycin until the drug sensitivity is known. The drug
treatment schema may be changed according to the laboratory results.

Antibiotics are usually part of therapy in people who have no symptoms and whose germs are
in inactive state. Antibiotics in this case are helpful in preventing the activation of the
infection. The antibiotic used for this purpose is called isoniazid (INH). If taken for six to 12
months, it will prevent the tuberculosis from becoming active in the future. This medicine
may not however be taken during pregnancy or in people who suffer from liver disease or
alcoholism. Moreover, several side effects have been reported to this drug and some of them
can be even life-threatening. One of the side effects caused by this drug is peripheral
neuropathy, meaning a decreased sensation in the extremities and which is normally
prevented or avoided by administering vitamin B6 at the same time with isoniazid.
Patients who have active bacteria are usually treated with a combination of medications, at
the same time with the main antibiotic, isoniazid. The main drugs used in conjunction with
isoniazid are rifampin, ethambutol and pyrazinamide.

Streptomycin, a drug that is given by injection, may be used as well, particularly when the
disease is extensive and/or the patients do not take their oral medications reliably (termed
"poor compliance").

Usually treatment lasts for few months but it can even be administered for years, in some
cases. Mainly, the rate of success of the treatment is in close relation with the patient's
compliance and ability to take the drugs as prescribed.

Diagnosis

Sputum is taken on three successive mornings as the number of organisms could be low, and
the specimen is treated with 3% KOH or NaOH for liquefaction and decontamination. Gram
stain should never be performed, as the organism is an "acid-fast bacillus" (AFB), meaning
that it retains certain stains after being treated with acidic solution. In the most common
staining technique, the Ziehl-Neelsen stain, AFB are stained a bright red, which stands out
clearly against a blue background; therefore, the bacteria are sometimes called red snappers.
The reason for the acid-fast staining is because of its thick waxy cell wall. The waxy quality
of the cell wall is mainly due to the presence of mycolic acids. This waxy cell wall also is
responsible for the typical caseous granuloma formation in tuberculosis. The component
responsible, trehalose dimycolate, is called the cord factor. A grading system exists for
interpretation of the microscopic findings based on the number of organisms observed in each
field. Patients of pulmonary tuberculosis show AFB (acid fast bacillus) in their sputum in
only 50% of cases, which means that, even if no organisms are observed, further
investigation is still required. Acid-fast bacilli can also be visualized by fluorescent
microscopy using auramine-rhodamine stain for screening, which makes them appear
somewhat golden in color. Also, M. tuberculosis is grown on a selective medium known as
Lowenstein-Jensen medium, which has traditionally been used for this purpose. However,
this method is quite slow, as this organism requires 6–8 weeks to grow, which delays
reporting of results. A faster result can now be obtained using Middlebrook medium or
BACTEC.
It should be taken into consideration that during an advanced stage of tuberculosis, the
organism may infect almost any part of the body, which means that a specimen should
appropriately be chosen (e.g. intestinal tuberculosis-stool).

An immunochromatographic serological essay for the diagnosis of M. tuberculosis has also

been developed.

DETECTION OF MYCOBACTERIUM TUBERCULOSIS BY STAINING:

1) Ziehl–Neelsen stain:

The Ziehl–Neelsen stain, also known as the acid-fast stain, was first described by two
German doctors; Franz Ziehl (1859 to 1926), a bacteriologist and Friedrich Neelsen (1854 to
1894), a pathologist.

PURPOSE:

It is a special bacteriological stain used to identify acid-fast organisms, mainly

Mycobacterium tuberculosis. It is helpful in diagnosing Mycobacterium tuberculosis since its
lipid rich cell wall makes it resistant to Gram stain. It can also be used to stain few other
bacteria like Nocardia. The reagents used are Ziehl–Neelsen carbolfuchsin, acid alcohol and
methylene blue. Acid-fast bacilli will be bright red after staining.
2)Auramine-rhodamine stain:

The auramine-rhodamine stain (AR), also known as the Truant auramine-rhodamine stain, is
a histological technique used to visualizee acid-fast bacilli using fluorescence microscopy,
notably species in the Mycobacterium genus.[1] Acid-fast organisms display a reddish-yellow
fluorescence.[2] Although the auramine-rhodamine stain is not as specific for acid-fast
organisms (i.e. Mycobacterium tuberculosis or Nocardia) as the Ziehl-Neelsen stain, it is
more affordable and more sensitive, therefore it is often utilized as a screening tool. AR stain
is a mixture of Auramine O and Rhodamine B

Auramine O, also called Basic yellow 2, Pyocatanium aureum, aizen auramine, Pyoktanin

Yellow, Canary Yellow, Pyoktanin, or C.I. 41000, is a diarylmethane dye used as a
fluorescent stain. Auramine O can be used to stain acid-fast bacteria (e.g. Mycobacterium),
where it binds to the mycolic acid in its cell wall) in a way similar to Ziehl-Neelsen stain.
Auramine O can be used together with Rhodamine B as the Truant auramine-rhodamine
stain for Mycobacterium tuberculosis..

Rhodamine dyes fluoresce and can thus be detected easily and inexpensively with

instruments called fluorometers. Rhodamine dyes are used extensively in biotechnology
applications such as fluorescence microscopy, flow cytometry, fluorescence correlation
spectroscopy and ELISA.
Rhodamine B is used in biology as a staining fluorescent dye, sometimes in combination
with auramine O, as the auramine-rhodamine stain to demonstrateacid-fast organisms,
notably Mycobacterium.

CULTURE OF MYCOBACTERIUM TUBERCULOSIS

Lowenstein Medium and Lowenstein-Jensen (LJ) Medium are used for the isolation and
cultivation of mycobacteria and as bases for selective, differential and enriched media for
mycobacteria.
LJ Medium, tubed as deeps, is used for the semi-quantitative catalase test.
LJ Medium, Gruft, is a selective medium used for the isolation and cultivation of
mycobacteria.
LJ Medium with Iron is used to determine iron uptake for differentiation and identification of
mycobacteria.

LJ Medium with Pyruvic Acid is an enrichment medium used for enhanced growth of
mycobacteria.
LJ Medium with 5% sodium chloride is used to characterize certain strains of mycobacteria.

Summary and Explanation

LJ Medium is an inspissated, egg-based medium developed from Jensen’s modification of

Lowenstein’s formula. Gruft modified LJ Medium by adding penicillin and nalidixic acid for
selective isolation of mycobacteria. Gruft also found that the addition of ribonucleic acid
(RNA) increased the percentage of tubercle bacilli recovered from clinical specimens
compared to recovery on the standard LJ Medium. Wayne and Doubek differentiated rapidly-
growing from slow-growing mycobacteria based on iron intake. The rapidgrowing
mycobacteria take up iron in the medium, producing rusty-brown colonies and a tan
discoloration in the medium. M. chelonae and slow-growing species do not take up the iron.
Hughes and Dixon and Cuthbert reported that the addition of pyruvic acid to egg-based
media resulted in improved recovery of tubercle bacilli compared to recovery on egg-based
media supplemented only with glycerol. Dixon and Cuthbert recommended using pyruvic
acid-egg medium in addition to media supplemented with glycerol for optimum recovery of
tubercle bacilli from clinical specimens.

