0% found this document useful (0 votes)
267 views21 pages

Transcription and Translation Power Point

Uploaded by

api-176402481
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
267 views21 pages

Transcription and Translation Power Point

Uploaded by

api-176402481
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPT, PDF, TXT or read online on Scribd

Transcription and Translation

Protein Structure

Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome

Replication
DNA
DNA double helix unwinds DNA now single-stranded New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated

RNA vs. DNA

DNA Double stranded Deoxyribose sugar Bases: C,G A,T

RNA Single stranded Ribose sugar Bases: C,G,A,U

Both contain a sugar, phosphate, and base.

Transcription and Translation: An Overview (aka the Central Dogma)

DNA
Transcription

RNA
Translation

Protein

Transcription

RNA polymerase unwinds the DNA strand and begins to create a complementary RNA strand. RNA forms base pairs with DNA C-G A-U Primary transcriptlength of RNA that results from the process of transcription

TRANSCRIPTION
ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACU

Major players in transcription

mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

Major players in transcription

RNA polymerasecomplex of enzymes with 2 functions:

Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides

Transcription is donewhat now?


Now we have mRNA transcribed from the cells DNA. It leaves the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin.

We know how mRNA is made, but how do we read the code?

Reading the DNA code

Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

Translation

Second stage of protein production mRNA is on a ribosome

Ribosomes

2 subunits, separate in cytoplasm until they join to begin translation


Large Small E P A

Contain 3 binding sites


Translation

Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome

tRNA

Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon

tRNA Function

Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code. The anticodon in tRNA binds to the codon in mRNA and adds a specific amino acid to the chain.

Visualizing translation

Translation animation

Which codons code for which amino acids?

Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of DNA that brings about transcription of a segment of RNA

The Genetic Code

ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACUG

Transcription vs. Translation Review


Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

You might also like