Calcium Imaging

We have developed an automatic method for the analysis and identification of dynamical regimes in intracellular calcium patterns from confocal calcium images. The method allows the identification of different dynamical patterns such as spatially concordant and discordant alternans, irregular behavior or phase-locking regimes such as period doubling or halving. The method can be applied to the analysis of different cardiac pathologies related to anomalies at the cellular level such as ventricular reentrant arrhythmias.

Calcium ions are known to act as important cellular signals during nervous system development. In vitro studies have provided significant information on the role of calcium signals during neuronal development; however, the function of this messenger in nervous system maturation in vivo remains to be established. The zebrafish has emerged as a valuable model for the study of vertebrate embryogenesis. Fertilisation is external and the rapid growth of the transparent embryo, including development of internal organs, can be observed easily making it well suited for imaging studies. The developing nervous system is relatively simple and has been well characterised, allowing individual neurons to be identified. Using the zebrafish model, both intracellular and intercellular calcium signals throughout embryonic development have been characterised. This review summarises technical approaches to measure calcium signals in developing embryonic and larval zebrafish, and includes recent developments that will facilitate the study of calcium signalling in vivo. The application of calcium imaging techniques to investigate the action of this messenger during embryogenesis in intact zebrafish is illustrated by discussion of their contribution to our understanding of neuronal development in vivo.

As recent advances in calcium sensing technologies facilitate simultaneously imaging action potentials in neuronal populations, complementary analytical tools must also be developed to maximize the utility of this experimental paradigm. Although the observations here are fluorescence movies, the signals of interest—spike trains and/or time varying intracellular calcium concentrations—are hidden. Inferring these hidden signals is often problematic due to noise, nonlinearities, slow imaging rate, and unknown biophysical parameters. We overcome these difficulties by developing sequential Monte Carlo methods (particle filters) based on biophysical models of spiking, calcium dynamics, and fluorescence. We show that even in simple cases, the particle filters outperform the optimal linear (i.e., Wiener) filter, both by obtaining better estimates and by providing error bars. We then relax a number of our model assumptions to incorporate nonlinear saturation of the fluorescence signal, as well external stimulus and spike history dependence (e.g., refractoriness) of the spike trains. Using both simulations and in vitro fluorescence observations, we demonstrate temporal superresolution by inferring when within a frame each spike occurs. Furthermore, the model parameters may be estimated using expectation maximization with only a very limited amount of data (e.g., ∼5–10 s or 5–40 spikes), without the requirement of any simultaneous electrophysiology or imaging experiments.

Mammals rely heavily on olfaction to interact adequately with each other and with their environment 1 . They make use of seventransmembrane G-protein-coupled receptors to identify odorants and pheromones. These receptors are present on dendrites of olfactory sensory neurons located in the main olfactory or vomeronasal sensory epithelia, and pertain to the odorant 2 , trace amineassociated receptor 3 and vomeronasal type 1 (ref. 4) or 2 (refs 5-7) receptor superfamilies. Whether these four sensor classes represent the complete olfactory molecular repertoire used by mammals to make sense of the outside world is unknown. Here we report the expression of formyl peptide receptor-related genes by vomeronasal sensory neurons, in multiple mammalian species. Similar to the four known olfactory receptor gene classes, these genes encode seven-transmembrane proteins, and are characterized by monogenic transcription and a punctate expression pattern in the sensory neuroepithelium. In vitro expression of mouse formyl peptide receptor-like 1, 3, 4, 6 and 7 provides sensitivity to disease/inflammation-related ligands. Establishing an in situ approach that combines whole-mount vomeronasal preparations with dendritic calcium imaging in the intact neuroepithelium, we show neuronal responses to the same molecules, which therefore represent a new class of vomeronasal agonists. Taken together, these results suggest that formyl peptide receptor-like proteins have an olfactory function associated with the identification of pathogens, or of pathogenic states.

Since its
development, the ionophore BAPTA
(1,2-bis(2-aminophenoxy)-ethane-N,N,N’,N’-tetraacetic acid) has been used unchanged in calcium sensing applications. In this work we present a comprehensive experimental and theoretical study of novel alterations in the structure of BAPTA, with a focus on the systematic modification of the chain connecting the two aromatic rings of the molecule (denoted as “linker”). A bis-(diethylamino)xantene fluorophore was also attached to the structures in a fixed position and the structure-fluorescence response relationship of these molecules was investigated in addition. The effect of the length of the linker, the number of O atoms in this chain and even the removal of one of the rings was tested; these all proved to significantly alter the characteristics of the compounds. For example, it was found that the second aromatic ring of BAPTA is not essential for the turn-on of the fluorescence. We also demonstrated that successful sensing can be realized even by replacing the chain with a single oxygen atom, which suggests the availability of a new calcium binding mode of the chelator. The reliable turn-on characteristic, the steep Ca2+ fluorescence titration curve and the intense fluorescence emission combine to make this compound a prospective candidate as a calcium sensing molecular probe in diagnostic neurobiological applications.

