THÈSE

En vue de l'obtention du

DOCTORAT DE L’UNIVERSITÉ DE TOULOUSE

Délivré par l’Université Toulouse III – Paul Sabatier

Discipline ou spécialité : Physiopathologie Humaine

Présentée et soutenue par Fanny Coudane

Le 18 décembre 2009

Titre : Fonction et régulation des peptidyl-arginine désiminases

dans l’épiderme et au cours de la cicatrisation cutanée

JURY

Marek Haftek
Jean-Pierre Molès
Carle Paul
Guy Serre
Michel Simon

Ecole doctorale : Biologie Santé Biotechnologies

Unité de recherche : UDEAR UMR 5165
Directeur(s) de Thèse : Michel Simon
Rapporteurs : Marek Haftek, Laurent Misery et Jean-Pierre Molès
Remerciements

Je remercie le Professeur Guy Serre de m’avoir accueillie dans « l’Unité de Différenciation

Epidermique et Auto-immunité Rhumatoïde » et de m’avoir permis de réaliser cette thèse dans les
meilleures conditions.

J’adresse mes remerciements à Laurent Misery, Jean-Pierre Molès et Marek Haftek de me faire
l’honneur d’évaluer ces travaux. Merci d’avoir accepté la lourde tâche d’êtres rapporteurs de ce
manuscrit.
Merci également au Pr Carle Paul d’avoir accepté de participer au jury de cette thèse malgré un emploi
du temps chargé.

Merci à mon directeur de thèse, Michel Simon d’avoir encadré ce travail et de m’avoir fait confiance
durant ces années.

Je tiens à remercier tout particulièrement mon autre main, Carole Goldfinger Pons, pour sa gentillesse
et son soutien inébranlable, et le fait qu’elle soit la seule personne au monde à être capable de
déchiffrer un protocole sur un post-it.

Je veux adresser tous mes remerciements à Marie-Claire Méchin pour sa collaboration et son
investissement constant concernant mon travail.

Je tiens à exprimer ma profonde gratitude à toutes les «ex- Michelettes » d’avoir toujours été là pour
moi.
Merci à Cécile Caubet, Cissou, pour ton écoute, tes conseils et tes encouragements permanents, avoir
partagé un bureau avec toi était plus qu’un privilège. Merci à Anne-Aurélie Raymond, Taikonmi, pour
tes repas du jeudi soir et ton ouverture d’esprit. Grâce à toi je sais qu’un simple battement d’aile de
papillon peut effectivement…dévier une autoroute. Je remercie de tout cœur Véronique Adoue,
colgate powerful vé, pour toutes nos conversations pleines de sensiblerie et pour ta patience hors du
commun. Merci à Rachida Nachat, Rachichi, pour ton sens de l’humour et ta franchise, je te souhaite
le meilleur pour la suite, et j’espère que ce sera sous la forme d’une jolie petite rouquine.

Un grand merci aux autres membres de l’équipe et tout spécialement à Julie Henry, youyou, mon
deuxième cerveau, pour toutes tes (nombreuses) blagues qui me font encore rire, et pour ton
extraordinaire sérénité lors de ma rédaction. Merci également à Catherine Bouchouata, Cathy, pour
m’avoir toujours aidé quand j’en avais besoin, et à Chiung-Yueh Hsu, Chouchou, pour ta gentillesse et
pour m’avoir fait saliver tous les midis.
Je tiens à exprimer ma reconnaissance à Anne Huchenq-Champagne, pour m’avoir initié et aidé,
toujours avec le sourire, à comprendre le monde merveilleux mais quelque peu compliqué de
l’animalerie.

Merci aux suivantes, qui vont passer, j’en suis sûre, des thèses d’exception. A commencer par Leïla
Gazeilles, merci pour ton franc parlé et ton sourire au quotidien, merci à Laetitia Laurent et son
« ami » Nicolas Mattiuzzo, en continuant d’espérer qu’ils se rejoindront prochainement. J’adresse des
remerciements particuliers à Emilie Leclerc pour ta prévenance et ton soutien sans faille, et pour avoir
toujours pu compter sur toi, y compris dans les moments de panique totale. Maintenant je peux enfin
vous dire à toutes, la phrase préférée de tout doctorant : « courage c’est la dernière ligne droite ! ».

Merci aux membres des autres équipes qui ont participé de près ou de loin à ce travail, en particulier
Mireille Sebbag, pour tes encouragements et tes remarques précieuses.

Je tiens aussi à mentionner le plaisir que j'ai eu à travailler au sein de l’UDEAR, je ne peux hélas pas
citer tous les membres du laboratoire mais merci à tous de m’avoir accompagnée, encouragée, aidée et
soutenue durant ces années.

Je remercie également mes amis qui ont été d’une patience exceptionnelle, et qui ont relativement bien
dissimulé leur incompréhension (« Mais qu’elle idée ! », « Dis donc c’est long une thèse »). Une
pensée particulière pour Céline, Nico, Sophie, les Tarbais et Franchon, Asca et les Youpettes. Merci à
Julia, choup, copine de galère et de bière au Champagne.
Merci au Marin breton gardois Brieuc, pour ton scooter, ton soutien, les mois passés et ceux à venir,
en plus, grâce à toi je peux répondre « oui » à la question « est-il possible de faire une thèse et de
garder un semblant de vie sociale ?»

Merci à tous ceux qui ont bravé les éléments déchaînés pour venir m’écouter

Je dédie cette thèse à toute mon extraordinaire famille, en particulier à mes parents et mon frère. Et je
termine par une pensée pour ma grand-mère.
 Résumé

Fonction et régulation des peptidyl-arginine désiminases dans l’épiderme et au cours de la cicatrisation

cutanée

Les peptidyl-arginine désiminases (PADs) catalysent une modification post-traductionnelle appelée désimination
ou citrullination, qui correspond à la transformation des résidus arginyl en résidus citrullyl. Leur rôle
physiologique est encore mal compris mais elles sont associées à de nombreux mécanismes pathologiques. Par
exemple, la citrullination de la fibrine est observée au cours de nombreux processus inflammatoires. Dans
l’épiderme, trois isoformes de PADs sont exprimées, les PAD1, 2 et 3. Leur expression et leur activation
dépendent étroitement de l’état de différenciation des kératinocytes. La désimination de la filaggrine par les PAD1
et 3 est une étape majeure du métabolisme de cette protéine clé pour les fonctions de barrière épidermique, alors
que le rôle de la PAD2 n’est pas connu.
Pour étudier les mécanismes responsables de la régulation des PADs, nous avons utilisé deux modèles d’induction
de la différenciation des kératinocytes en culture. Nous avons ainsi mis en évidence une régulation post-
transcriptionnelle. En effet, la stimulation de l’expression des ARNm des PAD1-3 par la Vitamine D n’est pas
suffisante pour induire les protéines correspondantes. Au contraire, l’augmentation de la densité cellulaire induit
l’expression des gènes PADI1 et 3, les PAD1 et 3 et le taux de désimination. De plus, nous avons observé que les
PAD1-3 sont capables d’auto-désimination in vitro et que celle-ci réduit leur activité. Une approche in silico, à
partir de modèles tridimensionnels, nous a permis de montrer que l’auto-désimination de la PAD3 induit des
changements structuraux susceptibles d’expliquer cette réduction d’activité.
Afin de mieux comprendre le rôle des PADs, j’ai analysé leur expression et les protéines désiminées lors de la
cicatrisation cutanée. J’ai pour cela réalisé des blessures excisionnelles sur le flanc de souris adultes et détecté ces
protéines au cours des phases inflammatoire et de ré-épithélialisation de la cicatrisation. J’ai en particulier montré
que Pad3 n’est pas exprimée par les cellules prolifératives de la languette de ré-épithélialisation qui progresse le
long de la plaie, mais seulement dans les kératinocytes en cours de différenciation où elle est colocalisée avec la
filaggrine. La Pad3 pourrait donc être impliquée dans le rétablissement de la barrière épidermique. De façon très
intéressante, j’ai détecté des protéines désiminées dans le caillot fibrino-plaquettaire et identifié l’une d’elles
comme étant la fibrine. Mes résultats montrent que c’est une Pad normalement absente de l’épiderme, la Pad4, qui
est responsable de la désimination de cette protéine.
Finalement, j’ai cherché à comprendre le rôle de la Pad2 dans l’épiderme à l’aide de souris dont le gène Padi2 a
été invalidé. J’ai montré que l’absence de Pad2 ne modifie pas le profil et le taux des protéines épidermiques
citrullinées et n’induit pas une sur-expression des autres isoformes de Pad. Elle ne modifie ni la différenciation
des kératinocytes, ni les fonctions de barrière épidermique et n’influence pas la cicatrisation cutanée et la
désimination de la fibrine.
Mon travail de thèse a permis de mettre en évidence une régulation complexe de la désimination, en particulier
différents niveaux de régulation post-transcriptionnelle des PADs, mais aussi des rôles spécifiques des Pad3 et 4
dans la cicatrisation. Si la présence de fibrine citrullinée avait été montrée dans plusieurs cas d’inflammations
pathologiques, en particulier articulaires, c’est la première fois qu’elle est décrite au cours d’un processus
physiologique comme la cicatrisation cutanée.

3
 Abstract

Peptidylarginine deiminase functions and regulation in the epidermis and during cutaneous wound healing
Deimination or citrullination is a posttranslational modification catalyzed by peptidylarginine deiminases (PADs).
PADs convert protein-bound arginines into citrullines in a calcium dependent manner. The physiological role of
deimination remains to be fully identified but PADs are found to be associated with numerous pathological
mechanisms. For example, fibrin deimination has been observed in various inflammatory [Link] PAD
isoforms, PAD1, 2 and 3, are expressed in the epidermis where their expression and activation depend on the
keratinocyte differentiation state. PAD1 and 3 are involved in the deimination of filaggrin, leading to the
production of the Natural Moisturizing Factor. Filaggrin deimination by PAD 1 and 3 is essential for the skin
hydration and barrier functions, whereas the role of PAD2 remains unknown.
To investigate the mechanisms implicated in PAD regulation we used cultured primary keratinocytes and induced
their differentiation either by increased cell density or by treatment with vitamin D. We evidenced the presence of
a post-transcriptional regulation. Indeed vitamin D increased PAD1-3 mRNA amounts with distinct kinetics but
neither the protein nor the deimination rate. By contrast high cell-density increased PAD1 and 3 but not PAD2 at
the mRNA and protein levels and up-regulated protein deimination. Moreover auto-deimination was shown to
decrease PAD activity by increasing the distance between the four major amino-acids of the active site.
To better understand the roles of PADs in skin differentiation and inflammation, I evaluated the presence of
citrullinated proteins and the expression of Pads during cutaneous wound closure. I performed full-thickness
punches on adult mice back skin and analyzed the protein expression by immunohistology and western blotting
during inflammatory and re-epithelializating phases of wound recovery. Pad3, normally expressed in the stratum
granulosum, was not detected in the hyperproliferative tongue of the neo-epidermis progressing over the wound.
However Pad3 was shown to be coexpressed with (pro)filaggrin in a large number of keratinocyte layers in the
differentiating part of the neo-epidermis. We hypothesized that Pad3 and filaggrin coexpression was the result of
the accelerated differentiation program intended to restore the barrier function and the hydration of the upper
epidermis. Interestingly, at the wound site, citrullinated proteins were also detected in the clot and fibrin was
shown to be one of them. Our data show that the involved enzyme at this site is Pad4, an isotype usually not
expressed in the epidermis in basal conditions but previously described in inflammatory tissues.
Finally I analyzed the cutaneous phenotype of Pad2-deficient mice to discriminate the role of this isotype in the
epidermis. No morphological or histological modifications in the skin of the Padi2 invalidated mice have been
detected so far. The level of citrullinated proteins was not altered and no detectable increase in the expression of
the other Pad isoforms was observed. The absence of Pad2 did not induce any modification in epidermal
differentiation, skin barrier functions, wound healing and fibrin deimination.

My PhD study revealed a complex regulation of deimination in keratinocyte cultures, in particular various post-
transcriptional levels of PADI gene expression, and specific functions of Pad3 and 4 during cutaneous wound
healing. I also described for the first time the presence of deiminated fibrin in physiological conditions as wound
recovery in mice.

4
 Liste des abbréviations

LISTE DES ABBREVIATIONS :

ACPA : auto-anticorps anti protéines citrullinées (Anti-Citrullinated Proteins Autoantibodies)

ADN : Acide Désoxyribo-Nucléique
ADNc : ADN complémentaire
AMC : anticorps anti citrulline modifiée (Anti-Modified Citrulline antibody)
AP-1 : Activating Protein 1
ARN : Acide Ribo-Nucléique
ARNm : ARN messager
CaR : récepteur calcique
CARM1 : Coactivator-associated Arginine Methyltransferase 1
CDSN : cornéodesmosine
ChIP: Chromatine immunoprecipitation assay
cis-UCA : acide cis urocanique
CDE : Complexe de Différenciation Epidermique
CNS : segment codant conservé
DA : Dermatite Atopique
DP : desmoplakine
DSC : desmocolline
DSG : desmogléine
DHEA : déhydroépiandrosterone
EGF : facteur de croissance épidermique (Epithelial Growth Factor)
EGTA : acide éthylène glycol-tétraacétique
FGF : facteur de croissance fibroblastique (Fibroblast Growth Factor)
FNH : Facteur Naturel d’Hydratation
FPA / B : fibrinopeptide A / B
GEE : Gaine Epithéliale Externe
GEI : Gaine Epithéliale Interne
GFAP : protéine fibrillaire acide gliale (Glial Fibrillary Acidic Protein)
GROα : Growth Related Oncogene α
HMT : Histones Méthyltransférases
H2A / B : Histone 2 A / B
IFAP : protéines associées aux filaments intermédiaires (Intermediate Filament Associated
Protein)

5
 Liste des abbréviations

IFNγ : interferon γ
IV : Ichtyose Vulgaire
Ig : immunoglobuline
K : kératine
kDa / kD : kilodaltons
KGF : facteur de croissance kératinocytaire (Keratinocyte Growth Factor)
KO: Knockout
NF-κB : nuclear factor-kappa B
MBP : protéine basique de la myéline (Myelin Basic Protein )
MCP-1 : Monocyte Chemoattractant Protein 1
miARN : microARN
MZF1 : Myeloid Zinc Finger 1
NAP-2 : Neutrophil Activating Peptide 2
NETs : Neutrophil Extracellular Traps
PAD/Pad : Peptidyl Arginine Désiminase
pb : paire(s) de bases
PCR : Polymerase Chain Reaction
PEP-1 : Profilaggrin Endoproteinase 1
PIE : Peptidylarginine deiminase Intergenic Enhancer
PIP2 : Phosphatidyl Inositol bis Phosphate
PKC: protéine kinase C
PKG : plakoglobine
PKP: plakophiline
PLC : phospholipase C
PMRT1 : Protein Arginine Methyltransferase 1
PPAR : Peroxisome Proliferator-Activated Receptor
PR : Polyarthrite Rhumatoïde
RT : Reverse Transcription
RXR : récepteur X aux rétinoïdes
SCCE : Stratum Corneum Chymotryptic Enzyme
SCTE : Stratum Corneum Tryptic Enzyme
SDS : dodécylsulfate de sodium
SEP : Sclérose En Plaque.

6
 Liste des abbréviations

ShARN : small hairpin ARN

SiARN : small interfering ARN
SNPs : Single Nucleotide Polymorphisms
TGases : transglutaminases
TEWL : TransEpidermal Water Loss
TGF : Transforming Growth Factor
THH : trichohyaline
TNFα : Tumor Necrosis Factor α
trans-UCA : acide trans-urocanique
TUNEL: terminal dUTP-biotin nick end labelling
UTR : Untranslated Region
UVs : rayons ultra-violets
VDR : récepteur à la vitamine D
VDRE : éléments de réponse à la Vitamine D
VEGFA : vascular endothelial growth factor A
Vit D3 : vitamine D3
7-DHC : 7, déhydrocholestérol

7
8
 Liste des figures

LISTE DES FIGURES

Figure 1 : représentation schématique de la peau................................................................................................ 23
Figure 2 : représentation schématique du cycle pilaire........................................................................................ 24
Figure 3 : représentation schématique de la structure d’un follicule pileux ........................................................ 25
Figure 4 : les cellules souches de l'épiderme ne sont pas responsables du renouveau de l'épiderme .................. 26
Figure 5 : coupe histologique de l’épiderme colorée à l’hématoxyline-éosine. ................................................... 29
Figure 6 : modèle de division cellulaire au niveau de la couche basale .............................................................. 30
Figure 7 : représentation schématique des différentes fonctions de barrière de l’épiderme vis-à-vis de
l’environnement extérieur ..................................................................................................................................... 34
Figure 8 : représentation schématique des principales étapes de la différenciation épidermique ....................... 35
Figure 9 : réaction de transamidation catalysée par les transglutaminases ........................................................ 38
Figure 10 : modèle de formation de l’enveloppe cornée ...................................................................................... 41
Figure 11 : mécanismes de formation des lamelles lipidiques extra-cornéocytaires impliquées dans
l’imperméabilité de la couche cornée ................................................................................................................... 46
Figure 12 : représentation schématique des corps lamellaires, des lipases et des lipides intercornéocytaires (A)
et image de microscopie électronique montrant les lamellae lipidiques dans l’espace intercellulaire de la couche
cornée de l’épiderme de souris (B) ....................................................................................................................... 47
Figure 13: représentation schématique des différents types de jonctions cellulaires présentes dans l’épiderme.47
Figure 14 : représentation schématique et observation en microscopie électronique d’un desmosome (a) et d’un
cornéodesmosome (b) ........................................................................................................................................... 50
Figure 15 : modèle de régulation de la desquamation.......................................................................................... 52
Figure 16 : métabolisme de la filaggrine humaine ............................................................................................... 55
Figure 17 : expression clinique et diminution de l’expression de profilaggrine chez les patients atteints
d’ichtyose vulgaire (IV) et de dermatite atopique (DA)........................................................................................ 57
Figure 18 : signification clinique des mutations perte de fonction du gène de la profilaggrine (FLG) ............... 58
Figure 19 : composition et rôles du Facteur Naturel d’Hydratation.................................................................... 60
Figure 20 : illustration d’exemples de moyens d’étude de la fonction de barrière de l’épiderme........................ 61
Figure 21 : représentation schématique du métabolisme de la vitamine D .......................................................... 63
Figure 22 : régulation de la différenciation par le calcium et la vitamine D ....................................................... 65
Figure 23 : représentation schématique de l’expression des protéines AP-1 dans l’épiderme humain et de souris
.............................................................................................................................................................................. 66
Figure 24 : représentation schématique des phases principales du processus de cicatrisation cutanée.............. 67
Figure 25 : représentation schématique de la phase inflammatoire..................................................................... 68
Figure 26 : représentation schématique du fibrinogène et de la fibrine............................................................... 71
Figure 27 : représentation schématique de la phase de ré-épithélialisation ........................................................ 76
Figure 28 : histologie de la réparation cutanée.................................................................................................... 78
Figure 29 : représentation schématique de la phase de remodelage.................................................................... 82
Figure 30 : la désimination................................................................................................................................... 91
Figure 31 : organisation génomique du locus des PADs chez l’Homme (1p35-36) et la souris (4E1) ................ 93
Figure 32 : la désimination de la filaggrine change ses propriétés de migration sur gel SDS............................. 97

9
 Liste des figures

Figure 33 : structure tridimensionnelle de la PAD4............................................................................................. 98

Figure 34: localisation des PAD1, 2 et 3 dans l’épiderme humain (A) et murin (B).......................................... 100
Figure 35 : détection en immuno-microscopie éléctronique des PAD1 (a) et PAD3 (b–c) dans le stratum
corneum (SC) et les granules de kératohyaline (KHG)....................................................................................... 101
Figure 36 : représentation schématique de la localisation et des rôles des PADs dans l’épiderme................... 102
Figure 37 : photographie au microscope électronique à balayage montrant les NETs...................................... 105
Figure 38 : schéma représentatif de la boucle d’auto-entretien de la PR. ......................................................... 108
Figure 39 : modèle de pathogénèse de la sclérose en plaque ............................................................................. 111
Figure 40 : promoteurs minimums des gènes PADI1, 2 et 3 exprimés dans l’épiderme et les facteurs de
transcription liés ................................................................................................................................................. 114
Figure 41 : modèle schématique de régulation à longue distance de la transcription du gène PADI3.............. 115
Figure 42 : génération des souris KO Padi2 ...................................................................................................... 202
Figure 43 : analyse histologique de la peau de souris sauvages (WT) et KO (Padi2-/-).................................... 202
Figure 44 : analyse de la barrière épidermique ................................................................................................. 203
Figure 45 : analyse des marqueurs de la différenciation.................................................................................... 203
Figure 46 : activation des PADs in vitro ............................................................................................................ 206
Figure 47 : représentation schématique des résultats obtenus lors des analyses de l’expression et du contrôle de
l’activité des PADs dans les kératinocytes humains en culture et à l’aide d’enzymes recombinantes ............... 210
Figure 48 : expression relative des ARNm des PADI1-4 dans les kératinocytes primaires en culture, en fonction
de la concentration extracellulaire de calcium................................................................................................... 212
Figure 49 : représentation schématique d‘une coupe de peau lors de la phase de ré-épithélialisation ............. 219

10
 Liste des tableaux

LISTE DES TABLEAUX

Tableau 1 : répartition des kératines dans l’épiderme ......................................................................................... 36

Tableau 2 : kératines de la peau et pathologies cutanées associées..................................................................... 37
Tableau 3 : différences physiologiques entre le processus de cornification et l’apoptose ................................... 43
Tableau 4 : composition chimique du facteur naturel d’hydratation.................................................................... 59
Tableau 5 : conséquences de l’inhibition des médiateurs de la phase inflammatoire de la cicatrisation cutanée
.............................................................................................................................................................................. 75
Tableau 6 : état des lieux des études sur la cicatrisation menées à l’aide de souris transgéniques et KO en 2004
.............................................................................................................................................................................. 89
Tableau 7 : pourcentage d’identité entre les séquences codantes (A) des paralogues humains des PADs, et (B)
des orthologues de PADs humaines, et de souris (Pads) ...................................................................................... 94
Tableau 8 : analyse de l’expression des gènes PADI dans différents tissus et organes humains par RT-PCR .... 95
Tableau 9 : récapitulatif des résultats obtenus lors de l’étude de l’expression des Pads et des protéines
citrullinées au cours de la cicatrisation cutanée................................................................................................. 220

11
12
 Table des matières

TABLE DES MATIERES

INTRODUCTION……………………………………………………………………………19

I- LA PEAU............................................................................................................................................ 21

A- Généralités...................................................................................................................................................... 21
1- Structure de la peau ...................................................................................................................................... 21
a- L’hypoderme ............................................................................................................................................ 21
b- Le derme .................................................................................................................................................. 21
c- L’épiderme ............................................................................................................................................... 22
d- La jonction dermo-épidermique............................................................................................................... 22
2- Les annexes cutanées : le follicule pileux..................................................................................................... 23
a- Les glandes sudoripares ........................................................................................................................... 23
b- Les glandes sébacées................................................................................................................................ 23
c- Le follicule pileux .................................................................................................................................... 23
3- Particularités de la peau de souris................................................................................................................. 26

B- Structure de l’épiderme................................................................................................................................. 28
1- Les cellules de l’épiderme ............................................................................................................................ 28
a- Les cellules de Langerhans....................................................................................................................... 28
b- Les cellules de Merkel ............................................................................................................................. 28
c- Les mélanocytes ....................................................................................................................................... 28
d- Les kératinocytes ..................................................................................................................................... 28
2- Une organisation stratifiée............................................................................................................................ 29
a- La couche basale, Stratum basale............................................................................................................. 29
b- La couche épineuse, Stratum spinosum ................................................................................................... 30
c- La couche granuleuse, Stratum granulosum............................................................................................. 31
d- La couche cornée, Stratum corneum ........................................................................................................ 31

C- Fonctions de barrière de l’épiderme ............................................................................................................ 33

1- Généralités.................................................................................................................................................... 33
2- La différenciation épidermique : formation du stratum corneum................................................................. 34
a- Formation de la matrice fibreuse.............................................................................................................. 35
b- Formation de l’enveloppe cornée............................................................................................................. 38
3- Différenciation et apoptose........................................................................................................................... 41
4- Les lipides intercornéocytaires ..................................................................................................................... 43
a- Les précurseurs des lipides de la couche cornée ...................................................................................... 44
b- Les céramides........................................................................................................................................... 44
c- Les acides gras ......................................................................................................................................... 44
d- Le cholestérol........................................................................................................................................... 45

13
 Table des matières

e- Organisation des lipides intercornéocytaires............................................................................................ 46

5- Les jonctions : desmosomes et cornéodesmosomes ..................................................................................... 47
a- Les jonctions serrées ................................................................................................................................ 48
b- Les jonctions communicantes (gap junctions) ......................................................................................... 48
c- Les jonction adhérentes (zonula adherens)............................................................................................... 48
d- Les desmosomes (macula adherens) ........................................................................................................ 48
e- La desquamation ...................................................................................................................................... 50
6- Formation du FNH ....................................................................................................................................... 52
a- Production du FNH : métabolisme de la filaggrine.................................................................................. 53
b- Composition et rôles du FNH .................................................................................................................. 58
7- Mesures de la fonction de barrière épidermique........................................................................................... 60
8- Régulation du programme de différenciation ............................................................................................... 61
a- Le pH........................................................................................................................................................ 61
b- Le calcium................................................................................................................................................ 62
c- La vitamine D........................................................................................................................................... 63
d- Régulation génique .................................................................................................................................. 65

II- LA CICATRISATION CUTANEE...................................................................................................... 67

A- Généralités...................................................................................................................................................... 67

B- La phase inflammatoire................................................................................................................................. 68
1- L’hémostase et la phase vasculaire............................................................................................................... 68
2- La matrice de fibrine .................................................................................................................................... 69
3- Les cellules inflammatoires et les cytokines ................................................................................................ 72
a- Les polynucléaires neutrophiles. .............................................................................................................. 72
b- Les macrophages...................................................................................................................................... 73
c- Les mastocytes ......................................................................................................................................... 74
d- Les lymphocytes T ................................................................................................................................... 74

C- La phase de ré-épithélialisation .................................................................................................................... 76

1- Formation d’un nouvel épiderme ................................................................................................................. 77
a- Migration.................................................................................................................................................. 77
b- Prolifération ............................................................................................................................................. 78
c- Régulation par les facteurs de croissance et les cytokines ....................................................................... 78
d- La maturation du néo-épiderme ............................................................................................................... 79
2- Angiogénèse ................................................................................................................................................. 79
3- Formation du tissu de granulation et fibroplasie .......................................................................................... 80
4- Reformation de la lame basale ..................................................................................................................... 81

D- La phase de remodelage ................................................................................................................................ 82

14
 Table des matières

E- Régulation de la cicatrisation : une régulation multifactorielle ................................................................. 83

1- Les hormones sexuelles................................................................................................................................ 83
2- Les PPARs.................................................................................................................................................... 83
3- AP-1 ............................................................................................................................................................. 84

F- Cicatrisation pathologique............................................................................................................................. 85
1- Retard de cicatrisation .................................................................................................................................. 85
2- Cicatrisation excessive ................................................................................................................................. 85
3- Les cicatrices rétractiles ............................................................................................................................... 85
4- Le psoriasis : une blessure qui ne cicatrise pas?........................................................................................... 85

G- Modèles animaux d’étude de la cicatrisation .............................................................................................. 87

III- LES PEPTIDYL-ARGININE DESIMINASES ................................................................................... 91

A- Introduction.................................................................................................................................................... 91

B- Caractéristiques des PADs ............................................................................................................................ 91

1- La réaction de désimination.......................................................................................................................... 91
2- Le locus des gènes des PADs ....................................................................................................................... 92
3- Conservation des séquences des gènes PADI............................................................................................... 93
4- Profil d’expression ....................................................................................................................................... 94
a- Au niveau ARNm..................................................................................................................................... 94
b- Au niveau protéique. ................................................................................................................................ 95
5- Spécificité d’action des PADs ...................................................................................................................... 96
6- Modulateurs de l’activité des PADs ............................................................................................................. 97
7- Structure cristallographique de la PAD4 ...................................................................................................... 97

C- Rôles physiologiques des PADs..................................................................................................................... 99

1- La peau ......................................................................................................................................................... 99
a- Expression différentielle des PADs dans l’épiderme ............................................................................... 99
b- Substrats épidermiques .......................................................................................................................... 100
c- La désimination dans les annexes cutanées............................................................................................ 102
2- Autres rôles physiologiques des PADs....................................................................................................... 103
a- L’apoptose.............................................................................................................................................. 103
b- La régulation génique............................................................................................................................. 103
c- La formation des NETs .......................................................................................................................... 105
d- Les chimiokines ..................................................................................................................................... 106
e- La reproduction ...................................................................................................................................... 106

D- PADs et pathologies ..................................................................................................................................... 107

1- La Polyarthrite Rhumatoïde ....................................................................................................................... 107

15
 Table des matières

a- Généralités.............................................................................................................................................. 107
b- Les ACPAs............................................................................................................................................. 107
c- Génétique de la PR................................................................................................................................. 108
d- Citrullination et inflammation................................................................................................................ 108
2- Les maladies neurodégénératives ............................................................................................................... 109
a- La sclérose en plaque ............................................................................................................................. 109
b- Autres pathologies du système nerveux central ..................................................................................... 111
3- Les cancers ................................................................................................................................................. 112
4- La néphropathie obstructive ....................................................................................................................... 112
5- Le psoriasis et l’érythrodermie ichtyosiforme congénitale......................................................................... 112

E- Régulation de l’expression des PADs ......................................................................................................... 113

1- Régulation par les oestrogènes ................................................................................................................... 113
2- Promoteurs minimaux des gènes des PADs exprimées dans l’épiderme.................................................... 113
3- Régulateurs transcriptionnels à longue distance......................................................................................... 115

OBJECTIFS………………………………………………………………………………...117

RESULTATS EXPERIMENTAUX………………………………………………………...121

PUBLICATION N° 1 : Deimination is regulated at multiple levels including auto-deimination of

peptidylarginine deiminases ........................................................................................................... 123

PUBLICATION N° 2 : Citrullination of fibrin and differential expression of peptidylarginine

deiminases during wound healing in mice ..................................................................................... 169

RESULTATS COMPLEMENTAIRES 1 : Etude du phénotype cutané des souris dont le gène

Padi2 a été invalidé ........................................................................................................................... 201
1- Confirmation de l’absence de la Pad2 dans les souris KO Padi2-/-....................................................... 201
2- Absence de phénotype cutané évident ................................................................................................... 202
3- Acquisition normale de la fonction de barrière ...................................................................................... 203
4- Différenciation normale ......................................................................................................................... 203

RESULTATS COMPLEMENTAIRES 2 : Activation des PADs in vitro .......................................... 205

DISCUSSION ET PERSPECTIVES………………………...............................................207

I- REGULATION DE L’EXPRESSION ET DE L’ACTIVITE DES PADs ............................................ 209

A- Expression et activité des PADs dans différents types cellulaires............................................................ 209

16
 Table des matières

B- Une régulation multi-contrôlée ................................................................................................................... 210

1- Régulation de l’expression des ARNm de PADI1-3 par la Vit D............................................................... 210
2- Régulation transcriptionnelle spécifique de chaque isotype....................................................................... 212
3- Régulation post transcriptionnelle des PADs ............................................................................................. 213
a- Régulation de la traduction : rôle possible des miARNs........................................................................ 213
b- Régulation de l’activité par auto-désimination ...................................................................................... 214

II- ETUDE DU PHENOTYPE DES SOURIS DONT LE GENE PADI2 A ETE INVALIDE .................. 215

A- La Pad2 n’est pas impliquée dans la cornification.................................................................................... 215

B- Peut-il y avoir une compensation par les autres isotypes ?....................................................................... 215

C- Quel rôle pour la PAD2 ? ............................................................................................................................ 216

D- Validation des outils immunologiques........................................................................................................ 216

E- Perspectives. ................................................................................................................................................. 217

III- LA CITRULLINATION DANS LA CICATRISATION CUTANEE .................................................. 218

A- Modèle d’étude............................................................................................................................................. 218

B- La Pad2 n’est pas indispensable à la cicatrisation .................................................................................... 219

C- Expression des Pads et protéines citrullinées ............................................................................................ 220

1- Expression des Pads dans l’épiderme......................................................................................................... 220
2- Citrullination et expression des Pads dans le caillot fibrino-plaquettaire................................................... 221
a- La fibrine est désiminée dans le caillot .................................................................................................. 221
b- La Pad4 est exprimée dans le caillot fibrino-plaquettaire ...................................................................... 222
c- Comment la fibrine est-elle citrullinée par la Pad4? .............................................................................. 222

D- Perspectives .................................................................................................................................................. 223

ANNEXE……………………………………………………………………………………225

BIBLOGRAPHIE…………………………………………………………………………..271

17
18
Introduction
 Chapitre 1 – La peau
Généralités

I- LA PEAU

A- Généralités
Plus vaste organe du corps humain, avec une surface d’environ 2 m2 pour un poids moyen
représentant 15 % du poids total d’un adulte, la peau assure un rôle essentiel de barrière vitale
vis-à-vis de l’environnement extérieur. La lumière, les produits chimiques, les pathogènes ou
même les contacts mécaniques sont autant d’agressions qui doivent être arrêtées par cette fine
enveloppe. Elle est également en première ligne de défense pour protéger le corps de la
déshydratation et joue un rôle dans la thermorégulation. Grâce à la présence de nombreux
récepteurs sensitifs, la peau est aussi un site important de perception sensorielle, pouvant
réagir à différents stimuli tactiles, thermiques ou douloureux.

1- Structure de la peau
La peau humaine est constituée de trois couches tissulaires principales superposées et
communicantes, de la plus profonde à la plus superficielle : l’hypoderme, le derme et
l’épiderme séparés par la jonction dermo-épidermique.

a- L’hypoderme : c’est la couche la plus profonde et la plus épaisse de la peau. L’hypoderme

est un tissu fibro-adipeux essentiellement composé d’adipocytes, cellules spécialisées dans le
stockage des lipides, regroupés en lobules et séparés par du tissu conjonctif. Il joue le rôle
d’isolant thermique, de réserve énergétique et de protection contre les chocs.

b- Le derme : c’est un tissu conjonctif innervé et vascularisé d’origine mésenchymateuse

constitué principalement d’eau et de fibres protéiques noyées dans un gel réticulaire de
mucopolysaccharides et protéoglycanes. Il joue un rôle majeur dans la nutrition, le soutien et
la protection de l’épiderme et des annexes cutanées, mais est aussi impliqué dans la
thermorégulation, la cicatrisation et la défense contre les pathogènes grâce à la présence de
cellules immunitaires (cellules dendritiques du derme, macrophages et lymphocytes T). La
partie superficielle du derme s’invagine à la jonction avec l’épiderme sous forme de papilles
dermiques, augmentant la surface de contact avec l’épiderme et permettant une meilleure
adhésion entre ces deux couches. Les papilles dermiques contiennent les fibres nerveuses, qui

21
 Chapitre 1 – La peau
Généralités

peuvent pénétrer la lame basale pour aller innerver l’épiderme ou être reliées à de véritables
corpuscules nerveux dans le derme jouant le rôle de mécanorécepteurs tactiles. Les papilles
dermiques sont également composées de vaisseaux sanguins, qui ne rentrent pas dans
l’épiderme. Les cellules principales du derme sont les fibroblastes qui vont synthétiser deux
types de fibres protéiques : les fibres de collagène et les fibres d’élastine, constituants de la
matrice extracellulaire. La grande majorité des fibres présentes dans le derme sont des fibres
de collagène (>90%) essentiellement de type 1 et 3, responsables de la résistance mécanique
de la peau, alors que les fibres d’élastine, elles, participent à son élasticité. Au niveau du
derme plus profond (derme réticulaire) ces fibres vont s’organiser parallèlement à la surface
de la peau. On retrouve également à ce niveau des corpuscules nerveux, récepteurs des
variations de pression, mais aussi des vaisseaux sanguins et les annexes cutanées : les
follicules pileux, associés étroitement aux glandes sébacées et aux glandes sudoripares (cf.
paragraphe suivant).

c- L’épiderme : c’est un tissu épithélial pluristratifié d’origine ectodermique correspondant à

la couche la plus externe de la peau. Une de ses principales fonctions est celle de barrière
entre l’organisme et son environnement extérieur.

d- La jonction dermo-épidermique : c’est une structure de 1 à 2 µm d’épaisseur constituée de

nombreux complexes protéiques. Elle apparaît divisée en trois zones distinctes en microscopie
électronique : la lamina lucida située immédiatement sous la membrane plasmique des
kératinocytes basaux et dans laquelle on peut distinguer les filaments d’ancrage des
hémidesmosomes, composés de collagène de type XVII; la lamina densa, plus profonde,
constituée de filaments de collagène de type IV; et la sub-lamina densa, correspondant à la
partie la plus superficielle du derme dans laquelle sont situées les fibrilles d’ancrage assurant
la liaison mécanique entre le derme et la lame basale et principalement constituées de
collagène de type VII. C’est une structure de jonction solide entre derme et épiderme, en
perpétuel remaniement, et qui possède des fonctions de supports mécaniques et d'adhésion
cellulaire. Elle permet les interactions entre les cellules et la matrice extracellulaire et possède
un rôle relatif de barrière, en limitant le passage de molécules et cellules entre derme et
épiderme, ainsi qu’un rôle de filtration (absorption, échange de produits nutritifs, de déchets
métaboliques....). Son intégrité est notamment indispensable à la cicatrisation cutanée.

22
 Chapitre 1 – La peau
Généralités

Figure 1 : représentation schématique de la peau.

(D’après [Link]

2- Les annexes cutanées : le follicule pileux

Ce sont des structures spécialisées, principalement localisées dans le derme et l’hypoderme.
Elles englobent :
a- Les glandes sudoripares : elles sécrètent la sueur et jouent un rôle dans la constitution d’un
film hydrolipidique protecteur présent à la surface de la peau, et dans la thermorégulation de
l’organisme et sa détoxification.
b- Les glandes sébacées : elles sécrètent le sébum qui participe avec la sueur à la composition
du film hydrolipidique, et protège la peau contre le dessèchement. Lorsqu’elles sont accolées
à un follicule pileux dans le derme elles forment le follicule pilo-sébacé.

c- Le follicule pileux :
Les follicules pileux sont considérés comme des organes à part entière. Ils sont présents dans
la peau sur toute la surface corporelle, à l’exception de la paume des mains et la plante des
pieds et de certaines parties génitales. Chaque follicule pileux est accompagné d’une glande

23
 Chapitre 1 – La peau
Généralités

sébacée qui sécrète le sébum, et d’un muscle arrecteur de poil (ou muscle horripilateur) dont
la contraction permet de redresser le poil et d’expulser le sébum.

Le follicule pileux a la capacité de se renouveler de manière cyclique et asynchrone à partir de

cellules présentes à sa base. Dans une vie, chaque follicule pileux engendre 15 cheveux
environ et subit autant de cycles pilaires. Ces derniers sont composés de différentes phases de
croissance (anagène), de régression (catagène) et de repos (télogène) ; le follicule pileux mort
est ensuite expulsé grâce à la poussée du follicule pileux sous jacent en phase anagène (figure
2).

Figure 2 : représentation schématique du cycle pilaire. D’après (Aberdam, 2007)

Cette structure complexe comporte une vingtaine de types cellulaires répartis en six grands
compartiments : les uns d’origine dermique (la gaine conjonctive, la papille dermique) et les
autres de nature épithéliale (la gaine externe, la gaine interne, la tige pilaire et la glande
sébacée). Ces compartiments sont organisés de manière concentrique autour d’un axe de
symétrie qui correspond à celui de la tige pilaire (figure 3).
La gaine épithéliale externe (GEE) est l’enveloppe externe du folicule pileux. Elle est en
continuité avec l’épiderme interfolliculaire alors que la gaine épithéliale interne (GEI) sépare

24
 Chapitre 1 – La peau
Généralités

la gaine externe de la tige pilaire. La GEI est constituée de 3 couches de cellules distinctes (la
couche de Henlé, de Huxley et la cuticule) qui se différencient de manière asynchrone en un
processus comparable à celui observé dans l’épiderme (cf. paragraphe « différenciation
épidermique »).
Chacun de ces domaines exprime des marqueurs spécifiques, par exemple les cellules de la
GEI, et à plus faible niveau celles de la medulla, synthétisent une protéine, la trichohyaline
(THH), stockée dans des granules spécialisés de 0,1 à 0,3 µm de diamètre (cf. paragraphe
« rôles physiologiques des PADs »).
L'unité de pigmentation est composée de mélanocytes localisés à la périphérie et au sommet
de la papille dermique. Ils produisent des grains de mélanine, présents dans le cortex de la tige
pilaire qui sont responsables de la couleur du cheveu (cf. paragraphe « les cellules de
l’épiderme »).

Figure 3 : représentation schématique de la structure d’un follicule pileux.

25
 Chapitre 1 – La peau
Généralités

Le « bulge » (renflement) est un amas de cellules de la GEE au-dessous de l'abouchement du

canal sébacé et qui sert de point d'attache au muscle arrecteur du poil. C’est une niche de
cellules souches qui vont pouvoir donner naissance à des progéniteurs folliculaires.
L’activation de ces progéniteurs lors de la phase catagène va permettre d’induire la formation
d’un nouveau follicule pileux (Oshima et al., 2001). Il existe également des cellules souches
dans l’infundibulum, région du follicule entre la glande sébacée et l’épiderme (figure 4). Il a
récemment été montré que les cellules souches du follicule pileux peuvent donner naissance
aux sébocytes mais aussi aux kératinocytes interfolliculaires (Taylor et al., 2000) qui vont
permettre le renouvellement de l’épiderme lors d’une lésion par blessure superficielle de la
peau (Claudinot et al., 2007; Oshima et al., 2001). Des expériences d’analyses génétiques et
de suivi de la descendance de ces cellules après coloration (figure 4) ont cependant permis de
montrer qu’elles ne jouent pas de rôle dans l’homéostasie de l’épiderme normal qui
posséderait ses propres cellules souches (Clayton et al., 2007; Ito, 2005).

Figure 4 Les cellules souches du follicule pileux ne sont pas

responsables du renouveau de l’épiderme. Afin
d’examiner quel type cellulaire participe au renouveau de
l’épiderme, une cellule souche multipotente (capable de former de nombreux
types cellulaires) a été isolée à partir d’un follicule pileux de rat. Cette cellule
a été marquée (avec un rétrovirus portant le gène Lac Z qui code pour la β-
galactosidase), clonée en culture, et transplantée dans de la peau de souris
nouveau-nées.
La peau a été prélevée et analysée 7 mois après. Les cellules issues de la
cellule souche sont uniquement présentes dans les follicules pileux et les
glandes sébacées (bleu) mais pas dans l’épiderme, indiquant que les cellules du
follicule pileux ne contribuent pas au renouveau de l’épiderme à long terme.
(Gurtner et al., 2008).

3- Particularités de la peau de souris

Notre étude portant sur la caractérisation de l’épiderme et de la cicatrisation chez la souris, il
est important de préciser les particularités de la peau de souris.
La peau de souris adulte est beaucoup plus fine qu’une peau humaine, l’épiderme murin ne
possède que 2 à 3 assises cellulaires en comparaison de 10 à 15 chez l’Homme. Elle est
également pourvue de très nombreux follicules pileux et peut se déplacer sur le fascia
musculaire sous jacent. Les modèles murins sont très utilisés malgré les différences

26
 Chapitre 1 – La peau
Généralités

importantes que la peau de souris présente avec la peau humaine : épaisseur totale de la peau
(400 µm pour les rongeurs contre 1400 µm pour l'Homme), épaisseur de l'épiderme (10 µm
pour les rongeurs contre une centaine de µm pour l'Homme), densité des follicules pileux
(1000 / mm2 pour les rongeurs contre 25 / mm2 pour l'Homme).

27
 Chapitre 1 – La peau
L’épiderme

B- Structure de l’épiderme
L’épiderme (du grec epi, dessus et derma, la peau) est un épithélium pavimenteux
pluristratifié et kératinisé qui constitue la structure externe de la peau. En contact avec
l’environnement extérieur, il assure une fonction de protection de l’organisme. Son épaisseur
de l’ordre de quelques centaines de µm varie en fonction des territoires anatomiques.
L’épiderme est constitué à plus de 90% de cellules épithéliales appelées kératinocytes, les
autres cellules épidermiques correspondant à des mélanocytes, des cellules de Langerhans et
des cellules de Merkel.

1- Les cellules de l’épiderme

a- Les cellules de Langerhans sont des cellules dendritiques mobiles représentant 3 à 5% des
cellules épidermiques. Ce sont des cellules présentatrices d’antigènes, véritables sentinelles
immunitaires de l’épiderme.

b- Les cellules de Merkel correspondent à la population cellulaire minoritaire de l’épiderme.

Ce sont des cellules neuro-épithéliales présentes au niveau de la couche basale qui joueraient
un rôle de mécanorécepteurs capables de détecter la déformation tissulaire.

c- Les mélanocytes représentent 3 à 5% de la population cellulaire épidermique et sont

indispensables à la photoprotection. Ils synthétisent le pigment naturel de la peau : la
mélanine, stockée dans le mélanosome. Ce processus appelé mélanogénèse est responsable de
la pigmentation de la peau, des cheveux mais aussi des poils et des iris. Les mélanocytes
transfèrent leurs mélanosomes aux kératinocytes basaux, par l’intermédiaire de leurs
dendrites, afin de protéger le matériel génétique kératinocytaire des mutations induites par les
rayonnements ultraviolets.

d- Les kératinocytes constituent plus de 90 % des cellules épidermiques. La formation de la

barrière physique externe de l’épiderme, la couche cornée, est assurée grâce à la
différenciation épidermique, programme génétique séquentiel, processus orienté au cours
duquel les kératinocytes subissent de nombreux changements morphologiques et
métaboliques aboutissant à leur transformation en cellules mortes cornifiées: les cornéocytes.

28
 Chapitre 1 – La peau
L’épiderme

Ces transformations se produisent au cours de la migration des kératinocytes de la couche la

plus interne de l’épiderme (couche basale) vers la couche la plus externe (couche cornée).

2- Une organisation stratifiée

L’épiderme est un épithélium pluristratifié constitué de cinq couches superposées formées
chacune d’une ou plusieurs assises cellulaires (figure 5).

Figure 5 : coupe histologique de l’épiderme colorée à l’hématoxyline-éosine.

D’après : [Link]

a- La couche basale, Stratum basale

La couche basale ou germinative est une monocouche de cellules prolifératives rattachées au
derme par la jonction dermo-épidermique. Les kératinocytes basaux sont de forme cubique,
avec un noyau volumineux et d’abondants mélanosomes.
Les kératinocytes de la couche basale sont les seuls à être mitotiquement actifs et relativement
indifférenciés. Ils assurent le renouvellement des cellules épithéliales de l’épiderme.

Pendant longtemps il a été considéré que les cellules souches de l’épiderme pouvaient
proliférer pour donner naissance 1- à d’autres cellules souches afin d’assurer l’auto-
renouvellement des kératinocytes basaux, 2- à des cellules amplificatrices transitoires qui
génèrent au bout de quelques cycles de multiplication des kératinocytes capables de sortir du
cycle cellulaire et de se différencier. Une publication récente a cependant remis en cause ce

29
 Chapitre 1 – La peau
L’épiderme

dogme, et propose un nouveau modèle dans lequel les cellules progénitrices au potentiel
prolifératif non limité seraient responsables de l’homéostasie épidermique en se divisant
principalement de façon symétrique (Clayton et al., 2007).
En effet, deux modèles de divisions cellulaires ont été précédemment observés et pourraient
coexister dans l’épiderme : les divisions symétriques et asymétriques (figure 6). Les divisions
symétriques contribueraient à la différenciation et la stratification en fournissant de nouvelles
cellules adjacentes au niveau de la couche basale, dont des cellules prolifératives et des
cellules capables de migrer dans la couche épineuse supérieure pour se différencier. Les
divisions asymétriques quant à elles, sont basées sur une orientation du fuseau mitotique qui
permet une division perpendiculaire à l’épithélium, de manière à générer à la fois une cellule
proliférative restant dans la couche basale et une cellule directement dans le compartiment
suprabasal (Lechler and Fuchs, 2005 ; Fuchs et al., 2007a).

Différenciation

Prolifération

Figure 6 : modèle de division cellulaire au niveau de la couche basale. D’après (Fuchs, 2007a). Modèle de division
symétrique (a) qui permet de former deux cellules-filles adjacentes sur un plan horizontal dans la couche basale après
division, et asymétrique (b) où l’une des cellules-filles se localise directement dans le compartiment épineux alors que la
première est maintenue dans la couche basale.

b- La couche épineuse, Stratum spinosum

La couche épineuse est composée de 5 à 10 assises cellulaires chez l’Homme. Elle doit son
nom à la présence de nombreuses « épines » visibles en microscopie optique qui sont en fait
des desmosomes, desquels convergent de nombreux faisceaux de filaments intermédiaires,
assurant la cohésion mécanique intercellulaire. Dès qu’une cellule migre au niveau de la

30
 Chapitre 1 – La peau
L’épiderme

couche épineuse, elle cesse tout cycle de division et commence à se différencier. Les cellules
sont polyédriques avec des noyaux volumineux et vont progressivement s’élargir et s’aplatir
lorsqu’elles progressent vers la couche supérieure.

c- La couche granuleuse, Stratum granulosum

La couche granuleuse est la dernière couche de cellules vivantes de l’épiderme. Elle est
formée de 2 à 3 assises de cellules chez l’Homme, de forme aplatie avec un noyau
perpendiculaire à la jonction dermo-épidermique. Le terme « granuleuse » provient de la
présence de nombreux grains de kératohyaline, visibles en microscopie optique, présents dans
le cytoplasme des kératinocytes. Ces granules contiennent chez le rongeur deux types de
protéines insolubles qui s’associent aux filaments intermédiaires : les granules de type F
contiennent la profilaggrine et ceux de type L, la loricrine. Chez l’Homme seule la filaggrine
est présente dans les granules, la loricrine étant dispersée dans le cytoplasme.
Des structures tubulo-vésiculaires appelées corps lamellaires ou kératinosomes sont
également présentes dans le cytoplasme des kératinocytes granuleux. Elles jouent un rôle
majeur dans l’établissement de la fonction de barrière épidermique en déversant leur contenu
protéique et lipidique par exocytose à l’interface couche granuleuse/couche cornée conduisant
à la formation d’un ciment intercornéocytaire (cf. paragraphe « les lipides »).

d- La couche cornée, Stratum corneum

La couche cornée est constituée de 25 à 30 couches de cellules mortes et anucléées : les
cornéocytes. Les organelles cellulaires et le noyau sont dégradés durant la transformation des
kératinocytes granuleux en cornéocytes, la cornification, le cytoplasme faisant place à une
matrice fibreuse de kératines et de filaggrine. La membrane cytoplasmique est remplacée par
une coque rigide et insoluble, l’enveloppe cornée. La partie la plus profonde de la couche
cornée appelée stratum compactum est constituée de cellules cohésives alors que la partie la
plus superficielle, le stratum disjonctum, est composée de cellules discohésives. L’ultime
étape de la différenciation épidermique correspond à l’élimination des cornéocytes les plus
superficiels par le processus de desquamation. Ces dernières cellules, continuellement
éliminées, sont alors remplacées par les cellules provenant des couches inférieures. La couche
cornée a longtemps été considérée comme une simple couche de cellules mortes non
fonctionnelles. Au cours des deux dernières décennies, la connaissance de ses propriétés a

31
 Chapitre 1 – La peau
L’épiderme

connu un essor considérable et son importance cruciale dans le maintien des barrières
hydrique, chimique, immunologique et mécanique de l’épiderme a été démontrée.

32
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

C- Fonctions de barrière de l’épiderme

1- Généralités
La fonction principale de l’épiderme est d’assurer une barrière protectrice entre l’organisme et
l’environnement extérieur. Plusieurs types de barrière sont mis en jeu (figure 7) :

- une barrière chimique et biochimique permet de lutter contre les allergènes et les irritants et
possède un rôle antibactérien grâce au pH acide de la couche cornée et à la présence
d’enzymes hydrolytiques et de peptides antimicrobiens.
- une barrière immunologique grâce aux constituants du système immunitaire inné et acquis.
- une barrière physique assurée grâce à la forte cohésion inter-cellulaire dont sont
responsables les nombreux desmosomes et qui permet à l’épiderme de résister aux agressions
extérieures. La mélanine absorbe comme nous l’avons vu le rayonnement ultraviolet. La
couche cornée absorbe aussi une partie du rayonnement ultraviolet grâce à la présence en
quantité importante d’acide urocanique, un dérivé de l’histidine.
- une barrière hydrique grâce à la présence de jonctions serrées dans la couche granuleuse,
des lipides intercornéocytaires et du facteur naturel d’hydratation (FNH) présent dans le
stratum disjunctum.
Ce sont plus particulièrement ces fonctions de protection physique et hydrique que nous
détaillerons dans ce manuscrit.

Nous appellerons ces fonctions collectivement « fonctions de barrière ».

33
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Figure 7 : représentation schématique des différentes fonctions de barrière de l’épiderme vis-à-vis de l’environnement
extérieur. Les fonctions de protection hydrique et physique représentées en rouge sont détaillées dans ce document.

2- La différenciation épidermique : formation du stratum corneum

La différenciation épidermique recouvre l’ensemble des phénomènes moléculaires,
biochimiques et morphologiques finement régulés qui transforment les kératinocytes basaux,
cellules nucléées et mitotiquement actives, en cellules mortes, cornifiées et anucléées ou
cornéocytes (figure 8). Les étapes ultimes de ce programme correspondent à la kératinisation
ou cornification. C’est précisément cette étape de cornification qui sera détaillée dans ce
chapitre.
La cornification se traduit par la mise en place de structures visibles en microscopie
électronique : le cytoplasme est transformé en matrice fibreuse et amorphe constituée de
macrofibrilles de kératines, la membrane plasmique est remplacée par une coque protéique
rigide appelée enveloppe cornée, l’espace intercornéocytaire est rempli de lamellae lipidiques
et les desmosomes deviennent des cornéodesmosomes. Les cornéodesmosomes sont
progressivement dégradés, au fur et à mesure que les cornéocytes progressent vers la surface
de la couche cornée, ce qui permet finalement leur libération au cours de la desquamation.
Chaque stade de la différenciation épidermique et les structures qui les caractérisent sont
sensibles à des défauts moléculaires à l’origine de multiples dermatoses. Une liste des

34
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

génodermatoses connues, pour lesquelles un locus chromosomique ou un gène ont été

identifiés, a été récemment établie (Leech and Moss, 2007).
Desquamation
Élimination des cornéocytes
corn éocytesmorts
mort
Cornification
Formation de l ’enveloppe cornifiée
cornifi ée
Cellules différenciées

Extrusion lipidique
Expression des derniers marqueurs de la
différenciation
différenciées
Couches

e.g. filaggrine et loricrine

Cellules

Renforcement du cytosquelette
prolifératives

Sortie du cycle cellulaire

proliférative
prolifératives
Cellules
Couche
Cellules

Renouvellement cellulaire constant par prolifération

prolif ération

Granule de kératohyaline Cornéodesmosome Desmosome Hémidesmosome

Figure 8 : représentation schématique des principales étapes de la différenciation épidermique. D’après (Denecker et
al., 2008)

a- Formation de la matrice fibreuse

- Les kératines
Les kératines sont les composants des filaments intermédiaires des cellules épithéliales, elles
sont les protéines structurales principales de l’épiderme constituant jusqu’à 85% des protéines
totales des cornéocytes (Coulombe, 1993). Elles possèdent toutes la même organisation
structurale avec un domaine central en hélice d’environ 310 acides aminés encadré par un
domaine amino terminal et un domaine carboxy terminal de taille extrêmement variable et de
structure non hélicoïdale.
Les kératines représentent plus de cinquante protéines regroupées en deux familles sur la base
de leur séquence protéique : les kératines acides de type I (K9 à K28) et les kératines basiques
de type II (K1 à K8 et K71 à K80) (Schweizer et al., 2006). La polymérisation des filaments
de kératines s’effectue grâce à l’assemblage d’hétérodimères de kératines acides et basiques
(Coulombe, 1993). Les hétérodimères s’assemblent dans un deuxième temps en tétramères
qui s’associent à leur tour par leurs extrémités pour former un protofilament. C’est

35
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

l’association et la compaction de plusieurs protofilaments qui donnent naissance aux

filaments intermédiaires de kératines de 10 à 12 nm de diamètre. Ceux-ci s’organisent dans la
cellule en un réseau qui permet de relier la membrane nucléaire à la membrane plasmique où
ils sont liés aux protéines desmosomales (Coulombe et al., 2000). Les cellules épithéliales
coordonnent ainsi l’expression d’au moins deux gènes pour produire un réseau de kératines.
Les kératinocytes de l’épiderme expriment différents hétérodimères de kératines, selon leur
degré de différenciation (tableau 1). En effet, les kératines K5 et K14 sont exprimées dans les
cellules non différenciées de la couche basale alors que leur expression est inhibée dans les
couches supérieures. Les kératines K1 et K10, elles, sont caractéristiques des couches
suprabasales (Eckert et al., 1997; Roop et al., 1988).
Les kératines K6, K16 et K17 ne sont exprimées que par les kératinocytes des épithéliums
hyperprolifératifs et lors de la cicatrisation cutanée (Paladini et al., 1996).
Enfin le réseau de filaments intermédiaires de kératines est hautement dynamique et n’aurait
pas seulement une fonction de protection de la cellule mais serait également impliqué dans
d’autres fonctions régulatrices et voies de signalisation intracellulaires comme la protection
contre le stress, la cicatrisation cutanée et l’apoptose (Gu and Coulombe, 2007).
Au cours de la cornification, les filaments intermédiaires de kératines vont s’agréger, grâce à
l’intervention d’un polypeptide de la famille des protéines associées aux filaments
intermédiaires (IFAP) : la filaggrine (pour filament aggregating protein ; détaillée dans le
paragraphe 6) afin de former la matrice fibreuse intracornéocytaire indispensable à la
résistance mécanique de l’épiderme (Fuchs and Weber, 1994).

Kératine de type I Kératine de type II

(acide) (basique)
Kératinocytes
K14 (50 kD) K5 (58 kD)
basaux
Kératinocytes K10 (56,5 kD) K1 (67 kD)
suprabasaux K2e (65 kD)
Cellules
K16 (48 kD) K6 (56kD)
hyperprolifératives

Tableau 1 : répartition des kératines dans l’épiderme.

36
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

- Pathologies associées aux filaments intermédiaires de kératines

Des mutations peuvent perturber l’assemblage des kératines et causer de nombreuses
affections cutanées in vivo (tableau 2). L’étude de ces pathologies a permis de mettre en
évidence le rôle cohésif du réseau de kératines. En effet, un défaut de kératinisation entraîne
une fragilité cellulaire pouvant conduire à une lyse des kératinocytes spontanément ou sous
l’influence d’un stress mécanique. Cela se traduit au plan clinique par une fragilité cutanée
conduisant à la formation de clivages ou « bulles » épidermiques. C’est le cas lors
d’épidermolyses bulleuses simples (OMIM #131800), provoquées par des mutations faux-
sens dans les gènes codant pour K5 et K14 entrainant une lyse des kératinocytes basaux. Une
mutation des kératines suprabasales K1/K10 est à l’origine de l’apparition d’une
hyperkératose épidermolytique ou érythrodermie ichtyosiforme congénitale bulleuse (OMIM
#113800), ou d’autres formes d’ichtyoses comme la kératodermie palmoplantaire striée
(OMIM #607654).
Type II Type I Pathologie

K1 K10 - Erythrodermie ichtyosiforme congénitale bulleuse (OMIM

#113800)
- Kératodermie palmoplantaire striée (OMIM #607654)
- Hyperkératose épidermolytique autosomique récessive (OMIM
#607602)
- Kératodermie palmoplantaire diffuse OMIM #600962)
- Ichtyose de Curth Macklin (OMIM #146590)
K2e - Ichtyose bulleuse de Siemens (OMIM #146800)
K9 - Kératodermie palmoplantaire épidermolytique (OMIM
#144200)
K5 K14 - Epidermolyses bulleuses simples de type Weber-Cockayne
(OMIM #131800), Koebner (OMIM #131900), Dowling Meara
(OMIM #131760)
- Epidermolyse bulleuse simple à transmission autosomique
récessive (OMIM #601001)
- Epidermolyse bulleuse simple « mottled-pigmentation »
(OMIM #131960)
- Maladie de Dowling Degos (OMIM #179850)
K6a/K6b K16/K17 - Pachyonychie congénitale type I et II (OMIM #167200 et
#167210)
- Kératodermie palmoplantaire focale (OMIM #613000)
- Stéatocystomatose (OMIM #184500)

Tableau 2 : kératines de la peau et affections cutanées associées. D’après (Arin and Mueller, 2007).

37
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

b- Formation de l’enveloppe cornée

- Généralités
Lors de la différenciation terminale, la membrane plasmique des kératinocytes est remplacée
par une structure mince et insoluble, imperméable et résistante, constituée de précurseurs
protéiques liés entre eux par des ponts disulfures et d’autres liens covalents. Cette structure
appelée enveloppe cornée est indispensable aux fonctions de barrière de l’épiderme. Elle est
observable en microscopie électronique sous la forme d’une couche dense aux électrons
d’environ 15 nm d’épaisseur, entourant les cornéocytes, et associée à une monocouche de
lipides d’environ 5 nm (Hirotani et al., 1982; Swartzendruber et al., 1989).
C’est une structure hautement insoluble, même en présence d’agents réducteurs comme le β-
mercaptoéthanol et le dithiothréitol ; cette insolubilité est due à la présence de liens covalents
isodipeptides Nε−(γ-glutamyl)-lysine formés entre des précurseurs protéiques par les
transglutaminases.

- Les transglutaminases
Les transglutaminases (TGases) appartiennent à la famille des protéases à cystéine « papain
like », elles catalysent la transamidation de résidus peptidyl glutamines en présence de
calcium (figure 9). Chez l’Homme, 8 isoformes ont été identifiées et sont impliquées dans de
nombreux processus biologiques, comme par exemple dans la conversion du fibrinogène en
fibrine lors de la coagulation par le facteur XIII.

protéine 1 protéine 2

résidu glutamine résidu lysine

protéine 1 protéine 2

Lien Nε-(γ-glutamyl)-lysine

Figure 9 : réaction de transamidation catalysée par les transglutaminases.

38
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Seules les TGases 1, 2, 3 et 5 sont présentes dans la peau. Les TGases 1, 3 et 5 sont exprimées
uniquement dans l’épiderme et participent à la formation de l’enveloppe cornée tandis que la
TGase 2 est également présente dans le derme et participe à la formation d’une matrice
extracellulaire lors du processus de cicatrisation (Lorand and Graham, 2003).
Les TGases 1 et 3 sont synthétisées sous forme de précurseurs et activées par protéolyse
partielle lors de la cornification. Les protéines candidates à cette activation sont la calpaïne 1
et la cathépsine D (Egberts et al., 2004; Kim and Bae, 1998) ainsi que la dispase et les
cathépsines L et S (Zeeuwen, 2004).
La TGase 1 est une protéine membranaire qui joue un rôle essentiel dans l’assemblage des
composants de l’enveloppe cornée. Les souris dont le gène Tgm1 a été invalidé meurent à la
naissance suite à un défaut de barrière cutanée induit par des anomalies de formation de
l’enveloppe cornée (Matsuki et al., 1998). Chez l’Homme, des mutations dans le même gène
sont responsables d’une ichtyose sévère, l’ichtyose lamellaire de type 1 (OMIM #242300)
(Huber et al., 1995). D’autre part, la TGase 1 est capable, in vitro, de participer à la formation
de l’enveloppe lipidique en catalysant l’estérification des ω-hydroxycéramides avec un
précurseur de l’enveloppe, l’involucrine (Nemes, 1999).
Les TGases 3 et 5 sont cytosoliques. La TGase 3 permet d’oligomériser des précurseurs
protéiques qui seront ensuite liés entre eux par la TGase 1 membranaire. La TGase 5 peut
former des liaisons avec de nombreux précurseurs protéiques et pourrait également jouer un
rôle dans les stades précoces de formation des enveloppes cornées au niveau des plaques
desmosomales pour maintenir l’adhésion inter-cellulaire (Candi et al., 2002; Cassidy, 2005).

- Initiation de la formation de l’enveloppe cornée

L’étape d’initiation de la formation de l’enveloppe a lieu au niveau de la couche épineuse.
Les deux premiers précurseurs protéiques sont l’envoplakine et la périplakine. Sous l’effet
d’une augmentation de la concentration calcique, ces deux protéines vont s’hétérodimériser
grâce à la TGase 5 et s’accumuler au niveau de la face interne de la membrane plasmique.
Elles sont immédiatement rejointes par une autre protéine, l’involucrine, fixée par la TGase 1
membranaire (DiColandrea et al., 2000; Kalinin et al., 2002; Steinert and Marekov, 1999).
Alors que la concentration calcique continue d’augmenter, la TGase 1 forme des liaisons entre
l’envoplakine et l’involucrine. Il se forme alors une sorte d’échafaudage protéique
particulièrement résistant qui recouvre la face interne de la membrane plasmique et incorpore
la plaque desmosomale. Curieusement, des souris invalidées pour chacun des gènes codant

39
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

pour l’involucrine, l’envoplakine ou la périplakine sont viables et ne présentent aucun

phénotype particulier (Aho et al., 2004; Djian et al., 2000; Maatta et al., 2001), ce qui suggère
une importante redondance des fonctions de ces trois protéines. L’étude de souris déficientes
simultanément pour ces trois protéines structurales a montré un léger retard de formation de la
fonction barrière et la présence d’une hyperkératose. Même si la barrière hydrique semble être
maintenue chez ces souris « triples knock-out », la barrière mécanique semble elle être
altérée, avec une inhibition de l’activité protéolytique des protéases épidermiques impliquées
dans la desquamation et une infiltration de cellules immunitaires dans le derme (Sevilla et al.,
2007).

- Etape de renforcement
Lors d’une étape suivante, après que les corps lamellaires aient déversé leur contenu dans les
espaces interkératinocytaires à la transition couche granuleuse/couche cornée, les
phospholipides de la membrane plasmique sont remplacés par des ω-hydroxycéramides qui
sont liés par la TGase 1 à l’involucrine (Candi et al., 2005; Jackson et al., 1993).
Parallèlement, de nouveaux précurseurs protéiques s’accumulent dans le cytoplasme des
kératinocytes. La loricrine est le composant principal de l’enveloppe cornée (jusqu’à 80% de
sa masse protéique). Elle est exprimée au niveau de la couche granuleuse (Steinert and
Marekov, 1997) et est liée à d’autres protéines, principalement aux SPRs (une famille de
petites protéines riches en proline) grâce à l’action de la TGase 3 cytosolique (Steinert et al.,
1998). Ces complexes sont ensuite transloqués à la périphérie des kératinocytes et incorporés
à l’échafaudage protéique préexistant. D’abondantes liaisons peptidiques sont formées au
niveau des desmosomes où de nombreux substrats des TGases sont présents.
D’autres protéines sont finalement ajoutées à l’enveloppe cornée comme les kératines, la
filaggrine, des protéines de la famille S100, la cornéodesmosine, etc. (figure 10).

