The administration of 10(-5) M epinephrine transiently decreased insulin receptor (IR) mRNA level... more The administration of 10(-5) M epinephrine transiently decreased insulin receptor (IR) mRNA levels in U-937 human promonocytic cells, which reached their minimum value after 24 hours. Such a decrease seems to be due, at least in part, to a reduction in transcript stability, since the IR mRNA half-life was observed to decline from approximately 4h in untreated cells to 3 h in epinephrine-treated cells. Computer inspection of the sequence of the 3' untranslated region of the human IR mRNA showed nine AUUUA pentamers and three U-rich regions. These domains could be targets for a RNA-binding protein induced by treatment with epinephrine producing a destabilization of IR mRNA in U-937 cells.
In the present work we study the binding of insulin to its receptors in adipocytes from subcutane... more In the present work we study the binding of insulin to its receptors in adipocytes from subcutaneous adipose tissue of left hypochondria extracted during an adrenalectomy carried out in a patient with Conn's Syndrome (left adrenal adenoma), comparing it to insulin binding to its receptors in adipocytes from subcutaneous adipose tissue of right hypochondria, obtained during a cholecystectomy because of cholelithiasis (controls). According to our results, there is an evident decrease in insulin binding to its receptors in adipocytes of the patient with Conn's Syndrome in relation to control group. This decrease in binding would be based both in a decrease in insulin receptor number as in an affinity loss of these receptors for the hormone. These facts at the receptor level could be originating a decrease in tissue response to insulin and be the base for glucose intolerance observed in patients with this pathology.
The effects of an in vivo cortisol-treatment to rats (2 X 2 mg/rat/day, for one week) on insulin ... more The effects of an in vivo cortisol-treatment to rats (2 X 2 mg/rat/day, for one week) on insulin plasma levels, insulin binding and antilipolytic activity in rat adipose tissue were investigated. Hyperinsulinemia together with an increase in insulin degradation in the serum of cortisol-treated rats were observed. The adipocytes from cortisol-treated animals showed a statistically significant decrease in insulin binding but no change in receptor numbers [cortisol-treated 103,000 +/- 8,000 (n = 8) receptors/cell and controls 138,000 +/- 15,000 (n = 16) receptors/cell], together with unchanged receptor affinity [ED50: cortisol-treated 3 X 10(-9) M and controls 3.2 X 10(-9) M], and a decreased sensitivity to the antilipolytic effect of insulin. The evidence presented for pre-receptor, receptor and post-receptor insulin defects on the action of cortisol in isolated rat adipocytes could represent a coordinated mechanism by which cortisol exerts "insulin resistance" in this tissue.
The relationship among plasma insulin disappearance, insulin binding to specific receptors in fat... more The relationship among plasma insulin disappearance, insulin binding to specific receptors in fat cells and antilipolytic insulin activity in streptozotocin-diabetic rats has been studied. Male Wistar rats were injected streptozotocin (65 mg/kg body weight) or saline by cardiac puncture. Decreased insulin levels and increased insulin degradation together with an increase in insulin binding were found in diabetic rats. The increase in insulin binding was related to an increase in the number of insulin receptors rather than to a change in receptor affinity. These findings at the pre-receptor and receptor levels could be correlated with an increase in antilipolytic insulin activity. However our results suggest that the mechanism for insulin action occurred through a potentiation of the norepinephrine lipolytic activity.
In this paper, the preliminary results regarding the alterations of the biological action mechani... more In this paper, the preliminary results regarding the alterations of the biological action mechanism of insulin in several types of pathological accumulations of fat, i.e. lipomas, Madelung's Lipomatosis and liposarcoma, are presented. The results indicate significant alterations both at the insulin receptor and post-receptor levels, with reduced biological activity of this hormone, which could have and inductive role in the pathogenesis of such entities.
Male Wistar rats with chronic hyperprolactinemia induced by grafting an anterior pituitary gland ... more Male Wistar rats with chronic hyperprolactinemia induced by grafting an anterior pituitary gland under the right kidney capsule were studied as experimental model. In these animals basal plasma glucose and insulin levels were unaltered. Epididymal adipocytes from hyperprolactinemic rats showed a significant increase in insulin binding at low unlabeled insulin concentrations. This increase in insulin binding can be principally attributed to an increase in the high affinity-low capacity binding sites, as demonstrated when Scatchard analysis was interpreted in terms of two types of insulin receptors. The dissociation constants (KD1 and KD2) were not different between the groups. The apparent insulin receptor affinity was also unchanged. Moreover, a decreased sensitivity to the antilipolytic effect of insulin was also obtained in adipocytes from hyperprolactinemic rats. These findings indicate that chronic hyperprolactinemia is able to increase high affinity insulin receptors in epididymal adipocytes, but tends to diminish the antilipolytic response, suggesting a lack of coupling between insulin binding and its biological activity in male adipose tissue. Several possible mechanisms involved in the process are suggested.
Treatment of U-937 human promonocytic cells with the cAMP increasing agents isoproterenol plus th... more Treatment of U-937 human promonocytic cells with the cAMP increasing agents isoproterenol plus theophylline decreased the basal level of heat-shock protein 70 (HSP70) mRNA. In addition, the cAMP increasing agents attenuated the increase in HSP70 mRNA and protein levels produced by cadmium chloride in U-937 and other human myeloid cell lines, reduced the capacity of cadmium treatment to generate stress-tolerance, and attenuated the cadmium-produced stimulation of heat-shock factor (HSF) binding activity. By contrast, isoproterenol plus theophylline failed to attenuate the stimulation of HSP70 gene expression and HSF binding activity caused by heat-shock. Isoproterenol plus theophylline did not prevent the uptake of cadmium into the cells, and increased to a similar extent the intracellular cAMP levels in cadmium- and heat-treated cells. The cAMP increasing agents reduced the induction by cadmium of the HSP27 stress gene, but failed to attenuate other cadmium-elicited stress reactions...
Evidence for pre-receptor, receptor and post-receptor glucagon defects was investigated in adipoc... more Evidence for pre-receptor, receptor and post-receptor glucagon defects was investigated in adipocytes from streptozotocin-diabetic rats. For this purpose male Wistar rats were injected by cardiac puncture with streptozotocin (65 mg/Kg body-weight) or saline solution and sacrificed after 7 and 15 days of drug administration. Increased glucagon levels and increased glucagon degradation in serum together with a decrease in glucagon binding were found in both groups of diabetic rats. The decrease in glucagon binding was related to a decrease in the number of glucagon receptors/cell rather than to a change in receptor affinity. The lipolytic response of glucagon was increased. However, the ability of glucagon to increase basal or theophylline-stimulated cAMP accumulation in the incubation medium of adipocytes from diabetic rats was decreased. Such alterations could represent a counter-regulatory mechanism of the hyperglucagonemia detected in streptozotocin-diabetic rats.
The simultaneous administration of the DNA topoisomerase II inhibitor etoposide (0.15 mM) and 1,2... more The simultaneous administration of the DNA topoisomerase II inhibitor etoposide (0.15 mM) and 1,25-dihydroxyvitamin D3 (VD3) (10 nM) synergistically induced the differentiation of HL-60 human promyelocytic leukemia cells. Similar results were obtained using U-937 human promonocytic cells, or the topoisomerase II inhibitors doxorubicin (15 nM) and mitoxantrone (2.5 nM). When sequential treatments were used, pre-incubation with VD3 had little effect on the subsequent action of etoposide, while pre-incubation with etoposide greatly potentiated the subsequent action of VD3. In addition, etoposide treatment stimulated VD3 binding activity and increased VD3 receptor mRNA and protein levels. The increase in hormone receptor expression may explain, at least in part, the capacity of topoisomerase inhibitors to potentiate the differentiation inducing activity of VD3.
Insulin receptor (IR) gene expression at the mRNA level was investigated in hindlimb skeletal mus... more Insulin receptor (IR) gene expression at the mRNA level was investigated in hindlimb skeletal muscle, epididymal adipose tissue and in the liver of rats exposed to prolonged in vivo administration of deoxycorticosterone acetate (DOCA). Following treatment, plasma insulin levels were reduced while glucose levels increased compared to values in control rats. DOCA-treated animals showed an increase in blood pressure and a reduction in body weight. This treatment also induced hypokalemia and decreased plasma protein levels. Sodium levels were unaffected. Moreover, no differences in DNA and protein content or in the indicator of cell size (protein/DNA) were observed in the skeletal muscle or adipose tissue of animals. In contrast, there was a clear increase in the protein and DNA contents of the liver with no change in the indicator of cell size. Northern blot assays revealed 2 major IR mRNA species of approximately 9.5 and 7.5 Kb in the 3 tissues from control animals. DOCA treatment ind...
Insulin receptor (IR) gene expression at the mRNA level was investigated in liver, hindlimb skele... more Insulin receptor (IR) gene expression at the mRNA level was investigated in liver, hindlimb skeletal muscle, and epididymal adipose tissue of rats exposed to prolonged in vivo administration of adrenaline in relation to control rats. In the liver of adrenaline-treated rats, there were no differences in relation to controls when DNA and protein content were measured. In skeletal muscle, only a slight decrease in protein concentration was detected. By contrast, a clear increase in both protein and DNA content was observed in the adipose tissue of treated animals. Northern blot assays revealed two IR mRNA species of approximately 9.5 and 7.5 Kb in the three tissues from controls. Adrenaline treatment induced an increase of approximately 60% in the levels of both RNAs in adipose tissue but not in liver or skeletal muscle. These results provide evidence for an in vivo tissue-specific regulation of IR gene expression at the mRNA level in rats under an experimental condition of excess of c...
Male Wistar rats of the third generation of rats drinking 200 micrograms Ni2+/mL as NiCl2 in thei... more Male Wistar rats of the third generation of rats drinking 200 micrograms Ni2+/mL as NiCl2 in their drinking water were studied. Basal plasma glucose and insulin levels were unchanged. Epididymal adipocytes from Ni2(+)-fed rats showed an increased insulin binding with a slight increase in apparent insulin affinity (ED50: Ni2(+)-fed rats 2.8 x 10(-9) M and controls 5 x 10(-9) M) with no change in insulin receptor numbers (Ni2(+)-fed rats 143,000 +/- 12,000 (6) receptors/cell and controls 126,000 +/- 13,000 (5]. Moreover, a decreased sensitivity to the antilipolytic response of insulin was also observed in adipocytes from Ni2(+)-fed rats. These events could represent actions of Ni2+ both at the receptor and post-receptor insulin levels. Several possible mechanisms involved in the process are suggested.
In the present study, we examine the effects of the treatment with 1,25-dihydroxyvitamin D 3 [150... more In the present study, we examine the effects of the treatment with 1,25-dihydroxyvitamin D 3 [150 IU/Kg (3.75 µg/Kg) once a day, for 15 days] to non-diabetic and streptozotocin-induced diabetic rats. The results indicate that treatment with 1,25-dihydroxyvitamin D 3 had minor effects in non-diabetic rats. The same treatment in streptozotocin-induced diabetic rats, although it did not correct the hyperglycemia and hypoinsulinemia induced by the diabetes, caused other actions that could mean beneficial effects on the amelioration of diabetes e.g., it avoided body weight loss, increased calcium and phosphorus plasma levels, and corrected the over-expression of the insulin receptor mRNA species of 9.5 and 7.5 Kb present in the hind limb muscle and heart of these animals. These genomic 1,25-dihydroxyvitamin D 3 effects could involve transcriptional mechanisms of repression mediated by vitamin D response elements in the rat insulin receptor gene promoter. Using computer analysis of this promoter, we propose the −249/−235 bp VDRE (5'GGGTGACCCGGGGTT3') with a pyrimidine (T) in the (+7) position of the 3' half-site as the best candidate for negative control by 1,25-dihydroxyvitamin D 3 . In addition, posttranscriptional mechanisms of regulation could also be implicated. Thus, computer inspection of the 5' untranslated region of the rat insulin receptor pre-mRNA indicated the presence of a virtual internal ribosome entry segment whereas the computer inspection of the 3' untranslated region localized various destabilizing sequences, including various AU-rich elements. We propose that through these virtual cis-regulatory sequences, 1,25-dihydroxyvitamin D 3 could control the translation and stability of insulin receptor mRNA species in the hind limb muscle and heart of diabetic rats.
The Journal of Steroid Biochemistry and Molecular Biology, 1999
The eect of aldosterone on insulin receptor (IR) expression was investigated in U-937 human promo... more The eect of aldosterone on insulin receptor (IR) expression was investigated in U-937 human promonocytic cells. The putative involvement of the mineralocorticoid receptor (MR) was also analysed. Aldosterone binding assays indicated the presence of MRs with high anity and limited capacity in these cells. RNA blot assays showed that aldosterone treatment decreased the levels of the two major IR mRNAs (11 and 8.5 kb) present in these cells in a dose-and time-dependent manner. The partial reversal of such a decrease by the mineralocorticoid antagonist spironolactone suggested that MR was involved in the process. Experiments with the RNA synthesis inhibitor actinomycin D indicated that the decrease in IR mRNA content in aldosterone-treated cells was not the result of transcript destabilisation. The inhibitory action of aldosterone was not prevented by the simultaneous presence of the protein synthesis inhibitor cycloheximide, suggesting that the reduction of IR gene expression occurs as a direct response to the action of aldosterone. Furthermore, insulin binding assays showed that aldosterone decreased IR capacity but did not alter receptor anity. In addition, the IR turnover resulted unaltered. These results provide the ®rst evidence for an in vitro modulation of human IR expression by aldosterone. #
The Journal of Steroid Biochemistry and Molecular Biology, 2005
This study was designed to explore the possible existence and location of estrogen response eleme... more This study was designed to explore the possible existence and location of estrogen response elements (EREs) in the human insulin receptor (hIR) gene promoter. Transfections of U-937 cells with the reported plasmids phIR(−1819)-GL2, phIR(−1473)-GL2, and phIR(−876)-GL2, that contain the −1819 to −271 bp fragment of the hIR promoter (wild-type promoter) and progressive 5 deletions of this promoter, revealed that while the activity of the wild-type promoter, was repressed 36% by treatment with 17-estradiol (E 2 ), the activities of progressive 5 deletions of this promoter were reduced by 26% and by 0%, by this hormone. This suggests that E 2 needs the wild-type promoter for full transcriptional repression of this gene and it also suggests the presence of putative EREs in the region between −1819/−877 bp of this promoter. To identify these EREs we performed a computer search, using the