This document has the following dependencies:
library(Rsamtools)
Use the following commands to install these packages in R.
source("http://www.bioconductor.org/biocLite.R")
biocLite(c("Rsamtools")
The Rsamtools packages contains functionality for reading and examining aligned reads in the BAM format.
The Rsamtools package is an interface to the widely used samtools/htslib library. The main functionality of the package is support for reading BAM files.
The SAM format is a text based representation of alignments. The BAM format is a binary version of SAM which is smaller and much faster. In general, always work with BAM.
The format is quite complicated, which means the R representation is also a bit complicated. This complication happens because of the following features of the file format
We will not attempt to fully understanding all the intricacies of this format.
A BAM file can be sorted in multiple ways. If it is sorted according to genomic location and if it is also “indexed” it is possible to retrieve all reads mapping to a genomic location, something which can be very useful. In Rsamtools this is done by the functions sortBam() and indexBam().
How to read a BAM file goes conceptually like this
BamFile() constructor.ScanBamParams().scanBam().First we setup a BamFile object:
bamPath <- system.file("extdata", "ex1.bam", package="Rsamtools")
bamFile <- BamFile(bamPath)
bamFile
## class: BamFile
## path: /Library/Frameworks/R.framework/Versions/3.2/Resources/lib.../ex1.bam
## index: /Library/Frameworks/R.framework/Versions/3.2/Resource.../ex1.bam.bai
## isOpen: FALSE
## yieldSize: NA
## obeyQname: FALSE
## asMates: FALSE
## qnamePrefixEnd: NA
## qnameSuffixStart: NA
Some high-level information can be accessed here, like
seqinfo(bamFile)
## Seqinfo object with 2 sequences from an unspecified genome:
## seqnames seqlengths isCircular genome
## seq1 1575 NA <NA>
## seq2 1584 NA <NA>
(obviously, seqinfo() and seqlevels() etc. are supported as well).
Now we read all the reads in the file using scanBam(), ignoring the possibility of selecting reads using ScanBamParams() (we will return to this below).
aln <- scanBam(bamFile)
length(aln)
## [1] 1
class(aln)
## [1] "list"
We get back a list of length 1; this is because scanBam() can return output from multiple genomic regions, and here we have only one (everything). We therefore subset the output; this again gives us a list and we show the information from the first alignment
aln <- aln[[1]]
names(aln)
## [1] "qname" "flag" "rname" "strand" "pos" "qwidth" "mapq"
## [8] "cigar" "mrnm" "mpos" "isize" "seq" "qual"
lapply(aln, function(xx) xx[1])
## $qname
## [1] "B7_591:4:96:693:509"
##
## $flag
## [1] 73
##
## $rname
## [1] seq1
## Levels: seq1 seq2
##
## $strand
## [1] +
## Levels: + - *
##
## $pos
## [1] 1
##
## $qwidth
## [1] 36
##
## $mapq
## [1] 99
##
## $cigar
## [1] "36M"
##
## $mrnm
## [1] <NA>
## Levels: seq1 seq2
##
## $mpos
## [1] NA
##
## $isize
## [1] NA
##
## $seq
## A DNAStringSet instance of length 1
## width seq
## [1] 36 CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG
##
## $qual
## A PhredQuality instance of length 1
## width seq
## [1] 36 <<<<<<<<<<<<<<<;<<<<<<<<<5<<<<<;:<;7
Notice how the scanBam() function returns a basic R object, instead of an S4 class. Representing the alignments as S4 object is done by the GenomicAlignments package; this is especially useful for access to spliced alignments from RNA sequencing data.
The names of the aln list are basically the names used in the BAM specification. Here is a quick list of some important ones
qname: The name of the read.rname: The name of the chromosome / sequence / contig it was aligned to.strand: The strand of the alignment.pos: The coordinate of the left-most part of the alignment.qwidth: The length of the read.mapq: The mapping quality of the alignment.seq: The actual sequence of the alignment.qual: The quality string of the alignment.cigar: The CIGAR string (below).flag: The flag (below).BAM files can be extremely big and it is there often necessary to read in parts of the file. You can do this in different ways
Let us start with the first of this. By specifying yieldSize when you use BamFile(), every invocation of scanBam() will only read yieldSize number of alignments. You can then invoke scanBam() again to get the next set of alignments; this requires you to open() the file first (otherwise you will keep read the same alignments).
yieldSize(bamFile) <- 1
open(bamFile)
scanBam(bamFile)[[1]]$seq
## A DNAStringSet instance of length 1
## width seq
## [1] 36 CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCG
scanBam(bamFile)[[1]]$seq
## A DNAStringSet instance of length 1
## width seq
## [1] 35 CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT
## Cleanup
close(bamFile)
yieldSize(bamFile) <- NA
The other two ways of reading in parts of a BAM file is to use ScanBamParams(), specifically the what and which arguments.
gr <- GRanges(seqnames = "seq2",
ranges = IRanges(start = c(100, 1000), end = c(1500,2000)))
params <- ScanBamParam(which = gr, what = scanBamWhat())
aln <- scanBam(bamFile, param = params)
names(aln)
## [1] "seq2:100-1500" "seq2:1000-2000"
head(aln[[1]]$pos)
## [1] 66 68 68 72 73 77
Notice how the pos is less than what is specified in the which argument; this is because the alignments overlap the which argument. The what=scanBamWhat() tells the function to read everything. Often, you may not be interested in the actual sequence of the read or its quality scores. These takes up a lot of space so you may consider disabling reading this information.
The “CIGAR” is how the BAM format represents spliced alignments. For example, the format stored the left most coordinate of the alignment. To get to the right coordinate, you have to parse the CIGAR string. In this example “36M” means that it has been aligned with no insertions or deletions. If you need to work with spliced alignments or alignments containing insertions or deletions, you should use the GenomicAlignments package. #### Flag
An alignment may have a number of “flags” set or unset. These flags provide information about the alignment. The flag integer is a representation of multiple flags simultanously. An example of a flag is indicating (for a paired end alignment) whether both pairs have been properly aligned. For more information, see the BAM specification.
In Rsamtools there is a number of helper functions dealing with only reading certain flags; use these.
Sometimes you want a quick summary of the alignments in a BAM file:
quickBamFlagSummary(bamFile)
## group | nb of | nb of | mean / max
## of | records | unique | records per
## records | in group | QNAMEs | unique QNAME
## All records........................ A | 3307 | 1699 | 1.95 / 2
## o template has single segment.... S | 0 | 0 | NA / NA
## o template has multiple segments. M | 3307 | 1699 | 1.95 / 2
## - first segment.............. F | 1654 | 1654 | 1 / 1
## - last segment............... L | 1653 | 1653 | 1 / 1
## - other segment.............. O | 0 | 0 | NA / NA
##
## Note that (S, M) is a partitioning of A, and (F, L, O) is a partitioning of M.
## Indentation reflects this.
##
## Details for group M:
## o record is mapped.............. M1 | 3271 | 1699 | 1.93 / 2
## - primary alignment......... M2 | 3271 | 1699 | 1.93 / 2
## - secondary alignment....... M3 | 0 | 0 | NA / NA
## o record is unmapped............ M4 | 36 | 36 | 1 / 1
##
## Details for group F:
## o record is mapped.............. F1 | 1641 | 1641 | 1 / 1
## - primary alignment......... F2 | 1641 | 1641 | 1 / 1
## - secondary alignment....... F3 | 0 | 0 | NA / NA
## o record is unmapped............ F4 | 13 | 13 | 1 / 1
##
## Details for group L:
## o record is mapped.............. L1 | 1630 | 1630 | 1 / 1
## - primary alignment......... L2 | 1630 | 1630 | 1 / 1
## - secondary alignment....... L3 | 0 | 0 | NA / NA
## o record is unmapped............ L4 | 23 | 23 | 1 / 1
Instead of reading a single file, it is possible to construct something called a BamViews, a link to multiple files. In many ways, it has the same Views functionality as other views. A quick example should suffice, first we read everything;
bamView <- BamViews(bamPath)
aln <- scanBam(bamView)
names(aln)
## [1] "ex1.bam"
This gives us an extra list level on the return object; first level is files, second level is ranges.
We can also set bamRanges() on the BamViews to specify that only certain ranges are read; this is similar to setting a which argument to ScanBamParams().
bamRanges(bamView) <- gr
aln <- scanBam(bamView)
names(aln)
## [1] "ex1.bam"
names(aln[[1]])
## [1] "seq2:100-1500" "seq2:1000-2000"
Sometimes, all you want to do is count… use countBam() instead of scanBam().
## R version 3.2.1 (2015-06-18)
## Platform: x86_64-apple-darwin13.4.0 (64-bit)
## Running under: OS X 10.10.5 (Yosemite)
##
## locale:
## [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
##
## attached base packages:
## [1] parallel stats4 methods stats graphics grDevices utils
## [8] datasets base
##
## other attached packages:
## [1] Rsamtools_1.20.4 Biostrings_2.36.4 XVector_0.8.0
## [4] GenomicRanges_1.20.6 GenomeInfoDb_1.4.2 IRanges_2.2.7
## [7] S4Vectors_0.6.5 BiocGenerics_0.14.0 BiocStyle_1.6.0
## [10] rmarkdown_0.8
##
## loaded via a namespace (and not attached):
## [1] knitr_1.11 magrittr_1.5
## [3] zlibbioc_1.14.0 GenomicAlignments_1.4.1
## [5] BiocParallel_1.2.20 lattice_0.20-33
## [7] hwriter_1.3.2 stringr_1.0.0
## [9] tools_3.2.1 grid_3.2.1
## [11] Biobase_2.28.0 latticeExtra_0.6-26
## [13] lambda.r_1.1.7 futile.logger_1.4.1
## [15] htmltools_0.2.6 yaml_2.1.13
## [17] digest_0.6.8 RColorBrewer_1.1-2
## [19] formatR_1.2 futile.options_1.0.0
## [21] bitops_1.0-6 evaluate_0.7.2
## [23] stringi_0.5-5 ShortRead_1.26.0