10

Nature, structure and organisation of the genetic material

KEY KNOWLEDGE
This chapter is designed to enable students to: develop awareness of the history relating to the discovery of the identity and structure of the genetic material DNA extend knowledge of the structure of DNA and its organisation into genes relate DNA at a molecular level to chromosomes and genes recognise the nature of the genetic code recognise the achievement of the Human Genome Project extend knowledge of the elds of genomics and proteomics develop understanding of types of gene mutation and their effects.

Reprinted with permission from Science Vol. 287, No. 5461 24, March 2000. (Drawings are from the Archives, California Institute of Technology.) Copyright 2000 AAAS.

Figure 10.1 This image shows the cover of the 24 March

2000 issue of Science, in which the announcement was made of the complete sequencing of the genome of the fruit y, Drosophila melanogaster. In the background, part of the DNA sequence can be seen. The drawings of the ies (male above and female below) were made in 1934 by E. M. Wallace. In this

chapter, we will explore how the understanding of inheritance developed over time, starting with the inheritance models of Mendels factors to todays understanding of the genetic material as DNA, the material of genes and chromosomes and its organisation into genomes.

In a monastery garden
In the summer of 1856, visitors to the monastery of St Thomas in the town of Brno, in what is now the Czech Republic, would have seen monks at work and prayer. Visitors may have noticed one monk examining owers on pea plants in the vegetable garden near the monastery kitchen.

Figure 10.2 Structure of the

ower of a pea plant: (a) pea ower and bud the ve petals include the keel made of two fused petals at the base of a pea ower, a large standard and two wing petals, (b) ower opened to show reproductive structures. The male structures are the stamens that produce pollen (sperm). Only ve of the ten stamens are shown. The stigma is part of the female structure and leads to the ovary which contains ovules (eggs).

(a)

Standard Petal

(b) Stigma

Stamen with pollen

Ovary

Flower bud

Wing

Keel

Figure 10.2 shows the typical structure of a pea ower. Under normal conditions, pea plants are self-fertilising that is, pollen from one ower fertilises the ovules of the same ower. However, this monk was carrying out a procedure to prevent self-fertilisation. Using forceps, he carefully removed the stamens from ower buds on one pea plant and dusted pollen that he had collected from another pea plant onto the stigma of the rst plant. In doing this, he was articially crossing the pea plants (see gure 10.3).
(a) Forceps

Flower of plant 1: stamens removed from ower

Brush collecting pollen

(b)

Flower of plant 2: pollen collected on brush

Figure 10.3 Process of

articial crosses of pea owers from different plants, (a) unripe stamens are removed from the ower of plant 1, (b) ripe pollen is collected on a brush from plant 2, (c) the ripe pollen is brushed onto the stigma of the ower of plant 1.

(c)

Pollen transferred from plant 2 ower to plant 1 ower

340

NATURE OF BIOLOGY BOOK 2

Later, the monk wrote about his procedure for an articial cross as follows: For this purpose, the bud is opened before it is perfectly developed, the keel is removed and each stamen carefully extracted by means of forceps, after which the stigma can once be dusted over with the foreign pollen. At another time, this monk could be seen in another section of the vegetable garden where he recorded the characteristics of mature pea plants in his notebook. Later, with others assisting him, the monk sat at a table where he shelled peas, sorted them into groups of different colours and shapes and counted the numbers in the various groups. Who was this quiet monk? He was Gregor Mendel (18221884) (see gure 10.5a, page 342). Growing up on a farm, the young Mendel would have noticed variation in the offspring of farm animals. Years later in the monastery, Mendel turned his attention to edible pea plants (Pisum sativum) and examined the inheritance of variation in seven different traits of this species (see gure 10.4). He also used other plant species, such as beans, and experimented with bees.
Trait Variations

Stem length tall Seed (cotyledon) colour yellow Seed (cotyledon) shape round Seed coat colour grey white wrinkled green short

Pod texture inflated constricted Constricted pods lack a hard inner pod lining so that the seed outlines can be seen (as in snow peas); inflated pods have a tough parchment-like lining.

Pod colour green yellow

Flower position

Figure 10.4 Variations in pea

plants used by Mendel in his experiments. Dominant traits are underlined. Which peas can be readily eaten, pods and all?

axial terminal In the axial arrangement, flowers can arise along the entire length of the stem; in the terminal arrangement, flowers are bunched at the top of the stem.

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

341

ODD FACT
Tall pea plants grow to a height of about two metres, while short pea plants grow to less than half a metre.
(a)

Why Mendel did it

What inspired Mendel to carry out his experiments is not known as many of his personal papers were burned by the abbot who succeeded him. Fortunately, Mendels ofcial papers and the notebooks that held the records of his experimental results were safely stored in the monastery archives.
(b)

Figure 10.5
(a) Gregor Mendel and (b) the monastery gardens in which he carried out his plant-breeding experiments. Mendel stopped his genetic experiments in 1871 after being elected Abbot in 1868. He died of Brights disease.

Just one rst-hand account of Mendel exists and it is that of a horticulturalist named Eichling who visited Mendel at the Brno monastery in 1878. Recalling this visit years later in 1942, Eichling wrote that Mendel gave him lunch and showed him the monastery garden. Mendel told Eichling that he had reshaped (the green peas) in height as well as in type of fruit. In response to Eichlings question of how he had done that, Mendel answered: It is just a little trick, but there is a long story connected with it which would take too long to tell.

How Mendel did it

For eight years from 1856 to 1864, Mendel carefully carried out breeding experiments with varieties of pea plants. Features of his experimental crosses that led to his success included the following. One trait at a time. Mendel initially examined variation in only one trait at a time. He set up crosses between plants that differed in just one trait, such as pod colour. Such crosses are termed monohybrid crosses. After he had recognised the pattern of inheritance of single traits, Mendel studied crosses of plants differing in two traits. Such crosses are termed dihybrid crosses. In contrast, other plant breeders tried to study variation in many traits at once and were confounded by all the variation that they observed in the offspring. Known history of parents. For his starting point (the P generation), Mendel used plants that were known to be pure breeding. Recording parentage. Unlike other plant breeders, Mendel kept careful records of the parents of every offspring. Counting offspring. Unlike other plant breeders, Mendel counted the appearance and numbers of different kinds of offspring produced in each generation. He also repeated his experimental crosses, obtaining large numbers of offspring so that average ratios could be determined.

Oodles of peas
Mendels choice of pea plants for his breeding experiments meant that he was able to obtain relatively large numbers of offspring from even a single cross. Every pea in a pod on a pea plant is a single offspring and each pea baby will grow into a mature plant (see gure 10.7).

Figure 10.6
342
NATURE OF BIOLOGY BOOK 2

In all, Mendel produced thousands of offspring from his pea plant crosses over eight years. Large numbers of offspring allow regularities to be recognised and valid averages to be identied. If only small numbers of offspring are obtained, regularities may not be seen and averages may be biased by chance events. Numbers do matter! For example, imagine that you have four coins and that one of them is double-headed. Would you be absolutely condent that you could identify the double-headed coin on the basis of the result of tossing each coin just once? What about ten tosses? Likewise, when Mendel was examining various outcomes from his crosses, such as green pods or yellow pods, he obtained large numbers because he wanted to ascertain their statistical relations.

Figure 10.7
(a) Hybrid plant with its baby offspring enclosed in pods. How many offspring have been produced from the self-fertilisation of the plant shown? Traits that are expressed in baby peas include pea shape and pea (cotyledon) colour. (b) After planting, each pea develops into a mature pea plant. Traits that are expressed in mature plants include ower position, stem length, seed coat colour and pod colour.

(a) Pod with peas enclosed

Immature ospring = peas

(b)

Mature ospring = adult plants

Mendels model of inheritance

Mendel developed a model to explain the patterns of inheritance of the pea variations and to enable predictions to be made about the outcome of crosses. Mendels model was built on several assumptions: 1. Each trait was controlled by a pair of inherited factors. For example, the trait seed colour was assumed to be controlled by a pair of factors, with one producing yellow and the other producing green.

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

343

2. For each trait, individual plants had two factors that could be identical or different. Plants with two identical factors (such as long and long) were referred to as pure breeding, while plants with different factors (such as long and short) were called hybrids. 3. Each factor was a discrete particle that retained its identity across generations. This idea challenged the commonly held view that inheritance was a blending process in which factors lost their identity (see gure 10.9). 4. The character that was expressed in the F1 hybrid plants was dominant, while the hidden character in the hybrid was recessive. For example, green pod colour is dominant and yellow pod colour is recessive. 5. During gamete formation, the members of each pair of factors separated to different gametes, with one factor per gamete. This is the principle of segregation of alleles or Mendels rst law.

Figure 10.8 Mendel demonstrated

the existence of inherited factors that retained their identity across generations.

6. In separating, members of one pair of factors behaved independently of members of other pairs of factors. This is the principle of independent assortment or Mendels second law. 7. The results of a particular cross were the same, regardless of which plant was used as the male parent and which as the female parent.

Particulate inheritance model

Blending inheritance model

Figure 10.9 Two models of

inheritance particulate and blending. In which model do the factors lose their identity? Which model did Mendel assume applied to his factors?

Response to Mendels results

Mendels results and his model of inheritance were rst reported at a meeting of a local scientic society in Brno in 1865 and were published in its journal in 1866. More than one hundred copies of this journal were distributed, including two copies that were sent to London. In addition, Mendel sent reprints of his paper to several scientists, including Carl Ngeli, one of the leading European biologists of that time. Mendels results were, however, ignored. Why? The scientic community failed to recognise the signicance of Mendels ndings, perhaps because he was not a professional plant breeder or biologist. Ngeli published a book on heredity in 1884 that made no reference to Mendel. In that book, Ngeli commented on the appearance of a long-haired kitten in the litter from two cross-bred short-haired cats, but could not account for this observation. Ngeli did not realise that his
344
NATURE OF BIOLOGY BOOK 2

ODD FACT
Mendel was disappointed that his work was not recognised and is reported to have stated: Meine Zeit wird schon kommen (My time is sure to come). That recognition did not come until 1900, more than 30 years after Mendels work was published and 12 years after his death.

ODD FACT
The rst report of a human condition behaving as a Mendelian dominant characteristic was published in 1905. This condition is abnormally short ngers or brachydactyly.

acquaintance from the monastery in Brno could have explained the occurrence of this long-haired kitten! In the years following the publication of Charles Darwins The Origin of Species in 1859, it is claimed that the attention of scientists moved to evolution and to the differences between species. As a result, there was a decline in interest in the work of plant and animal breeders who were concerned with differences within species. In this climate, few biologists would have been interested in the plant-breeding experiments of an obscure monk in a monastery in Brno. Mendels explanatory model was ignored for more than 30 years. Mendels model was rediscovered in 1900 by three biologists working independently. The biologists were de Vries, a Dutch plant breeder; Correns, an Austrian botanist; and Tschermak, a German botanist. After its rediscovery, biologists in Europe and America demonstrated that Mendels model applied to inheritance in many plants and animals. By the end of the rst decade of the twentieth century, Mendelian principles had been found to apply to many organisms, including: nettles (Urtica pilulifera) serrated leaf margin dominant to entire wheat (Triticum sp.) late ripening dominant to early ripening stocks (Matthiola sp.) coloured dominant to white maize (Zea mays) smooth seed dominant to wrinkled mice (Mus musculus) coloured coat dominant to albino rabbits (Oryctolagus cuniculus) Angora (long) fur dominant to short fur cattle (Bos taurus) polled (hornless) dominant to horned poultry (Gallus gallus) brown eggs dominant to white eggs sheep (Ovis aries) white wool dominant to black. The Mendelian model of inheritance was soon universally accepted as the basis of inheritance in plant and animal species.

KEY IDEAS
Mendel carried out carefully planned experiments using techniques different from other plant breeders. Mendel developed a model of inheritance built on a set of assumptions about his factors. Mendels model both explained observed results and allowed predictions. Mendels model of inheritance was ignored by the scientic community but was rediscovered in 1900 independently by three biologists. After its rediscovery, Mendels model was soon found to apply to other kinds of living things.

QUICK-CHECK
1 Identify the following as true or false. a Mendels model assumed that parental characters blended in their offspring. b Pea plants normally undergo cross-fertilisation. c Mendels model applies to inheritance in plants and animals but not to human inheritance. 2 List two assumptions of Mendels explanatory model for inheritance. 3 What impact did Mendels model make on the scientic community at the time it was rst reported? 4 Name the three biologists who rediscovered Mendels work.