40
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Initiation Renforcement Formation de l’enveloppe Desquamation

lipidique (partie haute de la
(couche épineuse) (couche granuleuse) couche granuleuse) (couche cornée)

Granule
Corps Cytoplasme
Lamellaire de loricrine

Envoplakine ¨Phospholipides Activité des transglutaminases

Periplakine
Loricrine W-OH-céramides
Involucrine
Kératine -5 -14 SPR Acides gras, Cholestérol
Kératine -1, -2e, -10 Autres protéines Liaison insoluble

Figure 10 : modèle de formation de l’enveloppe cornée. D’après (Candi et al., 2005).

3- Différenciation et apoptose
L’épiderme étant constamment soumis à des agressions extérieures, son intégrité est assurée
grâce à un équilibre entre différenciation, prolifération/desquamation.
L’apoptose est un processus de mort cellulaire programmée, sous contrôle génétique, par
lequel les cellules surnuméraires ou dysfonctionnelles de l’organisme sont éliminées,
généralement par phagocytose. L’apoptose touche des cellules isolées ou de petits îlots
cellulaires. Elle se caractérise par un remaniement du cytosquelette et une convolution des
membranes cytoplasmiques et nucléaires, une condensation de la chromatine, une
fragmentation de l’ADN dans les régions inter-nucléosomales et la formation de corps
apoptotiques. Afin de faciliter la reconnaissance des corps apoptotiques par les phagocytes, la
cellule va signaler son état apoptotique à son environnement en particulier grâce au
changement de localisation des molécules de phosphatidylsérine, du feuillet interne au feuillet
externe de la bi-couche lipidique qui forme la membrane plasmique.
Certains auteurs ont qualifié la cornification, qui aboutit à la mort programmée des
keratinocytes, d’apoptose à but fonctionnel (Gandarillas, 2000; Lippens et al., 2000).

41
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Effectivement, il existe des similarités entre l’apoptose et les étapes tardives de la

différenciation kératinocytaire : l’ADN est dégradé, le noyau et les organelles disparaissent, et
il y a mise en place d’un programme protéolytique. De plus, tous les acteurs de l’apoptose
sont présents dans l’épiderme même s’ils le sont sous une forme inactive.
Cependant, de nombreuses différences morphologiques et biochimiques existent entre ces
deux programmes (tableau 3). Tout d’abord, contrairement à l’apoptose qui est un procédé
rapide, la différenciation terminale dure plusieurs semaines. Des protéines spécifiques de la
cornification sont synthétisées. La membrane plasmique ne subit pas de convolutions mais est
progressivement remplacée par l’enveloppe cornée. Le marquage par effet TUNEL
(« terminal dUTP-biotin nick end labelling ») qui permet de visualiser la fragmentation de la
chromatine lors de l’apoptose, n’est pas observé dans les couches suprabasales mais
seulement de manière sporadique dans la couche basale de l’épiderme. Enfin, le cornéocyte
n’est pas phagocyté mais joue un rôle fondamental dans l’épiderme avant d’être éliminé par
desquamation. On peut aussi noter d’autres différences dans les mécanismes moléculaires
impliqués. En effet, le facteur de transcription pro-apoptotique p53, acteur majeur de
l’apoptose induite par des dommages nucléaires, n’a pas de rôle évident dans la cornification.
Les caspases, protéases à cystéine intracellulaires, effecteurs indispensables de l’apoptose,
sont exprimées dans l’épiderme humain normal mais sous leur forme zymogène et ne
semblent pas intervenir dans la différenciation terminale épidermique, au contraire de la
caspase-14 non-apoptotique qui est activée dans l’épiderme (Lippens, 2000; Raymond et al.,
2007) (cf. paragraphe sur le métabolisme de la filaggrine). Enfin, certains auteurs suggèrent
même que lors de la cornification il y aurait une suppression de l’apoptose. Cette hypothèse
est renforcée par le fait que l’inactivation d’un certain nombre de gènes pro-apoptotiques
n’engendre pas de phénotype cutané évident chez les souris (Droin and Green, 2004). Par
exemple, le facteur de transcription NF-κB (nuclear factor-kappa B) qui protège de nombreux
types cellulaires de l’apoptose, est activé et transloqué dans le noyau des kératinocytes
différenciés. Il semble être requis pour prévenir les kératinocytes suprabasaux d’une apoptose
prématurée et leur permettre d’induire la cornification (Seitz et al., 2000). Néanmoins, l’étude
de souris transgéniques pour les régulateurs de la voie NF-kB semble moduler ces premières
observations et montre que cette voie serait induite seulement lors de conditions
inflammatoires (Lippens et al., 2000).
Même si les kératinocytes semblent étrangement résistants à l’apoptose, ce qui irait dans le
sens d’une « protection » des cellules épidermiques, celle-ci peut cependant être induite dans

42
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

les couches suprabasales, notamment par les UVs, ce qui entraîne la formation des « sun-burn
cells ». Ces cellules possèdent des caractéristiques communes avec les cellules apoptotiques
comme la présence de photolésions, d’un noyau pyknotique marqué en TUNEL et d’un
cytoplasme éosinophile. Leur formation est induite par un programme multifactoriel
complexe associant l’activation de signaux causés par les dommages à l’ADN et de récepteurs
de surface, et le stress oxydatif (Laethem et al., 2005).
Etape Cornification Apoptose

Elimination des cellules mortes : Desquamation Phagocytose

Devenir des organelles : Lysés Encapsulés
Noyau : Elargissement Condensation
Fragmentation chromatine : Non Oui
Pas de fragmentation de Fragmentation de l’ADN
l’ADN TUNEL positif
TUNEL negatif

Membrane plasmique : Cornifiée Intacte

Durée du processus : Lente (20 jours) Rapide (20 min)
Activation par les ions calciques : Obligatoire Facultative
Enzymes impliquées : TGases 1, 3 et 5 TGase2, caspases, calpaines
Substrats des enzymes (exemples) : Kératines ICAD (inhibitor of caspase
activated deoxyribonuclease)
Loricrine Rb
SPRs Vinculine
Filaggrine IL-2
Trichohyaline PARP
Cystatine Serca
Elafine p75
Protéines desmosomales Bid

Tableau 3 : différences physiologiques entre le processus de cornification et l’apoptose. D’après (Melino et al, 2005).

4- Les lipides intercornéocytaires

La couche cornée présente une composition en lipides très différente de celle des autres
membranes biologiques. Elle est notamment très pauvre en phospholipides et est
essentiellement composée de céramides (50%), de cholestérol (20-25%) et d’acides gras libres
(15-20%) (Wertz, 2006). La lipogénèse des glandes sébacées permet aussi un apport en

43
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

triglycérides et squalènes. Les cornéocytes sont de ce fait entourés d’un ciment

intercornéocytaire lipidique qui joue un rôle essentiel dans la barrière hydrique en limitant la
perte en eau de l’organisme.

a- Les précurseurs des lipides de la couche cornée

Dans les couches granuleuses et épineuses, des précurseurs lipidiques sont contenus dans les
corps lamellaires, structures tubulo-vésiculaires dérivant de l’appareil de Golgi. A l’interface
couche granuleuse/couche cornée, sous l’influence d’un signal encore mal connu comme la
modification du gradient calcique, les corps lamellaires migrent jusqu’à la membrane
plasmique avec laquelle ils fusionnent et déversent leur contenu dans l’espace extracellulaire.
La sécrétion de ces corps lamellaires peut également être induite par une perturbation
expérimentale de la fonction de barrière de la couche cornée, par exemple par des forces
mécaniques (délaminage au scotch), ou un traitement topique de la peau à l’aide de solvants
ou de détergents (Menon et al., 1992). Après sécrétion, les précurseurs lipidiques sont
modifiés et s’organisent en lamellae qui remplissent les espaces inter-cornéocytaires. En plus
de ces précurseurs, les corps lamellaires sécrètent également l’ensemble des lipases
nécessaires à leur maturation (Freinkel and Traczyk, 1985; Grayson et al., 1985). Les
mécanismes permettant la formation des lipides de la couche cornée à partir de ces
précurseurs lipidiques sont schématisés en figure 11.

b- Les céramides
Les céramides représentent 50% des lipides et sont les plus divers de la couche cornée. Il
existe neuf sous-classes de céramides (CER1-9) présentant des chaînes carbonées d’acide gras
plus ou moins longues (queue) et des groupements sphingosine différents (tête). Ils sont issus
de l’hydrolyse des glucocéramides et des sphingomyélines par, respectivement, la β-
glucocérébrosidase et la sphingomyélinase acide (Holleran et al., 1993; Jensen et al., 1999;
Schmuth et al., 2000).

c- Les acides gras

L’épiderme contient aussi des acides gras libres ou liés à des triglycérides, phospholipides,
glycosylcéramides et céramides. Seuls les acides gras saturés ou monoinsaturés sont
synthétisés directement dans l’épiderme, les autres provenant de l’alimentation ou de la
circulation sanguine. Le syndrome de déficit en acides gras essentiels, causé par une mauvaise

44
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

absorption alimentaire ou une diète inappropriée, entraîne de profondes modifications de

l’épiderme et un défaut de barrière cutanée (Proksch et al., 1992). Les acides gras nécessaires
à l’établissement des lamelles lipidiques intercornéocytaires sont produits grâce à l’hydrolyse
des glycérophospholipides par la phospholipase A2. L’inhibition de l’activité de la
phospholipase A2 entraîne des défauts dans la structure des membranes lipidiques et dans la
perméabilité de la couche cornée (Mao-Qiang et al., 1995; Mao-Qiang et al., 1996). De plus
le glycérol libéré lors de cette réaction permet de retenir l’eau dans la couche cornée, jouant
ainsi un rôle dans le maintien de son hydratation.

d- Le cholestérol
Le cholestérol est synthétisé dans les couches les plus profondes de l’épiderme avant d’être
converti en sulfate de cholestérol par la sulfotransférase présente dans la couche granuleuse.
Le sulfate de cholestérol est à nouveau métabolisé en cholestérol dans la couche cornée grâce
à la stéroïde sulfatase. Cette enzyme joue un rôle essentiel dans la desquamation. En effet, elle
est sécrétée dans l’espace intercornéocytaire et son activité persiste dans les couches basses du
stratum corneum alors qu’elle disparaît dans les couches superficielles (Elias and Menon,
1991; Elias et al., 2004). Il en résulte un gradient négatif de sulfate de cholestérol dans la
couche cornée. Or, le sulfate de cholestérol est un inhibiteur de protéases à sérine qui jouent
un rôle dans la dégradation des cornéodesmosomes (cf. chapitre « desquamation ») (Elias et
al., 2004); pour cette raison il entraîne un retard de la desquamation lorsqu’il est appliqué en
topique sur l’épiderme de souris (Sato et al., 1998).

45
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Lamellae lipidiques

Céramides
Acides gras libres

PLA2 β Glucosylcérébrosidase Sphingomyélinase

Phospholipides Cholestérol
Glucosylcéramide Sphingomyéline

Stéroïde Sulfatase
Cholestérol sulfate
Sécretion

Corps Lamellaire

Cholestérol sulfate
ABCA12

Phospholipides Glucosylcéramide Sphingomyéline Cholestérol

Sphingomyéline
Céramides

Acides gras
modifiés

Elongases
Désaturases
Acides gras Cholestérol
cellulaire
Espace
extra-

Acides
Acides gras
gras Cholestérol

Figure 11 : mécanismes de formation des lamelles lipidiques extra-cornéocytaires impliquées dans l’imperméabilité de
la couche cornée. D’après (Feingold, 2007). Les enzymes sont représentées en bleu.

e- Organisation des lipides intercornéocytaires

L’organisation des lipides intercornéocytaires est elle aussi particulière à l’épiderme
(Kuempel et al., 1998). C’est une organisation « en sandwich », observée en microscopie
électronique comme une alternance de bandes claires représentant les chaînes hydrocarbonées
apolaires, et de bandes denses figurant les groupements polaires (figure 12) (Swartzendruber
et al., 1989 ; Madison, 2003; Madison et al., 1987).
De nombreuses pathologies épidermiques sont liées à des défauts dans la composition de
l’enveloppe lipidique. Des défauts de l’expression de céramides ainsi qu’une perturbation de
l’organisation lamellaire ont été observés dans le psoriasis et la dermatite atopique (Di Nardo,
1998; Ghadially et al., 1995; Madison, 2003).
Finalement de nombreuses ichtyoses sont causées par la mutation de gènes du métabolisme
lipidique.

46
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Lamellae
lipidique
Sphingo myélinase acide
β-glucocérébrosidase
Phospholipase
Stéroïde sulfatase

Corps Lamellaire

A B
Figure 12 : représentation schématique des corps lamellaires, des lipases et des lipides intercornéocytaires (A) et
image de microscopie électronique montrant les lamellae lipidiques dans l’espace intercellulaire de la couche cornée
de l’épiderme de souris (B). D’après (Ehrhardt et al., 2008; Madison, 2003). Flèches : enveloppe cornée, ICS : espace
intercellulaire, K : kératines de la matrice intracornéocytaire. Grossissement x200 000.

5- Les jonctions : desmosomes et cornéodesmosomes

Bien que la couche cornée soit considérée comme responsable de la fonction de barrière de
l’épiderme, il est important de noter que différents types de jonctions sont responsables de
l’adhésion et de la cohésion intercellulaire dans l’épiderme et participent donc à des degrés
divers au maintien de cette fonction de barrière. Ce sont les jonctions serrées, les jonctions
communicantes, les jonctions adhérentes et les desmosomes (figure 13).
Les hémidesmosomes quant à eux permettent d’ancrer les kératinocytes basaux sur la lame
basale.

Jonction adhérente

Jonction serrée

Desmosome

Jonction communicante

Figure 13: représentation schématique des différents types de jonctions cellulaires présentes dans l’épiderme.
D’après : [Link]

47
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

a- Les jonctions serrées

Ce sont des jonctions intercellulaires qui permettent de connecter les cellules entre elles, de
contrôler le transit moléculaire entre ces cellules et de séparer les lipides des pôles apical et
basolatéral (Brandner, 2009). Dans l’épiderme, ces structures sont localisées dans la couche
granuleuse et ont également un rôle dans le maintien de la fonction de barrière entre
l’intérieur de l’organisme et l’extérieur en évitant les pertes hydriques. Ce rôle a été démontré
grâce à l’analyse de souris « knockout » (KO) pour la claudine 1, une protéine
transmembranaire constituante des jonctions serrées. Ces souris montrent des défauts de
perméabilité des jonctions serrées et meurent de déshydratation dans les heures suivant la
naissance (Furuse et al., 2002).

b- Les jonctions communicantes (gap junctions)

Elles sont constituées de protéines transmembranaires, les connexines, qui s’assemblent en
complexes hexamèriques (les connexons) afin de former des pores de 2 nm entre deux
cellules adjacentes. Elles permettent le passage intercellulaire d’ions et de petites molécules,
mais assurent également un couplage électrique entre cellules. La connexine 43 est la plus
fortement exprimée dans l’épiderme. Des souris invalidées pour le gène codant pour la région
C-terminale de cette protéine présentent des déficits de barrière épidermique et une altération
du métabolisme de la filaggrine (Maass et al., 2004).

c- Les jonctions adhérentes (zonula adherens)

Elles sont formées d’une protéine transmembranaire, la E cadhérine et de différentes protéines
adaptatrices associées au cytosquelette d’actine. Ces jonctions assurent l’étanchéité entre les
épithé[Link] diminution de la E cadhérine est retrouvée dans l’eczéma sévère, une
pathologie caractérisée par un défaut de barrière (Trautmann et al., 2001). Une invalidation de
l’expression de cette protéine chez la souris entraîne aussi des anomalies au niveau des
jonctions serrées et des perturbations de barrière cutanée (Tunggal et al., 2005).

d- Les desmosomes (macula adherens)

Comme les jonctions adhérentes, les desmosomes appartiennent à la famille des jonctions
d’ancrage. Ils permettent de fixer solidement deux cellules épithéliales adjacentes et
participent à la cohésion tissulaire en permettant l’ancrage des filaments intermédiaires de

48
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

kératines de deux kératinocytes voisins en un même point d’adhésion. Ils sont présents dans
toutes les couches épidermiques, et prennent le nom de cornéodesmosomes dans la couche
cornée.
Les desmosomes sont des structures moléculaires complexes organisées autour de
glycoprotéines transmembranaires, les cadhérines desmosomales. Les domaines
extracellulaires des cadhérines sont situés dans l’espace intercellulaire desmosomal ou
« cœur » pour assurer l’adhésion entre les cellules voisines. La partie intracellulaire de ces
protéines est associée aux plaques desmosomales où sont présentes de nombreuses protéines
cytoplasmiques et où s’insèrent les filaments intermédiaires de kératines (Collin et al., 1992;
Garrod et al., 2002). Les principales protéines de la plaque desmosomale appartiennent à deux
grandes familles : la famille armadillo et la famille des plakines. Les membres de la famille
armadillo sont la plakoglobine (PKG), une molécule adaptatrice liant les cadhérines,
(desmocollines (DSC) et desmogléines (DSG)), à des protéines de plaque, et les plakophilines
(PKP). La famille des plakines est principalement représentée par les desmoplakines (DP),
responsables de la liaison entre les protéines armadillo et les filaments intermédiaires de
kératines, l’envoplakine et la périplakine.
Les constituants des desmosomes vont être exprimés de manière séquentielle lors de la
différenciation épidermique. La DSG2 est retrouvée exclusivement dans la couche basale,
alors que les DSC2, DSC3, et DSG3 sont très fortement exprimées dans la couche basale et
sont progressivement remplacées par DSG1, DSC1, et DSG4 lors du déplacement des
kératinocytes vers les couches supérieures. De façon similaire, pendant que PKP3 reste
constante dans toutes les couches de l’épiderme, PKP2 est graduellement remplacée par PKP1
(Jonca, 2008).

Lors de la transition couche granuleuse/couche cornée les desmosomes vont subir de profonds
changements morphologiques : la plaque desmosomale est progressivement incorporée à
l’enveloppe cornée jusqu’à devenir invisible en microscopie électronique et le cœur
intercellulaire se densifie (figure 14). La cohésion de la couche cornée est dépendante de la
présence de ces desmosomes cornéocytaires ou cornéodesmosomes. Toutes les protéines qui
les composent sont déjà présentes dans les desmosomes de l’épiderme sauf une qui est, à ce
jour, la seule protéine spécifique connue des cornéodesmosomes : la cornéodesmosine
(CDSN). C’est une protéine adhésive sécrétée par les kératinosomes des kératinocytes

49
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

granuleux dans l’espace intercornéocytaire (Haftek et al., 1997; Jonca et al., 2002; Serre et
al., 1991; Simon et al., 1997). Son importance dans la cohésion intercornéocytaire a été
démontrée récemment dans le laboratoire grâce à l’étude de souris déficientes pour le gène
Cdsn. Les souris ont de sévères défauts de barrière et décèdent dans l’heure qui suit la
naissance par suite d’un détachement de la couche cornée causé par des contraintes
mécaniques mineures. Des analyses structurales et ultrastructurales ont montré que la
cohésion inter-cellulaire est rompue à l’interface couche granuleuse/couche cornée (Leclerc et
al., 2009).

DESMOSOME

CORNEODESMOSOME

DSC1, DSG1, CDSN

Figure 14 : représentation schématique et observation en microscopie électronique d’un desmosome (a) et d’un
cornéodesmosome (b). Au moment de la cornification, à partir de la transition entre couche granuleuse et couche cornée la
partie extracellulaire des desmosomes est modifiée par incorporation de la CDSN, visualisée en microcopie électronique par
l’apparition d’une ligne dense entre les deux plaques desmosomales. D’après (Simon et al., 1997).

e- La desquamation
Le maintien de l’homéostasie de l’épiderme et le renouvellement constant de la couche cornée
sont assurés par une balance finement contrôlée entre la prolifération des kératinocytes basaux
et le détachement des cornéocytes à la surface de l’épiderme.
C’est le clivage protéolytique progressif des cornéodesmosomes qui va conduire à leur
exfoliation (Lundstrom et al., 1994; Simon et al., 2001). Les molécules responsables du

50
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

clivage des cornéodesmosomes sont encore mal caractérisées, cependant plusieurs protéases
potentiellement impliquées ont été identifiées dans la couche cornée. Ce sont pour la plupart
des protéases à sérine (kallikréines) et à cystéine (cathépsines). De la même manière, de
nombreux inhibiteurs de protéases sont présents dans les espaces extracellulaires de la couche
cornée et la desquamation passe par un équilibre finement régulé entre ces activités
protéasiques et anti- protéasiques (figure 15).
La protéolyse concerne initialement des protéases à sérine : la SCCE (stratum corneum
chymotryptic enzyme) ou kallikréine 7 et la SCTE (Stratum Corneum Tryptic Enzyme) ou
kallikréine 5. Ces deux protéases sont exprimées dans les kératinocytes granuleux puis
acheminées via les corps lamellaires dans les espaces intercellulaires à la transition couche
granuleuse/couche cornée. In vitro, la kallikréine 7 peut dégrader la DSC1 et la CDSN
(Caubet et al., 2004) tandis que la kallikréine 5, elle, est capable de dégrader la DSC1, la
DSG1 et la CDSN (Ekholm et al., 2000). Depuis, d’autres kallikréines ont été détectées dans
la couche cornée et impliquées dans la dégradation des cadhérines desmosomales et de la
CDSN, en particulier la kallikréine 14 (Brattsand et al., 2005). De plus, l’existence d’une
cascade d’autoactivation de ces protéases entre elles a été proposée (Caubet et al., 2004).
L’inhibiteur de protéases à sérine LEKTI peut inhiber plusieurs kallikréines, en particulier les
types 5 et 7. Il est codé par le gène SPINK5 et est exprimé dans la couche granuleuse.
L’importance de l’équilibre entre protéases et inhibiteurs de protéase peut être illustrée par la
découverte de l’origine du syndrome de Netherton. En effet, ce syndrome, caractérisé par de
sévères défauts de barrière épidermique associés à une desquamation excessive, est du à des
mutations non–sens du gène SPINK5 (Chavanas et al., 2000). Ces mutations entraînent un
défaut d’expression de LEKTI qui se traduit par une activité protéasique augmentée et une
protéolyse prématurée des cornéodesmosomes (Descargues et al., 2005). D’autres inhibiteurs
peuvent aussi être impliqués dans cette régulation des kallikréines, citons l’élafine et l’α2-
macroglobuline like-1 identifiée dans notre laboratoire (Toulza et al., 2007).
La plupart des études portent sur les protéases à sérine, mais de nombreuses autres protéases
ont été identifiées dans la couche cornée, parmi lesquelles des protéases à cystéine
(cathépsines L2/V et cathépsine L-like), ainsi qu’une protéase à acide aspartique (cathépsine
D) qui sont actives à pH acide et sont aussi capables de dégrader des composants du
cornéodesmosome in vitro (Bernard et al., 2003; Egberts et al., 2004; Roth et al., 2000). Leur

51
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

activité est également contrôlée in situ par des inhibiteurs spécifiques comme la cystatine M/E
(Zeeuwen et al., 2009).

Figure 15 : modèle de régulation de la desquamation. D’après (Caubet et al., 2004).

Les kallikréines 7 (SCCE) et 5 (SCTE) sont impliquées dans la desquamation en dégradant les composants extracellulaires
des cornéodesmosomes (cornéodesmosine, desmogléine 1 et desmocolline 1). Ces enzymes produites sous forme inactive
sont activées par le clivage trypsique d’un court domaine amino-terminal. Alors que l’activateur de la proKLK5 n’est pas
connu de façon certaine, cette enzyme semble être un activateur de la pro-KLK7. D’autres protéases, essentiellement des
cathépsines, sont détectées dans la couche cornée et sont proposées comme participant à la dégradation des composants du
cornéodesmosome. L’élafine, le SLPI, LEKTI et les cystatines, inhibiteurs des protéases à sérine ou cystéine, sont
probablement impliqués dans la régulation de la desquamation. Quand l’effet direct d’une protéase n’a pas été montré il est
indiqué avec une flèche ouverte. SCCE, stratum corneum chymotryptic enzyme; SCTE, stratum corneum tryptic enzyme;
CDSN, cornéodesmosine; DSG1, desmogléine 1; DSC1, desmocolline 1.

6- Formation du FNH
La compaction des filaments intermédiaires de kératines est assurée par la présence d’une
protéine associée aux filaments intermédiaires : la filaggrine. Mais cette protéine participe
également à l’hydratation cutanée grâce à sa protéolyse en acides aminés hygroscopiques,
constituants du Facteur Naturel d’Hydratation (FNH).

52
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

a- Production du FNH : métabolisme de la filaggrine

La filaggrine est une protéine au métabolisme complexe (figure 16), d’abord synthétisée sous
forme d’un précurseur basique de haut poids moléculaire (400 kDa) : la profilaggrine (Dale,
1985). Le gène de la profilaggrine (FLG) formé de 3 exons est localisé au niveau du
chromosome 1q21 dans une région appelée complexe de différenciation épidermique
(McKinley-Grant et al., 1989).
La profilaggrine est synthétisée sous forme phosphorylée et stockée dans les granules de
kératohyaline des kératinocytes granuleux. Elle est composée chez l’Homme d’un domaine
central de 10 à 12 sous-unités de filaggrine liées entre elles par un peptide de liaison
hydrophobe, d’un domaine N-terminal, constitué essentiellement de 2 sites de liaison au
calcium et d’un signal de localisation nucléaire, et enfin d’un domaine C-terminal unique. A
la transition couche granuleuse/couche cornée la profilaggrine est déphosphorylée avant
d’être clivée par protéolyse en sous-unités fonctionnelles de monomères basiques de
filaggrine de 37 kDa chez l’Homme et 27 kDa chez la souris (pour revue, (Mc Grath, 2008b)).
Les monomères ainsi libérés s’associent aux filaments intermédiaires de kératines par des
interactions ioniques afin de participer à l’agrégation et la stabilisation du réseau de kératines.
Cette association pourrait également permettre d’empêcher une protéolyse trop rapide de la
filaggrine (Dale et al., 1978; Mack et al., 1993; Manabe et al., 1991). La région N-terminale
est également libérée et transloquée dans le noyau (Pearton et al., 2002; Presland et al., 1997).
Dans le stratum compactum, les sous-unités de filaggrine sont désiminées (transformation de
résidus arginyl en résidus citrullyl) par une ou plusieurs peptidyl-arginine désiminases
(PADs) (cf. chapitre « Les PADs »). Cette modification entraîne un changement de charge, la
filaggrine devient alors acide et perd son affinité pour la kératine (Scott and Harding, 1986).
Les sous-unités de filaggrine se détachent de la matrice et sont complètement protéolysées,
dans les cornéocytes superficiels, en acides aminés libres entrant dans la composition du FNH
(Rawlings, 2005; Senshu et al., 1996).
Différentes protéases sont impliquées dans ce métabolisme complexe. Tout d’abord la furine
pourrait cliver le peptide N-terminal (Pearton et al., 2001), tandis que la calpaïne, une
protéase à cystéine, et l’endopeptidase de la profilaggrine (PEP-1) ont été impliquées dans le
clivage des peptides de liaison pour permettre la libération des monomères de filaggrine
(Resing et al., 1989; Yamazaki et al., 1997). D’autres protéases permettraient la conversion
profilaggrine/filaggrine : c’est le cas de la matriptase, une protéase à sérine transmembranaire

53
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

exprimée dans la plupart des tissus épithéliaux. Les souris dont le gène de la matriptase a été
inactivé dans l’épiderme présentent des défauts de barrière cutanée, une désorganisation des
lipides et une formation anormale de l’enveloppe cornéocytaire conduisant à la mort
postnatale par déshydratation (List et al., 2003). Un défaut d’expression des monomères de
filaggrine et une accumulation de profilaggrine ont également été observés. Cependant, un
clivage direct de la profilaggrine par la matriptase doit être écarté étant donné que la
profilaggrine est cytoplasmique alors que le site catalytique de la matriptase est
extracellulaire. La matriptase dont l’un des partenaires supposés est la prostasine pourrait
donc appartenir à une cascade protéolytique qui aboutirait secondairement à la protéolyse de
la profilaggrine.
La caspase 14 est un membre isolé de la famille des caspases (protéases à cystéine spécifiques
des résidus aspartate), protéines habituellement impliquées dans l’inflammation et l’apoptose.
Elle est exprimée uniquement dans les couches les plus différenciées de l’épiderme et c’est la
seule caspase à y être présente sous sa forme activée (Lippens, 2000; Raymond et al., 2007).
Les souris KO pour la caspase 14 présentent un défaut de barrière et une déshydratation. Des
études biochimiques ont montré que ces souris expriment les monomères de filaggrine, mais
aussi de nombreux fragments de plus faible poids moléculaire qui s’accumulent dans la
couche cornée (Denecker et al., 2007). Ces résultats, appuyés par le fait que la caspase 14 soit
capable de cliver la profilaggrine in vitro, démontrent un rôle essentiel de cette protéine dans
le métabolisme de la filaggrine. Deux mécanismes de clivage ont été envisagés : soit une
coupure directe de la filaggrine qui permettrait d’exposer des sites de clivage pour d’autres
endo- ou exo-peptidases, soit un mécanisme indirect où la caspase 14 activerait une endo- ou
exo-peptidase qui cliverait ensuite la filaggrine (Denecker et al., 2007; Denecker et al., 2008).
Les enzymes responsables du clivage spécifique de la filaggrine n’ont pas encore été
clairement identifiées. Une étude in vitro a montré que la calpaïne 1 clive préférentiellement
la filaggrine désiminée en peptides de faible poids moléculaire, et que la dégradation finale en
composants du FNH serait réalisée par une autre protéase à cystéine, au rôle physiologique
encore inconnu, l’hydrolase de la bléomycine (Kamata et al., 2009).
Même si les protéases catalysant le clivage de la filaggrine n’ont pas été formellement
identifiées, le “signal ” initiant cette protéolyse pourrait être le degré d’hydratation de la
couche cornée lui-même, qui assurerait une sorte de rétro-contrôle de la production du FNH et
donc de l’hydratation (Katagiri et al., 2003; Scott and Harding, 1986).

54
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Calpaïne 1
Hydrolase de la bléomycine

Calpaïne
PEP1
Matriptase
Caspase 14

Figure 16 : métabolisme de la filaggrine humaine. Schématisation de la partie supérieure de l’épiderme et des étapes de
production des acides aminés libres qui forment le facteur naturel d’hydratation. Les protéases potentiellement impliquées
dans la régulation du métabolisme sont également indiquées en bleu.

Modèles animaux et pathologies humaines

L’importance du rôle de la filaggrine a été mise en évidence grâce aux modèles animaux et à
l’identification de pathologies humaines présentant un défaut d’expression de cette protéine :
l’ichtyose vulgaire et la dermatite atopique.
Une surexpression de filaggrine humaine dans les kératinocytes suprabasaux de l’épiderme de
souris entraîne une légère mais significative accélération du rétablissement de la barrière
épidermique après une perturbation aiguë par délaminage au scotch (Presland et al., 2004). A
l’inverse, une perte d’expression de monomères fonctionnels est observée chez les souris
mutantes pour le gène flakytail (ft/ft). Ces souris possèdent une peau sèche et écailleuse et une
queue annulaire. Elles ont été proposées comme modèle pour l’ichtyose vulgaire (Presland et
al., 2000). Des travaux récents ont identifié la mutation flakytail et montré qu’elle correspond
à la délétion d’une paire de base, 2503delA, du gène de la filaggrine (Fallon et al., 2009).

55
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Chez l’Homme de nombreuses anomalies d’expression ou de maturation de la filaggrine ont

été identifiées. Particulièrement en 2006, lors de la découverte de deux mutations perte de
fonction de la filaggrine (R501X et 2282de14 entraînant une terminaison prématurée de la
traduction) qui touchent 9% de la population européenne et qui sont à la fois facteur de
prédisposition à la dermatite atopique et cause de l’ichtyose vulgaire (Palmer et al., 2008;
Smith et al., 2006). Ces résultats ont été largement confirmés depuis et d’autres mutations
dans d’autres cohortes et à partir de groupes ethniques différents ont par la suite été
découvertes (pour une revue voir Sandilands et al., 2009).

L’ichtyose vulgaire, de transmission autosomique dominante, est l’ichtyose humaine la plus

fréquente. Elle est caractérisée par une absence presque totale de couche granuleuse, une
hyperkératose modérée et une sécheresse cutanée (Sybert et al., 1985). On note également en
histologie une diminution voire une absence des granules de kératohyaline (figure 17).

La dermatite atopique (ou eczéma constitutionnel) est une affection inflammatoire chronique
fréquente chez l’enfant dont la prévalence n’a cessé d’augmenter ces dernières années,
passant de 5-10% à 10-25%, elle est devenue un véritable enjeu en matière de santé publique.
La pathogénie de la maladie intègre de nombreux facteurs en particulier génétiques,
immunologiques et environnementaux. C’est une pathologie parfois associée à l’apparition
d’asthme. Elle a été longtemps considérée comme une pathologie allergique ou
inflammatoire, après la découverte d’IgE à la surface des cellules dendritiques, le défaut
d’expression de filaggrine étant considéré comme résultant alors de l’inflammation cutanée.
Mais la découverte de mutations de la filaggrine comme étant un fort facteur deprédisposition
à la pathologie a remis en cause cette hypothèse (Smith et al., 2006). Aujourd’hui il est plus
largement considéré que l’anomalie de la fonction de barrière, due à la perte d’expression de
la filaggrine, est un préalable à l’apparition de la pathologie, permettant le passage
d’allergènes à travers la couche cornée et l’apparition des réactions inflammatoires qui en
découlent. Cependant une mutation dans le gène de la filaggrine n'entraîne pas forcément un
développement de la pathologie, les taux de pénétrance sont d’environ 60% pour les
hétérozygotes et 90% pour les homozygotes. Il doit donc exister d’autres gènes pouvant eux
aussi avoir un impact sur l’expression de cette maladie.

56
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Figure 17 : expression clinique et diminution de l’expression de profilaggrine chez les patients atteints d’ichtyose
vulgaire (IV) et de dermatite atopique (DA). (A) Sécheresse cutanée sur le bras d’un patient atteint d’IV. (B) La DA se
manifeste par un érythème, des érosions et des papules inflammatoires, et une lichénification sur la fosse antécubitale. (C)
Histopathologie d’un épiderme normal. La couche granuleuse contient de nombreux granules de kératohyaline (flèches) qui
sont absents lors de l’IV (D) (flèches). (E) Immunomarquage avec un anticorps anti profilaggrine dans la peau normale
montrant un marquage des granules de kératohyaline (flèches). Dans le cas d’une IV due à une mutation non sens du gène de
la profilaggrine, il y a une complète absence d’immunoréactivité de cet anticorps (F) dans l’épiderme. D’après (McGrath and
Uitto, 2008).

Depuis ces travaux, l’existence d’une association entre les mutations du gène de la filaggrine
et la susceptibilité à d’autres pathologies cutanées a été recherchée (figure 18). Il a notamment
été montré que ces mutations ne sont pas associées avec le psoriasis, autre pathologie
inflammatoire chronique qui touche 1 à 3% de la population et se caractérise par une forte
diminution de la synthèse de la filaggrine (Irvine, 2007; Smith et al., 2006; Zhao et al., 2007).

57
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Figure 18 : signification clinique des mutations perte de fonction du gène de la profilaggrine (FLG). Les mutations de
FLG sont directement associées à la cause/susceptibilité d’un certain nombre de d’affections dermatologiques ou peuvent en
modifier l’expression clinique. D’après (McGrath, 2008a).

b- Composition et rôles du FNH

Le FNH est retrouvé exclusivement dans le stratum corneum, il est composé majoritairement
d’un pool d’acides aminés, d’acide lactique, d’urée, de citrate et de sucres (tableau 4). Les
composants du FNH sont présents en grande quantité dans la couche cornée, pouvant
représenter jusqu’à 30% du poids du cornéocyte.
Les acides aminés issus du FNH, comme l’acide pyrrolidone carboxylique, sont
hygroscopiques. Ils peuvent capter l’eau présente dans l’atmosphère et agir comme humectant
(figure 19), ce qui permet à la couche cornée de rester perpétuellement hydratée malgré
l’action asséchante de l’environnement extérieur.
De plus, la présence d’acides aminés va participer à la diminution du pH de la couche cornée.
Cette acidité permet de réguler la flore bactérienne présente à la surface de la peau mais aussi
de contrôler l’action de nombreuses enzymes cornéocytaires, comme les protéases impliquées
dans le processus de desquamation ou les lipases essentielles à la maturation des lipides.
Enfin, la photo-isomérisation de l’acide trans-urocanique (trans-UCA), issu de la
transformation de l’histidine présente dans le FNH en acide cis-urocanique (cis-UCA), permet
l’absorption d’une partie du rayonnement UV (De Fine Olivarius et al., 1999).
Tous les acides aminés présents dans le FNH sont issus de la protéolyse de la filaggrine. Les
autres composants extracellulaires qui ne proviennent pas du cornéocyte, comme l’urée, les

58
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

sucres et le lactate pourraient provenir en partie des glandes sudoripares (Rawlings, 2005;
Rawlings and Harding, 2004).

Tableau 4 : composition chimique du facteur naturel d’hydratation. D’après (Rawlings and Harding, 2004).

Composants Composition (%
du FNH)

Acides aminés libres 40

Acide pyrrolidone carboxylique 12
Lactate 12
Sucres 8.5
Urée 7
Chlorure 6
Sodium 5
Potassium 4
Ammoniaque, acide urique, glucosamine, et créatine 1.5
Calcium 1.5
Magnesium 1.5
Phosphate 0.5
Citrate et formate 0.5

59
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Figure 19 : composition et rôles du Facteur Naturel d’Hydratation. Sur cette figure sont représentés la composition du
FNH en acides aminés et ses principaux rôles connus. Trans-UCA : acide trans-urocanique. PCA : acide pyrrolidone
carboxylique.

7- Mesures de la fonction de barrière épidermique

Différentes techniques permettent d’évaluer la fonction de barrière de l’épiderme. Par
exemple, une mesure indirecte, particulièrement utilisée en toxicologie, du flux ionique ou de
métabolites et molécules pouvant varier lors d’une perturbation de cette fonction (O2, CO2,
pH, etc.) (Abraar et al., 2009), mais également des tests de pénétration de colorants, ou une
mesure de la perte en eau trans-épidermique qui peut être réalisée in vivo.

- évaluation de la pénétration de colorants : de l’extérieur vers l’intérieur.

Il s’agit de techniques qui permettent de vérifier l’intégrité de l’épiderme en fonction de sa
capacité à laisser passer des colorants (figure 20). L’un des protocoles couramment utilisés
sur des souris nouveau-nées a initialement été mis en place par Hardmann en 1998 (Hardman
et al., 1998) pour évaluer la perméabilité de l’enveloppe cornée lors de l’embryogenèse. Il
consiste à immerger des souris au stade embryonnaire ou néonatal dans un colorant, le bleu de
toluidine. Les souris présentant un défaut de barrière apparaissent colorées en bleu,

60
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

contrairement à celles possédant une barrière normale qui ne laisse pas passer le colorant.
Cette technique est aussi applicable en histologie, et permet d’apprécier la pénétration du
Lucifer Yellow à l’aide d’un microscope à fluorescence.

- mesure de la perte en eau transépidermique (TransEpidermal Water Loss, TEWL) : de

l’intérieur vers l’extérieur.
Cette mesure permet d’évaluer la capacité de rétention d’eau de l’épiderme, et est inversement
corrélée à une bonne intégrité de la fonction de barrière. L’avantage de cette technique non
traumatisante est qu’elle peut aisément se réaliser in vivo. Elle est basée sur une mesure de
conductivité ou sur une mesure hygrométrique directe en chambre close.

Figure 20 : illustration d’exemples de moyens d’étude de la fonction de barrière de l’épiderme.

8- Régulation du programme de différenciation

a- Le pH
Il existe un gradient de pH dans l’épiderme qui diminue des couches les plus profondes vers
la surface de la couche cornée. Le pH de la couche cornée est effectivement acide, entre 4 et 6
et pourrait réguler nombre de phénomènes biologiques (Ohman, 1994).
Cette acidification de l’épiderme provient d’au moins trois origines distinctes : de la
production d’acides gras libres issus des phospholipides membranaires grâce à la

61
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

phospholipase 2, de l’activité de pompes échangeuses d’ions sodium/protons au niveau de la

couche granuleuse, et enfin de la présence de trans-UCA composant du FNH (Behne et al.,
2002; Hachem et al., 2003).
L’acidité de la couche cornée permet en premier lieu de participer à la fonction
antimicrobienne de la peau en régulant la flore bactérienne. Toutefois ce pH acide joue aussi
un rôle primordial dans la fonction de barrière et dans la régulation de la cohésion de la
couche cornée. De fait, la neutralisation du pH de la couche cornée de la peau de souris a pour
conséquences des altérations de fonction de barrière et d’intégrité de la couche cornée
particulièrement en activant les protéases à sérines (actives à pH neutre et alcalin) qui
dégradent alors des enzymes clés, impliquées dans la maturation des lipides et des
constituants des cornéodesmosomes (Behne et al., 2002; Brattsand et al., 2004; Elias et al.,
2004; Fluhr et al., 2001). Une augmentation du pH entraîne également une inhibition de la
sécrétion des corps lamellaires (Elias et al., 2004).
De plus, une perturbation du pH a été montrée dans l’ichtyose vulgaire et la dermatite
atopique (Fluhr et al., 2001; Rippke et al., 2004), ce qui renforcerait l’importance du rôle de
la protéolyse de la filaggrine en FNH dans l’acidification de la couche cornée. Le maintien
d’un pH acide dans la couche cornée permet en outre de diminuer la survenue de la dermatite
atopique chez la souris (Hatano et al., 2009).

b- Le calcium
De la même manière que pour le pH, il existe un gradient calcique au niveau de l’épiderme,
croissant des couches prolifératives vers les couches les plus différenciées, puis décroissant à
nouveau dans la couche cornée (Lee et al., 1992).
Ce gradient est essentiel à la différenciation épidermique, il permet de déclencher la sécrétion
des corps lamellaires et de réguler la transcription de nombreux gènes impliqués dans la
cornification comme les TGases, les protéines S100, l’involucrine, la loricrine, la filaggrine,
les PADs, etc. (Elias et al., 2002).
Des récepteurs et des canaux calciques ont été identifiés à la surface du kératinocyte. Les
canaux calciques permettraient de générer l’influx calcique intracellulaire à partir du calcium
extracellulaire, tandis que les récepteurs calciques (CaR), dont l’expression diminue lors de la
différenciation, permettraient le recrutement des stocks de calcium contenus dans le réticulum
endoplasmique et l’appareil de Golgi. Ce recrutement se fait grâce à l’hydrolyse du

62
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

phosphatidyl inositol bis phosphate (PIP2) par une phospholipase C et la mobilisation de la

protéine kinase C (voir le modèle proposé par (Bikle et al., 2004) et la figure 22).
Le calcium permet aussi d’induire la différenciation des kératinocytes primaires en culture.
Dans un milieu pauvre en calcium (≤ 0,05 mM), les cellules prolifèrent et expriment les
marqueurs des kératinocytes basaux. Quand elles sont cultivées en présence d’une
concentration calcique comprise entre 0,1 mM et 1,5 mM, elles stratifient et se différencient.
L’expression de marqueurs de différenciation comme la loricrine, les kératines K1 et K10 et
la filaggrine, suivie peu après de la formation d’une enveloppe cornée, est induite quelques
jours après la stimulation calcique (Hennings et al., 1980; Pillai et al., 1990; Thacher and
Rice, 1985).

c- La vitamine D
La peau est le seul organe capable de produire le cholécalciférol ou vitamine D3 (Vit D3). Le
7, déhydrocholesterol (7-DHC) est converti en Vit D3 sous l’influence des rayonnements UVs
grâce à un mécanisme en deux étapes (figure 21). La Vit D3 est ensuite métabolisée en
1,25(OH)2 Vit D3 qui correspond à la forme biologiquement active de la Vit D. La 1,25(OH)2
Vit D3 est surtout connue pour jouer un rôle dans le métabolisme osseux, mais elle est aussi
impliquée dans d’autres mécanismes comme la croissance cellulaire, l’apoptose et la
différenciation cellulaire.

Figure 21 : représentation schématique du métabolisme de la vitamine D. Le 7, déhydrocholestérol (7-DHC) est converti

en prévitamine D3 puis en vitamine D3 sous l’influence des rayonnements UVs. La vitamine D3 peut aussi être apportée par
l’alimentation (elle est notamment présente dans les poissons gras).

63
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

La Vit D agit selon une voie d’action génomique : elle se lie à son récepteur nucléaire VDR,
permettant l’association du VDR avec son partenaire hétérodimérique le récepteur X aux
rétinoïdes ainsi qu’avec un certain nombre de co-activateurs. Ceci permet de réguler la
transcription de gènes cibles via des éléments de réponse à la Vit D (VDRE) situés en général
en amont des promoteurs de ces gènes. L’expression du VDR lui-même est activée par c-Jun
(membre de la famille des facteurs de transcription AP-1). La Vit D permet ainsi d’augmenter
l’expression de gènes de différenciation épidermique comme ceux de l’involucrine et de la
TGase 1, mais aussi l’expression des Pad1 et 3 (Gibson et al., 1996; Palmer et al., 2008). Le
profil transcriptionnel de kératinocytes primaires humains en culture traités par la Vit D,
établi en utilisant des micropuces Affimetrix, a révélé la surexpression de 98 gènes, parmi
lesquels ceux codant pour les PADs, la cystatine M/E et de nombreux facteurs de
transcription et de marqueurs de la différenciation (Lu et al., 2005). L’invalidation du
récepteur de la Vit D chez la souris entraîne une alopécie, le rachitisme des animaux, une
disparition des granules de kératohyaline et une diminution d’expression de la filaggrine, de
l’involucrine et de la loricrine (Xie et al., 2002).
La Vit D peut également agir selon une voie non génomique, via des récepteurs
membranaires, et a été impliquée dans de nombreuses voies de signalisation communes avec
celles du calcium (Bikle and Pillai, 1993) (figure 22). En effet, la Vit D peut activer les
récepteurs calciques CaR et potentialiser ainsi la différenciation des kératinocytes in vitro
(Ratnam et al., 1999), ainsi que l’expression de nombreux membres de la famille des
phospholipases C. En outre elle agit en synergie avec le calcium pour activer l’expression de
l’involucrine et de la loricrine, certainement grâce à la proximité physique des éléments de
réponse au calcium et des VDRE que l’on retrouve notamment dans le promoteur du gène de
l’involucrine. Des mutations du site AP-1 d’un élément de réponse au calcium du gène de
l’involucrine bloquent à la fois l’action du calcium et de la 1,25-(OH)2D3 alors qu’une
mutation du VDRE bloque uniquement l’action de la 1,25-(OH)2D3 (Bikle et al., 2002; Ng et
al., 2000; Su et al., 1994). Cette interaction calcium /1,25-(OH)2D3 a été observée in vivo : les
souris dont le gène codant pour la 1-α−OHase, une enzyme impliquée dans la conversion de
la Vit D3 en métabolite actif (figure 21), a été invalidé, présentent une diminution non
réversible des marqueurs de différenciation et un gradient de calcium épidermique anormal,
ce qui provoque des défauts des fonctions de barrière (Bikle et al., 2004).

64
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

Ces résultats montrent que la Vit D peut induire la différenciation épidermique en synergie
avec le calcium. Au niveau thérapeutique, la 1,25-dihydroxyvitamine D3 et ses analogues sont
utilisés dans le traitement du psoriasis.

Figure 22 : régulation de la différenciation par le calcium et la vitamine D3. L’activation des récepteurs calciques (CaR)
et des phospholipases C (PLC) est induite par la 1,25 (OH)2D3, entraînant une augmentation de la concentration
intracellulaire d’inositol tri-phosphate (IP3) et de diacylglycérol (DAG). Cette augmentation induit l’activation de la protéine
kinase C (PKC) à la membrane plasmique et l’ouverture des canaux calciques membranaires. L’influx calcique intracellulaire
et l’activation de la PKC induisent la translocation nucléaire des facteurs AP-1 et l’expression des protéines de la
différenciation épidermique (involucrine et loricrine) permettant la formation de l’enveloppe cornée. La vitamine D peut
induire l’expression de CaR et de PLC.

d- Régulation génique

- Le complexe de différenciation épidermique

De nombreux gènes codant pour des protéines de l’enveloppe cornée sont situés au sein d’un
même cluster de 2,5 Mb appelé « Complexe de Différenciation Epidermique » (CDE). On y
retrouve plus de 50 gènes différents, exprimés principalement dans l’épiderme, la plupart
codant pour des protéines impliquées dans la cornification comme la filaggrine, la loricrine et
l’involucrine (Marshall et al., 2001; South et al., 1999).

65
 Chapitre 1 – La peau
Fonctions de barrière de l’épiderme

- Les facteurs de transcription de la famille AP-1

Parmi les facteurs de transcription impliqués dans la régulation transcriptionnelle des gènes
codant pour les protéines de la différenciation épidermique, les facteurs AP-1 jouent un rôle
important. Ils sont impliqués dans la transcription des gènes de la profilaggrine, des PADs
(voir paragraphe PADs), de l’involucrine, de la loricrine, des SPRRs, de la TGase 1,
etc.(Crish and Eckert, 2008; Jang et al., 2000; Jang and Steinert, 2002; Jessen et al., 2000;
Martin et al., 2004). Les facteurs AP-1 jouent en outre un rôle primordial dans la cicatrisation
cutanée que nous développerons dans le chapitre suivant. Cette famille de facteurs de
transcription se compose principalement d’homodimères ou d’hétérodimères Jun (c-Jun, Jun
B et Jun D) et Fos (c-Fos, Fos B, Fra-1 et Fra-2). Dans l’épiderme, l’expression des protéines
AP-1 varie avec la différenciation des kératinocytes (figure 23) (Mehic et al., 2005; Welter
and Eckert, 1995). Cette variation joue un rôle dans la régulation transcriptionelle des gènes
épidermiques. En effet, en fonction des dimères formés, l’activité des facteurs AP-1 est
variable. Alors que Jun D est plus abondant dans les kératinocytes prolifératifs, c-Jun et c-Fos
sont surtout retrouvés dans les plus différenciés (Angel et al., 2001).

Figure 23 : représentation schématique de l’expression des protéines AP-1 dans l’épiderme humain et de souris.
D’après (Angel et al., 2001).

66
 Chapitre 2 – La cicatrisation cutanée
Généralités

II- LA CICATRISATION CUTANEE

A- Généralités
La cicatrisation cutanée est un phénomène biologique très complexe, dynamique, qui se
met en place après une blessure de manière à rétablir le plus rapidement possible
l’intégrité et l’homéostasie de la peau. La fermeture correcte d’une lésion est possible
grâce à la coopération entre de nombreux médiateurs solubles (facteurs de croissance et
cytokines), la mise en jeu de différents types cellulaires (cellules inflammatoires,
endothéliales, sanguines, épithéliales et immunitaires) et les interactions avec la matrice
extracellulaire. La cicatrisation d’une plaie profonde (qui atteint également le derme) est
classiquement divisée en trois étapes principales qui se recoupent spatialement et
temporellement : la phase inflammatoire, la phase épithéliale et la phase de remodelage
tissulaire (figure 24) (Martin, 1997; Singer and Clark, 1999).

Haemostase et inflammation
Ré-épithélialisation et formation
du tissu de granulation
Remodelage

Haemostase

Neutrophiles
Cicatrisation

Macrophages

mastocytes mastocytes

Migration
Prolifération
Fibroplasie
Angiogénèse

Apoptose
Dépôt de collagène

Crosslink du collagène
Dégradation du collagène

contraction

Jours après blessure

Figure 24 : représentation schématique des phases principales du processus de cicatrisation cutanée.

67
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

B- La phase inflammatoire (0 à 10 jours)

Une plaie, qu’elle soit stérile ou non, implique toujours la présence d’une réaction
inflammatoire qui va durer jusqu’à la phase de remodelage tissulaire (figure 25). Cette
réaction est la première à se mettre en place, immédiatement après la blessure. Elle permet de
stopper l’hémorragie et de combattre les pathogènes. Elle fournit une matrice provisoire pour
la migration des cellules et joue un rôle dans la formation du tissu cicatriciel. La réponse
inflammatoire peut être divisée en deux phases principales : la phase vasculaire avec
l’hémostase et la phase cellulaire.

Follicule pileux

Epiderme
Bactérie

Oxygène

Caillot de fibrine
Cellule
épithéliale
Derme

Glande
Hypoderme sudoripare
Plaquette
Fibroblaste
Glande
Neutrophile Collagène Capillaire
sébacée

Figure 25 : représentation schématique de la phase inflammatoire. La blessure est caractérisée par la formation d’un
caillot de fibrine dans un environnement hypoxique (ischémie). Les bactéries, plaquettes et neutrophiles sont nombreux à
cette étape. Les annexes cutanées (follicule pileux, glandes sébacées et sudoripares) sont toujours présentes dans la peau non
lésée à l’extérieur de la plaie. D’après (Gurtner et al., 2008).

1- L’hémostase et la phase vasculaire

L’hémostase se met en place lorsqu’il y a saignement, c’est donc la toute première étape de la
cicatrisation. Elle consiste en deux processus principaux : la coagulation et la formation d’un
caillot de fibrine.

68
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

Lors d’une atteinte vasculaire, les plaquettes sont libérées et activées par des protéines de la
matrice extracellulaire comme le collagène ou la fibronectine. L’activation plaquettaire
entraîne à la fois leur adhésion et leur agrégation, ainsi que le relargage de nombreux
médiateurs et protéines adhésives (le fibrinogène, la fibronectine, la thrombospondine et le
facteur VIII). Tout ceci va entraîner la formation d’un clou plaquettaire qui permettra de
stopper l’hémorragie. De plus, l’activation des plaquettes entraîne le recrutement de cellules
inflammatoires sur le site de la blessure qui vont non seulement pouvoir combattre les
pathogènes, mais aussi jouer un rôle dans la dégradation et la formation du tissu cicatriciel.
En parallèle, la cascade de coagulation est initiée, permettant la conversion par la thrombine
du fibrinogène soluble en fibrine insoluble qui polymérise de manière à former un réseau
dense aboutissant à la formation d’un caillot fibrino-plaquettaire. Ce caillot est composé de
plaquettes incluses dans un réseau formé en majorité de fibrine ainsi que de fibronectine
plasmatiques, de vitronectine et de thrombospondine. Il permet la stabilisation du clou
plaquettaire, grâce à la liaison de la fibrine aux plaquettes, et donc l’obturation de la blessure
et sa protection vis-à-vis de l’environnement extérieur.

2- La matrice de fibrine
Cette matrice provisoire de fibrine possède également de nombreux rôles essentiels à la
cicatrisation. En effet, elle est impliquée dans la réparation tissulaire, l’adhésion leucocytaire
et l’angiogénèse. La rétractation du caillot est également essentielle à une bonne fermeture de
la blessure.
Le fibrinogène est une glycoprotéine plasmatique constituée de deux sous-unités liées entre
elles par des ponts disulfures (figure 26). Chaque sous-unité est formée de trois chaînes
peptidiques différentes, Aα, Bβ et γ. Le centre de la molécule comprend également deux
fibrinopeptides, FPA et FPB, correspondant à l’extrémité N-terminale des chaînes Aα et Bβ.
Lors de la dernière étape de la coagulation, la thrombine coupe les polypeptides et convertit le
fibrinogène soluble en fibrine insoluble qui va alors s’organiser en réseau solide stabilisé par
le facteur XIII (qui appartient à la famille des TGases). La dégradation du caillot de fibrine est
assurée par le processus de fibrinolyse sous l’action de la plasmine (pour revue, (Clark,
2003)).
La structure de la matrice de fibrine joue un rôle dans ses fonctions biologiques ; elle dépend
de nombreuses variables comme l’épaisseur des fibres, le nombre de branchements, la
porosité et la perméabilité du réseau. Elle peut être modifiée par différents paramètres comme

69
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

le pH, la concentration ionique et le taux de coagulation, influencée par la concentration de

thrombine, la vitesse de polymérisation par le facteur XIII ou de fibrinolyse par la plasmine
(Mosesson et al., 2001). L’importance des interactions entre ces protéines peut être illustrée
par le phénotype des souris invalidées pour le gène du plasminogène, le précurseur de la
plasmine. Ces souris présentent un diminution de la lyse de la fibrine entraînant des retards de
cicatrisation (Romer et al., 1996). Ce phénotype peut être réversé grâce à l’invalidation du
fibrinogène (List et al., 2003).
Des souris déficientes pour la chaîne A du fibrinogène cicatrisent à une vitesse normale mais
présentent des anomalies du processus de réparation, comme une hyperplasie épithéliale, des
défauts de migration des cellules épithéliales et de solidité de la cicatrice (Stewart et al.,
2001).
La matrice de fibrine permet la liaison de nombreuses molécules comme des protéines
plasmatiques (par exemple la fibronectine et la thrombosporine), des facteurs de croissance et
des cytokines. La fibrine et le fibrinogène (notés fibrin(ogène)) peuvent également fixer de
nombreux types cellulaires et fonctionnent comme un pont permettant différentes interactions
cellules-cellules principalement via des intégrines de surface, véritables récepteurs d’adhésion
cellulaire, ou d’autres types de récepteurs membranaires (par exemple VE-cadherin, I-CAM,
etc.) (Bennet, 2001; Ginsberg et al., 1992; Martinez et al., 2001). La fibrine sert aussi de
matrice provisoire au niveau de la plaie dans laquelle les cellules peuvent à la fois proliférer,
s’organiser et migrer (Clark et al., 1982; Clark, 2003). Ainsi le fibrin(ogène) possède
plusieurs sites qui peuvent se lier aux intégrines des cellules immunitaires (granulocytes et
monocytes) (Ugarova and Yakubenko, 2001). De plus, les peptides FPA et FPB du
fibrinogène, clivés par la thrombine, sont des chémoattractants pour ces mêmes cellules
(Richardson et al., 1976). En modulant l’activité des monocytes et macrophages, le
fibrin(ogène) joue un rôle prépondérant dans la transition entre les phases inflammatoire et
épithéliale de la cicatrisation (Clark, 2001).
La fibrine peut également se lier aux cellules endothéliales, une fois le peptide FPB clivé par
la thrombine, et promouvoir l’angiogénèse (Dvorak et al., 1987; Pandit et al., 2000), et aux
fibroblastes dont elle stimule la migration et la prolifération. Les caractéristiques du réseau de
fibrine vont directement affecter ces propriétés (Gailit et al., 1997).
Enfin, les kératinocytes ne possèdent pas de récepteurs au fibrin(ogène), ce qui semble leur
permettre de détacher le caillot lors de leur migration sur le site de la blessure (Kubo et al.,
2001). De plus, une autre équipe a proposé que, dans un premier temps, la fibrine activerait

70
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

indirectement la migration des kératinocytes en exposant le plasminogène aux cellules en

migration (Greer and Andreadis, 2003).

Figure 26 : représentation schématique du fibrinogène et de la fibrine montrant les principaux domaines structuraux, les
sites d’interactions qui participent à la polymérisation de la fibrine et quelques sites d’interactions cellulaires et moléculaires.
Fibrinopeptide A (FPA), Fibrinopeptide B (FPB). Des inhibiteurs de plasmine (PI) et des inhibiteurs d’activateurs du
plasminogène (PAI) sont présents également dans le plasma. Ils limitent une activation non spécifique de la plasmine à
distance du caillot à éliminer. L’activateur du plasminogène (tPA) se lie uniquement à la fibrine (Clark, 2003).

Finalement, la polymérisation et les propriétés uniques de la fibrine permettent la formation in

vitro de gels de fibrine, préparés à partir de fibrinogène et de thrombine. Ces gels sont
employés comme biomatériaux en clinique, pour améliorer la cicatrisation et arrêter les
saignements. Ils sont aussi utilisés comme matrice pour la culture bidimensionnelle ou
tridimensionnelle de cartilages et de tissus cardiovasculaires et nerveux. Enfin, des
kératinocytes mis en suspension dans de la fibrine ou des modèles d’épiderme reconstruit in

71
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

vitro comprenant à la fois des kératinocytes et des fibroblastes, peuvent servir à améliorer la
cicatrisation d’une plaie étendue (pour revue (Janmey et al., 2009)).

3- Les cellules inflammatoires et les cytokines

La libération des différents médiateurs vasoactifs et facteurs chimiotactiques par les
plaquettes et les cellules épithéliales activées, entraîne le recrutement de cellules
immunitaires, principalement les neutrophiles et macrophages, au niveau du site de la lésion.
La réponse inflammatoire est aussi caractérisée par une expression coordonnée des
leucocytes, spatialement et temporellement, et le respect de la chronologie de ces événements
est indispensable à une bonne réparation cutanée (Martin, 1997; Singer and Clark, 1999).

a- Les polynucléaires neutrophiles.

Les neutrophiles sont les premières cellules à infiltrer la plaie. Ils vont jusqu’à constituer plus
de 50% de la population cellulaire (un jour après blessure), afin de former une barrière dense
contre les pathogènes (Engelhardt et al., 1998). Les plaquettes et les neutrophiles sont piégés
et agrégés dans le caillot et relarguent de nombreux facteurs qui vont permettre d’amplifier
l’agrégation, de déclencher la coagulation ou d’attirer d’autres cellules immunitaires
(Szpaderska et al., 2003). Dans les heures qui suivent la blessure, les neutrophiles migrent par
diapédèse sur le site de la plaie à travers les cellules endothéliales des capillaires. Celles-ci
sont activées par des cytokines proinflammatoires, comme l’interferon γ (IFNγ) ou le « tumor
necrosis factor α » (TNFα), et expriment de nombreuses molécules d’adhésion, des
adhésines, qui, en interagissant avec les intégrines présentes à la surface des neutrophiles,
vont augmenter leur adhésion et leur diapédèse.
De nombreuses substances chémotactiques (chémokines) permettent d’augmenter la
migration des lymphocytes vers la blessure : citons l’interleukine 8 (IL-8), la « monocyte
chemoattractant protein » (MCP-1), NAP-2 (neutrophil activating peptide 2) dont le
précurseur est relargué par les plaquettes, et GROα (growth related oncogene) sécrétée par les
cellules endothéliales (Brandt et al, 2000; DiPietro et al., 1995; Rennekampff et al., 2000).
Ces deux dernières chémokines interagissent sur un même récepteur présent à la surface des
neutrophiles, CXCR2. Or, lorsqu’un récepteur est saturé par de trop fortes concentrations de
chémoattractant il finit par être désensibilisé, ce qui expliquerait qu’au bout de quelques jours
les neutrophiles ne sont plus attirés vers le site (Gillitzer and Goebeler, 2001). De plus
d’autres cytokines pro-inflammatoires comme le TNF-α ou l’interleukine 1 (IL-1) libérée par

72
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

les kératinocytes blessés immédiatement après la lésion, ou au contraire anti-inflammatoires

comme l’interleukine 10 (IL-10), contribueraient à réguler la migration des neutrophiles (Sato
et al., 1999; Singer and Clark, 1999).
Des produits de dégradation bactérienne, l’activation du complément ainsi que des produits de
dégradation de la fibrine jouent également un rôle dans le recrutement des neutrophiles.
Les neutrophiles éliminent les débris cellulaires et tissulaires et luttent contre les agents
infectieux par phagocytose en relarguant de nombreuses substances antimicrobiennes. Ils sont
eux-mêmes source de cytokines pro-inflammatoires (comme l’IL-1, IL-6 et TNF-α) et
peuvent à leur tour activer les macrophages.
Toutefois, la déplétion des neutrophiles par l’introduction d’antisérum anti-polynucléaires
dans une plaie aseptique chez le cobaye ne retarde pas la cicatrisation (Simpson and Ross,
1972). Cependant, le même type de déplétion induit un retard de cicatrisation chez les souris
âgées, retard certainement lié à une compensation réduite des fonctions des neutrophiles par
les autres cellules inflammatoires (Nishio, 2008).

b- Les macrophages
Après quelques jours, l’infiltration des neutrophiles s’arrête, et une partie de ces cellules entre
en apoptose avant d’être remplacée par des macrophages.
Les monocytes migrent dans le tissu où ils sont activés en macrophages qui deviennent alors
les cellules prédominantes pendant tout le reste de l’inflammation. Les monocytes sont attirés
sur le site de la lésion par certains des chémoattractants qui attirent les neutrophiles, comme
les facteurs libérés lors de la coagulation, des facteurs de croissance, l’hypoxie, des cytokines
inflammatoires et par la protéine inflammatoire du macrophage MCP-1 ou RANTES
(DiPietro et al., 1998; Frank et al., 2000; Werner and Grose, 2003). Ces molécules sont
produites par les plaquettes piégées dans le caillot de fibrine, les leucocytes dont les
macrophages eux-mêmes, les fibroblastes et les kératinocytes hyperprolifératifs présents en
bordure de la plaie qui contribuent ainsi à l’inflammation en sécrétant notamment MCP-1.
Les macrophages sont des cellules essentielles lors de la cicatrisation. Ils possèdent des
fonctions immunologiques de phagocytose et de cellule présentatrice d’antigène et sont une
source majeure de cytokines (comme les interleukines IL-1et 6 et le TNF-α) et de facteurs de
croissance. Ils digèrent et tuent les pathogènes, nettoient les débris tissulaires et phagocytent
les neutrophiles encore présents. Après la phagocytose, ces cellules relarguent des facteurs
chimiotactiques (comme la fibronectine) qui attirent les fibroblastes sur la zone lésée. Ils

73
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

jouent aussi un rôle dans l’angiogenèse et les facteurs de croissance qu’ils produisent sont
impliqués dans la migration cellulaire, la prolifération et la production de matrice afin de
former le tissu de granulation (Eming et al., 2007a).

c- Les mastocytes
Les dernières cellules présentes lors de la phase inflammatoire sont les mastocytes qui sont
aussi une source importante de cytokines et médiateurs pro-inflammatoires. Ces cellules, déjà
présentes dans la peau non lésée, vont dégranuler dans les heures qui suivent la blessure.
Des expériences de déplétion de ces cellules ont montré qu’elles pourraient jouer un rôle dans
l’inflammation, notamment en modulant l’infiltration des neutrophiles (Egozi et al., 2003),
mais pas sur la cicatrisation globale (Iba et al., 2004), alors qu’une étude plus récente a décrit
un impact sur la perméabilité vasculaire et le taux de fermeture de la plaie (Weller et al.,
2006).

d- Les lymphocytes T
Ils interviennent plus tard, lorsque la blessure est rebouchée, lors de la phase de remodelage
où ils constituent le type cellulaire le plus fréquent. Ils sont attirés sur le site de la plaie par
des chémokines comme le MCP-1 ou des cytokines comme l’IFNγ principalement secrétés
par les macrophages.

L’importance de la présence de ces différents types de cellules lors de l’inflammation cutanée

au cours de la cicatrisation est encore mal comprise. De récentes études effectuées à l’aide de
souris transgéniques suggèrent qu’aucun de ces types cellulaires n’est réellement
indispensable à une bonne cicatrisation, voire même qu’ils pourraient la ralentir (tableau 5)
(Martin and Leibovich, 2005). Cependant, des blessures effectuées sur des animaux dans un
environnement exempt de tout pathogènes cicatrisent beaucoup plus lentement (Tipton and
Dingman, 1966), et l’inhibition d’expression de certaines cytokines peut entraîner des
troubles ou au contraire des améliorations de la cicatrisation (Eming et al., 2007b; Gallucci et
al., 2000; Ishida et al., 2004). Tout ceci démontre le rôle essentiel de la phase inflammatoire
dans ce processus, même si les mécanismes qui la composent ne sont pas encore
complètement établis.