SEQFIND programme developed in our laboratory, by homology with the consensus vit-ERE (5 GGTCAnnnTGACC3 ) of the Xenopus vitellogenin A 2 gene promoter. The results of our search indicated no sequence identical to this consensus ERE, and neither was any sequence found to show 9 or 8 of the 10 bases of this consensus in this promoter. Nevertheless, a putative hIR ERE1 (5 AGTGAaacTGGCC3 ) showing 7 bases of the consensus vit-ERE, and 10 bases of the optimal binding sequence ERE (5 CA/GGGTCAnnnTGACCT/CG3 ), was identified between −1430/−1418 bp of the hIR promoter. An AP-1-like site was covering the 3 half-element of this ERE; another AP-1-like site was overlapping the first AP-1-like site, and finally a third AP-1-like site was located beside to the 5 half-element. In addition, another putative hIR ERE2 (5 GCTCCtagCAAAC3 ) showing 5 bases of the consensus vit-ERE, and 9 bases of the optimal binding sequence ERE, was located upstream of the hIR promoter, between −1567/−1555 bp. An AP-1-like site was located downstream of the 3 half-element of this ERE, and another AP-1-like site was beside the 5 half-element. EMSA analysis using nuclear extracts of E 2 -treated cells and natural sequences, including these putative EREs, indicated that ER -the only isoform expressed in U-937 cells -specifically recognized both EREs because ER-DNA complexes were efficiently competed by the corresponding unlabelled probe and supershifted by the anti-human ER (L-20) antibody. These data provide the first identification of EREs complexed with AP-1-like sites in the hIR promoter, which account for the transcriptional repression of the hIR gene mediated by ER in U-937 cells.
The Journal of Steroid Biochemistry and Molecular Biology, 2003
In earlier studies, we reported reduced human insulin receptor (hIR) mRNA levels, insulin binding... more In earlier studies, we reported reduced human insulin receptor (hIR) mRNA levels, insulin binding and insulin responsiveness in U-937 human promonocytic cells treated with aldosterone. The mechanism for this inhibition could be diminished IR gene transcription, since aldosterone did not affect hIR mRNA stability. All the effects were mediated by a downregulation of the mineralocorticoid receptor (MR, NR3C2) expressed at both the RNA and protein levels, suggesting that MR could act as a transcription factor that binds to hormone response elements in the hIR gene promoter. Indeed, MR has been shown to bind glucocorticoid response elements (GREs) in target genes. Given that five GREs have been characterized in the hIR promoter, we decided to test whether these elements could mediate the aldosterone-elicited inhibition of hIR expression detected by us in U-937 cells. In the present report, we demonstrate that aldosterone inhibits the activity of the hIR wild-type promoter by 23%, and causes 23 and 31% reductions in the activity of progressive deletions of this promoter comprised of fragments up to −1473 and −876 bp, respectively. This indicates that the −876 to −271 bp region of the hIR promoter may be sufficient for this transcriptional inhibition by aldosterone. We also provide evidence for direct MR interaction with some of the GREs of this promoter region, specifically with the cGRE1 and cGRE3, presumably as MR-MR homodimers, and with pGRE as a MR-GR heterodimer. This heterodimer may play the most relevant role and participate in the cross-talk between mineralocorticoids, glucocorticoids and insulin signalling in U-937 cells.
The Journal of Steroid Biochemistry and Molecular Biology, 2003
The present study was designed to explore the possible presence and location of Vitamin D respons... more The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the −1819 to −271 bp fragment of the hIR promoter (wild type promoter) and progressive 5 deletions of this promoter (up to −1473 and −876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (−1819)-GL2, phIR(−1473)-GL2 and phIR(−876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24 h with 10 −8 M 1,25-dihydroxyvitamin D 3 (1,25D 3 ). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5 deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from −876 to −271 bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D 3 . In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between −761 and −732 bp (5 CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3 ), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.
Somatostatin binding sites were characterized in isolated rat adipocytes. The binding was found t... more Somatostatin binding sites were characterized in isolated rat adipocytes. The binding was found to be saturable, reversible, and time-and temperature-dependent. The somatostatin binding sites are principally located on the cell surface. 12sI-[Tyr 1 t]somatostatin binding was not inhibited by glucagon and angiotensin II. By contrast, native somatostatin and somatostatin-28 displaced labeled peptide with a similar EDso: 50 nM. Scatchard analysis pointed to the existence of two classes of binding sites, with a Kd of 7.64 nM for the high-affinity sites and a Ka of 295 nM for the low-affinity ones. Comparison of somatostatin receptor binding and its lipolytic action in isolated rat adipocytes suggested that the spare receptor phenomenon cannot be applied to the lipolytic action of somatostatin in rat adipose tissue.
We studied insulin binding and action in adipocytes from female rats with chronic hyperprolactine... more We studied insulin binding and action in adipocytes from female rats with chronic hyperprolactinemia induced by grafting an anterior pituitary gland under the right kidney capsule. Normal basal insulin plasma levels were detected. An increase in insulin binding due to an increased number of receptors was observed (grafted:
The administration of 10(-5) M epinephrine transiently decreased insulin receptor (IR) mRNA level... more The administration of 10(-5) M epinephrine transiently decreased insulin receptor (IR) mRNA levels in U-937 human promonocytic cells, which reached their minimum value after 24 hours. Such a decrease seems to be due, at least in part, to a reduction in transcript stability, since the IR mRNA half-life was observed to decline from approximately 4h in untreated cells to 3 h in epinephrine-treated cells. Computer inspection of the sequence of the 3' untranslated region of the human IR mRNA showed nine AUUUA pentamers and three U-rich regions. These domains could be targets for a RNA-binding protein induced by treatment with epinephrine producing a destabilization of IR mRNA in U-937 cells.
In the present work we study the binding of insulin to its receptors in adipocytes from subcutane... more In the present work we study the binding of insulin to its receptors in adipocytes from subcutaneous adipose tissue of left hypochondria extracted during an adrenalectomy carried out in a patient with Conn's Syndrome (left adrenal adenoma), comparing it to insulin binding to its receptors in adipocytes from subcutaneous adipose tissue of right hypochondria, obtained during a cholecystectomy because of cholelithiasis (controls). According to our results, there is an evident decrease in insulin binding to its receptors in adipocytes of the patient with Conn's Syndrome in relation to control group. This decrease in binding would be based both in a decrease in insulin receptor number as in an affinity loss of these receptors for the hormone. These facts at the receptor level could be originating a decrease in tissue response to insulin and be the base for glucose intolerance observed in patients with this pathology.
The effects of an in vivo cortisol-treatment to rats (2 X 2 mg/rat/day, for one week) on insulin ... more The effects of an in vivo cortisol-treatment to rats (2 X 2 mg/rat/day, for one week) on insulin plasma levels, insulin binding and antilipolytic activity in rat adipose tissue were investigated. Hyperinsulinemia together with an increase in insulin degradation in the serum of cortisol-treated rats were observed. The adipocytes from cortisol-treated animals showed a statistically significant decrease in insulin binding but no change in receptor numbers [cortisol-treated 103,000 +/- 8,000 (n = 8) receptors/cell and controls 138,000 +/- 15,000 (n = 16) receptors/cell], together with unchanged receptor affinity [ED50: cortisol-treated 3 X 10(-9) M and controls 3.2 X 10(-9) M], and a decreased sensitivity to the antilipolytic effect of insulin. The evidence presented for pre-receptor, receptor and post-receptor insulin defects on the action of cortisol in isolated rat adipocytes could represent a coordinated mechanism by which cortisol exerts "insulin resistance" in this tissue.
The relationship among plasma insulin disappearance, insulin binding to specific receptors in fat... more The relationship among plasma insulin disappearance, insulin binding to specific receptors in fat cells and antilipolytic insulin activity in streptozotocin-diabetic rats has been studied. Male Wistar rats were injected streptozotocin (65 mg/kg body weight) or saline by cardiac puncture. Decreased insulin levels and increased insulin degradation together with an increase in insulin binding were found in diabetic rats. The increase in insulin binding was related to an increase in the number of insulin receptors rather than to a change in receptor affinity. These findings at the pre-receptor and receptor levels could be correlated with an increase in antilipolytic insulin activity. However our results suggest that the mechanism for insulin action occurred through a potentiation of the norepinephrine lipolytic activity.
In this paper, the preliminary results regarding the alterations of the biological action mechani... more In this paper, the preliminary results regarding the alterations of the biological action mechanism of insulin in several types of pathological accumulations of fat, i.e. lipomas, Madelung's Lipomatosis and liposarcoma, are presented. The results indicate significant alterations both at the insulin receptor and post-receptor levels, with reduced biological activity of this hormone, which could have and inductive role in the pathogenesis of such entities.
Male Wistar rats with chronic hyperprolactinemia induced by grafting an anterior pituitary gland ... more Male Wistar rats with chronic hyperprolactinemia induced by grafting an anterior pituitary gland under the right kidney capsule were studied as experimental model. In these animals basal plasma glucose and insulin levels were unaltered. Epididymal adipocytes from hyperprolactinemic rats showed a significant increase in insulin binding at low unlabeled insulin concentrations. This increase in insulin binding can be principally attributed to an increase in the high affinity-low capacity binding sites, as demonstrated when Scatchard analysis was interpreted in terms of two types of insulin receptors. The dissociation constants (KD1 and KD2) were not different between the groups. The apparent insulin receptor affinity was also unchanged. Moreover, a decreased sensitivity to the antilipolytic effect of insulin was also obtained in adipocytes from hyperprolactinemic rats. These findings indicate that chronic hyperprolactinemia is able to increase high affinity insulin receptors in epididymal adipocytes, but tends to diminish the antilipolytic response, suggesting a lack of coupling between insulin binding and its biological activity in male adipose tissue. Several possible mechanisms involved in the process are suggested.