C. elegans is a useful model for studying neuronal and genetic mechanisms underlying behavior. Calcium imaging, facilitated by genetically encoded calcium indicators, is a convenient tool for linking the function of a gene, neuron, circuit and tissue with a particular behavioral phenotype. Because C. elegans has a transparent body, calcium imaging can be performed non-invasively in intact animals. Over 10 homemade calcium imaging systems have been used to study C. elegans, each with a unique strategy to achieve reliable and sensitive results. Here, I summarize these strategies, and compare and contrast their underlying principles.  This discussion may help the development of calcium imaging systems as better research tools.

Nasal trigeminal chemosensitivity in mice and rats is mediated in part by epithelial solitary chemoreceptor (chemosensory) cells (SCCs), but the exact role of these cells in chemoreception is unclear (Finger et al. 2003). Histological evidence suggests that SCCs express elements of the bitter taste transduction pathway including T2R (bitter taste) receptors, the G protein8 9-gustducin, PLC<2, and TRPM5, leading to speculation that SCCs are the receptor cells that mediate trigeminal nerve responses to bitter taste receptor ligands. To test this hypothesis, we used calcium imaging to determine whether SCCs respond to classic bitter-tasting or trigeminal stimulants.

Legumes can acquire nitrogen through a symbiotic interaction with rhizobial bacteria. The initiation of this process is determined by a molecular dialogue between the two partners. Legume roots exude flavonoids that induce the expression of the bacterial nodulation genes, which encode proteins involved in the synthesis and secretion of signals called Nod factors (NFs). NFs signal back to the plant root and trigger several responses, leading to bacterial invasion and nodule formation. Here, we describe the molecular and cellular characterization of a Phaseolus vulgaris non-nodulating mutant (NN-mutant). Root hair cells of the NN-mutant plant respond with swelling and branching when inoculated with Rhizobium etli, albeit without curling induction. Furthermore, neither initiation of cell division in the outer cortex, nor entrapment of bacteria nor infection thread formation was observed. Both the bean wild-type and the NN-mutant responded with elevated intracellular calcium changes in the root hairs. Although the NN-mutant is deficient in early nodulin gene expression when inoculated with R. etli, it can be effectively colonized by arbuscular mycorrhizal fungi (Glomus intraradices). Our data indicate that the P. vulgaris NN-mutant is not blocked at the NFs early perception stage, but at later downstream stages between Ca2+ signaling and early nodulin induction. This supports the idea that both microsymbionts are perceived and trigger different downstream pathways in the host plant.

In the cerebral cortex, local circuits consist of tens of thousands of neurons, each of which makes thousands of synaptic connections. Perhaps the biggest impediment to understanding these networks is that we have no wiring diagrams of their interconnections. Even if we had a partial or complete wiring diagram, however, understanding the network would also require information about each neuron's function. Here we show that the relationship between structure and function can be studied in the cortex with a combination of in vivo physiology and network anatomy. We used two-photon calcium imaging to characterize a functional property-the preferred stimulus orientation-of a group of neurons in the mouse primary visual cortex. Large-scale electron microscopy of serial thin sections was then used to trace a portion of these neurons' local network. Consistent with a prediction from recent physiological experiments, inhibitory interneurons received convergent anatomical input from nearby excitatory neurons with a broad range of preferred orientations, although weak biases could not be rejected.

Granule cells are axonless local interneurons that mediate lateral inhibitory interactions between the principal neurons of the olfactory bulb via dendrodendritic reciprocal synapses. This unusual arrangement may give rise to functional properties different from conventional lateral inhibition. Although granule cells spike, little is known about the role of the action potential with respect to their synaptic output. To investigate the signals that underlie dendritic release in these cells, two-photon microscopy in rat brain slices was used to image calcium transients in granule cell dendrites and spines. Action potentials evoked calcium transients throughout the dendrites, with amplitudes increasing with distance from soma and attaining a plateau level within the external plexiform layer, the zone of granule cell synaptic output. Transient amplitudes were, on average, equal in size in spines and adjacent dendrites. Surprisingly, both spine and dendritic amplitudes were strongly dependent on membrane potential, decreasing with depolarization and increasing with hyperpolarization from rest. Both the current-voltage relationship and the time course of inactivation were consistent with the known properties of T-type calcium channels, and the voltage dependence was blocked by application of the T-type calcium channel antagonists Ni 2ϩ and mibefradil. In addition, mibefradil reduced action potential-mediated synaptic transmission from granule to mitral cells. The implication of a transiently inactivating calcium channel in synaptic release from granule cells suggests novel mechanisms for the regulation of lateral inhibition in the olfactory bulb.