74
 Chapitre 2 – La cicatrisation cutanée
La phase inflammatoire

Tableau 5 : conséquences de l’inhibition des médiateurs de la phase inflammatoire de la cicatrisation cutanée. D’après
(Martin and Leibovich, 2005).

Types cellulaires manquants

Méthodes Phénotype

Macrophages Neutrophiles Mastocytes

Mauvais
Antisera anti-macrophages absents débridement, retard
de la réparation

Normal, ré-
Antisera anti-neutrophiles absents épithélialisation plus
rapide

Macrophages plus
Antisera anti-plaquettes nombreux mais
cicatrisation normale

Réparation accélérée
PU.1 KO absents absents absents
et cicatrice diminuée

Neutrophiles plus
Kit W KO absents nombreux mais
cicatrisation normale

75
 Chapitre 2 – La cicatrisation cutanée
Ré-épithélialisation.

C- La phase de ré-épithélialisation (2 à 10 jours)

La deuxième phase de la cicatrisation consiste à reformer un nouveau tissu au niveau de la
plaie. C’est une phase essentiellement cellulaire qui permet de restaurer la fonction de barrière
épidermique grâce à la prolifération et à la migration des kératinocytes (figure 27). Les
cellules en bordure de la plaie vont rapidement migrer pendant que d’autres kératinocytes
prolifèrent afin de fournir un stock pour la formation du néo-épiderme, comprenant une
languette de migration kératinocytaire qui progresse des bords vers le centre de la plaie. Les
kératinocytes du néo-épiderme se différencient ensuite pour reformer un épiderme
fonctionnel. En parallèle de cette phase de re-formation d’une barrière imperméable se
déroulent une phase de re-vascularisation du tissu lésé (angiogénèse) qui permet l’apport
sanguin et une phase de renforcement du derme (fibroplasie).

Nouveau vaisseau
sanguin

Croûte

Monocyte Tissu de
Macrophage granulation

Figure 27 : représentation schématique de la phase de ré-épithélialisation. Cette phase est caractérisée par la formation
d’un nouveau tissu au niveau de la plaie. La plupart des types cellulaires présents lors de la phase inflammatoire ont migré
hors de la blessure et de nouveaux vaisseaux sanguins envahissent la zone lésée. D’après (Gurtner et al., 2008).

76
 Chapitre 2 – La cicatrisation cutanée
Ré-épithélialisation.

1- Formation d’un nouvel épiderme

a- Migration
Dans les premières 24 heures après blessure, la migration et la prolifération sont stimulées par
des facteurs de croissance libérés par les cellules endothéliales et les macrophages. Les
kératinocytes dis « activés » arrêtent de se différencier et commencent à migrer à partir des
bords de la plaie. Ils subissent pour cela de nombreux remaniements morphologiques (Singer
and Clark, 1999). Les kératinocytes s’aplatissent et s’allongent, et développent des projections
ressemblant à des pseudopodes et des lamellipodes grâce à un remaniement du cytosquelette
d’actine (figure 28). Ces structures adhèrent aux tissus environnants grâce aux intégrines,
notamment en se liant au collagène présent dans la matrice extracellulaire nouvellement
formée, mais aussi à différentes protéines de la matrice (comme la fibrine, la fibronectine ou
la vitronectine) et permettent le déplacement cellulaire. Pour pouvoir migrer, les kératinocytes
perdent le contact cellulaire et matriciel, notamment grâce à une altération des desmosomes et
hémidesmosomes, et se rétractent, provoquant un élargissement des espaces intercellulaires.
Enfin, ils produisent des métalloprotéases et l’activateur de plasminogène afin de dégrader,
respectivement, les composants de la matrice et la fibrine du caillot ; de plus, ils sont capables
de phagocyter les débris présents sur leur passage, cette phagocytose étant visible sous forme
de larges vacuoles dans leur cytoplasme (Coulombe, 2003; Odland and Ross, 1968). Ces
kératinocytes proviennent des couches basales et suprabasales de l’épiderme proche de la
blessure. Ces changements morphologiques visibles au cours de leur transformation sont
induits par des remaniements moléculaires incluant des modifications d’expression génique et
de régulation des protéines (Santoro and Gaudino, 2005).
Ainsi, les kératines du cytosquelette subissent des modifications : K6, K16 et K17, marqueurs
des cellules hyperolifératives, apparaissent très rapidement dans les cellules en bordure de la
plaie et dans la languette de ré-épithélialisation alors que les kératines K1 et K10, spécifiques
des cellules différenciées voient leur expression fortement diminuée (Mansbridge and Knapp,
1987). Il existe des études contradictoires quant au site exact d’expression de K6/K16 : elles
seraient exprimées soit uniquement dans les couches suprabasales du néo-épiderme (Patel et
al., 2005) soit également dans les cellules basales en migration (Usui et al., 2005). Le rôle
fonctionnel de ce changement d’expression des kératines en réponse à une blessure n’est
toujours pas clair. Par exemple, la délétion du gène codant pour la kératine K6a n’induit pas

77
 Chapitre 2 – La cicatrisation cutanée
Ré-épithélialisation.

de défauts de cicatrisation même si les kératinocytes hyperprolifératifs et en migration des

/
souris Krt6a n’expriment ni K6a ni l’autre isoforme murine K6b (Wojcik et al., 2000).

.
Figure 28 : Histologie de la réparation cutanée. (A) Coupe en résine de kératinocytes en avant de la languette de ré-
épithélialisation (flèche) migrant sous le caillot (C). (B) image de microscopie électronique à transmission d’une cellule en
migration avec une morphologie en lamellipode (flèche). Barre d’échelle : 100 µm (A) et 1 µm (B). D’après des images de
M. Turmaine (Martin, 1997).

b- Prolifération
Pendant la ré-épithélialisation, de nouveaux kératinocytes doivent être produits pour pouvoir à
leur tour migrer afin de former la languette du néo-épiderme qui progresse le long de la
blessure pour reboucher la plaie. Quelques heures après le début de la migration, le taux de
prolifération est augmenté en position distale par rapport à la languette de migration. Les
kératinocytes qui migrent sur la plaie sont issus de deux types différents de cellules souches
épithéliales : celles de la couche basale de l’épiderme interfolliculaire et celles provenant du
« bulge » des follicules pileux proches de la plaie (Ito, 2005). Cependant, les cellules
provenant du « bulge » ne semblent pas indispensables à la cicatrisation, même si elles y
contribuent, les cellules présentes dans l’épiderme interfolliculaire non lésé pouvant à elles
seules permettre la fermeture de la plaie (Gurtner et al., 2008; Langton et al., 2007).
Enfin, en 2007 une équipe a mis en évidence un phénomène intéressant : lors d’une blessure
excisionnelle de grande taille non suturée faite sur le dos de souris, de nouveaux follicules
pileux sont entièrement reconstitués lors du processus de cicatrisation à partir de cellules
dérivées de l’épiderme interfolliculaire et non du « bulge » d’autres follicules pileux (Ito,
2007).

c- Régulation par les facteurs de croissance et les cytokines

De nombreuses protéines sont impliquées dans la ré-épithélialisation. C’est le cas de protéines
de la matrice extracellulaire et de leurs récepteurs, de protéases, de protéines du cytosquelette

78
 Chapitre 2 – La cicatrisation cutanée
Ré-épithélialisation.

comme les kératines et de nombreuses enzymes. Mais de nombreux facteurs de croissance

(fibroblast growth factor FGF, keratinocyte growth factor KGF, TGFα, TGFβ, EGF), libérés
par les kératinocytes eux-mêmes ou les cellules avoisinantes comme les macrophages, les
fibroblastes ou les plaquettes permettent également de réguler cette étape en stimulant la
migration et la prolifération des kératinocytes.
Des cytokines pro-inflammatoires comme le TNFα, l’IL-1 et l’IL-6 et des chémokines
comme l’IL-8 et GROα chez l’Homme ou MIP2 et KC chez la souris, qui possèdent un
pouvoir chémoattractant pour les neutrophiles lors de la phase inflammatoire, permettent aussi
de réguler la ré-épithélialisation. L’IL-1 libérée par les cellules immunitaires, les fibroblastes
et les kératinocytes, en plus de ses propriétés chémoattractives, peut induire l’expression de
K6 et K16 et augmenter la migration et la prolifération des kératinocytes (Raja et al.,2007).
L’IL6, produite par les monocytes et les neutrophiles, est impliquée dans l’initiation de la ré-
épithélialisation. L’IL-8 est capable de stimuler in vitro la migration et est fortement exprimée
en bordure de plaie, zone d’où les kératinocytes migrent pour refermer la plaie (Gillitzer and
Goebeler, 2001). L’expression de GROα est augmentée lors de blessures aiguës et des études
in vitro suggèrent qu’elle joue un rôle dans la migration kératinocytaire. De plus, les
kératinocytes possèdent le récepteur pour ces deux chémokines (CXCR2), et son inactivation
entraîne des défauts de ré-épithélialisation (Devalaraja et al., 2000).

d- La maturation du néo-épiderme
Elle se fait simultanément avec la fermeture de la plaie et correspond à une reprise de la
fonction et de la morphologie normale des kératinocytes. Les cellules se différencient à partir
des bords de la languette de ré-épithélialisation proliférative vers le centre jusqu’à reformer un
épiderme différencié et fonctionnel. La réapparition des kératinosomes et l’expression des
marqueurs de différenciation comme la filaggrine ou les kératines suprabasales
permettentd’évaluer la progression de la différenciation. La filaggrine normalement exprimée
dans la couche granuleuse est détectée dans les couches les plus superficielles de la languette
du néo-épiderme (Kurokawa et al., 2006; Mansbridge and Knapp, 1987).

2- Angiogénèse
Simultanément, lors de la ré-épithélialisation, de nouveaux capillaires se forment à partir des
vaisseaux adjacents à la blessure afin de pourvoir les cellules qui migrent en nutriments : c’est
l’angiogenèse. Les principaux activateurs de l’angiogenèse sont deux facteurs de croissance,

79
 Chapitre 2 – La cicatrisation cutanée
Ré-épithélialisation.

le « vascular endothelial growth factor A » (VEGFA) et le « fibroblast growth factor 2 »

(FGF2; aussi connu comme bFGF) (Gurtner et al., 2008). Le VEGF peut être produit par de
nombreux types cellulaires comme les kératinocytes, les cellules endothéliales et les
fibroblastes, et son expression est augmentée lors de la cicatrisation. Le bFGF est libéré par
les macrophages dès la phase inflammatoire. Les cellules endothéliales des capillaires peuvent
elles aussi migrer sur le site de la blessure, mais ne peuvent pas proliférer. Les nouveaux
vaisseaux formés participent à la composition du tissu de granulation et apportent des
nutriments et de l’oxygène aux tissus environnants. Les cellules endothéliales peuvent aussi
sécréter de nombreuses substances actives parmi lesquelles des cytokines (pour revue :
Tonnesen et al., 2000).

3- Formation du tissu de granulation et fibroplasie

La reconstruction du derme ou fibroplasie démarre 3 à 4 jours après la blessure et est
caractérisée par la formation d’un tissu de granulation. La fibronectine de la matrice
extracellulaire provisoire promeut la formation de ce tissu de granulation en permettant la
migration des cellules. Grâce aux facteurs de croissance, à des cytokines et aux propriétés de
la matrice extracellulaire, les fibroblastes vont être activés. Ils migrent et prolifèrent dans le
derme en sécrétant de nombreuses protéases afin de dégrader le caillot et les protéines de la
matrice. Au cours de leur migration, ils synthétisent des constituants de la matrice composée
majoritairement de collagène, de protéoglycanes et d’élastine. Dans la peau normale, le
collagène de type I et le collagène de type III constituent respectivement 80 % et 10 % du
collagène total présent. Dans le cas d’une blessure aiguë, ce rapport est inversé et les
fibroblastes synthétisent majoritairement du collagène de type III (Abercrombie et al., 1956).
Le dépôt de collagène débute dans les premiers jours puis atteint un maximum à trois
semaines. L’association entre cette matrice, les capillaires, les macrophages et les fibroblastes
va permettre de former le tissu de granulation, nommé ainsi à cause des nombreux capillaires
qu’il comporte, visibles en histologie, qui servira de nouvelle matrice pour les kératinocytes
en fin de processus.
Les fibroblastes développent un phénotype de cellules migratoires caractérisé par la présence
de faisceaux d’actine dans leur cytoplasme capables de générer de petites forces de traction.
Au fur et à mesure qu’ils remodèlent la matrice extracellulaire, ils en augmentent les
contraintes et se différencient à nouveau. Les fibroblastes vont alors être stimulés par les
macrophages et certains d’entre eux vont se différencier en myofibroblastes contractiles

80
 Chapitre 2 – La cicatrisation cutanée
Ré-épithélialisation.

caractérisés par l’expression de l’isoforme d’actine spécifique du muscle lisse (α smooth

muscle actin). Cette différenciation est stimulée par les facteurs de croissance comme le
TGFβ1, des protéines de la matrice comme la fibronectine et les propriétés mécaniques du
microenvironnement. Les myofibroblastes sont les acteurs prédominants de la contraction de
la blessure. Ils s’alignent le long des fibres de contraction du tissu et permettent de contracter
la blessure le long des lignes de tension de la peau. Leurs pseudopodes s’allongent et l’actine
se lie à la fibronectine, attache les fibres de collagène et se rétracte en tirant les fibres de
collagène vers les cellules. Lorsque la blessure est rebouchée, les myofibroblastes sont
éliminés par apoptose (pour revue : Desmoulière et al., 2005; Tomasek et al., 2002).

4- Reformation de la lame basale

La lame basale commence à se reformer entre 7 et 9 jours après le début de la ré-
épithélialisation. Les kératinocytes produisent une membrane basale provisoire pendant leur
migration. Une membrane basale mature est ensuite reconstruite, sa formation débute par les
bords de la plaie en progressant vers le centre, fixant au fur et à mesure l’épiderme au derme
sous-jacent pendant que la fibrine et la fibronectine disparaissent progressivement.

81
 Chapitre 2 – La cicatrisation cutanée
Remodelage

D- La phase de remodelage (deux semaines à plusieurs années)

Figure 29: représentation schématique de la phase de remodelage. Cette étape peut parfois durer plusieurs années. La
blessure est refermée et la plupart des cellules ont migré hors du site de blessure ou sont entrées en apoptose en laissant une
masse tissulaire composée de collagène et de protéines de la matrice. D’après (Gurtner et al., 2008).

Même si la matrice extracellulaire est remodelée pendant tout le processus de cicatrisation, la

phase de remodelage proprement dite débute deux à trois semaines après la blessure et dure
quelques années (figure 29). Lors de cette phase, de nombreux processus activés lors de la
cicatrisation vont s’arrêter. La plupart des cellules migrent hors du site de la blessure ou
entrent en apoptose (Desmouliere et al., 1995) comme les capillaires du tissu de granulation,
afin de laisser une masse tissulaire constituée principalement de collagène et de protéines de
la matrice. Le collagène de type III est progressivement dégradé et remplacé par du collagène
de type I, plus résistant (Welch et al., 1990). Ce processus est accompli grâce à un équilibre
entre synthèse et lyse de collagènes, finement contrôlé par l’action combinée des
métalloprotéases de la matrice et de leurs inhibiteurs. Ces métalloprotéases constituent une
famille d’enzymes impliquées dans la dégradation protéolytique de nombreuses protéines.
Elles sont synthétisées par les fibroblastes, les macrophages et les cellules endothéliales
(Madlener et al., 1998).

82
 Chapitre 2 – La cicatrisation cutanée
Régulation multifactorielle

E- Régulation de la cicatrisation : une régulation multifactorielle

La cicatrisation est un processus complexe régulé à de nombreux niveaux. Les protéines de la
matrice et leurs récepteurs, les protéines du cytosquelette, des protéases, les cytokines et les
facteurs de croissance y jouent un rôle prépondérant comme nous venons de le voir. Mais de
très nombreuses autres molécules sont également impliquées, par exemple le calcium,
l’oxygène, et des hormones comme l’acétylcholine. L’âge et le sexe sont connus pour influer
sur la rapidité et la qualité de la cicatrisation. Chez les sujets âgés, il existe un retard de
cicatrisation caractérisé par une réponse inflammatoire plus longue, une activité protéasique
augmentée et une diminution des dépôts de matrice extracellulaire.

1- Les hormones sexuelles

Elles possèdent elles aussi une grande influence sur la fermeture de la plaie. Les oestrogènes
ont un effet bénéfique sur la cicatrisation. Ils ont été utilisés en topique ou par voie orale pour
augmenter le taux de cicatrisation des sujets âgés, en particulier des femmes. Au contraire, la
testostérone retarde la cicatrisation et augmente la réponse inflammatoire, ce qui permettrait
d’expliquer pourquoi les hommes âgés cicatrisent moins bien que les femmes de même âge,
même traitées aux anti-oestrogènes. Le même phénomène est observé chez les rongeurs où la
réparation cutanée est améliorée chez les souris qui ont été déplétées en androgène, mais
diminuée chez les souris ovariectomisées. En particulier, le 17-β-estradiol prévient les lésions
cutanées induites par l’ischémie en favorisant l’angiogénèse. Œstrogènes et progestérone sont
issus du même précurseur, la déhydroépiandrostérone (DHEA) qui peut également améliorer
la cicatrisation et dont la voie d’action passerait par les oestrogènes (Toutain et al., 2009; pour
revue, Gilliver et al., 2007).

2- Les PPARs
Curieusement, des acides gras polyinsaturés qui activent les récepteurs PPARα, PPARβ/δ and
PPARγ, plus connus comme étant des régulateurs transcriptionnels du métabolisme
glucidique et lipidique sont également impliqués. Chez la souris, l’expression de PPARα et
PPARβ normalement indétectable dans l’épiderme interfolliculaire est activée au niveau des
bords de la blessure, lors de la phase inflammatoire pour PPARα et jusqu’à la fin de la ré-
épithélialisation pour PPARβ (Michalik, 2001). L’expression de PPARβ est induite via
l’activation du complexe AP-1 grâce à des cytokines pro-inflammatoires comme le TNFα.

83
 Chapitre 2 – La cicatrisation cutanée
Régulation multifactorielle

Une fois la plaie rebouchée, une autre cytokine, le TGF β-1, permet d’inhiber la liaison de
AP-1 sur le promoteur du gène de PPARβ (Tan et al., 2001). La production de souris KO pour
les gènes de PPARα et PPARβ a permis de confirmer l’importance de ces deux récepteurs
dans la cicatrisation. L’invalidation de PPARα entraîne une diminution du recrutement des
cellules immunitaires sur le site de la blessure alors que l’invalidation de PPARβ entraîne des
retards de cicatrisation (Michalik, 2001).

3- AP-1
De nombreux gènes codant pour des protéines clés de la cicatrisation possèdent des sites de
liaison au facteur de transcription AP-1 sur leurs promoteurs. C’est le cas de facteurs de
croissance (TGFβ), de cytokines, de kératines, de métalloprotéases et de molécules
d’adhésion comme des intégrines. D’un autre côté, l’expression des sous-unités d’AP-1 est
elle-même influencée par de nombreuses cytokines et facteurs de croissance (pour revue,
Angel et al., 2001). Chez l’Homme, une régulation biphasique de ces sous-unités a été
observée dans les kératinocytes après blessure. Tout d’abord il y a une inhibition des sous-
unités c-Jun, Jun D, c-Fos et Fos B qui sont absentes des noyaux des kératinocytes en bordure
de plaie, avant une augmentation d’expression des sous-unités c-Jun , Jun B, Jun D et c-Fos
(Neub et al., 2007). Des souris invalidées pour les gènes de ces sous-unités ont permis de
confirmer l’importance d’AP-1 dans la cicatrisation. L’invalidation de c-Jun induit un retard
dans la cicatrisation, avec une absence de migration des cellules épidermiques sous le caillot
de fibrine durant les premiers jours (Li, 2003). Celle de Jun B provoque également un retard
de cicatrisation associé à une différenciation anormale des kératinocytes et une inflammation
prolongée (Florin et al., 2006). De plus, le déficit de c-Jun peut être compensé par une
surexpression de Jun B (Weitzman et al., 2000).

84
 Chapitre 2 – La cicatrisation cutanée
Cicatrisation pathologique

F- Cicatrisation pathologique
De nombreux états pathologiques comme le diabète, les infections ou la dénutrition peuvent
engendrer des défauts de cicatrisation (ulcères, escarres ou blessures chroniques) ou une
fibrose excessive (cicatrices hypertrophiques et chéloïdes).

1- Retard de cicatrisation

Lors de blessures chroniques, les trois phases de la cicatrisation perdent leur synchronisation
et le phénotype de certaines cellules est altéré. Par exemple, les kératinocytes en bordure de
plaie perdent leur capacité à proliférer à cause d’une incapacité à répondre aux signaux
d’activation. Cette perte de synchronisation entraîne un retard dans le processus de
cicatrisation. Elle peut être provoquée par de nombreuses causes. Nous pouvons par exemple
mentionner une infection de la plaie par des microorganismes, une carence en vitamine A ou
C, une immunodépression, des troubles de la vascularisation ou de la coagulation, et le
diabète dont l’hyperglycémie altère les fonctions lymphocytaires et entraîne une hypoxie
cutanée.

2- Cicatrisation excessive
Les cicatrices chéloïdes ou hypertrophiques sont définies par une accumulation de collagène
due à une activité fibroblastique excessive au niveau du site de la blessure. Les chéloïdes
présentent d’abord l’aspect de cicatrices hypertrophiques (cicatrice épaissie, érythémateuse) et
elles continuent d’évoluer après le 6ème mois, sans amélioration spontanée. Elles récidivent en
cas d’ablation chirurgicale. On retrouve également dans ces pathologies des défauts de
migration et de prolifération cellulaire, et de remodelage de la matrice.

3- Les cicatrices rétractiles

Elles surviennent généralement après des brûlures profondes et ont pour conséquence une
rétraction excessive des tissus qui peut notamment gêner la mobilité des membres. Ces
rétractions sont souvent dues à la mauvaise orientation de la plaie par rapport aux lignes de
tensions physiologiques de la région concernée.

4- Le psoriasis : une blessure qui ne cicatrise pas?

Le psoriasis est une pathologie cutanée multifactorielle fréquente atteignant 2% de la
population mondiale. Il existe différents types de psoriasis dont les manifestations cliniques

85
 Chapitre 2 – La cicatrisation cutanée
Cicatrisation pathologique

communes sont la présence de plaques érythémateuses et squameuses qui apparaissent par

poussée, une infiltration de lymphocytes T et de macrophages dans le derme et l’épiderme,
une hyperprolifération et des altérations de différenciation des kératinocytes. C’est une
maladie chronique qui évolue de façon très individuelle avec parfois des phases de rémission
au cours desquelles les lésions disparaissent. Elle est d’origine multifactorielle avec à la fois
des composantes génétique, immune, microbiologique et environnementale. De nombreux
locus de susceptibilité ont été identifiés, en particulier le locus PSORS1 sur le chromosome
6p21 dans la région des allèles HLA et du gène de la CDSN. Des polymorphismes
d’ADAM33, un gène également retrouvé dans la susceptibilité à l’asthme, ont été récemment
associés avec le psoriasis.
Plusieurs auteurs ont comparé le psoriasis à une cicatrisation persistante (Mansbridge and
Knapp, 1987; McKay and Leigh, 1995; Nickoloff et al., 2006). Dans les deux cas, il y a
présence d’un remodelage tissulaire important. La peau lésée est caractérisée par une
acanthose, une hyperkératose et une fibrose dermique, une dilatation des vaisseaux et une
infiltration de cellules immunitaires. De nombreuses molécules sont engagées à la fois dans la
cicatrisation et le psoriasis comme des facteurs de croissance (le TGFα, l’IGF-1 et le VEGF),
des interleukines (IL-6, IL-8 et IL-15), du TNFα et des métalloprotéases. Dans l’épiderme
psoriasique lésionnel comme dans le néo-épiderme cicatriciel, les kératines
hyperprolifératives K6/K16 sont exprimées dans les couches suprabasales. De plus, certains
malades déclenchent une poussée lésionnelle après une blessure légère, c’est le phénomène de
Koebner. Comme au cours de la cicatrisation, il existe une altération de l’expression des
facteurs AP-1 dans le psoriasis avec une forte diminution des ratios Jun B/c-Jun.
L’invalidation de ces facteurs spécifiquement au niveau de la peau entraîne un phénotype
semblable au psoriasis avec une inflammation persistante (Zenz et al., 2005). Lors du
psoriasis, en revanche, on observe une réponse angiogénique exagérée et l’activation
permanente du système immunitaire.

86
 Chapitre 2 – La cicatrisation cutanée
Modèles animaux

G- Modèles animaux d’étude de la cicatrisation

La cicatrisation est un phénomène extrêmement complexe, mettant en jeu des interactions
entre de nombreux types cellulaires, sa modélisation in vitro est en conséquence relativement
limitée. Des modèles de culture cellulaire peuvent toutefois être utilisés comme par exemple
la scarification d’une monocouche de kératinocytes en culture. Les interactions
fibroblastes/kératinocytes peuvent être étudiées à l’aide d’épidermes reconstruits. Mais ces
techniques restent toutefois complémentaires des études in vivo, généralement réalisées avec
des souris, en particulier des animaux transgéniques qui ont permis d’établir une meilleure
compréhension des mécanismes de la cicatrisation ces dernières années (tableau 6).
Cependant, des différences importantes existent entre la cicatrisation chez l’Homme et la
souris, la principale étant que la peau de souris, qui n’est pas attachée au fascia sous-jacent,
cicatrise beaucoup plus rapidement que la peau humaine du fait d’une plus forte contraction
de la blessure par les myofibroblastes du derme. Le porc, dont la cicatrisation est plus proche
de la cicatrisation humaine est également utilisé comme modèle. En effet, la peau du porc
ressemble à la peau humaine avec la même épaisseur d’épiderme et de derme, le même ratio
de follicules pileux, un contenu en collagène similaire ainsi qu’une même réponse aux
cytokines et facteurs de croissance. Néanmoins, les coûts et les difficultés de mise en place
d’études sur ces animaux imposants n’en font pas le premier modèle d’étude de la
cicatrisation.
Les types de blessures les plus couramment effectuées chez les souris sont les blessures dites
« incisionnelles » et « excisionnelles ».
- Blessure incisionnelle : des incisions sont effectuées sur le dos des souris et sont suturées.
Cependant, la fermeture de la plaie survenant dans les 24 heures, il est parfois difficile de
distinguer et d’étudier les différentes phases de la cicatrisation.
- Technique du punch : ce modèle est le plus utilisé. Une excision circulaire est réalisée sur le
dos ou les flancs des souris grâce à un emporte-pièce (punch). Ce modèle permet de créer des
blessures bien calibrées dont le diamètre est facilement contrôlable. Il peut être amélioré en
utilisant des anneaux de silicone du diamètre de la blessure, qui, en étant cousus à même la
peau, permettent de prévenir la contraction du derme et de se rapprocher de la cicatrisation
humaine.
En général, les blessures sont analysées selon des études histomorphométriques en mesurant
par exemple la vitesse de cicatrisation, la taille de la languette de prolifération ou l’épaisseur

87
 Chapitre 2 – La cicatrisation cutanée
Modèles animaux

du tissu de granulation. L’immunohistochimie permet également de donner des informations

pertinentes à la fois quantitatives, spatiales et temporelles sur l’expression des protéines. Il est
aussi possible de mener des études biomécaniques comme la tensiométrie qui mesure la force
de tension du tissu lors de la fermeture d’une plaie incisionnelle, mais également des
techniques classiques de biologie cellulaire et moléculaire comme la PCR quantitative, le
western blot ou l’analyse transcriptionnelle à l’aide de micropuces.

88
 Chapitre 2 – La cicatrisation cutanée
Modèles animaux

Tableau 6 : état des lieux des études sur la cicatrisation menées à l’aide de souris transgéniques et KO en 2004. D’après (Grose and Werner, 2004).
89
90
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Introduction

III- LES PEPTIDYL-ARGININE DESIMINASES

A- Introduction
Les peptidyl-arginine désiminases (PADs chez l’Homme et Pads chez la souris) appartiennent
à une famille d’enzymes dont le rôle physiologique est encore mal compris mais qui, du fait
de leur implication dans de nombreux mécanismes physiopathologiques, font l’objet d’un
nombre grandissant de publications ces dernières années.
Les PADs sont les catalyseurs d’une réaction appelée désimination (ou citrullination)
caractérisée pour la première fois en 1977 par Rogers et Taylors dans le follicule pileux
(Rogers, 1977). L’enzyme responsable de cette réaction fut ensuite purifiée et caractérisée à
partir d’un extrait protéique d’épiderme de rat (Fujisaki and Sugawara, 1981).

B- Caractéristiques des PADs

1- La réaction de désimination
La désimination est une modification post-traductionnelle au cours de laquelle les PADs
transforment un résidu arginyl en résidu citrullyl au sein d’une séquence peptidique, en
présence de calcium (figure 30).

NH2 NH2
I PAD I
C=NH2+ C=O
I I
NH + H20 NH + NH3
I Ca 2+ I
(CH2)3 (CH2)3
I I
– C
HN – – CO – C
– HN – – CO –
I I
H H
Résidu Résidu
ARGINYL CITRULLYL

Figure 30 : la désimination. C’est la transformation, sous l’action d’une PAD, d’un résidu arginyl (chargé positivement) en
résidu citrullyl (neutre), en présence de calcium.

91
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

L’action des PADs sur les arginines libres, non intégrées à une séquence peptidique, est
négligeable. La réaction qui convertit une L-arginine libre en L-citrulline libre est réalisée
indépendamment du calcium par des synthases d’oxyde nitrique. Une citrulline libre peut
aussi provenir de la conversion de l’ornithine en citrulline lors du cycle de l’urée grâce à
l’ornithine carbamoyltransférase.
La citrulline est un acide aminé ubiquiste et non essentiel chez l’Homme. Comme il n’existe
pas de codon spécifique pour cet acide aminé, sa présence dans une séquence peptidique est
toujours le résultat d’une modification post-traductionnelle réalisée par les PADs. Au cours de
la transformation des arginines en citrullines dans une séquence peptidique, la charge positive
de la protéine cible est diminuée, ce qui peut entraîner des changements de sa conformation,
et donc de sa fonction.
Bien qu’elle soit détectée dans la plupart des tissus, les cibles de cette modification et son rôle
physiologique n’ont pas encore été complètement élucidés.

2- Le locus des gènes des PADs

A ce jour, les données génomiques disponibles ont permis de démontrer l’existence de cinq
isotypes de PADs : les PAD1, 2, 3, 4 et 6 (la PAD4 ayant d’abord été désignée comme
PAD5), codées par 5 gènes dénommés PADI. Ces gènes sont localisés au sein d’un même
locus sur le chromosome 1 chez l’Homme, 4 chez la souris et 5 chez le rat (figure 31). Chez
l’Homme, ce locus s’étend sur 355 kb en position 1p35-36. Chez la souris et le rat, les gènes
Padi sont regroupés sur des régions d’environ 240 kb respectivement en position 4E1 et 5q36
(Chavanas et al., 2006).
Les 5 gènes PADI possèdent une longueur variable et des régions intergéniques de taille
hétérogène mais une organisation identique : ils sont tous divisés en 16 exons avec une
position intron/exon conservée.

92
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

A B

Figure 31 : organisation génomique du locus des PADs chez l’Homme (1p35-36) et la souris (4E1). Idéogramme du
chromosome 1 humain et du chromosome 4 de souris montrant la localisation et l’orientation des gènes PADI/Padi. A) Le
gène PADI/Padi2 est orienté dans la direction inverse de celle des quatre autres gènes. Hs : Homo sapiens, Mm : Mus
musculus. Les gènes PADI/Padi1, 2, 3, 4 et 6 sont représentés respectivement en rouge, bleu, vert, orange et violet. B) Pour
chaque locus, la taille des gènes (au-dessous) et des régions intergéniques (au-dessus) est indiquée en kb. Les flèches
ouvertes représentent la direction de transcription de chaque gène. D’après Voossenar et al., 2003 (A), Méchin et al., 2005
(B).

3- Conservation des séquences des gènes PADI

Les séquences codantes des gènes PADI présentent 59 à 71% d’identité, et les protéines
correspondantes, 44 à 57% d’identité (tableau 7). La PAD6 est l’isotype le moins conservé
avec 44% d’identité avec les autres PADs humaines et 66% avec son orthologue de souris ;
tandis que la PAD2 est la plus conservée, avec 92% d’identité entre les orthologues humain et
murin.
La construction d’un arbre phylogénétique basé sur la comparaison des séquences des PADs
des oiseaux à l’Homme révèle que le gène de la PAD2 est le premier à avoir divergé d’un
ancêtre commun et a probablement conservé sa fonction biologique ancestrale, tandis que les
autres gènes PADI ont divergé à la suite d’une spécialisation tissulaire ou par l’apparition de
nouvelles fonctions biologiques spécifiques. La conservation de régions intergéniques suggère
qu’elles jouent un rôle dans la régulation de ces gènes PADI.

93
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

A
% PAD1 PAD2 PAD3 PAD4 PAD6 pI kDa
homologie
PAD1 100 65 68 71 59 6.01 74.6
PAD2 100 67 65 59 5.40 75.3
PAD3 100 68 60 5.25 74.6
PAD4 100 61 6.15 74.0
PAD6 100 4.97 77.7

B
Comparaison des séquences
% d’identité
protéiques Homme/souris

PAD1/Pad1 76

PAD2/Pad2 92

PAD3/Pad3 87

PAD4/Pad4 73

PAD6/Pad6 66

Tableau 7 : pourcentage d’identité entre les séquences codantes (A) des paralogues humains des PADs, et (B) des
orthologues de PADs humaines, et de souris (Pads). Ces données proviennent des séquences des PADI1, 2, 3, 4 et 6
humains (GenBank AB033768, AB030176, AB026831, AB017919 et AY422079) et des Padi1-4 de souris (GenBank
AB013848, NM_008812, NM_011060 et AB013850). Le pI et la masse molaire déduits de la séquence en acides aminés des
PADs sont indiqués.

4- Profil d’expression
L’étude des profils d’expression des PADs a révélé une spécificité d’expression pour chaque
isotype aussi bien au niveau de l’ARNm que de la protéine (tableau 8).

a- Au niveau ARNm
Les transcrits de PADI1 sont principalement retrouvés dans l’épiderme, la prostate, les
testicules, le placenta, la rate et le thymus (Guerrin et al., 2003). La PAD2 est l’isoforme
ubiquitaire : ses ARNm ont été détectés dans tous les tissus testés (Nachat et al., 2004). PAD3
est l’isoforme dite « épidermique », car ses transcrits ont été retrouvés dans l’épiderme et le
follicule pileux, mais aussi dans d’autres organes comme le poumon, la prostate ou le rein,
tandis que PAD4 est absente de l’épiderme mais présente dans tout le système
hématopoiétique (Guerrin et al., 2003; Kanno et al., 2000; Nakashima et al., 1999). PAD6 est
exprimée essentiellement dans les ovaires, les testicules et les oocytes, mais aussi dans les
leucocytes du sang périphérique (Zhang et al., 2004).

94
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

PADI1 PADI2 PADI3 PADI4 PADI6

Peau + + + - -
Epiderme + + + - -
Poumon + + + + +
Testicule + + + + +
Cerveau - + - - -
Placenta + + - + -
Thymus + + + + -
Rate + + - + +
Intestin grêle - + + + -
Rein - + + + +
Ovaire - + - - +
Prostate + + + + -
Leucocytes du sang - + - + +
Foie + + - + +
Colon + + + - -
Muscle squelettique - + - - +
Pancréas + + + + -
Coeur - + - + -
Lignée HL-60 - + + + +
Tableau 8 : analyse de l’expression des gènes PADI dans différents tissus et organes humains par RT-PCR (+ :
détection d’un signal, - absence de signal) (Nachat, 2005).

b- Au niveau protéique
L’expression protéique des PADs a été décrite dans de nombreux organes et tissus.
L’isoforme de type 1 a été détectée dans toutes les couches de kératinocytes de l’épiderme
humain et de souris, mais également dans le follicule pileux, les muscles arrecteurs du poil et
les glandes sudoripares chez l’Homme (Mechin et al., 2005; Nachat et al., 2005a; Nachat et
al., 2005b).
Chez le rat et la souris des analyses immunohistologiques ont permis de localiser la Pad2 dans
de nombreux tissus ou organes dont le cerveau, l’utérus, les cellules hématopoïétiques,
l’hypophyse, le muscle squelettique et la peau (Akiyama et al., 1989, Mils et al., 1992;
Nachat et al., 2005a; Nagata and Senshu, 1990; Takahara et al., 1989; Watanabe et al., 1988).
Chez l’Homme, la PAD2 a été localisée dans le cytoplasme des cellules sécrétrices et
myoépithéliales des glandes sudoripares eccrines et apocrines (Urano et al., 1990), dans
l’épiderme (Ishigami et al., 2002), dans les muscles arrecteurs du poil (Nachat et al., 2005b)
ainsi que dans les monocytes et les macrophages (Vossenaar et al., 2004b). Elle est également
détectée en grande quantité dans le cerveau (Ishigami et al., 2002).

95
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

L’isoforme de type 3 semble être exprimée dans un nombre de tissus plus restreint. On la
retrouve dans les couches de kératinocytes les plus différenciés de l’épiderme et du follicule
pileux chez l’Homme et la souris (Kanno et al., 2000; Mechin et al., 2005; Nachat et al.,
2005a; Nachat et al., 2005b).
La PAD4 est l’isoforme nucléaire, elle est d’ailleurs la seule isoforme à posséder un signal de
nucléarisation et a été détectée dans le noyau des cellules HL-60 différenciées en granulocytes
ou en monocytes, les éosinophiles et les neutrophiles (Nakashima et al., 2002). La Pad4 est
également présente dans le cerveau de souris (Raijmakers et al., 2005).
Enfin la Pad6 a une expression tissulaire très spécifique des oocytes et blastocytes de souris
(Esposito et al., 2007).

5- Spécificité d’action des PADs

Une activité PAD a été détectée dans la plupart des tissus chez tous les vertébrés mais peu de
substrats physiologiques ont été identifiés. Il s'agit principalement de protéines riches en
arginine, structurales comme les kératines, la GFAP et la vimentine, et des protéines associées
aux filaments intermédiaires comme la filaggrine et la trichohyaline. Des protéines nucléaires
sont également la cible de la désimination comme les histones et la nucléophosmine ou encore
des protéines extracellulaires comme la fibrine et la fibronectine. Cependant, tous les résidus
arginyls ne peuvent être désiminés. L’action des PADs dépend alors de plusieurs facteurs
comme la position du résidu arginyl dans la séquence d’acides aminés, la nature des acides
aminés environnants ou les contraintes structurales ; une hélice α sera par exemple
difficilement citrullinée contrairement à un coude β qui sera une région très sensible (Tarcsa
et al., 1996). Il existe un anticorps capable de reconnaître toutes les protéines désiminées d’un
échantillon, en western blot comme en immunohistochimie, après modification chimique des
citrullines, l’anticorps AMC pour « Anti-Modified Citrulline » (Senshu et al., 1995; Senshu et
al., 1992).
La spécificité de substrat pour chaque isotype a pu être évaluée in vitro principalement grâce à
l’utilisation de PADs recombinantes. L'activité des PADs recombinantes est estimée grâce à
un test colorimétrique utilisant des substrats synthétiques dérivés de l'arginine. Elle diffère
pour chaque PAD, par exemple la PAD2 est l'isoforme la plus active sur le tosyl-L-arg-O-Me.
Les PAD1-3 recombinantes sont aussi capables de désiminer la filaggrine in vitro avec une
efficacité variable : la PAD2 possède une activité maximale alors que la PAD3 est la moins

96
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

active. Cette désimination de la filaggrine change ses propriétés de migration sur gel de
polyacrylamide en présence de dodécylsulfate de sodium (SDS) (figure 32).

Figure 32 : la désimination de la filaggrine change ses propriétés de

migration. Immunodétection de la filaggrine désiminée par l’anticorps
monoclonal AHF11. La désimination de la filaggrine par la PAD1 au cours du
temps (de 40 à 1140 minutes) induit un changement dans sa migration sur gel
SDS, sa masse moléculaire apparente passant de 45 à 66 kDa (Mechin et al.,
2005).

6- Modulateurs de l’activité des PADs

Le calcium étant indispensable à la désimination, les chélateurs de calcium, comme l’EGTA,
sont des inhibiteurs évidents de l’activité PAD.
Les autres inhibiteurs connus sont des agents capables de modifier les résidus cystéinyl,
comme le monoiodoacétamide ou le β chloromercuribenzoate (Fujisaki and Sugawara, 1981).,
ou des molécules capables d’interagir avec le site catalytique des PADs de manière à produire
une inhibition irréversible, comme le paclitaxel , le 2-chloroacétamine et le fluoro-amidine.
(Pritzker and Moscarello, 1998; Stone et al., 2005; Luo et al., 2006). Le paclitaxel, un dérivé
du taxol, est capable d’inhiber l’activité de la Pad2 bovine purifiée, alors que le 2-
chloroacétamide, le Cl- amidine et le fluoro-amidine sont des inhibiteurs de PAD4 agissant
via la modification d’un résidu cystéine indispensable à l’activité du site catalytique (Arita et
al., 2004). Cependant, l’action de ces inhibiteurs n’a pas été testée sur les autres isoformes des
PADs.

7- Structure cristallographique de la PAD4

La structure de la PAD4 humaine a été résolue à 2.3Å (figure 33) grâce à la cristallisation de
la PAD4 libre ou complexée avec un substrat synthétique (le benzoyl-L-arginine amide) ou
naturel (peptides N-terminaux des histones H3 et H4).
Les données cristallographiques ont permis de mettre en évidence le repliement de la protéine
en deux domaines. Le domaine N-terminal comprend deux sous-domaines « immunoglobulin
like » et le domaine C-terminal comprend le site actif sous forme d’un sillon qui fixe le
substrat au cœur de cinq modules ββαβ circulaires et pseudosymétriques (hélice α/β). Au
moins sept acides aminés, très conservés entre les différents isotypes (sauf pour PAD6

97
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Caractéristiques des PADs

confirmant encore que cette isoforme est la plus divergente), sont impliqués dans la formation
du site catalytique. La PAD4 possède également cinq sites de fixation au calcium, deux dans
le domaine C-terminal et trois dans le domaine N-terminal. La fixation des ions calcium dans
le domaine N-terminal provoque une modification de conformation de la molécule dans ce
même domaine qui pourrait être à l’origine du contrôle de l’activité enzymatique par le
calcium ou pourrait réguler l’interaction enzyme–substrat. En présence de calcium, la
structure de la PAD4 est sensiblement la même en l’absence ou en présence de substrat,
indiquant que la fixation du substrat n’influe pas sur la formation du site actif. En revanche la
liaison de deux ions calcium en C-terminal est essentielle à l’activation de l’enzyme.
L’analyse cristallographique suggère également que la PAD4 pourrait former des dimères
grâce à l’association tête-bêche du domaine N-terminal d’une première molécule avec le
domaine C-terminal d’une deuxième molécule (Arita et al., 2004).
Enfin, l'étude de la PAD4 en présence de son substrat naturel a révélé l’importance pour la
reconnaissance de l’arginine cible, d’une conformation désordonnée (déstructurée) du peptide
portant le résidu arginyl (Arita et al., 2006).

Figure 33 : structure tridimensionnelle de la PAD4.

a) Représentation de PAD4 sous forme de monomère complexé avec un substrat synthétique. Les 5 ions Ca2+ (Ca1–Ca5) sont
indiqués sous forme de boules noires, et le substrat, benzoyl-L-arginine amide, est représenté en bleu foncé selon le modèle "
boules et bâtons". Les sous-domaines 1 et 2 et le domaine C-terminal sont respectivement en jaune, vert et rouge. La région
correspondant au signal de localisation nucléaire (NLS) est indiquée sous forme de pointillés.

b) Représentation sous forme de dimère complexé avec un substrat synthétique (benzoyl-L-arginine amide). L'axe
cristallographique est orienté verticalement à travers le centre du dimère (Arita et al., 2004).

98
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

C- Rôles physiologiques des PADs

Du fait de leur très large répartition tissulaire, les PADs devraient être impliquées dans de
nombreuses fonctions biologiques. Cependant, cette modification post-traductionnelle est
encore mal connue.

1- La peau
Trois PADs sont exprimées dans la peau humaine et de souris : ce sont les PAD1, 2 et 3 (cf.
chapitre « profil d’expression »). Des analyses par RT-PCR ont également montré une
expression du gène Padi4 dans la peau de rat, mais l’expression n’a pas été étudiée au niveau
protéique (Yamakoshi et al., 1998).

a- Expression différentielle des PADs dans l’épiderme

En 2005, la création d’anticorps dirigés contre des peptides spécifiques de chaque isotype a
permis de localiser spécifiquement les PADs dans l’épiderme et de montrer leur profil
d’expression spécifique (figure 34). Par microscopie confocale sur cryocoupes de peaux, la
PAD1 est immunodétectée dans le cytoplasme de tous les kératinocytes de l’épiderme avec un
gradient d’intensité de la couche basale vers la couche granuleuse. Elle est aussi la seule
isoforme à être retrouvée dans les cornéocytes après délaminage au scotch de la couche
cornée. La PAD2 est localisée dans le cytoplasme des kératinocytes épineux et à la périphérie
des kératinocytes dans la couche granuleuse tandis que la PAD3 est exprimée uniquement
dans la couche granuleuse (Nachat et al., 2005b). L’expression des PADs est similaire dans
l’épiderme de souris, bien que la PAD1 soit surtout détectée dans la couche granuleuse. Enfin,
lorsque des kératinocytes sont cultivés en conditions différenciantes, en présence de 1,5 mM
de calcium, l’expression des ARNm des mêmes PADs est également augmentée par rapport
aux conditions prolifératives (Chavanas et al., 2008).

99
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

Figure 34: localisation des PAD1, 2 et 3 dans l’épiderme humain (A) et murin (B). Les PADs ont été localisées par
immunofluorescence indirecte avec des anticorps anti-peptide spécifiques et observées en microscopie confocale. SC stratum
corneum, SG stratum granulosum, SS stratum spinosum, SB stratum basale (d’après Nachat et al., 2005b).

b- Substrats épidermiques
Les protéines citrullinées de l’épiderme sont essentiellement présentes dans la couche cornée.
Trois substrats des PADs y ont été identifiés : la kératine K1, la kératine K10 et la filaggrine
(Senshu et al., 1996).
Comme précédemment discuté, la filaggrine est désiminée avant sa protéolyse en acides
aminés, sa désimination entraînant un changement de charge lui permettant de se détacher de
la matrice fibreuse (figure 36). In vitro, elle peut être désiminée par les PAD1, 2 et 3 avec des
efficacités variables selon l’isoforme. Enfin, des analyses en immunomicroscopie
électronique ont montré une colocalisation de la PAD1 et de la filaggrine dans la partie basse
de la couche cornée, ainsi qu’une colocalisation de la PAD3 avec la profilaggrine dans les
granules de kératohyaline et avec la filaggrine dans les premières couches de cornéocytes
(figure 35) (Méchin et al., 2005). Ces travaux suggèrent fortement que la PAD1 et la PAD3
sont les isoformes qui désiminent la filaggrine in vivo. Le fait que des protéines désiminées
n’aient pas été identifiées dans les couches de kératinocytes vivants suggère que les PADs n’y
sont pas actives, peut-être en raison d’une trop faible concentration de calcium.
La PAD1 étant la seule isoforme présente jusqu’en haut de la couche cornée (figure 35), elle
est également la meilleure candidate pour la désimination de K1 et K10. Le rôle de cette

100
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

désimination n’est pas encore connu, mais on peut supposer qu’elle joue un rôle dans des
modifications structurelles de la matrice cornéocytaire.
La fonction et les substrats de la PAD2 dans l’épiderme sont à ce jour encore inconnus.
La figure 36 résume la localisation et les rôles des PADs dans l’épiderme.

Figure 35 : détection en immuno-microscopie électronique des PAD1 (a) et PAD3 (b–c) dans le stratum corneum (SC)
et les granules de kératohyaline (KHG). (a) Les flèches indiquent le marquage de la PAD1 des cornéocytes les plus
profonds (C1) aux plus superficiels (C6). (b) La détection de la PAD3 (marquée par des billes d’or de 5 nm de diamètre
indiquées par les flèches) et de la filaggrine (billes d’or de 10 nm de diamètre) ne persiste pas au-delà de la 3ème couche de
cornéocytes (C3). (c) Zoom de ce même marquage au niveau d un kératinocyte granuleux. Barre d’échelle = 200 nm (a et b)
et 100 nm (c) (Méchin et al., 2005).

101
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

Production du FNH
Relachement de la
matrice

Acides aminés libres

Protéolyse Désimination des

kératines

Dissociation
filaggrine/matrice
cornéocytaire

Désimination de la
filaggrine

Association avec les

filaments de kératine

Translocation nucléaire du Protéolyse des

peptide N-terminal
peptides de liaison

Déphosphorylation

La filaggrine phosphorylée est stockée dans les

granules de kératohyaline

Figure 36 : représentation schématique de la localisation et des rôles des PADs dans l’épiderme. D’après (Méchin et al.,
2007).

c- La désimination dans les annexes cutanées

Les PAD1 et 2 sont détectées dans le muscle arrecteur du poil et dans les glandes sébacées
(Nachat et al., 2005a).
La THH est la première protéine décrite comme ayant des résidus citrullyl (Rogers and
Taylor, 1977). C’est une protéine majeure du follicule pileux (voir le chapitre «follicule
pileux »), qui assure notamment le renforcement de la GEI et guide la croissance de la tige
pilaire. La PAD3 est certainement l’isoforme qui désimine la THH dans la medulla et la GEI.
La désimination de la THH entraîne sa solubilisation à partir des granules de THH et permet
sa liaison par les TGases aux filaments intermédiaires de kératines pour former une structure
rigide et insoluble dans la GEI (Nachat et al., 2005a; Tarcsa et al., 1996).

102
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

La PAD3 colocalise également avec la protéine S100A3 dans le follicule pileux (Kanno et al.,
2000). S100A3 est une protéine fortement exprimée dans les cellules différenciées du cuticule
de la GEI, dont les fonctions dans le follicule pileux sont encore inconnues. La PAD3
désimine l’arginine 51 de cette protéine in vitro, ce qui permet la formation d’homotétramères
(Kizawa et al., 2008).

2- Autres rôles physiologiques des PADs

a- L’apoptose
Plusieurs études se sont intéressées à la désimination lors de l’induction de l’apoptose par un
ionophore du calcium. Dans les kératinocytes de rat, l’apoptose s’accompagne de la
désimination d’une protéine non identifiée à la périphérie des noyaux (Mizoguchi et al.,
1998). Dans les macrophages de souris et les monocytes et macrophages humains, l’influx
calcique induit la désimination de la vimentine, le composant des filaments intermédiaires des
cellules mésenchymateuses. Sa désimination désorganise les filaments intermédiaires, les
auteurs de cette étude suggèrant que ce mécanisme joue un rôle dans les changements
morphologiques associés à l’apoptose (Asaga et al., 1998; Vossenaar et al., 2004b).
Cependant, il n’a pas été déterminé si l’activation des PADs est due à l’induction de
l’apoptose proprement dite ou simplement à l’augmentation de la concentration en calcium.
La surexpression de la PAD4 seule suffit à induire l’apoptose dans des cellules jurkat et HL-
60, via une augmentation des taux de p53, p21 et bax, une protéine impliquée dans la voie
apoptotique mitochondriale (Liu et al., 2006). Le mécanisme mis en jeu passerait par la
désimination des histones induisant une altération de la structure de la chromatine et une
augmentation de la sensibilité de l’ADN à la fragmentation.

b- La régulation génique
L’ADN des eucaryotes est compacté sous forme de chromatine. L’unité de base de ce
compactage est le nucléosome : il est composé d’ADN enroulé autour d’un octamère
d’histones (composé de deux copies de H2A, H2B, H3 et H4). Les nucléosomes sont ensuite
assemblés en structures de plus en plus complexes à l’aide d’une cinquième histone H1. La
compaction de la chromatine joue un rôle majeur dans la régulation de l’activation de la
transcription de l’ADN et de sa réplication. L’activation de la transcription d’un gène est ainsi
conditionnée par la conformation de la chromatine située dans sa région de contrôle : la

103
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

chromatine doit être dans un état décondensé afin de rendre cette région accessible aux
différentes protéines régulant la transcription. L’extrémité amino-terminale des histones à la
surface du nucléosome peut être la cible de modifications post-traductionnelles qui
engendrent des variations d’affinité de l’ADN pour les protéines régulatrices. Ces
modifications comme la méthylation, influencent l’état de compaction de la chromatine et
donc modifient les niveaux d’expression des gènes. La méthylation des résidus lysine et
arginine catalysée par des histones méthyltransférases (HMT) permet ainsi de réguler la
transcription. PMRT1 (protein arginine methyltransferase 1) et CARM1 (co activator-
associated arginine methyl transferase 1), en association avec des coactivateurs
transcriptionnels et avec p53, facilitent la transcription en méthylant l’arginine 3 de H4 et
l’arginine 17 de H3.
Le rôle de corégulateur transcriptionnel de l’isoforme nucléaire PAD4 a été confirmé dans
plusieurs études. En effet, le recrutement et l’activité de PAD4 entrent en jeu dans la
répression de la transcription des gènes de réponse aux oestrogènes dans les cellules MCF7
dérivées d’un adénocarcinome des glandes mammaires. De plus la PAD4 peut agir comme un
corépresseur transcriptionnel sur le promoteur du gène du facteur de croissance VEGF-A
(vascular endothelial growth factor-A) (Cuthbert et al., 2004). La désimination des histones
par la PAD4 lui permettrait de jouer un rôle dans la régulation transcriptionnelle en réprimant
l’augmentation de la transcription induite par la méthylation de ces protéines. De façon
intéressante, les mêmes Arg des histones peuvent être désiminées ou méthylées. La PAD4
régulerait aussi cette méthylation au cours d’une réaction de déméthylimination en
convertissant les arginines monométhylées en citrulline (Bannister et al., 2002). A l’inverse,
les arginines diméthylées ne peuvent pas être citrullinées (Cuthbert et al., 2004). Plus
récemment, il a été montré que PAD4 et l’histone déacétylase 1 (HDAC1) s’associent et
collaborent pour générer un environnement chromatinien répressif du promoteur pS2, cible
des oestrogènes, et permettre le désengagement de l’ARN polymérase II (Denis et al., 2009).
Dans la lignée granulocytaire HL-60, la désimination des histones H3 et H4 empêche leur
méthylation par la méthyltransférase CARM1 (Cuthbert et al., 2004; Hagiwara et al., 2002;
Wang et al., 2004). PAD4 contrebalance également l’inactivation par CARM1 du cofacteur
p300 nécessaire à l’activation de la transcription par les récepteurs aux hormones nucléaires
(Lee et al., 2005). Enfin, Li et coll. ont montré le recrutement de PAD4 en association avec
p53 sur le promoteur de p21, une cible de p53 au cours de l’apoptose induite par les UVs, et
montré une corrélation inverse entre l’expression de p21 et la citrullination de la chromatine à

104
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

proximité du promoteur du gène de p21. Ils ont suggéré un rôle de la désimination des
histones dans le retour à l’état réprimé des gènes cibles de p53 (Li et al., 2008).

c- La formation des NETs

Le traitement des cellules HL-60 et des neutrophiles du sang humain par un ionophore du
calcium induit la citrullination des histones H3, H2A et H4. Comme une forte concentration
en calcium intracellulaire est connue pour déclencher l’apoptose, il était admis que la
désimination des histones pourrait être une étape précoce de l’apoptose. Or, l’équipe de
Marko Radic a montré que cette désimination est une réponse des neutrophiles aux stimuli
inflammatoires qui activent ces cellules après une infection bactérienne, mais n’est pas un
événement lié à leur apoptose. Lors de cette même étude, les auteurs ont mis en évidence que
la chromatine libérée par la dégranulation des neutrophiles activés contient de l’histone H3
citrullinée (Neeli et al., 2008). En effet, après stimulation, les neutrophiles meurent selon un
processus différent de l’apoptose et de la nécrose et libèrent leur chromatine associée à
diverses protéines nucléaires dans l’espace extracellulaire (figure 37). Cette structure
cellulaire porte le nom de “neutrophil extracellular traps” (NETs). Les NETs agissent comme
une sorte de filet qui immobilise les bactéries (Fuchs et al., 2007).

Figure 37 : photographie au microscope électronique à balayage montrant les NETs (neutrophil extracellular traps).
Les Nets entourant les neutrophiles humains après 60 min de stimulation au phorbol 12-myristate 13-acétate (PMA). (Photo :
Dr. Martina Behnen-Härer & Dr. Matthias Klinger).

Le rôle prépondérant de la PAD4 et des histones citrullinées dans la formation des NETs a
ensuite été décrypté. En effet, la décondensation de la chromatine dans les neutrophiles et les
granulocytes HL-60 est associée à l’activité de la PAD4, et la citrullination de H4 est elle-
même associée à une décondensation spectaculaire de la chromatine. La citrullination des

105
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Rôles physiologiques des PADs

histones nucléosomales par la PAD4 diminue la capacité de l’histone H5 à compacter les

« matrices nucléosomales » et, parallèlement, induit une décondensation de la chromatine. La
chromatine décondensée est ensuite relarguée du noyau vers le cytoplasme pour induire la
formation des NETs (Wang et al., 2009).

d- Les chimiokines
Les chimiokines forment une famille de protéines solubles capables d’attirer les leukocytes
lors de l’inflammation. Diverses modifications post-traductionnelles peuvent affecter les
propriétés des chimiokines. En particulier, les chimiokines CXCL10 et CXCL11 sont
désiminées in vitro par la PAD2 et CXCL10 est naturellement citrullinée in vivo. La
désimination de ces molécules réduit leur capacité à fixer l’héparine et leur chimiotactisme
notamment envers les lymphocytes T (Loos et al., 2008). La même équipe a également mis en
évidence la citrullination naturelle de l’interleukine 8 et suggéré que cette modification
réalisée par les PAD2 ou 4 pourrait empêcher sa protéolyse par la thrombine, et diminuer sa
capacité à attirer les neutrophiles sur les sites de l’inflammation dans un modèle murin in
vivo. De plus, le fait que les PADs soient incapables de citrulliner l’IL-1β, dont la position des
arginines N-terminales est comparable à celle de CXCL8, montre que la citrullination est
spécifique de la nature des cytokines et pas seulement du site de désimination (Proost et al.,
2008). La désimination de CXCL12 inhibe également les propriétés biologiques de cette
chimiokine, en empêchant notamment sa fixation à son partenaire CXCR4 (Struyf et al.,
2009). Ces résultats suggèrent que les PADs pourraient posséder des propriétés anti-
inflammatoires.

e- La reproduction
Le rôle de Pad6 dans la reproduction a été démontré grâce à l’étude du phénotype des souris
invalidées pour Padi6. Ces souris sont viables et produisent des oocytes qui peuvent être
fécondés. Cependant, elles sont infertiles à cause d’anomalies du développement des zygotes
et des embryons. L’absence de Pad6 entraîne une désorganisation du cytosquelette de l’oocyte
et de l’embryon aux stades précoces. Ce cytosquelette est une structure très dynamique,
formée de kératines, qui subit une suite de réorganisations complexes à partir de la
fécondation pour finalement se dissocier en filaments au stade blastocyste. L’une de ces
kératines pourrait être la cible de Pad6 à l’image de la désimination des kératines
précédemment décrite dans l’épiderme (Esposito et al., 2007).

106
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

D- PADs et pathologies

1- La Polyarthrite Rhumatoïde

a- Généralités
La Polyarthrite Rhumatoïde (PR, OMIM#180300) est une maladie auto-immune qui touche 1
à 3 % de la population française, dont trois fois plus de femmes que d’hommes. La PR est la
pathologie rhumatismale inflammatoire la plus fréquente. Elle touche les articulations
synoviales et entraîne la formation d’un tissu bourgeonnant, le pannus synovial, qui va éroder
l’os et le cartilage sous-jacent. L’inflammation rhumatoïde, comme toutes les inflammations,
est caractérisée par une vasodilatation, la formation d’un œdème et une infiltration cellulaire
des cellules immunitaires (monocytes/macrophages, cellules dendritiques, lymphocytes T et
B, neutrophiles et plasmocytes).

b- Les ACPAs
De nombreux auto-anticorps sont présents dans le sérum des patients atteints de PR, dont une
population très spécifique de la maladie tout d’abord identifiée comme les « auto-anticorps
anti-filaggrine ». Ils ont ensuite été appelés auto-anticorps anti protéines citrullinées (AAPC
ou ACPA pour « anti-citrullinated proteins autoantibodies ») car ils ne sont capables de
reconnaître la filaggrine que lorsque celle-ci est désiminée (Girbal-Neuhauser et al., 1999;
Sebbag et al., 1995; Simon et al., 1993). Dans les articulations où la filaggrine n’est pas
exprimée, ces auto-anticorps reconnaissent spécifiquement et majoritairement des formes
citrullinées des chaînes Aα et Bβ de la fibrine (ou du fibrinogène) (Masson-Bessiere et al.,
2001). Ils apparaissent très précocement dans le sérum des patients, parfois même avant
l’apparition des premiers signes cliniques.
L’inflammation du tissu synovial induite ou entretenue par le conflit antigène/anticorps entre
les dépôts extravasculaires de fibrine citrullinée et les auto-anticorps anti-protéines
citrullinées participe à l’auto-entretien de la maladie (Sebbag et al., 2004) (figure 38). Seules
les PAD2 et 4 sont présentes dans le tissu synovial rhumatoïde et cette expression est corrélée
avec l’intensité de l’inflammation. Ces deux isotypes sont donc probablement impliqués dans
la désimination de la fibrine (Foulquier et al., 2007). Les mécanismes conduisant à
l’activation des PADs et à leur sécretion à l’extérieur de la cellule afin de désiminer la fibrine
n’ont toujours pas été élucidés.

107
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

Finalement des études récentes décrivent une nouvelle classe d’auto-anticorps spécifiques de
la PR, les anticorps anti-PAD4 (Harris et al., 2008). Leur présence est associée à une
pathologie plus sévère (Halvorsen et al., 2008).

Figure 38 : Schéma représentatif de la boucle d’auto-

Plasmocyte entretien de la PR.
Dans le tissu synovial rhumatoïde, la fibrine désiminée

ACPA devient la cible d’auto-anticorps anti-fibrine citrullinée

Activation de
mécanismes produits localement par des plasmocytes. Ce conflit
effecteurs antigène/anticorps induit l’inflammation via l’activation de
mécanismes effecteurs. L’inflammation conduit à
Fibrine Citrullinée Auto-entretien
de la synovite l’extravasation du plasma et à la polymérisation du

Citrullination fibrinogène, provoquant ainsi la formation de nouveaux

(PAD2, PAD4) dépôts de fibrine dans le tissu synovial qui peuvent devenir
Inflammation
substrats d’une ou plusieurs PADs. Tout ceci permettrait
l’auto-entretien de l’inflammation et la dégradation du tissu
Fibrine
synovial des patients, les auto-anticorps anti-fibrine citrullinée

Extravasation de plasma et étant absents du tissu synovial des donneurs sains.

polymérisation du
D’après (Foulquier et al., 2007).
fibrinogène

c- Génétique de la PR
Sur la base d’un lien génétique entre la PR et une région chromosomique située en 1p36, une
forte association a été mise en évidence entre un haplotype fonctionnel du gène PADI4 et la
PR dans une population japonaise (Suzuki et al., 2003). L’haplotype de susceptibilité présente
quatre « SNPs » (single nucleotide polymorphisms) dans des régions exoniques qui semblent
conférer une plus grande stabilité à l’ARNm, ce qui pourrait engendrer des taux plus élevés de
PAD4. Des résultats concordants ont été obtenus sur des populations coréennes (Kang et al.,
2006), japonaises (Ikari et al., 2005) et d’Amérique du nord (d’origine européenne).
Cependant aucune association n’a pu être mise en évidence dans plusieurs études portant sur
des populations européennes (Barton et al., 2004; Caponi et al., 2004; Farago et al., 2007;
Martinez et al., 2001).

d- Citrullination et inflammation
La présence de dépôts de fibrine citrullinée n’est pas spécifique à la PR mais a été retrouvée
dans le tissu synovial de patients atteints d’autres synovites (Foulquier et al., 2007; Vossenaar
et al., 2004a) et des protéines citrullinées ont été mises en évidence dans de nombreux tissus

108
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

enflammés comme le muscle des patients atteints de polymyosite ou le colon de patients

atteints de la maladie de Bowel (Makrygiannakis et al., 2006). Enfin des protéines désiminées
ont été décrites dans les cellules broncho-alvéolaires de fumeurs sains présentant des signes
d’inflammation pulmonaire (Klareskog et al., 2006), en association avec une augmentation de
l’expression de PAD2 (Makrygiannakis et al., 2008).

2- Les maladies neurodégénératives

a- La sclérose en plaque
La Sclérose en Plaque (SEP, OMIM #126200) est une pathologie inflammatoire
démyélinisante du système nerveux central qui entraîne une perte progressive de la mobilité.
La SEP détruit la gaine de myéline, gaine multilamellaire protéo-lipidique entourant certains
groupes d’axones, qui facilite la conduction neuronale.
La protéine basique de la myéline (MBP pour Myelin Basic Protein) est synthétisée par les
oligodendrocytes. C’est la protéine majoritaire des gaines de myéline. Des auto-anticorps
anti-MBP ont été détectés dans le liquide céphalo-rachidien des patients atteints de SEP, mais
ils ne sont pas spécifiques de la pathologie et sont présents dans de nombreuses autres
maladies neuro-dégénératives. La MBP peut subir de nombreuses modifications post-
traductionelles comme la phosphorylation, la méthylation et la désimination. La protéine
acide fibrillaire gliale (GFAP pour glial fibrilliary acidic protein) appartient à la famille des
composants des filaments intermédiaires. C’est une protéine majeure des astrocytes, les
cellules de soutien et de nutrition du système nerveux central. Les cerveaux de patients
atteints de SEP montrent de forts taux de MBP et de GFAP désiminées, le niveau de
désimination étant proportionnel à la sévérité de la maladie. La désimination de la MBP induit
de forts changements conformationnels de la protéine, augmente sa susceptibilité à la
protéolyse et diminue ses interactions avec les lipides de la gaine de myéline qui devient alors
instable.
Dans un modèle murin de sclérose en plaque (l’encéphalomyélite auto-immune
expérimentale), une hypercitrullination de la MBP et de la GFAP a été observée dans la
moelle épinière. Une injection de MBP hypercitrullinée augmente la sévérité de la maladie
expérimentale. Ces données suggèrent une implication de la citrullination dans le processus
de démyélination de la SEP. L’activité de la Pad2 et le niveau d’expression de son ARNm
augmente dans un modèle de souris transgéniques développant une démyélinisation

109
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

spontanée, un mois avant l’observation de la citrullination de la MBP et des signes cliniques

concomitants (Moscarello et al., 2002).
Deux PADs exprimées dans le cerveau pourraient potentiellement être impliquées : la PAD2
et la PAD4, la PAD2 étant la plus fortement détectée. Cependant d’autres PADs pourraient
être impliquées lors d’une infection au cours de laquelle la barrière hémato-encéphalique est
rompue, entraînant une infiltration de cellules immunitaires. Une colocalisation des PAD2 et
4 ainsi qu’une augmentation de la détection de ces deux protéines et des protéines citrullinées
ont été observées en immunomicroscopie électronique au niveau des gaines de myéline des
patients atteints de SEP (Wood et al., 2008). L’augmentation de synthèse de la PAD2 pourrait
être la conséquence d’une hypométhylation du promoteur de son gène due à une
augmentation de l’activité de la DNA déméthylase, entraînant une augmentation de la
transcription (Moscarello et al., 2007). Ces données semblent être en faveur de l’hypothèse
d’une augmentation de l’expression de PAD2 et/ou 4, qui entraînerait l’augmentation des
protéines citrullinées dans le cerveau des patients se traduisant par une dégradation des gaines
de myéline. La dégradation de la MBP exposerait de nouveaux épitopes immunodominants
entretenant l’inflammation. Une seule étude a cherché une association entre des haplotypes de
PADI4 et la SEP mais aucune corrélation n’a pu être mise en évidence (Tommasi et al.,
2006).
Dans le cerveau et la moelle épinière des souris invalidées pour Padi2, une diminution très
importante de la citrullination a été observée, confirmant le rôle prépondérant de la Pad2.
Toutefois, aucune différence n’a été observée lors de l’induction de l’encéphalomyélite auto-
immune expérimentale entre ces animaux et des souris sauvages (Raijmakers et al., 2006).
Toutes ces observations suggèrent un rôle de la désimination et de la PAD2 dans la
physiopathologie de la SEP mais ne leur en attribuent pas la cause. Une étude toute récente a
cependant confirmé l’implication de la PAD2. En effet, sa surexpression dans le cerveau de
souris transgéniques entraîne la destruction des gaines de myéline (Musse et al., 2008).
La PAD4 pourrait, quant à elle, être transloquée dans les noyaux par le TNFα. Les souris
transgéniques surexprimant cette molécule montrent effectivement une augmentation de
citrullination des histones et d’expression de la Pad4 dans le cerveau. Cette translocation
pourrait être un mécanisme additionnel conduisant à l’apoptose des oligodendrocytes
(Mastronardi et al., 2006).
Ces données ont permis à l’équipe de Moscarello et Mastronardi de proposer le modèle
physiopathologique décrit dans la figure 39.