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

345

ODD FACT
The science of genetics was initially called Mendelism after Gregor Mendel, who laid the foundations for the modern science of genetics. The name genetics was introduced in the early 1900s by William Bateson, the rst professor of genetics at Cambridge University.

Where are genes located?

Mendels factors were rst postulated to be separate particles, behaving independently of each other and located in cells. The rst clue that Mendels factors did not always behave independently came from experiments by W. Bateson (18511926) and R. C. Punnett (18751967) in England in the early 1900s. They found that in some crosses with peas, a particular variation (red ower colour) tended to be inherited with another specic variation (erect petal shape). The factors concerned behaved as if they were physically coupled. Yet in other crosses with peas, the same variants were very rarely inherited together, as if they repelled each other. These crosses produced red owered offspring that nearly always had hooded petals and only rarely had erect petals (see gure 10.10). About the same time in 1902, in the United States, Walter Sutton (18761916) recognised that the thread-like structures seen in cells and known as chromosomes (chromo = coloured; soma = body) provided a mechanism for the operation of Mendels laws. Based on the parallels that he observed in the behaviours of Mendels factors and of chromosomes, Sutton came to the conclusion that Mendels factors were located on the chromosomes (see gures 10.11 and 10.12).

Figure 10.10 Pea owers

vary in colour and petal shape. If independent assortment occurs, red owers would be expected to show erect petals just as commonly as hooded, and likewise for purple owers. What result did Bateson and Punnett observe?

rgd

ragged leaf

virescent seedling

w H

yellow skin
blood groupH

Y sl pg Dt Pl su sm py

yellow endosperm ms slashed leaf pale green seedling dotted aleurone purple plant sugary endosperm salmon silk pygmy

male sterile

se p

sleepy-eye pea comb

Chromosome 8

ma P Na

marbled
blood groupP

naked neck

Chromosome 6

h Fl

silkiness flightless

Figure 10.11 This idea was

rst postulated by Sutton (1902) and Boveri (1903), but the rst experimental evidence came only in 1910 from Morgans laboratory.

(a)

Chromosome 1

(b)

Figure 10.12 Linkage groups in (a) maize (Zea mays) and (b) in chickens (Gallus
gallus). Bateson and Punnett were the rst to recognise that Mendels factors (genes) did not always assort independently.

346

NATURE OF BIOLOGY BOOK 2

Walter Sutton did not carry out any experimental crosses instead he synthesised the independent results of other scientists, recognised patterns and made the key link between the chromosomes studied by cytologists and the genes studied by geneticists (see table 10.1). Figures 10.13 and 10.14 show the parallel relationship between the behaviour of genes and chromosomes during meiosis.

Table 10.1 Parallels between the

behaviour of genes and the behaviour of chromosomes, expressed in modern terminology

Genetic behaviour Segregation of the members of each pair of alleles into different gametes

Chromosomal behaviour Separation (disjunction) of the members of each pair of matching chromosomes into different gametes (gure 10.13) Random orientation of different pairs of chromosomes across the cell equator prior to their separation during gamete formation (gure 10.14)
R
1 2R

Random assortment of the alleles of different genes into gametes

R R R r r r r Anaphase 1 Anaphase 2 R

r
1 2r

Figure 10.13 Disjunction of

matching chromosomes into different gametes results in segregation of alleles.

r Gametes

R R R r r T T t t R r r R R R r r t t T T r r Anaphase 1 R

T T t t t t

R R

T T

1 4 RT

r r R R

t t

1 4 rt

t t

1 4 Rt

T T

r r

T T

Figure 10.14 Random orientations

of non-matching chromosomes lead to independent assortment of genes into different gametes.

1 4 rT

Anaphase 2

Gametes

The parallel behaviour of chromosomes and genes provided strong evidence for Suttons conclusion that genes were located on chromosomes. However, it was not until 1910 that the rst specic gene was demonstrated to be located on a specic chromosome. This was done by T. H. Morgan (18661945) (see gure 10.15).
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

347

Morgan and his co-workers at Columbia University (United States) conrmed Suttons conclusion. They showed that factors (genes) were not free particles like peas in soup, but were organised into larger structures chromosomes. They showed that when genes were located close together on homologous chromosomes, specic alleles of these linked genes tended to be inherited together. Morgans ndings explained the strange observation of Bateson and Punnett. Clearly, the genes controlling pea ower shape and pea ower colour were located close together on the same chromosome.

Figure 10.15 Thomas Hunt Morgan with y drawings. Morgan used fruit ies (Drosophila melanogaster) in his experiments that showed that genes were located on chromosomes. In 1933, T. H. Morgan was awarded a Nobel Prize for his contribution to genetics.

What are genes made of?

Early in the twentieth century, a gene was simply something that was inferred to be present in a gamete and something that acted in an unknown way to produce a particular phenotype. However, nothing was known about the nature of genes or how genes acted to produce particular phenotypes. The writings of biologists show that the nature of genes (or factors) was a mystery:
Beyond their existence in the gamete and their mode of transmission we make no suggestion as to the nature of these factors. Punnett, 1911 . . . the material is termed for convenience a factor or a gene, terms which do not imply any knowledge as to the nature of the substance causing characters to appear . . . Cutler, 1923

A commonly held, but incorrect, view at that time was that genes were probably made of protein. However, over the rst half of the twentieth century, several experiments revealed what genes were made of.

Grifths changing bacteria

Figure 10.16
Imagine a substance that can change mild-mannered and harmless organisms into disease-causing killer organisms. In 1928, a British biologist, Frederick Grifth (18771941), extracted such a substance. Just as pea plants show variations, pneumococci bacteria also show variations (see table 10.2).
Strain smooth type rough type Distinctive feature external capsule present outside cell wall external capsule absent Disease-causing or not cause pneumonia harmless

Table 10.2 Kinds of pneumococci

bacteria

348

NATURE OF BIOLOGY BOOK 2

Grifth carried out experiments using two kinds of pneumococci bacteria (see gure 10.17). He found that: injection of living smooth type into mice caused them to die from pneumonia injection of living rough type left the mice healthy. Grifth also killed smooth bacteria by heating and extracted the contents of these dead cells. When mice received an injection of this material, they remained healthy. These results supported the conclusion that pneumonia was caused by living smooth pneumococci bacteria. Grifth then mixed the contents from dead smooth cells with living rough cells. He injected mice with these treated rough cells and found that they died from pneumonia. When the dead mice were examined, living smooth cells were found, even though no living smooth cells had been injected. How had this happened?

Figure 10.17 Grifths

experiments. The dead bacterial cells were obtained by killing the bacteria by heating. Living smooth bacterial cells were found in the dead mice in experiment 4. Where did these living smooth cells come from?

1. Living smooth cells (Dead) from pneumonia

2. Living rough cells

(No change)

3. Dead smooth cells

(No change)

4. Living rough cells + dead smooth cells (Dead) from pneumonia; living smooth cells present in mouse

Figure 10.18

The deadly smooth bacteria found in the mice had formerly been harmless rough bacteria. The harmless rough bacteria had been changed or transformed by something in the contents of the smooth cells. This change agent caused the harmless rough bacteria to produce an external capsule and become the deadly smooth type of bacteria. This something became known as the transforming factor. It was concluded that the transforming substance was equivalent to the substance of the genetic material itself. Grifths experiments demonstrated that genetic material was a chemical substance (see gure 10.18). But, what was it?
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

349

Averys answer to the puzzle

In 1943, Oswald Avery (18771955) and his co-workers identied the chemical nature of the transforming factor. Avery (see gure 10.19) obtained extracts of dead, smooth pneumococci bacteria and treated this material with various enzymes that could destroy lipids and proteins and carbohydrates. He found that the extracts could still transform harmless rough bacteria to deadly smooth bacteria (see table 10.3). However, when the extracts were treated with enzymes that destroy deoxyribonucleic acid (DNA), the extract could no longer transform other bacteria. These experiments gave the rst clue to the identity of the genetic material and supported the conclusion that genes were made of the chemical compound DNA.

Table 10.3 Outcomes of treatments of transforming factor from dead smooth

pneumococci bacteria with various agents. Which treatment destroyed the transforming factor?

Treatment protein-destroying enzymes lipid-destroying enzymes

Result ability to transform rough to smooth remained ability to transform rough to smooth remained ability to transform rough to smooth remained transformation ability destroyed

Figure 10.19 Oswald Avery.

What was his contribution to the understanding of genes? His key research was published in the article: Studies on the chemical nature of the substance inducing transformation of pneumococcal types, Journal of Experimental Medicine, vol. 79, p. 137, (1944).

carbohydrate-destroying enzymes DNA-destroying enzymes

Later, Avery extracted the contents from smooth bacteria, separated and puried the various components until he had a highly puried sample of the transforming factor. When this was identied, it was found to be DNA. The momentous discovery of Avery and his co-workers was not accepted immediately by the entire scientic community. Some biologists doubted the validity of Averys conclusion. Even books published some years after Avery announced his discovery include cautious statements about the identity of genetic material, as for example:
. . . the present experiments strongly suggest rather than prove that genes are pure DNA . . . 1957

New scientic discoveries are not always rapidly accepted by the entire scientic community. If scientists hold strongly competing alternative views, they may not readily accept new ndings that disagree with their views. It is now universally accepted that genes are made of the chemical compound DNA. DNA belongs to the class of chemical substances called nucleic acids. Figure 10.20 shows one bacterial cell (centre) that has been treated to release its genetic material strands of the nucleic acid DNA.

Figure 10.20 Threads of genetic material from the bacterium Escherichia coli. What is this material?
350
NATURE OF BIOLOGY BOOK 2

KEY IDEAS
Genes are located on chromosomes. The rst suggestion that genes were located on chromosomes was made in 1902 by Sutton. In 1910, Morgan and his co-workers carried out the rst experiments that demonstrated that genes were located on chromosomes. Grifth demonstrated the chemical nature of the genetic material by showing that a substance existed in bacteria that could change or transform one strain of harmless bacteria into a lethal strain and that this change was then passed on to the next generation. Averys experiments led to the conclusion that the transforming factor, and hence the genetic material, is DNA (deoxyribonucleic acid).

QUICK-CHECK
5 Whose experiments were the rst that suggested that Mendels factors did not always behave independently? 6 How did the work of Morgan change Mendels model? 7 What is the transforming factor? 8 Briey explain how the work of the following scientists contributed to an understanding of the chemical nature of Mendels factors. a Grifth b Avery

Nature of genes
With Averys discovery, Mendels factors or genes were identied as being made of DNA. Denitions of genes before Averys work naturally make no reference to their chemical nature. The following denitions of a gene come from textbooks, including some published during the early part of this century. A gene was dened as: a name for the thing in a germ cell which makes the germ cell develop a particular character, such as tallness as opposed to dwarfness (1911) an independently inheritable element of the genotype by the presence of which some particular character in the organism is made possible (1918) the hypothetical unit in a germ cell which determines the production of a particular character in the individual derived from that germ cell (1921) a hypothetical unit in the chromatin of a cell which has a specic inuence on certain characteristics (1934) something which appears to pass through the reproductive cells and to inuence a particular character in the offspring (1939) a segment of a DNA molecule that can copy itself and pass on to other generations the directions it contains (1966).

Analysing DNA
Figure 10.21
Genes are made of the chemical substance called deoxyribonucleic acid (DNA). Lets examine further this substance that we introduced in chapter 1 (page 23).
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

351

Nucleotides: building blocks of DNA

Complex structures are built from one or more building blocks (sub-units) that are organised in a regular manner. Insect eyes are built from ommatidia, walls are built of bricks, fences are built of palings. The genetic material DNA is a complex molecule built of many basic building blocks called nucleotides. (Other complex molecules that are made of basic building blocks include proteins that are built of amino acids.) The nucleotide sub-units in DNA are assembled head-to-tail forming a chain. Four different kinds of nucleotides are found in DNA and they are normally distinguished by the letters A, C, G and T. Each nucleotide has a sugar (deoxyribose) part, a phosphate part and an N-containing base. The sugar and the phosphate parts are the same in all four nucleotides. However, the different nucleotides vary in the bases they contain. The four different bases found in the nucleotides that are the sub-units of DNA are: adenine, thymine, cytosine and guanine. Note that the letters A, T, C and G that are used to label the four different kinds of nucleotides come from the names of the bases they contain. Figure 10.22 shows various representations of the four nucleotides.
Phosphate Sugar Base
P S T P S G

ODD FACT
Two of the bases, cytosine and thymine, belong to the class of chemical compounds called pyrimidines. The other two, adenine and guanine, are larger and belong to the class of chemical compounds called purines.