Principles of the Procedure

Lowenstein Medium Base is a relatively simple formulation that requires supplementation in

order to support the growth of mycobacteria. Glycerol and egg mixture are added prior to the
inspissation process. These substances provide fatty acids and protein required for the
metabolism of mycobacteria. The coagulation of the egg albumin during sterilization
provides a solid medium for inoculation purposes. Malachite green selectively inhibits
contaminants.
Low-level concentrations of penicillin (50.0 units/mL) and nalidixic acid (35.0 mg/mL) are
included in the LJ Medium,
Gruft, to inhibit gram-positive as well as some gram-negative bacterial contaminants. The
addition of RNA (0.05 mg/mL) enhances the recovery of tubercle bacilli. In the iron uptake
test, most rapid growers take up the iron salt in the medium (ferric ammonium citrate, 25
mg/mL), producing rusty brown colonies and a tan discoloration in the surrounding medium.
Slow-growing species and most strains of M. chelonae do not take up the iron in the medium.

Pyruvic acid (2.5 mg/mL) enhances the growth of tubercle bacilli. The ability to tolerate 5%
sodium chloride is a characteristic of certain strains of mycobacteria (e.g., M. fortuitum and
M. chelonae subsp. abscessus). Catalase is an intracellular, soluble enzyme capable of
splitting hydrogen peroxide into water and oxygen. The oxygen bubbles into the reaction
mixture creating a column of bubbles. With a column height breakpoint of 45 mm, the
mycobacteria can be divided into groups: those producing less than 45 mm (M. tuberculosis,
M. marinum, M. avium complex and M. gastri); and those producing more than 45 mm (M.
kansasii, M. simiae, most scotochromogens, the non-photochromogenic saprophytes and the
rapid growers)

POLYMERASE CHAIN REACTION (PCR) :

INTRODUCTION

The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a

single or few copies of a piece of DNA across several orders of magnitude, generating
thousands to millions of copies of a particular DNA sequence. The method relies on thermal
cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting
and enzymatic replication of the DNA.
Primers (short DNA fragments) containing sequences complementary to the target region
along with a DNA polymerase (after which the method is named) are key components to
enable selective and repeated amplification.
As PCR progresses, the DNA generated is itself used as a template for replication, setting in
motion a chain reaction in which the DNA template is exponentially amplified. PCR can be
extensively modified to perform a wide array of genetic manipulations.
Almost all PCR applications employ a heat-stable DNA polymerase, such as Taq polymerase,
an enzyme originally isolated from the bacterium Thermus aquaticus. This DNA polymerase
enzymatically assembles a new DNA strand from DNA building blocks, the nucleotides, by
using single-stranded DNA as a template and DNA oligonucleotides (also called DNA
primers), which are required for initiation of DNA synthesis.
The vast majority of PCR methods use thermal cycling, i.e., alternately heating and cooling
the PCR sample to a defined series of temperature steps. These thermal cycling steps are
necessary first to physically separate the two strands in a DNA double helix at a high
temperature in a process called DNA melting. At a lower temperature, each strand is then
used as the template in DNA synthesis by the DNA polymerase to selectively amplify the
target DNA.
The selectivity of PCR results from the use of primers that are complementary to the DNA
region targeted for amplification under specific thermal cycling conditions.
Developed in 1983 by Kary Mullis PCR is now a common and often indispensable technique
used in medical and biological research labs for a variety of [Link] include DNA
cloning for sequencing, DNA-based phylogeny, or functional analysis of genes; the diagnosis
of hereditary diseases; the identification of genetic fingerprints (used in forensic sciences and
paternity testing); and the detection and diagnosis of infectious diseases. In 1993, Mullis was
awarded the Nobel Prize in Chemistry for his work on PCR.

A strip of eight PCR tubes, each containing a 100 μL reaction mixture

PCR principles and procedure:

PCR is used to amplify a specific region of a DNA strand (the DNA target). Most PCR
methods typically amplify DNA fragments of up to ~10 kilo base pairs (kb), although some
techniques allow for amplification of fragments up to 40 kb in size.

A basic PCR set up requires several components and reagent These components include:

 DNA template that contains the DNA region (target) to be amplified.

 Two primers that are complementary to the 3' (three prime) ends of each of the sense
and anti-sense strand of the DNA target.
 Taq polymerase or another DNA polymerase with a temperature optimum at around
70 °C.
  Deoxynucleoside triphosphates (dNTPs; also very commonly and erroneously called
deoxynucleotide triphosphates), the building blocks from which the DNA
polymerases synthesizes a new DNA strand.
 Buffer solution, providing a suitable chemical environment for optimum activity and
stability of the DNA polymerase.
 Divalent cations, magnesium or manganese ions; generally Mg2+ is used, but Mn2+ can
be utilized for PCR-mediated DNA mutagenesis, as higher Mn2+ concentration
increases the error rate during DNA synthesis.
 Monovalent cation potassium ions.

The PCR is commonly carried out in a reaction volume of 10–200 μl in small reaction tubes
(0.2–0.5 ml volumes) in a thermal cycler. The thermal cycler heats and cools the reaction
tubes to achieve the temperatures required at each step of the reaction (see below). Many
modern thermal cyclers make use of the Peltier effect which permits both heating and cooling
of the block holding the PCR tubes simply by reversing the electric current. Thin-walled
reaction tubes permit favorable thermal conductivity to allow for rapid thermal equilibration.
Most thermal cyclers have heated lids to prevent condensation at the top of the reaction tube.
Older thermocyclers lacking a heated lid require a layer of oil on top of the reaction mixture
or a ball of wax inside the tube.

PCR MACHINE THERMAL CYCLER FOR PCR

PROCEDURE:
Typically, PCR consists of a series of 20-40 repeated temperature changes, called cycles,
with each cycle commonly consisting of 2-3 discrete temperature steps, usually three (Fig. 2).
The cycling is often preceded by a single temperature step (called hold) at a high temperature
(>90°C), and followed by one hold at the end for final product extension or brief storage. The
temperatures used and the length of time they are applied in each cycle depend on a variety of
parameters. These include the enzyme used for DNA synthesis, the concentration of divalent
ions and dNTPs in the reaction, and the melting temperature (Tm) of the primers.

 Initialization step: This step consists of heating the reaction to a temperature of 94–
96 °C (or 98 °C if extremely thermostable polymerases are used), which is held for 1–
9 minutes. It is only required for DNA polymerases that require heat activation by
hot-start PCR.