110
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

Surexpression du gène PADI2

hypométhylation
du promoteur de
la PAD2 de la charge
positive

ADN déméthylase Diminution de la

compaction de la myéline

La myéline devient
instable

Libération de MBPcit

Translocation de
PAD4 dans les Apoptose des
noyaux oligodendrocytes Libération d’épitopes :
MBPcit et peptides
immunogènes

Réponse immunitaire
Démyélinisation

Figure 39 : modèle de pathogénèse de la sclérose en plaque. D’après (Musse et al., 2008).

b- Autres pathologies du système nerveux central

Une augmentation de GFAP et de vimentine citrullinées a été observée dans l’hippocampe de
patients atteints de la maladie d’Alzheimer (OMIM 104300); de plus la GFAP, les protéines
citrullinées et la PAD2 colocalisent dans cette région du cerveau. L’augmentation de la
citrullination pourrait être due à l’augmentation locale de la concentration calcique dans des
conditions d’hypoxie ou après d’autres stress neurodégénératifs (Ishigami et al., 2005).
Enfin, une augmentation de l’expression de PAD2 et de la citrullination ont été observées
d’une part, par une approche protéomique lors du glaucome primaire à angle ouvert (OMIM
137760) (Bhattacharya et al., 2006) et d’autre part, lors de l’infection de souris par le prion.
Dans ce dernier cas, les protéines désiminées correspondent à la MBP, la GFAP, l’énolase et
l’aldolase (Jang et al., 2008).

111
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

3- Les cancers
Deux analyses immuno-histologiques ont mis en évidence un lien entre désimination et
cancer. Dans la première, l’expression de PAD4 a été détectée dans des cellules néoplasiques
de tumeurs de Paget extra-mammaires (néoplasme cutané du sujet âgé) (Urano et al., 1990).
Dans la deuxième, c’est l’expression ectopique de PAD4 qui a été détectée, ainsi qu’une
augmentation du taux de protéines désiminées dans les cellules épithéliales de nombreux
adénocarcinomes. Dans ces cellules, PAD4, CD34, un marqueur des cellules progénitrices
hématopoïétiques, et les kératines désiminées K8, K18, et K19 sont co-localisées (Chang and
Han, 2006). Enfin, une dernière étude plus récente a confirmé par différentes techniques la
présence de PAD4 dans le sang et les tissus de patients atteints de tumeurs malignes
d’origines très différentes (Chang et al., 2009).

4- La néphropathie obstructive
Dans le rein de rat, la désimination est principalement observée dans la capsule de Bowman
(ou capsule glomérulaire rénale), qui est constituée de deux feuillets entourant complètement
le glomérule rénal.
Dans des expériences d’obstruction unilatérale de l’uretère réalisées chez le rat, une
augmentation de l’ARNm de la Pad2 et des protéines désiminées a été détectée dans le rein,
cette augmentation étant réversible après la levée de l’obstruction. Des analyses par
électrophorèse 2D et spectrométrie de masse ont pu mettre en évidence la présence d’actine
désiminée (Feng et al., 2005).

5- Le psoriasis et l’érythrodermie ichtyosiforme congénitale

Des défauts de désimination, caractérisés par une diminution du taux de kératine K1
désiminée, ont été observés en immunohistologie sur des coupes de peau de patients atteints
de psoriasis ou d’érythrodermie ichtyosiforme congénitale bulleuse (OMIM 113800) (Ishida-
Yamamoto et al., 1992; Ishida-Yamamoto et al., 2000). Cette dernière est une génodermatose
autosomique rare caractérisée par la formation de cloques et d’érythèmes à la naissance, puis
le développement d’une hyperkératose s’aggravant avec l’âge. Cependant, le lien de cause à
effet et le rôle éventuel de cette diminution de la citrullination ainsi que l’implication des
PADs dans le développement de ces pathologies restent encore à élucider.

112
 Chapitre 3 – Les Peptidyl-Arginine désiminases
PADs et pathologies

En outre, il est intéressant de noter que la Vit D, qui est utilisée en traitement du psoriasis,
induit une augmentation de l’expression des ARNm des PAD1, 2 et 3 dans les kératinocytes
prolifératifs en culture (Lu et al., 2005) et de Pad1 et 3 in vivo (Palmer et al., 2008).

E- Régulation de l’expression des PADs

Le calcium est évidemment un régulateur indispensable de l’activité des PADs, mais
l’expression de ces protéines peut également être modulée.

1- Régulation par les oestrogènes

Une injection d’oestradiol à des souris ayant subi une ovariectomie augmente la quantité
d’ARNm de la Pad2 mais aussi de la Pad1 de manière dépendante de la dose et du temps
(Takahara et al., 1992). Dans l’hypophyse, la quantité d’ARNm est 50 fois plus élevée chez le
rat femelle que chez le mâle, et la quantité d’ARNm chez le mâle augmente avec l’âge
(Akiyama et al., 1995; Watanabe et al., 1990). Ces études renforcent l’hypothèse d’une
régulation oestrogéno-dépendante de l’isotype Pad2.
Dans les cellules MCF-7, le promoteur minimum de PADI4 a été identifié comme étant une
séquence de 348 pb située en amont du site d’initiation de la transcription. Les facteurs de
transcription AP-1, Sp1/Sp3 et NF-Y agissent de façon coopérative pour réguler l’expression
de ce gène. Or, les oestrogènes peuvent activer l’expression de PADI4 grâce à la liaison de
leur récepteur à un élément de réponse en amont du gène. Ils induisent également une
augmentation concomitante des niveaux d’AP-1, Sp1 et NF-Y (Dong et al., 2007). Ces
résultats suggèrent que l’expression de PAD4 pourrait également être stimulée par les
oestrogènes.

2- Promoteurs minimaux des gènes des PADs exprimées dans

l’épiderme
A l’aide d’une série de constructions en amont du gène rapporteur luciférase et de
kératinocytes primaires humains en culture, notre équipe en collaboration avec l’équipe
d’Hidenari Takahara (Ibaraki, Japon) s’est intéressée à la caractérisation des promoteurs
minimums des gènes PADI1, 2 et 3 (figure 40).
Pour PADI1, le promoteur minimal correspond à une région de 195 pb située en amont du site
d’initiation de la transcription. Son activité nécessite la fixation de Sp1 mais aussi celle du

113
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Régulation de l’expression

facteur MZF1. Sp1 est un facteur de transcription relativement ubiquiste, qui régule
l’expression de nombreux gènes de la différenciation comme l’involucrine, la loricrine et les
TGases. La fonction de MZF1 n’avait encore jamais été explorée dans l’épiderme. Il s’agit
d’un facteur de transcription jouant notamment un rôle dans les étapes précoces de la
différenciation des lignées myéloides (Dong et al., 2007). En ce qui concerne PADI2, le
promoteur minimal correspond à une séquence de 132 pb comprenant quatre sites de fixation
pour le facteur de transcription Sp1, l’activité de ce promoteur étant liée à la présence des
facteurs de transcription Sp1 et Sp3 (Dong et al., 2005). Enfin, pour PADI3 le promoteur
minimal correspond à une séquence de 129 pb capable de fixer également Sp1/Sp3 et le
facteur NF-Y (Dong et al., 2006).
Toutefois, ces promoteurs minimaux sont liés par des facteurs de transcription exprimés dans
de nombreux tissus et ne permettent pas à eux seuls d’expliquer la spécificité d’expression des
PADI1-3 dans les cellules les plus différenciées de l’épiderme.

Complexe transcriptionnel
Expression basale et induction par le Ca2+

MZF1 MZF1 SP1/3 MZF1 MZF1 TBP Transcription

Pol II
CC CC GC GG GG
ATG PADI1
TATAA

-195 -175 -139 -117 -103 -85 -38 1 84

Promoteur minimum

Expression basale et induction par le Ca2+

SP1/3 SP1/3 SP1/3SP1/3 Transcription

Pol II
GC GC GC GC ATG PADI2

-132 -114 -63 -52 1 80

Expression basale et induction par le Ca2+

NFYA SP1/3 NFYA SP1/3

TBP Pol II Transcription
CAAT GC CAAT GC ATG PADI3
TATAA

-129 -101 -80 -53 -39 1 41

Figure 40 : promoteurs minimums des gènes PADI1, 2 et 3 exprimés dans l’épiderme et les facteurs de transcription
liés. D’après (Adoue, 2008).

114
 Chapitre 3 – Les Peptidyl-Arginine désiminases
Régulation de l’expression

3- Régulateurs transcriptionnels à longue distance

L’étude d’une séquence non codante intergénique conservée entre l’Homme et la souris a
permis l’identification de sites de contrôle à longue distance des gènes PADI1 et PADI3. Un
activateur transcriptionnel nommé PIE est localisé à 86 kb du promoteur de PADI3. Il active
la transcription uniquement dans les kératinocytes différenciés en présence d’une
concentration élevée de calcium via le recrutement des facteurs AP-1, c-Jun et c-Fos
(Chavanas et al., 2008). De la même manière deux activateurs transcriptionnels à longue
distance nommés PIE-S1 et PIE-S2, peuvent agir en synergie pour activer la transcription de
PADI1 et PADI3. On note la présence de sites de fixation pour les facteurs de transcription
MIBP1 / RFX1 (facteurs de transcription connus pour interagir in vivo dans la transcription de
gènes viraux) sur PIE-S1, et la fixation différentielle de c-Jun et Jun D sur le site AP-1 de
PIE-S2 en fonction de l’état de différenciation des kératinocytes. Cette étude, réalisée dans
notre laboratoire, a permis de poser les bases moléculaires de la spécificité d’expression de
PADI1 et PADI3 au cours de la différenciation épidermique : leur régulation passerait par
l’action à longue distance d’un activateur transcriptionnel bipartite, dont l’activité est
dépendante d’une compétition entre les facteurs c-Jun et JunD déjà naturellement présents
dans l’épiderme (figure 41). Par exemple, la fixation de c-Jun permettrait d’activer la
transcription de PADI3 dans les kératinocytes les plus différenciés, alors que la présence de
Jun D empêcherait cette activation dans les kératinocytes prolifératifs (Adoue et al., 2008a).

Figure 41 : modèle schématique de régulation à longue

distance de la transcription du gène PADI3.

Dans les kératinocytes prolifératifs (partie basse de la

figure), JunD se lie à PIE-S1 sans augmentation d’activité
du promoteur de PADI3. Dans les kératinocytes différenciés
(partie haute de la figure), c-Jun remplace JunD sur PIE-S1
permettant d’augmenter l’activité du promoteur de PADI3
probablement à travers une interaction avec un complexe
MIBP1/RFX1 lié sur PIE-S2 et avec la boîte TATA en
position proximale.D’après (Adoue et al., 2008a)

115
116
Objectifs
 Objectifs

La désimination ou citrullination est une modification post-traductionnelle catalysée

par une famille d’enzymes : les peptidyl-arginine désiminases (PADs). Les PADs peuvent
convertir en présence de calcium les résidus arginyl en résidus citrullyl au sein d’une
séquence peptidique. Le rôle physiologique des PADs est encore mal compris, même si la
PAD4 a été impliquée dans la régulation génique, mais elles semblent associées à de
nombreux processus pathologiques.
Trois isoformes de PADs sont exprimées dans l’épiderme, les PAD1, 2 et 3. Leur
localisation, recherchée à l’aide de sérums anti-peptides spécifiques, a mis en évidence un
profil d’expression spécifique de l’état de différenciation des kératinocytes. L’expression des
PADs et leur activation au cours du programme de différenciation terminale est un
mécanisme finement régulé qui, outre les promoteurs proximaux de leurs gènes, met en jeu
l’action à longue distance d’activateurs transcriptionnels et des facteurs AP-1. Leur
localisation et leurs caractéristiques biochimiques indiquent que les PAD1 et 3 désiminent la
filaggrine et les kératines K1 et K10, des protéines clés pour les fonctions de barrière que
remplit la couche superficielle de l’épiderme dite couche cornée. Cependant le rôle et les
cibles de la PAD2 dans cet épithélium ne sont pas connus.
Par ailleurs, la citrullination de la fibrine, réalisée probablement par les PAD2 et 4, est
observée au cours de nombreux processus pathologiques inflammatoires, et a tout
particulièrement été impliquée dans la physiopathologie de la polyarthrite rhumatoïde.

Dans ce contexte, les objectifs de mon travail de thèse correspondaient à trois axes majeurs :

1- Analyser l’expression des Pads et identifier les protéines citrullinées au cours de la

cicatrisation cutanée dans un modèle murin, en particulier au cours des phases
inflammatoire et de formation d’un nouvel épiderme.
2- Comprendre le rôle de la PAD2 dans l’épiderme, en caractérisant le phénotype cutané
de souris invalidées pour le gène Padi2 et qui nous ont été gracieusement fournies par
la Société Boehringer Ingelheim Pharmaceutical, Inc. (Ridgefield, CT).
3- Poursuivre l’étude de la régulation de l’expression et de l’activation des PADs au
cours de la différenciation des kératinocytes en utilisant des kératinocytes
épidermiques humains en culture primaire dont la différenciation est induite selon
deux modèles couramment utilisés, l’effet de la confluence et un traitement avec de la
vitamine D. En particulier, nous avons recherché un éventuel contrôle au niveau post-
transcriptionnel.

119
Résultats expérimentaux
 Publication n° 1 :

Deimination is regulated at multiple levels including auto-deimination of

peptidylarginine deiminases

Méchin Marie-Claire, Coudane Fanny, Adoue Véronique, Arnaud Jacques, Duplan Hélène,

Charveron Marie, Schmitt Anne-Marie, Takahara Hidenari, Serre Guy, Simon Michel

En révision pour Molecular and Cellular Life Science

Les peptidyl-arginine désiminases (PADs) catalysent une modification post-traductionnelle

des protéines appelée désimination, qui correspond à la transformation des résidus arginyl en
résidus citrullyl. Parmi les cinq PADs humaines, seules trois sont détectées dans l’épiderme
où elles jouent un rôle primordial en ciblant la filaggrine, un acteur clé pour l’hydratation des
couches superficielles de l’épiderme et ses fonctions de barrière. Leur expression et leur
activation dépendent de l’état de différenciation des kératinocytes. Pour étudier les
mécanismes mis en jeu, nous avons utilisé des kératinocytes humains normaux en culture et
avons induit leur différenciation selon deux modèles classiquement utilisés : l’augmentation
de la densité cellulaire et un traitement avec la vitamine D.
La stimulation transcriptionnelle de PADI1-3 par la vitamine D ne s’est pas révélée suffisante
pour induire l’expression des protéines correspondantes et l’activité PAD. Par contre,
l’augmentation de la densité cellulaire a induit l’expression des gènes PADI1 et 3, des
protéines correspondantes PAD1 et 3, ainsi que l’augmentation du taux de désimination (par
un facteur ~12). De plus, nous avons observé que les PAD1-3 sont capables d’auto-
désimination in vitro et que celle-ci réduit leur capacité à désiminer la filaggrine. Une
approche in silico, à partir de modèles tridimensionnels de PAD3 nous a permis de mesurer
l’effet de l’auto-désimination sur la protéine, en substituant ses arginines les plus accessibles
par des citrullines. L’auto-désimination induit une augmentation de la distance entre les 4
acides aminés majeurs (Asp-350, His-470, Asp-472 et Cys-646) du site actif de l’ordre de 1 Å
(jusqu’à 38%) et du volume de celui-ci d’environ 2 Å3 (~ 20%). Ces changements structuraux
fins peuvent certainement justifier la réduction de l’activité des PADs observée.

123
La désimination est donc largement verrouillée puisqu’elle est contrôlée via la transcription des

gènes PADI, mais aussi au-delà, au niveau post-transcriptionnel et certainement post-

traductionnel par l’auto-désimination des PADs.

124
Research Article

Deimination is regulated at multiple levels including auto-deimination of peptidylarginine deiminases

Méchin Marie-Clairea, Coudane Fannya, Adoue Véroniquea, Arnaud Jacquesa, Duplan Hélèneb,

Charveron Marieb, Schmitt Anne-Marieb, Takahara Hidenaric, Serre Guya, Simon Michela,*

a
CNRS-University of Toulouse III, UMR5165, Institut Fédératif de Recherche 150 (INSERM-CNRS-

Université Paul Sabatier-Centre Hospitalier Universitaire de Toulouse), Toulouse, France.

b
Centre Européen de Recherche sur la Peau et les Epithéliums de Revêtement (CERPER),

Pierre Fabre Dermo-Cosmétique, Toulouse, France.

c
Department of Applied Biological Resource Sciences, School of Agriculture, University of Ibaraki,

Ibaraki, Japan.

*
Corresponding author, Michel SIMON UMR5165, CNRS-Université Toulouse III, CHU Purpan,

Place du Dr Baylac TSA40031, 31059 Toulouse cedex 9, France.

Tel: +33-561 158 427; Fax: +33-561 499 036; E-mail: [Link]@[Link]

Running title: Multilock regulation of deimination in keratinocytes

125
Abstract

Peptidylarginine deiminases (PADs) catalyze deimination, converting arginyl- to citrullyl-residues.

Only three PAD isotypes are detected in the epidermis where they play a crucial role, targeting

filaggrin, a key actor for the tissue hydration and barrier functions. Their expression and activation

depends on the keratinocyte differentiation state. To investigate this regulation we used primary

keratinocytes induced to differentiate either by increasing cell-density or by treatment with vitamin D.

High cell-density increased PAD1 and 3 but not PAD2, at the mRNA and protein levels, and up-

regulated protein deimination. By contrast, vitamin D increased PAD1-3 mRNA amounts, with

distinct kinetics, but neither the proteins nor the deimination rate. Furthermore, auto-deimination was

shown to decrease PAD activity, increasing the distances between the four major amino-acids of the

active site. In summary, deimination can be regulated at multiple levels: transcription of the PADI

genes, translation of the corresponding mRNAs and auto-deimination of PADs.

Key words: Post-translational modification; keratinocyte; differentiation; citrulline; arginine;

calcium; protein structure.

126
In the epidermis, keratinocytes coexist in several states of differentiation to maintain the homeostasis

of the tissue so as to assure its vital barrier function, i.e. to protect the whole body against physical,

chemical or biological insults. Keratinocytes, characterized by a scarce cytoplasm and a large nucleus,

proliferate in the stratum basale. They differentiate during their migration to the surface of the

stratified tissue and become first spinous cells forming the stratum spinosum, then granular

keratinocytes in the stratum granulosum before finally dying in a unique cell-death program. The

resulting cells, called corneocytes, devoid of nucleus and other organelles, accumulate in the stratum

corneum and are finally eliminated at the skin surface by the desquamation process. This complex

program of differentiation involves structural proteins ((pro)filaggrin, involucrin, keratins, etc.), lipid

metabolism enzymes (phospholipases, glucocerebrosidases, etc.) and post-translational modification

enzymes, including proteases (kallikreins, cathepsins, etc.), transglutaminases and peptidylarginine

deiminases (PADs).

PADs (E.C. [Link]) have been detected in most organs, tissues and cells. They catalyze the

deimination (or citrullination) reaction in the presence of calcium, converting arginyl residues into

citrullyl residues (for a recent review, see (Méchin et al., 2007)). They are suspected to be involved in

the pathological events of several severe human diseases such as multiple sclerosis and rheumatoid

arthritis (reviewed in (Méchin et al., 2007; Harauz et al., 2007; Sebbag et al., 2004)). In the skin, the

main PAD targets are filaggrin and keratins K1 and K10 in the epidermis (Senshu et al., 1996), and

trichohyalin in the hair follicles (Rogers and Taylor, 1977). Deimination induces charge loss on the

targeted protein and changes its conformation, its interactions (either association or dissociation) and

therefore its function, as it has been well documented for trichohyalin (Tarcsa et al., 1997; Tarcsa et

al., 1996) and recently for S100A3 (Kizawa et al., 2008).

Filaggrin deimination could induce its dissociation from intermediate filaments and its subsequent

degradation to free amino-acids, producing the so-called natural moisturizing factor, important for the

epidermal barrier functions as it retains water in the stratum corneum and adsorbs part of UV

radiation (Méchin et al., 2007; Rawlings and Harding, 2004). Importantly, a reduced amount of

filaggrin, which is associated with reduced levels of hygroscopic amino-acids and altered barrier

functions, underlies ichtyosis vulgaris (OMIM 146700) and is a major risk factor for atopic dermatitis

127
(OMIM 603165), two very common skin diseases often associated to rhinitis and asthma. The known

reasons for filaggrin decrease are profilaggrin-gene null mutations (McGrath, 2008b; Palmer et al.,

2008; Smith et al., 2006) and cytokine-induced down-regulation (Howell et al., 2008; Howell et al.,

2007). Defective PAD activities also can be suspected since in vitro deimination of filaggrin increases

its proteolysis by calpain I and bleomycin-hydrolase, two proteases involved in its processing in the

lower stratum corneum (Kamata et al., 2009). Therefore, a default of PAD activity could disturb

filaggrin metabolism and natural moisturizing factor production, and consequently the epidermal

barrier function efficiency. Moreover, decreased levels of deimination have been observed in patients

with bullous congenital ichthyosiform erythroderma (OMIM 113800) and psoriasis (OMIM 177900)

(Ishida-Yamamoto et al., 2002; Ishida-Yamamoto et al., 2000). It is therefore of major importance to

know how PADs and deimination are regulated during keratinocyte differentiation.

There are five PADs (PAD1-4 and 6), encoded by distinct genes (PADI1-4 and 6) clustered in a single

locus at 1p35-36 (Chavanas et al., 2004). In the epidermis, PAD1 has been immunodetected

throughout the tissue, PAD2 in the suprabasal living keratinocytes, and PAD3 in the granular

keratinocytes and in the deeper corneocytes, whereas PADI4 and 6 are not expressed (Dong et al.,

2005; Guerrin et al., 2003; Nachat et al., 2005b; Nachat et al., 2005a). Using cultures of primary

normal human keratinocytes (NHKs) induced to differentiate by a shift of calcium concentration in

the medium, we have previously shown that this pattern of expression is due in part to regulation of

PADI gene expression at the transcriptional level (Adoue et al., 2008;Chavanas et al., 2008; Dong et

al., 2008; Dong et al., 2006; Dong et al., 2005), and for a recent review (Ying et al., 2009)).

In the present work, to more precisely analyze the regulation of PADs and deimination, we

successively developed two other well known models of in vitro NHK differentiation. In these models

NHK differentiation was induced (i) by addition, in a defined culture medium, of the active form of

vitamin D (Vit D), the 1-α, 25-dihydroxyvitamin D3 (Bikle et al., 2004; Bikle and Pillai, 1993;

Hosomi et al., 1983; Reichrath, 2007; Reichrath et al., 2007); and (ii) by increasing the cell density

(Nilsson et al., 2004; Poumay et al., 1999; Poumay and Pittelkow, 1995). Since PADs seem to be

regulated not only at the transcriptional but also at the translational and post-translational levels in

other cell types (Suzuki et al., 2003; Vossenaar et al., 2004), we tested the effect of differentiation of

128
NHKs on the steady-state levels of PADI mRNAs, but also on PAD1-3 protein amounts and on PAD

activity. Moreover, we observed that in vitro PADs can auto-deiminate themselves, the enzymes

becoming less active after deimination. Therefore, auto-deimination could be an additional step of

regulation in the control of PAD activity.

129
Materials and methods

Primary keratinocyte cell cultures

To produce primary NHKs, foreskin biopsies were harvested from young children without any history

of skin diseases after informed consent had been given by their families according to the ethical

guidelines of the University of Toulouse III, the French Ministry of the Research and Technology, and

the Declaration of Helsinki. Epidermal keratinocytes were isolated according to the procedure

described in (Rheinwald and Green, 1975), and cultured in the defined KBM-2 medium (Promocell,

Heidelberg, Germany) supplemented with several growth factors as follows: 0.4% bovine pituitary

extract, 0.125 ng/ml epidermal growth factor, 5 µg/ml human insulin, 0.33 µg/ml hydrocortisone, 10

µg/ml human transferrin, 0.39 µg/ml epinephrine and 0.15 mM CaCl2 in the presence of 100 µg/ml

primocinTM (Cayla-Invivogen, Toulouse, France) in a humidified incubator at 37°C with 5% CO2.

The medium was changed every 3 days. When NHKs reached confluence, they were transferred, after

a short trypsin incubation, into either 24-well-plates at 104 cells per well (for RNA extractions) or T25

flasks at 2 x 105 cells per flask (for protein extractions). When the subcultures reached about 70%

confluence, NHKs were treated once with either 10-7 M Vit D (Sigma-Aldrich, St Louis), 10-7 M Vit

D and 1.5 mM CaCl2 (Vit D + Ca2+), or 0.1% DMSO (vehicle control), for no longer than 3 days.

NHKs were harvested at 6 hours, 24 hours, 7 days and 10 days after the start of the treatment. When

cell density was used as a differentiation procedure, NHKs were harvested at low (cells covering less

than 50% of the surface), intermediate (cells covering 50 to 70% of the surface) and high (cells

covering more than 70% of the surface with a beginning of stratification) cell density, as previously

described (Sarafian et al., 2006).

Protein and RNA extractions

For protein extractions, NHKs were homogenized by pipetting into TE-NP40 buffer [50 mM Tris-HCl

pH 7.4, 150 mM NaCl, 1% NP-40, 10 mM EDTA and a 1/100 (v/v) cocktail of mammalian protease

inhibitors (Sigma-Aldrich)] and shaking for 20 min at 4°C. After centrifugation at 15000 RPM for 20

min at 4°C, soluble proteins in the supernatants were harvested to obtain the “TE-NP40 extracts”. The

130
pellets were then solubilized in Laemmli buffer [50 mM Tris-HCl pH 6.8, 0.1% SDS, 1.6% β-

Mercapto-ethanol, 0.8% Glycerol, 0.006% Bromophenol-blue] and sonicated on ice (twice, 15

seconds each) to obtain the “Laemmli extracts”. Proteins of the “TE-NP40 extracts” were quantified

by the Bradford method (Amresco Inc.) with a standard BSA curve. After gel electrophoresis and

electro-transfer, amounts of protein in the “Laemmli extracts” were estimated by Ponceau red

staining. All extracts were stored at -80°C.

For total RNA extractions, NHKs from 3 wells were homogenized by pipetting with 350 µl of RLT

buffer from the RNeasy extraction kit (Qiagen, Courtaboeuf, France), quickly frozen in liquid

nitrogen and stored at -80°C until complete extraction as mentioned in the manufacturer’s

instructions. A DNase I, RNase free treatment (Qiagen) was performed directly on the column for 15

min at room temperature. Quantity and quality of the RNA were checked with an RNA 6000 nano

assay kit using the Agilent 2100 bioanalyzer, according to the manufacturer’s instructions (Agilent

technologies, Waldbronn, Germany).

Antibodies and purified recombinant human PAD1-3 and His-filaggrin

The anti-modified-citrulline antibody (AMC), a generous gift from T. Senshu, Tokyo, Japan, was

used at 0.184 µg/ml. Anti-PAD antipeptides were produced, purified and used as previously described

(Guerrin et al., 2003; Nachat et al., 2005). Anti-PAD2 monoclonal antibody, a kind gift from A.

Ishigami, Chiba, Japan, was diluted at 1/1000. Its specificity has been controlled on recombinant PAD

isotypes (A. Ishigami et al, manuscript submitted for publication). Anti-actin monoclonal antibody

(MAB1501) was diluted at 1/30 000 (Chemicon International, Southampton, UK). Anti-involucrin

monoclonal antibody (clone SY5) was diluted at 1/5000 (Sigma, Aldrich). The monoclonal antibody

AHF11, reacting mainly with deiminated filaggrin, was used at 0.4 µg/ml as previously described

(Dong et al., 2005b). Anti-rabbit and anti-mouse IgG secondary antibodies (Zymed, Clinisciences,

Montrouge, France) were diluted at 1/10 000 and 1/8000, respectively, and used as previously

described (Guerrin et al., 2003; Nachat et al., 2005). Active recombinant human PAD1-3 and His-

filaggrin were produced and purified as previously described (Dong et al., 2005; Kanno et al., 2000;

Nakashima et al., 1999).

131
Western blotting analysis

Equal amounts of proteins (30 µg; according to Ponceau red staining) were resolved by 10% sodium

dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then electro-transferred to

nitrocellulose membranes for western blotting analysis as previously described (Guerrin et al., 2003;

Nachat et al., 2005). Immunoreactivities were quantified in arbitrary units with the ImageJ program

available at the following address [[Link] Data were normalized with detection of

the housekeeping gene product, actin.

Reverse transcription and real time PCR

For real time PCR, cDNAs were produced in 20 µl from 1 µg of total RNA, with 15 U of AMV

reverse transcriptase (RT) from the reverse transcription system kit (Promega, Charbonnières-les-

bains, France) and a mixture of 5 mM MgCl2, 1 mM dNTP, 4 mM RecRNasineRibon inhibitor, 25

ng/µl oligo-dT. First, RNAs were denatured for 2 min at 70°C, reverse transcribed for 60 min at 42°C

and ultimately denatured for 1 min at 99°C. Each RT product was used for real time PCR after 1/10

dilution and analyzed in duplicate PCR plates. All samples that were to be compared were analysed in

the same PCR plates for the genes of interest and the three housekeeping genes used for normalization

(YWHAZ, B2M and GAPDH; Table 1). PCR reactions were performed twice on a Biorad iCycler 96-

well block, with the real-time detection system software, V3.0, in 26 µl using iQ sybergreen mixture

(Biorad, Marne-la-Coquette, France), each primer at 460 nM (Table 1), and 5 µl of the diluted cDNA

with a program as follows: [95°C, 30 sec] 3 cycles, [95°C, 1min 30 sec] 1 cycle, [95°C, 15 sec; 60°C,

30 sec] 40 cycles, [95°C, 1 min 30 sec] 1 cycle and [95°C to 20°C, 10 sec] 80 steps. For PADI genes,

several primers were designed with the Beacon Designer or Primer3 software (iQBiorad Beacon

designer; [Link] (Rozen and Skaletsky, 2000), checked in silico by a

“blast” analysis and controlled on positive diluted cDNAs (1/10, 1/30, 1/90, 1/270, 1/810) (Table 1).

The efficiencies of the PADI primer pairs were determined between 99.5 and 113.5% with cDNAs

produced from NHKs, HaCaT cells and testis [the latter was from the human Multiple Tissue cDNA

panel, (BD Bioscience, Erembodegen, Belgium)]. Furthermore, to be sure of PADI primer

132
specificities, amplicons were controlled on 2.5% agarose gel, then purified and sequenced. The cycle

threshold (Ct) number was defined as an arbitrary number of PCR cycles in which the PCR curves

were in the linear range. The Ct values measured for the PADI genes and for the differentiation

marker genes were normalized to the Ct values of three housekeeping genes according to the function

2-∆∆Ct. As previously advised (Vandesompele et al., 2002), the Ct variations obtained for the 3

housekeeping genes in the different cell culture conditions were controlled (the ∆Ct (means ± sem)

for YWHAZ, B2M and GAPDH, were 0.633 ± 0.036, 0.577 ± 0.070 and 0.424 ± 0.204, respectively).

In this work, all the reported data correspond to normalization using YWHAZ. Similar results were

obtained using B2M or GAPDH (data not shown).

PAD activities and auto-deimination assays

Quantification of PAD activity, referred to as the “deimination rate”, was performed by western

blotting with the anti-citrulline AMC antibody, as described above. To evaluate the activity of PADs

in HaCaT and HeLa cells, proteins were extracted into the following buffer [50 mM Tris-HCl pH 7.4,

150 mM NaCl, 1 mM EDTA, 0.5% sodium deoxycholate, 1% Triton X-100 and a 1/100 (v/v) cocktail

mammalian protease inhibitors (Sigma-Aldrich)] sonicated on ice for 20 sec and centrifuged at 10 000

g for 10 min at 4°C. After addition of CaCl2 to 10 mM and DTT to 5 mM, the HaCaT and HeLa cell

extracts were incubated for 1 h at 50°C, and the proteins immunodetected with the anti-citrulline

AMC antibody.

For auto-deimination assays, purified recombinant PAD1-3 were incubated in a first step for 1 h at

50°C in the following deimination buffer [50 mM Tris-HCl pH 7.4, 10 mM CaCl2, 5 mM DTT]. Next,

the resulting PAD activity of each isotype was analyzed on a purified recombinant His-filaggrin

subunit and revealed by immunodetection using AHF11, as previously described (Dong et al., 2005).

Statistical analysis

Statistical analyses were performed by unpaired Student’s t-test. All the experiments were done at

least three times and the data expressed as the mean ± SEM. Differences were considered significant

when the p value was less than 0.05.

133
Topological 3D models of PAD3

As previously described for PAD1 (Méchin et al., 2007), we produced topological 3D models of

PAD3 using the atomic coordinates derived from the analysis of PAD4 crystal structures (Arita et al.,

2004). Schematic ribbon representations of 3D structures of PAD3 were derived from the following

PAD4 atomic coordinates available in the Protein Data Bank [[Link] Ca2+-free

PAD4 (PDB accession code 1WD8, also called “empty model”) and PAD4 complexed to Ca2+ and

benzoyl-L-arginine amide as a substrate (1WDA, also called “full model”) (Arita et al., 2004). All the

3D modeling structures were produced by the Bioinformatic Tool Server @TOME (@utomatic

Threading Optimisation Modeling & Evaluation) at the CBS Informatics Team

[[Link] (Douguet and Labesse, 2001). They were refined by energy minimization

(3000 iterations) and validated by Ramachandran plot analyses using MSI Insight II modules

Biopolymer, CHARMM and Viewer on an O2 SGI workstation and finally analyzed on the “Swiss-

Pdb Viewer Deep View 4.0.1 (SPDBV)” [[Link] (Guex and Peitsch, 1997).

After in silico exchanges of arginine (Arg) by citrulline (Cit), the percentages of the accessibility to

solvents of the Arg or Cit were evaluate for “empty” and “full” PAD3 models. Distances between the

Cγ of Asp-350, the Nδ1 of His-470, the Cγ of Asp-472 and the Sγ of Cys-646, the four major amino-

acids of the active site, were computed using “SPDBV”. From these distances, the volume of the

tetrahedrons formed between these four reactive atoms was obtained according to the Euler formula

(Dove and Summer, 1992) (supplemental Fig. S1).

134
Results

PADs and deimination in human keratinocyte cell lines

Looking for cellular models suitable to test for the regulation of deimination, we first used the

immortalized HaCaT keratinocytes, and the cervix adenocarcinoma HeLa cells. Even though we

detected mRNAs encoding PADs by RT-PCR, and PADs by western blotting in both cell lines, we

were unable to immunodetect deiminated proteins using the anti-citrulline AMC antibody (data not

shown). This suggested that PADs were inactive. Since it is known that a high calcium ion

concentration is necessary for PADs to be active, HeLa and HaCaT cells were treated with ionomycin,

a calcium-ionophore which increases the calcium influx in the cytoplasm, or with thapsigargin which

induces the release of calcium from the endoplasmic reticulum. These treatments did not allow

deiminated proteins to be detected (data not shown). These results demonstrate that HeLa and HaCaT

keratinocytes are not adapted to analyze endogenous PAD activity and deimination rate. In all the

following experiments we used cultures of primary normal human keratinocytes (NHKs), where the

expression of PADI1-3 has previously been demonstrated.

Vit D increases the PADI1-3 mRNA amounts in NHKs, with distinct kinetics, but not the

corresponding proteins

Since the active form of Vit D has been reported to induce PAD activity in human myeloid leukemia

HL-60 cells (Nakashima et al., 1999) and to promote keratinocyte differentiation (Bikle and Pillai,

1993; Hosomi et al., 1983; Reichrath, 2007; Reichrath et al., 2007), we investigated the effect of

NHK treatment for 24 hours with either Vit D (10-7 M) or Vit D (10-7 M) in presence of 1.5 mM

calcium (Vit D + Ca2+). First, we confirmed, by real time PCR, the expression of PADI1-3 in NHKs,

and the transcriptional effect of Vit D [with low (0.35 mM) or high (1.5 mM) calcium concentrations]

on three keratinocyte differentiation markers, namely the genes of profilaggrin (FLG), involucrin

(IVL) and keratin 10 (KRT10) (data not shown). As is the case in the epidermis (Chavanas et al., 2004;

Guerrin et al., 2003; Nachat et al., 2005), transcripts of PADI4 and 6 were never detected. The Vit D

treatment was shown to up-regulate the PADI1-3 mRNA amounts and no synergic effect of calcium

135
was observed (Table 2). On the contrary, as previously reported (Bikle et al., 2004; Bikle and Pillai,

1993), the high calcium concentration potentiated the Vit D-induced over-expression of the

differentiation markers by a factor of 2.45 ± 0.58 for KRT10, 2.76 ± 1.50 for FLG and 5.88 ± 1.58 for

IVL. The Vit D effect on the amounts of PADI1-3 transcripts started to be detectable after only 6

hours of treatment (data not shown). When we analyzed the effect of Vit D over a longer time (Fig.

1), we observed that the three epidermal PADI genes showed clearly distinct kinetics of induction: the

induction of PADI1 and 3 was maximal at 24 hours, and the amounts of PADI1 and PADI3 mRNAs

had returned to the base line at day 7, whereas the quantity of PADI2 mRNAs continued to increase

until day 10 after the start of the treatment.

We next investigated the effect of the Vit D treatment on PAD expression at the protein level. Treated

NHKs and controls were homogenized in TE-NP40 buffer, a condition known to extract PADs, and

the same amounts of extracted proteins were immunodetected with antibodies against PAD1, PAD2

and PAD3 (Fig. 2A). Using actin detection to normalize the data, the amounts of immunodetected

PAD1-3 remained unchanged after the Vit D treatments as compared to controls. Since PADs require

high calcium concentration to be active (at least in vitro) and Vit D has been reported to increase the

intracellular calcium concentration, we also checked the effect of Vit D on the level of PAD activity.

To reveal deimination rates, NHK proteins were sequentially extracted in TE-NP40 and Laemmli

buffers, and immunodetected with the anti-citrulline AMC antibody (Fig. 2B). No or very little

deimination was detected in the “TE-NP40 extracts” (Fig. 2B, top panels) in contrast to the large

smear of deiminated proteins always observed in the “Laemmli extracts” of NHKs harvested at 6

hours, 24 hours or 7 days after the beginning of the treatments (Fig. 2B, bottom panels). Profiles of

deiminated proteins were similar between controls and Vit D-treated NHK extracts and furthermore,

after actin normalization, no significant effect on the deimination rate was measured between extracts.

Protein deimination rate in NHKs increases drastically with cell-density

Cell-density has been largely described as an efficient way to induce differentiation of NHKs

(Maijgren et al., 2004; Poumay et al., 1999; Poumay and Pittelkow, 1995). We therefore used this

model to further analyze the effect of keratinocyte differentiation on PADs. First, by real time PCR,

136
we investigated the state of differentiation of NHKs harvested at low, intermediate and high cell-

density. We analyzed the mRNA levels of four differentiation markers, i.e. KRT10, FLG, IVL as

above and also galectin 7 (LGALS 7) (Sarafian et al., 2006) (Table 3). As expected, the amounts of

transcripts of these markers were significantly increased at the highest cell-density. For PADI gene

expression, the kinetics of induction were distinct. First, the PADI3 transcript amount was increased

around five fold at the intermediate cell-density and returned to the baseline at the high cell-density.

Next, as observed for the differentiation marker genes, PADI1 transcript level was increased nearly

threefold at the high cell-density. Finally, the amount of PADI2 transcripts remained constant. The

high cell-density of NHKs was also efficient to increase PAD protein amounts (Fig. 3A) and to

drastically up-regulate PAD activity (Fig. 3B). Using actin immunodetection to normalize the data,

the amounts of PAD1 and PAD3 in the “TE-NP40 extracts” were shown to have risen by a factor of

2.30 ± 0.54 and 3.69 ± 0.41, respectively. In parallel, involucrin was also increased at the protein level

by a factor of 3.09 ± 1.31 (Fig. 3B, bottom panel) confirming the effect of cell-density on the

differentiation of NHKs. Furthermore, a large increase of the deimination rate was clearly evidenced

(by a factor of 12.72 ± 0.93) as shown by immunodetection of the “Laemmli extracts” using the anti-

citrulline AMC antibody. In contrast, no effects of NHK cell-density on PAD2 protein amounts were

observed (1.32 ± 0.02). This was to be expected since PADI2 transcript amounts were not modified.

To summarize, NHK differentiation, promoted by an increase in cell density, induced larger amounts

of PADI3 and PADI1 mRNAs, of PAD3 and PAD1 proteins and of protein deimination rate. This

corresponds to the in vivo situation where PAD3, PAD1 and deiminated filaggrin are detected in the

most differentiated keratinocytes.

Auto-deimination might control PAD activity

During in vitro PAD activity measurements, we observed a calcium-dependent auto-deimination of

PAD1, 2 and 3, after incubation of the enzymes for 1 h at 50°C (Fig. 4A). We wondered whether

auto-deimination might be another level to control PAD activity. To test this hypothesis, a filaggrin

subunit, a physiological substrate of PADs, was incubated for increasing periods of time with the

same amount (40 mU) of unmodified (Fig.4B, lanes -) and auto-deiminated recombinant PAD1, 2 or 3

137
(Fig.4B, lanes +; auto-deimination was achieved during 1 h of pre-incubation at 50°C). As we and

others have demonstrated previously (Dong et al., 2005b; Kanno et al., 2000a; Tarcsa et al., 1996),

deimination of filaggrin induced a progressive shift of its migration in SDS-gels, with an apparent

molecular mass increasing from ~ 45 (non-deiminated) to ~ 66 (fully-deiminated) kDa. More efficient

was the deimination of filaggrin more close to ~ 66 kDa was its migration in the gels. When filaggrin

was incubated with the auto-deiminated PADs, the shift in its migration was generally less

pronounced (Fig. 4B, for example compare lanes 1 and 2). Therefore filaggrin was less deiminated,

indicating that the auto-deiminated PADs were less active. This was clearly observed for each isotype

at different incubation times according to their kinetics: after 5 min with the auto-deiminated PAD1

(lanes 1 and 2), after 5 and 60 min with the auto-deiminated PAD2, (lanes 5 and 6, and lanes 7 and 8)

and after 60 min with the auto-deiminated PAD3 (lanes 9 and 10). When filaggrin was incubated with

the auto-deiminated PADs for longer times, it was quite completely deiminated (lanes 3 and 4 for

PAD1, lanes 11 and 12 for PAD3 and not shown for PAD2). These data demonstrate that PAD

activity is reduced and not completely abolished by their calcium-dependent auto-deimination.

After auto-deimination, we also observed a decrease in the intensity of PAD3 immunodetection in

western blotting experiments using the anti-PAD3 anti-peptide antibody (Fig. 4A, top of panel 3).

This is probably linked to antigenic variation(s) of the charge and/or structure of the epitopes after

deimination and therefore to a reduced avidity of the antibody for its immunogenic peptide (49-

DIYISPNMERGRERADTR-66). Assuming a strong structural similarity between PAD3 and PAD4

on the basis of their high sequence similarities, we developed 3D models of PAD3 [without bound-

calcium and substrate (“empty” enzyme), with bound-calcium and benzoyl-L-arginine amide as a

substrate (“full” enzyme)] from PAD4 crystal structures (See supplemental data Fig. S2). According

to these models, the four arginyl residues of PAD3 peptide 49-66 are largely accessible to solvents

and therefore probably to PAD3 itself for deimination (See supplemental data Table S1).

We thought that auto-deimination, inducing a major modification of the global charge of PADs, could

change their 3D structure and in turn their activity. To test this hypothesis we mimic auto-deimination

of PAD3 in silico. First, we determined the accessibility to solvents of all the Arg of the enzyme.

Then the most accessible Arg (% of accessibility ≥ 40) were replaced by Cit in the 3D models [these

138
new models were refined by energy minimization (3000 iterations)], and the Arg/Cit accessibility was

computed again, as described in the experimental procedures. We also calculated the volumes and

surface areas of these 3D structures (of either the entire molecule or the conserved C-terminal domain

containing the active site). Unexpectedly, the accessibility to solvents, volumes and surface areas

remained very similar before and after Arg/Cit conversions (See supplemental data Tables S1 and S2).

In contrast, major differences linked to the presence or absence of both calcium and substrate were

observed between PAD3 models. This suggests that the overall framework structure of the enzyme

was not drastically perturbed by auto-deimination. Alternatively, auto-deimination might induce

subtle conformational changes of the structure and/or accessibility of the active site, sufficient to

reduce PAD activity. To test this hypothesis, and according to a multiple alignment analysis of human

and murine PAD primary sequences (Méchin et al., 2007), we compared, before and after Arg/Cit

substitutions into the PAD3 topological models, the distances between the Asp-350 (atom Cγ), His-

470 (atom Nδ1), Asp-472 (atom Cγ) and Cys-646 (atom Sγ) (Figure 5). These conserved amino-acids

have been previously described for PAD4 as the four reactive amino-acids probably involved directly

in the deimination reaction mechanism (Arita et al., 2004). After deimination, large increases of

distances were observed between the Cγ of Asp-472 and the Sγ of Cys-646 (1.21 Å; 23.54%), the Nδ1

of His-470 (1.3 Å; 38.12%), and the Cγ of Asp-350 (1.42 Å; 19.48%); and also between and the Cγ of

Asp-350 and the Sγ of Cys-646 (0.98 Å; 21.40%). This suggested that the volume of the active site of

PAD3 increases after auto-deimination. To evaluate this swelling, we calculated the volumes of the

tetrahedron form between the four previous atoms of the major amino-acids in the active site of the

PAD3 topological models. The computed volumes were 64.05 Å3 for the “empty” PAD3 model,

against 11.05 Å3 for the “full” PAD3 model, confirming the huge effect of calcium binding. More

interestingly, substitutions of the accessible Arg by Cit in the “full” 3D model (i.e. the active form)

induced an enlargement of 2.34 Å3 (21.1%) to reach 13.39 Å3. These larger distances observed

between major amino-acids involved in the deimination reaction, and consequently the bigger volume

of the active site could explain the reduction of PAD activity induced by auto-deimination. Therefore,

we could suspect auto-deimination as a major step to regulate deimination in vivo.

139
140
Discussion

Since PADs seem to be regulated at multilock points (Méchin et al., 2007; Ying et al., 2009), we

investigated for the first time, the control of deimination during epidermal cell differentiation at

several levels. We quantified first the amounts of each PADI gene transcript, second the amount of the

corresponding PAD isotypes and, third the protein deimination rate as a direct evaluation of PAD

activity. Moreover, we tested whether auto-deimination could be an additional level of control.

HeLa and HaCaT cell lines were not adapt to these investigations since no endogenous protein

deimination was detectable, even after treatments to increase the intra-cellular calcium concentration.

We therefore used primary NHK cultures, and modulated their differentiation following two in vitro

models: (i) treatment with 10-7 M Vit D and (ii) high cell-density.

In the NHKs, we showed that the amounts of PADI1-3 gene transcripts are up-regulated as early as 6

to 24 hours after starting Vit D treatment. Moreover, for the first time, we demonstrated by a

quantitative RT-PCR approach that whereas the amounts of PADI3 rapidly return to the baseline, the

effect on PADI1 is still observable at day 10 after the beginning of the treatment, and the amount of

PADI2 transcript continues to increase until day 10. So, during differentiation of NHKs induced by

VitD, the regulation of the three PADI genes follows distinct kinetics. The differentiation of NHKs

induced by high cell-density controls the amounts of the PADI gene transcripts differently. In this

cellular model, PADI2 is not affected whereas PADI1 and PADI3 are clearly up-regulated. In

summary, the three epidermal PADI genes are controlled differentially during the keratinocyte

differentiation program. In agreement with this hypothesis, we have already demonstrated, using

NHKs exposed to high calcium concentration (1.5 mM), another model to induce differentiation, that

the minimal promoter-driven transcription of PADI3 but not PADI2 is strongly increased through

chromatin looping events by the binding of AP-1 factors to several long-range enhancers, 86 kb and

81-82 kb distant from the PADI3 promoter (Adoue et al., 2008b; Chavanas et al., 2008). During the

course of this work, transcriptional profiling of Vit D-treated immortalized (KerTr) and primary

NHKs using Affymetrix genechips and Q-PCR has confirmed the up-regulation of PADI1-3 and other

differentiation-related genes (Lu et al., 2005). However, in this latter study the corresponding protein

141
levels and enzymatic activities have not been investigated. Moreover, the authors have proposed that a

VitD treatment could be therapeutically relevant in psoriasis to correct the deimination alterations

observed in the patient epidermis. Our own results do not sustain this proposal since inducing the

mRNA levels is not sufficient to induce the protein level and deimination.

To further investigate the Vit D up-regulation of PADI1-3 genes in NHKs, we performed luciferase-

reporter assays as previously described (Adoue et al., 2008b). NHKs, cultured in a medium containing

low or high amounts of calcium, with (10-7 M) or without VitD, were transfected with reporter

plasmids containing 700 bp segments upstream of the transcription initiation start site as PADI1-3

promoters or corresponding controls. However, no effects of Vit D treatment were observed,

suggesting that Vit D does not act through Vit D response elements (VDRE) located in the PADI1-3

minimal promoters (data not shown). Through the use of transgenic murine models, the Vit D receptor

(VDR) has recently been demonstrated to be involved in hair follicle differentiation and in β-catenin

induced skin tumors (Palmer et al., 2008). A Padi3 2-4 fold transcriptional up-regulation was induced

by treatment with the Vit D analog EB1089 of primary keratinocytes from wild type mice but not

VDR null mice. In the same study using chromatin immunoprecipitation experiments, 3 functional

variant consensus VDREs were identified among 11 putative ones upstream of the Padi3 promoter, in

the distal region between nucleotides -2839 and –3095. Based on these data and, using the “NHR scan

program” ([Link] we found at least 11 canonical

direct repeats (DR1 to 5) in the 6000 bp upstream of the human PADI3 transcription initiation start

site (Genbank accession number AJ549502) (data not shown). Some of them could be functional.

Finally, to test for the in vivo necessity of Vit D, for Pad expression in the skin, we immunodetected

Pad1 and 3 on sections of formalin-fixed skin from adult wild type and VDR null mice. In the

epidermis, we did not detect any obvious differences in the location or any decrease in the expression

level of either of these isotypes (see supplemental data Fig. S3). This suggests that the expression of

Pad1 and 3 in basal conditions does not need VitD stimulation via the VDR pathway.

In this work, we also observed for the first time that PADs are regulated in NHKs at the post-

transcriptional level. Indeed, in spite of the up-regulation of mRNAs encoding PAD1-3, the

corresponding proteins are not over-expressed and the deimination rate is not increased in Vit D-

142
treated NHKs compared to controls (note that 0.1 % DMSO induces deimination by itself.) Such a

complex PAD regulation during differentiation has been previously observed in other cellular models.

For example, during monocyte/macrophage differentiation, PADI2 and PADI4 mRNA amounts are

unrelated to PAD2 and PAD4 protein levels (Vossenaar et al., 2004). It has been suggested that

PADI2 mRNA translation is subject to differentiation stage-specific regulation by its 3’ untranslated

terminal region, but other mechanisms may be proposed, including messenger regulation by miRNAs.

Using HeLa and HaCaT cells, we also highlight the fact that PADs could be expressed but not active.

At least one PAD isoform was detected in both cell lines without any deiminated proteins.

Interestingly, in normal epidermis, PAD1 and PAD2 are expressed in the basal and spinous layers,

where deiminated proteins are not detected. This strongly suggests that PADs are also controlled in

vivo at the level of their enzymatic activity. One way to achieve this level of control may be a post-

translational modification. We give here the first evidence that in vitro auto-deimination reduces the

activity of PAD1-3, suggesting that auto-deimination could be a new step of PAD regulation in vivo,

as auto-phosphorylation is for kinases. Auto-regulation of PADs by deimination could control the

deimination rate of filaggrin and therefore have major incidences on its metabolism and consequently

on stratum corneum moisturizing and barrier functions. The existence of auto-deimination of PADs in

vivo remains to be proved, and the mechanism to control their activity is yet to be determined. It

should be also noticed that auto-deimination of PADs does not seem to induce large conformational

changes of the enzymes, as suggested by our computational modeling of PAD3 structure. In contrast,

we propose that subtle changes (increasing distances between major amino-acids involved in the

catalytic reaction, and increasing volume) at the level of the active site could be sufficient to reduce

(not abolish) the catalytic PAD activities.

Furthermore, this work demonstrates, for the first time, that NHK cell density enhances the

transcription of the human PADI3 (fivefold) and PADI1 (threefold) genes, the expression of PAD3

and PAD1, and mainly the deimination rate of cellular proteins (by a factor of 12). This expands the

list of epidermal differentiation markers, including filaggrin, keratins, involucrin and galectins,

regulated by cell confluence.

143
The expression of PAD4 in HeLa and HaCaT cells and its absence in NHKs could be related to the

fact that these cell lines are malignant or transformed. In agreement with this hypothesis, PAD4 has

been detected in various carcinomas (especially adenocarcinomas) but not in the corresponding

normal tissues (Chang and Han, 2006). Furthermore, overexpression of PAD4 has been associated

with G1-phase cell arrest and apoptosis events in hematopoietic cells (Li et al., 2008; Liu et al.,

2006).

The regulation (or disregulation) of PADs in dry skin environments such as atopic dermatitis, the

prevalence of which increases in children of industrial countries (de Benedictis et al., 2009), and in

other pathological situations such as rheumatoid arthritis, is currently being deciphered in our research

unit.

144
Acknowledgments

We thank C. Pons for her excellent technical assistance, the staff of the “Laboratoire de Biologie

Cellulaire Cutanée du CERPER” especially I. Cerutti, M. J. Haure and S. Julié for their technical

advice, the sequencing and genotyping facility of the IFR150 at Toulouse-Purpan, particularly C.

Offer and H. Brun for their precious high efficiency, and the histological facility at Toulouse-Purpan,

especially F. Capilla for her technical advice. We are indebted to Dr A Ishigami (Chiba, Japan) for the

anti-PAD2 antibody, and to Drs H Palmer and G. Carmeliet (Cancer Research UK Cambridge

Research Institute, Cambridge, UK) for providing us with skin sections of VDR-null mice and control

littermates. We would also particularly like to thank N. Mattiuzzo for his technical bio-informatics

suggestions for performing VDRE sequences analysis. This work was supported by grants from the

“Centre National de la Recherche Scientifique” (CNRS), the “Société Française de Dermatologie” and

the “Centre Européen de Recherche sur la Peau et les Epithéliums de Revêtement” (CERPER,

Toulouse, France) and by the “Institut National de la Santé et de la Recherche Médicale” (INSERM).

[1] Méchin, M.C., Sebbag, M., Arnaud, J., Nachat, R., Foulquier, C., Adoue, V., Coudane, F.,
Duplan, H., Schmitt, A.M., Chavanas, S., Guerrin, M., Serre, G. and Simon, M. (2007)
Update on peptidylarginine deiminases and deimination in skin physiology and severe human
diseases. Int J Cosmet Sci 29. 147-68.
[2] Sebbag, M., Chapuy-Regaud, S., Auger, I., Petit-Texeira, E., Clavel, C., Nogueira, L.,
Vincent, C., Cornelis, F., Roudier, J. and Serre, G. (2004) Clinical and pathophysiological
significance of the autoimmune response to citrullinated proteins in rheumatoid arthritis. Joint
Bone Spine 71. 493-502.
[3] Harauz, G. and Musse, A.A. (2007) A tale of two citrullines--structural and functional aspects
of myelin basic protein deimination in health and disease. Neurochem Res 32. 137-58.
[4] Senshu, T., Kan, S., Ogawa, H., Manabe, M. and Asaga, H. (1996) Preferential deimination of
keratin K1 and filaggrin during the terminal differentiation of human epidermis. Biochem
Biophys Res Commun 225. 712-9.
[5] Rogers, G.E. and Taylor, L.D. (1977) The enzymic derivation of citrulline residues from
arginine residues in situ during the biosynthesis of hair proteins that are cross-linked by
isopeptide bonds. Adv Exp Med Biol 86A. 283-94.

145
[6] Tarcsa, E., Marekov, L.N., Andreoli, J., Idler, W.W., Candi, E., Chung, S.I. and Steinert, P.M.
(1997) The fate of trichohyalin. Sequential post-translational modifications by peptidyl-
arginine deiminase and transglutaminases. J Biol Chem 272. 27893-901.
[7] Tarcsa, E., Marekov, L.N., Mei, G., Melino, G., Lee, S.C. and Steinert, P.M. (1996) Protein
unfolding by peptidylarginine deiminase. Substrate specificity and structural relationships of
the natural substrates trichohyalin and filaggrin. J Biol Chem 271. 30709-16.
[8] Kizawa, K., Takahara, H., Troxler, H., Kleinert, P., Mochida, U. and Heizmann, C.W. (2008)
Specific citrullination causes assembly of a globular S100A3 homotetramer: a putative Ca2+
modulator matures human hair cuticle. J Biol Chem 283. 5004-13.
[9] Rawlings, A.V. and Harding, C.R. (2004) Moisturization and skin barrier function. Dermatol
Ther 17 Suppl 1. 43-8.
[10] Smith, F.J., Irvine, A.D., Terron-Kwiatkowski, A., Sandilands, A., Campbell, L.E., Zhao, Y.,
Liao, H., Evans, A.T., Goudie, D.R., Lewis-Jones, S., Arseculeratne, G., Munro, C.S.,
Sergeant, A., O'Regan, G., Bale, S.J., Compton, J.G., DiGiovanna, J.J., Presland, R.B.,
Fleckman, P. and McLean, W.H. (2006) Loss-of-function mutations in the gene encoding
filaggrin cause ichthyosis vulgaris. Nat Genet 38. 337-42.
[11] Palmer, C.N., Irvine, A.D., Terron-Kwiatkowski, A., Zhao, Y., Liao, H., Lee, S.P., Goudie,
D.R., Sandilands, A., Campbell, L.E., Smith, F.J., O'Regan, G.M., Watson, R.M., Cecil, J.E.,
Bale, S.J., Compton, J.G., DiGiovanna, J.J., Fleckman, P., Lewis-Jones, S., Arseculeratne, G.,
Sergeant, A., Munro, C.S., El Houate, B., McElreavey, K., Halkjaer, L.B., Bisgaard, H.,
Mukhopadhyay, S. and McLean, W.H. (2006) Common loss-of-function variants of the
epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat
Genet 38. 441-6.
[12] McGrath, J.A. (2008) Filaggrin and the great epidermal barrier grief. Australas J Dermatol 49.
67-73; quiz 73-4.
[13] Howell, M.D., Fairchild, H.R., Kim, B.E., Bin, L., Boguniewicz, M., Redzic, J.S., Hansen,
K.C. and Leung, D.Y. (2008) Th2 cytokines act on S100/A11 to downregulate keratinocyte
differentiation. J Invest Dermatol 128. 2248-58.
[14] Howell, M.D., Kim, B.E., Gao, P., Grant, A.V., Boguniewicz, M., Debenedetto, A.,
Schneider, L., Beck, L.A., Barnes, K.C. and Leung, D.Y. (2007) Cytokine modulation of
atopic dermatitis filaggrin skin expression. J Allergy Clin Immunol 120. 150-5.
[15] Kamata, Y., Taniguchi, A., Yamamoto, M., Nomura, J., Ishihara, K., Takahara, H., Hibino, T.
and Takeda, A. (2009) Neutral cysteine protease bleomycin hydrolase is essential for the
breakdown of deiminated filaggrin into amino acids. J Biol Chem 284. 12829-36.
[16] Ishida-Yamamoto, A., Senshu, T., Eady, R.A., Takahashi, H., Shimizu, H., Akiyama, M. and
Iizuka, H. (2002) Sequential reorganization of cornified cell keratin filaments involving
filaggrin-mediated compaction and keratin 1 deimination. J Invest Dermatol 118. 282-7.

146
[17] Ishida-Yamamoto, A., Senshu, T., Takahashi, H., Akiyama, K., Nomura, K. and Iizuka, H.
(2000) Decreased deiminated keratin K1 in psoriatic hyperproliferative epidermis. J Invest
Dermatol 114. 701-5.
[18] Chavanas, S., Méchin, M.C., Takahara, H., Kawada, A., Nachat, R., Serre, G. and Simon, M.
(2004) Comparative analysis of the mouse and human peptidylarginine deiminase gene
clusters reveals highly conserved non-coding segments and a new human gene, PADI6. Gene
330. 19-27.
[19] Guerrin, M., Ishigami, A., Mechin, M.C., Nachat, R., Valmary, S., Sebbag, M., Simon, M.,
Senshu, T. and Serre, G. (2003) cDNA cloning, gene organization and expression analysis of
human peptidylarginine deiminase type I. Biochem J 370. 167-74.
[20] Nachat, R., Méchin, M.C., Charveron, M., Serre, G., Constans, J. and Simon, M. (2005b)
Peptidylarginine deiminase isoforms are differentially expressed in the anagen hair follicles
and other human skin appendages. J Invest Dermatol 125. 34-41.
[21] Nachat, R., Méchin, M.C., Takahara, H., Chavanas, S., Charveron, M., Serre, G. and Simon,
M. (2005a) Peptidylarginine deiminase isoforms 1-3 are expressed in the epidermis and
involved in the deimination of K1 and filaggrin. J Invest Dermatol 124. 384-93.
[22] Méchin, M.C., Enji, M., Nachat, R., Chavanas, S., Charveron, M., Ishida-Yamamoto, A.,
Serre, G., Takahara, H., Simon, M. (2005) The peptidylarginine deiminases expressed in
human epidermis differ in their substrate specificities and subcellular locations. Cell Mol Life
Sci 62. 1984-95.
[23] Dong, S., Kanno, T., Yamaki, A., Kojima, T., Shiraiwa, M., Kawada, A., Mechin, M.C.,
Chavanas, S., Serre, G., Simon, M. and Takahara, H. (2006) NF-Y and Sp1/Sp3 are involved
in the transcriptional regulation of the peptidylarginine deiminase type III gene (PADI3) in
human keratinocytes. Biochem J 397. 449-59.
[24] Dong, S., Kojima, T., Shiraiwa, M., Mechin, M.C., Chavanas, S., Serre, G., Simon, M.,
Kawada, A. and Takahara, H. (2005) Regulation of the expression of peptidylarginine
deiminase type II gene (PADI2) in human keratinocytes involves Sp1 and Sp3 transcription
factors. J Invest Dermatol 124. 1026-33.
[25] Dong, S., Ying, S., Kojima, T., Shiraiwa, M., Kawada, A., Mechin, M.C., Adoue, V.,
Chavanas, S., Serre, G., Simon, M. and Takahara, H. (2008) Crucial roles of MZF1 and Sp1
in the transcriptional regulation of the peptidylarginine deiminase type I gene (PADI1) in
human keratinocytes. J Invest Dermatol 128. 549-57.
[26] Chavanas, S., Adoue, V., Mechin, M.C., Ying, S., Dong, S., Duplan, H., Charveron, M.,
Takahara, H., Serre, G. and Simon, M. (2008) Long-range enhancer associated with
chromatin looping allows AP-1 regulation of the peptidylarginine deiminase 3 gene in
differentiated keratinocyte. PLoS ONE 3. e3408.