A T G

P S G

ODD FACT
DNA was rst isolated from nuclei of cells from pus on bandages by the young Swiss post-graduate student, Miescher. At that time in 1869, he was working in a laboratory located in a castle in Tubingen, Germany and gave the name, nuclein to the compound he isolated. DNA was the only known nucleic acid for many years, but in the 1930s, a second kind was found in the cell cytosol this was given the name RNA.

Figure 10.22 Four different representations of the nucleotides that are the sub-units of
DNA. Can you identify the phosphate, the sugar and the base in each nucleotide?

When many nucleotides join to form a chain, a bond forms between the sugar of one nucleotide and the phosphate group of the next nucleotide, and so on (see gure 10.23). So, one chain of nucleotides runs from head-to-tail, with a phosphate group at the head end (also known as the 5 [5 prime] end) and a sugar molecule at the tail end (also known as the 3 [3 prime] end).
P P S T P S T P S A P S A P S T

1.

2.

3.

Figure 10.23 Joining nucleotides

to form a DNA chain

So DNA is built from nucleotides joined to form a chain. However, the question remained: how is a typical DNA molecule arranged in three-dimensional space? For example, does it consist of one nucleotide chain coiled into a ball? Does it contain more than one nucleotide chain?

Early analysis of DNA

The relative proportions of the different nucleotides in DNA from various organisms can be identied. Table 10.4 shows a summary of experimental results obtained by various scientists in the late 1940s and early 1950s.
352
NATURE OF BIOLOGY BOOK 2

Table 10.4 Approximate values for the total amounts of the four kinds of nucleotides in
DNA samples from different organisms. What predictions would you make about DNA from calf liver cells?

Nucleotides Source of DNA calf thymus yeast cells tubercle bacteria herring sperm A 1.7 1.8 1.1 1.1 T 1.6 1.9 1.0 1.1 C 1.0 1.0 2.6 0.9 G 1.0 1.0 2.6 0.9

These gures indicate a possible pattern. It appears that in DNA the proportions of A and T are about equal and also that the proportions of C and G are about equal. This idea, known as Chargaffs rule, was an important observation that later contributed to understanding the 3-D structure of DNA.

KEY IDEAS
The genetic material DNA is built of sub-units called nucleotides joined to form a linear chain. Each nucleotide consists of a deoxyribose sugar part, a phosphate part and an N-containing base. The sugar and phosphate parts are identical in nucleotides found in DNA, but there are four different bases, namely adenine (A), guanine (G), cytosine (C) and thymine (T). Chargaffs rule states that certain bases occur in equal proportions in DNA.

QUICK-CHECK
9 What are the sub-units of DNA? 10 If the sub-units of DNA were analysed, what parts would be identied? 11 The relative proportion of the G nucleotide in DNA from human gut cells was found to be 1.4 and that of T was 0.9. What other conclusions are possible?

DNA forms a double helix

The questions that scientists now had to answer included: If more than one nucleotide chain is present, how are the chains arranged in relation to each other to form a 3-D DNA molecule?

Watson and Cricks model making

In 1953, James Watson (1928 ) and Francis Crick (19162004) (see gure 10.24) announced that they had identied the 3-D structure of DNA as being two
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

353

nucleotide chains arranged to form a double helix. Their work built on the work of other scientists, in particular, the pioneering X-ray crystallography work of Rosalind Franklin (19201958) and Maurice Wilkins (19162004).

Figure 10.24 James Watson and

Francis Crick identied the double helix structure of DNA.

ODD FACT
In 1962 the Nobel Prize was awarded jointly to Watson, Crick and Wilkins for their work in discovering the structure of DNA. The other person who played a decisive role in this discovery was Rosalind Rosy Franklin. She died of cancer in 1958 at the age of 37. The rules governing the Nobel Prize do not permit an award to be made to a person after death.

The key features of the double helix model of DNA (see gure 10.25) are: Each DNA molecule consists of two nucleotide chains. The chains run in opposite directions and are said to be anti-parallel. The sugarphosphate backbones of the two chains are on the outside of the DNA double helix and they coil around each other in a regular manner to form a molecule with a constant diameter. The bases (A, T, C and G) are arranged so that they point to the inside of the DNA molecule. The bases in one chain pair with the bases in the second chain in a very specic way: there is pairing only between A and T or between C and G. Weak hydrogen bonds form between the base pairs. The base pairs between the two strands, namely, A with T and C with G, are said to be complementary base pairs (see gure 10.26). This complementary double helix structure for DNA ts with the known properties of the genetic material including the facts that DNA: can act as a template for its own replication contains genetic instructions can undergo change or mutation. The box on pages 3778 contains excerpts from James Watsons personal account of the discovery of the DNA double helix (The Double Helix, Atheneum, New York, 1968). Reading these excerpts may help you understand how scientists work and realise that they spend time thinking about problems and assessing alternative ideas, not just doing experiments.

354

NATURE OF BIOLOGY BOOK 2

(a)

(b)

Figure 10.25 Two representations

of DNA (a) Double helix (side view) showing the sugarphosphate backbones on the outside of the DNA, with the sugars (deoxyribose) shown in yellow and the phosphates in pink. The inner rungs are formed by base pairing of A with T and C with G. (b) Pairing of the nucleotide bases of the inner rungs of the DNA double helix. Here we see the complementary pairing between A and T and between C and G. Notice that the size of an AT pair is the same as the size of a CG pair. This observation was an important clue in solving the structure of DNA.

Figure 10.26 Chemical formulae

for the complementary bases in DNA. Note the two hydrogen bonds between the AT pair and the three hydrogen bonds between a CG pair (shown in red).
N H N Adenine H N N N H H O N O CH3 N N H H N N O N N H Thymine Guanine H H H N

N N O H

Cystosine

Know one, infer the other

A double helical DNA molecule contains complementary base pairs: AT, TA, CG and GC. If the order along one DNA chain is known, the sequence of bases in the second chain can be inferred. So, if one DNA chain has the base sequence: G G T A C G T A . . . , the sequence in the complementary chain must be: CCATGCAT. . .

Separate, then nd your partner!

Double helical DNA consists of two nucleotide chains held together by weak hydrogen bonds between the complementary nucleotides that are easily broken with a low input of energy. If a solution of DNA is heated to 90C for two minutes, each double helical DNA molecule separates (a process called dissociation) to form two single chains of DNA (see gure 10.28). This heating does not break the strong sugarphosphate bonds that join nucleotides into one chain. If this solution is then allowed to cool, the complementary regions of the chains pair, the hydrogen bonds re-form, and the DNA returns to a double-stranded helix form (re-association) (see gure 10.28). Pairing between complementary DNA chains or parts of chains from different sources is referred to as hybridisation.
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

Figure 10.27 Just 88 years

after Mendels experiment, his factors were recognised as bits of a DNA double helix.

355

Heat

Cool

E
Figure 10.28 The double helix
structure of DNA can undergo a reversible change. What is this change?
Dissociation Re-association

KEY IDEAS
DNA normally exists as a double helix molecule. In a DNA double helix, bases along one chain pair with complementary bases in the other chain and are stabilised by weak hydrogen bonds. Double-helical DNA can be reversibly dissociated into two single DNA chains by heating and the chains re-associate on cooling.

QUICK-CHECK
12 What is meant by a double helix? 13 What would be expected to happen if a solution of DNA was (a) gently heated, and (b) then allowed to cool? 14 Consider part of a DNA chain with the nucleotides: . . . T T A G G A C. . . Which of the following is part of the complementary strand: a . . . C C G A A G T. . . ? b . . . T T A G G A C. . . ? c . . . A A T C C T G. . . ?

Relating DNA to chromosomes and genes

How much DNA in a chromosome?
Diploid human cells contain 23 pairs of chromosomes. Each chromosome contains just one double-stranded DNA molecule. The longer a chromosome, the longer the DNA molecule that it contains and the more genes it is expected to carry. The length of a piece of double-stranded DNA is commonly expressed as the number of base pairs (bp) it contains. For single-stranded DNA, the length is expressed as the number of bases (b). The total amount of DNA in a haploid human cell is about 3000 million bp with a total length of nearly one metre. If this DNA is divided among 23 chromosomes, the total length of the DNA molecule in an average chromosome is about four centimetres, consists of about 120 million bp and constitutes several thousand genes. The DNA double helix is very, very thin: only 2 nm (0.000 002 mm) wide. (A strand of hair having the same proportions would be more than one kilometre long.) The organisation of this length of DNA into a microscopic chromosome involves much coiling and supercoiling (refer back to gure 1.29, page 24).

ODD FACT
The smallest chromosome deletion that can be detected visually through a microscope is about four million bp.

356

NATURE OF BIOLOGY BOOK 2

How much DNA in an average gene?

A human cell has an estimated 20 000 to 25 000 genes. Each gene consists of a length of double-stranded DNA that contains coded information for a particular function. An average gene consists of several thousands of base pairs. Genes vary in size and range from about 8000 base pairs to more than two million base pairs in length. The longest human gene isolated so far is the DMD gene responsible for Duchenne muscular dystrophy, an inherited disorder affecting muscles.

How many genes in the human genome?

The genome is the total set of genes carried by an individual or cell. For many years, the total number of human genes was believed to be 100 000 or more. (Remember these are genes, not alleles.) In February 2001, the rst draft of the base sequence of the human genome was published. Based on this sequence, the total number of human genes was identied as being in the range of 30 000 to 40 000, much lower than the expected number of around 100 000 genes. This was all the more surprising when the number of genes in a simple roundworm (Caenorhabditis elegans) was known to be about 19 000 and the number in the fruit y (Drosophila melanogaster) was about 14 000. From these ndings, it became apparent that a more complex organism, such as a fruit y, did not necessarily have more genes compared with a less complex organism, such as a nematode worm. A further shock came in October 2004 when the number of human genes was revised downwards to the range of 20 000 to 25 000 genes. This nding was published in the 21 October 2004 issue of the science journal Nature. In this publication, a group of leading researchers identied 19 599 human genes that hold the instructions for making proteins and they found another 2188 segments of DNA that are likely to be identied as genes. This led to their estimate of 20 000 to 25 000 genes in total.

Figure 10.29

ODD FACT
At a biological conference in early 2001, researchers recorded their guesses about the number of human genes; their estimates ranged from 27 462 to 200 000!

Where is the DNA in a cell?

In human cells, the DNA is almost exclusively located in the nucleus, separated from the cytosol by a nuclear membrane. The same is true for the cells of all eukaryotic organisms. So, if we look at an image of cells that are stained selectively, with one stain being for DNA, we will see that the DNA appears to be conned to the nucleus (see gure 10.31). This chromosomal or nuclear DNA carries almost all of the 20 000 to 25 000 genes that we have in each cell. However, mitochondria, which are cells organelles found in the cytosol, also have minute quantities of DNA.

Mitochondria contain DNA

Mitochondria are cell organelles concerned with the generation and storage of energy in the form of ATP that are found in eukaryote cells. (Prokaryote cells do not have mitochondria.) Mitochondria contain DNA and mtDNA is a doublestranded circular molecule. The two strands of each circular molecule of human mtDNA together comprise 16 568 base pairs and code for 37 genes: 13 genes code for proteins that are involved in cellular respiration 2 genes code for ribosomal RNA (rRNA) 22 genes code for transfer RNAs (tRNAs). Figure 10.32 shows a diagram of a circular mtDNA and the location of the 37 genes. One part of the mtDNA, identied as the D-loop, does not contain any
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

Figure 10.30

357

ODD FACT
Of the 37 genes carried on mtDNA, 28 are located on one strand, known as the H strand, and 9 are located on the complementary strand, known as the L strand. The H(eavy) strand has many more G bases than the L(ight) strand that is rich in Cs.

Figure 10.31 Photomicrograph

showing animal cells that have been selectively stained for DNA (orange), which is conned to the nucleus in each cell

genes. The term D-loop comes from the fact that, during replication of mtDNA, the rst newly synthesised strand displaces one of the parental strands and forms a loop.
12s rRNA
OH

D-Loop nt 0/16569

Cyt b

Figure 10.32
Map of the double-stranded circular molecule of human mitochondrial DNA (mtDNA) showing the various genes for which this DNA codes. Do all the mtDNA genes control production of proteins? To avoid congestion, symbols for the 22 tRNA genes are not shown. Can you locate these 22 genes by their colour code? OH and OL denote the origins of replication of the two chain of the mtDNA molecule.