 Denaturation step: This step is the first regular cycling event and consists of heating
the reaction to 94–98 °C for 20–30 seconds. It causes DNA melting of the DNA
template by disrupting the hydrogen bonds between complementary bases, yielding
single-stranded DNA molecules.
 Annealing step: The reaction temperature is lowered to 50–65 °C for 20–40 seconds
allowing annealing of the primers to the single-stranded DNA template. Typically the
annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used.
Stable DNA-DNA hydrogen bonds are only formed when the primer sequence very
closely matches the template sequence. The polymerase binds to the primer-template
hybrid and begins DNA synthesis.
 Extension/elongation step: The temperature at this step depends on the DNA
polymerase used; Taq polymerase has its optimum activity temperature at 75–80 °C,
[10][11]
and commonly a temperature of 72 °C is used with this enzyme. At this step the
DNA polymerase synthesizes a new DNA strand complementary to the DNA
template strand by adding dNTPs that are complementary to the template in 5' to 3'
direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl group
at the end of the nascent (extending) DNA strand. The extension time depends both
on the DNA polymerase used and on the length of the DNA fragment to be amplified.
As a rule-of-thumb, at its optimum temperature, the DNA polymerase will polymerize
a thousand bases per minute. Under optimum conditions, i.e., if there are no
limitations due to limiting substrates or reagents, at each extension step, the amount of
DNA target is doubled, leading to exponential (geometric) amplification of the
specific DNA fragment.

 Final elongation: This single step is occasionally performed at a temperature of 70–

74 °C for 5–15 minutes after the last PCR cycle to ensure that any remaining single-
stranded DNA is fully extended.

 Final hold: This step at 4–15 °C for an indefinite time may be employed for short-
term storage of the reaction.
Figure 3: Ethidium bromide-stained PCR products after gel electrophoresis. Two sets of
primers were used to amplify a target sequence from three different tissue samples. No
amplification is present in sample #1; DNA bands in sample #2 and #3 indicate successful
amplification of the target sequence. The gel also shows a positive control, and a DNA ladder
containing DNA fragments of defined length for sizing the bands in the experimental PCRs.

To check whether the PCR generated the anticipated DNA fragment (also sometimes referred
to as the amplimer or amplicon), agarose gel electrophoresis is employed for size separation
of the PCR products. The size(s) of PCR products is determined by comparison with a DNA
ladder (a molecular weight marker), which contains DNA fragments of known size, run on
the gel alongside the PCR products .

PURPOSE OF DOING PCR:

To do PCR, the original DNA that one wishes to copy need not be pure or abundant. It can be
pure but it also can be a minute part of a mixture of materials. So, PCR has found widespread
and innumerable uses -- to diagnose genetic diseases, do DNA fingerprinting, find bacteria
and viruses, study human evolution, clone the DNA of an Egyptian mummy biological
relationships, etc.. Accordingly, PCR has become an essential tool for biologists, DNA
forensics labs, and many other laboratories that study genetic material., establish paternity
ETC.

APPLICATIONS OF PCR

Selective DNA isolation

PCR allows isolation of DNA fragments from genomic DNA by selective amplification of a
specific region of DNA. This use of PCR augments many methods, such as generating
hybridization probes for Southern or northern hybridization and DNA cloning, which require
larger amounts of DNA, representing a specific DNA region. PCR supplies these techniques
with high amounts of pure DNA, enabling analysis of DNA samples even from very small
amounts of starting material.

Other applications of PCR include DNA sequencing to determine unknown PCR-amplified

sequences in which one of the amplification primers may be used in Sanger sequencing,
isolation of a DNA sequence to expedite recombinant DNA technologies involving the
insertion of a DNA sequence into a plasmid or the genetic material of another organism.
Bacterial colonies ([Link]) can be rapidly screened by PCR for correct DNA vector
constructs.[15] PCR may also be used for genetic fingerprinting; a forensic technique used to
identify a person or organism by comparing experimental DNAs through different PCR-
based methods.

Some PCR 'fingerprints' methods have high discriminative power and can be used to identify
genetic relationships between individuals, such as parent-child or between siblings, and are
used in paternity testing (Fig. 4). This technique may also be used to determine evolutionary
relationships among organisms.

Figure 4: Electrophoresis of PCR-amplified DNA fragments. (1) Father. (2) Child. (3)
Mother. The child has inherited some, but not all of the fingerprint of each of its parents,
giving it a new, unique fingerprint.

Amplification and quantification of DNA

Because PCR amplifies the regions of DNA that it targets, PCR can be used to analyze
extremely small amounts of sample. This is often critical for forensic analysis, when only a
trace amount of DNA is available as evidence. PCR may also be used in the analysis of
ancient DNA that is tens of thousands of years old. These PCR-based techniques have been
successfully used on animals, such as a forty-thousand-year-old mammoth, and also on
human DNA, in applications ranging from the analysis of Egyptian mummies to the
identification of a Russian tsar.

Quantitative PCR methods allow the estimation of the amount of a given sequence present in
a sample—a technique often applied to quantitatively determine levels of gene expression.
Real-time PCR is an established tool for DNA quantification that measures the accumulation
of DNA product after each round of PCR amplification.

PCR in diagnosis of diseases

PCR permits early diagnosis of malignant diseases such as leukemia and lymphomas, which
is currently the highest developed in cancer research and is already being used routinely. PCR
assays can be performed directly on genomic DNA samples to detect translocation-specific
malignant cells at a sensitivity which is at least 10,000 fold higher than other methods.

PCR also permits identification of non-cultivatable or slow-growing microorganisms such as

mycobacteria, anaerobic bacteria, or viruses from tissue culture assays and animal models.
The basis for PCR diagnostic applications in microbiology is the detection of infectious
agents and the discrimination of non-pathogenic from pathogenic strains by virtue of specific
genes.

Viral DNA can likewise be detected by PCR. The primers used need to be specific to the
targeted sequences in the DNA of a virus, and the PCR can be used for diagnostic analyses or
DNA sequencing of the viral genome. The high sensitivity of PCR permits virus detection
soon after infection and even before the onset of disease. Such early detection may give
physicians a significant lead in treatment. The amount of virus ("viral load") in a patient can
also be quantified by PCR-based DNA quantitation techniques.