Abstraet--Extracellular ATP is known to activate intracellular enzymes in astrocytes via P2 purinoceptors that appear to play important physiological and pathological roles in these supporting brain cells. In this study, major P2 purinoceptor subtypes on astrocytes of neonatal rat cerebral cortices were identified in receptor expression experiments, when astrocytic messenger RNA was injected into Xenopus oocytes and recombinant P2 purinoceptors were characterized pharmacologically. In messenger RNA-injected oocytes, ATP evoked inward chloride currents (IcLca) typical of stimulating metabotropic receptors that release intracellular Ca 2+. Half-maximal activation with ATP occurred at 40 nM: the Hill coefficient was 0.5, which indicated that ATP stimulated two subtypes of P2 purinoceptor. UTP and 2-methylthioATP were the most active (and equipotent) of a series of nucleotides activating recombinant P2 purinoceptors. These results indicated that the two P2 purinoceptors expressed by astrocytic messenger RNA were of P2U and P2Y subtypes. Responses to ATP were antagonized by the P2 purinoceptor antagonist (suramin) but not by the P~ purinoceptor blocker (sulphophenyltheophylline). Findings in expression studies were confirmed in assays of intracellular signalling systems using primary cultures of rat astrocytes. UTP and 2-methylthioATP stimulated mitogen-activated protein kinase to the same extent as ATP, although UTP was less potent than either ATP or 2-methylthioATP. Both UTP and ATP increased intracellular Ca 2+ (as measured by fura-2/AM luminescence) which, in cross-desensitization experiments, indicated the involvement of two subtypes of P2 purinoceptors.

To investigate their potentially toxic effects on mammalian vascular smooth muscle, pentane extracts of papaya seeds and the chief active ingredient in the extracts, benzyl isothiocyanate (BITC), were tested for their effects on the contraction of strips of dog carotid artery. BITC and the papaya seed extract caused relaxation when added to tissue strips that had been pre-contracted with phenylephrine (PE). Incubation of the tissue with papaya seed extract or BITC caused inhibition of contraction when the strips were subsequently contracted with KCl or PE. This relaxation and inhibition of contraction did not appear to be endothelium-dependent, as endothelium-denuded rings showed the same degree of relaxation or inhibition of contraction in response to the preparations/drugs as those with the endothelium intact. The effects of both BITC and the extract were irreversible, i.e., the tissue did not recover to normal contractile ability after extensive washing. Exposure of the tissue to the papaya seed extract caused slower relaxation of the tissue, compared to controls, both after contraction with PE and subsequent addition of carbachol (CCh), and after contraction with KCl and then washing. Calcium imaging studies using cultured endothelial cells showed strong influxes of Ca 2+ into the cells in response to addition of the papaya seed extract. We conclude that these extracts, when present in high concentration, are cytotoxic by increasing the membrane permeability to Ca 2+ , and that the vascular effects of papaya seed extracts are consistent with the notion that BITC is the chief bio-active ingredient. D

Alterations of the β-adrenergic signalling, structural remodelling, and electrical failure of T-tubules are hallmarks of heart failure (HF). Here, we assess the effect of β-adrenoceptor activation on local Ca 2+ release in electrically coupled and uncoupled T-tubules in ventricular myocytes from HF rats. We employ an ultrafast random access multi-photon (RAMP) microscope to simultaneously record action potentials and Ca 2+ transients from multiple T-tubules in ventricular cardiomyocytes from a HF rat model of coronary ligation compared to sham-operated rats as a control. We confirmed that β-adrenergic stimulation increases the frequency of Ca 2+ sparks, reduces Ca 2+ transient variability, and hastens the decay of Ca 2+ transients: all these effects are similarly exerted by β-adrenergic stimulation in control and HF cardiomyocytes. Conversely, β-adrenergic stimulation in HF cells accelerates a Ca 2+ rise exclusively in the proximity of T-tubules that regularly conduct the action potential. The delayed Ca 2+ rise found at T-tubules that fail to conduct the action potential is instead not affected by β-adrenergic signalling. Taken together, these findings indicate that HF cells globally respond to β-adrenergic stimulation, except at T-tubules that fail to conduct action potentials, where the blunted effect of the β-adrenergic signalling may be directly caused by the lack of electrical activity.