147
[27] Adoue, V., Chavanas, S., Coudane, F., Mechin, M.C., Caubet, C., Ying, S., Dong, S., Duplan,
H., Charveron, M., Takahara, H., Serre, G. and Simon, M. (2008) Long-range enhancer
differentially regulated by c-Jun and JunD controls peptidylarginine deiminase-3 gene in
keratinocytes. J Mol Biol 384. 1048-57.
[28] Ying, S., Dong, S., Kawada, A., Kojima, T., Chavanas, S., Mechin, M.C., Adoue, V., Serre,
G., Simon, M. and Takahara, H. (2009) Transcriptional regulation of peptidylarginine
deiminase expression in human keratinocytes. J Dermatol Sci 53. 2-9.
[29] Hosomi, J., Hosoi, J., Abe, E., Suda, T. and Kuroki, T. (1983) Regulation of terminal
differentiation of cultured mouse epidermal cells by 1 alpha,25-dihydroxyvitamin D3.
Endocrinology 113. 1950-7.
[30] Bikle, D.D., Oda, Y. and Xie, Z. (2004) Calcium and 1,25(OH)2D: interacting drivers of
epidermal differentiation. J Steroid Biochem Mol Biol 89-90. 355-60.
[31] Bikle, D.D. and Pillai, S. (1993) Vitamin D, calcium, and epidermal differentiation. Endocr
Rev 14. 3-19.
[32] Reichrath, J. (2007) Vitamin D and the skin: an ancient friend, revisited. Exp Dermatol 16.
618-25.
[33] Reichrath, J., Lehmann, B., Carlberg, C., Varani, J. and Zouboulis, C.C. (2007) Vitamins as
hormones. Horm Metab Res 39. 71-84.
[34] Poumay, Y., Herphelin, F., Smits, P., De Potter, I.Y. and Pittelkow, M.R. (1999) High-cell-
density phorbol ester and retinoic acid upregulate involucrin and downregulate suprabasal
keratin 10 in autocrine cultures of human epidermal keratinocytes. Mol Cell Biol Res
Commun 2. 138-44.
[35] Poumay, Y. and Pittelkow, M.R. (1995) Cell density and culture factors regulate keratinocyte
commitment to differentiation and expression of suprabasal K1/K10 keratins. J Invest
Dermatol 104. 271-6.
[36] Nilsson, J.A., Hedberg, J.J., Vondracek, M., Staab, C.A., Hansson, A., Hoog, J.O. and
Grafstrom, R.C. (2004) Alcohol dehydrogenase 3 transcription associates with proliferation of
human oral keratinocytes. Cell Mol Life Sci 61. 610-7.
[37] Vossenaar, E.R., Radstake, T.R., van der Heijden, A., van Mansum, M.A., Dieteren, C., de
Rooij, D.J., Barrera, P., Zendman, A.J. and van Venrooij, W.J. (2004) Expression and activity
of citrullinating peptidylarginine deiminase enzymes in monocytes and macrophages. Ann
Rheum Dis 63. 373-81.
[38] Suzuki, A., Yamada, R., Chang, X., Tokuhiro, S., Sawada, T., Suzuki, M., Nagasaki, M.,
Nakayama-Hamada, M., Kawaida, R., Ono, M., Ohtsuki, M., Furukawa, H., Yoshino, S.,
Yukioka, M., Tohma, S., Matsubara, T., Wakitani, S., Teshima, R., Nishioka, Y., Sekine, A.,
Iida, A., Takahashi, A., Tsunoda, T., Nakamura, Y. and Yamamoto, K. (2003) Functional

148
 haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are
associated with rheumatoid arthritis. Nat Genet 34. 395-402.
[39] Rheinwald, J.G. and Green, H. (1975) Serial cultivation of strains of human epidermal
keratinocytes: the formation of keratinizing colonies from single cells. Cell 6. 331-43.
[40] Sarafian, V., Jans, R. and Poumay, Y. (2006) Expression of lysosome-associated membrane
protein 1 (Lamp-1) and galectins in human keratinocytes is regulated by differentiation. Arch
Dermatol Res.
[41] Nakashima, K., Hagiwara, T., Ishigami, A., Nagata, S., Asaga, H., Kuramoto, M., Senshu, T.
and Yamada, M. (1999) Molecular characterization of peptidylarginine deiminase in HL-60
cells induced by retinoic acid and 1alpha,25-dihydroxyvitamin D(3). J Biol Chem 274.
27786-92.
[42] Kanno, T., Kawada, A., Yamanouchi, J., Yosida-Noro, C., Yoshiki, A., Shiraiwa, M.,
Kusakabe, M., Manabe, M., Tezuka, T. and Takahara, H. (2000) Human peptidylarginine
deiminase type III: molecular cloning and nucleotide sequence of the cDNA, properties of the
recombinant enzyme, and immunohistochemical localization in human skin. J Invest
Dermatol 115. 813-23.
[43] Rozen, S. and Skaletsky, H. (2000) Primer3 on the WWW for general users and for biologist
programmers. Methods Mol Biol 132. 365-86.
[44] Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. and
Speleman, F. (2002) Accurate normalization of real-time quantitative RT-PCR data by
geometric averaging of multiple internal control genes. Genome Biol 3. RESEARCH0034.
[45] Arita, K., Hashimoto, H., Shimizu, T., Nakashima, K., Yamada, M. and Sato, M. (2004)
Structural basis for Ca(2+)-induced activation of human PAD4. Nat Struct Mol Biol 11. 777-
83.
[46] Douguet, D. and Labesse, G. (2001) Easier threading through web-based comparisons and
cross-validations. Bioinformatics 17. 752-3.
[47] Guex, N. and Peitsch, M.C. (1997) Swiss-Model and the sxiss-Pdb viewer: An environment
for comparative protein modeling. Electroph. 18. 2714-2723.
[48] Dove, K.L. and Summer, J.S. (1992) Tetrahedra with integer edges and interger volume.
Math. Mag. 65.
[49] Bikle, D.D., Chang, S., Crumrine, D., Elalieh, H., Man, M.Q., Dardenne, O., Xie, Z., Arnaud,
R.S., Feingold, K. and Elias, P.M. (2004) Mice lacking 25OHD 1alpha-hydroxylase
demonstrate decreased epidermal differentiation and barrier function. J Steroid Biochem Mol
Biol 89-90. 347-53.
[50] Lu, J., Goldstein, K.M., Chen, P., Huang, S., Gelbert, L.M. and Nagpal, S. (2005)
Transcriptional profiling of keratinocytes reveals a vitamin D-regulated epidermal
differentiation network. J Invest Dermatol 124. 778-85.

149
[51] Palmer, H.G., Anjos-Afonso, F., Carmeliet, G., Takeda, H. and Watt, F.M. (2008) The
vitamin D receptor is a Wnt effector that controls hair follicle differentiation and specifies
tumor type in adult epidermis. PLoS ONE 3. e1483.
[52] Chang, X. and Han, J. (2006) Expression of peptidylarginine deiminase type 4 (PAD4) in
various tumors. Mol Carcinog 45. 183-96.
[53] Liu, G.Y., Liao, Y.F., Chang, W.H., Liu, C.C., Hsieh, M.C., Hsu, P.C., Tsay, G.J. and Hung,
H.C. (2006) Overexpression of peptidylarginine deiminase IV features in apoptosis of
haematopoietic cells. Apoptosis 11. 183-96.
[54] Yao, H., Li, P., Venters, B.J., Zheng, S., Thompson, P.R., Pugh, B.F. and Wang, Y. (2008)
Histone Arg modifications and p53 regulate the expression of OKL38, a mediator of
apoptosis. J Biol Chem 283. 20060-8.
[55] de Benedictis, F.M., Franceschini, F., Hill, D., Naspitz, C., Simons, F.E., Wahn, U., Warner,
J.O. and de Longueville, M. (2009) The allergic sensitization in infants with atopic eczema
from different countries. Allergy 64. 295-303.

150
Legends of figures

Figure 1. Effect of Vit D on PADI1-3 transcript levels in NHKs at 1, 7 and 10 days. Quantitative

RT-PCR analysis of the steady-state levels of PADI1-3 mRNAs was performed using NHKs treated

for 24 h with either 10-7 M Vit D in DMSO or DMSO alone (control), harvested at the indicated time,

and using the YWHAZ mRNA as the reference to normalize. The ratios (treated / control) are

expressed as means ± sem for a representative experiment performed in duplicate from among at least

3 independent experiments.

Figure 2. Effect of Vit D on PAD1-3 protein levels (A) and PAD activity (B) in NHKs.

(A) Immunodetection of PAD1-3 and actin in “TE-NP40” extracts of NHKs treated for 24 h with

either Vit D (with or without 1.5 mM calcium) or DMSO as the vehicle control, as mentioned at the

top of the panels. NHKs were harvested at the indicated time. (B) Immunodetection of deiminated

proteins using the anti-citrulline AMC antibody in the “TE-NP40” (top) and “Laemmli” (bottom)

extracts of NHKs treated as described above. Molecular masses are reported in kDa on the right.

Positive controls [C] correspond either to purified recombinant human PAD1, PAD2 and PAD3, and

to human epidermal extracts (A) or to deiminated fibrinogen (B).

Figure 3. Effect of cell-density on PAD1-3 protein levels and PAD activity.

(A) Immunodetections of PAD1-3 (arrowheads) and actin in “TE-NP40” extracts of NHKs harvested

at intermediate (Int.) and high cell-density, as mentioned on the panels. Data obtained for 3

independent experiments are shown. The positive controls [C] correspond to purified human

recombinant PAD1 (top panel), PAD2 (middle panel) and PAD3 (bottom panel). (B)

Immunodetection of deiminated proteins with the anti-citrulline AMC antibody (top panel), of

involucrin (middle panel) and of actin (bottom panel) in the “Laemmli” extracts of NHKs harvested at

intermediate (Int.) and high cell-density. Data obtained for 3 independent experiments are shown.

Molecular masses are reported in kDa on the right.

151
Figure 4. Calcium-dependent auto-deimination of PAD1-3 modulates their activity.

(A) Purified PAD1-3 (as indicated) were incubated in the deimination buffer (Tris-HCl 50 mM pH

7.4, CaCl2 10 mM, DTT 5 mM) for 1h at 50°C in the presence (+) or absence ( - ) of 10 mM EDTA.

PAD1-3 were then immunodetected with their respective anti-PAD antibodies (top panel) and the

anti-citrulline AMC antibody (bottom panel). (B) PADs (40 mU) were preincubated for 1h in the

deimination buffer at either 50°C to allow autodeimination (+) or 0°C as a negative control (-). To test

for the residual PAD activity after auto-deimination, an equal amount of a recombinant filaggrin

subunit was incubated for 5 to 1140 min with the preincubated enzymes, as indicated. For each PAD

isotype the times of incubation with filaggrin were chosen according to their efficiency to deiminate

this physiological substrate. Filaggrin was then immunodetected with AHF11, a monoclonal antibody

recognizing the deiminated filaggrin. Fully deiminated filaggrin is observed at ~ 66 kDa, whereas

partially deiminated forms migrate between ~ 45 and ~ 66 kDa. More the deimination of filaggrin was

efficient more its migration was close to ~66 kDa.

Figure 5. Auto-deimination induces conformational changes of the PAD3 active site.

Zoom, from topological models of PAD3, on the four amino-acids (as indicated on the left panel)

involved during catalysis in the active site, left panel, from “empty” PAD3 model (from WD8) with

39 Arg; middle panel, from “full” PAD3 model (from WDA) with 39 Arg; right panel, from “full”

PAD3 model (from WDA) with Cit instead of the most solvent accessible Arg (accessibility ≥ 40 %).

Distances calculated between the atoms of the four major reactive amino-acids, as indicated, are

reported in Å.

152
Tables and figures

Table 1. Characteristics of primers for Q-PCR experiments.

. .

Sequences* Exon Amplicon Tm

a
. or AN size (bp) (°C)
Genes encoding PADs
PADI1 agagtgacatcgtggacattc 15 231 86
gctcgtggtaggacaagtagtc 16

PADI2 ggtgggatgagcagcaagcgaatc 14 165 86

gaacagagcgggcaggtcaatgatg 15

PADI3 gcagagtgtgacatcattgacatcc 15 173 87

gaccgcaccttctcctccag 16

PADI4 ccacacggggcaaactgtc 6 170 87

cagcagggagatggtgaggg 7

PADI6 cgtggagaagtgcattcacctgaac 14 152 86

gcctcgcaaaggacctcttggg 15

Differentiation marker genes

FLG gcaaggtcaagtccaggagaa NM_002016 122 85
ccctcggtttccactgtctc

IVL gccaggtccaagacattcaac NM_005547 110 86

gggtggttatttatgtttgggtgg

KRT10 tgatgtgaatgtggaaatgaatgc NM_000421 147 83

gtagtcagttccttgctcttttca

LGALS 7 ctggcacggtgctgagaat NM_002307 149 88

cttgctgttgaagaccacctc

Housekeeping genes
YWHAZ acttttggtacattgtggcttcaa NM_003406 94 82
ccgccaggacaaaccagtat

B2M acccccactgaaaaagatga NM_004048 114 83

atcttcaaacctccatgatg

GAPDH tgcaccaccaactgcttagc NM_002046 87 84

ggcatggactgtggtcatgag
.

153
* For each gene, the first sequence is the upper primer and the second one is the lower. Abbreviations

for genes: PADI, peptidylarginine deiminase; FLG, profilaggrin; IVL, involucrin; KRT10, keratin 10;

LGALS7, galectin 7; YWHAZ, tyrosine 3 / tryptophan 5 – monooxygenase activation protein, zeta

polypeptide; B2M, beta-2-microglobulin; GAPDH, glyceraldehyde -3-phosphate dehydrogenase. Tm

is the melting temperature of the amplicon as observed during experimental validations of the primer

pairs for real time PCR. aAN: GenBank accession number. For PADI genes, the ANs are as follows:

PADI1, AB033768; PADI2, AB030176; PADI3, AB026831; PADI4, AB017919; PADI6, AY422079.

154
Table 2. Treatment of NHKs with Vit D increases PADI1-3 transcript amounts at 24 h*.
PADI1 PADI2 PADI3
Vit D a 1.99 ± 0.47 7.96 ± 1.90 5.25 ± 1.25
b 1.45 ± 0.30 7.73 ± 0.27 4.46 ± 0.46
c 6.45 ± 2.24 8.87 ± 1.93 24.69 ± 8.36

Vit D + Ca2+ a 2.19 ± 0.45 9.01 ± 1.55 4.46 ± 1.21

b 1.52 ± 0.10 8.02 ± 0.56 4.04 ± 0.56
. c 4.12 ± 1.63 8.08 ± 2.09 16.05 ± 3.94

* Quantitative RT-PCR analysis of the steady-state levels of PADI1-3 mRNAs was performed using

NHKs treated for 24 h with either 10-7 M Vit D in DMSO or DMSO alone (control), and the YWHAZ

mRNA as the reference. The ratios (treated / control) are expressed as means ± sem for 3 independent

experiments (a-c), each performed in duplicate plates.

155
Table 3. Modulation of the transcript amounts of differentiation marker and PADI1-3 genes by
NHK cell-density *.
NHK cell-density .

Intermediate / low High / low

KRT10 1.04 ± 0.16 8.90 ± 2.28
FLG 1.02 ± 0.32 7.73 ± 2.57
IVL 0.40 ± 0.32 2.61 ± 2.72
LGALS 7 4.56 ± 2.17 18.09 ± 12.49
PADI1 0.69 ± 0.30 3.49 ± 0.98
PADI2 1.03 ± 0.34 0.72 ± 0.20
PADI3 5.03 ± 1.62 0.91 ± 0.19 .

* Quantitative RT-PCR analysis of the steady-state levels of the indicated mRNAs was performed

using NHKs harvested at low, intermediate and high cell-density, and YWHAZ mRNA as the

reference. The ratios are expressed as means ± sem for 3 independent experiments, each performed in

duplicate plates. Abbreviations are as described in the legend of Table 1.

156
Figure 1

157
Figure 2

158
Figure 3

159
Figure 4

160
Figure 5

161
Table S1: Arg accessibility to solvents in the 3D models of PAD3*.

* Three-dimensional models of PAD3 without bound-calcium and substrate (empty) or with bound-

calcium and -benzoyl-L-arginine amide (full) were deduced from the PAD4 structures and the amino-

acid sequence of PAD3. For each Arg, the accessibility to the solvents (in %) was computed. The most

accessible Arg (% of accessibility ≥ 40) were then replaced by Cit, and the accessibility computed

again. The same was done with all Arg replaced by Cit.

162
Table S2: Volumes and surface areas of the entire molecule or C-terminal domain of PAD3*.

* Volumes (Å3) and surface areas (Å2) were computed for PAD3 three-dimensional structures either

without bound-calcium and substrate (empty) or with bound-calcium and -benzoyl-L-arginine amide

as a substrate (full) using “Swiss-Pdb Viewer Deep View 4.0.1”. The same evaluation was made after

substitutions of the most accessible Arg to Cit. The same was done for the C-terminal (C-ter) domain

of PAD3 (from Pro-295 to Pro-664) containing the active site.

163
Figure S1: Schematic representation of the formula to evaluate a tetrahedron volume.

164
Figure S2: Topological 3D models of PAD3*.

* 3D modeling of A, Ca2+-free PAD3 (derived from 1WD8) and B, Ca2+-bound PAD3. The

immunoglobulin-like sub-domains 1 (residues 1-123) and 2 (residues 124-294) are in green and purple

respectively, and the C-terminal domain (295-664) is in yellow. The lateral chains of the arginines of

the peptide 49-66 in sky blue and of the Arg-67 and Arg-69 in red are reported on the structure to

show their accessibility. Ten amino-acids major in the active site are shown using space-filling

representation. The arginine (Arg-372), glycine (Gly-374) and leucine (Leu-640), probably involved in

the substrate specificity of PAD3 are in red, black and orange respectively. The arginine (Arg-346),

tryptophan (Trp-347) and valine (Val-468) recently reported as important in the active site of PAD4

and conserved in the other PADs are in red, grey and pink. Among the four amino-acids directly

involved in the deimination reaction, the two aspartic acids (Asp-350 and Asp-472) are in sky blue and

165
blue navy, respectively, the histidine (His-470) is in purple and the cysteine (Cys-646) in green. As

observed for PAD1 and PAD4 (Méchin et al., 2007), the two structures are roughly superimposable.

166
Figure S3: No decrease in the expression of Pad1 and Pad3 in the epidermis of VDR-null as
compared to wild type mice*.

* Paraffin-embedded sections of 30 (A-D), 60 (E-H) and 105 (I-L) days old wild type (WT) (A, C, E,

G, I and K) and VDR-null mice (B, D, F, H, J and L) were analyzed by immunohistochemical staining

with the purified polyclonal antibodies against Pad1 and Pad3. Pad1 and Pad3 are located

preferentially in the stratum granulosum of both WT and VDR-null mouse epidermis. No decrease in

the detection level of both Pad1 and Pad3 was evidenced in the VDR-null mouse epidermis. Moreover

Pad3 but not Pad1 was located in dermal cysts of the VDR-null mouse skin (H and L).

hf (hair follicle); dc (dermal cyst). Bars in A -D = 100 µm; bar in E-L = 200 µm.

167
Method: Paraffin-embedded skin sections of WT and VDR-null mice were a kind gift from H. Palmer

and G. Carmeliet (Cancer Research UK Cambridge research Institute, Cambridge,UK). Skin sections

were deparaffinised and rehydrated using standard procedures. Immunohistochemistry was performed

using the Histostain-Plus kit (Zymed) according to the manufacturer's instructions. Pad1 and Pad3

were detected using already described and validated isotype specific rabbit antipeptide antibodies at a

concentration of 1 and 0.3 µg/ml respectively. Before applying the primary antibodies, tissue sections

were processed for heat-induced epitope retrieval using a target retrieval solution at pH 9.9 (Dako,

#S3308) and pH 9 (Dako, #S2368) for Pad1 and Pad3 detection respectively. The slides were then

incubated in a humidified chamber with their corresponding primary antibodies overnight at 4°C.

Colour was developed in an aminoethyl carbazole substrate solution and the tissues were

counterstained with hematoxylin. A normal rabbit antiserum was used as a negative control.

168
 Publication n° 2 :

Citrullination of Fibrin and Differential Expression of Peptidylarginine Deiminases

during Wound Healing in Mice

Fanny Coudane, Marie-Claire Méchin, Anne Huchenq, Julie Henry, Rachida Nachat,
Akihito Ishigami, Véronique Adoue, Mireille Sebbag, Guy Serre, Michel Simon.

Soumis à : The Journal of Investigative Dermatology

La désimination ou citrullination est une modification post-traductionnelle catalysée par une

famille d’enzymes : les peptidyl-arginine désiminases (PADs). Les PADs peuvent convertir
en présence de calcium les résidus arginyl en résidus citrullyl au sein d’une séquence
peptidique. Trois isoformes de PADs sont exprimées dans l’épiderme, les PAD1, 2 et 3. Les
PAD1 et 3 ont été impliquées dans la désimination de la filaggrine, et donc dans la production
du Facteur Naturel d’Hydratation indispensable à l’hydratation de la couche cornée. La
désimination a également été observée dans de nombreuses conditions inflammatoires au sein
de différents tissus.
Afin de mieux comprendre le rôle de ces enzymes, nous avons analysé leur expression et
recherché les protéines désiminées lors de la cicatrisation cutanée. Nous avons pour cela
réalisé des blessures excisionnelles sur le flanc de souris adultes et détecté ces protéines par
immunohistologie durant 10 jours au cours des phases inflammatoire et de ré-épithélialisation
de la cicatrisation. Pad1 a été immunodétectée dans toutes les couches suprabasales des
kératinocytes du néo-épiderme ainsi que dans le tissu non lésé. Pad3, normalement détectée
dans la couche granuleuse de l’épiderme interfolliculaire, a présenté un profil d’expression
plus spécifique. Elle n’a pas été détectée dans les cellules prolifératives de la languette de ré-
épithélialisation qui progresse le long de la plaie, mais seulement dans les kératinocytes en
cours de différenciation dans le cytoplasme desquels elle était colocalisée avec la
(pro)filaggrine. L’utilisation de souris Padi2-/- semblait indiquer que Pad2 n’est pas
nécessaire à la cicatrisation.
Enfin nous avons détecté des protéines désiminées à la fois dans la couche cornée de
l’épiderme à distance de la blessure et du néo-épiderme dans la phase tardive de la ré-
épithélialisation, mais aussi dans le caillot fibrino-plaquettaire et la croûte qui en dérive. Nous

169
avons montré par western blot que la fibrine est l’une des protéines désiminées dans le caillot
et détecté la présence d’une Pad normalement absente de l’épiderme : la Pad4. La présence de
fibrine citrullinée et de PAD4 a été montrée dans plusieurs cas d’inflammation pathologique
en particulier articulaire, mais c’est la première fois qu’elle est décrite au cours d’un
processus physiologique, la cicatrisation cutanée. Notre hypothèse est que la Pad4 pourrait
être amenée au niveau du site de la blessure par des cellules inflammatoires comme les
neutrophiles.

170
 Citrullination of Fibrin and Differential Expression of Peptidylarginine Deiminases during
Wound Healing in Mice

Fanny Coudane1, Marie-Claire Méchin1, Anne Huchenq1, Julie Henry1, Rachida Nachat1, Akihito
Ishigami2, Véronique Adoue1, 3, Mireille Sebbag1, Guy Serre1, Michel Simon1.

1
CNRS-University of Toulouse III, UMR5165, Institut Fédératif de Recherche 150 (INSERM-CNRS-
Université Paul Sabatier-Centre Hospitalier Universitaire de Toulouse), Toulouse, France.
2
Department of Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, Chiba, Japan.

3
Present address: Genome Québec Innovation Centre and Department of Human Genetics, McGill
University, Montreal, Canada.

Correspondence: Michel SIMON UMR5165, CNRS-Université Toulouse III, CHU Purpan, Place du
Dr Baylac TSA40031, 31059 Toulouse cedex 9, France.
Tel: +33-5 6115 8427; Fax: +33-5 6149 9036; E-mail: [Link]@[Link]

Short title: Citrullination in Wound Healing

Keywords: citrulline / posttranslational modifications / skin / epidermis / wound healing

Abbreviations: IF, immunofluorescence; PAD, peptidylarginine deiminase; SC, stratum corneum; SG,
stratum granulosum.

171
ABSTRACT
Citrullination or deimination is a posttranslational modification catalyzed by peptidylarginine

deiminases (PADs) that convert protein-bound arginines into citrullines. PAD1-3 are differentially

expressed in the epidermis, where deimination of filaggrin plays a key role in the stratum corneum

(SC) barrier functions. Since deimination has been observed in various inflammatory conditions, we

analyzed Pad expression and citrullinated proteins during cutaneous wound healing. Full-thickness

punches were performed on adult mouse back skin, and wound recovery was analyzed over 10 days by

immunohistology. Pad1 was immunodetected in all layers of keratinocytes in the neo-epidermis as

well as in the non-injured tissue. Pad3, normally expressed in the stratum granulosum, was not

detected in the hyperproliferative tongue of the neo-epidermis closed to the leading edge, but was

shown to be coexpressed with (pro)filaggrin in a large number of keratinocyte layers in its

differentiating part. Wound healing seemed to be Pad2-independent, as shown using Padi2-/- mice.

Deiminated proteins were detected in the SC of the non-injured epidermis and of the neo-epidermis in

the late phase of re-epithelialization. At the wound site, they were also detected in the clot and then in

the clot-derived scab. Our data showed that the involved enzyme at this site is Pad4, and that fibrin is

one of the deiminated proteins.

172
INTRODUCTION

Deimination or citrullination is a posttranslational modification of various proteins catalyzed by five

peptidylarginine deiminases (PADs; EC [Link]). PADs convert, in a calcium-dependent manner, the
guanidino group of arginyl residues into the ureido group of citrullyl residues (Fujisaki and Sugawara,
1981; Vossenaar et al., 2003). The physiological role of deimination is beginning to be unraveled
(Méchin et al., 2007). Deimination of the NH2 terminus of histones H2A, H3 and H4 by PAD4 is
thought to be involved in gene regulation, particularly of estrogen target genes (Cuthbert et al., 2004;
Hagiwara et al., 2002; Nakashima et al., 2002b; Wang et al., 2004b). In addition, hypercitrullination
of histones has been proposed to play a role in the innate immune response to bacterial infections
through chromatin decondensation in neutrophils (Neeli et al., 2008; Wang et al., 2009). Deimination
of IL8 and CXCL10, probably by PAD2, alters the biological properties of these chemokines (Loos et
al., 2009; Proost et al., 2008). Pad6 is essential for female mouse fertility, and the inactivation of Pad6
gene induces an early zygote/embryo developmental defect (Esposito et al., 2007). The importance of
deimination is also highlighted by its involvement in human diseases: i) in the inflamed synovial
membrane of rheumatoid arthritis patients, arthritogenic and disease-associated autoantibodies to
citrullinated proteins recognize a deiminated form of fibrin generated by locally expressed PAD2
and/or PAD4 (Foulquier et al., 2007; Masson-Bessiere et al., 2001); ii) an increased deimination of
myelin basic protein and glial fibrillary acidic protein is linked to the development of multiple
sclerosis (Keilhoff et al., 2007; Kim et al., 2003) and has been observed in the brain of patients with
Alzheimer’s disease (Ishigami et al., 2005).
In skin, the major deiminated proteins are trichohyalin in the hair follicles (Rogers, 1977; Tarcsa et
al., 1997; Tarcsa et al., 1996), and keratins K1 and K10 and filaggrin in the epidermis (Senshu et al.,
1996). PAD3 deimination of trichohyalin, a structural protein of cells in the inner root sheath and in
the medulla of the hair shaft, is necessary for its cross-linking by transglutaminases and therefore plays
a major role in the mechanical resistance of hair follicles. Deimination of filaggrin, a key protein for
the barrier functions of the cornified layer, is necessary for its detachment from the corneocyte matrix
and its subsequent degradation to free amino acids. The amino acids and their derivatives, urocanic
and pyrrolidone carboxylic acids, are the main components of the natural moisturizing factor (for
reviews, see (Méchin et al., 2007; Rawlings, 2005). Decrease in the deimination of K1 has been
reported in psoriasis and bullous congenital ichthyosiform erythroderma (Ishida-Yamamoto et al.,
1992; Ishida-Yamamoto et al., 2000).
In the human and newborn mouse epidermis, three PAD isotypes are expressed, PAD1/Pad1,
PAD2/Pad2 and PAD3/Pad3, with similar patterns of expression. PAD1 has been detected in the entire
epidermis, PAD2 in the suprabasal layers, and PAD3 only in the granular and lower cornified layers
(Mechin et al., 2005; Nachat et al., 2005a; Nachat et al., 2005b). We have proposed that PAD1 and 3

173
are responsible for the deimination of filaggrin and keratins (Mechin et al., 2005) but the exact
function of PAD2 remains unknown.
PAD expression in keratinocytes is regulated at multiple levels, including transcription of their
encoding PADI genes. In particular, transcription factors of the AP1 family, namely c-Jun, c-Fos and
JunD, have been shown recently to be involved in a long range control of PADI3 gene transcription
(Adoue et al., 2008a; Chavanas et al., 2008b). These transcription factors are either down-regulated or
translocated to the keratinocyte cytoplasm in the very early phase of cutaneous wound healing (Neub
et al., 2007), suggesting a possible down-regulation of PADI3. Interestingly, decreased deimination of
K1 (Ishida-Yamamoto et al., 2000) and a down-regulation of AP1 factors (Zeeuwen et al., 2004; Zenz
and Wagner, 2006) have been observed in psoriatic lesional skin, a disease with features of a chronic
wound response (McKay and Leigh, 1995; Nickoloff et al., 2006). In addition, wound healing is a
complex and dynamic process that consists of three main overlapping phases: inflammation in the first
48 hours, re-epithelialization 2-10 days after injury (including keratinocyte hyperproliferation,
migration then differentiation) and remodeling of the dermis for a year. Since deimination has been
previously observed in several inflammatory conditions (Foulquier et al., 2007; Makrygiannakis et al.,
2006), the deimination of proteins during the inflammation phase of wound healing can be suspected.
To gain more information on the physiological importance of deimination in the epidermis, we
investigated the immunodetection patterns of citrullinated proteins, Pad1 and Pad3 during cutaneous
wound healing. Moreover, to evaluate the role of Pad2 we analyzed the cutaneous phenotype of Padi2
knock-out mice, and compared wound healing in wild type and Padi2-/- mice.

174
RESULTS AND DISCUSSION
To investigate pattern of deiminated proteins and expression of Pad1 and 3 during cutaneous wound
healing, we performed 4 mm excisional wounds on the flank of normal adult C57BL/6 mice, and
immunohistochemical analysis on sections of mouse skin using an antibody to citrullinated proteins
and affinity-purified antibodies specific for Pad1 or Pad3. We also used anti-keratin K6 and anti-
(pro)filaggrin antibodies to discriminate hyperproliferative and differentiating states of the
keratinocytes. During the 10 days following wounding, we analyzed the epidermis at some distance
from the wound and several wound areas. We observed the keratinocytes localized behind and at the
wound margin, and the keratinocytes of the regenerating epidermis (neo-epidermis) including the
leading edge. We also analyzed the blood clot in the early phase of healing and then the clot-derived
scab.

Deiminated proteins, Pad1 and Pad3 are detected in the interfollicular epidermis of adult mice
In the epidermis distant from the wound (Figure 1A), and also in the epidermis of non-wounded mice
(data not shown), deiminated proteins were detected in the stratum corneum (SC), Pad1 in the
cytoplasm of all keratinocytes and Pad3 only in the stratum granulosum (Salomon et al.) where
profilaggrin was also immunodetected. These results showed that, in the epidermis of adult mice, Pads
are expressed and deimination occurs with patterns similar to those previously observed in newborn
mice (Akiyama and Senshu, 1999; Nachat et al., 2005b).

Citrullination and Pad1 and 3 during wound healing

In the early phase (day 1) of wound healing (Figure 1B), deiminated proteins were strongly detected in
the clot. In some cases the labeling appeared intracellular or nuclear. No deiminated proteins were
detected at the epidermal wound margin or in the regenerating epidermis. At these sites, no Pad1, Pad3
and (pro)filaggrin was detected. When we analyzed the expression of K6 as a well known marker of
hyperproliferation (Mansbridge and Knapp, 1987), the protein was only detected in some hair follicles
(data not shown), meaning that the proliferative phase of re-epithelialization had not started yet, as
expected.
In the re-epithelialization phase 2-4 days after wounding (Figures 2 and 3), deiminated proteins were
strongly immunodetected in the scab that had formed at the surface of the wound. The labeling was
either diffuse and apparently extracellular or located in the nucleus of some cells (Figure 2). The same
pattern was observed using indirect immunofluorescence (IF) and confocal microscopy analysis
(Figure 3A). Moreover, an increase in the amount of detected citrullinated proteins was observed in
the SC at and just behind the wound margins, as compared to the SC in the epidermis at distance from
the wound site (Figure 3A). The anti-K6 antibody (Figure 2) stained the cytoplasm of suprabasal cells
in all the regenerating epidermis progressing over the injured dermis. The expression of (pro)filaggrin

175
was delayed compared with that of K6. It was only detected in the upper keratinocytes of the most
distal part of the neo-epidermis (Figure 2), as previously published (Mansbridge and Knapp, 1987;
Paladini et al., 1996a; Patel et al., 2005). Profilaggrin and filaggrin were observed in the cytoplasm of
6-7 keratinocyte layers with a granular pattern of labeling, and in the lower SC. Pad1 was detected in
all the regenerating epidermis up to the leading edge. The anti-Pad3 antibody also labeled the
cytoplasm of 6-7 keratinocyte layers with a granular pattern, and the lower SC. The expression of
Pad3 and (pro)filaggrin seemed to follow the same kinetics of appearance when serial sections were
observed (Figure 2). To confirm these results, double-labeling direct IF was performed using the
Zenon immunolabeling technology and analyzed by confocal microscopy. At and just behind the
wound margin, we observed an increase in the detection of Pad3 and (pro)filaggrin (Figure 3B). The
co-localization of Pad3 and profilaggrin in the granular keratinocytes of the neo-epidermis was clearly
demonstrated (Figure 3C). Double-labeling was performed with the anti-K6 and anti-Pad3 antibodies
to control the specificity of detection. The absence of transfer of the Zenon-label from one primary
antibody to the other was confirmed since K6 was not detected in the epidermis at some distance from
the wound where Pad3 was (Figure 3D, left part of the pictures).

During the late phase (day 6-8) of re-epithelialization (Figure 4) citrullinated proteins were detected
in the scab and the SC of the neo-epidermis. The migrating tongue of the neo-epidermis had achieved
its progression, i.e. the leading edges were in contact, and the keratinocytes were no longer
proliferating as demonstrated by the absence of K6. Pad1 was detected in all the neo-epidermis with a
lower intensity in the basal layer. Pad3 was still co-expressed with (pro)filaggrin in several layers of
granular keratinocytes.
Later in the process of healing (8 to 10 days) when the scab had came out, deiminated proteins were
only detected in the SC (Figure 5, upper). Pad1 was detected in all the suprabasal epidermis (data not
shown). K6 was no longer expressed. Pad3 and (pro)filaggrin still had the same granular pattern of
expression in differentiating keratinocytes (Figure 5).
This colocalization of Pad3 and profilaggrin in the granular keratinocytes, probably in keratohyalin
granules, observed during the entire re-epithelialization suggested a similar mechanism of regulation
for the expression of both proteins. Since filaggrin is a substrate of PAD3, we can suspect that the
expression pattern of these proteins had converged during evolution. Interestingly, expression of both
human filaggrin and PAD3 genes has been shown to be regulated at the transcriptional level, and
implicates Activated Protein-1 (AP-1) transcription factors, particularly c-Jun (Adoue et al., 2008a;
Chavanas et al., 2008b; Jang et al., 1996). Expression of c-Jun is also reduced at the wound margins in
the early phase of wound healing (Neub et al., 2007). A downregulation of c-Jun transcripts has also
been found in psoriasis (Basset-Seguin et al., 1991; Zenz et al., 2005). A resulting reduction of PAD3
expression, that remains to be tested, could therefore explain the decrease deimination of keratins
observed in the patient SC.

176
In the scab fibrin is a good candidate for deimination by Pad4
To biochemically characterize the citrullinated proteins in the scab we performed western blotting
experiments (Figure 6A) with proteins sequentially extracted in different solubility conditions: in the
presence of first nonidet P-40 detergent (TENP40 buffer extracts), then urea (TEU buffer extracts) and
finally urea and a reducing agent (TEUDTT buffer extracts). The anti-citrulline antibody clearly
immunodetected several citrullinated proteins of various molecular weight, essentially in the TENP40
and TEU buffer extracts (lanes 1 and 2). A fibrin-rich clot is known to form early in the course of
wound repair (Gurtner et al., 2008). Moreover, citrullinated fibrin has been identified in the synovial
tissue affected by a wide variety of inflammatory conditions and shown to be extracted in similar
conditions (Chapuy-Regaud et al., 2005; Foulquier et al., 2007). We therefore investigated whether
fibrin was a potential target of PADs in the scab. We confirmed the presence of fibrin in the TEU
buffer extracts by western blotting with an antiserum directed to the β-chain of fibrin(ogen). The β-
chain was mainly detected as a large band of approximately 55 kD (Figure 6B). This band co-migrated
with the in vitro citrullinated β-chain of purified mouse fibrinogen used as a positive control. We then
performed immunoblotting of the same membrane after dehybridation, with the anti citrulline
antibody. An immunoreactive band was detected at exactly the same size (Figure 6B, arrow),
indicating that fibrin could actually be one of the citrullinated extracellular proteins detected in the
scab. This is another example of fibrin deimination during inflammation. This confirms that fibrin
deimination is neither synovium- nor rheumatoid arthritis-specific but rather an inflammation-related
process. The function of fibrin deimination is not known. However, two recent studies have suggested
that the citrullination of fibrinogen could inhibit its transformation directed by thrombin into fibrin
fibrils (Nakayama-Hamada et al., 2008; Okumura et al., 2009).
We next looked for the Pad isotypes present in the protein extracts of scabs by immunoblotting
(Figure 6C) using the above described isotype-specific anti-Pad antibodies. Two additional probes
were used: a monoclonal antibody specific for PAD2, and affinity-purified antibodies specific for
PAD4, both known to specifically react with their corresponding mouse ortholog, but that had
unfortunately turned out useless in immunohistological analysis despite extensive work to overcome
low reactivity and high background levels on mouse tissues (not shown). Pad1, 2 and 3 could not be
detected in the scab extracts. The absence of Pad1 and 3 detection is consistent with the
immunohistological data. Only Pad4 was detected in the TEU buffer extracts. This suggests that, in the
wound-induced scab, Pad4 is the isotype involved in the deimination of proteins, and particularly of
fibrin. This hypothesis is in line with the observation of PAD4 isotype in the inflamed synovium of
human patients with arthritis where fibrin has been shown to constitute an important target for this
enzyme (Foulquier et al., 2007) or of mice and rat with various experimentally-induced arthritides
(Vossenaar et al., 2003; Lundberg et al., 2005). It is also consistent with PAD4 being expressed in
various cells of the hematopoietic lineage (Hagiwara et al., 2002), including monocytes, macrophages

177
and neutrophils, i.e. cells commonly found in wound scabs and of importance for the wound repair. In
fact, after formation of a platelet plug, the cellular response of the inflammatory phase is characterized
by the influx of leukocytes at the wound site. Shortly after the injury, neutrophils are the first cells to
migrate in great number to form a barrier against the invading pathogens at the wound site. They
reside diffusely distributed in the blood clot, which provides a matrix for the recruitment of cells
(Gillitzer and Goebeler, 2001). At the wound site (day 4) in the scab, we experimentally confirmed the
already known presence of polynuclear cells by haematoxylin/eosin staining, and of neutrophils by
immunohistochemistry with the monoclonal antibody NIMP-R14 (Figure S1). Interestingly, histone
hypercitrullination performed by PAD4 has been detected in neutrophils and has been suggested to
play a major role in the innate immune response to bacterial infections by mediating chromatin
decondensation. Upon activation, neutrophils release in the extracellular space highly decondensed
chromatin structures associated with cytoplasmic proteins, termed neutrophil extracellular traps. These
structures bind bacteria and fungi, and induce their death through a high local concentration of
antimicrobial peptides (Fuchs et al., 2007; Wang et al., 2009). This process may take place for
neutrophils in the clot and be at the origin of the extracellular release of Pad4 that can mediate
citrullination of extracellular proteins including fibrin. An alternative possibility is that apoptosis (or
necrosis) of Pad-expressing cells present in the clot could lead to leak out of the enzymes following
membrane integrity lost. Whatever the cells and mechanisms involved in Pad expression and
activation, it should be mentioned that the presence of Pad4, the only isoform with a nuclear
localization signal (Nakashima et al., 2002b), is in agreement with the immunohistological detection
of citrullinated proteins in the nucleus of some cells in the clot and the scab (Figures 1, 2 and 3A).

Pad2 is not required for a normal cutaneous wound healing in mice

To discriminate a potential role of Pad2 in wound healing, we analyzed the cutaneous phenotype of
Padi2 knockout mice. These mice were obtained by insertion/deletion of a neomycin cassette in the
first exon of the Padi2 gene and display no evident phenotype (Raijmakers et al., 2006). In basal, non-
healing, conditions no morphological or histological modifications were detected in the skin of the
Padi2 invalidated mice (Figure S2 and data not shown). The level of citrullinated proteins was not
altered and no detectable increase in the expression of the other Pad isoforms was observed. When
analyzed by immunohistology and western blotting, no changes in the expression of the differentiation
markers keratin K10, loricrin and (pro)filaggrin were noted. In addition, the barrier function, as
revealed by trans-epidermal water loss measurement remained the same (Figure S2 and data not
shown). These results show that the absence of Pad2 does not seem to induce any modifications in
cornification. We performed 4 mm full thickness punch biopsies on the flank skin of Padi2 knock out
mice, and analyzed wound healing over 10 days by immunohistology and western blotting. The
completion of wound closure was similar in wild type and Padi2-/- littermate mice (Figure 7A). No
morphological or histological changes were evidenced (data not shown). Moreover, citrullinated

178
proteins were strongly detected in the scabs with both extracellular and nuclear staining patterns
(enlargements, Figure 7B upper part). Finally, the patterns and kinetics of K6, (pro)filaggrin and Pad3
expression in skin during wound healing in wild type and Padi2-/- mice were identical (Figure 7B and
data not shown). These data demonstrate that the Pad2 isotype does not play an essential role in the
completion of wound closure and in the citrullination of proteins in the blood clot and the clot-derived
scab. They strengthen the role of Pad4 in the deimination of proteins in the clot during cutaneous
wound healing.

In conclusion, during cutaneous wound healing deiminated proteins were detected by

immunohistology in the clot and then in the scab where their presence was confirmed by
immunoblotting analysis. One of these deiminated proteins could correspond to a deiminated form of
fibrin. In the scab only Pad4 was detected. We suspect this isotype to be produced by the very
abundant neutrophils detected into the scab. Using Padi2-/- knock out mice, we showed that Pad2 is
not necessary for both normal wound recovery and deimination of scab proteins during wound
healing. As regards the epidermis, the expression of Pad1 and Pad3 was shown to be regulated during
wound closure: they were not detected during the early phase, when keratinocytes migrate. Pad3
reappeared concomitantly with profilaggrin at the periphery of the neo-epidermis when keratinocytes
begin to differentiate. The proteins are colocalized in 6-7 layers of upper keratinocytes, as compared to
1-2 in the intact normal epidermis. We hypothesize that these increases are the result of the accelerated
differentiation program of keratinocytes in the neo-epidermis leading to an increasing production of
natural moisturizing factor intended to restore the barrier function and the hydration of the upper
epidermis. As Pad3 and (pro)filaggrin follow the same kinetics/pattern of expression during re-
epithelialization, we assume that Pad3 is the isotype involved in filaggrin deimination during this
process.

179
MATERIALS AND METHODS
Antibodies
The characterization of the isotype-specific affinity-purified rabbit anti-peptide antibodies directed to
Pad1, 3 and 4 has already been reported (Guerrin et al., 2003a; Nachat et al., 2005b). The mouse
monoclonal anti-Pad2 antibody was recently described (Shimada et al., in press). Rabbit polyclonal
antibodies against keratin K6 and (pro)filaggrin were from Covance Research (Princeton, NJ) and the
rabbit polyclonal antibody against fibrin(ogen) was from Cambio (Cambridge, UK). Citrullinated
proteins were probed using rabbit IgG to modified citrullyl residues, a generous gift of Pr Tatsuo
Senshu, Yokohama City University, Yokohama, Japan), as previously described (Senshu et al., 1992).

Excisional wound healing

Punch biopsies (full thickness; 4 mm in diameter) were made in the flanks of adult C57BL/6 mice (10-
12 weeks old). Mice were anesthetized with pentobarbital and their flank shaved. A 4 mm-diameter
punch was used every two days to create wounds that extended through the panniculus carnosus, 1 cm
on either side of the lumbar midline. Digital photographs of the wounds were taken at 1 or 2-day
intervals during 10 days. Wound surface area was measured using ImageJ Software (National
Institutes of Health, Bethesda, MD) and plotted as a percentage of the surface at day zero. At day 10
the animals were euthanized. Wounded and healed skin was excised and fixation in formalin or
freezing, for further histological analysis or western blotting analyses, respectively, was immediately
performed to prevent post-morten deimination. All procedures were performed according to the
conventional principles for animal care, and were approved by the relevant Institutional Animal Care
and Use Committees, i.e. the Regional Ethic Commitee for animal experimentation and the CNRS.

Immunohistology
The formalin-fixed mouse skin samples were embedded in paraffin and 5 µm-thick sections were
generated. Immunohistochemical staining was performed using a Vectastain ABC kit (Vector
Laboratories, Burlingame, CA), according to the manufacturer’s instruction. Anti-Pad1 and -Pad3
were diluted to 1 and 0.3 µg/ml, respectively. The antibodies against keratin K6 and (pro)filaggrin
were diluted following the manufacturer recommendations. Citrullinated proteins were probed using
rabbit IgG to modified citrullyl residues after in situ modification of citrullyl residues as previously
described (Senshu et al., 1992). Before overnight incubation at 4°C in a moist chamber with the
primary antibodies, tissue sections were processed for heat-induced epitope retrieval using one of the
following target retrieval solutions: pH 9.9 or 9 buffered solutions (Dako, Glostru, Denmark) for the
detection of citrullinated proteins or Pad3, respectively, and a 1 mM EDTA pH 10 solution for Pad1
detection. Finally, the slides were incubated for 10 minutes with the secondary reagent provided in the
kit, and bound antibodies were visualized by incubation for 10 minutes at room temperature with

180
diaminobenzidine and counterstained with hematoxylin. A normal rabbit antiserum was used as a
negative control.
Indirect IF was performed on mouse skin samples, after antigen retrieval as described above. After
rehydration in PBS at room temperature, sections were incubated in a moist chamber for 30 minutes
with PBS containing 1% goat serum and 0.05% Tween-20, then 1 hour at 37°C with the antibodies
diluted in the same buffer. After washing four times in PBS containing 0.05% Tween-20, sections
were incubated for 1 hour at room temperature with 488 Alexa Fluor® secondary antibodies diluted to
1/1000 in PBS containing 1% bovine serum albumin and 0.05% Tween-20. Sections were washed in
PBS and mounted in an anti-fading solution (Mowiol; Calbiochem, San Diego, CA) before
observation under a confocal laser microscope (LSM510, Carl Zeiss, Iena, Germany).
Direct double-labeling IF was performed with the Zenon labeling system that allows using of multiple
antibodies derived from the same species in the same protocol, according to the manufacturer
instructions (Invitrogen, Carlsbad, CA). Rabbit anti-(pro)filaggrin and -keratin K6 antibodies were
prelabeled with the Zenon® Alexa Fluor® 555 Rabbit IgG2b labeling kit, and rabbit anti-Pad3
antibodies with the Zenon® Alexa Fluor® 488 Rabbit IgG2b labeling kit with a final dilution of
1/100, 1/100 and 1/30, respectively. Sections were observed by confocal microscopy (LSM710, Carl
Zeiss). Co-localization was evaluated by a comparison of the emission spectra of the fluorochromes
along a line crossing several stained keratohyalin granules using the Zen 2008 software (Carl Zeiss).

Extraction of proteins from scab

The scabs obtained 2-4 days after wounding, were frozen to prevent post-mortem deimination and
sequentially extracted after disruption by sonication in equal volumes of a Tris-EDTA buffer (40 mM
Tris-HCl, pH 7.5, 10 mM EDTA and 0.1% (v/v) protease inhibitor cocktail (Sigma-Aldrich, St Louis,
MO) containing either 0.5% Nonidet P-40 (TENP40 buffer extract), 6 M urea (TEU buffer extract), or
6 M urea and 50 mM dithiothreitol (TEUDTT buffer extract).

Protein electrophoresis and immunoblotting

Recombinant PADs (a kind gift of Pr Hidenari Takahara, Ibaraki, Japan), rabbit muscle Pad2 (Sigma-
Aldrich), mouse purified citrullinated fibrinogen produced as previously described (Masson-Bessière
et al., 2001), and scab protein extracts were separated by 7.5 % SDS-polyacrylamide gel
electrophoresis, stained with Coomassie blue or electrotransferred to reinforced nitrocellulose
membranes. The membranes were stained with Ponceau Red and incubated overnight at 4°C with the
primary antibodies at a concentration of 1, 0.6 and 2.2 µg/ml for the anti-Pad1, -Pad3 and -Pad4
antibodies, respectively. The monoclonal anti-Pad2 antibody (hybridoma supernatant) was diluted to
1/500, and the anti-fibrin(ogen) following the manufacturer instruction. The blots were probed with
HRP-conjugated secondary antibodies (Zymed, San Fransisco, CA). Detection was performed with
ECL reagent (GE Healthcare, Buckinghamshire, UK).

181
Padi2 knock out mice
The Pad2 deficient mice were obtained from Boehringer Ingelheim Pharmaceutical, Inc. (Ridgefield,
CT) and have been described previously (Rajmakers et al., 2006). All mice were bred and housed in a
specific pathogen-free transgenic mouse facility and the animal protocols were approved by the
French Ministry for Education, Research and Technology (Genetic Engineering Commission) and the
CNRS.

182
CONFLICT OF INTEREST
All authors state no conflict of interest.

ACKNOWLEDGMENTS
We are indebted to Dr Brian Werneburg and Boehringer Ingelheim Pharmaceutical for the gift of
Padi2+/- mice, Pr Hidenari Takahara (Ibaraki University, Japan) for the recombinant PADs, and Pr
Tatsuo Shenshu for the anti-citrullinated protein antibodies. We thank Carole Pons and Renan
Destrade for their excellent technical assistance, Sophie Allard from the confocal microscopy facility
(INSERM, IFR150, Toulouse), and Dr Talal al Saati (INSERM, UMR563, Toulouse) for his help in
the identification of cellular infiltrate. We are also indebted to the experimental histopathology and
animal facilities (Platform in Life Sciences AnExplo of Toulouse genopole (Genotoul)) of IFR150.
This work was supported by the «Institut National de la Santé et de la Recherche Médicale»
(INSERM), the Toulouse University and the «Centre National de la Recherche Scientifique» (CNRS).

183
REFERENCES

Adoue V, Chavanas S, Coudane F, Méchin M-C, Caubet C, Ying S, et al. (2008) Long-Range
Enhancer Differentially Regulated by c-Jun and JunD Controls Peptidylarginine Deiminase-3 Gene in
Keratinocytes. J Mol Biol 384:1048-57.

Akiyama K, Senshu T (1999) Dynamic aspects of protein deimination in developing mouse epidermis.
Exp Dermatol 8:177-86.

Basset-Seguin N, Escot C, Moles JP, Blanchard JM, Kerai C, Guilhou JJ (1991) C-fos and c-jun
Proto-Oncogene Expression Is Decreased in Psoriasis: an In Situ Quantitative Analysis. J Invest
Dermatol 97:672-8.

Chapuy-Regaud S, Sebbag M, Baeten D, Clavel C, Foulquier C, De Keyser F, et al. (2005) Fibrin

Deimination in Synovial Tissue Is Not Specific for Rheumatoid Arthritis but Commonly Occurs
during Synovitides. J Immunol 174:5057-64.

Chavanas S, Adoue V, Méchin M-C, Ying S, Dong S, Duplan H, et al. (2008) Long-Range Enhancer
Associated with Chromatin Looping Allows AP-1 Regulation of the Peptidylarginine Deiminase 3
Gene in Differentiated Keratinocyte. PLoS ONE 3:e3408.

Clavel C, Nogueira L, Laurent L, Iobagiu C, Vincent C, Sebbag M, Serre G. (2008) Induction

of macrophage secretion of tumor necrosis factor α through Fcγ receptor IIa engagement by
rheumatoid arthritis-specific autoantibodies to citrullinated proteins complexed with
fibrinogen. Arthritis Rheum 58:678-88.

Cuthbert GL, Daujat S, Snowden AW, Erdjument-Bromage H, Hagiwara T, Yamada M, et al. (2004)
Histone Deimination Antagonizes Arginine Methylation. Cell 118:545-53.

Esposito G, Vitale AM, Leijten FP, Strik AM, Koonen-Reemst AM, Yurttas P, et al. (2007)
Peptidylarginine deiminase (PAD) 6 is essential for oocyte cytoskeletal sheet formation and female
fertility. Mol Cell Endocrinol 273:25-31.

Foulquier C, Sebbag M, Clavel C, Chapuy-Regaud S, Al Badine R, Mechin MC, et al. (2007) Peptidyl
arginine deiminase type 2 (PAD-2) and PAD-4 but not PAD-1, PAD-3, and PAD-6 are expressed in
rheumatoid arthritis synovium in close association with tissue inflammation. Arthritis Rheum 56:3541-
53.

Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, et al. (2007) Novel cell death
program leads to neutrophil extracellular traps. J Cell Biol 176:231-41.

Fujisaki M, Sugawara K (1981) Properties of Peptidylarginine Deiminase from the Epidermis of

Newborn Rats. J Biochem 89:257-63.

184
Gillitzer R, Goebeler M (2001) Chemokines in cutaneous wound healing. J Leukoc Biol 69:513-21.

Guerrin M, Ishigami A, Mechin MC (2003) cDNA cloning, gene organization and expression analysis
of human peptidylarginine deiminase type I. Biochem J 370:167-74.

Gurtner GC, Werner S, Barrandon Y, Longaker MT (2008) Wound repair and regeneration. Nature
453:314-21.

Hagiwara T, Nakashima K, Hirano H, Senshu T, Yamada M (2002) Deimination of arginine residues

in nucleophosmin/B23 and histones in HL-60 granulocytes. Biochem Biophys Res Commun 290:979-
83.

Ishida-Yamamoto A, Senshu T, Eady RA, Takahashi H, Shimizu H, Akiyama M, et al. (2002)

Sequential reorganization of cornified cell keratin filaments involving filaggrin-mediated compaction
and keratin 1 deimination. J Invest Dermatol 118:282-7.

Ishida-Yamamoto A, Senshu T, Takahashi H, Akiyama K, Nomura K, Iizuka H (2000) Decreased

deiminated keratin K1 in psoriatic hyperproliferative epidermis. J Invest Dermatol 114:701-5.

Ishigami A, Ohsawa T, Hiratsuka M, Taguchi H, Kobayashi S, Saito Y, et al. (2005) Abnormal

accumulation of citrullinated proteins catalyzed by peptidylarginine deiminase in hippocampal extracts
from patients with Alzheimer's disease. J Neurosci Res 80:120-8.

Jang S-I, Steinert PM, Markova NG (1996) Activator Protein 1 Activity Is Involved in the Regulation
of the Cell Type-specific Expression from the Proximal Promoter of the Human Profilaggrin Gene. J
Biol Chem 271:24105-14.

Johansen C, Kragballe K, Rasmussen M, Dam TN, Iversen L (2004) Activator protein 1 DNA binding
activity is decreased in lesional psoriatic skin compared with nonlesional psoriatic skin. Br J Dermatol
151:600-7.

Keilhoff G, Prell T, Langnaese K, Mawrin C, Simon M, Fansa H, et al. (2008) Expression pattern of
peptidylarginine deiminase in rat and human Schwann cells. Dev Neurobiol 68:101-14.

Kim JK, Mastronardi FG, Wood DD, Lubman DM, Zand R, Moscarello MA (2003) Multiple
Sclerosis: An Important Role for Post-Translational Modifications of Myelin Basic Protein in
Pathogenesis. Mol Cell Proteomics 2:453-62.

Loos T, Mortier A, Gouwy M, Ronsse I, Put W, Lenaerts J-P et al. (2009) Citrullination of CXCL10
and CXCL11 by peptidylarginine deiminase: a naturally occuring posttranslational modification of
chemokines and new dimension of immunoregulation. Blood 112: 2648-56.

Lundberg K, Nijenhuis S, Vossenaar ER, Palmblad K, van Venrooij WJ, Klareskog L, et al. (2005)
Citrullinated proteins have increased immunogenicity and arthritogenicity and their presence in
arthritic joints correlates with disease severity. Arthritis Res Ther 7:R458-67.

185
Makrygiannakis D, Klint E, Lundberg IE, Lofberg R, Ulfgren AK, Klareskog L, et al. (2006)
Citrullination is an inflammation-dependent process. Ann Rheum Dis 65:1219-22.

Mansbridge JN, Knapp M (1987) Changes in Keratinocyte Maturation During Wound Healing. J
Invest Dermatol 89:253-63.

Masson-Bessiere C, Sebbag M, Girbal-Neuhauser E, Nogueira L, Vincent C, Senshu T, et al. (2001)

The Major Synovial Targets of the Rheumatoid Arthritis-Specific Antifilaggrin Autoantibodies Are
Deiminated Forms of the {{alpha}}- and {{beta}}-Chains of Fibrin. J Immunol 166:4177-84.

McKay IA, Leigh IM (1995) Altered keratinocyte growth and differentiation in psoriasis. Clin
Dermatol 13:105-14.

Méchin MC, Enji M, Nachat R, Chavanas S, Charveron M, Ishida-Yamamoto A, et al. (2005) The
peptidylarginine deiminases expressed in human epidermis differ in their substrate specificities and
subcellular locations. Cell Mol Life Sci 62:1984-95.

Méchin MC, Sebbag M, Arnaud J, Nachat R, Foulquier C, Adoue V, et al. (2007) Update on
peptidylarginine deiminases and deimination in skin physiology and severe human diseases. Int J
Cosmet Sci 29:147-68.

Moscarello M.A., Mastronardi F.G., Wood D.D. (2007) The role of citrullinated proteins suggests a
novel mechanism in the pathogenesis of multiple sclerosis. Neurochem Res 32:251-6.

Nachat R, Méchin MC, Charveron M, Serre G, Constans J, Simon M (2005a) Peptidylarginine

deiminase isoforms are differentially expressed in the anagen hair follicles and other human skin
appendages. J Invest Dermatol 125:34-41.

Nachat R, Méchin MC, Takahara H, Chavanas S, Charveron M, Serre G, et al. (2005b)

Peptidylarginine deiminase isoforms 1-3 are expressed in the epidermis and involved in the
deimination of K1 and filaggrin. J Invest Dermatol 124:384-93.

Nakashima K, Hagiwara T, Yamada M (2002) Nuclear Localization of Peptidylarginine Deiminase V

and Histone Deimination in Granulocytes. J Biol Chem 277:49562-8.

Nakayama-Hamada M, Suzuki A, Furukawa H, Yamada R, Yamamoto K (2008) Citrullinated

Fibrinogen Inhibits Thrombin-catalysed Fibrin Polymerization. J Biochem 144:393-8.

Neeli I, Khan SN, Radic M (2008) Histone Deimination As a Response to Inflammatory Stimuli in
Neutrophils. J Immunol 180:1895-902.

Neub A, Houdek P, Ohnemus U, Moll I, Brandner JM (2007) Biphasic Regulation of AP-1 Subunits
during Human Epidermal Wound Healing. J Invest Dermatol 127:2453-62.

Nicholas A.P., Sambandam T., Echols J.D., Tourtellotte W.W. (2004) Increased citrullinated glial
fibrillary acidic protein in secondary progressive multiple sclerosis. J Comp Neurol 473:128-36.

186
Nickoloff BJ, Bonish BK, Marble DJ, Schriedel KA, DiPietro LA, Gordon KB, et al. (2006) Lessons
Learned from Psoriatic Plaques Concerning Mechanisms of Tissue Repair, Remodeling, and
Inflammation. J Invest Dermatol Symp P 11:16-29.

Okumura N, Haneishi A, Terasawa F (2009) Citrullinated fibrinogen shows defects in FPA and FPB
release and fibrin polymerization catalyzed by thrombin. Clin Chim Acta 401:119-23.

Opdenakker G, Van Damme J, Proost P (2009) Citrullination of CXCL8 increases its potency to
mobilize neutrophils in the blood circulation. Haematologica in press.

Paladini RD, Takahashi K, Bravo NS, Coulombe PA (1996) Onset of re-epithelialization after skin
injury correlates with a reorganization of keratin filaments in wound edge keratinocytes: defining a
potential role for keratin 16. J Cell Biol 132:381-97.

Patel GK, Wilson CH, Harding KG, Finlay AY, Bowden PE (2005) Numerous Keratinocyte Subtypes
Involved in Wound Re-Epithelialization. J Invest Dermatol 126:497-502.

Proost P, Loos T, Mortier A, Schutyser E, Gouwy M, Noppen S, et al. (2008) Citrullination of CXCL8
by peptidylarginine deiminase alters receptor usage, prevents proteolysis, and dampens tissue
inflammation. J Exp Med 205:2085-97.

Raijmakers R, Vogelzangs J, Raats J, Panzenbeck M, Corby M, Jiang H, et al. (2006) Experimental

autoimmune encephalomyelitis induction in peptidylarginine deiminase 2 knockout mice. J Comp
Neurol 498:217-26.

Rawlings A. (2005) Stratum Corneum Moisturization at the Molecular Level : An Update in Relation
to the Dry Skin Cycle. J Invest Dermatol 124:1099-110.

Rogers G, Harding, HWJ, Llewellyn-Smith, IJ (1977) The origin of citrulline-containing proteins in

the hair follicle and the chemical nature of trichohyalin, an intracellular precursor. Biochim Biophys
Acta 495: 159–75.

Senshu T, Kan S, Ogawa H, Manabe M, Asaga H (1996) Preferential deimination of keratin K1 and
filaggrin during the terminal differentiation of human epidermis. Biochem Biophys Res Commun
225:712-9.

Senshu T, Sato T, Inoue T, Akiyama K, Asaga H (1992) Detection of citrulline residues in deiminated
proteins on polyvinylidene difluoride membrane. Anal Biochem 203:94-100.

Shimada N, Handa S, Uchida Y, Fukuda M, Maruyama N, Asaga H, et al. (2009) Developmental and
age-related changes of peptidylarginine deiminase 2 in the mouse brain J Neurosc Res in press.

Tarcsa E, Marekov LN, Andreoli J, Idler WW, Candi E, Chung S-I, et al. (1997) The Fate of
Trichohyalin. J Biol Chem 272:27893-901.

187
Tarcsa E, Marekov LN, Mei G, Melino G, Lee S-C, Steinert PM (1996) Protein Unfolding by
Peptidylarginine Deiminase. J Biol Chem 271:30709-16.

Vossenaar ER, Zendman AJ, van Venrooij WJ, Pruijn GJ (2003a) PAD, a growing family of
citrullinating enzymes: genes, features and involvement in disease. Bioessays 25:1106-18.

Vossenaar ER, Nijenhuis S, Helsen MMA, van der Heijden A, Shenshu T, van den Berg WB, et al.
(2003b) Citrullination of synovial proteins in murine models of rheumatoid arthritis. Arthritis Rheum
48:2489-500.

Wang Y, Li M, Stadler S, Correll S, Li P, Wang D, et al. (2009) Histone hypercitrullination mediates

chromatin decondensation and neutrophil extracellular trap formation. J Cell Biol 184:205-13.

Wang Y, Wysocka J, Sayegh J, Lee YH, Perlin JR, Leonelli L, et al. (2004) Human PAD4 regulates
histone arginine methylation levels via demethylimination. Science 306:279-83.

Zenz R, Eferl R, Kenner L, Florin L, Hummerich L, Mehic D (2005) Psoriasis-like skin disease and
arthritis caused by inducible epidermal deletion of Jun proteins. Nature 437:369-75.

Zenz R, Wagner EF (2006) Jun signalling in the epidermis: From developmental defects to psoriasis
and skin tumors. Int J Biochem Cell Biol 38:1043-9.

188
LEGENDS
Figure 1. Localization of deiminated proteins, Pad1 and Pad3 in skin during the wound healing
early inflammatory phase.
Citrullinated proteins (Candi et al.), Pad1, Pad3 and (pro)filaggrin ((pro)Flg) were
immunohistochemically localized in sections of paraffin-embedded samples of mouse wounded skin,
as indicated. The samples were obtained 1 day after wounding, at the early inflammatory stage of
healing. The analyses were performed both at some distance from (A) and at the level of (B) the
wound site. A strong staining of citrullinated proteins is observed in the clot where the arrows denote
nuclear staining of some cells and the star a diffuse, apparently extracellular, staining. The dotted lines
show the dermo-epidermal junction, and the arrowheads the wounded site. Scale bars = 100 µm.

Figure 2. Localization of deiminated proteins, Pad1 and Pad3 in normal skin during the wound
healing early phase of re-epithelialization.
Paraffin-embedded skin sections of wounded mice were analyzed using the anti-modified citrulline
(Candi et al.), anti-Pad1 and anti-Pad3 antibodies, as indicated. Keratin K6 and (pro)filaggrin
((pro)Flg) specific antibodies were used to mark keratinocyte hyperproliferation and late
differentiation, respectively. The samples were obtained 2 to 4 days after wounding during the early
stage of re-epithelialization. A strong staining of citrullinated proteins is observed mainly inside the
scab. The arrows denote the presence of a nuclear staining and the star indicates a diffuse, extracellular
staining. The dotted lines show the dermo-epidermal junction. Scale bars = 100 µm.

Figure 3. Co-localization of Pad3 and profilaggrin in normal skin during the wound healing
early phase of re-epithelialization.
Paraffin-embedded skin sections of wounded mice were analyzed by confocal microscopy using the
anti- modified citrulline, anti-Pad1, anti-Pad3, anti-keratin K6 and anti-(pro)filaggrin antibodies, as
indicated. The samples were obtained 2 to 4 days after wounding. The abbreviations are as in Figure 2,
and the wounded site (ws) is indicated by an open arrow. (A) The presence of citrullinated proteins in
the scab is confirmed: the arrows denote the presence of abundant nuclear staining and the star
indicates diffuse staining. An increase in the detection of citrullinated proteins in the stratum corneum
is observed at the wound margin, as compared to the more distal epidermis. (B) Using the Zenon
technology for immunolabelling and direct immunofluorescence, an increase in the detection of Pad3
and (pro)filaggrin in the stratum granulosum is observed at the wound margin. A merged image of
(pro)filaggrin/Pad3 detection is shown. (C) The co-localization of (pro)filaggrin and Pad3 in granular
keratinocytes is shown by double labeling, and confirmed by the spectral profiles of the two
fluorochromes (Zenon-Alexa-488 in green and Zenon-Alexa-555 in red) detected along the white
arrow (lower panels). (D) A merged image of K6/Pad3 detection is shown. The absence of a total
superposition indicates the stability of the Zenon-Fab-antibody complexes and the absence of transfer

189
of the Zenon-labels from one primary antibody to the other. The dotted lines show the dermo-
epidermal junction. Scale bars = 100 µm.

Figure 4. Localization of deiminated proteins, Pad1 and Pad3 in normal skin during the wound
healing late phase of re-epithelialization.
Paraffin-embedded skin sections of wounded mice were analyzed using the anti-modified citrulline,
anti-Pad1, anti-Pad3, anti-keratin K6 and anti-(pro)filaggrin antibodies, as indicated. The skin biopsies
were obtained 6 to 8 days after wounding during the late stage of re-epithelialization where no more
proliferative keratinocytes can be observed (keratin K6 is not detected). The abbreviations are as in
Figure 2. A strong staining of deiminated proteins is observed in the scab and the stratum corneum.
The dotted lines show the dermo-epidermal junction. Scale bars = 100 µm.

Figure 5. Localization of deiminated proteins, Pad3, keratin 6 and (pro)filaggrin in normal skin
at the end of the process of wound healing.
Paraffin-embedded skin sections of wounded mice were analyzed using the anti modified citrulline,
anti-Pad1, anti-Pad3, anti-keratin K6 and anti-(pro)filaggrin antibodies, as indicated. The sections
were obtained 8 to 10 days after wounding. Note the detection of deiminated proteins in the stratum
corneum of the neo-epidermis (arrow). The abbreviations are as in Figure 2. The dotted lines show the
dermo-epidermal junction. Scale bars = 100 µm.

Figure 6. Immunodetection of deiminated proteins, fibrin(ogen) and Pad4 in protein extracts of

wound scab.
Wound scab proteins were sequentially extracted in Tris-HCl buffers containing nonidet P-40
(Lippens S), urea (Lippens S) and urea/DTT (Lippens S), and analyzed by Western blotting. (A)
Citrullinated proteins are detected with the anti-modified citrulline antibody (Candi et al.) in all the
extracts. (B) The β-chain of fibrin is detected in the urea-extract with a specific antiserum. The arrow
indicates a deiminated protein with a size corresponding to that of the deiminated β-chain of
fibrinogen. Deiminated fibrinogen was used as a positive control (+). The position of molecular
markers is indicated on the left in kDa. (C) Pad1, 2 and 3 are not immunodetected. Pad4, the nuclear
isotype, is detected in the urea-extracts. Recombinant Pad1, 3 and 4 and purified Pad2 were used as
positive controls (+).