Treatment of U-937 human promonocytic cells with the cAMP increasing agents isoproterenol plus th... more Treatment of U-937 human promonocytic cells with the cAMP increasing agents isoproterenol plus theophylline decreased the basal level of heat-shock protein 70 (HSP70) mRNA. In addition, the cAMP increasing agents attenuated the increase in HSP70 mRNA and protein levels produced by cadmium chloride in U-937 and other human myeloid cell lines, reduced the capacity of cadmium treatment to generate stress-tolerance, and attenuated the cadmium-produced stimulation of heat-shock factor (HSF) binding activity. By contrast, isoproterenol plus theophylline failed to attenuate the stimulation of HSP70 gene expression and HSF binding activity caused by heat-shock. Isoproterenol plus theophylline did not prevent the uptake of cadmium into the cells, and increased to a similar extent the intracellular cAMP levels in cadmium- and heat-treated cells. The cAMP increasing agents reduced the induction by cadmium of the HSP27 stress gene, but failed to attenuate other cadmium-elicited stress reactions...
Evidence for pre-receptor, receptor and post-receptor glucagon defects was investigated in adipoc... more Evidence for pre-receptor, receptor and post-receptor glucagon defects was investigated in adipocytes from streptozotocin-diabetic rats. For this purpose male Wistar rats were injected by cardiac puncture with streptozotocin (65 mg/Kg body-weight) or saline solution and sacrificed after 7 and 15 days of drug administration. Increased glucagon levels and increased glucagon degradation in serum together with a decrease in glucagon binding were found in both groups of diabetic rats. The decrease in glucagon binding was related to a decrease in the number of glucagon receptors/cell rather than to a change in receptor affinity. The lipolytic response of glucagon was increased. However, the ability of glucagon to increase basal or theophylline-stimulated cAMP accumulation in the incubation medium of adipocytes from diabetic rats was decreased. Such alterations could represent a counter-regulatory mechanism of the hyperglucagonemia detected in streptozotocin-diabetic rats.
The simultaneous administration of the DNA topoisomerase II inhibitor etoposide (0.15 mM) and 1,2... more The simultaneous administration of the DNA topoisomerase II inhibitor etoposide (0.15 mM) and 1,25-dihydroxyvitamin D3 (VD3) (10 nM) synergistically induced the differentiation of HL-60 human promyelocytic leukemia cells. Similar results were obtained using U-937 human promonocytic cells, or the topoisomerase II inhibitors doxorubicin (15 nM) and mitoxantrone (2.5 nM). When sequential treatments were used, pre-incubation with VD3 had little effect on the subsequent action of etoposide, while pre-incubation with etoposide greatly potentiated the subsequent action of VD3. In addition, etoposide treatment stimulated VD3 binding activity and increased VD3 receptor mRNA and protein levels. The increase in hormone receptor expression may explain, at least in part, the capacity of topoisomerase inhibitors to potentiate the differentiation inducing activity of VD3.
Insulin receptor (IR) gene expression at the mRNA level was investigated in hindlimb skeletal mus... more Insulin receptor (IR) gene expression at the mRNA level was investigated in hindlimb skeletal muscle, epididymal adipose tissue and in the liver of rats exposed to prolonged in vivo administration of deoxycorticosterone acetate (DOCA). Following treatment, plasma insulin levels were reduced while glucose levels increased compared to values in control rats. DOCA-treated animals showed an increase in blood pressure and a reduction in body weight. This treatment also induced hypokalemia and decreased plasma protein levels. Sodium levels were unaffected. Moreover, no differences in DNA and protein content or in the indicator of cell size (protein/DNA) were observed in the skeletal muscle or adipose tissue of animals. In contrast, there was a clear increase in the protein and DNA contents of the liver with no change in the indicator of cell size. Northern blot assays revealed 2 major IR mRNA species of approximately 9.5 and 7.5 Kb in the 3 tissues from control animals. DOCA treatment ind...
Insulin receptor (IR) gene expression at the mRNA level was investigated in liver, hindlimb skele... more Insulin receptor (IR) gene expression at the mRNA level was investigated in liver, hindlimb skeletal muscle, and epididymal adipose tissue of rats exposed to prolonged in vivo administration of adrenaline in relation to control rats. In the liver of adrenaline-treated rats, there were no differences in relation to controls when DNA and protein content were measured. In skeletal muscle, only a slight decrease in protein concentration was detected. By contrast, a clear increase in both protein and DNA content was observed in the adipose tissue of treated animals. Northern blot assays revealed two IR mRNA species of approximately 9.5 and 7.5 Kb in the three tissues from controls. Adrenaline treatment induced an increase of approximately 60% in the levels of both RNAs in adipose tissue but not in liver or skeletal muscle. These results provide evidence for an in vivo tissue-specific regulation of IR gene expression at the mRNA level in rats under an experimental condition of excess of c...