16s rRNA

PL ND6 ND5

Complex 1 genes (NADH dehydrogenase) Complex IV genes (cytochrome c oxidase) Complex III genes (ubiquinol : cytochrome c oxidoreductase) Complex V genes (ATP synthase) Transfer RNA genes Ribosomal RNA genes

ND1 Q

ND2 OL ND4

ND4L ND3 CO1 COI COIII ATPase6 nt9207 ATPase8

Gene structure
The template strand and its partner
A gene consists of part of a double-helical molecule of DNA. One of the two chains contains the information present in a particular gene and this is called the template strand. The complementary chain is sometimes called the nontemplate strand.
358
NATURE OF BIOLOGY BOOK 2

Representations of DNA
DNA cannot be seen with a light microscope. However, a technique known as scanning tunnelling microscopy (STM) allows DNA molecules to be visualised (see gure 10.33). Part of a single chain of DNA could be shown as follows: . . . -nucleotide-nucleotide-nucleotide-nucleotide-nucleotide- . . . OR it could be shown as: . . . -P-sugar-P-sugar-P-sugar-P-sugar-P-sugar- . . . | | | | | base base base base base

Figure 10.33 Part of a DNA

double helix revealed through scanning tunnelling microscopy

OR the specic nucleotides in one chain could be shown: 5 . . . A T T A G C T T G A G G C G . . . 3 Which representation is correct? All are correct. Which representation is the most informative? The third is the most informative because it gives the information about the order of nucleotides, the only variable part of the genetic material. What information does the second representation provide? DNA is not always represented in diagrams as a double helix. Figure 10.34 shows some of the many ways of representing DNA. The representation used will depend on the purpose of the diagram. Each provides different information about DNA. For example, (a) gives information about the coding regions (introns) and the non-coding regions (exons) within a gene, while (c) gives the base sequence.
(a)
Intron 1 Exon 1 Intron 2
A C G
T

(d)

Exon 2

Exon 3
T A T A G

(b)
879 bp 286 bp

C T A

(c)
TCTGAGCGCG GCGCTCAGA AGCTGGACAGCC GCTGTCCAGCT
T A

Figure 10.34
Different ways of representing DNA

Gene sequencing
What is this? ATGGTGCACCTGACTCCTGAGGAGAA This is part of the nucleotide sequence of the template strand of the human HBB gene, which controls production of one of the protein chains found in haemoglobin. What is the sequence of the complementary strand? When the order of the nucleotides in a gene is identied, the gene is said to be sequenced. The order in many genes from animals, plants and bacteria has been identied, and data are being added each week. Gene sequencing involves the process of identifying the order of nucleotides along a gene. Figure 10.35 shows a scientist examining some sets of
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

Figure 10.35 A scientist

examining the sequence of bases in DNA

359

ODD FACT
In 1990, the cost of DNA sequencing was about $10 per base. By 2003, the cost had dropped to about 5 cents per base.

bands arranged in columns. Each band represents one nucleotide and the order of the bands down the column corresponds to the gene sequence. New techniques of sequencing are described in the box below. Are gene sequencers used only for human genes? No! The genetic material of all organisms is DNA and the structure of that DNA is identical, regardless of whether it comes from wheat, jellysh, ducks, Bacillus bacteria, insects or people. In all organisms, genes are built of the same alphabet of four letters, namely, the nucleotides A, T, C and G of DNA. The only exception to this generalisation is that one particular group of viruses (family Retroviridae), known as retroviruses, have ribonucleic acid or RNA as their genetic material, not DNA. So the genetic instruction kit to make a human being or make an oak tree or make a white shark consists of thousands of instructions, each consisting of DNA with different base sequences.

DNA SEQUENCERS
(a)

The process of gene sequencing has now been automated and is done using instruments known as DNA sequencers (see gure 10.36a). This automated system involves the use of four different coloured uorescent dyes, each of which binds to a specic base (A, T, C or G) in DNA. The DNA chain is sequenced using a procedure that stepwise makes a complementary copy using the DNA template, with each copy being one nucleotide longer than the previous one as shown below: DNA template: CTCTCCGCCAAACGCATAACC 1st copy 2nd copy 3rd copy 4th copy etc. 21st copy G* GA* GAG* GAGA* GAGAGGCGGTTTGCGTATTGG*

G A

(b)

G A G G C G G T T T G C G T A T T G G Laser signal Computer output

Figure 10.36
(a) ABI Prism 310 Genetic Analyzer from Applied Biosystems (b) Output from a DNA sequencer showing the laser signals and the output from the computer, which identied the base sequence in part of a DNA fragment. What is signalled by a red band?

In each case, the nucleotide at the end of each copy becomes attached to the specic uorescent dye (shown as a *). The copies move in turn, shortest rst, past a scanning laser that activates the dye so that it emits a uorescent signal, which is captured by a detector. This detector transfers the signal to a microcomputer, which determines the entire base sequence. The output from a DNA sequencer shows the base sequences as a series of coloured signals (see gure 10.36b) with a yellow peak denoting G, a red peak denoting T, a green peak denoting A and a blue peak denoting C. DNA sequencing laboratories exist in several Australian cities, including the Brisbane Division of the Australian Genome Research Facility and the DNA Sequencing Laboratory at the Walter and Eliza Hall Institute in Melbourne. You can visit the latter at the web site http://www.wehi.edu.au/dsl.

360

NATURE OF BIOLOGY BOOK 2

Comparing DNA from different organisms

Databases hold information about the base sequences in the DNA of genes of many organisms. Table 10.5 shows part of various genes from different organisms a duck, a Bacillus bacterium, a corn plant and a human being. Could you pick the human gene? Its not possible. The genes look similar because the genetic language of all living things is written in a common language based on an alphabet of four letters (A, T, C and G) that correspond to the nucleotides (and bases) present in DNA.

Table 10.5 Part of the sequences of different genes from various organisms. Numbers are placed above the sequences for ease
of locating a particular nucleotide.

1 Organism P

10 TTA

20

30

40

ATG GCT ACC AAG ATA 1 10

GCC CTC CTT GCG CTC CTT TCC CTT TTA 20 30 40 AAA GAG GGA AGC 40

Organism Q

ATG AAG TGT AAT GAA TGT AAC AGG GTT CAA TTA 1 10 20 30

Organism R

ATG ACG CTG ACT CAA GCT GAG AAG GCT GCC GTG ATC ACC ATC TGG 1 10 20 30 40 GGG TTC TGC TGG GCT

Organism S

ATG AGG CTC TTG TGG TTG CTT TTC ACC ATT

P: corn plant Q: Bacillus bacterium R: duck S: human being

How do genes differ?

The total human DNA contains a make a human being instruction kit; the total geranium DNA contains a make a owering plant, geranium type instruction kit. The human genetic instruction kit consists of tens of thousands of separate instructions, such as make the hair protein, keratin and make growth hormone. Different genetic instructions within and between species are due to different nucleotide sequences in the genes.

KEY IDEAS
The length of a double-helical DNA molecule can be expressed as the number of base pairs (bp) it contains. Each human chromosome contains one long molecule of doublestranded DNA with millions of base pairs. A typical gene consists of tens of thousands of base pairs. The estimated total number of human genes is 20 000 to 25 000. Of the two DNA chains in a gene, the one containing the genetic information is known as the template strand of DNA, while its complementary chain is called the non-template strand. Genetic instructions are coded in an alphabet of four letters only: (the nucleotides) A, T, C and G. Identication of the order of nucleotides along a length of DNA is called DNA sequencing. Different genes vary in the nucleotide sequences along their DNA.

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

361

QUICK-CHECK
15 A piece of DNA contains 20 000 bp. Is this more likely to be a whole chromosome or a whole gene? Explain. 16 If genes were isolated from a cat, a cyanobacterium and a cauliower, what similarity would be seen? 17 If the two human genes for making blood-clotting factor and salivary amylase were compared: a in what way would they be similar? b in what way different?

Nature of the genetic code

Codes and more codes
The genetic instructions for all organisms are written in a code that uses an alphabet of four letters only, namely A, T, C and G. What is a code? Figure 10.37 shows some codes. Codes communicate information. To translate or decode a coded message, the information held in the code elements must be known. When decoded, this information may be verbal (words) or numerical (numbers) or auditory (musical sounds) or may specify an object. If the coded information exists in a permanent form, the information can be decoded at any time by returning to read the code. For example, you can play a CD many times: each time the CD player decodes (translates) the information that is permanently encoded as microscopic pits on the disk surface.

Figure 10.37 Various ways of

representing information codes. Can you think of others?

The genetic code

The DNA of genes is an information-carrying molecule. Genetic information is coded using just four elements: A, T, C and G. Before DNA was identied as the genetic material, many biologists thought that DNA was too simple a molecule to contain complex genetic instructions. How can a large amount of information be encoded by a code that has a small number of elements? A code consisting of a few elements can encode a large amount of information. The morse code has two elements only, a dot (.) and a dash (). By using
362
NATURE OF BIOLOGY BOOK 2

various combinations of these elements, morse code can convey very complex information, such as all the words in this chapter.

Information encoded in the genetic code

The genetic code in DNA typically contains information for joining amino acids to form proteins. We can show this as: Coded information nucleotide sequences in DNA Decoded information order of amino acids in proteins

Proteins have many functions, and the various types include: structural proteins, which occur in connective tissues and in cell membranes contractile protein of muscle and myolaments enzymes that regulate chemical processes proteins of the immune system, such as the antibodies oxygen-carrying proteins, such as haemoglobin hormonal proteins, such as insulin and growth hormone. By encoding the sets of instructions on how to make the various types of proteins, genes control the structure and the biochemical and physiological functioning of an organism. The estimated 20 000 to 25 000 genes of a human organism contain all the instructions on How to make a human organism that, if printed as the base sequences, would ll 1000 volumes of an encyclopedia.

Organisation of the genetic code

Consider two observations: 1. Genes typically contain coded information for assembling amino acids to form proteins. 2. Proteins are made of combinations of 20 different amino acid sub-units. From these observations, it may be inferred that the genetic code must have at least 20 different instructions or pieces of information. Examine table 10.6.

Table 10.6
Number of nucleotides in one instruction 1 (e.g. T) 2 (e.g. AA, AT, GA) 3 (e.g. TTA, GCC, AAA) 4 (e.g. GGGA, TGCA, AATG) In discussing the genetic code, the term base is sometimes used. You should recall that each base is part of a nucleotide. Total number of different instructions possible 4 16 64 256

In fact, one genetic instruction consists of a group of three bases, such as AAT, GCT and so on. Because of this, the genetic code is referred to as a triplet code. This form of code is sufcient to account for the pieces of information that must be encoded. Consider a piece of DNA with the base sequence: T A C A A A C A A G C T C C T A C T . . . This DNA has six coded instructions (shown underlined) that are decoded or translated as follows: 1. TAC = Start building a protein, commencing with the amino acid, met 2. AAA = now add the amino acid, phe 3. CAA = now add the amino acid, val 4. GCT = now add the amino acid, arg 5. CCT = now add the amino acid, gly. 6. ATT = now stop.
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

363

Cracking the genetic code

The genetic code was originally unknown and had to be broken. In 1961, the rst piece of the genetic code was broken when the three-base sequence AAA in DNA was decoded as Put the amino acid, phe, into a protein under construction (see gure 10.38). By 1966, all 64 pieces of the genetic code had been deciphered. The appendix (page 656) contains the genetic code and the full names and structures of amino acids. Many of the meanings are shown in shorthand form by the name of an amino acid, for example, lys. You should remember that the complete meaning is Put the amino acid, lys, into a protein chain. The code also contains the instructions: START adding amino acids to a chain, and STOP adding amino acids to the chain. The main features of the genetic code are: Pieces of information in the genetic code consist of triplets or three-base sequences (e.g., TCA). The code is non-overlapping. So, a fragment of DNA consisting of 12 bases contains four pieces of information or instructions. The code is essentially the same in bacteria, in plants, and in animals it is said to be universal (but see the odd fact at left). The code is said to be redundant because, in many cases, more than one triplet of bases codes for one particular amino acid. The information encoded in DNA is the set of instructions to assemble amino acid sub-units into proteins. The information also includes a START instruction and STOP instructions. The START code is TAC and there are three STOP codes, ATT or ATC or ACT.

