Transcription and Translation
Protein Structure
Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome
Replication
DNA
DNA double helix unwinds DNA now single-stranded New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated
RNA vs. DNA
DNA Double stranded Deoxyribose sugar Bases: C,G A,T
RNA Single stranded Ribose sugar Bases: C,G,A,U
Both contain a sugar, phosphate, and base.
Transcription and Translation: An Overview (aka the Central Dogma)
DNA
Transcription
RNA
Translation
Protein
Transcription
RNA polymerase unwinds the DNA strand and begins to create a complementary RNA strand. RNA forms base pairs with DNA C-G A-U Primary transcriptlength of RNA that results from the process of transcription
TRANSCRIPTION
ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACU
Major players in transcription
mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus
Major players in transcription
RNA polymerasecomplex of enzymes with 2 functions:
Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides
Transcription is donewhat now?
Now we have mRNA transcribed from the cells DNA. It leaves the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin.
We know how mRNA is made, but how do we read the code?
Reading the DNA code
Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases
Translation
Second stage of protein production mRNA is on a ribosome
Ribosomes
2 subunits, separate in cytoplasm until they join to begin translation
Large Small E P A
Contain 3 binding sites
Translation
Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome
tRNA
Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon
tRNA Function
Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code. The anticodon in tRNA binds to the codon in mRNA and adds a specific amino acid to the chain.
Visualizing translation
Translation animation
Which codons code for which amino acids?
Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of DNA that brings about transcription of a segment of RNA
The Genetic Code
ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACUG
Transcription vs. Translation Review
Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein
