what is strobemer? see https://github.com/ksahlin/strobemers
- this project implement an c++ version of the strobemer s(n,k,w_min,w_max) with small difference (the window will not shrink at the end of sequence).
Features:
- any n>1 is supported.
- randstrobes is supported.
- minstrobes is supported.
- hybirdstrobes is supported.
- there small benchmark were attached. (Ignore them if you don't care)
-
first copy strobemer.h and strobemer.cpp into your project.
-
then write your code like :
#include "strobemer.h"
int main() {
char seq[101]="ATGGGCAGAGTTTGACGTAGTCAATGCTTATGAACGAACGCTCCAATATGAATCAGCTCGTGATTTTTGCTGTAAAAATCGTAGCATACTGTTTGATAAA";
//strobemer::init(3,13,13,20,strobemer_type::minstrobe); // n=3,k=13,w_min=13,w_max=20,type=minstrobe
//strobemer::init(3,13,13,21,strobemer_type::hybridstrobe); // n=3,k=13,w_min=13,w_max=20,type=hybridstrobe
strobemer::init(3,13,13,20,strobemer_type::randstrobe); // n=3,k=13,w_min=13,w_max=20,type=randstrobe
int number = 100-strobemer::strobmer_span()+1;
strobemer * buff = new strobemer[number];
strobemer::chop_strobemer(seq,100,buff);
for(int i = 0 ; i< number ; i++ ){
if(buff[i].valid)
std::cout<<buff[i].to_string()<<'\n'; // or do whatever you want ...
}
delete [] buff;
return 0;
}
then compile and link it like:
g++ -std=c++11 -c strobemer.cpp -o strobemer.o
g++ -std=c++11 example.cpp strobemer.o -o example
- random sequence with length=100,000 nt.
- mutation rates are 0.01, 0.05 and 0.1.
- random mutaion.
- equal probability of sub/ins/del.
- each test run 100 times.
- compare the match number of all kmer/strobemer.
- compare k30, randstrobe(2,15,50) and minstrobe(2,15,50).
Results of the "average match of all kmers/strobemers (%) " for different error rates and different methods:
| 0.01 | 0.05 | 0.1 | |
|---|---|---|---|
| Kmer(30) | 74.6 | 22.5 | 4.7 |
| minstrobe(2,15,15,50) | 70.1 | 17.5 | 3.2 |
| randstrobe(2,15,15,50) | 70.1 | 17.5 | 3.2 |
- compare the match number of all kmer/strobemer snp markers.
- assign one snp for each 1000bp ( total 99 snps for 100,000bp because I drop the snp at the sequence end ).
- compare k30, randstrobe(2,15,50) and minstrobe(2,15,50).
- for k30, one snp generate 30 kmer markers.
- for strobemer(2,15,50), each snp generate 65 strobemer markers.
Results of the "average match number of all snp markers" for different error rates and different methods:
| 0.01 | 0.05 | 0.1 | |
|---|---|---|---|
| Kmer(30) | 2210 | 665 | 143 |
| minstrobe(2,15,15,50) | 4511 | 1100 | 208 |
| randstrobe(2,15,15,50) | 4502 | 1134 | 210 |
Results of the "#detected snp " for different error rates and different methods:
| 0.01 | 0.05 | 0.1 | |
|---|---|---|---|
| Kmer(30) | 94.5 | 55.5 | 18 |
| minstrobe(2,15,15,50) | 98 | 68.5 | 26.3 |
| randstrobe(2,15,15,50) | 99 | 92.3 | 52.3 |
- compare the match number of all kmer/strobemer snp markers.
- assign one snp for each 1000bp ( total 99 snps for 100,000bp because I drop the snp at the sequence end ).
- compare k20, k40, randstrobe(2,10,30) and minstrobe(2,10,30).
- for K20, one snp generate 20 kmer markers.
- for K40, one snp generate 40 kmer markers.
- for strobemer(2,10,30), each snp generate 40 strobemer markers.
Results of the "average match number of all snp markers" for different error rates and different methods:
| 0.01 | 0.05 | 0.1 | |
|---|---|---|---|
| Kmer(20) | 1631.5 | 748.93 | 260.72 |
| Kmer(40) | 2682.38 | 540.22 | 62.83 |
| minstrobe(2,10,10,30) | 3171.38 | 1296.55 | 411.71 |
| randstrobe(2,10,10,30) | 3164.28 | 1292.72 | 417.33 |
Results of the "#detected snp " for different error rates and different methods:
| 0.01 | 0.05 | 0.1 | |
|---|---|---|---|
| Kmer(20) | 96.79 | 71.05 | 37.79 |
| Kmer(40) | 92.81 | 39.98 | 8.01 |
| minstrobe(2,10,10,30) | 98.54 | 85.05 | 51.82 |
| randstrobe(2,10,10,30) | 98.99 | 95.24 | 73.39 |
Enjoy ~~