Male Wistar rats of the third generation of rats drinking 200 micrograms Ni2+/mL as NiCl2 in thei... more Male Wistar rats of the third generation of rats drinking 200 micrograms Ni2+/mL as NiCl2 in their drinking water were studied. Basal plasma glucose and insulin levels were unchanged. Epididymal adipocytes from Ni2(+)-fed rats showed an increased insulin binding with a slight increase in apparent insulin affinity (ED50: Ni2(+)-fed rats 2.8 x 10(-9) M and controls 5 x 10(-9) M) with no change in insulin receptor numbers (Ni2(+)-fed rats 143,000 +/- 12,000 (6) receptors/cell and controls 126,000 +/- 13,000 (5]. Moreover, a decreased sensitivity to the antilipolytic response of insulin was also observed in adipocytes from Ni2(+)-fed rats. These events could represent actions of Ni2+ both at the receptor and post-receptor insulin levels. Several possible mechanisms involved in the process are suggested.
In the present study, we examine the effects of the treatment with 1,25-dihydroxyvitamin D 3 [150... more In the present study, we examine the effects of the treatment with 1,25-dihydroxyvitamin D 3 [150 IU/Kg (3.75 µg/Kg) once a day, for 15 days] to non-diabetic and streptozotocin-induced diabetic rats. The results indicate that treatment with 1,25-dihydroxyvitamin D 3 had minor effects in non-diabetic rats. The same treatment in streptozotocin-induced diabetic rats, although it did not correct the hyperglycemia and hypoinsulinemia induced by the diabetes, caused other actions that could mean beneficial effects on the amelioration of diabetes e.g., it avoided body weight loss, increased calcium and phosphorus plasma levels, and corrected the over-expression of the insulin receptor mRNA species of 9.5 and 7.5 Kb present in the hind limb muscle and heart of these animals. These genomic 1,25-dihydroxyvitamin D 3 effects could involve transcriptional mechanisms of repression mediated by vitamin D response elements in the rat insulin receptor gene promoter. Using computer analysis of this promoter, we propose the −249/−235 bp VDRE (5'GGGTGACCCGGGGTT3') with a pyrimidine (T) in the (+7) position of the 3' half-site as the best candidate for negative control by 1,25-dihydroxyvitamin D 3 . In addition, posttranscriptional mechanisms of regulation could also be implicated. Thus, computer inspection of the 5' untranslated region of the rat insulin receptor pre-mRNA indicated the presence of a virtual internal ribosome entry segment whereas the computer inspection of the 3' untranslated region localized various destabilizing sequences, including various AU-rich elements. We propose that through these virtual cis-regulatory sequences, 1,25-dihydroxyvitamin D 3 could control the translation and stability of insulin receptor mRNA species in the hind limb muscle and heart of diabetic rats.
The Journal of Steroid Biochemistry and Molecular Biology, 1999
The eect of aldosterone on insulin receptor (IR) expression was investigated in U-937 human promo... more The eect of aldosterone on insulin receptor (IR) expression was investigated in U-937 human promonocytic cells. The putative involvement of the mineralocorticoid receptor (MR) was also analysed. Aldosterone binding assays indicated the presence of MRs with high anity and limited capacity in these cells. RNA blot assays showed that aldosterone treatment decreased the levels of the two major IR mRNAs (11 and 8.5 kb) present in these cells in a dose-and time-dependent manner. The partial reversal of such a decrease by the mineralocorticoid antagonist spironolactone suggested that MR was involved in the process. Experiments with the RNA synthesis inhibitor actinomycin D indicated that the decrease in IR mRNA content in aldosterone-treated cells was not the result of transcript destabilisation. The inhibitory action of aldosterone was not prevented by the simultaneous presence of the protein synthesis inhibitor cycloheximide, suggesting that the reduction of IR gene expression occurs as a direct response to the action of aldosterone. Furthermore, insulin binding assays showed that aldosterone decreased IR capacity but did not alter receptor anity. In addition, the IR turnover resulted unaltered. These results provide the ®rst evidence for an in vitro modulation of human IR expression by aldosterone. #
The Journal of Steroid Biochemistry and Molecular Biology, 2005
This study was designed to explore the possible existence and location of estrogen response eleme... more This study was designed to explore the possible existence and location of estrogen response elements (EREs) in the human insulin receptor (hIR) gene promoter. Transfections of U-937 cells with the reported plasmids phIR(−1819)-GL2, phIR(−1473)-GL2, and phIR(−876)-GL2, that contain the −1819 to −271 bp fragment of the hIR promoter (wild-type promoter) and progressive 5 deletions of this promoter, revealed that while the activity of the wild-type promoter, was repressed 36% by treatment with 17-estradiol (E 2 ), the activities of progressive 5 deletions of this promoter were reduced by 26% and by 0%, by this hormone. This suggests that E 2 needs the wild-type promoter for full transcriptional repression of this gene and it also suggests the presence of putative EREs in the region between −1819/−877 bp of this promoter. To identify these EREs we performed a computer search, using the SEQFIND programme developed in our laboratory, by homology with the consensus vit-ERE (5 GGTCAnnnTGACC3 ) of the Xenopus vitellogenin A 2 gene promoter. The results of our search indicated no sequence identical to this consensus