Figure 7. Pad2 is not required for a normal cutaneous wound healing in mice.
The healing process of excisional wounds in the back skin of Padi2 knockout and control mice was
followed over 10 days (n=6 animals per genotype and time point, 1–4 wounds of each animal were
analyzed). (A) The surfaces of wound closure were measured over time and plotted as a percentage of
the surface at day zero. No significant differences in wound closure were detected between wild type

190
(black line) and Padi2-/- (gray line) mice. Bars represent the mean plus standard deviation. (B)
paraffin-embedded skin sections of wounded Padi2-/- mouse were analyzed using the anti-modified
citrulline, anti-keratin K6, anti-(pro)filaggrin and anti-Pad3 antibodies, as indicated. The samples were
obtained 4 to 6 days after wounding during the early stage of re-epithelialization where proliferative
keratinocytes can be observed (detection of K6). The abbreviations are as in Figure 2. The dotted lines
show the dermo-epidermal junction. Scale bars = 100 µm or 10 µm in the enlargements.

Supplemental Figure S1. Neutrophils are present in the scab.

At day 4 during cutaneous wound healing, neutrophils are detected in the scab, as seen in
haematoxylin/eosin staining (H/E) and confirmed with the anti neutrophil antibody Nimp R-14
(Abcam, Cambridge, UK). The neo-epidermis is indicated. Scale bars = 50 µm.

Supplemental Figure S2. The epidermis of Padi2 knockout mice is apparently normal.
(A) Frozen newborn mouse skin samples were first ground to a fine powder in liquid nitrogen. All
subsequent steps were performed at 0-4°C. The proteins were sequentially extracted by suspension in
Hepes buffer (50 mM Hepes-KOH, pH 7.6, 1 mM EGTA, 0.43 mM PMSF, 0.5 mM DTT, 1% Triton
X-100) and disruption by sonication (Lippens S). After centrifugation for 30 minutes at 12,000 g, the
supernatant was collected and the remaining pellet was extracted in an equal volume of the same
buffer containing 6 M urea (Lippens S). Proteins of wild type (wt; Padi2+/+) and Padi2 knockout
(Padi2-/-) mouse skin were then analyzed by Western blotting with an anti-Pad2 antibody and an anti-
modified citrulline antibody (Candi et al.). Pad2 was detected in the protein extracts of wt but not
knockout mice. Citrullinated proteins are detected in the extracts of wild type and Padi2-/- mice with
the same profile of detection. (B) Trans epidermal water loss (TEWL) of 2-day-old knockout, wt and
heterozygous mice were evaluated using an EP1 Evaporimeter (Servo Med, AB Stockholm, Sweden).
No significant differences (ns) were observed in the values obtained. One-tailed Student's t-tests and
Mann Whitney tests were performed for statistical evaluation of data. P-values of more than 0.05 were
considered non significant. All bars correspond to the mean ± SEM values (n = 30 animals). (C)
Cryosections of back skin samples of newborn mice were analyzed using the anti-modified citrulline,
anti-Pad1, anti-Pad3, anti-(pro)filaggrin ((pro)fil), anti-loricrin (lor) and anti-keratin K10 antibodies.
Anti-loricrin and anti-K10 antibodies were from Covance. The dotted lines show the dermo-epidermal
junction. Scale bars = 100 µm.

191
192
193
194
195
196
197
198
199
200
 Résultats complémentaires 1
Etude du phénotype des souris Padi2-/-

Résultats complémentaires 1 :

Etude du phénotype cutané des souris dont le gène Padi2 a été invalidé.

Les souris invalidées pour le gène Padi2 nous ont été fournies par la société Boehringer
Ingelheim Pharmaceutical, Inc. (Ridgefield, CT). Elles ont été obtenues par insertion/délétion
d’une cassette néomycine dans le premier exon du gène Padi2.
Raijmakers et coll. ont produit ces souris pour étudier l’effet de l’absence de Pad2, dans le
cerveau sur le développement de l’encéphalomyélite auto-immune expérimentale. Ils ont
observé une diminution très importante des protéines citrullinées dans le cerveau des souris
KO, ce qui indique que cette isoforme a un rôle prépondérant dans la citrullination des
protéines au cours de l’encéphalite, mais ont aussi montré que cette modification n’est pas
indispensable au développement de la pathologie (Raijmakers et al., 2006).

1- Confirmation de l’absence de la Pad2 dans les souris KO Padi2-/-

Le génotypage des souris a été réalisé par PCR (Polymerase Chain Reaction) à partir d’ADN
de queue de souris grâce à trois amorces spécifiques : deux amorces, respectivement, en
amont et en aval de l’exon 1 du gène Padi2 et une amorce située dans la cassette néomycine
(figure 42A et B). S’il y a eu un évènement de recombinaison homologue, l’amplicon a une
taille de 312 pb (Padi2-/-), tandis que pour les souris sauvages il est de 471 pb.
L’absence d’expression de la protéine a été confirmée par immunodétection d’extraits de peau
de souriceaux nouveau-nés (figure 42C) (voir l’article n°2).

201
 Résultats complémentaires 1
Etude du phénotype des souris Padi2-/-

A B

Figure 42 : Génération des souris KO Padi2. Schéma décrivant la position des amorces utilisées pour le génotypage (A) et
résultats obtenus (B). Analyse par western blot d’un extrait protéique de peau de souriceaux (C).

2- Absence de phénotype cutané évident

Des analyses morphologiques et histologiques n’ont pas permis de mettre en évidence de
différences phénotypiques entre l’épiderme des souris sauvages (WT) et Padi2-/- (figure 43).
Au niveau macroscopique, je n’ai pas observé de variations du poids des animaux, de l’aspect
du pelage ni de l’épiderme; une analyse histologique a montré que l’épaisseur de l’épiderme
et le nombre d’assises de kératinocytes de ses différentes couches sont identiques. Je n’ai pas
non plus observé de variation du nombre des follicules pileux et des annexes cutanées.

A WT Padi2-/-
Figure 43 : analyse histologique de la peau
des souris sauvages (WT) et KO (Padi2-/-).

Coloration en haematoxyline de cryocoupes

de peau de souris nouveau-nées (A) et
haematoxyline / éosine de coupes de peau de
B
souris adultes fixées en formaldéhyde et
incluses en paraffine (B).

202
 Résultats complémentaires 1
Etude du phénotype des souris Padi2-/-

3- Acquisition normale de la fonction de barrière

L’acquisition des fonctions de perméabilité (de l’extérieur vers l’intérieur) et de rétention
d’eau évaluées respectivement par un test de pénétration du bleu de toluidine (figure 44A) et
de perte en eau trans-épidermique (TEWL) (figure 44B), était identique entre les embryons
sauvages, KO et hétérozygotes.

wt Padi2 -/- A : Coloration bleu Figure 44 : analyse de la barrière épidermique.

toluidine L’acquisition de la fonction de barrière
épidermique vis-à-vis de l’environnement
extérieur analysée par la pénétration du bleu de
toluidine dans les embryons de 18,5 jours (A) et

B : TEWL par la perte en eau trans-épidermique de

souriceaux nouveau-nés (B). Elle est similaire
pour les souris sauvages (wt), hétérozygotes (+/-)
3 portées: n=24
TEWL [Link]-2 h-1 et KO (Padi2-/-).
3

2,5

1,5

0,5

0
+/+ +/- -/-

4- Différenciation normale
Je n’ai pas mis en évidence de différence dans l’expression des marqueurs de différenciation
kératine K10, involucrine, loricrine et (pro)filaggrine, par western blot (figure 45) et
immunohistochimie (article n°2).

Figure 45 : analyse des marqueurs de la différenciation.

Des extraits de peau du dos ou de queue (q) de souriceaux
nouveau-nés (NN) sauvages (wt) et KO ont été
immunodétectées avec des anticorps anti-kératine 10,
loricrine et involucrine

203
204
 Résultats complémentaires 2 :

Activation des PADs in vitro.

Les cellules prolifératives de la lignée HaCaT expriment les PADs 1, 2, 3 et 4 mais aucune
protéine désiminée n’a pu y être détectée (article 1 et données non publiées de M-C Méchin).
Nous avons cherché à activer la désimination. Pour cela nous avons soumis ces cellules à
deux traitements (figure 46A et B) :
A : Afin de déterminer l’impact des rayonnements UVs, connus pour induire l’apoptose, sur
la réaction de désimination, les cellules HaCaT ont été irradiées avec des doses d’UV-B de 25
et 50 mJ/cm2. Cette irradiation a clairement permis de détecter des protéines citrullinées par
Western blot avec l’anticorps anti-citrulline AMC.
B : Les cellules ont été soumises à un stress oxydatif, grâce à l’ajout de peroxyde d’hydrogène
dans le milieu de culture pendant une heure. L’activation des PADs a également pu être mise
en évidence par immunodétection avec l’anticorps AMC.

Dans un extrait de kératinocytes primaires non-différenciés en culture, les PAD1-3 ont pu être
détectées facilement mais pas les protéines désiminées (article n°1). Pour tenter d’activer la
désimination un tapis cellulaire de kératinocytes a été « blessé » par des rayures selon le
« scratch assay » décrit par Turchi et al (Turchi et al., 2002). Les kératinocytes ont été
récoltés immédiatement, ou après 3 à 24 heures d’incubation. Des protéines désiminées ont
été mises en évidence par immunodétection avec l’anticorps AMC après 3 et 6 heures
d’incubation (figure 46C). Les extraits protéiques de ces kératinocytes nous ont été
aimablement fournis par le Dr G. Ponzio (INSERM U634, Nice).

205
 UVs (mJ/cm2)
A B C+ H2O2 T-
C
Kd
C+ 0 25 50
Kd C C+ C- 3h 6h 8h 12h 24h C-24h
250 Kd
250
250
130
130 130
95
95 95
72 72
72
55 55
55
36
36
36
28 28

28

Figure 46 : activation des PADs in vitro. (A et B) Des cellules HaCaT ont été irradiées avec des doses d’UV-B de 25 et 50
mJ/cm² (A) ou traitées pendant 1h avec 0,4 mM d’H2O2 (B). (C) Des kératinocytes humains normaux en culture ont été
« blessés » et recueillis immédiatement (C-) ou après 3, 6, 8, 12 et 24 h d’incubation. Des cellules recueillies après 24h sans
blessure préalable ont aussi été analysées (C- 24h). Les pistes (C+) correspondent à un extrait de fibrinogène désiminé. Dans
tous les cas, les cellules ont été extraites en tampon Laemmli et les protéines citrullinées détectées avec l’anticorps AMC
(voir le paragraphe « matériel et méthodes » de l’article n°1).

206
Discussion et perspectives
 Discussion et perspectives
Régulation de l’expression et de l’activité des PADs

Nos travaux nous ont permis de poser les bases de la régulation complexe de
l’expression des PADs. Nous avons par ailleurs établi que les Pad3 et 4 de souris ont des rôles
spécifiques dans la cicatrisation cutanée. Si la présence de fibrine citrullinée avait été montrée
dans plusieurs cas d’inflammation pathologique, en particulier articulaire, c’est la première
fois qu’elle est décrite au cours d’un processus physiologique comme la cicatrisation cutanée.

I- Régulation de l’expression et de l’activité des PADs

Nous avons montré que les PADs sont régulées à plusieurs niveaux dans les kératinocytes
humains primaires en culture: transcriptionnel, post-transcriptionnel et certainement post-
traductionnel.

A- Expression et activité des PADs dans différents types cellulaires

Dans les lignées cellulaires HaCaT (kératinocytes immortalisés) et HeLa (adénocarcinome du
col de l’utérus) couramment utilisées comme modèles pour étudier les kératinocytes in vitro,
nous n’avons pas pu mettre en évidence la présence de protéines citrullinées. Cependant nous
avons détecté les ARNm des PADs par RT-PCR (PAD1-4 dans les cellules HaCaT et PAD3
et 4 dans les cellules HeLa) ainsi que leurs formes protéiques par western blot (PAD1-4 dans
les cellules HaCaT et PAD4 dans les cellules HeLa). Ceci suggère la présence de PADs
inactives dans ces cellules, ou une activité trop faible pour être détectée. Comme les PADs
sont actives en présence de fortes concentrations de calcium, nous avons alors utilisé un
traitement à la ionomycine, un ionophore calcique qui augmente le flux de calcium dans le
cytoplasme, ou la thapsigargine, qui permet le relarguage de calcium intracellulaire à partir du
réticulum endoplasmique. Là encore aucune protéine citrullinée n’a pu être détectée. C’est
pour cette raison que nous avons continué notre étude in vitro en utilisant des kératinocytes
humains primaires en culture.

Nous avons également essayé d’induire la citrullination dans les cellules HaCaT par
irradiation avec des doses croissantes d’UV-B, ou par un stress oxydatif au peroxyde
d’hydrogène. Dans les deux cas, des protéines citrullinées ont été immunodétectées dans les
extraits protéiques. Cette expérience montre que dans ce modèle cellulaire, la désimination
n’est pas uniquement dépendante de la concentration en calcium ou de la différenciation
épidermique, mais peut être activée lors d’un stress ou au cours de l’apoptose. Les PADs

209
 Discussion et perspectives
Régulation de l’expression et de l’activité des PADs

seraient donc maintenues à l’état inactif dans les conditions basales. Le(s) mécanisme(s)
déclencheur(s) de l’activation, les isotypes de PADs ainsi que les voies de signalisation mises
en jeu ne sont pas connus.

B- Une régulation multi-contrôlée

Les résultats obtenus lors de cette étude sont schématisés sur la figure 47.

1- Régulation de l’expression des ARNm de PADI1-3 par la Vit D.

La Vit D augmente l’expression des PADs dans les cellules HL-60 et permet d’initier la
différenciation des kératinocytes en culture. De plus, de nombreuses études ont montré qu’elle
joue un rôle dans la différenciation épidermique en agissant en synergie avec le calcium (voir
le chapitre d’introduction « régulation de la différenciation »). Nous avons donc étudié les
effets de la Vit D (à la concentration communément employée de 10-7 M) sur des
kératinocytes primaires prolifératifs en culture, utilisée seule ou en association avec 1,5 mM
de calcium.

ARNm :
PAD1+
Ca 2+
PAD3+++
potentialisation

ARNm :
Pas
PAD1max à 24h d’augmentation
Vit D d’ expression Pas d’ d’Activité
PAD2 jusqu’à 10jours des protéines.
PAD3 max à 24h

ARNm : Protéine:
Confluence PAD1+++ Activité
PAD1+++
PAD3+++
PAD3+++
PADs:
autodésimination

Régulation Régulation post- Régulation post-

transcriptionnelle transcriptionnelle traductionnelle

Figure 47 : représentation schématique des résultats obtenus lors des analyses de l’expression et du contrôle de
l’activité des PADs dans les kératinocytes humains en culture et à l’aide d’enzymes recombinantes

210
 Discussion et perspectives
Régulation de l’expression et de l’activité des PADs

Nous avons confirmé que les PAD4 et 6 ne sont pas exprimées par les kératinocytes en
culture et que la Vit D augmente les quantités d’ARNm des marqueurs de la différenciation
épidermique (filaggrine, involucrine et kératine 10), cet effet étant bien potentialisé par l’ajout
de calcium.
La Vit D augmente également les quantités d’ARNm des PAD1, 2 et 3 dès 6 heures de
traitement, avec des cinétiques et des taux d’induction différents. Cependant, contrairement
aux marqueurs de différenciation, aucun effet potentialisateur du calcium n’a été observé. Ces
observations suggèrent que la Vit D affecte la stabilité des messagers ou la transcription des
gènes PADI indépendamment du calcium, soit directement en tant que régulateur
transcriptionnel à travers les VDRE, soit indirectement en modifiant l’expression d’autres
facteurs de transcription comme les membres de la famille AP-1.
En effet, la Vit D possède une voie d’action génomique passant par un récepteur nucléaire, le
VDR, et des éléments de réponse (VDRE) situés sur les gènes cibles. Afin d’identifier la voie
d’action de la Vit D sur les gènes PADI, nous avons réalisé des essais luciférase avec leurs
promoteurs. Des plasmides rapporteurs contenant des séquences d’ADN, correspondant au
segment de 700 pb en amont du site d’initiation de la transcription et recouvrant tout le
promoteur minimal de PADI1, 2 et 3, ont été transfectés dans les kératinocytes cultivés en
présence ou en absence de Vit D. L’effet sur la transcription a été évalué grâce à l’activité
d’un gène rapporteur codant pour la luciférase. Nous n’avons pas détecté de différence, ce qui
suggère que la Vit D n’agit pas par l’intermédiaire de VDRE localisés sur les promoteurs
minimaux des gènes des PAD1-3.
Le récepteur de la Vit D (VDR) est impliqué dans l’augmentation de l’expression de gènes de
la différenciation épidermique, et en particulier de Padi1 et 3 chez la souris lors de la
différenciation du follicule pileux et de l’induction de tumeurs via la voie β-caténine (Palmer
et al, 2008). Cette équipe a montré une surexpression de l’ARNm de la Pad3 après traitement
avec un analogue de la Vit D sur des kératinocytes issus de souris sauvages mais pas sur des
kératinocytes issus de souris KO pour le VDR. Ces chercheurs ont également identifié trois
variants consensus du VDRE fonctionnels, à longue distance du promoteur de Padi3. En nous
basant sur ces données et à l’aide du programme “NHR scan program”
([Link] nous avons trouvé au moins 11
séquences répétées (canonical direct repeat DR1 à 5) situées dans la région de 6000 pb en
amont du site d’initiation de la transcription du gène PADI3 humain (numéro d’accession
Genbank AJ549502). Il serait intéressant de tester leur fonctionnalité en effectuant des tests

211
 Discussion et perspectives
Régulation de l’expression et de l’activité des PADs

d’activité luciférase ou des expériences d’immunoprécipitation de la chromatine. Celles-ci

permettent de déterminer in vivo si des sites de fixation à des facteurs de transcription sont
occupés par une ou plusieurs protéines régulatrices. Dans le but d'estimer l’implication du
VDR in vivo, j’ai effectué des expériences d’immunohistologie sur des coupes de peau de
souris sauvages ou KO pour le VDR. Je n’ai pas mis en évidence de différence d’expression
pour les Pad1 et 3.
Un profil transcriptionnel des kératinocytes traités par la Vit D a été établi à l’aide de
micropuces de la Société Affimetrix (Lu, Goldstein et al., 2005). Parmi les nombreux gènes
régulés, ceux des PADs ont été retrouvés, ce qui confirme nos données expérimentales. Les
auteurs ont suggéré que l’utilisation de la Vit D et de ses analogues dans le traitement du
psoriasis corrige les défauts de désimination observés dans l’épiderme des patients. Nos
résultats contredisent cette hypothèse : en effet, si l’expression des ARNm des PADs est bien
augmentée, il n’en est pas de même pour les protéines et la désimination.
La Vit D peut également agir selon une voie non génomique, directement via des récepteurs
membranaires, et activer les récepteurs calciques des kératinocytes (CaR) et potentialiser ainsi
la différenciation de ces cellules (Ratnam et al., 1999). Il serait intéressant de regarder dans
notre modèle si l’activation des PADs passe par cette voie d’activation. Pour cela nous
pourrions inhiber in vitro spécifiquement l’expression ou l’activité des récepteurs
membranaires ou des acteurs de la voie des phospholipases impliqués dans cette activation
(par l’utilisation de siRNA par exemple).

2- Régulation transcriptionnelle spécifique de chaque isotype

Dans les kératinocytes cultivés en présence de 1,5 mM de calcium, il avait déjà été démontré
dans le laboratoire que si l’expression des ARNm de PADI1 était légèrement augmentée, celle
des ARNm PADI2 ne variait pas alors que les transcrits de PADI3 subissaient une
augmentation importante par rapport aux mêmes kératinocytes cultivés en présence de 0,2
mM de calcium (figure 48). Ces résultats s’expliquent par le rôle d’un activateur
transcriptionnel distant (Adoue et al., 2008).

Figure 48 : expression relative des ARNm des PADI1-4 dans les

kératinocytes primaires en culture, en fonction de la concentration
extracellulaire de calcium (d’après Chavanas et al., 2008).

212
 Discussion et perspectives
Régulation de l’expression et de l’activité des PADs

De la même manière, nous avons montré que la différenciation induite par la confluence
cellulaire permet aussi d’augmenter le niveau d’expression des ARNm de PAD1 et 3 mais pas
ceux de PAD2. Comme nous l’avons déjà vu, au cours du traitement à la Vit D, les transcrits
des 3 gènes PADI suivent une cinétique d’activation propre. Les transcrits des PAD1 et 3
présentent un niveau maximal après 24 heures avant de retrouver leur niveau basal au bout de
7 jours tandis que la quantité d’ARNm de PAD2 continue à augmenter jusqu’à 10 jours après
induction.

3- Régulation post-transcriptionnelle des PADs

Parallèlement à une régulation transcriptionnelle complexe, l’expression des PADs est aussi
régulée au niveau post-transcriptionnel dans les kératinocytes, comme cela a été
précédemment observé lors de la différenciation monocyte/macrophage (Vossenaar et al.,
2004). En effet, une stimulation de l’expression des ARNm de PADI1-3 par la Vit D n’est pas
suffisante pour induire l’augmentation des protéines correspondantes. De même, une ou
plusieurs PADs peuvent être exprimées dans un kératinocyte sans pour autant y être actives,
comme nous l’avons vu par exemple dans les cellules HeLa et HaCaT. Il semble aussi que ce
soit le cas in vivo, où les PADs sont détectées dans l’épiderme de la couche basale à la surface
de la couche cornée, mais où les protéines ne sont désiminées que dans cette dernière.

a- Régulation de la traduction : rôle possible des miARNs

Vossenaar et coll. ont suggéré l’existence d’une régulation post-transcriptionelle de la PAD2
grâce à la région 3’ UTR de son ARNm (Vossenaar et al., 2004b), mais d’autres mécanismes
peuvent être envisagés comme l’impl,ication de miARNs. Les miARNs sont de petits ARNs
représentant un puissant système de contrôle des gènes. Ils agissent à la manière des siARNs
et sont d’abord transcrits sous forme de précurseurs de grande taille à partir de leurs gènes
spécifiques. Ensuite, sous forme de simple brin, ils interagissent avec l’ARNm cible par un
jeu d’appariement de bases entraînant sa destruction ou l’inhibition de sa traduction. Par une
analyse in silico (TargetScan miRNA Regulatory Site prediction, (Grimson et al., 2007)),
nous avons identifié dans la région non codante du dernier exon de PADI1 et PADI2, la
présence de deux sites putatifs de fixation des miRNAs miR-324-3p (pour PADI1) et miR-22
(pour PADI2) avec des scores de, respectivement, 53% et 82%. Ces sites sont par ailleurs
conservés dans les séquences des gènes Padi paralogues de la souris, du rat, du chien et du
poulet, suggérant fortement l’existence d’une fonction biologique conservée au cours de

213
 Discussion et perspectives
Régulation de l’expression et de l’activité des PADs

l’évolution. Ce contrôle par des miRNAs permettrait d’expliquer en partie le contrôle de

l’expression des PADs au niveau protéique via la stabilité ou / et la traduction de leurs
messagers.

b- Régulation de l’activité par auto-désimination

Les PAD1-3 sont capables de s’auto-désiminer in vitro et cette auto-désimination diminue
leur capacité à désiminer la filaggrine. Une approche in silico, à partir de modèles
tridimensionnels de PAD3 nous a permis de mesurer l’effet de l’auto-désimination sur le site
actif, après substitution des arginines les plus accessibles par des citrullines. L’auto-
désimination induit des changements de distance entre les 4 acides aminés majeurs du site
actif (Asp-350, His-470, Asp-472 et Cys-646) de l’ordre de 1Å (jusqu’à 38%) et des
changements du volume de celui-ci d’environ 2Å3 (~ 20%). Ces changements structuraux fins
pourraient être à l’origine de la réduction de l’activité PAD. La découverte d’une auto-
désimination in vivo qui entraînerait une diminution d’activité des PADs permettrait
d’expliquer qu’aucune protéine citrullinée ne soit détectée, même en présence de calcium,
dans les lignées HaCaT et Hela qui expriment au moins une PAD. Parallèlement, les PAD1 et
2 sont présentes dans les couches vivantes de l’épiderme mais des protéines citrullinées sont
retrouvées uniquement au niveau de la couche cornée. D’autres modifications post-
traductionnelles comme la phosphorylation pourraient aussi être à l’origine du contrôle de
l’activité des PADs.
Pour confirmer ces résultats, nous testerons l’activité de chacune des PADs recombinantes
avant ou après pré-incubation et donc induction de l’auto-désimination, grâce à un test ELISA
récemment développé qui permet de mesurer le taux de citrullination en utilisant un peptide
dérivé de la filaggrine (test ABAP, Modiquest Research B.V., Nijmegen, Pays-Bas). L’effet
de la désimination par une autre PAD pourra aussi être évalué. Pour rechercher une auto-
désimination in vivo nous pourrons immunodétecter les PADs immunoprécipitées à partir
d’un extrait d’épiderme à l’aide de l’anticorps anti-protéines désiminées AMC.

214
 Discussion et perspectives
Etude du phénotype des souris Padi2-/-

II- Etude du phénotype des souris dont le gène Padi2 a été

invalidé
La PAD2 est l’isotype le plus ubiquiste. Elle a été détectée en immunohistochimie dans
l’épiderme humain et de souris (Nachat et al., 2005b) et si la PAD1 et la PAD3 semblent
jouer un rôle dans la désimination de la filaggrine, le rôle de la PAD2 dans ce tissu est encore
inconnu.
Les souris invalidées pour le gène Padi2 ont été obtenues grâce à un partenariat avec la
société Boeringer Inghelheim Pharmaceutical, Inc. (Ridgefield, CT). Raijmakers et coll. qui
ont développé ces souris ont observé comme seul phénotype une diminution très importante
des protéines citrullinées dans le cerveau, ce qui indique que l’isoforme Pad2 a un rôle
prépondérant dans la citrullination des protéines dans ce tissu (Raijmakers et al., 2006).

A- La Pad2 n’est pas impliquée dans la cornification

Dans l’épiderme des souris Padi2-/-, le taux des protéines citrullinées est inchangé. Je n’ai pas
mis en évidence de différence dans l’expression des marqueurs de différenciation kératine
K10, involucrine, loricrine et (pro)filaggrine, par western blot et immunohistochimie. La
fonction de barrière hydrique, évaluée par mesure de la perte en eau trans-épidermique, ne
semble pas modifiée. La formation et l’imperméabilité de la couche cornée d’embryons de
18,5 jours, évaluées grâce à un test de pénétration du bleu de toluidine semblent normales.
Ces résultats montrent que l’absence de Pad2 n’induit pas d’altération dans le processus de
cornification.

B- Peut il y avoir une compensation par les autres isotypes ?

L’expression des Pad1, 3, et 4 que j’ai analysée en western blot et immunohistologie n’est pas
modifiée dans l’épiderme des souris Padi2-/-, démontrant l’absence d’une compensation par
la surexpression d’une autre Pad. Dans le cerveau des souris Padi2-/-, aucune différence dans
l’expression des Pad1, 3 et 4 n’a non plus été observée (Raijmakers et al., 2006) ce qui
confirme nos résultats. Nous ne pouvons cependant pas exclure une éventuelle compensation
par une augmentation de l’activité d’un autre isotype. Malheureusement les techniques
disponibles à ce jour ne permettent pas de mesurer l’activité de chaque Pad indépendamment.

215
 Discussion et perspectives
Etude du phénotype des souris Padi2-/-

C- Quel rôle pour la PAD2 ?

PADI2 est le gène ancestral des gènes PADI et c’est le seul à présenter une expression quasi
ubiquiste, il est d’ailleurs pratiquement toujours co-exprimé avec un autre gène PADI dans les
tissus étudiés. Il possède aussi toutes les caractéristiques d’un gène de ménage : son
promoteur ne contient pas de boîte TATA (contrairement aux PADI1, 3, 4 et 6), est riche en
nucléotides GC, comporte plusieurs motifs reconnus par le facteur de transcription Sp1, et
comprend un îlot CpG. De plus, la régulation de sa transcription se différencie de celle des
autres gènes PADI (Chavanas et al., 2008; Adoue et al., 2008). Pourtant, bien que les gènes
de ménage codent généralement pour des protéines indispensables à la cellule, la souris
déficiente pour le gène Padi2 ne présente pas de phénotype évident. Cela suggère une
redondance d’action de PAD2 avec les autres PADs. De nombreux articles évoquent pourtant
l’implication de la PAD2 dans la physiopathologie de plusieurs maladies comme la sclérose
en plaques. De plus, elle pourrait jouer un rôle au cours de l’inflammation en modifiant les
propriétés des cytokines inflammatoires (Loos et al., 2008; Proost et al., 2008). Une autre
possibilité serait que la PAD2 participerait à la régulation de l’activité des PADs en
désiminant les autres isotypes. Finalement, elle pourrait être activée dans des conditions non
physiologiques, au cours d’un stress cellulaire ou de l’apoptose. Il a par exemple été montré
que son expression augmente dans les astrocytes cultivés en condition hypoxique
(Sambandam et al., 2004).
J’ai par ailleurs montré que les kératinocytes HaCaT irradiés avec 50 mJ/cm² de rayons UV-B
(connus pour induire l’apoptose de ces cellules) ou soumis à un stress oxydatif, présentent un
taux élevé de protéines citrullinées. Il serait intéressant de reproduire ces expériences avec des
kératinocytes de souris sauvages ou KO pour Padi2.

D- Validation des outils immunologiques

Lors de cette étude, nous avons utilisé des sérums anti-peptides spécifiques de chaque
isoforme de PAD humaine et reconnaissant leur orthologue de souris, en particulier un
anticorps anti-PAD2 (Nachat, et al., 2005b). A notre grande surprise, utilisé en
immunohistochimie, cet anti-PAD2 a présenté un marquage identique de l’épiderme des
souris sauvages et KO. En western blot, il a cependant permis de montrer l’absence de la
Pad2. Ces observations impliquent la présence de réactivités non-spécifiques avec d’autres
protéines de l’épiderme de souris en immunohistologie, et ce quelles que soient les
nombreuses conditions de fixation et de démasquage d’épitopes testées. J’ai également

216
 Discussion et perspectives
Etude du phénotype des souris Padi2-/-

employé un anticorps monoclonal anti-PAD2 fourni par le Pr Ishigami (Université Toho,

Chiba, Japon) qui a confirmé en western blot l’absence de Pad2 dans l’épiderme des souris
KO. Cet anticorps utilisé en immunohistologie n’a cependant pas présenté de marquage
spécifique de l’épiderme des souris.
J’ai aussi évalué la réactivité d’autres anticorps anti-Pad2 comme un anti-sérum provenant de
la société Abcam, et un anticorps recombinant produit par l’équipe du Pr Nicholas
(Sambandam et al., 2004). Aucun de ces anticorps n’a donné de résultats satisfaisants en
immunohistologie.

E- Perspectives
L’invalidation de l’expression de chacune des PADs dans les kératinocytes primaires, en
culture monocouche ou utilisés pour produire des épidermes reconstruits, permettrait
d’évaluer le rôle de ces enzymes. Il faudrait inhiber simultanément l’expression, d’une, de
deux ou des trois PADs exprimées dans l’épiderme grâce à des siRNAs ou shRNAs, par la
technique d’interférence à l’ARN, ou en utilisant des inhibiteurs des PADs quand ils auront
été identifiés. Nous pourrions alors évaluer la contribution de chaque isotype à la
désimination de la filaggrine et des kératines et démontrer leur importance pour
l’établissement de la barrière épidermique. Il serait de la même manière possible de tester leur
rôle dans l’apoptose et au cours d’un stress et vérifier notre hypothèse d’un contrôle de
l’activité des PADs par les PADs elle-mêmes. Nous pourrions aussi évaluer l’impact de la
sur-expression des PADs in vitro grâce à des vecteurs rétro- ou lentiviraux.

217
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

III- La citrullination dans la cicatrisation cutanée

Dans le but de rechercher un rôle de la Pad2 dans la peau dans des conditions non
homéostasiques, j’ai comparé la cicatrisation cutanée des souris sauvages et KO pour la
PAD2. J’ai en particulier étudié la citrullination des protéines au cours de la phase
inflammatoire, plusieurs protéines dont la fibrine étant désiminées au cours de divers
processus inflammatoires pathologiques comme par exemple dans le tissu synovial des
patients atteints de PR.

A- Modèle d’étude
Le modèle choisi pour cette étude a été le modèle de blessure excisionnelle, le plus
couramment utilisé lors de l’étude de la cicatrisation chez la souris. Ce modèle est plus
facilement analysable qu’une blessure incisionelle, car la cinétique de fermeture des plaies est
plus longue. Cependant, la peau de souris présentant des disparités avec la peau humaine,
notamment sa mobilité sur le fascia sous jacent, il n’est pas possible de transposer les résultats
obtenus directement à l’Homme (la cicatrisation chez le porc reste le modèle de référence).
C’est tout de même un modèle d’étude facile à mettre en place et les mécanismes
inflammatoires et de ré-épithélialisation mis en jeu chez la souris sont relativement similaires
aux mécanismes humains.
J’ai réalisé des blessures sur le flanc de souris adultes sauvages et Padi2-/- à l’aide d’un
punch de 4 mm, ce qui permet de contrôler le diamètre de peau prélevée, et observé la
cicatrisation au cours du temps pendant 10 jours. J’ai ensuite analysé l’expression des Pad1 et
3 et la désimination des protéines dans les kératinocytes présents au niveau et à distance des
marges de la plaie, au niveau du néo-épiderme progressant sur la blessure, dans le caillot
fibrino-plaquettaire puis dans la croûte dérivée du caillot desséché (figure 49).

218
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

Caillot fibrino- plaquettaire

a b

épiderme
c

Néo-épiderme derme

Figure 49 : représentation schématique d’une coupe de peau lors de la phase de ré-épithélialisation. Les zones
analysées en immunohistologie correspondent aux zones situées à distance de la plaie (a), au niveau des marges de la plaie
(b), dans le néo-épiderme (c) et dans le caillot fibrino-plaquettaire.

B- La Pad2 n’est pas indispensable à la cicatrisation

Aucune différence n’a été observée au cours de la cicatrisation des souris sauvages et KO, au
niveau macroscopique, en terme de cinétique de fermeture des blessures (chez les mâles
comme chez les femelles), ainsi qu’au niveau histologique. Les Pad1 et 3 possèdent le même
profil d’expression. Le caillot fibrino-plaquettaire dans les deux cas ne persiste pas au delà de
la phase de ré-épithélialisation. La languette épidermique de migration qui progresse sur la
plaie exprime les marqueurs de prolifération (K6) puis de différenciation (filaggrine) avec une
cinétique comparable. Ces observations nous permettent de conclure que la Pad2 ne joue pas
de rôle essentiel dans la cicatrisation cutanée.

219
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

C- Expression des Pads et protéines citrullinées

Les résultats obtenus lors de cette étude sont résumés dans le tableau ci-dessous.

CICATRISATION CUTANEE
Phase précoce (inflammation) Ré-épithélialisation
Epiderme Cellules Cellules re- Caillot fibrino-
Expression/détection proximal prolifératives différenciées plaquettaire
Epiderme distal
(marges de la (Western Blot)
plaie)
Pad1 + (CSB*) - + + -
Pad3 + (CG) - - + -
Pad4 - ? ? ? +
Protéines
+ (CC) - - + +
désiminées
(pro)filaggrine + (CG) - - + -
K6 - - + - -

Tableau 9 : récapitulatif des résultats obtenus lors de l’étude de l’expression des Pads et des protéines citrullinées au
cours de la cicatrisation cutanée chez la souris. * Couches suprabasales, CSB ; couche granuleuse, CG ; couche cornée.
CC

1- Expression des Pads dans l’épiderme

Lors de la phase précoce de la cicatrisation, un jour après la blessure, les Pad1 et 3, tout
comme la (pro)filaggrine et la kératine 6 ne sont pas détectées aux abords de la lésion.
Au cours de la phase de ré-épithélialisation, la languette hyperproliférative du néo-épiderme,
qui exprime la kératine 6, progresse sur la plaie. Les kératinocytes en bordure de la languette
(dans sa partie distale) se différencient à nouveau (ils expriment la profilaggrine) afin de
rétablir progressivement une barrière fonctionnelle vis-à-vis de l’environnement extérieur.
Pad1 est alors exprimée sur tout l’épiderme suprabasal, par les kératinocytes prolifératifs ou
différenciés. La Pad3 est co-localisée avec la (pro)filaggrine lors de toute la phase de ré-
épithélialisation dans les kératinocytes qui se différencient à nouveau. Cette expression
concomitante des deux protéines pourrait entraîner la production du facteur naturel
d’hydratation qui contribuerait à restaurer la fonction de barrière épidermique et l’hydratation

220
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

de la couche cornée nouvellement formée. Ces résultats confirment que la Pad3 est bien
l’isoforme qui désimine la filaggrine et suggèrent un mécanisme commun de régulation de
l’expression des deux protéines. D’une façon intéressante, Neub et coll. ont observé une
inhibition de l’expression des facteurs AP-1 dans les 24 heures qui suivent une blessure
réalisée chez l’Homme (Neub et al., 2007). Or, les gènes de la filaggrine et de la PAD3 sont
tous deux régulés par les facteurs AP-1, et particulièrement le facteur c-Jun. De plus, c-Jun est
impliqué dans la cicatrisation. Les souris KO pour c-Jun mettent plus de temps à cicatriser,
avec des défauts de ré-épithélialisation se traduisant par une absence d’invasion du caillot de
fibrine par le néo-épiderme durant les premiers jours (Jang et al., 2000; Li, 2003; Zenz et al.,
2005). Une inhibition de l’expression de c-Jun et de la citrullination est aussi observée dans le
psoriasis (Zenz et al., 2005), une pathologie souvent comparée à une blessure chronique. Tout
ceci suggère une régulation commune des gènes de la filaggrine et de Pad3 par les facteurs
AP-1. Il serait intéressant d’analyser l’expression de la PAD3 dans l’épiderme des patients
psoriasiques, afin de déterminer si une diminution de cette isoforme contribue à la diminution
de la désimination observée dans cette pathologie.

2- Citrullination et expression des Pads dans le caillot fibrino-

plaquettaire
Durant toute la cicatrisation, j’ai mis en évidence la présence de protéines citrullinées dans le
caillot de fibrine au niveau du site de la blessure. Afin d’identifier les protéines désiminées,
j’ai immunodétecté des extraits de caillot réalisés dans différentes conditions de solubilité. De
nombreuses bandes ont été détectées dans les extraits préparés en tampon contenant un
détergent ionique ou de l’urée.

a- La fibrine est désiminée dans le caillot

La fibrine est le composant majeur du caillot fibrino-plaquettaire dont elle peut être extraite
dans les conditions décrites dans l’article n°2. C’est aussi une cible connue des PADs dans de
nombreuses conditions inflammatoires (Chapuy-Régaud et al., 2005 ; Foulquier et al., 2007).
La mise en place d’une matrice de fibrine est essentielle lors de la cicatrisation. Elle permet la
liaison de nombreuses molécules et cellules différentes et sert de matrice provisoire au niveau
de la plaie dans laquelle les cellules peuvent à la fois proliférer, s’organiser et migrer. Nous
avons confirmé la présence de fibrine citrullinée dans les extraits de protéines solubles en
tampon urée à l’aide d’un anticorps dirigé contre la chaîne β de la fibrine et du fibrinogène.

221
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

Cela corrobore le fait que la présence de fibrine citrullinée n’est pas spécifique de la PR mais
est associée aux mécanismes de type inflammatoire. C’est la première description de la
désimination de la fibrine au cours d’un processus inflammatoire physiologique. Le rôle de la
désimination de la fibrine n’est pas connu. Cependant les propriétés du caillot de fibrine
généré lors de la cicatrisation dépendent de nombreux facteurs biochimiques comme le pH et
la concentration ionique, et peuvent être modifiées par de nombreux paramètres comme le
taux de coagulation, influencé par la concentration de thrombine, ou la vitesse de fibrinolyse
par la plasmine (Mosesson et al., 2001). La citrullination permettant de modifier la charge
globale d’une protéine et ainsi d’affecter ses propriétés structurales (comme celles des
kératines ou de la myéline), la modification de la fibrine pourrait jouer un rôle dans la
structure de la matrice de fibrine. Deux publications récentes d’ailleurs suggéré que la
citrullination du fibrinogène inhibe sa transformation en fibres de fibrine par la thrombine
(Nakayama-Hamada et al., 2008; Okumura et al., 2009). De la même manière, la
citrullination de la fibrine pourrait interférer avec la fibrinolyse en inhibant son clivage par la
plasmine, ces deux enzymes coupant après un résidu arginyl.

b- La Pad4 est exprimée dans le caillot fibrino-plaquettaire

La Pad4, l’isoforme nucléaire, est le seul isotype immunodétecté dans des extraits de caillots
fibrino-plaquettaires, ce résultat étant en accord avec le fait qu’aucune des Pads dites
« épidermiques » (Pad1 et 3) n’a été retrouvée dans la matrice de fibrine en
immunohistologie. La présence de la Pad4 suggère qu’elle est l’isotype capable de désiminer
les protéines du caillot, et en particulier la fibrine lors de la cicatrisation cutanée chez la souris
mais aussi au cours d’arthrites du rat et de la souris induites expérimentalement et pourquoi
pas dans la PR. En effet, il est clair que la Pad2 ne joue pas un rôle majeur dans la
désimination de la fibrine au cours de la cicatrisation, comme je l’ai montré à l’aide des souris
Padi2-/-. De plus, seule la Pad4 a été identifiée dans le tissu synovial de rats ou de souris
après induction expérimentale d’une arthrite (Vossenaar et al., 2003; Lundberg et al., 2005).
Enfin la PAD4 a été immunodétectée dans le tissu synovial de patients atteints de diverses
arthrites (Foulquier et al., 2007).

c- Comment la fibrine est-elle citrullinée par la Pad4?

La fibrine est une protéine extracellulaire, or la Pad4 est une protéine nucléaire. Comment la
Pad4 peut-elle désiminer la fibrine à l’extérieur de la cellule? L’une des hypothèses

222
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

envisageables concerne la désimination par l’enzyme des neutrophiles. En effet, les

neutrophiles sont des acteurs prépondérants de la cicatrisation et ils envahissent le caillot de
fibrine, dès la phase inflammatoire, où ils restent emprisonnés. Lorsqu’ils sont activés, ces
polynucléaires libèrent de la chromatine décondensée sous forme de « filet » qui piège les
bactéries et les détruit grâce à une forte concentration de peptides antimicrobiens. L’hyper-
citrullination de la chromatine permettrait sa décondensation et sa libération dans l’espace
extracellulaire. Ce processus pourrait se produire dans le caillot et ainsi être à l’origine de la
libération de Pad4 hors de la cellule. L’apoptose ou la nécrose des cellules dues à
l’inflammation pourraient également être à l’origine de la libération de Pad4. Finalement, une
sécrétion « non classique » pourrait être responsable de la présence extracellulaire de cette
enzyme.

D- Perspectives
- Souris transgéniques :
L’invalidation des gènes de la Pad1, Pad3 et Pad4 chez la souris par la technique du KO
permettra d’étudier et de discriminer le rôle physiologique de ces isotypes, en particulier lors
de la différenciation épidermique mais aussi de la cicatrisation. Les phénotypes attendus
pourraient correspondre à un défaut de formation ou de lyse du caillot de fibrine pour les
souris Pad4-/-, et un défaut de ré-épithélialisation pour les souris Pad3-/-. De même, l’étude
de la désimination de la fibrine au cours de la cicatrisation des souris déplétées en
neutrophiles (à l’aide de sérums anti-neutrophiles) ou en neutrophiles, mastocytes et
macrophages (souris PU.1-/-, voir chapitre Introduction, paragraphe « cicatrisation »),
permettra de tester le rôle des neutrophiles et de l’invasion cellulaire lors de l’inflammation.

- Des expériences in vitro pourraient également contribuer à la compréhension des

mécanismes mis en jeu.
Nous avons observé une augmentation de la citrullination consécutivement à une lésion des
kératinocytes en culture (« scratch assay »). Cependant les mécanismes mis en jeu sont
inconnus. Il serait possible de rechercher une eventuelle surexpression d’une Pad, et
d’analyser l’effet de son inhibition (ou des Pads exprimées), à l’aide de siRNAs ou
d’inhibiteurs spécifiques sur la migration et la prolifération des kératinocytes.
Dans le même ordre d’idées, il serait également possible d’étudier l’effet de l’invalidation du
gène d’une Pad dans les kératinocytes (souris KO ou technique de l’interférence à l’ARN) sur

223
 Discussion et perspectives
La citrullination dans la cicatrisation cutanée

la différenciation des épidermes reconstruits (Garlick and Taichman, 1994), ou après greffe
d’épidermes reconstruits sur une souris nude (Escamez et al., 2004).
Enfin, il serait intéressant de créer une matrice de fibrine citrullinée à partir de fibrinogène
citrulliné in vitro pour répondre à différentes questions concernant l’impact de la citrullination
sur le réseau de fibrine : la fibrinolyse est-elle modifiée ? La migration et la différenciation
des kératinocytes sur cette matrice sont-elles modifiées ? Et plus généralement, est-ce que la
formation de gel de fibrine désiminée ou de kératinocytes mis en suspension dans de la fibrine
citrullinée peuvent toujours améliorer la cicatrisation d’une plaie étendue, ou au contraire
l’empêcher ?

224
Annexes
 Liste des publications

Publications - Revues internationales à comité de lecture :

Fanny Coudane, Marie-Claire Méchin, Anne Huchenq, Julie Henry, Rachida Nachat, Akihito
Ishigami, Véronique Adoue, Mireille Sebbag, Guy Serre, Michel Simon. Citrullination of fibrin and
differential expression of peptidylarginine deiminases during wound healing in mice.
Soumis

Marie-Claire Méchin, Fanny Coudane, Véronique Adoue, Jacques Arnaud, Hélène Duplan, Marie
Charveron, Anne-Marie Schmitt, Hidenari Takahara, Guy Serre, Michel Simon. Deimination is
regulated at multiple levels including auto-deimination of peptidylarginine deiminases.
Soumis

V. Adoue, S. Chavanas, F. Coudane, M-C. Méchin, C. Caubet, S. Ying, S. Dong, H. Duplan, M.

Charveron, H. Takahara, G. Serre, M. Simon. Long-range enhancer differentially regulated by c-Jun
and JunD controls peptidylarginine deiminases-3 in keratinocytes.
J. Mol. Biol. 2008, 384 : 1048-1057.

S. Chavanas, M.-C. Méchin, R. Nachat, V. Adoue, F. Coudane, G. Serre, M. Simon. Peptidylarginine

deiminases and deimination in biology and pathology: relevance to skin homeostasis.
J. Dermatol. Sci. 2006, 44 : 63-72. Article de revue invité.

M.-C. Méchin, M. Sebbag, J. Arnaud, R. Nachat, C. Foulquier, V. Adoue, F. Coudane, H. Duplan,

A.-M. Schmitt, S. Chavanas, M. Guerrin, G. Serre and M. Simon. Update on peptidylarginine
deiminases and deimination in skin physiology and severe human diseases.
Intern. J. Cosmetic Sci. 2007, 29 : 147-168. Article de revue invité.

Communications

Coudane F, Méchin MC, Huchenq A, Adoue V, Ishigami A, Chavanas S, Caubet C, Werneburg B,

Serre G, Simon M. Phénotype cutané des souris dont le gène PADI2 a été invalidé. Congrès Annuel
de Recherche Dermatologique, TOULOUSE, septembre 2008. J Invest Dermatol, 129 : 803, 2009.

227
Coudane F, Méchin MC, Huchenq A, Adoue V, Nachat R, Caubet C, Werneburg B, Serre G, Simon
M. Citrullination et peptidyl-arginine désiminases au cours de la cicatrisation cutanée chez la souris.
Congrès Annuel de Recherche Dermatologique, REIMS, juin 2009.

Coudane F, Méchin MC, Huchenq A, Adoue V, Ishigami A, Chavanas S, Caubet C, Werneburg E,

Serre G, SimonM. Phenotypical characterization of Padi2 knockout mice. European Epidermal
Barrier Research Network (E2BRN), BOUSSENS, novembre 2008.

Adoue V, Chavanas S, Coudane F, Méchin MC, Caubet C, Ying S, Dong S, Duplan H, Charveron M,
Takahara H, Serre G, Simon M. Un enhancer bipartite distant contrôle la transcription du gène PADI3
par le biais du recrutement de différents facteurs AP-1 au cours de la différenciation kératinocytaire.
Congrès Annuel de Recherche Dermatologique, TOULOUSE, septembre 2008. J Invest
Dermatol, 129 : 799, 2009.

Méchin MC, Coudane F, Adoue V, Arnaud J, Duplan H, Charveron M, Schmitt AM, Takahara H,
Serre G, Simon M. L’expression des peptidyl-arginine désiminases kératinocytaires est régulée de
façon différentielle. Congrès Annuel de Recherche Dermatologique, REIMS, juin 2009.

Adoue V, Chavanas S, Coudane F, Méchin MC, Ying S, Dong S, Duplan H, Charveron M, Takahara
H, Serre G, Simon M. A bipartite long range enhancer recruits distinct AP-1 factors to control
peptidylarginine deiminase-3 gene during keratinocyte differentiation. European Epidermal Barrier
Research Network (E2BRN), BOUSSENS, novembre 2008.

Méchin MC, Coudane F, Adoue V, Chavanas S, Duplan H, Charveron M, Schmitt AM, Takahara H,
Serre G, Simon M. Cell-density and 1, 25-dihydroxyvitamin D3 enhance peptidylarginine deiminases
in cultured primary human keratinocytes. European Epidermal Barrier Research Network
(E2BRN), BOUSSENS, novembre 2008.

Adoue V, Coudane F, Méchin MC, Nachat R, Chavanas S, Serre G, Simon M. Long-range

transcriptional regulation of genes in the epidermis: focus on the PADI gene locus. 1st International
Symposium on Deimination and Skin Biology, Takahara H, Kawada A Eds, OSAKA, avril 2009.

Méchin MC, Nachat R, Adoue V, Coudane F, Arnaud J, Chavanas S, Serre G, Takahara H, Simon M.
Protein deimination and peptidylarginine deiminases in skin physiopathology. In 1st International
Symposium on Deimination and Skin Biology, Takahara H, Kawada A Eds, OSAKA, avril 2009.

228
doi:10.1016/[Link].2008.10.019 J. Mol. Biol. (2008) 384, 1048–1057

Available online at [Link]

Long-Range Enhancer Differentially Regulated by c-Jun

and JunD Controls Peptidylarginine Deiminase-3 Gene
in Keratinocytes
Véronique Adoue 1 , Stéphane Chavanas 1 , Fanny Coudane 1 ,
Marie-Claire Méchin 1 , Cécile Caubet 1 , Shibo Ying 2 , Sijun Dong 2 ,
Hélène Duplan 3 , Marie Charveron 3 , Hidenari Takahara 2 , Guy Serre 1
and Michel Simon 1 ⁎
1
UMR 5165, CNRS-Toulouse Long-range cis elements are critical regulators of transcription, particularly
III University, CHU Purpan, for clustered paralogous genes. Such are the five PADI genes in 1p35–36
Place du Dr Baylac TSA4003, encoding peptidylarginine deiminases, which catalyze deimination, a Ca2+-
31059 Toulouse cedex 9, France dependent post-translational modification. Deimination has been impli-
2 cated in the pathophysiology of severe human diseases such as multiple
Department of Applied
sclerosis and rheumatoid arthritis. The PADI genes present different ex-
Biological Resource Sciences,
pression patterns. PADI1–3 are expressed in the epidermis, with increased
School of Agriculture, Ibaraki expression levels in the most differentiated keratinocytes. Previous studies
University, 300-0393 Ibaraki,
on PADI proximal promoters failed to explain such specificity of expression.
Japan
We identified a conserved intergenic sequence in the PADI locus (IG1),
3
Institut de Recherche Pierre which may play a role in PADI transcriptional regulation. In this work, we
Fabre, 2 rue Viguerie, BP 3071, identified two DNase I·hypersensitive sites located in IG1, PAD intergenic
31052 Toulouse, France enhancer segment 1 (PIE-S1) and PIE-S2, which act in synergy as a bipartite
enhancer of the PADI3 and probably PADI1 promoters in normal human
Received 28 July 2008; epidermal keratinocytes differentiated by a high-calcium-containing med-
received in revised form ium (1.5 mM). PIE-S1 and PIE-S2 present all the hallmarks of transcriptional
26 September 2008; enhancers: orientation-independence, copy-number dependence and cell-
accepted 2 October 2008 type specificity. PIE-S1 and PIE-S2 comprise conserved putative binding
Available online sites for MIBP1/RFX1 and activator protein 1, respectively. Deletion mutant
15 October 2008 screening revealed that these sites are crucial for the enhancer activity.
Furthermore, chromatin immunoprecipitation assays evidenced differential
binding of JunD or c-Jun on the activator protein 1 site depending on the cell
differentiation state. Our results reveal the molecular bases of the expression
specificity of PADI1 and PADI3 during keratinocyte differentiation through
a long-range enhancer and support a model of PADI gene regulation
depending on c-Jun–JunD competition.
© 2008 Elsevier Ltd. All rights reserved.
Keyword: AP-1; epidermis; gene expression; transcription; peptidylarginine
Edited by M. Yaniv deiminases

Introduction
*Corresponding author. E-mail address: The proximal promoter region of a transcriptional
msimon@[Link]. unit does not always contain all necessary trans-
Abbreviations used: ChIP, chromatin cription factor binding modules to direct proper
immunoprecipitation; CNS, conserved noncoding spatiotemporal expression of the cognate gene.
segments; HBE1, fetal ɛ-globin gene; NHEK, normal Transcription can be mediated by cis-regulatory
human epidermal keratinocyte; PAD, peptidylarginine elements located in transcriptionally active chroma-
deiminase; AP-1, activator protein 1; PIE-S1, PAD tin as far as several hundred kilobases from the
intergenic enhancer segment 1; EMSA, electrophoretic transcription start site.1 Such long-range regulation
mobility shift assay; qPCR, quantitative PCR. has been described in the tissue-specific transcrip-

0022-2836/$ - see front matter © 2008 Elsevier Ltd. All rights reserved.
229
Long-Range PADI3 Gene Regulation 1049

tional control of individual genes, e.g., those en- PADI2–4 and PADI3–4, respectively. Thus, proximal
coding interferon γ in the brain2 or p63 in the regulation alone could not fully explain the diversity
epidermis,3 and also in the coordinate regulation of and specificity of PADI expression. In the search for
clustered paralogous genes4 such as those for the other PADI transcriptional regulators, we have
small proline-rich proteins in the epidermis5 and identified an 8-kb evolutionary-conserved region
for the β-globin multigenic family in the erythroid (IG1) between PADI1 and PADI2, which contains 19
cells.4 Comparative analysis of human and mouse CNS that potentially bind transcription factors.8
genomic sequences to highlight highly conserved In this study, our goal was to determine whether
noncoding sequences (CNS) and testing for DNase I IG1 contained long-range PADI gene regulators. We
chromatin hypersensitivity is a powerful strategy to studied IG1 in normal human epidermal kerati-
predict distal candidate regulatory regions.6 nocytes (NHEKs), where the genes PADI1–3 adja-
The peptidylarginine deiminases (PADs) constitute cent to IG1 are expressed in a finely regulated
a family of five enzymes designated PAD1–4 and fashion.17–19,21 Here, we reveal two regions located
PAD6, encoded by the five paralogous genes PADI1– in IG1, which cooperate at a long distance to spe-
4 and PADI6 clustered within a 355-kb region on cifically increase the PADI3 promoter activity in
chromosome 1p35–36.7,8 These enzymes are respon- differentiated NHEKs, and identify members of the
sible for deimination, a Ca2+-dependent post-transla- activator protein 1 (AP-1) family as major transcrip-
tional modification whereby the positively charged tion factors involved in this regulation.
argininyl residue is modified into the uncharged
citrullinyl residue leading to dramatic conforma-
tional and functional protein modifications. Protein
deimination has been detected in most mammalian
Results
tissues, and abnormalities of deimination have been
shown to be associated with severe human diseases. IG1 contains a specific enhancer of the PADI1
Deimination of myelin basic protein is increased in and PADI3 promoters in differentiated NHEKs
multiple sclerosis (OMIM 126200),9 and fibrin deimi-
nation in synovial membrane is a key factor in the In order to identify transcriptional regulatory ele-
pathophysiology of rheumatoid arthritis (OMIM ments in IG1, we performed luciferase assays in
180300).10 Moreover, mutations within the gene primary cultures of NHEKs. Cells were either
PADI4 have been shown to be associated with maintained for 72 h in proliferative conditions in
susceptibility to rheumatoid arthritis in Asian low-calcium (0.2 mM) serum-free medium or ex-
populations.10 Furthermore, PAD4 has been reported posed to high calcium concentration (1.5 mM) to
to regulate transcription through histone modifica- induce growth arrest and differentiation, as pre-
tions.11,12 Also, a decrease in the levels of deiminated viously described.22 Consistent with the in vivo
keratins K1 and K10 has been observed in cutaneous pattern of expression of PAD1–3, quantitative real-
diseases such as bullous congenital ichthyosiform time reverse transcription PCR showed that the
erythroderma (OMIM 113800) 13 and psoriasis calcium switch was associated with strongly ele-
(OMIM 177900).14 Deimination is a key parameter vated levels of mRNAs for PADI3 (4.7-fold), and, to a
of epidermis differentiation. Epidermis is a stratified minor extent, for PADI2 (1.8-fold) and PADI1 (2-fold)
epithelium in which the basal proliferative keratino- (data not shown). Calcium-stimulated or unstimu-
cytes undergo profound morphological changes re- lated NHEKs were transfected by a set of reporter
sulting in the formation of the uppermost (cornified) plasmids containing either the whole IG1 region or
layer, which contributes to the epidermal barrier one of four arbitrarily chosen IG1 fragments encom-
functions.15,16 Deimination of filaggrin and keratin passing the full length of IG1 (namely, fragments
K1 play a pivotal role in barrier formation, including IG1-1 to IG1-4), as depicted in Fig. 1. Fragments IG1-
hydration of the cornified layer. During the kerati- 1 to IG1-4 are about 2.4, 2.2, 1.8 and 1.4 kb long and
nocyte differentiation steps, gene expression is accu- contain 4, 4, 7 and 4 CNS, respectively. Along with
rately regulated. PAD1 is detected throughout the IG1 or the fragments IG1-1 to IG1-4, we subcloned
epidermis with an increased expression in differen- the promoter segments of PADI1, 2 and 3 and that
tiated cells, PAD2 in the suprabasal layers, and PAD3 from SV40. As shown in Fig. 2a and b, segment IG1-
only in the terminally differentiated keratinocytes.17 3 (1764 bp) displayed a robust and specific enhancer
PADI gene expression is tightly controlled in a cell effect (threefold, P b 0.01) on PADI1 and PADI3
differentiation- and tissue-dependent manner, promoters under high-calcium conditions and
although the mechanisms involved are poorly under- showed no effect on the SV40 or PADI2 promoters.
stood. To characterize regulators of PADI gene A less pronounced effect was observed in prolif-
expression, we have previously defined the minimal erative keratinocytes but was revealed to be not
promoter regions of the genes PADI1 to 4 as short statistically significant. The constructs containing
sequences of less than 350 bp upstream of the the full-length IG1 or any of the IG1-1, -2 or -4 did
transcription initiation site.18–21 Many transcription not show any significant effect on any tested
factors implicated in this proximal regulation are promoters in these conditions (Fig. 2a and data not
shared by the PADI promoters: Sp1 is involved in the shown). In further experiments, we focused on the
activity of the four PADI1–4 minimal promoters, PADI3 gene promoter, the basal activity of which is
whereas Sp3 and NF-Y are crucial for those of greater than that of the PADI1 promoter, providing

230
1050 Long-Range PADI3 Gene Regulation

Fig. 1. Structure of the human PADI gene locus. IG1 is depicted as a black box. The four fragments of IG1 are indicated.
The PADI genes and their transcription orientation are shown with open boxes and arrows. The relative expression of the
different genes in proliferative and differentiated keratinocytes is shown below (the higher the number of +, the higher the
expression level).

greater sensitivity. We next performed experiments Two minimal regions of 346 and 245 bp, ∼1-kb dis-
to confirm that IG1-3 presented enhancer character- tant from each other, appeared necessary to enhance
istics. We showed that fragment IG1-3 enhanced the activity of the PADI3 promoter in differentiated
PADI3 promoter activity in an orientation-indepen- NHEKs. None of them showed any enhancer effect
dent and copy-number-dependent manner (Fig. 3a), when assayed independently. We named these two
two hallmarks of transcriptional enhancers. No such sequences PAD intergenic enhancer segment 1 (PIE-
enhancer activity was detected in human cervix S1; GenBank accession number EU694174) and 2
adenocarcinoma HeLa cells or in primary normal (PIE-S2; GenBank accession number EU694175),
human dermal fibroblasts, suggesting that the acti- respectively. Notably, PIE-S1 and PIE-S2 overlap
vity of fragment IG1-3 depends on cell type and/or two distinct conserved sequences of IG1: CNS10
status (Fig. 3b). We concluded that IG1-3 contained a (157 bp, nt 112,979–113,135 in AJ549502) and CNS14
specific enhancer of the PADI1 and PADI3 promoters (334 bp, nt 114,226–114,559) (Fig. 4). Neither CNS10
in differentiated NHEKs. nor CNS14 showed any detectable effect when
assayed individually.
IG1-3 contains a bipartite enhancer
PIE-S1 and PIE-S2 are DNase I hypersensitive
To refine the critical segment encompassing the
enhancer in IG1-3, we engineered a series of deletion To explore the chromatin conformation around
mutants and tested them for their ability to enhance PIE-S1 and PIE-S2, we performed DNase I hyper-
PADI3 promoter activity in luciferase assays (Fig. 4). sensitivity assays using quantitative PCR (qPCR) as

Fig. 2. Luciferase assays high-

light a candidate regulatory region
in IG1 with enhancer activity on the
PADI1 and PADI3 gene promoters
in Ca2+-stimulated keratinocytes.
NHEKs were co-transfected with
firefly luciferase (LUC) reporter
plasmids containing the indicated
fragment (1 to 4) of IG1 upstream of
a PADI or SV40 promoter and with
a Renilla luciferase normalization
plasmid. After transfection, cells
were incubated in 0.2 mM (gray
bars) or 1.5 mM (black bars) cal-
cium-containing medium for 72 h.
(a) We explored the activity of IG1-1
to IG1-4 on the PADI3 promoter, (b)
and then focused on IG1-3 to test its
activity on PADI1, PADI2 and SV40
promoters. Values of relative luci-
ferase activity (RLU) are expressed
as means ± SEM for at least three
independent experiments, each per-
formed in triplicate wells. Signifi-
cant differences were evaluated
using the Student's t test; ⁎P b 0.05,
⁎⁎P b 0.01.

231
Long-Range PADI3 Gene Regulation 1051

Fig. 3. IG1-3 presents character-

istics of transcriptional enhancers.
Luciferase tests were performed as
in Fig. 2. (a) We tested the effects of
IG1-3 orientation and copy number
on the PADI3 promoter activity. (b)
IG1-3 cellular specificity was evalu-
ated in HeLa cells and primary
normal human fibroblasts on PADI1
and PADI3 gene promoter activ-
ities. Values of relative luciferase
activity (RLU) are expressed as
means ± SEM for at least three inde-
pendent experiments, each per-
formed in triplicate wells. Signi-
ficant differences were evaluated
using the Student's t test; ⁎P b 0.05,
⁎⁎P b 0.01.

previously described.23 We incubated nuclei from region of the fetal ɛ-globin gene (HBE1) that is not
proliferative or differentiated NHEKs with increas- transcribed in epidermis or NHEKs. We also
ing DNase I concentrations and evaluated the investigated the chromatin conformation around
number of remaining copies of matrix DNA. As a the CNS9 (96 bp, nt 112,873–112,969), which
negative control, we used a segment of the promoter presented no regulatory activity on PADI3 promoter

Fig. 4. Identification of a bipar-

tite enhancer within IG1-3. Lucifer-
ase tests were performed as in Fig.
2. A series of deletion mutants of
IG1-3 were generated from enzyme
restriction sites and tested for their
ability to enhance PADI3 gene pro-
moter activity. CNS10 and CNS14
localizations in IG1-3 are depicted
below the bar chart. Values of rela-
tive luciferase activity (RLU) are
expressed as means ± SEM for at
least three independent experi-
ments, each performed in triplicate
wells. Significant differences were
evaluated using the Student's t test;
⁎P b 0.05, ⁎⁎P b 0.01.

232
1052 Long-Range PADI3 Gene Regulation

in luciferase assay (data not shown). As shown in PIE-S1/-S2 by distinct nuclear factors with various
Fig. 5a, while remaining copies of CNS9 and HBE1 effects ruled their activity on the target promoter
remained constant with increasing DNase I concen- and, therefore, we queried which transcription
tration, PIE-S1 and PIE-S2 were found to be factors bound to PIE-S1 and -S2 in both proliferative
hypersensitive, with a dramatic fall in the remaining and differentiated conditions.
copy number in calcium-stimulated NHEKs. This
indicated an open chromatin conformation and PIE-S1 contains an MIBP1/RFX1-like site
supported their role as enhancers prone to bind essential to the IG1-3 enhancer activity
transcriptional activators in differentiated keratino-
cytes. Unexpectedly, we also found DNase I hyper- Sequence alignment of IG1-3 between human and
sensitivity of PIE-S1 and PIE-S2 in unstimulated mouse genomes showed several conserved potential
keratinocytes (Fig. 5b), i.e., in conditions where no binding sites for the transcription factors Sp1, NF1
detectable and significant enhancer effect was and MIBP1/RFX1 in PIE-S1 (Fig. 6a). Luciferase
found. We hypothesized that the occupancy of assays using constructs bearing invalidating muta-
tions or deletions of these candidate binding sites
were performed. Mutation of the MIBP1/RFX1 site
resulted in the loss of the enhancer effect on PADI3
promoter, but not mutation of the Sp1 or NF1 sites
(Fig. 6b and c). Electrophoretic mobility shift assay
(EMSA) experiments showed that the MIBP1/RFX1
site was able to bind nuclear epidermal proteins.
However, additional supershift experiments using
antibodies to MIBP1 or RFX1 did not detect any
fixation of these transcriptional factors on this site,
due to either the poor reactivity of the available
antibodies in these conditions or the binding of yet
unknown proteins from MIBP1 and/or RFX1
families not recognized by the commercially avail-
able MIBP1/RFX1 antibodies (data not shown).