IDENTIFICATION OF MYCOBACTERIUM TUBERCULOSIS BY

POLYMERASE CHAIN REACTION IN CLINICAL SPECIMENS

INTRODUCTION
Tuberculosis is a major health problem in the developing world where nearly 95% of all the
cases of pulmonary tuberculosis in the world are located. The diagnosis of tuberculosis is
difficult in extra pulmonary tuberculosis and in situations where clinical diagnosis is
suggestive but bacteriological proof is lacking. Detection of acid fast bacilli by conventional
microscopy is simple and rapid but lacks adequate sensitivity, whereas culture is
comparatively more sensitive and specific, but result becomes available after several weeks.
The serological tests available are also marred by a wide range of specificity and sensitivity
ratings. Hence, there is need for an alternative detection method which is specific, sensitive
and quick, particularly so when bacteriological proof of diagnosis is lacking. In recent years,
polymerase chain reaction (PCR) test has been found to be useful for rapid diagnosis of
tuberculosis from a variety of clinical specimens. “ The present study is an attempt to assess
the role of PCR in the diagnosis of tuberculosis in comparison with other conventional
methods.

Experimental Procedures
 Sample Preparation
 Preparation of Clinical Samples for DNA Extraction
 DNA Extraction
 Quantitation of Mycobacterial DNA
 Purity Check of Extracted DNA
 Amplification of Mycobacterial DNA by PCR
 Analysis of PCR Products
MATERIALS
AND
METHODS
BACTERIOLOGY LABORATORY
 STREAKING –

Materials:

Petri dish containing (set - fairly firm - dry) nutrient agar.

Wire loops, mounted in metal handle

Inoculum material in broth or other (liquid) medium

Procedure:

Clear an area of bench, and wipe it with disinfectant.

Flame a wire loop, bringing it all to red heat, and leave it upright in a rack to cool.

1) Using the loop, take a drop of the liquid culture medium (broth) provided and spread it
carefully in a line across the surface of the agar as shown. With the same loop, a second, third
and fourth line may be drawn parallel to the first. Close the lid of the Petri dish immediately.

2) Sterilise the loop in the flame once again, and allow it to cool.

3) Turn the Petri dish so that the end of the previous lines can be the start of the next ones.

4) Take a cooled loop and make 2 or 3 strokes as before. Close the lid of the Petri dish
immediately.

Repeat 2,3,4 until there is no more space round the edge (4 or 5 times), then finish off with a
single zigzag streak across the middle.
INOCULATION OF CULTURE MEDIA

[Link] the effective detection of the bacterial content of specimens, it is important to achieve
growth of individual colonies by using a good technique to inoculate the specimen on to
culture medium.

2. All culture media should be checked before use for contamination and expiry date. Culture
media should
have an identifiable batch or quality control number and have passed QC tests before use
Plates that are
beyond their expiry date, contaminated plates, and broth media appearing unusually turbid
should be
discarded
3. The initial area inoculated should cover between a quarter and a third of the total area of
agar used. Whole
plates, half plates, or quarter plates can be used depending on the circumstances. Specimens
may be
plated out for individual colonies, or seeded directly over an entire segment of a plate and
incubated
without further spreading
4. Wire loops should be flamed by holding them loop end down in a Bunsen flame until the
loop and entire
wire reach red heat. Place on a rack to cool before use. This should be done before and after
use and
between agar plates. It is usual to use two loops, to allow adequate cooling of one after
flaming whilst the
other is in use. Different disposable loops should be used for each plate
5. In a potentially heavily contaminated sample, the loop should either be flamed between
each series of
streak, or the loop may be rotated to make the next series of streaks with the unused side of
the loop. For
semi-quantitative analysis of urine the loop should not be flamed in this way
6. All media should be incubated as soon as possible after inoculation to prevent loss of
viability. Plates for anaerobic incubation.
PREPARATION OF NUTRIENT AGAR

To prepare 200 ml of Nutrient Agar

 MATERIALS:
1. Electronic or beam balances.
2. Weigh boats, tongue depressors.
3. 10 ml nonsterile pipettes.
4. Tripods, asbestos wire-gauze, asbestos gloves.
5. pH paper or pH meter with standard buffers.
6. 4 13x100 mm screw capped culture tubes.
7. Graduated Cylinder, 250 ml.
8. 2 500ml Erlenmeyer Flasks
9. Beef Extract, Peptone, Agar.
10. 3 N HCl, 3 N KOH.
11. 16 x 150 mm screw cap culture tubes.
12. Nonabsorbent cotton and gauze to make cotton stoppers.

Nutrient Agar
 Beef Extract: 0.3%
 Peptone: 0.5%
 Agar: 1.5%

PROCEDURE:
1. You will be making 200 ml of Nutrient Agar. To weigh out Beef Extract, first tare a tongue
depressor, then dip it into the Beef Extract and weigh. Adjust the amount of Beef Extract
until the correct amount is obtained. You need to weight out enough Beef Extract to get a
0.3% solution.
2. Tare a weigh boat and weigh out enough Peptone and add that to the flask.
3. Add 200 ml of distilled water and swirl to dissolve the peptone and beef extract. Check the
pH, it should be 7.0.
[Link] a weigh boat and weigh out enough Agar and add that to the flask.
5. With a bunsen burner, tripod, asbestos wire-gauze, heat the medium to boiling to dissolve
the agar.
PRECAUTIONS:
1) keep the rotating the flasks to prevent the agar from cooking onto the
bottom of the flask and
2) watch out: boiling agar can froth and boil out all over the lab bench.
As soon as it begins to boil take it off the heat and put it on to the bench. Allow it to cool a
few minutes.
3) While the agar is still warm, but not hot, pipette 3 ml each into 4 13x100 mm screw cap
culture tubes.
4) Label the flask and your tubes with your name.
5) After preparation of your medium, the instructor will take you to the autoclave.
6) Place your media in the autoclave.
7) After discussion of the parts of the autoclave, autoclave the medium for 20 minutes.

PREPERATION OF CHOCOLATE AGAR AND BLOOD AGAR:-

Composition:
Ingredients Grams/Litre
Meat extract 10.0
Peptone 10.0
Sodium chloride 5.0
Agar 15.0
Final pH 7.3+/-0.2 at 37°C
Store prepared media below 8°C, protected from direct light. Store dehydrated powder, in a
dry place, in tightly-sealed containers at 2-25°C.