Hebb's postulate (Hebb, 1949), an increase in postsynaptic [Ca 2ϩ ] i can induce bidirectional changes in synaptic strength depending on activation of specific biochemical pathways (Bienenstock et al., 1982; Lisman, 1989; Stanton and Sejnowski, 1989) . Despite its strategic location for signal processing, spatiotemporal dynamics of [Ca 2ϩ ] i changes and their relationship with synaptic plasticity at the cerebellar mossy fiber (mf)-granule cell (GrC) relay were unknown. In this paper, we report the plasticity/[Ca 2ϩ ] i relationship for GrCs, which are typically activated by mf bursts (Chadderton et al.,

Using patch-clamp and calcium imaging techniques, we characterized the effects of ATP and histamine on human keratinocytes. In the HaCaT cell line, both receptor agonists induced a transient elevation of [Ca 2 ϩ ] i in a Ca 2 ϩ -free medium followed by a secondary [Ca 2 ϩ ] i rise upon Ca 2 ϩ readmission due to store-operated calcium entry (SOCE). In voltage-clamped cells, agonists activated two kinetically distinct currents, which showed differing voltage dependences and were identified as Ca 2 ϩ -activated (I Cl(Ca) ) and volume-regulated (I Cl, swell ) chloride currents. NPPB and DIDS more efficiently inhibited I Cl(Ca) and I Cl, swell , respectively. Cell swelling caused by hypotonic solution invariably activated I Cl, swell while regulatory volume decrease occurred in intact cells, as was found in flow cytometry experiments. The PLC inhibitor U-73122 blocked both agonist-and cell swelling-induced I Cl, swell , while its inactive analogue U-73343 had no effect. I Cl(Ca) could be activated by cytoplasmic calcium increase due to thapsigargin (TG)-induced SOCE as well as by buffering [Ca 2 ϩ ] i in the pipette solution at 500 nM. In contrast, I Cl, swell could be directly activated by 1-oleoyl-2-acetyl-sn -glycerol (OAG), a cell-permeable DAG analogue, but neither by InsP 3 infusion nor by the cytoplasmic calcium increase. PKC also had no role in its regulation. Agonists, OAG, and cell swelling induced I Cl, swell in a nonadditive manner, suggesting their convergence on a common pathway. I Cl, swell and I Cl(Ca) showed only a limited overlap (i.e., simultaneous activation), although various maneuvers were able to induce these currents sequentially in the same cell. TG-induced SOCE strongly potentiated I Cl(Ca) , but abolished I Cl, swell , thereby providing a clue for this paradox. Thus, we have established for the first time using a keratinocyte model that I Cl, swell can be physiologically activated under isotonic conditions by receptors coupled to the phosphoinositide pathway. These results also suggest a novel function for SOCE, which can operate as a "selection" switch between closely localized channels.

Two-photon calcium imaging is now an important tool for in vivo imaging of biological systems. By enabling neuronal population imaging with subcellular resolution, this modality offers an approach for gaining a fundamental understanding of brain anatomy and physiology. Proper analysis of calcium imaging data requires denoising, that is separating the signal from complex physiological noise. To analyze two-photon brain imaging data, we present a signal plus colored noise model in which the signal is represented as harmonic regression and the correlated noise is represented as an order p autoregressive process. We provide an efficient cyclic descent algorithm to compute approximate maximum likelihood parameter estimates by combing a weighted least-squares procedure with the Burg algorithm. We use Akaike information criterion to guide selection of the harmonic regression and the autoregressive model orders. Our flexible yet parsimonious modeling approach reliably separates stimulus-evoked fluorescence response from background activity and noise, assesses goodness of fit, and estimates confidence intervals and signal-to-noise ratio. This refined separation leads to appreciably enhanced image contrast for individual cells including clear delineation of subcellular details and network activity. The application of our approach to in vivo imaging data recorded in the ferret primary visual cortex demonstrates that our method yields substantially denoised signal estimates. We also provide a general Volterra series framework for deriving this and other signal plus correlated noise models for imaging. This approach to analyzing two-photon calcium imaging data may be readily adapted to other computational biology problems which apply correlated noise models.

Information-theory is being increasingly used to analyze complex, self-organizing processes on networks, predominantly in analytical and numerical studies. Perhaps one of the most paradigmatic complex systems is a network of neurons, in which cognition arises from the information storage, transfer, and processing among individual neurons. In this article we review experimental techniques suitable for validating information-theoretical predictions in simple neural networks, as well as generating new hypotheses. Specifically, we focus on techniques that may be used to measure both network (microcircuit) anatomy as well as neuronal activity simultaneously. This is needed to study the role of the network structure on the emergent collective dynamics, which is one of the reasons to study the characteristics of information processing. We discuss in detail two suitable techniques, namely calcium imaging and the application of multi-electrode arrays to simple neural networks in culture, and discuss their advantages and limitations in an accessible manner for non-experts. In particular, we show that each technique induces a qualitatively different type of error on the measured mutual information. The ultimate goal of this work is to bridge the gap between theorists and experimentalists in their shared goal of understanding the behavior of networks of neurons.