ODD FACT
The genetic code is not completely universal. Some triplets that code for one instruction in most organisms code for a different instruction in a few other organisms. For example, the triplet ATC which is a STOP signal in most organisms codes for the addition of the amino acid, glu, in some protists, including Paramecium. The code is also different for mitochondrial DNA TCT is a STOP signal, not a code for arg.

KEY IDEAS
DNA contains information encoded in the base sequence of its template strand. Genes contain coded instructions for joining specic amino acids into proteins. The genetic code in DNA is a non-overlapping triplet code consisting of groups of three bases. One piece of genetic code typically contains the information to add one amino acid to a protein.

QUICK-CHECK
18 Give an example of a code. 19 In what form is information held in a DNA molecule? 20 Which of the following statements is most accurate? Explain your choice. a DNA is converted to the amino acid sub-units of protein. b DNA contains the coded information for joining amino acids to form protein. c DNA turns into protein. 21 How many instructions (for adding amino acids) are present in the base sequence: TTAGGG? 22 What code translates as START joining amino acids to form a protein? 23 What are the meanings of the following codes in DNA: CAA and ACT?

Figure 10.38 In 1961,

Nirenberg and Matthaei cracked the rst element of the genetic code.

364

NATURE OF BIOLOGY BOOK 2

ODD FACT
The largest genome yet identied is that of an amoeba (Amoeba dubia). Its genome comprises 670 000 000 000 base pairs. This is more than 200 times larger than the human genome!

What is a genome?
The genome of an organism is its complete set of genetic instructions, encoded in DNA. For humans, the genome consists of the DNA of the haploid set of autosomes, plus sex chromosomes. Similarly, for other eukaryotes animals, plants, fungi, protists their genomes are the DNA of the haploid sets of their chromosomes. When we refer to the genome of a eukaryotic organism, as for example, the chimp genome or the rice genome, we are speaking about the nuclear DNA. We can also talk about the genome of those organelles that contain DNA, such as the mitochondrial genome or the chloroplast genome. The eld of study of genomes is termed genomics. For prokaryotes bacteria and archaeans their genomes comprise the DNA of the single circular chromosome that carries the genetic instructions of each species. For viruses, their genomes consist of their entire genetic instructions encoded in one DNA molecule, or, in the case of retroviruses, in one RNA molecule. When a genome is sequenced, it means that the precise order or sequence of bases in the DNA of the genome has been identied. Reports of the sequencing of the genome of various organisms appear in scientic journals. For example, in March 2000, the fruit y genome sequence was published (refer back to gure 10.1) and, in October 2005, sequences of the RNA of the genomes of more than 200 inuenza viruses were published, including one inuenza virus that was the cause of the 1918 u pandemic.

ODD FACT
Reports of the sequencing of the genomes of various organisms appear regularly in the scientic press. Publication of genome sequences typically occurs in stages: a preliminary release, a nal draft sequence then a nished version. The error rate in the nal sequence is less than one in every 10 000 bases.

Looking at the human genome

Every person, apart from identical siblings, has a unique genome. However, the genomes of all members of the species Homo sapiens share many similarities. It is estimated that the genomes of two unrelated people would on average have about three million differences. Sounds a lot? It is not a lot as this means they differ by only one base pair in a thousand, or 0.1 per cent. Put another way, the genomes of two unrelated people are 99.9 per cent the same (see gure 10.39).

Figure 10.39 (a) Each individual

in this group has a unique genome, but, as humans, their genomes are 99.9 per cent similar. How many bases are represented by a 0.01 per cent difference? (b) Image of coloured bases forming part of the human genome sequence. How many different colours would you expect?
(b)

(a)

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

365

ODD FACT
In December 1999, chromosome 22 became the rst human chromosome to be sequenced (33 500 000 bp and 545 genes). In May 2000, sequencing of the 33 800 000 base pairs of chromosome 21 was completed.

Here are some facts about the human genome. How big? About 3 000 000 000 bp (3 billion base pairs) organised as a DNA double helix in the chromosomes. The most recent measurement puts the size of the human genome at 2 850 000 000 base pairs. If you were to count the bases on one chain of DNA at the rate of one per second, it would take you over 90 years to complete the count. How many genes? 20 000 to 25 000 genes organised into the DNA of 22 nonhomologous autosomes and the X and Y sex chromosomes. The majority of these genes contain the instructions for building proteins and surprisingly, these genes constitute about 1.5 per cent of the total genome! About 95 per cent of the genome is of unknown function. (While this is sometimes called junk DNA, it should more correctly be called non-coding DNA, because functions for at least some of this DNA will be identied in the future.) How do the genomes of individuals differ? Many of the differences between the genomes of different people are single base differences in the DNA sequence of the genome (see gure 10.40), known as single nucleotide polymorphisms or SNPs. Other differences involve variation in the number of repeats of short sequences of bases.

Figure 10.40 Matching parts of

the DNA sequence in the genome of two people. There is just a single difference (shown arrowed) in one of the DNA strands (and of course in the complementary strand). Differences of this type between genomes are known as single nucleotide polymorphisms or SNPs (pronounced snips).

Person 1

--CCTTGCGTA A TCCG----GGAACGCAT T AGGC---

Person 2

--CCTTGCGTA C TCCG----GGAACGCAT G AGGC---

The Human Genome Project (HGP)

The international cooperative and publicly funded research project known as the Human Genome Project (HGP) began in 1990 with the aim of sequencing the human genome and mapping all the human genes. (A privately funded project with the same aim was also begun by the US company, Celera Genetics.) The human genome is packaged into the human chromosomes. Research groups in different countries, principally the United States, United Kingdom, France, Germany and Japan, undertook the sequencing of individual human chromosomes, assisted by other countries, including Australia. The HGP stands as one of the greatest scientic explorations. It has revealed the entire genetic instructions that make us human. In June 2000, the International Consortium announced that a rough draft of the human genome had been achieved. In April 2003, the nal version of the human genome was completed (see gure 10.41). The deciphering of the functions of the various parts of the human genome and their precise mapping will continue for many years, particularly those parts that are presently described as junk. Benets that are expected to result from the HGP include positive impacts on medicine as follows. Diagnosis: Data from the HGP can be used to provide improved and more accurate diagnoses of inherited disorders due to single genes. Treatment: Data from the HGP can be used to identify the products of genes and infer how mutant alleles that cause inherited diseases produce their undesirable effects. Understanding more about how genes act and identifying their products will generate new treatments for inherited disorders. Prevention: Data from the HGP will assist in identifying genetic factors that predispose some people to disabling conditions, such as strokes and cancers.

Figure 10.41
366
NATURE OF BIOLOGY BOOK 2

ODD FACT
The DNA sequenced in the HGP came from 12 anonymous donors who provided either blood samples (from females) or sperm samples (from males).

This knowledge might identify people at risk and develop treatments to reduce or prevent these conditions. Human biology: Data from the HGP will allow us to understand better the genetic control of normal human development and will also provide new insights into human evolution, anthropology and the prehistory migrations of human groups.

What other genomes have been sequenced?

As at December 2005, the complete genomes of more than 330 different kinds of organism had been fully sequenced, and the sequencing of hundreds more was in progress. For example, the sequencing of the genome of Cinnamon the cat is underway and that of Tasha the dog is complete. Table 10.7 lists some of the organisms whose genomes have been sequenced.

To view photos and read more about Cinnamon and Tasha, go to www.genome.gov and click on Newsroom or do a search for each name.

Table 10.7 Selected organisms whose genomes have been sequenced as at the end of 2005
Organism Date published Size of genome (base pairs, bp) Estimated number of genes Comment

AGCphiX174 CGTAATTTACCGCGCTTACCGTAATTTAC11 TGGCCTACTTACCGTA TTAC C virus Apr. 1993 5 386 rst genome sequenced ATTTACCGCGCTTACCGTAATTTACCTGGCCTACTTACCGTAA TTACCGCGCTT T smallpox May 186 000 197 ACCGTvirus TTTACCTGGC1993ACTTACCGTAATTTACCGCGCTTACCGTAATTTAC AA CT July 1995 830 000 1 850 bacterium Haemophilus inuenzae CTGGCCTACTTACCGTAATTTACCG1CGCTTACCGTAATTTACCrstGGCCTACTTA T (bacterium) CCGTAATTTACCGCGCT1996 CCGTAATTTACCGCGCTTACCGTArst TTTACand GGC TA A CT Apr. 12 069 000 6 294 eukaryote Saccharomyces cerevisiae rst fungus (brewers TAC CTACTyeast) CGTAATTTACCGCGCTTACCGTAATTTACCTGGCCTACTTACCGTA A TTACCGCGCTTACCG1998ATTTACCTGGCCTACTT1ACCGTAArstTTACCGCGCT T Aug. TA 1 700 000 738 T archaean Methanococcus janaschii (archaean TAAat TTACCTGGCCTACTTACCGTAATTTACCGCGCTTACCGTAATTTA found T TACCG vents) hydrothermal CCTGGCCTACTTACCGT1998TTTACCGCGCTTACCGTAATTTACCGCGCTTACCG AA Dec. 97 000 000 19 099 rst animal Caenorhabditis elegans TAATTTACCTGGCCTACTTACCGTAATTTACCGCGCTTACCGTAATTTACCTGG (nematode worm) CCTACTmelanogaster AA Mar. ACCGCGC137 000CCGTAATTTACCTGGCCTACTTACCGT TTT 2000 TTA 000 14 100 Drosophila TACCGT (fruit T AATTy) ACCGCGCTTACCGTAATTTACCTGGCCTACTTACCGTAATTTACCGCGC Dec. 2000 115 000 000 25 498 T plant Arabidopsis thaliana TTACCGTAATTTACCTGGCCTACTTACCGTAATTTACCGCGCTrstACCGTAATTT (thale cress) ACCGCGCTTACCGTAATTTACCTGGCCTACTTACC GTAATTTACCGCGCTTAC Oct. 278 000 000 14 000 main Anopheles gambiae CGTAATTTACCTGGCCT2002 TTACCGTAA TTACCGCGCTTACCGTvectorTof malariaCT AC T AA TTAC (mosquito) GGCCTACTT(rat) CGTAAT2004ACCGCGCTTACCGTAA20TTACCTGGCCTACTTACC AC TT T 975 Apr. 275 000 000 Rattus norvegicus GTAATTTACCGCGCTTACCGTAATTTACCTGGCCTACTTACCGTAATTTACCGC Apr. 390 000 000 37 544 Oryza sativa (rice) GCCTACTTACCGTAATT2005CCGCGCTTACCGTAATTTACCTGGCCTACTTACCG TA
In June 2004, it was announced that Australian and US scientists would cooperate on sequencing the genome of an Australian marsupial, the tammar wallaby (Macropus eugenii). The Australian researchers involved in this project are at the Australian Genome Research Facility in Melbourne. Read the story of one of the scientists, Dr Sue Forrest, who is involved in the sequencing of the tammar wallaby (see page 369). In addition to the organisms listed in table 10.7 above, the genomes of the mitochondria of several species, including the human mitochondrial genome (16 568 bp), have been sequenced. So, too, have the chloroplast genomes of several plant species.
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

367

A genome is more than simply a sequence of so many base pairs. Researchers also explore genomes in terms of other features, including: organisation of the genome into chromosomes genome maps, identifying the order of genes and the relative position of each gene on the DNA of the chromosomes proteins produced by a genome identifying all the protein products of the coding genes within a genome, a new eld of study termed proteomics.

Comparative genomics
The availability of the complete sequences of the genomes of an increasing number of organisms has created a new eld of study known as comparative genomics. Comparing the genomes of various species will elucidate how various features of genomes have evolved and how the genomes of closely related species differ. Comparative genomics also provides data to assist research into medicine, ecology and biodiversity and is also a powerful tool in exploring evolution (see chapter 14, pages 5567). For example, comparative genomics has provided evidence of the occurrence of processes such as gene duplication, where a second copy of a gene appears in a genome, and horizontal gene transfer, where a new gene has been acquired by one species as a result of the transfer of DNA from a second species. In August 2005, the sequencing of the genome of the chimp (Pan troglodytes) (see gure 10.42) was completed. Comparisons between the chimp genome and the human genome are expected to elucidate the genes that control the distinctive features of primates, such as high brain-to-body-mass ratios, and the genes that determine our uniquely human features. Figure 10.43 shows a map of the B2 cat chromosome. This gure also shows a comparison of that chromosome with the human chromosome-6. Note that some of the genes are conserved in the two species, as indicated by the dotted lines.