PROCEDURE:
1. Suspend 40 g mixture of the above ingredients in 1 litre of distilled water.
2. Bring to a boil to dissolve completely.
3. Sterilize by autoclaving at 121°C for 15 minutes.
4. For blood agar, cool to 45-50°C and add aseptically 6% (5-10% is typically) of sterile
defibrinated blood.
PREPARATION OF Mac CONKEY AGAR:-

COMPOSITION:
Approximate Formula* Per Liter

Peptone ................................................................... 17.0 g

Proteose Peptone ....................................................... 3.0 g
Lactose ..................................................................... 10.0 g
Bile Salts No. 3 ........................................................... 1.5 g
Sodium Chloride ........................................................ 5.0 g
Agar ......................................................................... 13.5 g
Neutral Red ................................................................ 0.03 g
Crystal Violet .............................................................. 1.0 mg

PROCEDURE:

1. Suspend the powder in 1 L of purified water:

2. Heat with frequent agitation and boil for 1 minute to completely dissolve the powder.
3. Autoclave at 121°C for 15 minutes.
NOTE: If MacConkey Agar Base is to be used within 12 hours, omit autoclaving and gently
boil medium for 5 minutes.
Add 1% carbohydrate before or after autoclaving, depending upon heat lability. The surface
of MacConkey agars without salt should be thoroughly air-dried prior to inoculation.
4. Test samples of the finished product for performance using stable, typical control cultures.
SEROLOGY LABORATORY
DIRECT ELISA PROTOCOL
Buffers and Reagents:
Bicarbonate/carbonate coating buffer (100 mM)
Antigen or antibody should be diluted in coating buffer to immobilize them to the wells:
3.03 g Na2CO3,
6.0 g NaHCO3
1000 ml distilled water
pH 9.6,

PBS:
1.16 g Na2HPO4,
0.1 g KCl,
0.1 g K3PO4,
4.0 g NaCl (500 ml distilled water) pH 7.4.
Blocking solution:
Commonly used blocking agents are 1% BSA , serum, non-fat dry milk, casein, gelatin in
PBS.
Wash solution:
Usually PBS or Tris -buffered saline (pH 7.4) with detergent such as 0.05% (v/v) Tween20
(TBST).
Antibody dilution buffer:
Primary and secondary antibody should be diluted in 1x blocking solution to reduce
Non specific binding.

General Procedure:
Coating antigen to microplate:
1. Dilute the antigen to a final concentration of 20 μg/ml in PBS or other carbonate buffer.
Coat the wells of a PVC microtiter plate with the antigen by pipeting 50 μl of the antigen
dilution in the top wells of the plate. Dilute down the plate as required.
Test samples containing pure antigen are usually pipeted onto the plate at less than 2ug/ml.
Pure solutions are not essential, but as a guideline, over 3% of the protein in the test sample
should be the target protein. (antigen). Antigen protein concentration should not be over
20ug/ml as this will saturate most of the available sites on the microtitre plate.
Ensure the samples contain the antigen at a concentration that is within the detection range
of the antibody.
2. Cover the plate with an adhesive plastic and incubate for 2 h at room temperature, or 4oC
overnight. The coating
incubation time may require some optimisation.
3. Remove the coating solution and wash the plate twice by filling the wells with 200 μl PBS.
The solutions
or washes are removed by flicking the plate over a sink. The remaining drops are removed by
patting the plate on a paper towel.

Blocking:
4. Block the remaining protein-binding sites in the coated wells by adding 200 μl blocking
buffer, 5% non fat dry milk/PBS, per well. Alternative blocking reagents include BlockACE
or BSA.
5. Cover the plate with an adhesive plastic and incubate for at least 2 h at room temperature
or, if more convenient, overnight at 4°C.
[Link] the plate twice with PBS.

Incubation with the Antibody:

7. Add 100 μl of the antibody, diluted at the optimal concentration (according to the
manufacturer’s instructions) in blocking buffer immediately before use.
8. Cover the plate with an adhesive plastic and incubate for 2 h at room temperature.
This incubation time may require optimisation. Although 2 hours is usually enough to obtain
a strong signal, if a weak signal is obtained, stronger staining will often observed when
incubated overnight at 4oC.
9. Wash the plate four times with PBS.

Detection :
10. Dispense 100 μl (or 50 μl) of the substrate solution per well with a multichannel pipet or a
multipipet.
11. After sufficient color development (if it is necessary) add 100 μl of stop solution to the
wells.
12. Read the absorbance (optical density) of each well with a UV Spectrophotometer.
Note: some enzyme substrates are considered hazardous (potential carcinogens), therefore
always handle with care and wear gloves.

Analysis of data:
Prepare a standard curve from the data produced from the serial dilutions with concentration
on the x axis (log scale) vs absorbance on the Y axis (linear). Interpolate the concentration of
the sample from this standard curve.

INDIRECT ELISA PROTOCOL :

Buffers and Reagents:

 Bicarbonate/carbonate coating buffer (100 mM)

o Antigen or antibody should be diluted in coating buffer to immobilize them to the

wells:
o 3.03 g Na2CO3,
o 6.0 g NaHCO3
o 1000 ml distilled water
o pH 9.6,

 PBS:
o 1.16 g Na2HPO4,
o g KCl,
o g K3PO4,
o 4.0 g NaCl (500 ml distilled water) pH 7.4.
 Blocking solution:
Commonly used blocking agents are 1% BSA , serum, non-fat dry milk, casein, gelatin in
PBS.
 Wash solution:
Usually PBS or Tris -buffered saline (pH 7.4) with detergent such as 0.05% (v/v) Tween20
(TBST).
 Antibody dilution buffer:
Primary and secondary antibody should be diluted in 1x blocking solution to reduce
Non specific binding.

General Procedure:

 Coating antigen to microplate:

1. Dilute the antigen to a final concentration of 20 μg/ml in PBS or other carbonate buffer.
Coat the wells of a PVC microtiter plate with the antigen by pipeting 50 μl of the antigen
dilution in the top wells of the plate. Dilute down the plate as required.
Test samples containing pure antigen are usually pipeted onto the plate at less than 2ug/ml.
Pure solutions are not essential, but as a guideline, over 3% of the protein in the test sample
should be the target protein. (antigen). Antigen protein concentration should not be over
20ug/ml as this will saturate most of the available sites on the microtitre plate.
Ensure the samples contain the antigen at a concentration that is within the detection range
of the antibody.
2. Cover the plate with an adhesive plastic and incubate for 2 h at room temperature, or 4oC
overnight. The coating
incubation time may require some optimisation.
3. Remove the coating solution and wash the plate three times by filling the wells with 200 μl
PBS. The solutions
or washes are removed by flicking the plate over a sink. The remaining drops are removed by
patting the
plate on a paper towel.

 Blocking

4. Block the remaining protein-binding sites in the coated wells by adding 200 μl blocking
buffer, 5% non fat dry milk or 5% serum in /PBS, per well. Alternative blocking reagents
include BlockACE or BSA.
5. Cover the plate with an adhesive plastic and incubate for at least 2 h at room temperature
or, if more convenient, overnight at 4°C.
6. Wash the plate twice with PBS.

 Incubation with Primary and Secondary antibody

1. Add 100 μl of diluted primary antibody to each well.
2. Cover the plate with an adhesive plastic and incubate for 2 h at room temperature.
This incubation time may require optimisation. Although 2 hours is usually enough to obtain
a strong signal, if a weak signal is obtained, stronger staining will often observed when
incubated overnight at 4oC.
3. Wash the plate four times with PBS.
4. Add 100 μl of conjugated secondary antibody, diluted at the optimal concentration
(according to the
manufacturer) in blocking buffer immediately before use.
5. Cover the plate with an adhesive plastic and incubate for 1-2 h at room temperature.
6. Wash the plate four times with PBS.
7. Dispense 100 μl (or 50 μl) of the substrate solution per well with a multichannel pipet or a
multipipet.
8. After sufficient color development (if it is necessary) add 100 μl of stop solution to the
wells.
9. Read the absorbance (optical density) of each well with a plate reader.