PIE-S2 binds distinct AP-1 factors depending on

NHEK differentiation state

Similarly, we searched for transcription factors

that bound to the candidate region PIE-S2. Sequence
analysis identified a highly conserved transcription
factor binding site for AP-1 (Fig. 6a). AP-1 factors
consist of homo- or heterodimers of members of the
Jun (c-Jun, JunB and JunD) and Fos (c-Fos, FosB,
Fra-1 and Fra-2) families, which are differentially
expressed during epidermis differentiation. 24,25
Luciferase assays using PIE-S2 bearing mutations
invalidating the AP-1 site resulted in the loss of the
PADI3 promoter transcriptional activation by PIE-
S1/-S2 (Fig. 6b and c). This showed that the AP-1
site in PIE-S2 was essential for the enhancer activity.
By EMSA, with or without antibodies directed
against the epidermis-expressed members of the
AP-1 family and nuclear extracts of proliferative and
calcium-differentiated keratinocytes, we observed
that the AP-1 site of PIE-S2 was able to bind c-Jun,
JunD and JunB (data not shown). To determine
Fig. 5. PIE-S1 and PIE-S2 are DNase I hypersensitive which of these proteins actually bind PIE-S2 in
sites in proliferative and differentiated NHEK. DNase I living keratinocytes, we carried out chromatin
hypersensitivity was evaluated for PIE-S1, PIE-S2, CNS9 immunoprecipitation (ChIP) experiments. ChIP
and a segment of the promoter region of HBE1 by qPCR revealed a strongly increased occupancy of PIE-S2
experiments. Nuclear extracts from keratinocytes cultured by c-Jun (4.6 ± 0.8-fold) in differentiated compared to
under (a) high (1.5 mM) or (b) low (0.2 mM) calcium con-
proliferative keratinocytes, together with a strongly
ditions were treated with increasing amounts of DNase I
(0 μg, 10 ng, 100 ng, 1 μg and 10 μg), and the percentage of increased occupancy of PIE-S2 by JunD (7.3 ± 2-fold)
remaining copies of matrix DNA was determined com- in proliferative compared to differentiated keratino-
pared to a control treatment without DNase I. Values cytes (Fig. 7). Taken together, these findings suggest
correspond to the mean ± SEM of triplicates of a represen- that PIE-S2 bound distinct AP-1 factors according to
tative experiment out of three independent assays. the keratinocyte differentiation state, namely, JunD

233
Long-Range PADI3 Gene Regulation 1053

Fig. 6. AP-1 and MIBP1/RFX1 binding sites are essential for the IG1-3 enhancer activity. (a) Human/mouse sequence
alignment of IG1-3 identifies conserved putative transcription factor binding sites in the candidate regions PIE-S1 and
PIE-S2, as indicated. (b) Luciferase plasmids were engineered with invalidated MIBP1/RFX1, Sp1, NF1 or AP-1 binding
sites (the wild-type binding sites are indicated by black boxes). Luciferase tests were performed as in Fig. 2. Values of
relative luciferase activity (RLU) are expressed as means ± SEM for at least three independent experiments, each
performed in triplicate wells. Significant differences were evaluated using the Student's t test; ⁎P b 0.05, ⁎⁎P b 0.01. (c)
Locations of MIBP1/RFX1 (PIE-S1) and AP-1 (PIE-S2) binding sites on IG1.

in the condition showing not statistically significant transcriptional regulation of the PADI genes involves
enhancer activity and c-Jun in the condition show- additional modules other than those within the
ing significant enhancer activity. proximal promoters, which could explain the expres-
sion specificity of the PADI genes in differentiated
keratinocytes.
Discussion Surprisingly, the whole 8-kb IG1 region presents
no detectable regulatory activity upon PADI1 and
In this study, we report the characterization of two PADI3 promoters, although it encompasses PIE-S1
conserved distal cis-regulatory elements, PIE-S1 and and PIE-S2. This could be explained by the various
PIE-S2, clearly active on the PADI3 promoter in distances between these sequences and PADI pro-
keratinocytes prone to differentiate through calcium moter in luciferase plasmid constructions or, more
stimulation. Together, they bear all the hallmarks of likely, by the presence of other possible regulatory
enhancers: interspecies conservation, DNase I hyper- elements with antagonist effect within IG1.
sensitivity, orientation independence, and cell-type Transcription factor binding sites for MIBP1/
specificity.26 These two sequences are located 1 kb RFX1 and AP-1 were shown to be essential for the
apart in IG1 and cooperate to significantly enhance enhancer activity of PIE-S1 and PIE-S2, respectively.
the promoter activity of PADI3, from which they are RFX1 belongs to a conserved family of five homo-
approximately 81-kb distant (Fig. 8). PIE-S1 and PIE- dimeric and heterodimeric DNA-binding proteins.
S2 are probably also involved in the regulation of the RFX1 and MIBP1 can interact in vivo and were
PADI1 promoter by IG1-3. Our findings disclose that shown to be involved in the expression of a variety

234
1054 Long-Range PADI3 Gene Regulation

reported to inhibit the AP-1 factors and particularly

the expression of c-Jun,35 blocks the calcium-induced
increase of the PADI3 mRNA levels in NHEKs
(Chavanas et al., in preparation). Since no functional
AP-1 binding site could be identified in PADI3
minimal promoter, this result strongly supports the
notion that AP-1 controls PADI3 expression through
the AP-1 site within PIE-S2. These data are consistent
with previous studies showing that JunD is mainly
expressed in the basal layer of the epidermis contain-
ing proliferative keratinocytes, while c-Jun is promi-
nently found in the most differentiated keratino-
cytes.24 Furthermore, transcriptional properties of
AP-1 factors show that JunD is a weaker transcrip-
tional activator than c-Jun.36 Lastly, the ratio of c-Jun/
Fig. 7. On the AP-1 site of PIE-S2, ChIP assays showed JunD has previously been proposed as a key
increased binding of c-Jun or JunD in differentiated and parameter of gene expression and growth regulation
proliferative NHEKs, respectively. Chromatin was immu- in small intestinal crypt cells, NIH-3T3 fibroblasts
noprecipitated from NHEKs grown in the presence of 0.2 and malignant fibrosarcoma cells.37–39 This has
or 1.5 mM calcium, using the indicated antibodies, and generally been explained through the regulation of
qPCR experiments were performed to evaluate the copy genes with opposite effects. To the best of our
number of immunoprecipitated AP-1 region. Relative knowledge, this is the first description of competition
copy number enrichments between differentiated and
between the binding of c-Jun and JunD at the same
proliferative NHEKs are expressed on a log2 scale. Log2
values ≥ 1 are equivalent to a relative enrichment·≥ 2 in AP-1 site. Taken together, our results provide new
differentiated versus proliferative NHEKs. Inversely, log2 insights into long-range regulation of PADI1 and
values less than or equal to − 1 are equivalent to a relative PADI3 involving c-Jun, JunD and MIBP1/RFX1
enrichment ≥ 2 in proliferative versus differentiated complex factors, as modeled in Fig. 8.
NHEKs. Normalization was performed using a negative Both PIE-S1 and PIE-S2 are necessary for the
control without antibody. Values correspond to the mean increased transcription of PADI3. Synergistic activity
± SEM of triplicates of a representative experiment out of
three independent assays. Significant differences were
evaluated using the Student's t test; ⁎P b 0.05, ⁎⁎P b 0.01.

of cellular and viral genes, including c-myc, major

histocompatibility complex class II genes and
human hepatitis B virus genes.27–29 Despite exten-
sive efforts, we failed to identify the actual factor
that bound to the MIBP1/RFX1-like site. However,
the MIBP1/RFX1 complex remains a good candi-
date. MIBP1 mRNA has been observed in epidermal
granular keratinocytes. 30 Also, we successfully
detected both MIBP1 and RFX1 transcripts in diffe-
rentiating NHEKs by reverse transcription PCR.
Moreover, we showed a significant 50% decrease in
the activity of the PADI3 gene promoter in the pre-
sence of PIE-S1 alone (Fig. 4), suggesting that in the
absence of PIE-S2, PIE-S1 has a silencing activity on
the target promoter. The observation of such
opposite effects agrees with previously described
properties of the MIBP1/RFX1 complex, which has
been shown to function as a silencer or an enhancer
depending on its association with other transcrip-
tion factors.31,32 Fig. 8. Schematic model of the long-range transcription
We showed the recruitment of AP-1 factors onto regulation of PADI3 gene. A model of the cooperation
PIE-S2. The AP-1 family of transcription factors has between AP-1 and MIBP1/RFX1 complex in the long-
a key role in skin physiology24 and in the regulation range PADI3 regulation is proposed. In proliferative
NHEKs (bottom), JunD binds PIE-S1, in the absence of
of genes specific to differentiated keratinocytes, such
any detectable enhancer activity upon PADI3 promoter. In
as those for involucrin and loricrin.33,34 Our data differentiated NHEKs (top), c-Jun replaces JunD on PIE-
showed an increased binding of JunD in prolifera- S1, resulting in increased PADI3 promoter activity,
tive NHEKs and of c-Jun in Ca2+-differentiated ones. probably through an interaction with an MIBP1/RFX1
In agreement, we have found that nordihydro- complex on PIE-S2 and the TATA box at the proximal
guaiaretic acid, a natural polyphenolic compound level.

235
Long-Range PADI3 Gene Regulation 1055

of long-range regulatory elements has been shown human DNA and comprised 700 bp including proximal
for the regulation of other genes such as those of the promoters as published previously.18,19,21 IG1 fragments
β-globin locus.40,41 Furthermore, AP-1 family mem- and promoter regions were generated by PCR, then
bers have often been identified working coopera- subcloned into the pGL3 luciferase firefly reporter vector
backbone (Promega, Madison, WI) using the restriction
tively with other factors such as Sp1,42 various
sites NheI-XhoI and BglII-XhoI, respectively. Site-directed
members of the activating transcription factor or the mutagenesis was performed by PCR using the Vent DNA
CCAT/enhancer binding protein.43 In the same way, polymerase according to the supplier's recommendations
the MIBP1/RFX1 complex can act synergistically (NEB), followed by DpnI digestion of the PCR products to
with several elements. In particular, cooperation remove the parental strains. Sequence retrieval and
with AP-1 factors has been shown in the LTR of an analyses were performed using the Human BLAT Search
endogenous VL30 retrotransposon44 and in the Web site,† the Vista suite‡ and the Dialign-TF program§.
regulation of MHC class II genes.45
In our system, the IG1-3 fragment was found to be Cell cultures, transfection and luciferase reporter
specific to the PADI1 and PADI3 transcription, but assays
showed no detectable effect on PADI2 despite its
orientation-independent effect. Alignment of the Primary human keratinocytes were prepared from
PADI1 and PADI3 gene promoter sequences revealed foreskin in accordance with Helsinki principles. NHEKs
only one shared conserved sequence, corresponding were grown in KGM2 with all necessary growth factors
to the TATA box (data not shown). Unlike PADI1 and (KGM2 and Supplement Pack, Promocell, Heidelberg,
PADI3, the PADI2 gene harbors a TATA-less promo- Germany) in the presence of 0.15 mM (proliferating
ter region, and it has been shown that the TATA box conditions) or 1.5 mM (differentiating conditions) Ca2+
is an important determinant in preferential activa- for 72 h. Human dermal fibroblasts and HeLa cells were
maintained in Dulbecco's modified Eagle's medium with
tion of one promoter over another by a distant 10% (v/v) fetal bovine serum (Invitrogen, Carlsbad, CA).
element.46,47 Direct interaction between PIE-S1/-S2 Cells were plated onto 24-well plates at a density of
and the TATA binding protein will be investigated in 50 × 103 cells per well for NHEKs and 100 × 103 per well for
the near future through ChIP assays. Chromatin the other cells. Transfection experiments were carried out
conformation modifications are essential to bring a with 1 μg of each construct with TransFast Transfection
distant regulator and promoter into close proximity. Reagent (Promega). All cells were co-transfected with
Forthcoming experiments such as chromosome con- 0.01 μg of pRLTK vector, which contained the Renilla
formation capture also would also help to investigate luciferase gene used to correct for transfection efficiency.
the chromatin events underlying the interaction Six hours after transfection, culture medium was added.
between PIE-S1/-S2 and the PADI1–3 genes. Cells were lysed 72 h later with 100 μl of Passive Lysis
Buffer (Promega) per well. Luciferase activities were
In this work, we have highlighted the cooperative analyzed with the Dual-Luciferase Reporter Assay System
action of two DNase I hypersensitive sites conserved (Promega) using a Centro LB960 luminometer (Berthold
during evolution, PIE-S1 and PIE-S2, in the long- Technologies, Bad Wildbad, Germany).
range transcriptional activation of PADI1 and PADI3
promoters in differentiated NHEKs. This is an
essential step toward better knowledge of PAD ex- Quantitative DNase I protection assays
pression in the epidermis. Highlighting IG1 as a
genomic region involved in the transcriptional con- DNase protection assays were performed as described
by McArthur et al.23 Proliferative and differentiated
trol of PADI genes may also be critical to under-
NHEKs were incubated in hypotonic buffer (swollen
standing PAD implication in the pathophysiology of cells), then lysed by adding IGEPAL 10%. Nuclei were
diseases characterized by modifications in the isolated with sucrose density gradient, then incubated for
deiminated protein rate, including psoriasis and 5 min at 37 °C with increasing DNase I concentrations and
multiple sclerosis. Recent works have evidenced left overnight with proteinase K. Chromatin was purified
the presence of a single-nucleotide polymorphism using standard phenol/chloroform extraction and ethanol
within a distal enhancer that is associated with a precipitation. Quantifications were performed from 5 ng
subtype of leukemia48 and in tissue-specific long- of DNase I-digested DNA by qPCR assays using a
range enhancers that could be associated with breast SyBr-green-based qPCR mixture (MP Biomedicals, Solon,
cancer risk.49 With this in mind, we included IG1 in a OH) and an ABI7300 system (Applied Biosystems, Foster
City, CA).
recently initiated screen of the PADI locus in the
search for variant haplotypes possibly associated
with rheumatoid arthritis. Electrophoretic mobility shift assay

Nuclear extracts were prepared from NHEK culture

Materials and Methods using the CelLytic NuCLEAR Extraction Kit (Sigma).
Biotin end-labeled double-stranded oligonucleotides for
AP-1 and MIBP1/RFX1 sites as well as nonlabeled oligo-
Genomic segment amplification and mutagenesis nucleotides were purchased from Invitrogen. Poly(dIdC)
experiments

All the oligonucleotide primers used in this work are † [Link]

listed in Supplementary Table 1. The promoter regions of ‡^[Link]
the genes PADI1–3 were amplified by PCR from normal §^[Link]

236
1056 Long-Range PADI3 Gene Regulation

was added to the mix to prevent unspecific binding of 2. Hatton, R. D., Harrington, L. E., Luther, R. J.,
proteins. Binding reactions were performed at room tem- Wakefield, T., Janowski, K. M., Oliver, J. R. et al.
perature for 30 min. Control competition experiments (2006). A distal conserved sequence element controls
with a 200-fold molar excess of unlabeled DNA were Ifng gene expression by T cells and NK cells. Immunity,
performed (data not shown). In supershift experiments, 25, 717–729.
2 μg of antisera against c-Jun (BD, Franklin Lakes, NJ), 3. Antonini, D., Rossi, B., Han, R., Minichiello, A., Di
JunB, JunD, c-Fos, FosB, Fra1 and Fra2 (Santa Cruz Bio- Palma, T., Corrado, M. et al. (2006). An autoregulatory
technologies, Santa Cruz, CA) was added and the mixture loop directs the tissue-specific expression of p63
was incubated for 90 min at 4 °C with the binding reaction through a long-range evolutionarily conserved enhan-
mixture before the EMSA was performed. The biotin- cer. Mol. Cell. Biol. 26, 3308–3318.
labeled DNA was detected by LightShift chemilumines- 4. Li, Q., Peterson, K. R., Fang, X. & Stamatoyannopou-
cent EMSA kit (Pierce). los, G. (2002). Locus control regions. Blood, 100,
3077–3086.
ChIP assays 5. Martin, N., Patel, S. & Segre, J. A. (2004). Long-range
comparison of human and mouse Sprr loci to identify
conserved noncoding sequences involved in coordi-
ChIP was performed as described previously,50 using nate regulation. Genome Res. 14, 2430–2438.
20 × 106 actively growing or calcium-differentiated NHEKs 6. Pennacchio, L. A., Ahituv, N., Moses, A. M., Prabhakar,
per experiment. Proteins were cross-linked to DNA using S., Nobrega, M. A., Shoukry, M. et al. (2006). In vivo
1.2 % formaldehyde. Chromatin was fragmented using an enhancer analysis of human conserved non-coding
ultrasonic processor (Microson, Brussels, Belgium) and sequences. Nature, 444, 499–502.
then purified by proteinase K digestion, phenol/chloro- 7. Guerrin, M., Ishigami, A., Mechin, M. C., Nachat, R.,
form extraction and ethanol precipitation. Correct DNA Valmary, S., Sebbag, M. et al. (2003). cDNA cloning,
fragment size was checked by agarose gel electrophoresis. gene organization and expression analysis of human
Twenty-five micrograms of precleared chromatin was peptidylarginine deiminase type I. Biochem. J. 370,
immunoprecipitated with 5 μg of the antibodies specific to 167–174.
the AP-1 family members as described above, or without 8. Chavanas, S., Mechin, M. C., Takahara, H., Kawada,
antibody. Quantitative PCR was performed with one- A., Nachat, R., Serre, G. & Simon, M. (2004).
tenth of the immunoprecipitated DNA samples. Comparative analysis of the mouse and human
peptidylarginine deiminase gene clusters reveals
Accession numbers highly conserved non-coding segments and a new
human gene, PADI6. Gene, 330, 19–27.
The data presented here have been submitted to GenBank 9. Moscarello, M. A., Pritzker, L., Mastronardi, F. G. &
under the reference numbers EU694174 and EU694175. Wood, D. D. (2002). Peptidylarginine deiminase: a can-
didate factor in demyelinating disease. J. Neurochem. 81,
335–343.
10. Suzuki, A., Yamada, R., Chang, X., Tokuhiro, S.,
Sawada, T., Suzuki, M. et al. (2003). Functional
Acknowledgements haplotypes of PADI4, encoding citrullinating enzyme
peptidylarginine deiminase 4, are associated with
rheumatoid arthritis. Nat. Genet. 34, 395–402.
We are indebted to C. Bouchouata for expert
11. Hagiwara, T., Nakashima, K., Hirano, H., Senshu, T. &
assistance, to C. Offer and H. Brun for sequencing, Yamada, M. (2002). Deimination of arginine residues
and to P. Gallinié and J.-P. Chavoin for providing in nucleophosmin/B23 and histones in HL-60 granu-
skin samples. This work was supported by Institut locytes. Biochem. Biophys. Res. Commun. 290, 979–983.
National de la Santé et de la Recherche Médicale 12. Wang, Y., Wysocka, J., Sayegh, J., Lee, Y. H., Perlin, J. R.,
(INSERM), Paul Sabatier Toulouse III University Leonelli, L. et al. (2004). Human PAD4 regulates histone
(UPS), Centre National de la Recherche Scientifique arginine methylation levels via demethylimination.
(CNRS), European Social Fund (ESF), European Science, 306, 279–283.
Regional Development Fund (ERDF), the French 13. Ishida-Yamamoto, A., McGrath, J. A., Judge, M. R.,
Society for Dermatological Research (SRD) and Leigh, I. M., Lane, E. B. & Eady, R. A. (1992). Selective
involvement of keratins K1 and K10 in the cytoskeletal
Pierre-Fabre Research Institute (CERPER, Centre
abnormality of epidermolytic hyperkeratosis (bullous
Européen de Recherche sur la Peau et les Epithé- congenital ichthyosiform erythroderma). J. Invest.
liums de Revêtement, Toulouse). Dermatol. 99, 19–26.
14. Ishida-Yamamoto, A., Senshu, T., Takahashi, H.,
Akiyama, K., Nomura, K. & Iizuka, H. (2000). Dec-
Supplementary Data reased deiminated keratin K1 in psoriatic hyperpro-
liferative epidermis. J. Invest. Dermatol. 114, 701–705.
Supplementary data associated with this article 15. Segre, J. A. (2006). Epidermal barrier formation and
can be found, in the online version, at doi:10.1016/ recovery in skin disorders. J. Clin. Invest. 116, 1150–1158.
[Link].2008.10.019 16. Fuchs, E. (2008). Skin stem cells: rising to the surface.
J. Cell Biol. 180, 273–284.
17. Nachat, R., Mechin, M. C., Takahara, H., Chavanas, S.,
References Charveron, M., Serre, G. & Simon, M. (2005).
Peptidylarginine deiminase isoforms 1–3 are ex-
1. Howard, M. L. & Davidson, E. H. (2004). cis- pressed in the epidermis and involved in the deimi-
Regulatory control circuits in development. Dev. Biol. nation of K1 and filaggrin. J. Invest. Dermatol. 124,
271, 109–118. 384–393.

237
Long-Range PADI3 Gene Regulation 1057

18. Dong, S., Kojima, T., Shiraiwa, M., Mechin, M. C., promoter is required for expression in epidermis.
Chavanas, S., Serre, G. et al. (2005). Regulation of the J. Biol. Chem. 273, 30460–30465.
expression of peptidylarginine deiminase type II 34. Jang, S. I. & Steinert, P. M. (2002). Loricrin expression
gene (PADI2) in human keratinocytes involves Sp1 in cultured human keratinocytes is controlled by a
and Sp3 transcription factors. J. Invest. Dermatol. 124, complex interplay between transcription factors of the
1026–1033. Sp1, CREB, AP1, and AP2 families. J. Biol. Chem. 277,
19. Dong, S., Kanno, T., Yamaki, A., Kojima, T., Shiraiwa, 42268–42279.
M., Kawada, A. et al. (2006). NF-Y and Sp1/Sp3 are 35. Park, S., Hahm, E. R., Lee, D. K. & Yang, C. H. (2004).
involved in the transcriptional regulation of the Inhibition of AP-1 transcription activator induces
peptidylarginine deiminase type III gene (PADI3) in myc-dependent apoptosis in HL60 cells. J. Cell.
human keratinocytes. Biochem. J. 397, 449–459. Biochem. 91, 973–986.
20. Dong, S., Zhang, Z. & Takahara, H. (2007). Estrogen- 36. Mechta-Grigoriou, F., Gerald, D. & Yaniv, M. (2001).
enhanced peptidylarginine deiminase type IV gene The mammalian Jun proteins: redundancy and
(PADI4) expression in MCF-7 cells is mediated by specificity. Oncogene, 20, 2378–2389.
estrogen receptor-alpha-promoted transfactors act- 37. Patel, A. R. & Wang, J. Y. (1999). Polyamine depletion is
ivator protein-1, nuclear factor-Y, and Sp1. Mol. associated with an increase in JunD/AP-1 activity in
Endocrinol. 21, 1617–1629. small intestinal crypt cells. Am. J. Physiol. 276, G441–G450.
21. Dong, S., Ying, S., Kojima, T., Shiraiwa, M., Kawada, 38. Pfarr, C. M., Mechta, F., Spyrou, G., Lallemand, D.,
A., Mechin, M. C. et al. (2008). Crucial Roles of MZF1 Carillo, S. & Yaniv, M. (1994). Mouse JunD negatively
and Sp1 in the transcriptional regulation of the pepti- regulates fibroblast growth and antagonizes transfor-
dylarginine deiminase type I gene (PADI1) in human mation by ras. Cell, 76, 747–760.
keratinocytes. J. Invest. Dermatol. 128, 549–557. 39. Bossy-Wetzel, E., Bravo, R. & Hanahan, D. (1992).
22. Boyce, S. T. & Ham, R. G. (1983). Calcium-regulated Transcription factors junB and c-Jun are selectively
differentiation of normal human epidermal keratino- up-regulated and functionally implicated in fibrosar-
cytes in chemically defined clonal culture and serum- coma development. Genes Dev. 6, 2340–2351.
free serial culture. J. Invest. Dermatol. 81, 33s–40s. 40. Molete, J. M., Petrykowska, H., Bouhassira, E. E.,
23. McArthur, M., Gerum, S. & Stamatoyannopoulos, G. Feng, Y. Q., Miller, W. & Hardison, R. C. (2001).
(2001). Quantification of DNaseI-sensitivity by real- Sequences flanking hypersensitive sites of the beta-
time PCR: quantitative analysis of DNaseI-hypersen- globin locus control region are required for synergistic
sitivity of the mouse beta-globin LCR. J. Mol. Biol. 313, enhancement. Mol. Cell. Biol. 21, 2969–2980.
27–34. 41. Feng, Y. Q., Warin, R., Li, T., Olivier, E., Besse, A.,
24. Angel, P., Szabowski, A. & Schorpp-Kistner, M. (2001). Lobell, A. et al. (2005). The human beta-globin locus
Function and regulation of AP-1 subunits in skin control region can silence as well as activate gene
physiology and pathology. Oncogene, 20, 2413–2423. expression. Mol. Cell. Biol. 25, 3864–3874.
25. Mehic, D., Bakiri, L., Ghannadan, M., Wagner, E. F. & 42. Banks, E. B., Crish, J. F., Welter, J. F. & Eckert, R. L.
Tschachler, E. (2005). Fos and jun proteins are speci- (1998). Characterization of human involucrin promo-
fically expressed during differentiation of human ter distal regulatory region transcriptional activator
keratinocytes. J. Invest. Dermatol. 124, 212–220. elements—a role for Sp1 and AP1 binding sites.
26. Brand, A. H., Breeden, L., Abraham, J., Sternglanz, R. Biochem. J. 331(Pt 1), 61–68.
& Nasmyth, K. (1985). Characterization of a “silencer” 43. Chinenov, Y. & Kerppola, T. K. (2001). Close encoun-
in yeast: a DNA sequence with properties opposite to ters of many kinds: Fos–Jun interactions that mediate
those of a transcriptional enhancer. Cell, 41, 41–48. transcription regulatory specificity. Oncogene, 20,
27. Makino, R., Akiyama, K., Yasuda, J., Mashiyama, S., 2438–2452.
Honda, S., Sekiya, T. & Hayashi, K. (1994). Cloning 44. Maijgren, S., Sur, I., Nilsson, M. & Toftgard, R. (2004).
and characterization of a c-myc intron binding protein Involvement of RFX proteins in transcriptional activa-
(MIBP1). Nucleic Acids Res. 22, 5679–5685. tion from a Ras-responsive enhancer element. Arch.
28. Moore, B. B., Cao, Z. A., McRae, T. L., Woo, C. H., Dermatol. Res. 295, 482–489.
Conley, S. & Jones, P. P. (1998). The invariant chain 45. Andersson, G. & Peterlin, B. M. (1990). NF-X2 that
gene intronic enhancer shows homology to class II binds to the DRA X2-box is activator protein 1. Ex-
promoter elements. J. Immunol. 161, 1844–1852. pression cloning of c-Jun. J. Immunol. 145, 3456–3462.
29. Blake, M., Niklinski, J. & Zajac-Kaye, M. (1996). Inter- 46. Ohtsuki, S., Levine, M. & Cai, H. N. (1998). Different
actions of the transcription factors MIBP1 and RFX1 core promoters possess distinct regulatory activities in
with the EP element of the hepatitis B virus enhancer. the Drosophila embryo. Genes Dev. 12, 547–556.
J. Virol. 70, 6060–6066. 47. Bertolino, E. & Singh, H. (2002). POU/TBP coopera-
30. Toulza, E., Mattiuzzo, N. R., Galliano, M. F., Jonca, N., tivity: a mechanism for enhancer action from a
Dossat, C., Jacob, D. et al. (2007). Large-scale identi- distance. Mol. Cell, 10, 397–407.
fication of human genes implicated in epidermal 48. Steidl, U., Steidl, C., Ebralidze, A., Chapuy, B., Han,
barrier function. Genome Biol. 8, R107. H. J., Will, B. et al. (2007). A distal single nucleotide
31. Katan, Y., Agami, R. & Shaul, Y. (1997). The transcrip- polymorphism alters long-range regulation of the PU.1
tional activation and repression domains of RFX1, a gene in acute myeloid leukemia. J. Clin. Invest. 117,
context-dependent regulator, can mutually neutralize 2611–2620.
their activities. Nucleic Acids Res. 25, 3621–3628. 49. Yang, R., Frank, B., Hemminki, K., Bartram, C. R.,
32. Fukuda, S., Yamasaki, Y., Iwaki, T., Kawasaki, H., Wappenschmidt, B., Sutter, C. et al. (2008). SNPs in
Akieda, S., Fukuchi, N. et al. (2002). Characterization ultraconserved elements and familial breast cancer
of the biological functions of a transcription factor, c- risk. Carcinogenesis, 29, 351–355.
myc intron binding protein 1 (MIBP1). J. Biochem. 131, 50. Soutoglou, E., Viollet, B., Vaxillaire, M., Yaniv, M.,
349–357. Pontoglio, M. & Talianidis, I. (2001). Transcription
33. Crish, J. F., Zaim, T. M. & Eckert, R. L. (1998). The factor-dependent regulation of CBP and P/CAF histone
distal regulatory region of the human involucrin acetyltransferase activity. EMBO J. 20, 1984–1992.

238
International Journal of Cosmetic Science, 2007, 29, 147–168

Review Article
Update on peptidylarginine deiminases and
deimination in skin physiology and severe human
diseases

M.-C. Méchin*, M. Sebbag*, J. Arnaud*, R. Nachat*1, C. Foulquier*, V. Adoue*, F. Coudane*, H. Duplan ,

A.-M. Schmitt , S. Chavanas*, M. Guerrin*, G. Serre* and M. Simon*
*CNRS-University of Toulouse III, UMR5165, Institut Fédératif de Recherche Claude de Préval, IFR30 (INSERM-CNRS-
Université Paul Sabatier-Centre Hospitalier Universitaire de Toulouse), Toulouse and  Institut de Recherche Pierre
Fabre, Toulouse, France

Received 22 December 2006, Accepted 9 February 2007

Keywords: differentiation, inflammation, post-translational modification, rheumatoid arthritis, skin barrier

1
Present address: Epithelial Cell Biology (Skin), Cambridge Research Institute, Lika Shing Centre, Robinson
Way, Cambridge CB2 ORE, U.K.

main biochemical, genetic and functional aspects of

Synopsis
PADs together with their pathophysiological impli-
Deimination (or citrullination) is a recently des- cations.
cribed post-translational modification, but its conse-
quences are not yet well understood. It is catalysed
Résumé
by peptidylarginine deiminases (PADs). These
enzymes transform arginyl residues involved in a La désimination (ou citrullination) est une modifica-
peptidyl link into citrullyl residues in a calcium- tion post-traductionnelle catalysée par les peptidyl-
dependent manner. Several PAD substrates have arginine désiminases (PADs), décrite depuis peu et
already been identified like filaggrin and keratins K1 dont les conséquences sont encore mal comprises.
and K10 in the epidermis, trichohyalin in hair folli- Ces enzymes transforment, de façon dépendante du
cles, but also ubiquitous proteins like histones. PADs calcium, les résidus arginyl engagés dans un lien
act in a large panel of physiological functions as cel- peptidique en résidus citrullyl. Plusieurs substrats
lular differentiation or gene regulation. It has been ont été identifiés: la filaggrine et les cytokératines
suggested that deimination plays a role in many K1 et K10 de l’épiderme, la trichohyaline dans le
major diseases such as rheumatoid arthritis, mul- follicule pileux mais aussi des protéines ubiquistes
tiple sclerosis, Alzheimer’s disease and psoriasis. comme les histones. Les PADs interviennent dans de
Five human genes (PADIs), encoding five highly nombreuses fonctions physiologiques telles que la
conserved paralogous enzymes (PAD1-4 and 6), différenciation cellulaire ou la régulation génique.
have been characterized. These genes are clustered La désimination pourrait jouer un rôle dans plu-
in a single locus, at 1p35-36 in man. Only PAD1-3 sieurs maladies sévères et fréquentes comme la poly-
are expressed in human epidermis. PADs seem to be arthrite rhumatoı̈de, la sclérose en plaque, la
controlled at transcriptional, translational and maladie d’Alzheimer ou encore le psoriasis. Cinq
activity levels and they present particular substrate gènes humains (PADIs) codant pour 5 enzymes par-
specificities. In this review, we shall discuss these alogues conservées (PAD1-4 et 6) ont été cara-
ctérisés. Ils sont regroupés en un seul locus, en
Correspondence: Marie-Claire Méchin, UMR5165, Faculté
de Médecine, 37 allées Jules Guesde, F-31073 Toulouse
1p35-36 chez l’homme. Seules les PAD1-3 sont ex-
cedex, France. Tel.: +33 561145948; fax: +33 primées dans l’épiderme humain. Les PADs semb-
561145938; e-mail: mechin@[Link] lent contrôlées aux niveaux transcriptionnel et

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie 147
239
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

traductionnel, ainsi qu’au niveau de leur activité. Here, we propose to describe one not well-known
Elles présentent chacune leurs spécificités de subst- modification of proteins, deimination (or citrullina-
rats. Ces principaux aspects biochimiques, géné- tion). First described in hair follicles and the epider-
tiques et fonctionnels des PADs tout comme leurs mis [2], deimination is the calcium-dependent
implications physiopathologiques seront discutés conversion of an arginyl residue, in a (poly)-peptide,
dans cette revue. into a citrullyl residue by a peptidylarginine deimi-
nase (PAD, EC [Link]) (Fig. 1). Five PADs are
known in mammals. Each deimination reaction
Introduction to deimination by PADs
generates a charge loss potentially leading to modi-
fications in the conformation of the PAD substrate
Deimination or citrullination, a post-translational
and subsequently in its interactions.
modification

Many post-translational modifications have been

Identification and properties of PADs
characterized as the biochemistry of proteins was
studied. With new technologies and proteomic
PADs, a new family of enzymes
approaches, many others will probably be discov-
ered soon and their implications in cell biology will With a molecular genomic approach, we recently
become better understood (For a review see demonstrated the clustering of the five human
Ref. [1]). PADI genes at a single locus at 1p35-36 [3]

+
H2N
NH2
HN PAD

H2O
R1 R2
Ca2+
N
H +
O NH4 O
NH2
Arginyl- HN

+ R1 R2
NH3CH3 N
H Figure 1 Schematic representation
H2O O of the citrullination reactions. Pepti-
+ Ca2+ dylarginine deiminase (PAD)-medi-
H2N ated citrullination corresponds to
H2O Citrullyl-
NHCH3 the transformation into a citrullyl
H residue, in the presence of calcium,
of either an arginyl residue or of a
PAD4
mono-methyl-arginyl residue,
releasing ammonia or methylamine,
R1 R2 respectively. To note that, so far
N only PAD4 has been demonstrated
to act on mono-methyl-arginyl-resi-
H
O dues. R1 and R2 refer to amino-acyl
residues involved in a peptide bond
with the targeted (mono-methyl-)
Mono-methyl-arginyl- arginyl residue.

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
148 International Journal of Cosmetic Science, 29, 147–168
240
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

(a) Telomere
8.0 24.0 3.1 85.7

PADI 6 PADI 4 PADI 3 PADI 1 PADI 2 1p35-36

< < < < >
29.5 55.5 35.1 40.9 50.7

(b)
Telomere
23.9 11.2 2.5 62.0

Padi 6 Padi 4 Padi 3 Padi 1 Padi 2 4E1

< < < < >
15.2 27.4 25.3 32.8 46.2

Figure 2 Schematic representation of the human PADI (a) and mouse Padi (b) loci at 1p35-36 and 4E1, respectively.
For each locus, sizes of the genes and of intergenic regions are indicated in kb at the bottom and top, respectively. The
open arrows represent the transcription direction of each gene. Note that PADI2 (or Padi2) transcription takes place in
the opposite direction to the other PADI genes.

(Fig. 2a). The five genes encode distinct PAD iso- Table I Percentage of homology between primary
types named PAD1-4 and PAD6 (PAD4 was also human peptidylarginine deiminases (PAD) amino-acid
previously designated as PAD5). Actually, the clo- sequences, theoretical isoelectric point (pI) and calculated
ning and the characterization of all PADI genes molecular mass (kDa) of each human PAD
required more than a decade and the investiga-
tions of many research teams. Briefly, cDNAs % homology PAD1 PAD2 PAD3 PAD4 PAD6 pI kDa
encoding the ‘Pad muscle type’ of rat and mouse
were cloned first, corresponding to the Pad2 iso- PAD1 100 65 68 71 59 6.01 74.6
type [4–6]. Next, cDNAs from rodents coding for PAD2 100 67 65 59 5.40 75.3
PAD3 100 68 60 5.25 74.6
the ‘Pad follicle type’, identified as Pad3 isotype,
PAD4 100 61 6.15 74.0
and the ‘Pad epidermis type’, initially defined as PAD6 100 4.97 77.7
Pad1 isotype, were isolated [7–9]. Subsequently, a
new isotype called PAD4 was identified from HL- These data were extracted from the sequences of human PAD1,
60 cells (a human myeloid leukaemia cell line) 2, 3, 4 and 6 corresponding to GenBank accession numbers
[10] and the cDNAs of human PAD1-3 were char- AB033768, AB030176, AB026831, AB017919 and AY422079,
acterized [11–13]. Finally, cDNAs encoding the respectively. Percentages of homology were calculated by Blast
last isotype, PAD6, also known as ePad in mouse, analysis and clustalw program, as previously described [13].

were identified [3, 14, 15]. PAD6 and/or ePad

mRNAs have been detected in ovary, testis, periph- identified in vivo, in particular structural proteins:
eral blood leucocytes, oocytes and early cleavage- intermediate filament (IF) proteins, such as kera-
stage embryos [3, 14, 15]. The five human PAD tins K1 and K10, vimentin and glial fibrillary aci-
isotypes are highly conserved at the protein level dic protein (GFAP), and IF-associated proteins like
with 59–71% of homology (Table I). Conservation filaggrin and trichohyalin [16–22]. Other sub-
has also been demonstrated at the levels of nucleo- strates are nuclear proteins, histones (H2A, H3
tide sequences and organization of the human and and H4) and nucleophosmin/B23 [23], and also
murine PADI gene loci [3] (Fig. 2b). Conservation extra-cellular proteins such as fibrin and fibronec-
of intergenic non-coding sequences suggests that tin [24, 25]. These PAD targets are involved in
they may play a role in a possible co-regulation of biological functions as diverse as epidermal differ-
these genes. entiation, gene regulation and inflammation/
coagulation. Generally, they are abundant proteins
and present a high percentage of arginine in their
Substrates and specificities of PADs
primary sequence. This is the case, for example,
Peptidylarginine deiminase activity has been detec- for trichohyalin (22.7%), filaggrin (11%), GFAP
ted in all vertebrates and in most organs, tissues (10.9%) and vimentin (9.2%). It is interesting to
and cells. Several substrates of PADs have been note that the PAD substrates already known are

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 149
241
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

often basic proteins (or contain basic domains) fied and thus arguing again for the specificity of
whereas PADs themselves are rather acidic accord- each type of PAD [28]. Similarly, some arginyl res-
ing to their theoretical isoelectric point (Table I). idues of the Aa- and Bb-chains of human fibrin-
This probably facilitates the interactions between ogen exhibit different sensitivities to deimination
these enzymes and their substrates. by recombinant PAD2 or PAD4 [29]. Overall,
Deimination by PADs takes place on arginine in these catalytic specificities suggest possible comple-
a peptidyl link, in specific amino-acid environ- mentarities of PAD isotypes to deiminate several
ments and under particular structural constraints. arginines of a particular target. Finally, the recom-
Trichohyalin, mainly helicoidal, is poorly deimi- binant forms of PAD1-3 have shown, on several
nated in vitro by Pad2 whereas filaggrin, less synthetic arginine derivatives, relative activities
structured, is fully modified, as demonstrated by similar to those of PAD1-3 purified from diverse
biophysical data [19]. The substrate specificity of organs [28, 30–33] (Table II). This suggests that
Pad2 is the best known, as a purified Pad2 from PADs do not require eukaryote-specific post-trans-
rabbit muscle has been commercially available for lational modification(s) to be active. Nevertheless,
many years. For this isotype, it has been shown by PADs (at least PAD1-3) were found to be capable
using peptides that an N-terminal arginine is of calcium-dependent ‘auto-deimination’ in an in
poorly deiminated, that proline or glutamic acid vitro assay [M-C Méchin, unpubl. data]. The ques-
contiguous to the arginine are not favourable tions ‘Does auto-deimination happen in vivo?’ and
amino-acids, and that the first of two consecutive if so ‘What is its function?’ remain unanswered.
arginines are better deiminated [19, 26, 27]. The
specificity of purified recombinant human PAD1-3
PAD4, nuclear location and crystal structure
towards nine synthetic arginine-derivatives has
been analysed and shown to differ between these PAD4, mainly expressed in haematopoietic cells,
three isotypes [28]. PAD2, for example, is more carries a functional nuclear localization signal
active on tosyl-l-Arg-O-Me or benzoyl-l-Arg-O-Et (56-PPAKKKST-63, poorly conserved in mouse
than PAD1 and 3. After deimination, the migra- Pad4) as demonstrated by transfection of HeLa
tion of a protein in an sodium dodecyl sulfate-gel cells (a human carcinoma cell line) [34]. In the
can change dramatically, as observed for trichohy- nucleus of MCF-7 cells (a human breast carcinoma
alin and filaggrin [19, 28]. Migration of filaggrin cell line) and murine early-stage embryos, PAD4
is not the same when it is deiminated by PAD1, 2 deiminates arginyl and mono-methyl-arginyl resi-
or 3, suggesting that different arginines are modi- dues on the N-terminal head of histones H3 and

Table II Comparison of the relative activities on synthetic substrates and on protamin of recombinant peptidylarginine
deiminases (PAD)1, 2 and 3 and the corresponding enzymes purified from various tissues and species

PAD1 PAD2 PAD3

Relative
activity (%) Rec1 mEp2 bMu3 Rec1 mEp4 rMu5 mEp6 rabMu7 Rec1 mEp8 rMu9

Bz-l-Arg-O-Et 100 100 100 100 100 100 100 100 100 100 100
Bz-l-Arg-O-Me 88.7 71.4 / 46.5 83.0 77.9 68.3 83.9 57.6 26.8 /
Bz-l-Arg-O-NH2 100.2 150 / 50.5 48.7 51.8 48.7 41.4 73.1 88.4 /
Tos-l-Arg-O-Me 3.2 19.6 / 62.9 51.6 / 63.0 65.9 18.2 27.4 /
Ac-l-Arg-O-Me 105.1 66.7 / 33.0 39.5 44.8 44.7 42.5 26.5 32.1 /
Bz-l-Arg 109.6 102 106 18.7 14.2 18.5 18.4 14.9 19.7 11.6 18.0
Ac-l-Arg 113.2 65.0 / 2.4 13.0 / 3.3 2.6 7.2 11.6 /
l-Arg-O-Me 10.3 14.3 / 2.1 2.8 / 2.0 1.8 5.7 15.3 /
l-Arg 15.7 15.0 7.0 4.9 3.7 0.84 4.0 2.6 4.2 8.9 2.4
Protamin 109.5 37.5 / 115.3 59.0 / / / 218.6 141.1 /

(Rec1), Pure human recombinant PAD 1, 2 and 3 were produced as previously described [28]. (mEp2) and (bMu3), PAD1 was purified
from mouse [33] and bovine [31] epidermis, respectively. (mEp4) and (mEp6), PAD2 was purified from mouse epidermis [32 and 33,
respectively]. (rMu5) and (rabMu7), PAD2 was purified from rat [31] and rabbit [30] skeletal muscles, respectively. (mEp8) and (rMu9),
PAD3 was purified from mouse epidermis [33] and rat hair follicles [31], respectively.

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
150 International Journal of Cosmetic Science, 29, 147–168
242
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

H4 [35–37]. Deimination (or ‘demethylimination’) similarity between PADs. Nevertheless PAD6

of mono-methyl-arginyl residues produces a cit- appears as the most divergent isotype of the fam-
rullyl-residue and methylamine (Fig. 1). This reac- ily, as previously suggested by phylogenetic
tion antagonizes the histone methylation of approaches and according to the comparison of
arginines normally associated to transcription non-synonymous (dN) to synonymous (dS) nucleo-
induction. These data are of major importance tide substitution rates (dN/dS) between paralogous
because they are the first demonstration of a poss- PADI genes [3, 43].
ible reversibility of the methylation of histones ar-
ginyl residues and of the involvement of
Structural model of PAD1
deimination (at least by PAD4) in gene regulation
[38]. In contrast, di-methyl-arginyl residues could We produced a 3D model of PAD1 using the
not be deiminated by PAD4. The deimination of atomic coordinates derived from the analysis of
histones H2A, H3 and H4 has also been described PAD4 crystal structures [40], as described in detail
in HL-60 granulocytes where only one or two in the legend of Fig. 3. This allowed us to precisely
methyl-arginyl residues are transformed into cit- point out, at the structural level, the conservation
rullyl residues according to mass spectrometry and differences between these two isotypes. The
measurements [39]. 3D modelling of PAD1 showed conformational
PAD4 crystal structure has been resolved at changes of several regions after calcium binding
2.3Å and disclosed a head-to-tail homo-dimeric (compare Figs 3a,b), concerning in particular three
structure with two immunoglobulin-like sub- loops (indicated by arrowheads). These loops get
domains in the N-terminal part and five bbab closer and seem to cap the active site cleft. As
‘propeller-modules’ in the C-terminal half [40, 41]. expected, in the active site, the catalytic residues
At least seven amino-acids have been implicated of PAD1, deduced from the alignments and con-
in the formation of the catalytic PAD4 cleft with a served for all PADs (Asp-352, His-472, Asp-474
direct action of Cys-645, Asp-350, His-471 and and Cys-645 corresponding to Asp-350, His-471,
Asp-473 in the catalytic mechanism. Five cal- Asp-473 and Cys-645 of PAD4; Table III), are
cium-binding sites, with no EF-hand similarities, located in the bottom of the modelled cleft (Fig. 3a),
have also been defined. According to multiple and shift slightly to get closer after calcium binding
alignments of PAD4 with the other PAD isotypes, (Fig. 3b). They probably act directly in the
we show that the position of the amino-acids deimination reaction with the peptidyl-arginyl
involved in catalysis and calcium-binding sites are residue. In contrast, the three other amino-acids of
conserved (Tables III and IV), confirming the close the PAD1 active site (Arg-374, Arg-376 and

Table III Amino-acids involved in

peptidylarginine deiminases (PAD)4 PAD/Pad Asp-350 Arg-372 Arg-374 His-471 Asp-473 Arg-639 Cys-645
catalysis cleft are conserved between
PADs 1 D R R H D L C
2 D R G H D F C
3 D R G H D L C
4 D R R H D R/Y C
6 D Q/R A/S H D E/N A*

Comparisons were made according to the multiple alignment of primary human and
murine PAD sequences using the multalin program [42]. The human sequences
correspond to GenBank accession numbers given in Table I, the mouse sequences
correspond to GenBank accession numbers NM_011059, NM_008812, NM_011060,
NM_011061 and AB121692 for the mouse Pad 1, 2, 3, 4 and 6, respectively. Amino-acid
numbers are defined on the human PAD4 sequence. If the amino-acids are conserved
between the orthologous sequences, only one letter is indicated at the corresponding
position. When two amino-acids are indicated, the first one is for the human sequence and
the second for the orthologous mouse sequence. Bold letters: identical amino-acids. *: in
the PAD6 sequence two cysteines surround the Ala-676 aligned with the Cys-645 of
PAD4, and in Pad6 one cysteine is situated just before the aligned Ala-665.

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 151
243
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

Table IV Amino-acids involved in peptidylarginine deiminases (PAD)4 calcium-binding sites are conserved between
PADs.

Ca2+ sites:

1: PAD/Pad Gln-349 Glu-353 Phe-407 Leu-410 Glu-411

1 Q E F L D
2 Q E F L E
3 Q E F L E
4 Q E F L E
6 Q A I L M

2: PAD/Pad Glu–351 Asp-369 Ser-370 Asn-373

1 E D S N
2 E D S D
3 E D S N
4 E D S N/D
6 E D T A/V

3: PAD/Pad Asn-153 Asp-155 Asp-157 Asp-165 Asp-176 Asp-179

1 N D D D D D
2 N D E/D D D D
3 N D D D D D
4 N D D/E D D D
6 N N/S N/A D E/I N

4: PAD/Pad Asp-155 Asp-157 Asp-179 Asp-388

1 D D D D
2 D E/D D D
3 D D D D
4 D D/E D D/N
6 N/S N/A N G

5: PAD/Pad Asp-165 Asp-168 Glu-170

1 D H/A W/H
2 D D K
3 D D H/Y
4 D D E/K
6 D T/S K/Q

Comparisons were made according to the multiple alignment of primary human and murine PAD sequences, as described in Table III.
Amino-acid numbers are defined on the primary human PAD4 sequence. If the amino-acids are conserved between the orthologous
sequences, only one letter is indicated at the corresponding position. When two amino-acids are indicated, the first one is for the human
sequence and the second for the murine sequence. Bold letters: identical amino-acids. Italic letters: homologous amino-acids.

Leu-639 corresponding to Arg-372, Arg-374 and and move widely after calcium binding to become
Arg-639 of PAD4), less conserved (Table III), may closer together (compare Figs 3a,b). In that way,
play a role in the substrate specificity. They are they could constitute a kind of filter for substrates,
clearly located at the entry of the active site cleft some of them being ‘allowed’ to enter whereas

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
152 International Journal of Cosmetic Science, 29, 147–168
244
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

(a) (b)

Figure 3 3D modelling of peptidylarginine deiminase (PAD) 1 according to PAD4 crystal-structures. Schematic ribbon
representations of the 3D structure of PAD1 were derived from the following PAD4 atomic co-ordinates available in the
Protein Data Bank [[Link] Ca2+-free PAD4 (PDB accession code 1WD8) and PAD4 complexed to
Ca2+ and benzoyl-l-arginine amide as a substrate (1WDA) [40]. All the 3D modelling structures were produced by the
Bioinformatic Tool Server @TOME (@utomatic Threading Optimization Modeling & Evaluation) at the CBS Informatic
Team [[Link]] [44]. Furthermore, these models have been refined by energy minimization (3000 iterations)
and validated by Ramachandran plot analyses (data not shown) using MSI Insight II modules Biopolymer, CHARMM
and Viewer on an O2 SGI workstation (a and b). Illustrations of the 3D modelling of Ca2+-free PAD1 (derived from
1WD8) and of Ca2+-bound PAD1 complexed to benzoyl-l-arginine amide (derived from 1WDA), respectively. The immu-
noglobulin-like sub-domains 1 (residues 1–121) and 2 (residues 122–298) are in green and purple, respectively, and
the C-terminal domain is in yellow. The seven amino-acids of the active site are shown by using space-filling representa-
tion. The two arginines (Arg-374 and Arg-376) and the leucine (Leu-639) probably involved in the specificity of PAD1
are in green and purple, respectively. Among the four amino-acids directly involved in the deimination reaction, the
two aspartic acids (Asp-352 and Asp-474) are in black, the histidine (His-473) is in blue and the cysteine (Cys-645) in
red. The two structures are roughly superimposable except for particular regions pointed by arrows in the N-terminal-
and arrowheads in the C-terminal domain, respectively. In (b), the five calcium ions are indicated by asterisks.

others would not because of structural constraints recombinant form of PAD6 is active, at least on
and the charge environment. These 3D models of the soya bean trypsin inhibitor [14]. Further-
PAD1 provide structural clues for the fine specifici- more, an anti-ePad antibody has been shown to
ty of PADs and highlight their conservation. inhibit mouse embryonic development before
implantation, with a reduction of the percentage
of blastocyst formation from 90% to 60% [46].
PAD6, the isotype involved in embryonic develop-
Surprisingly, in this paper, it is proposed that
ment
Pad6 is an extra-cellular protein released from
PAD6 is the latest (and the last) isotype of the cortical granules when they undergo exocytosis.
family to be identified and the most divergent. Its As a signal peptide is predicted for the mouse
cDNA has been cloned from a human ovary lib- Pad6 but not for its human ortholog, this
rary and a human foetal brain library [3, 45]. A remains to be demonstrated. Finally, a patent has
proteomic approach has evidenced Pad6 (or ePad) been taken out on PAD6 for its putative contra-
expression in murine oocytes, where its action ceptive usefulness [14].
during remodelling of filamentous cytoskeletal
structures has been suggested [15]. Pad6 has
Regulation of PADs and deimination:
been detected in the cytoplasm and weakly in the
multilock control points
nucleus of murine blastocytes [15]. This isotype
presents a short lysine-rich motif in its N-terminal
Calcium
part (132-SDKQAKKK-139, conserved in PAD6),
but its role in the nuclear addressing of Pad6 It has long been well documented that the cata-
remains to be tested. The amino-acids of the lysis of deimination by PADs is absolutely depend-
catalytic site defined for PAD4 are partially con- ent on the presence of calcium. As the PAD4
served in the PAD6 sequence (Table III). In crystal structure is available, this calcium depend-
particular, the Cys-645 of PAD4 is not aligned ence can be better understood at the ‘atomic’ level
with any cysteine of PAD6 but with an alanine [40, 41]. No bivalent cation among eight (mag-
surrounded by two cysteines. Nevertheless, a nesium, manganese, cobalt, strontium, barium,

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 153
245
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

nickel, zinc and copper) was able to replace Calcium therefore appears as a major regulator
calcium in a rabbit muscle Pad2 activity assay. of PADs as it acts at both the activity and tran-
Some inhibition was even observed with mangan- scriptional levels.
ese (80%), nickel (65%) or cobalt (25%) [30].
PAD1–3 need 1- to 2.5-mM calcium to be fully
Oestrogens and other hormones
efficient in vitro on human purified filaggrin, and 4
to 20 mM on benzoyl-l-Arg-O-Et [28]. Even if Several in vivo experiments in rodents have shown
amino-acids of the calcium-binding sites are lar- an oestrogen-modulation of Pad2 activity in
gely conserved (Table IV), calcium sensitivity of the pituitary gland and the uterus (during the
PAD1–3 differs from one isotype to another and oestrous cycle). This was also observed in the
depends on the nature of substrate (small synthetic MtT/S rat cell line (derived from pituitary cells)
arginine-derivatives vs. structured proteins) [28]. cultured in vitro [53–59]. PAD activity is low in
Surprisingly, the calcium concentration used to the uterus of ovariectomized rats and restored to a
determine PAD activity (usually 10 mM) is consid- normal level in 4 days after injections of oestra-
erably higher than the intracellular physiological diol, but not of testosterone or progesterone [53].
calcium concentration (around 100 nM) of non- Moreover, when injected simultaneously, prog-
activated cells. It has been suggested that high cal- esterone antagonizes the induction by 17-b-oestra-
cium concentrations could occur locally in cells or diol-3-benzoate of PAD activity in the uterus of
in extreme situations like apoptosis or necrosis ovariectomized mice [57]. In MtT/S cells, insulin
(For a review see Ref. [47]). This hypothesis treatment (1 ng mL)1) over 15 h increases PAD
encouraged the research of deiminated proteins activity and mRNA level [56]. This increase could
after a calcium-ionophore treatment of cultured also depend on oestrogen as it is not observed in
cells. A 70-kDa nuclear protein and vimentin were the presence of steroid-depleted culture medium.
detected as targets of PADs in these in vitro models Clearly, oestrogen and other hormones – at least
[48, 49]. More recently, the overexpression of progesterone and insulin – regulate the activity of
PAD4 in cultured haematopoietic cell lines has Pad2 and maybe that of the other PAD isotypes.
been shown to induce a cell death programme
involving (i) the increase of p53 and p21, leading
Other molecules involved in cell differentiation
to cell-cycle arrest, (ii) a deregulation of the Bax/
Bcl2 balance, (iii) a large release of cytochrome c Both the transcription of genes encoding PAD and
from mitochondria to cytosol and (iv) the activa- PAD activity have been shown to be modulated by
tion of the apoptosome/caspase cascade [50]. Sur- molecules inducing differentiation of different cell
prisingly, no deiminated protein could be detected types. Moreover, each PADI gene seems to be inde-
in this model. So, the mechanism of PAD action in pendently controlled. In many cultured cells, like
apoptosis should be analysed in detail to be fully haematopoietic cells or keratinocytes, no deiminat-
understood. ed proteins could be detected without treatments
Calcium also seems to play a role in the regula- with vitamin D3, retinoic acid derivatives, or cal-
tion of the expression of PADI genes. When nor- cium-ionophores (as mentioned above). The active
mal human keratinocytes are cultured at low form of vitamin D3 (Vit D), 1, 25-dihydroxyvita-
(0.15 mM) or high (1.2 mM) calcium concentra- min D3, is known to act on the differentiation of
tions, the PADI2 and PADI3 relative mRNA levels keratinocytes, osteoblasts and chondrocytes, and
are weakly but significantly increased (two fold) at to play a major function in the control of calcium
the high calcium concentration, as shown by real and phosphate metabolism. By microarray analy-
time polymerase chain reaction [51, 52]. Sp1 and sis, Vit D treatment (10)7 M) of cultured keratino-
Sp3 bind to the minimal promoter of PADI2 as cis- cytes has been shown to regulate a complex
acting factors. They have been involved in its differentiation network [60]. The expression of 98
basal transcription and the Sp1/Sp3 ratio may genes, among 12 600 analysed, was modified by
constitute a basal mechanism to control PADI2 Vit D; 82 were up-regulated and 16, down-regula-
transcription. The basal- and calcium-induced ted. The major components induced in this net-
activity of the minimal promoter of PADI3 also work involved transcriptional factors (e.g. Klf-4
depends on the ratio of Sp1 and Sp3, and involves and Fos), structural proteins (e.g. involucrin), pro-
the NF-Y transcription factor. teases (several kallikreins), protease inhibitors

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
154 International Journal of Cosmetic Science, 29, 147–168
246
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

(several B-serpins) and post-translational modifica- respectively [64]. In line with these observations,
tion enzymes like PAD1-3 [60]. PAD activity has also been described as positively
In haematopoietic cells, as HL-60 cells, PAD4 influenced by the presence of reducing agents,
expression and activity are detected only when especially dithiothreitol. In general, PAD activity
they are induced to differentiate in granulocytes reaches a plateau at 2–10 mM of DTT depending
by all-trans-retinoic acid (10)6 M) or in mono- on the isotype considered [30, 33, 64]. Three
cytes by Vit D (10)7 M) after 2–5 days of treat- inhibitors of PADs have been identified recently,
ment [10]. Treatment of the cells with a phorbol namely paclitaxel (a taxol derivative), 2-chloroace-
ester (12-O-tetradecanoylphorbol-13-acetate) at tamidine, and fluoro-amidine [65–67]. Paclitaxel
10 ng mL)1 fails to induce this expression. Induc- carries a long chemical side arm similar to a
tion of PAD activity by retinoic acid (0.5 10)6 M) frequently used synthetic arginine derivative sub-
has also been observed in a newborn rat keratino- strate, the a-N-benzoyl-l-arginine-ethyl-ester. The
cyte cell line [61]. direct binding of micellar-tritiated paclitaxel to a
PAD2 and PAD4 are expressed in cells of both purified bovine Pad2 has been demonstrated with
peripheral blood and synovial fluid of rheumatoid an IC50 of 5 mM. The small 2-chloroacetamine
arthritis patients and their expression seems to be has been defined as an irreversible inhibitor of
finely regulated according to the differentiation PAD4 with an IC50 of 3 mM. F-amidine, a com-
state of the cells. PADI2 and PADI4 mRNA were pound similar to the PAD synthetic substrate a-N-
reported to be expressed in monocytes [CD14-pos- benzoyl-l-arginine-amide, appears as the most
itive peripheral blood mononuclear cells (PBMCs)] potent inhibitor of PAD4 with an IC50 of 20 lM
but PADI4 mRNA could not be detected in macr- when pre-incubated with calcium, and an IC50 >
ophages (obtained by a 7-days culture of adherent 200 lM without calcium. These molecules inter-
PBMCs) where PADI2 mRNA was observed [62]. act with the catalytic site of PADs producing irre-
Surprisingly, in that study, PAD4 protein has been versible inhibitions. Particularly, all the
immunodetected not only in monocytes, but also compounds able to covalently modify the SH
in macrophages. In contrast, PAD2 has been group of cysteinyl residues probably inhibit the
immunodetected only in macrophages [62]. enzyme via modification of the highly conserved
Although it was not investigated whether mRNA cysteinyl residue (Cys-645 in PAD4) of the cata-
stability or translation efficiency was affected, a lytic site, which has been proposed to initiate the
luciferase gene reporter approach has shown that citrullination reaction by nucleophilic attack of the
the long 3¢ UTR of the PADI2 mRNA (>2 kb) Cf atom of peptidyl-arginine [40]. Accordingly,
probably plays a role in the regulation of the pro- two potential mechanisms of PAD4 inactivation
tein production [62]. In the same way, PAD2 have been recently proposed, both directly invol-
expression in optic nerve cells seems to be regula- ving the catalytic Cys-645 residue [68].
ted at the translational level [63]. To date, nothing
has been published about PAD6 regulation.
PADs in skin physiology
Altogether, these data show that the regulation
of PADs is highly complex with multilock control
The known substrates of PADs in the epidermis
points at transcriptional, translational and activity
are cytoskeletal proteins and filaggrin, a crucial
levels.
protein for the moisturizing of the stratum cor-
neum
Modulators of PAD activity
During the nineties, three major substrates of
Given the importance of calcium for PAD activity, PADs were identified in mouse, rat, guinea pig or
calcium chelators such as EDTA or EGTA obvi- human epidermis [17, 18, 69, 70]. The presence
ously constitute early recognized PAD inhibitors. of deiminated proteins mainly in the stratum
Other inhibitors of PAD were mentioned long ago. corneum (SC) already suggested a function for
For example, agents that covalently modify cystei- deimination during terminal differentiation of
nyl residues such as monoiodoacetamide and keratinocytes. In a urea/2-mercaptoethanol-
p-chloromercuribenzoate inhibited a rat epidermal soluble-fraction of human epidermis, two deimina-
Pad preparation with a concentration inducing ted proteins have been identified as keratin 1 (K1)
50% of inhibition (IC50) of 100 lM and 1 lM, and keratin 10 (K10) [17, 18, 69, 70]. Later, the

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 155
247
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

arginine of the murine sequence GSSGGGRGGSS of placenta, prostate, spleen, testis and thymus [13].
the V2-subdomain in the non-helicoidal tail of K1 High levels of PAD1 are immunodetected in the
was defined as a deimination site [18]. The third cytoplasm of living keratinocytes – with an
substrate to be identified was filaggrin [17, 69, increasing intensity of staining from the stratum
70]. Filaggrin is a basic protein found in abun- basale to the stratum granulosum – as well as in
dance in the epidermis. It is synthesized by kera- all layers of the SC [13, 28] (Fig. 4a). PAD2, the
tinocytes of the granular layer as a large precursor most ubiquitous PAD according to RT-PCR analy-
(400 kDa in man) called profilaggrin, an essential sis, shows a cytoplasmic labelling in all the living
component of type F keratohyalin granules (KHG). layers of the epidermis with a pericellular staining
During the granular keratinocyte to corneocyte of granular keratinocytes [78]. PAD3, also in the
transition, profilaggrin is proteolysed into filaggrin cytosol, has been detected in the granular layer
units (in man, profilaggrin contains 10–12 filag- and the deeper layers of the SC [78, 28] (Fig. 4b).
grin units). These histidine- and arginine-rich PAD3 mRNA has been detected from prostate,
units associate with the keratin IFs facilitating small intestine, testis, thymus, lung, kidney, pan-
their aggregation and the resulting formation of creas, skin and epidermis [78]. At the mRNA level,
the intracorneocyte fibrous matrix. After its deimi- PAD4 and PAD6 have not been detected in
nation in the stratum compactum, each filaggrin human epidermis. PAD1 and 3 are co-located with
unit is thought to dissociate from the matrix and profilaggrin on KHG (Figs 4c and 5) [28]. Until
to be fully proteolysed to generate free amino-acids now, deiminated proteins have not been immuno-
of the Natural Moisturizing Factor (NMF), a com- detected in human and mouse epidermal KHG,
plex mixture of osmotic agents essential to main- and guinea pig profilaggrin has been shown to
tain 10–15% water in the SC [71] (For review see be devoid of citrulline [79]. This suggests that
Refs [72, 73]). The NMF is composed of glycerol, deimination by PADs is prevented in the granules,
urea, lactate, ions and free amino-acids (52%), of e.g. by a low local concentration of calcium.
which two derivatives have been characterized: Interestingly in this context, profilaggrin and
pyrrolidone carboxylic acid and trans-urocanic other components of the KHG contain active
acid. Pyrrolidone carboxylic acid derived from glu- calcium-binding sites of the EF-hand type in their
tamine is the most hygroscopic amino-acid, and amino-terminus, the function of which is not
trans-urocanic acid derived from histidine contri- known. One may speculate about a possible chela-
butes to photoprotection by partially absorbing tion of calcium by these molecules that in turn
ultraviolet radiation. The amino-acids of NMF are inactivates the PADs. However, perinuclear gran-
nearly all produced from the degradation of filag- ules of buccal mucosa cells and cytoplasmic gran-
grin, their relative proportion being closely related ules of cultured epidermis keratinocytes contain
to the filaggrin composition [71]. Recently, profi- deiminated proteins immunologically and bio-
laggrin variants, with non-sense mutations (e.g. chemically related to profilaggrin [80, 81]. These
R501X, 2282del4) have been defined as very data show that deimination may occur on KHG
strong pre-disposing factors for atopic dermatitis during keratinocyte terminal differentiation
(OMIM # %603165) and causative factors of programs related to but different from epidermis
ichtyosis vulgaris (OMIM # 146700) [74, 75]. differentiation, in particular when keratinocytes
We have demonstrated the capacity of purified are kept in a highly humid environment. PAD1
recombinant PADs to deiminate human filaggrin and 3 are also located in the cytoplasmic matrix of
in vitro with different calcium and pH sensitivities the deeper corneocyte layers (Figs 4c and 5),
according to the isotype of the used enzyme [28]. where deimination of filaggrin takes place. They
These differences could regulate filaggrin deimina- have therefore been proposed to deiminate filag-
tion in vivo as calcium- and pH-gradients are grin in vivo [28]. PAD1 isotype is also the best
known to exist in the SC [76, 77]. candidate for keratin deimination because it is the
only isotype which persists up to the top of the SC
where K1 and K10 are probably modified [28, 82]
PAD1–3 location, expression and function in
(Figs 4a and 5). It is not really known whether fil-
epidermis differentiation
aggrin and keratin deiminations are co-ordinated
At the mRNA level, PAD1 has been shown to be or separate events in the SC, but the latter seems
preferentially expressed in human epidermis, to be delayed. Also the role of keratin deimination

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
156 International Journal of Cosmetic Science, 29, 147–168
248
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

(a) (b)

(c)

Figure 4 Immuno-electron microscopy observations of peptidylarginine deiminase (PAD)1 (a) and PAD3 (b–c) in the
human stratum corneum (SC) and on keratohyalin granules (KHG). (a) Arrows indicate the small gold-particle (5-nm
diameter) labelling of PAD1 from the deeper (C1) to the upper (C6) layer of corneocytes in the SC. (b) PAD3 (gold-parti-
cles 5-nm diameter pointed with arrows) and filaggrin (gold-particles 10-nm diameter) labelling does not persist from
the third layer of corneocytes (C3). (c) Zoom on a KHG showing the presence of PAD3 (gold-particles 5-nm diameter
pointed with arrows) and profilaggrin (gold-particles 10-nm diameter). Bar ¼ 200 nm (a and b) and 100 nm (c).

is not known. We can only suppose that deimina- myoepithelial cells of sweat glands. PAD1 and 3
tion of keratins is involved in modifications of the have been immunodetected in the hair follicles:
corneocyte cytoplasmic matrix, as observed at the PAD1 in the companion layer between the inner
ultrastructural level, as both events are concomit- and outer root sheaths, and in the Huxley layer
ant [28]. and the non-cornified part of the cuticle of the
inner root sheath (IRS); PAD3 in the non-corni-
fied Henle and Huxley layers, and IRS cuticle and
PADs in cutaneous appendages
in the medulla. No PADs have been detected in
We have also analysed PAD1–3 expression and sebaceous glands. Deiminated proteins have been
the presence of deiminated proteins in several only detected in the IRS after cornification
human skin appendages, especially in anagen occurs, first in the Henle layer then in the cuticle
hair follicles (i.e. the growth phase of the follicles) and finally in the Huxley layer, and also in the
[83]. PAD1 and 2 have been immuno-localized in medulla. Trichohyalin, a known PAD substrate,
arrector pili muscles and in secretory and and PAD3 are co-located in the medulla. These

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 157
249
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

Figure 5 Schematic representation of the effects of filaggrin and keratin deimination, and peptidylarginine deiminases
(PAD) localization in the human epidermis. Left panel, PAD1, PAD2 and PAD3, as shown by their respective number,
are located on an ultrastructural schematic view of the epidermis. Right panel, Filaggrin (Fil) is produced in the upper
granular layer from its precursor profilaggrin, a major constituent of the keratohyalin granules (KHG). Profilaggrin,
firstly phosphorylated (p) is then dephosphorylated and proteolysed in a first step at the level of its peptide linkers. The
N-terminal domain of profilaggrin, carrying two EF-hand calcium-binding sites, translocates to the nucleus, and 10–12
filaggrin units (in man) are released. These basic filaggrin units interact with keratin intermediate filaments (KIF).
PAD1 and 3, located in the stratum granulosum and the lower stratum corneum, have been proposed to deiminate fil-
aggrin at multiple sites (Cit). The deimination alters filaggrin charges, modifies filaggrin/KIF interactions and induces fil-
aggrin dissociation from KIF. Then, in the upper SC deiminated filaggrin can be fully proteolysed to produce free amino-
acids of the NMF. In the upper SC also, keratin K1 and K10 are deiminated by PAD1.

data and previous analyses [20, 84] strongly sug- responsible for its unfolding and solubilization
gest that, in the medulla, deimination of the from trichohyalin granules allowing its subse-
highly helicoidal trichohyalin by PAD3 could be quent cross-linking by transglutaminases.