Figure 10.42 Of all living species,

the chimpanzee is most closely related to humans through evolution.

Figure 10.43 Comparison of cat

and human chromosomes at the gene loci level.

368

NATURE OF BIOLOGY BOOK 2

BIOLOGIST AT WORK
Dr Sue Forrest molecular geneticist
Dr Sue Forrest is a molecular geneticist and the Director/ CEO of the Australian Genome Research Facility, a major national research facility with nodes in Brisbane, Melbourne and Adelaide. Her previous position totalled 13 years at the Murdoch Childrens Research Institute at the Royal Childrens Hospital in Parkville. Most recently, she headed the Gene Discovery Group there for ve years, developing methodologies for the discovery of the genes responsible for common human diseases and, prior to this, ran the DNA Diagnostic laboratory for eight years. My interest in genetics developed right from my rst introduction to this fascinating area in rst-year Biology as part of my Bachelor of Science at Melbourne University. Following completion of my Honours degree, majoring in Biochemistry and Genetics, I headed overseas to study for my PhD at Oxford University where I was fortunate to work with Professor Kay Davies. We cloned the gene, dystrophin, in 1987. This gene, when mutated, results in Duchenne muscular dystrophy and was one of the rst disease-causing genes to be cloned in the late 1980s. In the gene discovery laboratory, we were particularly interested in neurodegenerative diseases. We looked for large pedigrees of individuals demonstrating clear Mendelian inheritance where we could obtain blood samples and determine the most likely location for the disease-causing gene using genetic markers. These studies would result in locating disease-causing genes to smaller sections of a particular chromosome but the hard part remained nding the exact gene that was mutated. A fantastic event in genetic history occurred in 2003 when the sequence of the human genome was announced as completed. The rst major outcome was that there were only about 25 000 genes in the human genome, compared to the 100 000 originally predicted, requiring new ideas about gene structure and function to be developed. Since the Human Genome Project was instigated, there is far more information about genes and their sequences on the Internet and much of the research is now done as computer cloning rather than actual laboratory bench work! The challenge now is to determine the function of the genes in the human genome and how they are regulated. During this nalisation of the Human Genome Project in 2001, I was offered the position of Scientic Director of the Australian Genome Research Facility (AGRF) followed by Director/CEO in 2003. AGRF is partly funded by the Federal Government to provide access to state-of-the-art genetic tools and technologies that can be utilised by researchers across the whole biological spectrum. Thus, moving to this position dramatically opened my eyes to the vast spectrum of molecular biology and genetic research in species, from microbes through to animals, that was occurring within Australia and around the world. Australia did not play a major role in the sequencing of the human genome, but through a unique collaboration between the National Institutes of Health in the USA and the Australian Genome Research Facility, funded by the State Government of Victoria, the genetic sequence of the tammar wallaby is being determined. This sequence will assist with dening which regions of the genome share sequence between human and wallaby, thereby indicating that they are likely to have a signicant function. Such sequences could be involved in regulating gene expression as an example. Also, much biological research has been done in Australia on the tammar wallaby demonstrating novel properties of lactation, development and reproduction that will be unravelled using the genetic sequence. It is an exciting time in genetics and I certainly would never have predicted in the early 1980s that, 20 years later, I could read the whole human genome sequence on the Internet. I wonder what the next 20 years will bring us!

Figure 10.44
Dr Sue Forrest, Director of the Australian Genome Research Facility, and a tammar wallaby named Wriggles

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

369

KEY IDEAS
The genome of an organism consists of its complete set of genetic instructions. The human genome consists of about 3000 million base pairs of DNA. The Human Genome Project was completed in 2003. Comparative genomics will provide new insights to our understanding of evolution.

QUICK-CHECK
24 List one of the benets of the Human Genome Project. 25 Identify the rst eukaryotic organism to have its genome sequenced. 26 Is the following statement true or false? Most of the genomes of two unrelated persons would be different. 27 What is meant by the term comparative genomics?

Genetic material: stable or changing?

Members of one European family, the House of Hapsburg, have been immortalised in art over several generations. Their portraits show that many members of the family had an excessively developed lower jaw that projected in front of the face (see gure 10.45). This condition, known as prognathism (also called Hapsburg lip), can be followed from Ernest the Lion (13771424) through ten generations to Maria Theresa (17171780). The transmission of this dominant trait across this family over several centuries to the present indicates that the genetic material is usually stable and is passed unchanged from generation to generation. Genetic material, however, can change. When this happens, a form of a gene that was never present in a family may appear in the phenotype. This appearance is sudden and, for example, is seen when a baby showing a dominant trait (such as a form of dwarsm, known as achondroplasia) is born to two parents of normal stature. This change, known as a mutation, presumably occurred in one of the parental gametes. Mutations change the instructions that are encoded in genes. When a causative agent cannot be identied, a mutation is said to be a spontaneous mutation. When a causative agent can be identied, the mutation is said to be an induced mutation. Agents known to cause mutations include radiation, such as X-rays, ultraviolet radiation, nuclear radiation, and certain chemical substances. These agents are called mutagenic agents. Protection against mutagenic agents is necessary to protect the DNA in both body cells and germline cells. Have you had an X-ray during a dental visit? The use of a lead apron during this procedure is to protect body tissues from exposure to radiation. Doses received by people working with radiation are monitored by wearing badges that contain radiation-sensitive devices (see gure 10.46).

Figure 10.45 Charles V: a person

with Hapsburg lip. The transmission of the autosomal dominant Hapsburg lip through many generations is revealed in portraits that allow the trait to be identied.

Figure 10.46 Dr Jenny Cox coordinates courses in Medical Radiations. Here she
operates an X-ray machine. Notice on Jennys coat the personal radiation monitor that measures her exposure to unseen radiation.

370

NATURE OF BIOLOGY BOOK 2

ODD FACT
Spontaneous mutations or sports appear from time to time in domesticated plants and animals. These heritable mutations include the rst appearance of short-legged (Ancon) sheep in 1791 on Seth Wrights farm in New England, United States.

Kinds of mutations
Here is part of the base sequence in part of the template strand of a DNA molecule:
10 20

AAT GTC GGA GTC

Some mutations involve a single change in the base sequence of a gene as shown below. Once changes of this nature occur, they are stable, and if the mutations involve germline cells, they will be transmitted to future generations. These single base mutations include: Substitution: replacement of one nucleotide by another in the DNA. After exposure to a mutagenic agent, the original sequence is changed to:
10 20 AAT CTC GGA GTC

ODD FACT
In the 1920s, ies were taken up in a balloon to a height of more than 18 kilometres and it was found that the rate of gene mutation in these ies occurred more than ve times more rapidly at this height than at sea level. Can you suggest a possible explanation?

This mutation involves replacement (substitution) of G by C at position number 13. Addition: insertion of one or more nucleotides into the DNA strand. After exposure to a mutagenic agent, the original sequence is changed to:
10 20 AAT GTC GGT AGT C

This mutation involves addition of a T between original nucleotides (numbers 17 and 18). Deletion: removal of one or more nucleotides from the DNA strand. After exposure to a mutagenic agent, the original sequence is altered to:
10 20 AAT GCG GAG TC

This mutation has deleted T from between original nucleotides (numbers 13 and 15).

Effect of single base mutations

Figure 10.47
A single base substitution affects just one triple in the genetic code. The effect may be zero as, for example, a change from GAA to GAG because the altered triplet still codes for the same amino acid, leu. Base substitutions of this type are termed silent mutations. In contrast, another single base substitution can be a major change, as for example from ACA to ACT, which alters the coded information from add the amino acid, cys to stop adding amino acids. Single base additions (or deletions) have a major effect on the genes involved because they alter not only the triplet at the point of addition (or deletion) but also every triplet following that point. They are known as frameshift mutations.

Chemical mutagens include: mustard gas peanut oil ethyl methane sulfonate (EMS).

Trinucleotide repeat mutations

Other gene mutations involve the addition or deletion of a large number of bases. Included within several normal human genes are multiple copies of a three-base (trinucleotide) sequence. One kind of mutation, known as a trinucleotide repeat expansion (TRE), involves additional repeats of these sequences and is the cause of several inherited conditions (see table 10.8). Compared with the normal allele which has a small number of trinucleotide repeats, the mutant allele has a much longer base sequence because the number of repeats is greatly increased.
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

371

ODD FACT
Fragile-X syndrome is the most common inherited form of mental retardation in males and occurs at a frequency of about 1/1250 male births. Affected males often have long faces, large ears and, after puberty, may have enlarged testes (macro-orchidism). In many cases, this mutation is visibly expressed on the X chromosome.

Table 10.8 Examples of trinucleotide repeat expansion mutations

Gene FMR1 HD Mutant condition fragile-X syndrome Huntington disease Trinucleotide repeats CCG: 200 to 1000+ repeats CAG: 36 to 120 repeats

In 1991, it was recognised that males affected by fragile-X syndrome (see gure 10.48) have from 200 to 2000 repeats of the CCG trinucleotide within their mutant FMR1 allele, in contrast to the normal 6 to about 50 repeats seen in unaffected persons. Similarly, males and females affected by Huntington disease have from 36 to over 100 repeats of the CAG trinucleotide in their mutant HD allele, while unaffected persons normally have from 6 to about 35 copies of this trinucleotide. Trinucleotide repeat expansion mutations tend to be unstable so that the number of repeats can change from one generation to the next. For example, the number of trinucleotide repeats has been observed to increase when the mutant HD allele is transmitted from an affected male parent to his children.
(b) (c)

(a)

Figure 10.48 (a) A male with fragile-X syndrome (b) Fragile X (left) and Y chromosomes from an affected male (c) A fragile X
(left) and normal X chromosome from a carrier female

Does it matter to the next generation?

Mutations occur in all organisms. A mutation that occurs in a body cell of an organism is a somatic mutation. Only that cell and daughter cells that it produces by mitosis will have the mutation. Somatic mutations are not passed on to the next generation. A mutation that occurs in a cell that produces gametes by meiosis is a germline mutation. Germline mutations are heritable. A well-known germline mutation is that of the royal haemophilia (see the box on page 374). From early in this century, hundreds of mutations appeared in the fruit-ies (Drosophila melanogaster) kept in T. H. Morgans laboratory at Columbia University, United States. These mutations provided new inherited variations affecting eye colour, wing vein pattern, wing shape and the number of bristles on the thorax (see gure 10.49). Crosses based on these mutant variations helped extend Mendels original model of inheritance by generating new patterns of inheritance that led to new inferences about linkage and X-linkage.

(a)

(b)

(c)

(d)

Figure 10.49 Mutations produced

many variations in fruit-ies (a) normal (b) cut wing (c) curled wing (d) no wing.

DNA is capable of repair

When DNA is altered by a mutagenic agent, the alteration may sometimes be reversed through the operation of various DNA repair mechanisms that are like cellular repair kits and involve one or more enzymes.

372

NATURE OF BIOLOGY BOOK 2

Why slip, slop and slap?

Although DNA repair mechanisms exist, the ability of DNA to repair the damage caused by mutagenic agents is limited. Protection from DNA damage owing to UV radiation can be achieved by applying sun-blocking agents or sunscreens and wearing hats and shirts. This protection can reduce the risk of DNA damage and the consequent risk of skin cancer. The Cancer Societies in each Australian state run public education programs to warn people about the risk of excessive exposure to sunlight during the Australian summer (see gure 10.50). The DNAdamaging radiation in sunlight is UV-B and our exposure to this has increased since the early 1980s as a result of the thinning of the upper atmospheric ozone layer, the so-called ozone hole.

KEY IDEAS
The genetic material DNA is usually stable. DNA can undergo change (mutation). Mutations of DNA can vary and include deletions, substitutions and additions of nucleotides, as well as the type known as trinucleotide repeat expansions. Agents that can cause mutations are known as mutagenic agents. Mutations can be somatic or germline, and only germline mutations can be transmitted to the next generation. DNA mutations often, but not always, have deleterious results.

Figure 10.50 Exposure to

the ultraviolet radiation of sunlight can cause damage to DNA and gene mutation, particularly in the dividing cells of the skins germinal layer. DNA damage is associated with an increased risk of skin cancers, including the most serious form of skin cancer known as melanoma.

QUICK-CHECK
28 How do a substitution mutation and a deletion mutation differ? 29 The DNA in the gametes of an industrial worker is altered because of exposure to a chemical. a Is this a spontaneous or an induced mutation? b Is this a somatic or a germline mutation? c Can this mutation be transmitted to the workers children?