 Detection

Although many different types of enzymes have been used for detection, horse radish
peroxidase (HRP) and alkaline phosphatase (ALP) are the two widely used enzymes
employed in ELISA assay. It is important to consider the fact that some biological materials
have high levels of endogenous enzyme activity (such as high ALP in alveolar cells, high
peroxidase in red blood cells) and this may result in non-specific signal. If necessary, perform
an additional blocking treatment with Levamisol (for ALP) or with 0.3% solution of H2O2 in
methanol (for peroxidase).
ALP substrate
For most applications pNPP (p-Nitrophenyl-phosphate) is the most widely used
[Link] yellow color of nitrophenol can be measured at 405 nm after 15-30 min
incubation at room temperature. (This reaction can be stopped by adding equal volume of
0.75 M NaOH).
HRP chromogens
The substrate for HRP is hydrogen peroxide. Cleavage of hydrogen peroxide is coupled to
oxidation of a hydrogen donor which changes colour during reaction.
TMB (3,3’,5,5’-tetramethylbenzidine) add TMB solution to each well, incubate for 15-30
min, add equal volume of stopping solution (2 M H2SO4) and read the optical density at 450
nm.
OPD (o-phenylenediamine dihydrochloride. The end product is measured at 492 nm. Be
aware that the substrate is light sensitive so keep and store it in the dark.
ABTS (2,2’-azino-di-[3-ethyl-benzothiazoline-6 sulfonic acid] diammonium salt. The end
product is green and the optical density can be measured at 416 nm.
Note: some enzyme substrates are considered hazardous (potential carcinogens), therefore
always handle with care and wear gloves.

 Analysis of data:
Prepare a standard curve from the data produced from the serial dilutions with concentration
on the x axis (log scale) vs absorbance on the Y axis (linear). Interpolate the concentration of
the sample from this standard curve.
 VDRL TEST

Requirements: Patient’s serum, water bath, freshly prepared cardiolipin antigen, VDRL
slide, mechanical rotator, pipettes, hypodermic syringe with unbeveled needle and
microscope. Known reactive and non-reactive serum controls are also required.
VDRL antigen: The cardiolipin antigen is an alcoholic solution composed of 0.03%
cardiolipin, 0.21% lecithin and 0.9% cholesterol. The cardiolipin antigen must be freshly
constituted each day of test. The working antigen is a buffered saline suspension of
cardiolipin.
VDRL slide: This is a glass slide measuring 2 X 3 inch with 12 concave depressions, each
measuring 16 mm in diameter and 1.75 mm deep.
Procedure: Patients’ serum is inactivated by heating at 56oC for 30 minutes in a water bath
to remove non-specific inhibitors (such as complement). The test can be performed both
qualitatively and quantitatively. Those tests that
are reactive by qualitative test are subjected to quantitative test to determine the antibody
titres.
Qualitative test: 0.05 ml of inactivated serum is taken into one well. 1/60th ml (or 1 drop
from 18 gauge needle) of the cardiolipin antigen is then added with the help of a syringe
(unbeveled) to the well and rotated at 180 rpm for 4 minutes. Every test must be accompanied
with known reactive and non-reactive controls. The slide is then viewed under low power
objective of a microscope for flocculation. The reactive and non-reactive controls are looked
first to verify the quality of the antigen. Depending on the size the results are graded as
weakly reactive (W) or reactive (R). Reactive samples are then subjected to quantitative test.
Qualitative test: this is performed to determine the antibody titres. The serum is doubly
diluted in saline from 1in 2 to 1:256 or more. 0.05 ml of each dilution is taken in the well and
1/60 ml of antigen is added to each dilution and rotated in a rotator. The results are then
checked under the microscope. The highest dilution showing flocculation is considered as
reactive titre. Sometimes, due to very high level of antibodies in the serum (prozone
phenomenon) the qualitative test may be non-reactive. If the clinical findings are strongly
suggestive of syphilis, a quantitative test
may be directly performed on the serum specimen.

RESULT:
Patients suffering from syphilis produce antibodies that react with cardiolipin antigen in a
slide flocculation test, which are read using a microscope.
TUBERCULOSIS LABORATORY
DETECTION OF MYCOBACTERIUM TUBERCULOSIS BY STAINING:

1) Ziehl–Neelsen stain:

PRINCIPLE: The lipoid capsule of the acid-fast organism takes up carbolfuchsin and resists
decolorization with a dilute acid rinse. The lipoid capsule of the mycobacteria is of such high
molecular weight that it is waxy at room temperature and successful penetration by the
aqueous based staining solutions (such as Gram's) is prevented.
CONTROL: Any tissue containing acid-fast organisms. Use filtered water in the waterbath
and staining procedure.
FIXATIVE: 10% formalin
TECHNIQUE: Cut paraffin sections at 4-5 microns.
EQUIPMENT: Rinse all glassware in DI water, coplin jars, microwave oven.

REAGENTS:
 Ziehl-Neelsen Carbol-Fuchsin
Solution:
Basic fuchsin 2.5 gm
Distilled water 250.0 ml
100% alcohol 25.0 ml
Phenol crystals, melted 12.5 ml
Mix well, filter into brown bottle.
Label bottle with date and initials,
solution is stable for 1 year.

CAUTION: Carcinogen, toxin.

 1% Acid Alcohol:
 Hydrochloric acid 10.0 ml
70% Alcohol 990.0 ml
Mix well, label with date and
initials, stable for 1 year.
CAUTION: Corrosive.

 Methylene Blue Stock Solution:

Methylene blue 0.7 gm
Distilled water 50.0 ml
Mix well, filter into bottle. Label
with date and initials, stable for 1
year.
 Methylene Blue Working Solution:
Methylene Blue Stock 5.0 ml
Distilled water 45.0 ml
Pour into coplin jar, stable for 2
months.
CAUTION: Avoid contact and inhalation.

SAFETY/PPE: Wear nitrile gloves, goggles and lab coat. Keep hot, uncapped, solutions in
the exhaust hood. Avoid contact and inhalation.
Basic fuchsin: carcinogen.
Phenol: toxic by ingestion, inhalation and skin absorption. Readily absorbed through skin,
causing increased heart rate, convulsions and death. Will burn eyes and skin, analgesic action
may cause loss of pain. Target organ effects in digestive, nervous and urinary systems.
Hydrochloric acid: strong irritant to skin, eyes and respiratory system. Target organ effects
via inhalation on skin, respiratory, reproductive and fetal systems.
Methylene blue: produced deleterious effects on fertility in rats.