Animal behavior originates from neuronal activity distributed across brain-wide networks. However, techniques available to assess large-scale neural dynamics in behaving animals remain limited. Here we present compact, chronically implantable, high-density arrays of optical fibers that enable multi-fiber photometry and optogenetic perturbations across many regions in the mammalian brain. In mice engaged in a texture discrimination task, we achieved simultaneous photometric calcium recordings from networks of 12–48 brain regions, including striatal, thalamic, hippocampal and cortical areas. Furthermore, we optically perturbed subsets of regions in VGAT-ChR2 mice by targeting specific fiber channels with a spatial light modulator. Perturbation of ventral thalamic nuclei caused distributed network modulation and behavioral deficits. Finally, we demonstrate multi-fiber photometry in freely moving animals, including simultaneous recordings from two mice during social interaction. High-density multi-fiber arrays are versatile tools for the investigation of large-scale brain dynamics during behavior.

The ecdysis behavioral sequence in insects is a classic fixed action pattern (FAP) initiated by hormonal signaling. Ecdysis triggering hormones (ETHs) release the FAP through direct actions on the CNS. Here we present evidence implicating two groups of central ETH receptor (ETHR) neurons in scheduling the first two steps of the FAP: kinin (aka drosokinin, leucokinin) neurons regulate pre-ecdysis behavior and CAMB neurons (CCAP, AstCC, MIP, and Bursicon) initiate the switch to ecdysis behavior. Ablation of kinin neurons or altering levels of ETH receptor (ETHR) expression in these neurons modifies timing and intensity of preecdysis behavior. Cell ablation or ETHR knockdown in CAMB neurons delays the switch to ecdysis, whereas overexpression of ETHR or expression of pertussis toxinin these neurons accelerates timing of the switch. Calcium dynamics in kinin neurons are temporally aligned with pre-ecdysis behavior, whereas activity of CAMB neurons coincides with the switch from pre-ecdysis to ecdysis behavior. Activation of CCAP or CAMB neurons through temperature-sensitive TRPM8 gating is sufficient to trigger ecdysis behavior. Our findings demonstrate that kinin and CAMB neurons are direct targets of ETH and play critical roles in scheduling successive behavioral steps in the ecdysis FAP. Moreover, temporal organization of the FAP is likely a function of ETH receptor density in target neurons.

Background: Haplosclerid marine sponges produce pore forming polyalkylpyridinium salts (poly-APS), which can be used to deliver macromolecules into cells. The aim of this study was to investigate the delivery of DNA, siRNA and lucifer yellow into cells mediated by poly-APS and its potential mechanisms as compared with other lipofection systems (lipofectamine and N 4 ,N 9dioleoylspermine (LipoGen)). DNA condensation was evaluated and HEK 293 and HtTA HeLa cells were used to investigate pore formation and intracellular delivery of cDNA, siRNA and lucifer yellow.

Histamine has long been recognised as a classical inducer of pruritus. However, the specific mechanism of histamine-induced itch has still not been fully understood. The H 1 and H 4 receptor appear to be key components in the induction of itch. The specific role of the H 3 receptor in histamine-induced itch remains unclear. The aim of our study was to investigate the role of the four known histamine receptors (H 1-4 R) in acute itch in mice. Intradermal injection of the selective H 3 R inverse agonist pitolisant induced strong itch in mice. Pitolisant (50 nmol/ injection)-induced pruritus could be completely blocked by a combined treatment with the H 1 R antagonist cetirizine (15 mg/kg) and the H 4 R antagonist JNJ 7777120 (15 mg/kg), whereas the H 2 R antagonist ranitidine (15 mg/kg) failed to inhibit the scratch response. Next, expression and function of histamine receptors on sensory neurons isolated from dorsal root ganglia of mice were investigated. As the itch sensation results from the excitation of sensory nerves in the skin, we further focused on skin specific sensory neurons. Therefore, neurons were retrograde labelled from the skin by means of a fluorescent tracer. Expression of H 1 R, H 3 R and H 4 R on skin innervating sensory neurons was detected. By single-cell calcium imaging, it was demonstrated that histamine induces a calcium increase in a subset of (skin-specific) sensory neurons via activation of the H 1 R and H 4 R as well as inhibition of the H 3 R. It is assumed that the decreased threshold in response to H 3 R antagonism activates H 1 R and H 4 R on sensory neurons, which in turn results in the excitation of histamine-sensitive afferents and therefore elicits the sensation of itch.