ODD FACT
Mutations that change bases at exonintron junctions have serious effects on the gene product. Why?

A closer look at a gene

The part of a gene that contains the coded information for making a protein is called the coding region of a gene. The regions on either side of the coding region of a gene are called anking regions. The anking region before the start of the coding region is called the upstream region. The anking region after the end of the coding region is called the downstream region. The box on page 375 provides further information about these regions.

Introns: just an interruption or two

To avoid confusing the two terms, exon and intron, think about INterruption and INtron and that will help you remember the functional difference. Introns are transcribed but not translated.

An unexpected discovery about the genes in eukaryotes was made in 1977. Until then, the coding region of a gene was thought to be continuous (see gure 10.52a). Instead, the coding region is interrupted by other segments of DNA. Each segment of the coding region of a gene is called an exon. The exons are separated by lengths of DNA that do not contain instructions relating to the protein chain. These non-coding segments are called introns (see gure 10.52b).
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

373

A ROYAL MUTATION
Queen Victoria of England (18191901) had nine children, many of whom married into the European royal families that existed during the 1800s. Victoria carried a gene mutation. The mutation may have occurred in the germline cell in one of Victorias parents. Another possibility is that the mutation occurred in the queens gonadal tissues. This gene mutation affected the DNA of the F8C gene which is located on the X chromosome and controls production of a blood-clotting substance. Victorias daughters, Alice and Beatrice, inherited from their mother an X chromosome with the mutated allele (h). Since these daughters inherited a normal allele (H) from their father, Albert, they were heterozygous carriers (Hh) of haemophilia. One of Victorias sons, Leopold, inherited the mutation from his mother. Males are hemizygous for X-linked traits, so Leopold was genotype h (Y) and showed the recessive condition, haemophilia. In haemophilia, the blood fails to clot normally and internal bleeding can occur. Another of Victorias sons, Albert (later King Edward VII of England), did not inherit this mutation and so haemophilia disappeared from the English royal family. The haemophilia mutation was introduced into the royal families of Russia and Spain by Alice and Beatrice who transmitted it to some of their children. One of Victorias carrier granddaughters was Alexandra, who married Nikolas II, the Tsar of Russia. Their only son, Alexis, suffered from haemophilia. Nikolas and Alexandra became preoccupied with their sons condition and sought cures, particularly through the monk, Rasputin. Some people have speculated that this led to neglect of state matters by the Tsar and may have contributed to the Russian Revolution of 1917.

Figure 10.51
Victoria and her descendants. A germline mutation in Victoria, or one of her parents, caused haemophilia to appear in her family. This family group includes several of Victorias daughters who were heterozygous carriers of this trait and passed it on to their sons. Will haemophilia appear in the sons or daughters of carrier females?

Albert Queen Victoria Leopold Duke of Albany Alexandra

Irene Frederick William Tsar Nikolas II of Russia Alice of Athlone Victoria Alfonso Leopold Maurice Eugenie XIII of Spain

Edward VII

Alice of Hesse

Beatrice

Kaiser Wilhelm II of Germany

George V

Edward George VIII VI

Waldemar

Henry

Alexis

Rupert

Alfonso

Gonzalo

Elizabeth II

Philip

Key Normal male

Charles Andrew Anne Edward

Juan Carlos

Haemophiliac male Normal female, known heterozygous carrier

Normal female, unknown genetic status

374

NATURE OF BIOLOGY BOOK 2

Figure 10.52 (a) Pre-1980 view

of gene with a continuous coding region (b) Actual situation with coding region (orange) broken into segments (exons) by non-coding segments (green)

(a) pre-1980 Start Stop

(b) mid-1980 Start Intron 1 Intron 2 Exon 3 Stop

Gene Single coding region

Exon 1

Exon 2 Interrupted gene

So, genes are not like nursery rhymes in a book, where the reader starts at the beginning and reads through to the end. The information in genes is broken up into segments and the sections in between are lled with other printed material that is unrelated to the rhyme.

CODING AND FLANKING REGIONS

If it were possible to travel in a miniaturised vehicle along a gene, what would we see? The coding region The coding region is the segment of DNA double helix that contains the information that is translated into a chain of amino acids. The template strand commences with a start signal (TAC) and ends with a stop signal, such as ACT. If we looked over to the complementary strand, there would be no surprises for every A in the template strand there would be a T, for every G a C and so on. Upstream from the coding region The region of DNA upstream from the coding region contains some particular base sequences. One part of the upstream region is rich in As and Ts and is often called the TATA box, because the sequence TATA (or similar) occurs in one of the anti-sense strands. Another sequence commonly found further upstream is called the CAT or CAAT box. Role of upstream sequences Consider the following observations: Upstream sequences are invariably found in all organisms. It is reasonable to suggest that these upstream sequences serve an important function since they have been maintained during evolution. If these sequences had no function, they would have been lost or changed during the evolutionary history of species. If upstream sequences are altered by mutation, the activity of the coding region of the gene may be reduced or even become inactive. The absence of the correct upstream signal is a cause of some inherited human diseases. One form of thalassaemia is due to a missing TATA group in the upstream region of the DNA of both copies of the specic gene in the people concerned. The upstream region includes segments of DNA to which hormones can attach. The fact that some hormones can bind to DNA provides one clue as to how hormones can inuence the action of genes. These observations support the conclusion that sequences in the upstream region appear to control the start of the decoding process and the rate at which protein products are produced by gene action. For this reason, these upstream sequences are sometimes called promoters. Downstream from the coding region The DNA following the end of the coding region is referred to as the downstream region (see gure 10.53). About 20 bases downstream, the sequence AATAAA is usually found. If this sequence is altered, the gene action is altered. The downstream region includes an end transcription signal that terminates the process of transcription of mRNA. Critical sites where mutations can affect normal functioning of a gene include: the upstream promoter region the START and STOP signals. Why?

Upstream region START

Coding region STOP

Downstream region

CAT ... ATATA ...

TAC ...... CTCCGGGAT ...... ACT

.... AATAAA ....

Figure 10.53 Regions of the template strand of a typical gene. What is the DNA sequence in the other DNA strand?

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

375

Here is an interrupted rhyme: Hey, diddle diddle the cat and the d HERE IS AN INTERRUPTION dle, the cow jumped over the AND HERE IS ANOTHER INTERRUPTION moon. The little dog laughed to see such fun and the dish HERES ANOTHER ran away with the spoon. If this interrupted rhyme were thought of as a gene, how many exons and how many introns would it contain? The underlined portions are like exons, and there are four of them. The interruptions are like introns, and there are three of them. They are removed from the mRNA before translation. The number of exons and introns in genes varies. The DNA making up the HBB gene that controls the production of one chain of the haemoglobin molecules consists of three exons and two introns. The F8C gene that controls the production of Factor VIII that assists in blood clotting consists of 26 exons and 25 introns.

Back to Mendels factors

In this chapter, we have moved from the mid-1800s when a monk (Mendel) planted edible peas in a monastery garden and puzzled about the results obtained with crosses of plants from certain seeds. Mendel produced a model that explained these outcomes and predicted the results of future crosses. His explanatory model involved factors that were inferred particles, unseen and of unknown nature. Since that time, the work of many scientists has revealed much about Mendels factors. Now known as genes, these factors are located on chromosomes and consist of DNA that exists as a double-helical molecule with one chain carrying genetic instructions in a code that uses triplets of nucleotide bases. Far from being just inferred entities, Mendels factors can be measured and the nucleotide sequence that encodes the information in every gene can be identied.

KEY IDEAS
Each gene in eukaryote organisms contains a coding region, and also includes anking regions upstream and downstream of the coding region. The coding region of a gene typically consists of several exons separated or interrupted by introns.

QUICK-CHECK
30 Using words or diagrams, distinguish between the members of each of the following pairs: a intron and exon b coding region and anking region. 31 True or false? All genes contain the same number of exons.

376

NATURE OF BIOLOGY BOOK 2

FINDING THE DOUBLE HELIX

In the 1950s, as well as James Watson and Francis Crick from Cambridge University, other scientists were trying to discover the structure of DNA. These included Rosalind (Rosy) Franklin and Maurice Wilkins, also at Cambridge, who identied the X-ray diffusion patterns of crystalline DNA, and Linus Pauling in the United States. Possibly three chains? Watson wrote:
Supercially, the X-ray data were compatible with two, three, or four strands.

Watson commented:
. . . my stomach sank in apprehension . . . Seeing that neither Francis nor I could bear any further suspense, he (Peter) quickly told us that the model was a threechain helix with the sugarphosphate backbone in the centre. This sounded so suspiciously like our aborted effort of last year . . .

At rst, Watson and Crick tried a three-chain model, with the sugarphosphate backbones at the inside of the model. Watson wrote:
. . . we decided upon models in which the sugar phosphate backbone was in the centre of the molecule. Only in that way would it be possible to obtain a structure regular enough to give the crystalline diffraction patterns observed by Rosy and Maurice. Our rst few minutes with the models, though, were not joyous . . . After tea, however, a shape began to emerge which brought back our spirits. Three chains twisted about each other . . . Admittedly, a few of the atomic contacts were still too close for comfort, but, after all, the ddling had just begun.

In fact, Paulings model was incorrect. The critical breakthrough came when Rosalind Franklin prepared X-ray diffraction patterns of a different form of DNA (the B-form) (see gure 10.54). Watson wrote:
The instant I saw the picture my mouth fell open and my pulse began to race. The pattern was unbelievably simpler than those obtained previously. Moreover, the black cross of reections which dominated the picture could arise only from a helical structure . . .

He later recalled:
Then as the train jerked towards Cambridge, I tried to decide between the two- and three-chain models . . . Thus by the time I had cycled back to college and climbed over the back gate, I had decided to build two-chain models. Francis would have to agree. Even though he was a physicist, he knew that important biological objects come in pairs.

Eventually, Watson and Crick realised that this threechain model had major faults. Watson wrote:
A fresh start would be necessary to get the problem rolling again.

Fitting two chains together Over the next months, Watson and Crick tried to build a two-chain model, but they were still working with the incorrect idea that the sugarphosphate backbones were in the centre of the molecule and the bases on the outside. Watson said:
. . . for a day and a half I tried to nd a suitable two-chain model with the backbone in the centre . . . Though I kept insisting that we should keep the backbone in the centre, I knew none of my reasons held water. But the real stumbling block was the bases. As long as they were outside, we did not have to consider them. If they were pushed inside, the frightful problem existed of how to pack together two or more chains with irregular sequences of bases.

Chargaffs rule provides a clue A new avenue of exploration was raised by the ratio of the four bases in DNA:
The moment was thus appropriate to think seriously about some curious regularities in DNA chemistry . . . the number of adenine (A) molecules was very similar to the number of thymine (T) molecules, while the number of guanine (G) molecules was very close to the number of cytosine (C) molecules. Back in my rooms I lit the coal re . . . With my ngers too cold to write legibly I huddled next to the replace, daydreaming about how several DNA chains could fold together in a pretty and hopefully scientic way.

Slowly, the correct model started to evolve:

The next morning, however, as I took apart a particularly rep ulsive backbone-centred molecule, I decided that no harm could come from spending a few days building backbone-out models. This meant temporarily ignoring the bases . . . There was no difculty in twisting an externally situated backbone into a shape compatible with the X-ray evidence.

At that time, Linus Pauling, an American scientist, developed his model for the structure of DNA. He sent the details of his model through his son Peter to Watson and Crick, who at rst were disappointed to think that they had been beaten to the answer.

(continued )

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

377

The sugarphosphate backbones were arranged on the outside of the model; they posed no further problem, but the nagging problem of what to do with the bases still remained:
I went ahead spending most evenings at the lms, vaguely dreaming that at any moment the answer would suddenly hit me . . . Even during good lms I found it almost impossible to forget the bases. Thus, unless some very special trick existed, randomly twisting two polynucleotide chains around one another should result in a mess.

This model also gave a clue as to how DNA could be replicated:

Chargaffs rules then suddenly stood out as a consequence of a double-helical structure for DNA. . . . Given the base sequence of one chain, that of its partner was automatically determined. Conceptually, it was thus very easy to visualise how a single chain could be a template for the synthesis of a chain with the complementary sequence.

Another clue was recognised:

Thus, conceivably the crux of the matter was a rule governing hydrogen bonding between bases.