PROCEDURE:
1. Deparaffinize and hydrate to distilled water.
2. Carbol-fuchsin solution, microwave 80 power, 45 seconds, allow slides to stand in hot
solution for 5 minutes. Filter solution once a week.
3. Wash in running tap water.
4. 1% Acid alcohol until light pink and color stops running.
5. Wash in running tap water for 5 minutes..
6. Rinse in distilled water.
7. Working methylene blue for 30 seconds.
8. Rinse in water.
9. Dehydrate, clear, and coverslip

RESULT:

Acid-fast bacilli bright red

Background blue

DETECTION OF MYCOBACTERIUM TUBERCULOSIS BY CULTURING:

Preparation of Lowenstein-Jensen (LJ) Medium:

COMPOSITION:
Approximate Formula* Per 600 mL
Asparagine ................................................................. 3.6 g
Monopotassium Phosphate ........................................ 2.4 g
Magnesium Sulfate .................................................... 0.24 g
Magnesium Citrate .................................................... 0.6 g
Potato Flour .............................................................30.0 g
Malachite Green ........................................................ 0.4 g
Precaution
Biosafety Level 2 practices and procedures, containment equipment and facilities are required
for non-aerosol-producing manipulations of clinical specimens such as preparation of acid-
fast smears. All aerosol-generating activities must be conducted in a Class I or II biological
safety cabinet. Biosafety
Level 3 practices, containment equipment and facilities are required for laboratory activities
in the propagation and manipulation of cultures of M. tuberculosis and M. bovis. Animal
studies also require special procedures.

PROCEDURE:
1. Suspend 37.4 g of the powder in 600 mL of purified water containing 12 mL of glycerol.
Do not add glycerol if bovine tubercle bacilli or other glycerophobic organisms are to be
cultivated. Mix thoroughly.
2. Heat with frequent agitation just until the medium boils.
3. Autoclave at 1210C for 15 minutes. Cool to approximately 500C.
4. Meanwhile, prepare 1,000 mL of whole eggs collected aseptically and mixed thoroughly,
without introducing air bubbles.
5. Admix base and egg gently until mixture is uniform and without bubbles.
6. Distribute in suitable sterile containers such as screw-capped tubes.
7. Arrange tubes in slanted position, then coagulate and inspissate at 850C for 45 minutes.
8. Test samples of the finished product for performance using stable, typical control cultures.

Following inoculation, keep test containers shielded from light and place them in a suitable
system providing an aerobic atmosphere enriched with carbon dioxide. Incubate at 350C
Slanted and bottled media should be incubated in a horizontal plane until the inoculum is
absorbed. Tubes and bottles should have screw caps loose for the first 3 weeks to permit the
circulation of carbon dioxide for the initiation of growth. Thereafter, to prevent dehydration,
tighten caps; loosened briefly once a week. Stand tubes upright if space is a problem.
Expected Results
Cultures should be read within 5-7 days after inoculation and once a week thereafter for up to
8 weeks.
Record Observations:
1. Number of days required for colonies to become macroscopically visible. Rapid growers
have mature colonies within 7 days; slow growers require more than 7 days for mature
colony forms.
2. Pigment production
White, cream to buff = Nonchromogenic (NC)
Lemon, yellow, orange, red = Chromogenic (Ch)

Stained smears may show acid-fast bacilli, which are reported only as “acid-fast bacilli”
unless definitive tests are performed. Bottles may be examined by inverting the bottles on the
stage of a dissecting microscope. Read at 10-60× with transmitted light. Scan rapidly at 10-
20× for the presence of colonies. Higher magnification (30-60×) is helpful in observing
colony morphology; i.e., serpentine cord-like colonies. Examine LJ Medium with Iron for
rusty-brown colonies with a tan discoloration in the surrounding medium, indicating
uptake of the iron. The presence or absence of growth in the tube of medium containing
5% NaCl aids in the differentiation of mycobacterial isolates. The salt tolerance test is
positive when numerous colonies appear on the control medium and more than 50 colonies
grow on the medium containing 5% NaCl.6,15 Colonies on the control medium, but no
visible growth on the test medium after a total of 4 weeks of incubation constitutes a negative
test.
In the semi-quantitate catalase test, mycobacteria fall into two groups with M. tuberculosis
falling into the group producing a column of bubbles less than 45 mm in height.

Limitations of the Procedure

1. Negative culture results do not rule-out active infection by mycobacteria. Some factors that
are responsible for unsuccessful cultures are:
• The specimen was not representative of the infectious material; i.e., saliva instead of
sputum.
• The mycobacteria were destroyed during digestion and decontamination of the
specimen.
• Gross contamination interfered with the growth of the mycobacteria.
• Proper aerobic conditions and increased CO 2 tension were not provided during
incubation.
2. Mycobacteria are strict aerobes and growth is stimulated by increased levels of CO 2. Screw
caps on tubes or bottles should be handled as directed for exchange of CO2.
 IDENTIFICATION OF MYCOBACTERIUM TUBERCULOSIS BY
POLYMERASE CHAIN REACTION IN CLINICAL SPECIMENS

Experimental Procedures
Sample Preparation
Fifteen sputum samples which were AFB positive (2-9 bacilli/smear) were randomly selected
from samples referred to Department of Microbiology, King George’s Medical College,
Lucknow. These samples were culture positive on LJ media. Growth was identified as M.
tuberculosis. Saliva samples from ten healthy persons were included as negative controls.
Preparation of Clinical Samples for DNA Extraction
A total of 3 ml of all positive and negative samples were first treated with equal volume of
4% NaOH at 37°C for 30 min with intermittent vortexing. Samples were then centrifuged at
6000 g and pellets were washed twice with sterile distilled water by centrifugation (Vestal et
al., 1977). The pellet was suspended in 1.5 ml of TE buffer to make a homogenous
suspension and finally was equally distributed in seven sterile tube (200 μl each) for DNA
extraction byseven different protocols. In order to avoid contamination, samples were
processed in a separate bio-safety cabinet, which was not used for DNA amplification or
detection. All the plastic wares used for DNA extraction were DNase free, disposable and
not reused throughout the experiment. Different sets of micro-pipettes were used at each step
i.e. for sample processing, DNA extraction, PCR mix preparation and electrophoresis.