The purpose of the present work was to characterize calcium responses of brain-capillary endothelial cells (BCEC), the cells forming the blood-brain barrier, to chemical, hyperosmolar and mechanical stimulation. Confluent BCEC cultures were grown from capillary fragments isolated from rat cerebral cortex. Intracellular free calcium ([Ca 2+ ] i ) was measured using fura-2 and digital imaging. Our experiments show large endothelial calcium responses to substance P and ATP, up to a peak value of approximately 1000 and 600 nM, respectively, and these responses were observed in 2/3 of the cells. Calcium responses to bradykinin, histamine, and hyperosmolar sucrose or mannitol were smaller, attaining a peak in the range 180-340 nM, and were observed in a smaller fraction of the cells. No calcium responses were observed to high-potassium, L-glutamate, serotonin, carbachol, noradrenalin, and nitric-oxide donors. Consecutive superfusion of the cultures with ATP, bradykinin, and histamin showed that cells with a certain response pattern were spatially grouped; the response pattern itself varied widely between experiments. Mechanical stimulation of a single cell caused a calcium response in the stimulated cell in primary cultures and triggered an intercellularly propagating calcium wave in passaged cultures. Given the important effect of endothelial [Ca 2+ ] i on blood-brain barrier permeability and transport, we conclude that substance P and ATP are potential modulators of blood-brain barrier function. Hyperosmolarity-induced blood-brain barrier opening is probably not mediated through endothelial [Ca 2+ ] i .

Schizophrenia exhibits up to 80% heritability. A number of genome wide association studies (GWAS) have repeatedly shown common variants in voltage-gated calcium (Cav) channel genes CACNA1C, CACNA1I and CACNA1G have a major contribution to the risk of the disease. More recently, studies using whole exome sequencing have also found that CACNA1B (Cav2.2 N-type) deletions and rare disruptive variants in CACNA1A (Cav2.1 P/Q-type) are associated with schizophrenia. The negative symptoms of schizophrenia include behavioural defects such as impaired memory, sleep and circadian rhythms. It is not known how variants in schizophrenia-associated genes contribute to cognitive and behavioural symptoms, thus hampering the development of treatment for schizophrenia symptoms. In order to address this knowledge gap, we studied behavioural phenotypes in a number of loss of function mutants for the Drosophila ortholog of the Cav2 gene family called cacophony (cac). cac mutants showed several behavioural features including decreased night-time sleep and hyperactivity similar to those reported in human patients. The change in timing of sleep-wake cycles suggested disrupted circadian rhythms, with the loss of night-time sleep being caused by loss of cac just in the circadian clock neurons. These animals also showed a reduction in rhythmic circadian behaviour a phenotype that also could be mapped to the central clock. Furthermore, reduction of cac just in the clock resulted in a lengthening of the 24 h period. In order to understand how loss of Cav2 function may lead to cognitive deficits and underlying cellular pathophysiology we targeted loss of function of cac to the memory centre of the fly, called the mushroom bodies (MB). This manipulation was sufficient to cause reduction in both short- and intermediate-term associative memory. Memory impairment was accompanied by a decrease in Ca2+ transients in response to a depolarizing stimulus, imaged in the MB presynaptic terminals. This work shows loss of cac Cav2 channel function alone causes a number of cognitive and behavioural deficits and underlying reduced neuronal Ca2+ transients, establishing Drosophila as a high-throughput in vivo genetic model to study the Cav channel pathophysiology related to schizophrenia.

Texte de vulgarisation scientifique présentant à un grand public comment le laboratoire du Dr De Koninck utilise les techniques de la biophotonique afin d'observer en tant réeel des processus jadis inobservables dans les neurones et au niveau des synapses. Survol du projet de recherche de ma maîtrise en neurobiologie et invitation à consulter la publication dans PloS One.

INTRODUCTION:

Beaux, bien branchés et plastiques

Quand j'ai vu pour la première fois l'image d'un neurone, ce fut un coup de foudre. Beauté et complexité! Morphologie exceptionnelle rappelant les ramifications des arbres, mais aussi chiffres percutants : notre cerveau contient 100 milliards de neurones, et chacun peut entretenir 10 000 connexions, ou synapses, avec ses voisins. J'ai entrepris une maîtrise en neurobiologie. Naturellement, puisque les mécanismes de la mémoire et de l'apprentissage m'intéressent, c'est vers le laboratoire de Paul De Koninck que je me suis tourné, reconnu pour l'étude de « l'enzyme du souvenir », la CaMKII, dans la plasticité synaptique, c'est-à-dire la capacité qu'ont les neurones de se connecter les uns aux autres avec plus ou moins de force en fonction des apprentissages. Mon projet de recherche porte sur les signaux calciques intra-neuronaux de la CaMKII et sur son interaction avec la protéine Rem2. Suivez-moi et non seulement il me fera plaisir de vous aider à décoder ce charabias, mais en plus je vais-je pense-vous y intéresser!

