Advanced Walkthrough¶

Overview¶

The purpose of this walkthrough will be to illustrate an execution gNALI to find high-confidence loss-of-function variants of genes using additional optional parameters.

Input Data¶

The input file should contain a list of genes as HGNC symbols, separated by a newline character. Genes in non-standard formats will not be analyzed.

The example input file located in the following location:

inputs/genes.txt

The example input file contains the following contents and can be found here:

> cat inputs/genes.txt
CCR5
ALCAM

Running gNALI¶

gNALI only requires an input file, and has other optional parameters. We will use an input file with the path inputs/genes.txt and query gnomADv2.1.1. Since gnomADv2.1.1 is the default database, we do not have to specify it with the -d/--database parameter. To see what predefined filters are available with this database, we can use the help command (more info here). Available additional filters can be found here.

Next, we will filter the variants keeping only those with a non-zero number of homozygous control samples (available as a predefined filter) and alternate allele count greater than 2 (by specifying an additional filter). We will also generate a VCF file for variants passing filtering, generate population frequencies, and write our results to a directory called output-advanced.

Here is what such a command would look like:

gnali
    --input inputs/genes.txt
    --predefined_filters homozygous-controls
    --additional_filters "AC>2"
    --vcf
    --pop_freqs
    --output output-advanced/

Output¶

By default, gNALI will have two output files in output-advanced/: a basic output file, and a detailed output file. When using the -v/--vcf flag, a third additional output file will be generated. More information on outputs can be found here.

Output files for this example can be found here.

Basic Output¶

The basic output file contains a subset of the input genes, the ones that have high-confidence loss-of-function variants that pass filtering. It also contains a list of genes that could not be found in the specified database, if any.

The file shown below can also be found here.

output-advanced/Nonessential_Host_Genes_\(Basic\).txt:

HGNC_Symbol	Status
CCR5	HC LoF found
ALCAM	HC LoF found, failed filtering

Detailed Output¶

The detailed output file contains the high-confidence loss-of-function variants that pass filtering with some annotations extracted. Since we are using the --pop_freqs flag, we will also have the population frequency data added.

The file shown below can also be found here.

output-advanced/Nonessential_Host_Genes_\(Detailed\).txt:

Chromosome	Position_Start	RSID	Reference_Allele	Alternate_Allele	Score	Quality	LoF_Variant	LoF_Annotation	HGNC_Symbol	Ensembl Code	HGVSc	african-AC	african-AN	african-AF	ashkenazi-jewish-AC	ashkenazi-jewish-AN	ashkenazi-jewish-AF	european-non-finnish-AC	european-non-finnish-AN	european-non-finnish-AF	finnish-AC	finnish-AN	finnish-AF	south-asian-AC	south-asian-AN	south-asian-AF	latino-AC	latino-AN	latino-AF	east-asian-AC	east-asian-AN	east-asian-AF	other-AC	other-AF	other-AN	male-AC	male-AF	male-AN	female-AC	female-AN	female-AF
3	46415066	rs146972949	C	T	120238.89	PASS	T	stop_gained	CCR5	ENSG00000160791	ENST00000292303.4:c.673C>T	23	16252	1.4152100000e-03	0	10016	0.0000000000e+00	8	113418	7.0535500000e-05	0	21590	0.0000000000e+00	0	30566	0.0000000000e+00	3	34516	8.6916200000e-05	0	18382	0.0000000000e+00	0	0.0000000000e+00	6108	14	1.0326900000e-04	135568	20	115280	1.7349100000e-04
3	46415066	rs146972949	C	T	120238.89	PASS	T	stop_gained	CCR5	ENSG00000160791	ENST00000343801.4:c.673C>T	23	16252	1.4152100000e-03	0	10016	0.0000000000e+00	8	113418	7.0535500000e-05	0	21590	0.0000000000e+00	0	30566	0.0000000000e+00	3	34516	8.6916200000e-05	0	18382	0.0000000000e+00	0	0.0000000000e+00	6108	14	1.0326900000e-04	135568	20	115280	1.7349100000e-04
3	46415066	rs146972949	C	T	120238.89	PASS	T	stop_gained	CCR5	ENSG00000160791	ENST00000445772.1:c.673C>T	23	16252	1.4152100000e-03	0	10016	0.0000000000e+00	8	113418	7.0535500000e-05	0	21590	0.0000000000e+00	0	30566	0.0000000000e+00	3	34516	8.6916200000e-05	0	18382	0.0000000000e+00	0	0.0000000000e+00	6108	14	1.0326900000e-04	135568	20	115280	1.7349100000e-04
3	46414943	rs775750898	TACAGTCAGTATCAATTCTGGAAGAATTTCCAG	T	1947603.90	PASS	-	frameshift_variant	CCR5	ENSG00000160791	ENST00000292303.4:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA	168	8706	1.9297000000e-02	35	290	1.2069000000e-01	1621	15392	1.0531400000e-01	478	3468	1.3783200000e-01	-	-	-	23	848	2.7122600000e-02	0	1558	0.0000000000e+00	102	9.3922700000e-02	1086	1289	7.3893600000e-02	17444	1138	13904	8.1847000000e-02
3	46414943	rs775750898	TACAGTCAGTATCAATTCTGGAAGAATTTCCAG	T	1947603.90	PASS	-	frameshift_variant	CCR5	ENSG00000160791	ENST00000343801.4:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA	168	8706	1.9297000000e-02	35	290	1.2069000000e-01	1621	15392	1.0531400000e-01	478	3468	1.3783200000e-01	-	-	-	23	848	2.7122600000e-02	0	1558	0.0000000000e+00	102	9.3922700000e-02	1086	1289	7.3893600000e-02	17444	1138	13904	8.1847000000e-02
3	46414943	rs775750898	TACAGTCAGTATCAATTCTGGAAGAATTTCCAG	T	1947603.90	PASS	-	frameshift_variant	CCR5	ENSG00000160791	ENST00000445772.1:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA	168	8706	1.9297000000e-02	35	290	1.2069000000e-01	1621	15392	1.0531400000e-01	478	3468	1.3783200000e-01	-	-	-	23	848	2.7122600000e-02	0	1558	0.0000000000e+00	102	9.3922700000e-02	1086	1289	7.3893600000e-02	17444	1138	13904	8.1847000000e-02

VCF Output¶

When using the -v/--vcf flag, variants passing filtering as well as headers from the database will be written to a VCF file.

The file shown below can also be found here.

> cat output-advanced/Nonessential_Gene_Variants.vcf

##fileformat=VCFv4.2
##hailversion=0.2.7-c860755b5da3
...
#CHROM  POS         ID          REF                                 ALT QUAL        FILTER  INFO
3       46415066    rs146972949 C                                   T   120238.89   PASS    AC=34;AN=250848;AF=1.35540e-04;...
3       46414943    rs775750898 TACAGTCAGTATCAATTCTGGAAGAATTTCCAG   T   1947603.90  PASS    AC=2427;AN=31348;AF=7.74212e-02;...