Skip to content
zzhen edited this page May 17, 2023 · 4 revisions

Welcome to the Easy353 wiki!

Introduction

Easy353 is a tool specifically designed to recover the Angiosperms353 gene set (AGS). In fact, Easy353 can recover not only AGS but also user-specified target genes (e.g., chloroplast genes, ITS). Easy353 can effectively filter target-related reads from sequencing reads, and accurately recover target genes using its optimized reference-guided assembler.

The Angiosperms353 gene set (AGS) is a universal low-copy protein-coding nuclear gene set across all angiosperm plants for phylogeny reconstruction[1], which can provide phylogenetic information at multiple scales and has promising applications.

image-20230427223819794

The figure illustrates the Easy353 takes the sequencing reads of species X and a set of reference sequences (orthologous genes from other speices) as input, and outputs the target genes of species x.

To run Easy353, two inputs are required:

(1) sequencing reads in FASTQ format and (2) a set of reference sequences, i.e. AGS.

Reads Files (Sequencing Reads)

Easy353 can assemble any next-generation sequencing (NGS) reads provided in the FASTQ format. Both paired and unpaired reads are accepted as input. Compressed files (.gz) can also be used as input files.

@ST-E00600:58:HKYNGALXX:1:1101:1434:1000 1:N:0:GAGTTCGA
ATTGGGCACGACACGAAACGAAATTTTTGTTAACAGGAATTTAGAAGTAGATATTCAAGTTATGGTTGGTTATTAAGGTTATCTTATCAAAAGATAGAGCAAGATGGTTATGCTTTTTAAGGCTAAGGAAAATGTCAGCATCTACTTCAT
+
AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJ7JJJJJJJJJJJJJJJJJJJJJJJJ7JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ77JJJJJ7J7JJJ7JJJJJJJJ7JJJJJJ7JJJJJJJJJJJ-JJJJJJ-JJJJJ-J7-JJ

Reference Files (Reference Sequences)

Reference files are FASTA-formatted text files containing a set of reference sequences, which are orthologous genes from species closely related to the target species. When the target genes are Angiosperms353 genes, the references sequences could be

downloaded from Kew Tree of Life Explorer[2] and generated by the script build_database.oy. If you want to recover a specific target gene, you should manually create a reference file in the following format:

>Aphanopleura_breviseta
GTTGGTGTATTAGTATGTGAAGCAGGATGCGTATTGGAAAACTTAATTTCTTTCCTAGACAATGAAGGGTATTTTATAATGCCGTTAGACCTAGGTGCAAAAGGTAGCTGTCAGATTGGTGGAAATGTTTCTACAAATGCTGGGGGTTTGCGTTTGGTCCGTTATGGATCGCTTCATGGAAATGTACTTGGTCTTTACACTGATCTTTCAGATGGTAC
>Scaligeria_napiformis
ATCGGTGTATTAGTATGTGAAGCAGGATGCGTATTGGAAAACTTGATTTCTTTCCTAGACAACGAAGGGTTTATAATGCCGTTAGACCTAGGTGCGAAAGGTAGCTGTCAGATTGGTGGAAATGTTTCAACAAATGCTGGGGGTTTGCGGTTGGTCCGTTATGGATCACTTCATGGAAATGTACTAGGTCTTGAAGCTGTTTTAGCAGATGGTACCGT
>Hymenolaena_sp.
GTTGGTGTTTTGGTATGTGAAGCAGGATGCGTATTGGAAAACTTGATGTCTTTCCTAGATAATGAAGGGTTCATAATGCCGTTGGACCTAGGTGCAAAAGGTAGCTGTCAGATTGGTGGAAATGTTTCAACAAATGCTGGGGGTTTGCGGTTGGTACGATATGGATCACTTCATGGGAATGTACTCGCTCTGGAAACTGTTTTAGCAAATGGGACCGT
>Daucus_carota
ATGCCGTTAGACTTAGGTGCAAAAGGTAGCTGTCAGATTGGTGGAAATATTTCAACAAATGCTGGGGGTTTGCGGTTGGTCCGTTATGGATCACTGCATGGAACTGTGCTCGGTCTGGAAGCTGTTTTAGCTGATGGTACCATTCTTGACATGCTTGGAACTTTACGAAAAGATAATACGGGATATGACCTGAAGCACTTGTTTATAGGAAGTGAGGG

To efficiently recover multiple genes, you can store several reference files within a single directory, streamlining the bulk extraction process for target genes.

[1] Johnson MG, Pokorny L, Dodsworth S, Botigue LR, Cowan RS, Devault A, Eiserhardt WL, Epitawalage N, Forest F, Kim JT. 2019. A universal probe set for targeted sequencing of 353 nuclear genes from any flowering plant designed using k-medoids clustering. Syst Biol. 68:594-606.

[2] Baker WJ, Bailey P, Barber V, Barker A, Bellot S, Bishop D, Botigué LR, Brewer G, Carruthers T, Clarkson JJ, et al. 2021. A Comprehensive Phylogenomic Platform for Exploring the Angiosperm Tree of Life. Syst Biol. 71:301-319.

Clone this wiki locally