A pre-trained transformer model for inference on insect DNA barcoding data.
Check out our paper
from transformers import AutoTokenizer, AutoModel
# Load the tokenizer
tokenizer = AutoTokenizer.from_pretrained(
"bioscan-ml/BarcodeBERT", trust_remote_code=True
)
# Load the model
model = AutoModel.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
# Sample sequence
dna_seq = "ACGCGCTGACGCATCAGCATACGA"
# Tokenize
input_seq = tokenizer(dna_seq, return_tensors="pt")["input_ids"]
# Pass through the model
output = model(input_seq.unsqueeze(0))["hidden_states"][-1]
# Compute Global Average Pooling
features = output.mean(1)- Clone this repository and install the required libraries by running
pip install -e .- Download the data from our Hugging Face Dataset repository
cd data/
python download_HF_CanInv.pyOptional: You can also download the first version of the data
wget https://vault.cs.uwaterloo.ca/s/x7gXQKnmRX3GAZm/download -O data.zip
unzip data.zip
mv new_data/* data/
rm -r new_data
rm data.zip- DNA foundation model baselines: The desired backbone can be selected using one of the following keywords:
BarcodeBERT, NT, Hyena_DNA, DNABERT, DNABERT-2, DNABERT-S
python baselines/knn_probing.py --backbone=<DESIRED-BACKBONE> --data-dir=data/
python baselines/linear_probing.py --backbone=<DESIRED-BACKBONE> --data-dir=data/
python baselines/finetuning.py --backbone=<DESIRED-BACKBONE> --data-dir=data/ --batch_size=32
python baselines/zsc.py --backbone=<DESIRED-BACKBONE> --data-dir=data/Note: The DNABERT model has to be downloaded manually following the instructions in the paper's repo and placed in the pretrained-models folder.
- Supervised CNN
python baselines/cnn/1D_CNN_supervised.py
python baselines/cnn/1D_CNN_KNN.py
python baselines/cnn/1D_CNN_Linear_probing.py
python baselines/cnn/1D_CNN_ZSC.py
Note: Train the CNN backbone with 1D_CNN_supervised.py before evaluating it on any downtream task.
- BLAST
cd data/
python to_fasta.py --input_file=supervised_train.csv &&
python to_fasta.py --input_file=supervised_test.csv &&
python to_fasta.py --input_file=unseen.csv
makeblastdb -in supervised_train.fas -title train -dbtype nucl -out train.fas
blastn -query supervised_test.fas -db train.fas -out results_supervised_test.tsv -outfmt 6 -num_threads 16
blastn -query unseen.fas -db train.fas -out results_unseen.tsv -outfmt 6 -num_threads 16To pretrain the model you can run the following command:
python barcodebert/pretraining.py
--dataset=CANADA-1.5M \
--k_mer=4 \
--n_layers=4 \
--n_heads=4 \
--data_dir=data/ \
--checkpoint=model_checkpoints/CANADA-1.5M/4_4_4/checkpoint_pretraining.ptIf you find BarcodeBERT useful in your research please consider citing:
@article{arias2023barcodebert,
title={{BarcodeBERT}: Transformers for Biodiversity Analysis},
author={Pablo Millan Arias
and Niousha Sadjadi
and Monireh Safari
and ZeMing Gong
and Austin T. Wang
and Joakim Bruslund Haurum
and Iuliia Zarubiieva
and Dirk Steinke
and Lila Kari
and Angel X. Chang
and Scott C. Lowe
and Graham W. Taylor
},
journal={arXiv preprint arXiv:2311.02401},
year={2023},
eprint={2311.02401},
archivePrefix={arXiv},
primaryClass={cs.LG},
doi={10.48550/arxiv.2311.02401},
}