Methods of DNA Extraction

Seven protocols were used for extracting DNA according to previous published reports
including protocol number six, which is standardised in our laboratory. This protocol is a
combination of various steps already reported.
Protocol 1
1. Sample pellet was dispersed in 10 mM Tris-1mM EDTA buffer containing 0.1 % Tween
80 and 2 mg/ml lysozyme.
2. The tube was incubated for 2 hr at 37°C with intermittent shaking and centrifuged.
3. The pellet was lysed by redissolving in TE buffer containing 100μg of Proteinase K/ml and
1% (w/v) sodium dodecyl sulphate and incubated for 1 hr at 37°C.
4. DNA was extracted by adding an equal volume of TE saturated phenol: chloroform: iso-
amyl alcohol ([Link] v/v/v).
5. The aqueous phase was transferred to another tube and 0.1 volume of cold 3 M sodium
acetate (pH 5.2) was added.
6. Sample was mixed by inversion and placed on ice for 10 min before centrifugation for 10
min.
7. The supernatant fluid was transferred to another tube and DNA was precipitated by the
addition of 20 μg of acrylamide/ml, 0.05 volumes of 3M sodium acetate and 2.5 volume of
ethanol, washed, dried, dissolved in 25 μl sterile triple distilled water (Boddinghaus et al.,
1990).

Protocol 2
[Link] pellet of clinical sample was suspended in 200μl of Tris-EDTA buffer
(50mM Tris and 5mM EDTA pH 8.0) and frozen at -20°C.
2. Frozen aliquot was digested with lysozyme (1 mg/ml) at 37°C for 2hr.
3. Specimen was lysed by heating at 95°C with an alkaline sodium dodecyl sulphate solution
(10% w/v), followed by neutralisation with Tris-HCl buffer.
4. Finally DNA was extracted once with phenol: chloroform (24:1) and then precipitated with
2.5 volume of ethanol.
5. DNA pellet was suspended in 25μl of sterile distilled water for PCR analysis (Yuen et al.,
1993).

Quantitation of Mycobacterial DNA

DNA from equal numbers of M. tuberculosis (H37Rv) organisms was extracted by both the
stwo protocols in triplicate to check the reproducibility of the procedure. Fivelarge colonies
of M. tuberculosis were suspended in 5 mlof TE buffer after washing twice with sterile
distilled water.A homogenous suspension was made by vortexing this suspension for 5 min
after addition of six sterile glass beads. The tube was allowed to stand for 5 min. allowing the
larger ‘clumps’ to settle. Then 200 μl of this suspension was distributed into 6 tubes,
followed by extraction by two protocols in triplicate. Quantitation of DNA was done
spectrophotometrically by measuring absorbance at 260nm for comparative quantitative
analysis of DNA (Sambrook et al., 1989).
Serial dilutions of DNA extracted from all protocols were prepared ranging from 0.5_μg
to1.0 fg. All of these dilutions were amplified to compare the quality as well as to find out the
minimum amplifiable quantity of DNA.

Purity Check of Extracted DNA

The absorbance at 260 and 280nm was used to check the purity of the extracted DNA. A ratio
of A260/A280 was calculated. Pure preparation of DNA had A260/A280 values ranging
between 1.8 and 2.0. If there is a contamination with protein or phenol the ratio is
significantly lower.(Maniatis et al., 1989).

Amplification of Mycobacterial DNA by PCR

MATERIALS:
DNA amplification reaction was performed in a total volume of 20μl in:
 10mM Tris-HCl (pH8.3),
 1.5mM MgCl2,
 50mM KCl,
 50 pico moles of each primer (5'- CCTGCGAGCGTAGGC GTCGG and 5'-
CTCGTCCAGCGCCGCTTCGG,
 0.25 mM of each deoxy nucleoside triphosphate (dATP, dGTP, dTTP, and dCTP)
 0.5 unit of Thermus aquaticus
 DNA polymerase

PROCEDURE:
1. 2 μl of extracted DNA was added to 20 μl of PCR mixture with a positive displacement
pipette.
2. Amplification mixtures were subjected to 40 cycles of amplification in an automated
thermal cycler
3. Amplification cycles were as follows:
  initial denaturation: incubation for 5 minutes at 94°C
 denaturation: 40 cycles at 94°C for one minute
 annealing: 60°C for one minute
 polymerisation: 72°C for one minute
 final extension: Seven minutes at 72°C
4. Each set of amplification tubes included a positive control of M. tuberculosis (H37Rv)
DNA as well as a negative control of DNA samples extracted from saliva of normal healthy
persons.
Analysis of PCR Products
An aliquot (5μl) from PCR product of each sample was analysed by gel electrophoresis in 3%
agarose gels at constant voltage (30V), along with the molecular weight marker and PCR
products of positive and negative controls. A sharp band of 123 bp of amplified DNA was
visualised under UV light in positive samples by staining the gels with ethidium bromide (0.5
μg/ml, Sigma) for 15 minutes and de-staining with distilled water. The presence of a distinct
band of 123_bp (IS 610) was considered as a positive PCR result for M. tuberculosis DNA.

Figure 1. Sensitivity of M. tuberculosis DNA detection by PCR. Dilutions of

M. tuberculosis DNA were amplified with primer pair based on detection of
IS6110 sequence to amplify a 123 bp fragment. Lanes 1-7; template DNA
concentrations 10ng, 1ng, 100 pg, 10pg, 1pg, 100 fg and 10 fg, Lane Mmolecular
weight marker.
 CONCLUSION

Polymerase chain reaction is useful for the rapid detection of M. tuberculosis with reported
sensitivity of 55 to 95% in the culture positives and 100% in both smear and culture positive
clinical specimens PCR is an efficient technique with the theoretical possibility of amplifing
one DNA sequence of interest to 106 copies in the course of one working day. However,
there appears to be considerable confusion regarding its place in the diagnostic laboratory.
While research activity must continue if we are to refine the test, remove the numerous
drawbacks and reap the benefit of its potential, at present in view of the available data, the
test should not be used for diagnostic decision making. In 1996, USA FDA recommended
that MTDT should be restricted to smear positive specimens from untreated patients of
tuberculosis and used only in conjunction with traditional sputum examination. It should not
be used for smear negative sputum or other specimens such as pleural or cerebrospinal fluids.
In the last few years, although numerous papers have been published from various
laboratories of the world, including India, there appears to have been no quantum jump in the
state of the art knowledge in as far as use of PCR for diagnosing tuberculosis is concerned to
warrant any change in USA FDA’s recommendations. It needs to be stressed that based
solely on PCR results, clinicians should neither start treatment nor stop treatment. It would be
prudent for clinical laboratories to allocate additional resource to techniques which have been
shown to be highly reliable (although not adequately sensitive) so as to optimize their
diagnostic potential, while research laboratories must address themselves to overcoming the
numerous problems and variables identified, while performing PCR, before they offer this
test.
Molecular diagnostic techniques, although found promising, have not yet delivered their
promise. They are currently at a stage analogous to that of clinical bacteriological techniques
in the 1960s, before they were improved by using standardized protocols which stressed on
appropriate quality, assured reagents, meticulous attention to detail, adequate internal quality
control and participation in external proficiency testing programmes.