ERE, and neither was any sequence found to show 9 or 8 of the 10 bases of this consensus in this promoter. Nevertheless, a putative hIR ERE1 (5 AGTGAaacTGGCC3 ) showing 7 bases of the consensus vit-ERE, and 10 bases of the optimal binding sequence ERE (5 CA/GGGTCAnnnTGACCT/CG3 ), was identified between −1430/−1418 bp of the hIR promoter. An AP-1-like site was covering the 3 half-element of this ERE; another AP-1-like site was overlapping the first AP-1-like site, and finally a third AP-1-like site was located beside to the 5 half-element. In addition, another putative hIR ERE2 (5 GCTCCtagCAAAC3 ) showing 5 bases of the consensus vit-ERE, and 9 bases of the optimal binding sequence ERE, was located upstream of the hIR promoter, between −1567/−1555 bp. An AP-1-like site was located downstream of the 3 half-element of this ERE, and another AP-1-like site was beside the 5 half-element. EMSA analysis using nuclear extracts of E 2 -treated cells and natural sequences, including these putative EREs, indicated that ER -the only isoform expressed in U-937 cells -specifically recognized both EREs because ER-DNA complexes were efficiently competed by the corresponding unlabelled probe and supershifted by the anti-human ER (L-20) antibody. These data provide the first identification of EREs complexed with AP-1-like sites in the hIR promoter, which account for the transcriptional repression of the hIR gene mediated by ER in U-937 cells.
The Journal of Steroid Biochemistry and Molecular Biology, 2003
In earlier studies, we reported reduced human insulin receptor (hIR) mRNA levels, insulin binding... more In earlier studies, we reported reduced human insulin receptor (hIR) mRNA levels, insulin binding and insulin responsiveness in U-937 human promonocytic cells treated with aldosterone. The mechanism for this inhibition could be diminished IR gene transcription, since aldosterone did not affect hIR mRNA stability. All the effects were mediated by a downregulation of the mineralocorticoid receptor (MR, NR3C2) expressed at both the RNA and protein levels, suggesting that MR could act as a transcription factor that binds to hormone response elements in the hIR gene promoter. Indeed, MR has been shown to bind glucocorticoid response elements (GREs) in target genes. Given that five GREs have been characterized in the hIR promoter, we decided to test whether these elements could mediate the aldosterone-elicited inhibition of hIR expression detected by us in U-937 cells. In the present report, we demonstrate that aldosterone inhibits the activity of the hIR wild-type promoter by 23%, and causes 23 and 31% reductions in the activity of progressive deletions of this promoter comprised of fragments up to −1473 and −876 bp, respectively. This indicates that the −876 to −271 bp region of the hIR promoter may be sufficient for this transcriptional inhibition by aldosterone. We also provide evidence for direct MR interaction with some of the GREs of this promoter region, specifically with the cGRE1 and cGRE3, presumably as MR-MR homodimers, and with pGRE as a MR-GR heterodimer. This heterodimer may play the most relevant role and participate in the cross-talk between mineralocorticoids, glucocorticoids and insulin signalling in U-937 cells.
The Journal of Steroid Biochemistry and Molecular Biology, 2003
The present study was designed to explore the possible presence and location of Vitamin D respons... more The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the −1819 to −271 bp fragment of the hIR promoter (wild type promoter) and progressive 5 deletions of this promoter (up to −1473 and −876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (−1819)-GL2, phIR(−1473)-GL2 and phIR(−876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24 h with 10 −8 M 1,25-dihydroxyvitamin D 3 (1,25D 3 ). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5 deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from −876 to −271 bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D 3 . In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between −761 and −732 bp (5 CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3 ), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.
Somatostatin binding sites were characterized in isolated rat adipocytes. The binding was found t... more Somatostatin binding sites were characterized in isolated rat adipocytes. The binding was found to be saturable, reversible, and time-and temperature-dependent. The somatostatin binding sites are principally located on the cell surface. 12sI-[Tyr 1 t]somatostatin binding was not inhibited by glucagon and angiotensin II. By contrast, native somatostatin and somatostatin-28 displaced labeled peptide with a similar EDso: 50 nM. Scatchard analysis pointed to the existence of two classes of binding sites, with a Kd of 7.64 nM for the high-affinity sites and a Ka of 295 nM for the low-affinity ones. Comparison of somatostatin receptor binding and its lipolytic action in isolated rat adipocytes suggested that the spare receptor phenomenon cannot be applied to the lipolytic action of somatostatin in rat adipose tissue.
We studied insulin binding and action in adipocytes from female rats with chronic hyperprolactine... more We studied insulin binding and action in adipocytes from female rats with chronic hyperprolactinemia induced by grafting an anterior pituitary gland under the right kidney capsule. Normal basal insulin plasma levels were detected. An increase in insulin binding due to an increased number of receptors was observed (grafted:
Uploads
Papers by Consuelo Calle