Watson rst considered the pairing of identical bases, that is, A with A, T with T, and so on:
I thus started wondering whether each DNA molecule consisted of two chains with identical base sequences held together by hydrogen bonds between pairs of identical bases. For over two hours I happily lay awake with pairs of adenine residues whirling in front of my eyes. Only for brief moments did fear shoot through me that an idea this good could be wrong.

Watson and Crick announced their double-helix model in the short article that briey outlines a discovery that ranks as one of the major discoveries of the twentieth century: Watson, J. D. and Crick, F. H. C. (1953) Molecular structure of nucleic acids a structure for deoxyribose nucleic acid, Nature, vol. 171, pp. 737738.
You can read what Francis Crick thought at the following website: www.accessexcellence.org/AE/AEC/CC/crick.html.

However, the answer was very close. Watson wrote:

. . . so I spent the rest of the afternoon cutting accurate representations of the bases out of stiff cardboard . . . the following morning, I quickly cleared away the papers from my desk top so that I would have a large, at surface on which to form pairs of bases held together by hydrogen bonds . . . Suddenly I became aware that an adeninethymine pair held together by two hydrogen bonds was identical in shape to a guaninecytosine held together by at least two hydrogen bonds. All the hydrogen bonds seemed to form naturally; no fudging was required . . .

The DNA double helix structure was at last identied. The pairing between the bases in DNA involves hydrogen bonding between complementary bases, not identical bases. This model with AT and CG pairs between the chains made sense in terms of Chargaffs rule that the number of As was about equal to those of T, and that the number of Gs was about the same as those of C.

Figure 10.54 Evidence for the double helix came from

this X-ray pattern of the B-form of DNA prepared by Rosalind Franklin. The regular pattern indicated that DNA formed a helix.

378

NATURE OF BIOLOGY BOOK 2

BIOCHALLENGE
The human genome of about 3000 million base pairs includes 20 000 to 25 000 protein-coding genes and large regions of non-coding DNA. In this biochallenge, you will access two databases relating to the human genome. Do not worry about the complexity of some of the information in the database. The purpose is simply to familiarise you with some aspects of using major genetic databases. Exploring human genes Information about known human genes and inherited disorders comprises a large body of data held in the public database called Online Mendelian Inheritance in Man (OMIM). Go to www.jaconline.com.au/natureofbiology/natbiol2-3e and click on the OMIM weblink for this chapter. (Scroll to the bottom of the rst page and read the note.) Exploring the nucleotide sequence The Genome Browser Gateway web site contains the nucleotide sequence of the genomes of many organisms. It allows scientists to explore many aspects of different genomes. Your biochallenge is simply to access the site, recognise the complexity and amount of data held there and see the base sequence of a tiny portion of one of the human chromosomes. Go to www.jaconline.com.au/natureofbiology/natbiol2-3e and click on the Genome Browser weblink for this chapter.

Locate OMIM Facts on the left menu, and select Statistics. a How many genes and DNA markers are included in the database on the date that you access it? b How many genes have been mapped to specic loci on the various chromosomes? c Has every gene in the database been mapped to a specic chromosomal locus? Return to the left menu and locate OMIM, then select Search Gene Map. Conduct a search on the BRCA1 gene symbol. A table similar to the one below will appear. Location 17q21 Symbol BRCA1 Title MIM # 113705 Disorder Breast cancer

1 2 3 4 5

Locate the Genome eld, which defaults to Human. What other vertebrate genomes are in the database? Ensure that you have Human selected in the genome box. The Assembly eld shows the date of the version of the human genome you are using. The Position or search term eld defaults to chr7:127,471,196127,495,720. This means: chromosome-7, starting from base number 127 471 196 and ending at base 127 495 720. Click on the Submit button to reveal a set of complex information about this region of the chromosome. At the top of this display, locate the zoom button labelled base. Press this button to see the start of the base sequence of this region of chromosome-7 just a series of As, Ts, Cs and Gs. a What are the rst ten bases shown in this sequence? b If you went to any other sequence in any other human chromosome, would you expect to see anything other than a series of As, Ts, Cs and Gs? c What would you expect to see if you viewed the genome of another organism, such as a mouse or a carrot?

a The Title gives the name of the gene. What is the title of the BRCA1 gene? b The Location identies the gene locus. Where is this gene located? On the web site, click on the Location entry, and this will take you to a chromosome map. Notice the large number of genes and DNA markers on this chromosomal region. c Identify another inherited disorder very close (or linked) to the BRCA1 gene locus. Return to the table, and click on the MIM# entry to read a description of the gene. d Scroll down to the section on Clinical features. List three clinical features of this condition. e Scroll down further to the section on Inheritance. What is the mode of inheritance? You can search the OMIM database by gene name (such as FRM1, F8C or CTRF) or by chromosome regions (such as Xp21.1 or 4p16.3) or by a disorder (such as achondroplasia or alkaptonuria). You might like to try another search.

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

379

CHAPTER REVIEW
Key words
CROSSWORD

adenine base base pairs base sequence Chargaffs rule chromosomes coding region comparative genomics complementary base pairs cytosine D-loop decoded deoxyribonucleic acid (DNA) deoxyribose dihybrid dissociation DNA sequencers dominant double helix encoded exon anking regions frameshift gene gene duplication

gene sequence gene sequencing genetic code genome genomics germline mutation guanine horizontal gene transfer Human Genome Project (HGP) hybridisation hydrogen bonds induced mutation introns Mendels factors monohybrid mutagenic agents mutation nucleic acids nucleotide sequence nucleotides promoters proteomics purines pyrimidines re-association recessive

retroviruses single nucleotide polymorphisms somatic mutation spontaneous mutation TATA box template strand thymine transforming factor trinucleotide repeat expansion (TRE) triplet code

Questions
1 Making connections between concepts Use at least eight of the key words above to prepare a concept map on DNA structure. You may add other concepts that you wish. 2 Developing explanations Suggest explanations for the following: a The statement that Genes are made of DNA is absent from textbooks published before the mid-1940s. b In a DNA double helix, the number of adenine molecules can be used to predict the number of thymine molecules. c In a single strand of DNA, the number of adenine molecules cannot be used to predict the number of thymine molecules. d In a DNA double helix, the ratio (A + C)/(T + G) is equal to 1. e The information encoded in a piece of DNA consisting of only As ( AAAAAAAAAAAAAAAAAA etc.) is decoded as a protein containing only one kind of amino acid. f The information in a DNA template strand consisting of more than 100 nucleotides was greatly changed by the removal of just one base.
380
NATURE OF BIOLOGY BOOK 2

Egyptian number

Our equivalent 16 37 256 1322 100 100

Figure 10.55 Egyptian numbering

3 Applying knowledge Each answer is a number: a When four nucleotides join to form a chain, how many sugarphosphate bonds are formed? b A sequence of 12 nucleotides within the coding region of a gene encodes the information to join how many amino acids into a protein? c A protein consists of a chain of 22 amino acids. What is the minimum number of nucleotides needed to encode the instructions to join these amino acids to form this protein? d How many nucleotides in the START signal of a gene? e The total length of DNA from a human sperm cell. f The number of different kinds of amino acids that can be found in proteins. g This number corresponds to the distance in nanometres between adjacent pairs of bases in a DNA double helix. h The number of DNA molecules in a chromosome. 4 Analysing data Ancient Egyptians used a system of numbers that was based on a code. Examine the data in figure 10.55. a How many elements of this code are shown? b Try to crack the code by assigning a numeric meaning to each element. c Why do biologists talk about a genetic code? 5 Demonstrating your understanding Some biologists have likened parts of the genetic code to letters, words and sentences. To which of these would the following correspond: a TTA? b G? c GCG? d TAGCGTGTAGGCCTGTTGCAAA? e In the English language, words are of different lengths, such as ox and rhinoceros. Is this also true of the words in the genetic code? 6 Demonstrating your understanding Samples of DNA were analysed and the following proportions were found:
DNA Sample 1 Sample 2 Sample 3 A 1.2 0.8 1.0 C 1.2 0.8 0.7 G 1.2 0.4 0.7 T 1.2 0.4 1.0

Identify which of the above sample(s) could be double-stranded DNA Explain. 7 Evaluating information Refer to pages 3778 relating to the discovery of the double helix structure for DNA. Using Watson and Crick as examples of scientists, identify the following statements as true (T) or false (F) and briefly explain your choice: a Scientists might spend more time planning experiments rather than doing them. b Scientists start investigations without reference to the work of other scientists. c Discoveries occur only in laboratories as a result of experiments. d Unplanned inspiration can play a role in scientific discoveries.
NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

381

8 Demonstrating knowledge and understanding a What is Chargaffs rule? b After demonstrating that the proportions of A and T and of C and G were about equal in the DNA from many organisms, Chargaff and his co-workers wrote:
A comparison of the molar proportions reveals certain striking, but perhaps meaningless, regularities. 1949

10

15

TAC TCA GCG CTA GCA

Does this fact suggest that scientists will be aware of the importance of facts or regularities that they discover? Explain. c The paper describing Watson and Cricks 3-D model of DNA appeared in the journal Nature, vol. 171, page 737 (1953). Visit a library or search the Internet and locate this article. Does this article suggest that major discoveries can be explained only in long articles that are difcult to understand? 9 Applying principles Consider part of the template strand of the coding sequence of a gene from a owering gum that includes the base sequence at left: a Write the sequence in the corresponding portion of the complementary strand. b Refer to the genetic code (page 656) and copy and complete the following table.
Code (in DNA) Decoded information

TAC TCA GCG CTA GCA

Start with amino acid, met Now add the amino acid, ser

1500

1000

500

0 0 2000 4000 6000 Radiation (Roentgen units)

Figure 10.56
382
NATURE OF BIOLOGY BOOK 2

c If this sequence were from the DNA template strand from a monkey, would it translate in a different way from that of the owering gum? d Describe the result of each of the following DNA mutations separately: i deletion of nucleotide number 10 ii substitution of nucleotide number 13 (G) by A. 10 Demonstrating your understanding DNA is often described as the blueprint of life. a Explain why this is a reasonable analogy. b Which of the following is DNA more like: i a recipe for a cake? ii the ingredients that go into a cake? Explain. 11 Interpreting data presented graphically Examine the graph in gure 10.56: a What variable is plotted along the horizontal axis? Identify the units of measurement. b What variable is plotted along the vertical axis? Identify the units of measurement. c Describe the general trend shown in the graph. d What approximate dosage of radiation produced a mutation rate of about 0.1?

Sex-linked mutations (rate per 104 gametes)

12 Interpreting data and making predictions a Explain why people working in a situation involving exposure to radiation wear protective clothing or radiation monitoring devices. b Which organs of the human body are at risk of a germline mutation? c A segment of the eye tissue of a developing fruit-y undergoes a spontaneous mutation so that, after metamorphosis, the adult is a red-eyed y with a white sector in the right eye. Would you predict that offspring of this y in the next generation would show this mutant phenotype? Explain. 13 Demonstrating knowledge a Dene a mutagenic agent. b Give an example of a chemical mutagen. c Identify two types of radiation that are known to be mutagenic. 14 Analysing data Refer back to figure 10.43 on page 368. Examine this figure and answer the following questions. a Which cat chromosome is depicted here? b Which human chromosome is shown? c The human chromosome is labelled as Hsa6 from Homo sapiens. i What is meant by Hsa21? ii Suggest what might be meant by FcaB2. d Approximately how many gene loci are shown on the cat chromosome? e The dotted lines link matching (homologous) gene loci that occur in both species. How many homologous genes exist in the two species on these chromosomes? f In general, where genes are conserved between two species, is their order on the chromosomes also more or less conserved? 15 Using the web In 2005, the National Human Genome Research Institute published a press release regarding the detailed analysis of human chromosomes 2 and 4. Go to www.jaconline.com.au/natureofbiology/natbiol2-3e, click on the Gene Deserts weblink for this chapter and answer the following questions: a How many genes have been identied on chromosome 2 and on chromosome 4? b List two gene loci of interest on chromosome 4. c Chromosome 2 carries the locus of the gene that encodes genetic instructions for the muscle protein titin. What is distinctive about this gene (and this protein)? d What is a gene desert? e Regions of gene desert have been conserved in the evolution of birds and in the evolution of mammals. What does this nding suggest? f Humans have 23 pairs of chromosomes while chimps (and other great apes) have 24 pairs. i What long-standing hypothesis existed to explain how this reduction in chromosome number arose? ii Does the detailed analysis of human chromosome 2 provide support for this hypothesis? Explain.

NATURE, STRUCTURE AND ORGANISATION OF THE GENETIC MATERIAL

383