Neurotoxicity induced by beta-amyloid peptide (Ab) involves glutamate toxicity, resulting from overactivation of N-methyl-D-aspartate (NMDA) receptors and elevation of intracellular calcium. However, the heterogeneity of the NMDA receptors, frequently composed of NR1 and NR2A-D subunits, has been less studied. Thus, we determined the contribution of NMDA receptor subtypes on Ab 1-40 toxicity in HEK293 cells transiently expressing NR1/NR2A or NR1/NR2B subunits. Analysis of lactate dehydrogenase (LDH) release and trypan blue exclusion revealed an increase in Ab 1-40 toxicity upon NR1/NR2A expression, compared to NR1/NR2B, indicating loss of plasma membrane integrity. Furthermore, Ab 1-40 decreased intracellular ATP in cells expressing NR1/NR2A. MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10imine maleate), a noncompetitive NMDA receptor antagonist, partially prevented the decrease in cell viability and the energy impairment. These differences were not accounted for by the activation of caspases 2, 3, 8 and 9 or calpains or by DNA fragmentation, excluding the hypothesis of apoptosis. Functional NR1/NR2A and NR1/NR2B receptor subtypes were further evidenced by single-cell calcium imaging. Stimulation of NR1/ NR2A receptors with NMDA/glycine revealed an increase in intracellular calcium in cells pre-exposed to Ab 1-40 . Opposite effects were observed upon activation of NR1/NR2B receptors. These results suggest that NR1/NR2A-composed NMDA receptors mediate necrotic cell death in HEK293 cells exposed to Ab 1-40 through changes in calcium homeostasis. #

Pseudorabies virus (PrV) strains such as PrV-Bartha and its marker protein-expressing variants have been used in numerous studies as retrograde transneuronal tracing tools, defining the synaptic organization of mammalian neuronal circuits. However, the possibilities for functional examination of virus-infected neurons are limited to electrophysiological approaches or bulk loading strategies using calcium-sensitive dyes. Herein we report the generation and functional characterization of three PrV-Bartha-derived recombinant virus mutants that express different fluorescent calcium indicator proteins (FCIPs). All three generated virus recombinants are able to infect murine trigeminal neurons and express the corresponding FCIP (GCaMP2, camgaroo-2, or inverse pericam). Functionality of these virally expressed constructs was verified by using confocal Ca-imaging technologies. These FCIP-expressing virus recombinants provide a new tool for the functional analysis of whole circuits of synaptically connected neurons in vitro and in vivo.

Bitter substances are a structurally diverse group of com- pounds that appear to act via several transduction mecha- nisms. The bitter-tasting denatonium ion has been proposed to act via two different G-protein-regulated pathways, one involv- ing inositol 1,4,5-trisphosphate and raised intracellular calcium levels, the other involving phosphodiesterase and membrane depolarization via a cyclic nucleotide-suppressible cation chan- nel. The aim of the present study was to examine these trans- duction mechanisms in taste cells of the mudpuppy Necturus maculosus by calcium-imaging and whole-cell recording. De- natonium benzoate increased intracellular calcium levels and induced an outward current independently of extracellular cal- cium. The denatonium-induced increase in intracellular calcium was inhibited by U73122, an inhibitor of phospholipase C, and by thapsigargin, an inhibitor of calcium transport into intracel- lular stores. The denatonium-induced outward current was blocked by G...

Nasal trigeminal chemosensitivity in mice and rats is mediated in part by epithelial solitary chemoreceptor (chemosensory) cells (SCCs), but the exact role of these cells in chemoreception is unclear. Histological evidence suggests that SCCs express elements of the bitter taste transduction pathway including T2R (bitter taste) receptors, the G protein alpha-gustducin, PLCbeta2, and TRPM5, leading to speculation that SCCs are the receptor cells that mediate trigeminal nerve responses to bitter taste receptor ligands. To test this hypothesis, we used calcium imaging to determine whether SCCs respond to classic bitter-tasting or trigeminal stimulants. SCCs from the anterior nasal cavity were isolated from transgenic mice in which green fluorescent protein (GFP) expression was driven by either TRPM5 or gustducin. Isolated cells were exposed to a variety of test stimuli to determine which substances caused an increase in intracellular Ca2+ ([Ca2+]i). GFP-positive cells respond with increased [Ca2+]i to the bitter receptor ligand denatonium and this response is blocked by the PLC inhibitor U73122. In addition, GFP+ cells respond to the neuromodulators adenosine 5&amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;amp;#39;-triphosphate and acetylcholine but only very rarely to other bitter-tasting or trigeminal stimuli. Our results demonstrate that TRPM5- and gustducin-expressing nasal SCCs respond to the T2R agonist denatonium via a PLC-coupled transduction cascade typical of T2Rs in the taste system.

Although in erythrocytes calcium is thought to be important in homeostasis, measurements of this ion concentration are generally seen as rather problematic because of the auto-fluorescence or absorption properties of the intracellular milieu. Here, we describe experiments to assess the usability of popular calcium indicators such as Fura-2, Indo-1 and Fluo-4. In our experiments, Fluo-4 turned out to be the preferable indicator because (i) its excitation and emission properties were least influenced by haemoglobin and (ii) it was the only dye for which excitation light did not lead to significant auto-fluorescence of the erythrocytes. From these results, we conclude that the use of indicators such as Fura-2 together with red blood cells has to be revisited critically. We thus utilized Fluo-4 in erythrocytes to demonstrate a robust but heterogeneous calcium increase in these cells upon stimulation by prostaglandin E 2 and lysophosphatidic acid. For the latter stimulus, we recorded emission spectra of individual erythrocytes to confirm largely unaltered Fluo-4 emission. Our results emphasize that in erythrocytes measurements of intracellular calcium are reliably possible with Fluo-4 and that other indicators, especially those requiring UV-excitation, appear less favourable.

Male moths respond to conspecific female-released pheromones with remarkable sensitivity and specificity, due to highly specialized chemosensory neurons in their antennae. In Antheraea silkmoths, three types of sensory neurons have been described, each responsive to one of three pheromone components. Since also three different pheromone binding proteins (PBPs) have been identified, the antenna of Antheraea seems to provide a unique model system for detailed analyzes of the interplay between the various elements underlying pheromone reception. Efforts to identify pheromone receptors of Antheraea polyphemus have led to the identification of a candidate pheromone receptor (ApolOR1). This receptor was found predominantly expressed in male antennae, specifically in neurons located beneath pheromone-sensitive sensilla trichodea. The ApolOR1-expressing cells were found to be surrounded by supporting cells co-expressing all three ApolPBPs. The response spectrum of ApolOR1 was assessed by me...

Cardiac fibrillation, a form of cardiac arrhythmia, is the most common cause of embolic stroke and death associated with heart failure. The molecular mechanisms underlying cardiac fibrillation are largely unknown. Here we report a zebrafish model for cardiac fibrillation. The hearts of zebrafish tremblor (tre) mutants exhibit chaotic movements and fail to develop synchronized contractions. Calcium imaging showed that normal calcium transients are absent in tre cardiomyocytes, and molecular cloning of the tre mutation revealed that the tre locus encodes the zebrafish cardiac-specific sodium-calcium exchanger (NCX) 1, NCX1h. Forced expression of NCX1h or other calcium-handling molecules restored synchronized heartbeats in tre mutant embryos in a dosage-dependent manner, demonstrating the critical role of calcium homeostasis in maintaining embryonic cardiac function. By creating mosaic zebrafish embryos, we showed that sporadic NCX1h-null cells were not sufficient to disrupt normal cardiac function, but clustered wild-type cardiomyocytes contract in unison in tre mutant hearts. These data signify the essential role of calcium homeostasis and NCX1h in establishing rhythmic contraction in the embryonic zebrafish heart. calcium homeostasis ͉ cardiac arrhythmia ͉ heart Isolation of Zebrafish NCX1 Homologues. Partial sequences of NCX1n and NCX1h were amplified (94°C for 30 sec, 60°C for 60 sec, and 72°C for 60 sec for 32 cycles) and cloned into pCR II-TOPO vector (Invitrogen) by using the following primers: NCX1n forward, AGTGACACTGGTGAGAATGAC; NCX1n reverse, ATGGCTGTCTTCAAAGTCCTC; NCX1h forward, TAGACTTATGACTGGTGCAGG; NCX1h reverse, ACTC-CATGGGTGTCTTCAAAG. The full-length sequences of NCX1n and NCX1h were isolated by RACE. Total RNA was isolated from 30 h postfertilization (hpf) wild-type embryos with the RNAqueous-4 PCR kit (Ambion, Austin, TX). RACE was performed with the SMART RACE cDNA amplification kit (BD Biosciences) according to the manufacturer's protocol.

We introduce an optical method to stimulate individual neurons in brain slices in any arbitrary spatiotemporal pattern, using two-photon uncaging of MNI-glutamate with beam multiplexing. This method has single-cell and three-dimensional precision. By sequentially stimulating up to a thousand potential presynaptic neurons, we generated detailed functional maps of inputs to a cell. We combined this approach with two-photon calcium imaging in an all-optical method to image and manipulate circuit activity. t h s d o h t e m