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
158 International Journal of Cosmetic Science, 29, 147–168
250
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

conflict is involved in the self-maintenance of

PADs and deimination in pathology
rheumatoid inflammation [92]. Indeed, the com-
plement- and/or Fc receptor-mediated pro-inflam-
Rheumatoid arthritis and autoimmune response to
matory effects of this conflict lead to fibrinogen
citrullinated proteins
extravasation and to the formation of new fibrin
Rheumatoid arthritis (RA, OMIM #180300) affects deposits in the ST. These fibrin deposits become
0.5–1% of the adult population worldwide. It the substrate of one or more locally expressed
is essentially characterized by chronic inflamma- PAD(s) and constitute new targets for ACPA,
tion of diarthrodial joints often accompanied by hereby maintaining the immunological conflict
systemic manifestations. Immune cells infiltrate and subsequent inflammation. Interestingly, the
the synovial tissue (ST) in which synoviocytes, presence of citrullinated fibronectin has recently
and also capillaries and venules, are hyperplastic. been described in the ST of RA patients [25]. The
As a whole, they constitute the rheumatoid pan- reported co-location of citrullinated fibronectin
nus which erodes subjacent cartilage and bone with citrullinated fibrin deposits suggests that dei-
leading to irreversible articular destruction and mination of these two proteins, known to be able
serious functional disability. Rheumatoid arthritis to associate via covalent factor XIII-catalysed e-c-
aetiology is still unknown but autoimmune glutamyl lysine bonds, occurs concomitantly in
responses are considered as key factors in its the inflamed ST. It would be very interesting to
inflammatory process. This autoimmune character test whether citrullinated fibronectin also consti-
is reflected by the presence of autoantibodies of tutes an antigen target for ACPA, and therefore
diverse specificities in the serum of RA patients. could participate in the harmful immunological
Among these, autoantibodies to citrullinated pro- conflict involving ACPA.
teins (ACPA) are thought to play an important Only fragmentary information is available con-
role in the disease pathophysiology. Indeed, not cerning the isotypes of PADs expressed in the ST
only are ACPA by far the most disease-specific of of RA patients. Two studies report the presence of
the RA-associated autoantibodies, but they also PAD4 in the synovial sublining in small series of
often appear before clinical symptoms and are samples from RA patients [93, 29]. However, in a
linked to the most active and severe forms of RA. more extensive confocal microscopy analysis, the
These autoantibodies, initially described as two same group also reported the presence of PAD4 in
independent autoantibody families, the so-called all areas of the ST, colocalizing with cells exhibit-
‘antikeratin antibodies’ and the antiperinuclear ing positive staining for T-, B-, macrophage-, gra-
factor, have both been shown to recognize epitopes nulocyte-, fibroblast- or endothelial cell-specific
borne by several molecular variants of filaggrin markers [94]. This group also reported the pres-
and thus to constitute a unique family of autoanti- ence of PAD2 in the lining, sublining and deep
bodies [80, 85, 86]. It was subsequently demon- regions of one patient ST sample [29] and similar
strated that protein deimination was indispensable observations were made by another group in more
for antigen recognition by ACPA and several filag- than half of a larger series of 19 ST samples [95].
grin-derived peptides containing citrullyl residues Additionally, Pad2 and Pad4 proteins have been
bearing epitopes recognized by ACPA were identi- explored in animal models of arthritis, showing
fied [87–89]. Additionally, ACPA were shown to the absence of both enzymes in the ST of naı̈ve
be secreted and concentrated in the rheumatoid mice and the presence of only Pad4 in the
synovium [90] and, therein, major antigenic tar- inflamed ST of mice with collagen-induced arthritis
gets were identified that correspond to deiminated or streptococcal cell wall-induced arthritis [96]. No
forms of the a- and b-chains of fibrin [24]. Subse- data have yet been published concerning the other
quently, we characterized the sequential epitopes PAD isotypes in the human RA patient ST.
recognized on fibrin by ACPA and identified citrul- Although the expression of PAD1 and 3 appears
linated peptides bearing major linear epitopes [91]. to be rather confined to epithelial cells, making
The involvement of ACPA in the pathophysiology their absence in the healthy or rheumatoid syno-
of RA is probably through their disease-specific vium probable, such absence still needs to be
immunological conflict with deiminated fibrin, formally assessed because ST inflammation could
which occurs precisely in the disease-targeted tis- lead to induction of their expression. The most
sue. We have proposed that this immunological recently described PAD6 also deserves to be

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 159
251
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

explored as the presence of its corresponding putative RA-associated PADI4 haplotype remains
mRNA in peripheral blood leukocytes suggests to be explored. The association of RA with vari-
expression of the protein by the numerous haema- ants of the other PADI genes, particularly those
topoietic cells infiltrating the rheumatoid ST. It encoding isotypes expressed in the rheumatoid ST,
would be interesting to investigate whether PAD also deserves further testing.
expression in the ST is correlated with the degree
of ST inflammation in both RA and control
Multiple sclerosis and other neurodegenerative dis-
patients with inflammatory and non-inflammatory
eases
rheumatism. Such a correlation can indeed be sus-
pected in view of the fact that deimination of fibrin Multiple sclerosis (MS, OMIM # 126200) is one of
in the ST is observed during a variety of syno- the most common neurodegenerative diseases, des-
vitides [92] and deiminated proteins of still troying the axon-surrounding myelin sheath
unknown identity are detectable in several other formed by oligodendrocytes and Schwann cells,
inflamed non-synovial tissues such as the muscle with a progressive loss of motility sometimes lead-
of patients with polymyositis, the colon of patients ing to the patient’s death. Autoantibodies to mye-
with inflammatory bowel disease or the lung of lin basic protein (MBP), the major protein of the
individuals with interstitial pneumonia [97, 98]. axonal sheath, are detected in the cerebrospinal
How extra-cellular proteins such as fibrin or fibro- fluid of MS patients, but they are associated with
nectin can become PAD substrates whereas PADs various other neurodegenerative diseases and
are intra-cellular enzymes with no secretory signal therefore are not specific for MS (for reviews, see
peptide also remains to be precisely determined Refs [111, 112]). MBP undergoes several post-
though apoptosis and/or necrosis of cells of the translational modifications like phosphorylation,
inflammatory infiltrate have been proposed as methylation and deimination [113]. The extent of
events leading to the release of PADs in the extra- the latter is increased in the brain of MS patients
cellular milieu. and seems to be linked to the severity of the dis-
Given that PADs are involved in the generation ease. In a normal situation, 20% of MBP is deimi-
of the antigenic targets of ACPA in the ST and as nated. This amount is increased to 45% for the
systematic genome analyses (linkage studies) in chronic and even to 90% for the fulminating
French and Japanese populations have revealed a (Marburg’s variant) form of MS [114]. The deimi-
possible RA genetic factor in the region of chromo- nation induces a dramatic conformational change
some 1 encompassing the PAD locus [99–104], of MBP, alters many of its properties, and may be
PADI genes constitute major RA candidate genes involved in the pathogenesis of MS. This has been
not only functionally, but also positionally. The extensively reviewed in a recently published paper
first direct investigation of this hypothesis was [115], so we simply focus on some examples here.
reported in 2003. Single nucleotide polymorphisms In vitro, the slightly deiminated forms of MBP (6
(SNPs) of the genomic region encompassing the Cit/19 Arg, MBP-Cit6) are less degraded than the
PADI1-4 genes were explored in a case–control highly deiminated MBP (18Cit/19 Arg, MBP-
study within the Japanese population, leading to Cit18) by the metalloproteinase Stromelysin-1
the discovery of an association between RA and a [116] and the aspartic endoprotease cathepsin D
PADI4 haplotype [93]. The genetic association was [117, 118], two proteases involved in the genera-
confirmed in a replicate study from Japan [105], tion of MS lesions. MBP is normally associated
in a Korean population [106] and in a Caucasian with the lipids of the myelin membrane and pro-
population from North America [107], but was motes actin polymerization. In vitro, these interac-
not reproduced in Caucasian populations from the tions are disrupted after deimination of MBP or
U.K., France or Spain [108–110]. In the initial using a mutant of MBP carrying substitutions of
study, in vitro results indicated that the presence glutamines instead of citrullines to mimic deimina-
of the PADI4 haplotype could lead to a more stable tion [119–121]. Interestingly, unlike the control
mRNA and the authors suggested that PAD4 ‘MBP C1 component’, the deiminated ‘MBP C8
expression was increased in the ST of RA patients component’ [122], dispensed to Lewis rats by s.c.
leading to enhanced levels of citrullinated proteins boost with complete Freund adjuvant, increased
[93]. Whether a relation exists between the levels the clinical severity of experimental autoimmune
of PAD4 expression in vivo and the presence of the encephalomyelitis [an animal model of MS induced

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
160 International Journal of Cosmetic Science, 29, 147–168
252
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

by immunization of susceptible animals with pep- of Hg). Therefore, deimination could play an
tides or proteins from the central nervous system important role in the onset and/or progression of
(CNS)] [123]. All these data suggest the involve- several neurodegenerative human diseases.
ment of deiminated proteins in the chronicity and
the autoimmunity of the demyelination process
Psoriasis and bullous congenital ichthyosiform
occurring in the human disease. Concerning the
erythroderma
PAD involved in the deimination of MBP, it should
be mentioned that PAD2 is the only one to be Although deiminated proteins are detected in nor-
expressed at a high level in the CNS [78, 115]. mal epidermis, surprisingly little is known about
Therefore, it probably corresponds to the PAD iso- deimination in cutaneous diseases. Psoriasis vul-
type involved in the deimination of MBP in physio- garis (OMIM #177900) is a chronic dermatitis
logical conditions. In pathological situations such that affects around 2% of the population. It is
as MS, other isotypes may be (additionally?) characterized by red, scaly skin lesions that are
involved. Like in RA, PADI genes constitute candi- usually found on the scalp, elbows and knees, and
date genes in MS as suggestive evidence of linkage may be associated with severe arthritis. The aetiol-
for the 1p36 locus of chromosome 1 was obtained ogy of the disease is unknown but hyperprolifera-
in MS patients [124, 125]. Up to now, only one tion and abnormal differentiation of keratinocytes,
report has been published on the direct evaluation and infiltration of inflammatory cells into the der-
of the association of PADI genes with susceptibility mis and epidermis are suspected to play a major
to MS. This family-based study revealed no role in lesion formation. By immunohistochemical
association between variants of the PADI4 gene analysis, a decrease of deiminated proteins, in par-
and MS in a French Caucasian population [126]. ticular K1, has been observed in the hyperprolifer-
Interestingly, experimental autoimmune encephal- ative epidermis of psoriasic lesions comparatively
omyelitis induction is not impaired in Padi2 knock to non-lesional or normal epidermis [82]. In bul-
out mice even if a dramatic reduction of deiminat- lous congenital ichthyosiform erythroderma (BCIE,
ed proteins could be observed in the CNS of these OMIM # 113800) decreased amount of deiminated
mice in comparison with the wild type animals K1 has also been shown [128]. In nearly all
[127]. patients with BCIE, skin lesions appear during the
In addition, GFAP is heavily deiminated in unaf- first year of life and 75% of patients already have
fected white and grey matter from secondary pro- lesions at birth. There is notable early mortality
gressive MS patients, when compared with age- from epidermal erosions and infections. At the
matched patients without known neurological dis- keratinocyte level, a formation of clumps and peri-
eases [21]. GFAP is a major IF protein of astro- nuclear shells because of an abnormal arrange-
cytes, the structural and nutritive cells of the ment of keratin tonofibrils mainly involving K1
nervous system. Recently, the accumulation of dei- and K10 has been previously described [129,
minated GFAP and vimentin has been evidenced 130]. Of course, the abnormal deimination of K1
in hippocampal extracts from patients with Alzhei- in psoriasis and BCIE could be a consequence of
mer’s disease (AD, OMIM # 104300), the most the disease rather than its origin. Nevertheless, it
common form of progressive dementia in the is interesting to note that Vit D induces the expres-
elderly [22]. GFAP, deiminated proteins and PAD2 sion of PADI1-3 mRNA in cultured keratinocytes
have been co-localized in the astrocytes of AD hip- [60], and is currently used as an efficient drug in
pocampus. More recently, by a proteomic psoriasis [131].
approach, PAD2 and protein deimination have
also been implicated in the pathogenesis of human
Cancers
glaucoma (primary open-angle glaucoma, POAG,
OMIM # 137760). PAD2 and deimination appear Immunohistological analysis of cryosections of an
to be more abundant in POAG optic nerves than extramammary Paget’s tumour (OMIM #167300)
in the controls, and MBP has been identified as has shown the expression of a non-epidermal PAD
the major deiminated protein [63]. The authors protein in neoplastic cells [132]. Later, the cDNA
have also observed an induction of deiminated encoding PAD2 was cloned from human cutane-
proteins and PAD2 expression in cultured astro- ous squamous carcinoma cells (HSC-1) and PAD
cytes subjected to an increased pressure (40 mm activity was detected in extracts of HSC-1 cells

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 161
253
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

cultivated for 7 or 10 days [12]. Another more Asahikawa Medical College, Japan where the
recent immunochemical analysis has revealed an immunomicroscopy analysis was performed by
ectopic expression of PAD4 in epithelial cells of R. Nachat. This study was supported by grants
various adenocarcinomas compared with normal from the CNRS, Toulouse III University, INSERM,
tissues with a concomitant increase in deiminated the ‘Association de Recherche sur la Polyarthrite’
proteins [133]. In these cells, PAD4 has appeared (ARP), the ‘Société Française de Dermatologie’
as co-located with the haematopoietic progenitor (SFD), ‘Société de Recherche Dermatologique’ (SRD),
cell marker, CD34, and with keratins K8, K18 and the European Social Fund (ESF), the European
K19. Therefore, PAD4 could be highly expressed Regional Development Fund (ERDF) and the Pierre
in cancer cells. Fabre Research Institute.

Conclusion References

Before 2002, <10 international reports concerning 1. Seet, B.T., Dikic, I., Zhou, M.M. and Pawson, T.
PADs were published yearly. Since 2003, at least Reading protein modifications with interaction
15 articles involving PADs have been edited each domains. Nat. Rev. Mol. Cell. Biol. 7, 473–483
year and more than 45 just in 2005. This recent (2006).
2. Rogers, G., Harding, H.W. and Llewellyn-Smith, I.J.
burst must be linked to the demonstration of the
The origin of citrulline-containing proteins in the
involvement of PADs and deimination in the regu-
hair follicle: characterization, localization, and
lation of gene expression and in human diseases, function in keratinizing tissues. J. Invest. Dermatol.
especially RA. Since the demonstration of the dif- 108, 700–707 (1977).
fentiation-related differential expression of PAD in 3. Chavanas, S., Méchin, M.C., Takahara, H., Kawad-
keratinocytes, and because of the highly probable a, A., Nachat, R., Serre, G. and Simon, M. Compar-
involvement of PAD1 and 3 in the hydration of ative analysis of the mouse and human
the SC through the regulation of NMF production, peptidylarginine deiminase gene clusters reveals
a new field of investigation into PAD function is highly conserved non-coding segments and a new
now emerging. The demonstration that PADs are human gene, PADI6. Gene 330, 19–27 (2004).
clearly necessary for epidermal barrier function 4. Watanabe, K. and Senshu, T. Isolation and charac-
terization of cDNA clones encoding rat skeletal
and homeostasis must definitively increase our
muscle peptidylarginine deiminase. J. Biol. Chem.
interest for these enzymes. The increasing number
264, 15255–15260 (1989).
of molecular tools generated to analyse this 5. Tsuchida, M., Minami, N., Tsujimoto, H.,
enzyme family and the post-translational modifica- Fukazawa, C., Takahara, H. and Sugawara, K.
tion they catalyse has already been and will cer- Molecular cloning of mouse peptidylarginine deimi-
tainly continue to be very helpful not only for nase, and its possible isozyme cDNAs. Agric. Biol.
pathophysiological investigations, but also for the Chem. 55, 295–297 (1991).
design of useful new diagnostic and/or therapeutic 6. Watanabe, K., Nomoto, M., Nagata, S. et al. The
approaches. rat peptidylarginine deiminase-encoding gene:
Post-translational modifications like phosphory- structural analysis and the 5¢-flanking sequence.
lation, methylation, proteolysis and probably dei- Gene 114, 261–265 (1992).
7. Nishijyo, T., Kawada, A., Kanno, T., Shiraiwa, M.
mination are involved into a dynamic balance of
and Takahara, H. Isolation and molecular cloning
the finely regulated cell signalling. One major
of epidermal- and hair follicle-specific peptidylargi-
future goal will be to understand precisely the nine deiminase (type III) from rat. J. Biochem.
regulation of the enzymes, which catalyse these (Tokyo) 121, 868–875 (1997).
modifications during cell differentiation. PADs 8. Ishigami, A., Kuramoto, M., Yamada, M., Watanabe,
clearly belong to the group of post-translational K. and Senshu, T. Molecular cloning of two novel
modification enzymes that are worthy of further types of peptidylarginine deiminase cDNAs from
study. retinoic acid-treated culture of a newborn rat kera-
tinocyte cell line. FEBS Lett. 433, 113–118 (1998).
9. Rus’d, A.A., Ikejiri, Y., Ono, H., Yonekawa, T.,
Acknowledgements Shiraiwa, M., Kawada, A. and Takahara, H.
Molecular cloning of cDNAs of mouse peptidylargi-
The authors would like to thank Pr Akemi Ishida-
nine deiminase type I, type III and type IV, and the
Yamamoto at the Department of Dermatology,

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
162 International Journal of Cosmetic Science, 29, 147–168
254
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

expression pattern of type I in mouse. Eur. J. 21. Nicholas, A.P., Sambandam, T., Echols, J.D. and
Biochem. 259, 660–669 (1999). Tourtellotte, W.W. Increased citrullinated glial
10. Nakashima, K., Hagiwara, T., Ishigami, A. et al. fibrillary acidic protein in secondary progressive
Molecular characterization of peptidylarginine dei- multiple sclerosis. J. Comp. Neurol. 473, 128–136
minase in HL-60 cells induced by retinoic acid and (2004).
1alpha,25-dihydroxyvitamin D(3). J. Biol. Chem. 22. Ishigami, A., Ohsawa, T., Hiratsuka, M. et al.
274, 27786–27792 (1999). Abnormal accumulation of citrullinated proteins
11. Kanno, T., Kawada, A., Yamanouchi, J. et al. catalyzed by peptidylarginine deiminase in hippo-
Human peptidylarginine deiminase type III: campal extracts from patients with Alzheimer’s
molecular cloning and nucleotide sequence of the disease. J. Neurosci. Res. 80, 120–128 (2005).
cDNA, properties of the recombinant enzyme, and 23. Hagiwara, T., Nakashima, K., Hirano, H., Senshu,
immunohistochemical localization in human skin. T. and Yamada, M. Deimination of arginine resi-
J. Invest. Dermatol. 115, 813–823 (2000). dues in nucleophosmin/B23 and histones in HL-60
12. Ishigami, A., Ohsawa, T., Asaga, H., Akiyama, K., granulocytes. Biochem. Biophys. Res. Commun. 290,
Kuramoto, M. and Maruyama, N. Human peptidyl- 979–983 (2002).
arginine deiminase type II: molecular cloning, gene 24. Masson-Bessière, C., Sebbag, M., Girbal-Neuhaus-
organization, and expression in human skin. Arch. er, E., Nogueira, L., Vincent, C., Senshu, T. and
Biochem. Biophys. 407, 25–31 (2002). Serre, G. The major synovial targets of the
13. Guerrin, M., Ishigami, A., Mechin, M.C. et al. cDNA rheumatoid arthritis-specific antifilaggrin autoanti-
cloning, gene organization and expression analysis bodies are deiminated forms of the alpha- and
of human peptidylarginine deiminase type I. Bio- beta-chains of fibrin. J. Immunol. 166, 4177–
chem. J. 370 (Pt 1), 167–174 (2003). 4184 (2001).
14. Gossen, J.A. and van den Boogaart P. Peptidylargi- 25. Chang, X., Yamada, R., Suzuki, A., Kochi, Y.,
nine Deiminase 6. Patent WO02090531 (2002). Sawada, T. and Yamamoto, K. Citrullination of
15. Wright, P.W., Bolling, L.C., Calvert, M.E. et al. fibronectin in rheumatoid arthritis synovial tissue.
ePAD, an oocyte and early embryo-abundant pepti- Rheumatology (Oxford) 44, 1374–1382 (2005).
dylarginine deiminase-like protein that localizes to 26. Nomura, K. Specificity and mode of action of the
egg cytoplasmic sheets. Dev. Biol. 256, 73–88 muscle-type protein-arginine deiminase. Arch. Bio-
(2003). chem. Biophys. 293, 362–369 (1992).
16. Senshu, T., Akiyama, K., Kan, S., Asaga, H., Ishi- 27. Gyorgy, B., Toth, E., Tarcsa, E., Falus, A. and
gami, A. and Manabe, M. Detection of deiminated Buzas, E.I. Citrullination: a posttranslational modifi-
proteins in rat skin: probing with a monospecific cation in health and disease. Int. J. Biochem. Cell
antibody after modification of citrulline residues. Biol. 38, 1662–1677 (2006).
J. Invest. Dermatol. 105, 163–169 (1995). 28. Méchin, M.C., Enji, M., Nachat, R. et al. The pepti-
17. Senshu, T., Kan, S., Ogawa, H., Manabe, M. and dylarginine deiminases expressed in human epider-
Asaga, H. Preferential deimination of keratin K1 mis differ in their substrate specificities and
and filaggrin during the terminal differentiation of subcellular locations. Cell. Mol. Life Sci. 62, 1984–
human epidermis. Biochem. Biophys. Res. Commun. 1995 (2005).
225, 712–719 (1996). 29. Nakayama-Hamada, M., Suzuki, A., Kubota, K. et
18. Senshu, T., Akiyama, K. and Nomura, K. Identifica- al. Comparison of enzymatic properties between
tion of citrulline residues in the V subdomains of hPADI2 and hPADI4. Biochem. Biophys. Res. Com-
keratin K1 derived from the cornified layer of new- mun. 327, 192–200 (2005).
born mouse epidermis. Exp. Dermatol. 8, 392–401 30. Takahara, H., Oikawa, Y. and Sugawara, K. Purifi-
(1999). cation and characterization of peptidylarginine dei-
19. Tarcsa, E., Marekov, L.N., Mei, G., Melino, G., Lee, minase from rabbit skeletal muscle. J. Biochem.
S.C. and Steinert, P.M. Protein unfolding by pepti- (Tokyo) 94, 1945–1953 (1983).
dylarginine deiminase. Substrate specificity and 31. Watanabe, K., Akiyama, K., Hikichi, K., Ohtsuka,
structural relationships of the natural substrates R., Okuyama, A. and Senshu, T. Combined bio-
trichohyalin and filaggrin. J. Biol. Chem. 271, chemical and immunochemical comparison of pep-
30709–30716 (1996). tidylarginine deiminases present in various tissues.
20. Tarcsa, E., Marekov, L.N., Andreoli, J., Idler, W.W., Biochim. Biophys. Acta 966, 375–383 (1988).
Candi, E., Chung, S.I. and Steinert, P.M. The fate of 32. Takahara, H., Tsuchida, M., Kusubata, M., Akutsu,
trichohyalin. Sequential post-translational modifica- K., Tagami, S. and Sugawara, K. Peptidylarginine
tions by peptidyl-arginine deiminase and trans- deiminase of the mouse. Distribution, properties,
glutaminases. J. Biol. Chem. 272, 27893–27901 and immunocytochemical localization. J. Biol.
(1997). Chem. 264, 13361–13368 (1989).

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 163
255
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

33. Terakawa, H., Takahara, H. and Sugawara, K. 47. Saris, N.E. and Carafoli, E. A historical review of
Three types of mouse peptidylarginine deiminase: cellular calcium handling, with emphasis on mito-
characterization and tissue distribution. J. Biochem. chondria. Biochemistry (Mosc) 70, 187–194
(Tokyo) 110, 661–666 (1991). (2005).
34. Nakashima, K., Hagiwara, T. and Yamada, M. 48. Asaga, H., Yamada, M. and Senshu, T. Selective
Nuclear localization of peptidylarginine deiminase deimination of vimentin in calcium ionophore-
V and histone deimination in granulocytes. J. Biol. induced apoptosis of mouse peritoneal macrophag-
Chem. 277, 49562–49568 (2002). es. Biochem. Biophys. Res. Commun. 243, 641–646
35. Cuthbert, G.L., Daujat, S., Snowden, A.W. et al. (1998).
Histone deimination antagonizes arginine methyla- 49. Mizoguchi, M., Manabe, M., Kawamura, Y. et al.
tion. Cell 118, 545–553 (2004). Deimination of 70-kD nuclear protein during
36. Wang, Y., Wysocka, J., Sayegh, J. et al. Human epidermal apoptotic events in vitro. J. Histochem.
PAD4 regulates histone arginine methylation levels Cytochem. 46, 1303–1309 (1998).
via demethylimination. Science 306, 279–283 50. Liu, G.Y., Liao, Y.F., Chang, W.H. et al. Overexpres-
(2004). sion of peptidylarginine deiminase IV features in
37. Sarmento, O.F., Digilio, L.C., Wang, Y., Perlin, J., apoptosis of haematopoietic cells. Apoptosis 11,
Herr, J.C., Allis, C.D. and Coonrod, S.A. Dynamic 183–196 (2006).
alterations of specific histone modifications during 51. Dong, S., Kojima, T., Shiraiwa, M. et al. Regulation
early murine development. J. Cell. Sci. 117 (Pt 19), of the expression of peptidylarginine deiminase type
4449–4459 (2004). II gene (PADI2) in human keratinocytes involves
38. Zhang, Y. Molecular biology: no exception to Sp1 and Sp3 transcription factors. J. Invest. Derma-
reversibility. Nature 431, 637–639 (2004). tol. 124, 1026–1033 (2005).
39. Hagiwara, T., Hidaka, Y. and Yamada, M. Deimi- 52. Dong, S., Kanno, T., Yamaki, A. et al. NF-Y and
nation of histone H2A and H4 at arginine 3 in Sp1/Sp3 are involved in the transcriptional regula-
HL-60 granulocytes. Biochemistry 44, 5827–5834 tion of the peptidylarginine deiminase type III gene
(2005). (PADI3) in human keratinocytes. Biochem. J. 397,
40. Arita, K., Hashimoto, H., Shimizu, T., Nakashima, 449–459 (2006).
K., Yamada, M. and Sato, M. Structural basis for 53. Senshu, T., Akiyama, K., Nagata, S., Watanabe, K.
Ca(2+)-induced activation of human PAD4. Nat. and Hikichi, K. Peptidylarginine deiminase in rat
Struct. Mol. Biol. 11, 777–783 (2004). pituitary: sex difference, estrous cycle-related chan-
41. Arita, K., Shimizu, T., Hashimoto, H., Hidaka, Y., ges, and estrogen dependence. Endocrinology 124,
Yamada, M. and Sato, M. Structural basis for his- 2666–2670 (1989).
tone N-terminal recognition by human peptidyl- 54. Watanabe, K., Hikichi, K., Nagata, S. and Senshu,
arginine deiminase 4. Proc. Natl Acad. Sci. U.S.A. T. Estrous cycle dependent regulation of peptidyl-
103, 5291–5296 (2006). arginine deiminase transcripts in female rat pituit-
42. Corpet, F. Multiple sequence alignment with hierar- ary. Biochem. Biophys. Res. Commun. 172, 28–34
chical clustering. Nucleic. Acids Res. 16, 10881– (1990).
10890 (1988). 55. Nagata, S., Yamagiwa, M., Inoue, K. and Senshu,
43. Balandraud, N., Gouret, P., Danchin, E.G., Blanc, T. Estrogen regulates peptidylarginine deiminase
M., Zinn, D., Roudier, J. and Pontarotti, P. A rigor- levels in a rat pituitary cell line in culture. J. Cell.
ous method for multigenic families’ functional Physiol. 145, 333–339 (1990).
annotation: the peptidyl arginine deiminase (PADs) 56. Nagata, S., Uehara, T., Inoue, K. and Senshu, T.
proteins family example. BMC Genomics 6, 153 Increased peptidylarginine deiminase expression
(2005). during induction of prolactin biosynthesis in a
44. Douguet, D. and Labesse, G. Easier threading growth-hormone-producing rat pituitary cell line,
through web-based comparisons and cross-valida- MtT/S. J. Cell. Physiol. 150, 426–432 (1992).
tions. Bioinformatics 17, 752–753 (2001). 57. Takahara, H., Kusubata, M., Tsuchida, M., Kohs-
45. Zhang, J., Dai, J., Zhao, E. et al. cDNA cloning, aka, T., Tagami, S. and Sugawara, K. Expression of
gene organization and expression analysis of peptidylarginine deiminase in the uterine epithelial
human peptidylarginine deiminase type VI. Acta cells of mouse is dependent on estrogen. J. Biol.
Biochim. Pol. 51, 1051–1058 (2004). Chem. 267, 520–525 (1992).
46. Liu, M., Oh, A., Calarco, P., Yamada, M., Coonrod, 58. Akiyama, K., Nagata, S., Watanabe, K., Watanabe,
S.A. and Talbot, P. Peptidylarginine deiminase G., Taya, K., Sasamoto, S. and Senshu, T. Age-rela-
(PAD) is a mouse cortical granule protein that ted increase in peptidylarginine deiminase in the
plays a role in preimplantation embryonic develop- male rat pituitary. Mech. Ageing Dev. 81, 119–129
ment. Reprod. Biol. Endocrinol. 3, 42 (2005). (1995).

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
164 International Journal of Cosmetic Science, 29, 147–168
256
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

59. Arai, T., Kusubata, M., Kohsaka, T., Shiraiwa, M., partial sequence of mouse keratin K1. J. Dermatol.
Sugawara, K. and Takahara, H. Mouse uterus pep- Sci. 21, 113–126 (1999).
tidylarginine deiminase is expressed in decidual 71. Scott, I.R., Harding, C.R. and Barrett, J.G. Histidine-
cells during pregnancy. J. Cell. Biochem. 58, 269– rich protein of the keratohyalin granules. Source of
278 (1995). the free amino acids, urocanic acid and pyrrolidone
60. Lu, J., Goldstein, K.M., Chen, P., Huang, S., Gelbert, carboxylic acid in the stratum corneum. Biochim.
L.M. and Nagpal, S. Transcriptional profiling of ker- Biophys. Acta 719, 110–117 (1982).
atinocytes reveals a vitamin D-regulated epidermal 72. Rawlings, A.V. Trends in stratum corneum
differentiation network. J. Invest. Dermatol. 124, research and the management of dry skin condi-
778–785 (2005). tions. Int. J. Cosmet. Sci. 25, 63–95 (2003).
61. Ishigami, A., Ohsawa, T., Watanabe, K. and 73. Rawlings, A.V. and Harding, C.R. Moisturization
Senshu, T. All-trans retinoic acid increases peptidyl- and skin barrier function. Dermatol. Ther. 17
arginine deiminases in a newborn rat keratinocyte (Suppl. 1), 43–48 (2004).
cell line. Biochem. Biophys. Res. Commun. 223, 74. Palmer, C.N., Irvine, A.D., Terron-Kwiatkowski, A.
299–303 (1996). et al. Common loss-of-function variants of the epi-
62. Vossenaar, E.R., Radstake, T.R., van der Heijden, dermal barrier protein filaggrin are a major predis-
A. et al. Expression and activity of citrullinating posing factor for atopic dermatitis. Nat. Genet. 38,
peptidylarginine deiminase enzymes in monocytes 441–446 (2006).
and macrophages. Ann. Rheum. Dis. 63, 373–381 75. Smith, F.J., Irvine, A.D., Terron-Kwiatkowski, A.
(2004). et al. Loss-of-function mutations in the gene enco-
63. Bhattacharya, S.K., Crabb, J.S., Bonilha, V.L., Gu, ding filaggrin cause ichthyosis vulgaris. Nat. Genet.
X., Takahara, H. and Crabb, J.W. Proteomics impli- 38, 337–342 (2006).
cates peptidyl arginine deiminase 2 and optic nerve 76. Bikle, D.D., Oda, Y. and Xie, Z. Calcium and
citrullination in glaucoma pathogenesis. Invest. 1,25(OH)(2)D: interacting drivers of epidermal dif-
Ophthalmol. Vis. Sci. 47, 2508–2514 (2006). ferentiation. J. Steroid Biochem. Mol. Biol. 89–90,
64. Fujisaki, M. and Sugawara, K. Properties of pepti- 355–360 (2004).
dylarginine deiminase from the epidermis of new- 77. Matousek, J.L. and Campbell, K.L. A comparative
born rats. J. Biochem. (Tokyo) 89, 257–263 (1981). review of cutaneous pH. Vet. Dermatol. 13, 293–
65. Pritzker, L.B. and Moscarello, M.A. A novel micro- 300 (2002).
tubule independent effect of paclitaxel: the inhibi- 78. Nachat, R., Méchin, M.C., Takahara, H., Chavanas,
tion of peptidylarginine deiminase from bovine S., Charveron, M., Serre, G. and Simon, M. Peptidy-
brain. Biochim. Biophys. Acta 1388, 154–160 larginine deiminase isoforms 1–3 are expressed in
(1998). the epidermis and involved in the deimination of
66. Stone, E.M., Schaller, T.H., Bianchi, H., Person, K1 and filaggrin. J. Invest. Dermatol. 124, 384–393
M.D. and Fast, W. Inactivation of two diverse (2005).
enzymes in the amidinotransferase superfamily by 79. Harding, C.R. and Scott, I.R. Histidine-rich proteins
2-chloroacetamidine: dimethylargininase and pepti- (filaggrins): structural and functional heterogeneity
dylarginine deiminase. Biochemistry 44, 13744– during epidermal differentiation. J. Mol. Biol. 170,
13752 (2005). 651–673 (1983).
67. Luo, Y., Knuckley, B., Lee, Y.H., Stallcup, M.R. and 80. Sebbag, M., Simon, M., Vincent, C., Masson-Bes-
Thompson, P.R. A fluoroacetamidine-based inacti- siere, C., Girbal, E., Durieux, J.J. and Serre, G. The
vator of protein arginine deiminase 4: design, syn- antiperinuclear factor and the so-called antikeratin
thesis, and in vitro and in vivo evaluation. J. Am. antibodies are the same rheumatoid arthritis-speci-
Chem. Soc. 128, 1092–1093 (2006). fic autoantibodies. J. Clin. Invest. 95, 2672–2679
68. Luo, Y., Arita, K., Bhatia, M. et al. Inhibitors and (1995).
inactivators of protein arginine deiminase 4: func- 81. Girbal-Neuhauser, E., Montézin, M., Croute, F. et al.
tional and structural characterization. Biochemistry Normal human epidermal keratinocytes express in
45, 11727–11736 (2006). vitro specific molecular forms of (pro)filaggrin
69. Kan, S., Asaga, H. and Senshu, T. Detection of recognized by rheumatoid arthritis-associated antifi-
several families of deiminated proteins derived from laggrin autoantibodies. Mol. Med. 3, 145–156
filaggrin and keratins in guinea pig skin. Zool. Sci. (1997).
13, 673–678 (1996). 82. Ishida-Yamamoto, A., Senshu, T., Takahashi, H.,
70. Senshu, T., Akiyama, K., Ishigami, A. and Nom- Akiyama, K., Nomura, K. and Iizuka, H. Decreased
ura, K. Studies on specificity of peptidylarginine deiminated keratin K1 in psoriatic hyperprolifera-
deiminase reactions using an immunochemical tive epidermis. J. Invest. Dermatol. 114, 701–705
probe that recognizes an enzymatically deiminated (2000).

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 165
257
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

83. Nachat, R., Méchin, M.C., Charveron, M., Serre, G., enzyme peptidylarginine deiminase 4, are associ-
Constans, J. and Simon, M. Peptidylarginine deimi- ated with rheumatoid arthritis. Nat. Genet. 34,
nase isoforms are differentially expressed in the 395–402 (2003).
anagen hair follicles and other human skin append- 94. Chang, X., Yamada, R., Suzuki, A., Sawada, T.,
ages. J. Invest. Dermatol. 125, 34–41 (2005). Yoshino, S., Tokuhiro, S. and Yamamoto, K.
84. Rogers, G., Winter, B., McLaughlan, C., Powell, B. (PADI4) and citrullinated protein in synovial tissue
and Nesci, T. Peptidylarginine deiminase of the hair of rheumatoid arthritis. Rheumatology (Oxford) 44,
follicle: characterization, localization, and function 40–50 (2005).
in keratinizing tissues. J. Invest. Dermatol. 108, 95. De Rycke, L., Nicholas, A.P., Cantaert, T. et al. Syn-
700–707 (1997). ovial intracellular citrullinated proteins colocalizing
85. Girbal, E., Sebbag, M., Gomes-Daudrix, V., Simon, with peptidyl arginine deiminase as pathophysio-
M., Vincent, C. and Serre, G. Characterisation of logically relevant antigenic determinants of rheu-
the rat oesophagus epithelium antigens defined by matoid arthritis-specific humoral autoimmunity.
the so-called ‘antikeratin antibodies’, specific for Arthritis Rheum. 52, 2323–2330 (2005).
rheumatoid arthritis. Ann. Rheum. Dis. 52, 749– 96. Vossenaar, E.R., Nijenhuis, S., Helsen, M.M. et al.
757 (1993). Citrullination of synovial proteins in murine models
86. Simon, M., Girbal, E., Sebbag, M., Gomes-Daudrix, of rheumatoid arthritis. Arthritis Rheum. 48, 2489–
V., Vincent, C., Salama, G. and Serre, G. The cyto- 2500 (2003).
keratin filament-aggregating protein filaggrin is the 97. Bongartz, T., Cantaert, T., Atkins, S.R. et al. Citrul-
target of the so-called ‘‘antikeratin antibodies,’’ lination in extra-articular manifestations of rheu-
autoantibodies specific for rheumatoid arthritis. matoid arthritis. Rheumatology (Oxford) 46, 70–75
J. Clin. Invest. 92, 1387–1393 (1993). (2007).
87. Schellekens, G.A., de Jong, B.A., van den Hoogen, 98. Makrygiannakis, D., af Klint, E., Lundberg, I.E.,
F.H., van de Putte, L.B. and van Venrooij, W.J. Lofberg, R., Ulfgren, A.K., Klareskog, L. and Cat-
Citrulline is an essential constituent of antigenic rina, A.I. Citrullination is an inflammation-
determinants recognized by rheumatoid arthritis- dependent process. Ann. Rheum. Dis. 65, 1219–
specific autoantibodies. J. Clin. Invest. 101, 273– 1222 (2006).
281 (1998). 99. Cornelis, F., Faure, S., Martinez, M. et al. New sus-
88. Girbal-Neuhauser, E., Durieux, J.J., Arnaud, M. ceptibility locus for rheumatoid arthritis suggested
et al. The epitopes targeted by the rheumatoid arth- by a genome-wide linkage study. Proc. Natl Acad.
ritis-associated antifilaggrin autoantibodies are Sci. U.S.A. 95, 10746–10750 (1998).
posttranslationally generated on various sites of 100. Shiozawa, S., Hayashi, S., Tsukamoto, Y. et al.
(pro)filaggrin by deimination of arginine residues. Identification of the gene loci that predispose to
J. Immunol. 162, 585–594 (1999). rheumatoid arthritis. Int. Immunol. 10, 1891–1895
89. Union, A., Meheus, L., Humbel, R.L. et al. Identifi- (1998).
cation of citrullinated rheumatoid arthritis-specific 101. Jawaheer, D., Seldin, M.F., Amos, C.I. et al. A ge-
epitopes in natural filaggrin relevant for antifilag- nomewide screen in multiplex rheumatoid arthritis
grin autoantibody detection by line immunoassay. families suggests genetic overlap with other auto-
Arthritis Rheum. 46, 1185–1195 (2002). immune diseases. Am. J. Hum. Genet. 68, 927–936
90. Masson-Bessiere, C., Sebbag, M., Durieux, J.J. et al. (2001).
In the rheumatoid pannus, anti-filaggrin autoanti- 102. MacKay, K., Eyre, S., Myerscough, A. et al. Whole-
bodies are produced by local plasma cells and con- genome linkage analysis of rheumatoid arthritis
stitute a higher proportion of IgG than in synovial susceptibility loci in 252 affected sibling pairs in
fluid and serum. Clin. Exp. Immunol. 119, 544– the United Kingdom. Arthritis Rheum. 46, 632–639
552 (2000). (2002).
91. Sebbag, M., Moinard, N., Auger, I. et al. Epitopes of 103. Jawaheer, D., Seldin, M.F., Amos, C.I. et al. Screen-
human fibrin recognized by the rheumatoid arthri- ing the genome for rheumatoid arthritis susceptibil-
tis-specific autoantibodies to citrullinated proteins. ity genes: a replication study and combined
Eur. J. Immunol. 36, 2250–2263 (2006). analysis of 512 multicase families. Arthritis Rheum.
92. Chapuy-Regaud, S., Sebbag, M., Baeten, D., Clavel, 48, 906–916 (2003).
C., Foulquier, C., De Keyser, F. and Serre, G. Fibrin 104. Osorio, Y.F.J., Bukulmez, H., Petit-Teixeira, E. et al.
deimination in synovial tissue is not specific for Dense genome-wide linkage analysis of rheumatoid
rheumatoid arthritis but commonly occurs during arthritis, including covariates. Arthritis Rheum. 50,
synovitides. J. Immunol. 174, 5057–5064 (2005). 2757–2765 (2004).
93. Suzuki, A., Yamada, R., Chang, X. et al. Functional 105. Ikari, K., Kuwahara, M., Nakamura, T. et al.
haplotypes of PADI4, encoding citrullinating Association between PADI4 and rheumatoid

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
166 International Journal of Cosmetic Science, 29, 147–168
258
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

arthritis: a replication study. Arthritis Rheum. 52, 117. Cao, L., Goodin, R., Wood, D., Moscarello, M.A.
3054–3057 (2005). and Whitaker, J.N. Rapid release and unusual
106. Kang, C.P., Lee, H.S., Ju, H., Cho, H., Kang, C. and stability of immunodominant peptide 45–89 from
Bae, S.C. A functional haplotype of the PADI4 gene citrullinated myelin basic protein. Biochemistry 38,
associated with increased rheumatoid arthritis sus- 6157–6163 (1999).
ceptibility in Koreans. Arthritis Rheum. 54, 90–96 118. Pritzker, L.B., Joshi, S., Gowan, J.J., Harauz, G. and
(2006). Moscarello, M.A. Deimination of myelin basic pro-
107. Plenge, R.M., Padyukov, L., Remmers, E.F. et al. tein. 1. Effect of deimination of arginyl residues of
Replication of putative candidate-gene associations myelin basic protein on its structure and suscepti-
with rheumatoid arthritis in >4,000 samples from bility to digestion by cathepsin D. Biochemistry 39,
North America and Sweden: association of suscepti- 5374–5381 (2000).
bility with PTPN22, CTLA4, and PADI4. Am. J. 119. Boggs, J.M., Yip, P.M., Rangaraj, G. and Jo, E.
Hum. Genet. 77, 1044–1060 (2005). Effect of posttranslational modifications to myelin
108. Barton, A., Bowes, J., Eyre, S., Spreckley, K., Hinks, basic protein on its ability to aggregate acidic lipid
A., John, S. and Worthington, J. A functional hapl- vesicles. Biochemistry 36, 5065–5071 (1997).
otype of the PADI4 gene associated with rheuma- 120. Boggs, J.M., Rangaraj, G., Koshy, K.M., Ackerley,
toid arthritis in a Japanese population is not C., Wood, D.D. and Moscarello, M.A. Highly deimi-
associated in a United Kingdom population. Arthri- nated isoform of myelin basic protein from multiple
tis Rheum. 50, 1117–1121 (2004). sclerosis brain causes fragmentation of lipid vesi-
109. Caponi, L., Petit-Teixeira, E., Sebbag, M. et al. A cles. J. Neurosci. Res. 57, 529–535 (1999).
family based study shows no association between 121. Boggs, J.M., Rangaraj, G., Hill, C.M., Bates, I.R.,
rheumatoid arthritis and the PADI4 gene in a Heng, Y.M. and Harauz, G. Effect of arginine loss in
white French population. Ann. Rheum. Dis. 64, myelin basic protein, as occurs in its deiminated
587–593 (2005). charge isoform, on mediation of actin polymeriza-
110. Martinez, A., Valdivia, A., Pascual-Salcedo, D. et al. tion and actin binding to a lipid membrane
PADI4 polymorphisms are not associated with in vitro. Biochemistry 44, 3524–3534 (2005).
rheumatoid arthritis in the Spanish population. 122. Boulias, C., Pang, H., Mastronardi, F. and Mosca-
Rheumatology (Oxford) 44, 1263–1266 (2005). rello, M.A. The isolation and characterization of
111. Moscarello, M.A., Pritzker, L., Mastronardi, F.G. four myelin basic proteins from the unbound frac-
and Wood, D.D. Peptidylarginine deiminase: a can- tion during CM52 chromatography. Arch. Biochem.
didate factor in demyelinating disease. J. Neuro- Biophys. 322, 174–182 (1995).
chem. 81, 335–343 (2002). 123. Cao, L., Sun, D. and Whitaker, J.N. Citrullinated
112. Kim, J.K., Mastronardi, F.G., Wood, D.D., Lubman, myelin basic protein induces experimental auto-
D.M., Zand, R. and Moscarello, M.A. Multiple scler- immune encephalomyelitis in Lewis rats through a
osis: an important role for post-translational modifi- diverse T cell repertoire. J. Neuroimmunol. 88, 21–
cations of myelin basic protein in pathogenesis. 29 (1998).
Mol. Cell. Proteomics 2, 453–462 (2003). 124. Dyment, D.A., Sadovnick, A.D., Willer, C.J. et al.
113. Pritzker, L.B., Joshi, S., Harauz, G. and Moscarello, An extended genome scan in 442 Canadian mul-
M.A. Deimination of myelin basic protein. 2. Effect tiple sclerosis-affected sibships: a report from the
of methylation of MBP on its deimination by pepti- Canadian Collaborative Study Group. Hum. Mol.
dylarginine deiminase. Biochemistry 39, 5382– Genet. 13, 1005–1015 (2004).
5388 (2000). 125. Kenealy, S.J., Babron, M.C., Bradford, Y. et al. A
114. Wood, D.D., Bilbao, J.M., O’Connors, P. and second-generation genomic screen for multiple
Moscarello, M.A. Acute multiple sclerosis sclerosis. Am. J. Hum. Genet. 75, 1070–1078
(Marburg type) is associated with developmentally (2004).
immature myelin basic protein. Ann. Neurol. 40, 126. Tommasi, C., Petit-Teixeira, E., Cournu-Rebeix, I. et
18–24 (1996). al. PADI4 gene in multiple sclerosis: a family-based
115. Harauz, G. and Musse, A.A. A tale of two citrul- association study. J. Neuroimmunol. 177, 142–145
lines-structural and functional aspects of myelin (2006).
basic protein deimination in health and disease. 127. Raijmakers, R., Vogelzangs, J., Raats, J. et al.
Neurochem. Res. 32, 137–158 (2007). Experimental autoimmune encephalomyelitis induc-
116. D’Souza, C.A. and Moscarello, M.A. Differences in tion in peptidylarginine deiminase 2 knockout
susceptibility of MBP charge isomers to digestion by mice. J. Comp. Neurol. 498, 217–226 (2006).
stromelysin-1 (MMP-3) and release of an immuno- 128. Ishida-Yamamoto, A., Senshu, T., Eady, R.A.,
dominant epitope. Neurochem. Res. 31, 1045–1054 Takahashi, H., Shimizu, H., Akiyama, M. and
(2006). Iizuka, H. Sequential reorganization of cornified cell

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
International Journal of Cosmetic Science, 29, 147–168 167
259
Update on peptidylarginine deiminases and deimination M.-C. Méchin et al.

keratin filaments involving filaggrin-mediated 131. Holick, M. Clinical use of topical and oral calcitriol
compaction and keratin 1 deimination. J. Invest. or treating psoriasis. In: Vitamin D in dermatology
Dermatol. 118, 282–287 (2002). (Kragballe K. ed), pp. 259–269. Marcel Dekker,
129. Ishida-Yamamoto, A., McGrath, J.A., Judge, M.R., New York, NY (2000).
Leigh, I.M., Lane, E.B. and Eady, R.A. Selective 132. Urano, Y., Watanabe, K., Sakaki, A. et al. Immuno-
involvement of keratins K1 and K10 in the cyto- histochemical demonstration of peptidylarginine
skeletal abnormality of epidermolytic hyperkeratosis deiminase in human sweat glands. Am. J. Dermato-
(bullous congenital ichthyosiform erythroderma). pathol. 12, 249–255 (1990).
J. Invest. Dermatol. 99, 19–26 (1992). 133. Chang, X. and Han, J. (PAD4) in various tumors.
130. Fuchs, E. and Keith, R. Porter Lecture, 1996. Of Mol. Carcinog. 4, 183–196 (2006).
mice and men: genetic disorders of the cytoskele-
ton. Mol. Biol. Cell. 8, 189–203 (1997).

ª 2007 The Authors. Journal compilation

ª 2007 Society of Cosmetic Scientists and the Société Française de Cosmétologie
168 International Journal of Cosmetic Science, 29, 147–168
260
Journal of Dermatological Science (2006) 44, 63—72

[Link]/journals/jods

INVITED REVIEW ARTICLE

Peptidylarginine deiminases and deimination

in biology and pathology: Relevance to
skin homeostasis
Stéphane Chavanas, Marie-Claire Méchin, Rachida Nachat,
Véronique Adoue, Fanny Coudane, Guy Serre, Michel Simon *

UMR 5165, CNRS-University Toulouse III, Faculty of Medicine Purpan, 37 allées J. Guesde,
31073 Toulouse, France

Received 4 July 2006; accepted 12 July 2006

KEYWORDS Summary Deimination corresponds to the transformation of arginine residues

Citrulline; within a peptide sequence into citrulline residues. Catalyzed by peptidylarginine
Deimination; deiminases, it decreases the net positive charge of proteins, alters intra and
Epidermis; intermolecular ionic interactions and probably the folding of target proteins.
Filaggrin; Deimination has recently been implicated in several physiological and pathological
Hair follicles; processes. Here, we describe the enzymes involved in this post-translational mod-
Hydration; ification, focusing on their expression, location and roles in skin, as well as their
Peptidylarginine known protein substrates in the epidermis and hair follicles. We discuss also
deiminases; the potential involvement of deimination in human diseases including cutaneous
Post-translational disorders.
modifications; # 2006 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland
Skin Ltd. All rights reserved.

Contents

1. Deimination and peptidylarginine deiminases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

1.1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64
1.2. PAD4 crystal structure at a resolution of 2.3 Å . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
1.3. Deimination and gene expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
1.4. Deimination and apoptosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
2. Deimination in non cutaneous diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
2.1. Nervous system disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
2.2. Rheumatoid arthritis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
2.3. Experimental obstructive nephropathy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
2.4. Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66

* Corresponding author. Tel.: +33 5 6114 5948.

E-mail address: msimon@[Link] (M. Simon).

0923-1811/$30.00 # 2006 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/[Link].2006.07.004

261
64 S. Chavanas et al.

3. Expression, location and roles of PADs in skin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66

3.1. Epidermis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
3.2. Skin appendages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
3.3. Deimination and skin moisturizing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
4. Deimination and cutaneous diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
5. Conclusions and perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
Acknowledgements. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

1. Deimination and peptidylarginine follicle protein. Further works demonstrated that

deiminases deimination is catalyzed by a family of enzymes, the
peptidylarginine deiminases (PADs) (EC [Link]).
1.1. Introduction Five paralogous genes encode the 5 human PAD
isoforms, PADI1, 2, 3, 4 and 6. The genes PADI are
Deimination or citrullination is one of the most clustered on chromosome 1p35-36, a region con-
recently described post-translational modifications. served with synteny on the mouse chromosome 4E1
It corresponds to the transformation of arginine (Fig. 2). The coding sequences of these 5 genes
residues within a peptide sequence into citrulline display 59—71% nucleotide identity and 45—55%
residues (Fig. 1a). Although deimination has been aminoacid identity. Available genome data reveal
detected in most mammalian tissues and organs, the the existence of the five PADs in mammals, of three
targets of this post-translational modification and PADs in birds (Gallus gallus), and one in amphibians
its physiological role remain to be fully identified. (Xenopus laevis) and fish (Danio rerio, Takifugu
Deimination decreases the net positive charge of rubripes and Tetraodon nigroviridis). The gene
proteins, alters intra and intermolecular ionic inter- PADI2 first diverged from the common ancestor,
actions and probably the folding of target proteins has been submitted to high negative selective pres-
[1,2]. sure, and has probably retained the ancestral bio-
In their pioneering study in 1977, Rogers and chemical function [3]. The PADI genes may have
Taylor described for the first time a calcium-depen- been fixed through specialization of expression in
dent enzyme involved in the deimination of a hair tissues, or neofunctionalization through different
biochemical requirements [3,4]. Not only the
expression of the genes PADI is regulated at the
transcriptional level (as that of PADI2 [5,6], or PADI3
[7]), but also at the post-transcriptional (PADI4 [8])
and translational (PADI2 [6]) levels. PADI2 is
expressed in a wide array of tissues; PADI1, mainly
in epidermis, prostate, testis, placenta, spleen and
thymus; PADI3, in epidermis and hair follicles; and
PADI4, in the haematological system [9—12]. PADI6 is
expressed essentially in oocytes/ovary and testis,
and during embryonic development [3,4].

Fig. 1 Representation of the transformation of an argi- Fig. 2 The locus of the genes encoding human PADs. The
nine (a-left) and a methyl-arginine residue (b-left) into a locus of the five PADI genes is located in position p35-36 on
citrulline residue (a- and b-right). These conversions are chromosome 1. Transcription direction is indicated by an
catalyzed in the presence of calcium (Ca2+) by a peptidy- open arrow. Genomic distances are indicated in kilobases
larginine deiminase (PAD) including PAD4. (kb).

262
Peptidylarginine deiminases and deimination in biology and pathology 65

1.2. PAD4 crystal structure at a resolution granulocyte line [20,21], is likely to alter the struc-
of 2.3 Å ture of chromatin and DNA sensitivity to fragmenta-
tion. These findings show that deimination at least
PAD4 is folded into two domains: an N-terminal associates with, and may be is a signal for, apoptosis.
domain from Met1 to Pro300 which is further divided
into two immunoglobulin-like sub domains, and a C-
terminal domain with the active site cleft. PAD4 is a 2. Deimination in non cutaneous
head-to-tail dimer. Three calcium ion binding sites diseases
are positioned in the subdomain 2 in proximity to the
C-terminal domain, and two calcium ion binding 2.1. Nervous system disorders
sites were observed in the C-terminal domain near
the active site. They all differ from the canonical PAD2 has been detected at high levels in the grey
EF-hand motif. Calcium binding induces conforma- matter and hypothalamus [22], as well as in hippo-
tional changes that generate the active site cleft campus, and in rat glial cells, especially astrocytes
and are necessary for recognition of the substrate [23—25], microglial cells [10,25], and oligodendro-
moiety. The high sequence identity of the C-term- cytes [26]. PAD4 has also been detected in extracts of
inal domains of all PADs suggests that their struc- mouse brain and spinal cord [27]. The brains of
tures are similar [13]. patients with multiple sclerosis (MS) show increased
levels of deiminated myelin basic protein (MBP) and
1.3. Deimination and gene expression of deiminated glial fibrillary acidic protein (GFAP).
The level of deimination is proportional to disease
Post-translational modifications of histones associate severity [28,29]. MBP is synthesized by oligodendro-
with local transcriptional induction or repression. cytes and is a major component of the myelin sheath
Deimination has been shown to antagonize the tran- surrounding the axons of nerve cells. Deimination of
scriptional induction mediated by histone bound MBP enhances its sensitivity to proteolysis and weak-
arginine methylation [14,15]. In human HL-60 gran- ens its interactions with the phospholipids of the
ulocytes, the deimination of aminoterminal arginines myelin sheath which becomes unstable. Accordingly,
in histones H3 and H4 by PAD4 prevents their methy- in a MS mouse model, experimental autoimmune
lation by the methyltransferase CARM1. PAD4 was encephalomyelitis, hypercitrullination of MBP and
also shown to regulate histone arginine methylation GFAP occurs in spinal cord during the development
levels by converting monomethyl-arginine to citrul- of the disease [27,30]. Also, enhanced levels of PAD2
line in a demethylimination reaction (Fig. 1b). Con- and abnormal accumulation of deiminated vimentin
versely, dimethylation of arginines prevents and glial fibrillary acidic protein were detected in
deimination. Consistently, PAD4 recruitment and hippocampus from patients with Alzheimer’s disease
activity is linked to the transcriptional down-regula- (AD) but not in controls [31]. It has been proposed
tion of estrogen-responsive genes in MCF-7 cells. that PAD2 may be activated upon increase of local
Moreover, PAD4-mediated demethylimination also calcium level under hypoxic conditions or other neu-
alter the activity of the p300 coactivator complex rodegenerative changes [31]. Together, these find-
necessary for transcription activation by hormone ings disclosed an important role for PAD2 in the onset
nuclear receptors [16]. These results pointed out and progression of neurodegenerative human disor-
PAD activity as a novel mechanism contributing to ders, at least AD and MS. In addition, a role for PAD2
the epigenetic control of gene expression. and MBP deimination was proposed in primary open-
angle glaucoma optic nerve damage [32].
1.4. Deimination and apoptosis
2.2. Rheumatoid arthritis
A nuclear 70 kD protein and vimentin had been
found to be selectively deiminated during calcium Deimination appears to be a key factor in the
ionophore-induced apoptosis in rat epidermal ker- pathophysiology of rheumatoid arthritis (RA), the
atinocytes and in mouse peritoneal macrophages most frequently encountered human inflammatory
grown in vitro, respectively [17,18]. In a recent rheumatism. The conflict between autoantibodies
study [19], inducible expression of exogenous directed against citrullinated proteins and extra-
PAD4 in transfected Jurkat and HL-60 cells induces vascular deposits in the synovial tissue of deimi-
apoptosis through cell cycle arrest, via increased nated fibrin may be responsible for the self
levels of p53, and mitochondria-mediated pathway. maintaining of joint inflammation in patients [33].
Also, the deimination of histones H2A, H3, H4 and Based on previous studies indicating linkage
nucleophosmin/B23 by PAD4, as observed in HL-60 between RA and chromosome 1p36 [34], a genetic

263
66 S. Chavanas et al.

screen of variants of the PAD locus in a Japanese deiminated cytokeratins in most adenocarcinoma
panel disclosed a strong association between a func- and some non-adenocarcinoma tissue samples [45].
tional haplotype of the gene PADI4 and the RA
phenotype, including increased levels of autoanti-
body against deiminated proteins [8]. The suscept- 3. Expression, location and roles of
ibility haplotype contains 4 exonic variants of PADI4 PADs in skin
and enhanced the stability of the PADI4 transcripts
in vitro. Supporting results were obtained in panels 3.1. Epidermis
from Korea [35], Japan [36], North America (Eur-
opean origin [37]), and through a recent meta-ana- Only products of the PADI1, 2 and 3 genes have been
lysis [38] although no associations were found detected in skin or epidermis [4,6,9,46]. We inves-
between the PADI4 variant haplotype and the dis- tigated PAD expression by confocal microscopy on
ease in several European panels [39—42]. frozen sections of non-fixed human and mouse skin,
using anti-peptide antibodies highly specific for
2.3. Experimental obstructive each PAD isoform. PAD1 immunostaining was cyto-
nephropathy plasmic and spread throughout the whole epidermis
with an intensity gradient from the basal to the
In rat kidney, deimination preferentially occurs in granular layer (Fig. 3). PAD2 was mainly detected
Bowman’s capsule, the outer epithelium of the in both the spinous and granular layers with a more
glomerular corpuscle. Both PAD2 expression and intense staining of the latter. PAD2 is located in the
citrullinated protein content increase markedly in cytoplasm of spinous cells and at the periphery of
obstructive nephropathy experimentally induced by granular keratinocytes (Fig. 4). PAD3 was detected
unilateral ureteral ligation. One of the major dei- in the granular layer (Figs. 5 and 6). Double labelling
minated proteins was identified as actin. Since a showed the co-location of PAD3 with both profilag-
ureter-bladder anastomosis to release the obstruc- grin and filaggrin (Fig. 6). Further, immunoelectron
tion rapidly decreases the amount of citrullinated microscopy analyses showed that PAD1 was
proteins, it was speculated that PAD activation expressed all the way up to the surface of the
occurs in response to mechanical stress to glomeruli epidermis whereas PAD3 could not be detected
[43]. beyond the third or fourth corneocyte layer, i.e.
at the same area as filaggrin. Immunoblotting car-
2.4. Cancer ried out on samples of cornified layers, obtained
using adhesive tape stripping, confirmed that only
Neoplastic cells from extramammary Paget’s dis- PAD1 persists in the superficial corneocytes. In the
ease were found immunoreactive to antibodies granular keratinocytes, PAD1 was observed in asso-
against a PAD, which, on the basis of the absence ciation with both the cytokeratin intermediate fila-
of staining of normal epidermis, could be PAD4 or ments and keratohyalin granules, and PAD3 only was
PAD6 [44]. A recent study revealed that PAD4 is found within keratohyalin granules. These two PADs
significantly expressed and co-located with CD34 were also detected in the intracorneocyte fibrous
(a marker of haematopoietic progenitor cells) and matrix [9,46,47].

Fig. 3 Localization of PAD1 in human epidermis by confocal microscopy. Cryosections of human skin were analysed by
confocal microscopy with DG3.10, a monoclonal antibody specific for desmoglein 1 and 2 (Dsg1—2), and with anti-PAD1
antibodies. The merge image clearly shows the granular distribution of PAD1 in the cytoplasm of the upper spinous and
granular keratinocytes.

264
Peptidylarginine deiminases and deimination in biology and pathology 67

Fig. 4 Localization of PAD2 in human epidermis by confocal microscopy. Cryosections of human skin were analysed by
confocal microscopy with DG3.10, a monoclonal antibody specific for desmoglein 1 and 2 (Dsg1—2), and with anti-PAD2
antibodies. The merge images (Dsg1—2/PAD2) show the distribution of PAD2 in the cytoplasm of the upper spinous
keratinocytes and at the periphery of granular keratinocytes.

3.2. Skin appendages 3.3. Deimination and skin moisturizing

Deiminated proteins were detected for the first To ensure efficient barrier function, the cornified
time nearly thirty years ago within hair follicles layer must be cohesive (through the corneodesmo-
[48]. We recently documented the expression of somes), waterproof (due to the intercorneocyte
PADs in the anagen hair follicles [49]. PAD1 was lipid lamellae) and moisturized. Healthy cornified
detected within Huxley’s layer, the IRS cuticle and layer must contain 10—15% of water; otherwise it
the companion layer. PAD3 was present within the becomes rigid and cracks. The Natural Moisturizing
inner root sheath (IRS) and the medulla. These Factor (NMF) is an osmotic agent that allows water
data suggest that PAD1 and 3 are associated with retention. It contains a combination of glycerol,
the differentiation of hair follicles. PAD1 and 3 urea, lactate, and aminoacids of which two deriva-
could have a role in the control of the mechanical tives: trans-urocanic acid (derived from histidine)
resistance of the root sheath cells through the and the most hygroscopic aminoacid, pyrolidone
deimination of trichohyalin (Fig. 7). Indeed, carboxylic acid (derived from glutamine). These
citrullination of this protein allows its solubiliza- amino acids and derivatives are nearly all produced
tion from granules and its association with hair from the degradation of filaggrin [50]. Filaggrin is a
keratins through covalent interactions carried out basic protein that is synthesized by granular layer
by one or several transglutaminases. Both PADs keratinocytes as a 400 kDa large precursor, profilag-
may also be involved in the deimination of kRT1- grin, an essential component of type F keratohyalin
c29 and its human ortholog, the inner root sheath- granules. During transition to corneocyte, profilag-
specific type-I keratin 25Cirs3. After deimination, grin is proteolyzed into a dozen of filaggrin sub-
these keratins are cross-linked to trichohyalin and units. The latter, rich in histidine and other basic
other cornified envelope components [2]. PAD1 amino acids, associate with cytokeratin intermedi-
and 2 were detected in secretory and myoepithe- ate filaments, facilitating their aggregation and the
lial cells of sweat glands and in arrector pili formation of the intracorneocyte fibrous matrix
muscles. So far, no PAD was detected in sebaceous [51]. In the upper part of the stratum compactum,
glands. filaggrin separates from the intracorneocyte matrix

Fig. 5 Localization of PAD3 in mouse and human epidermis. Cryosections of mouse (a, b) and human (c) skin were
analysed with anti-PAD3 antibodies, without (a, c) and with (b) pre-absorption on the peptide used to affinity purified the
antibodies. The images show the specific distribution of PAD3 in the granular keratinocytes. Scale bar, 10 mm.

265
68 S. Chavanas et al.

Fig. 6 Co-localization of PAD3 and (pro)filaggrin in human epidermis by confocal microscopy. Cryosections of human
skin were analysed by confocal microscopy with anti-PAD3 antibodies, with AHF2, a monoclonal antibody directed against
profilaggrin and filaggrin ((pro)filaggrin), and with AHF7, a monoclonal antibody specific for filaggrin. The merge images
show the co-location of PAD3 with profilaggrin in the cytoplasm of the granular keratinocytes, and filaggrin in the lower
corneocytes, respectively.

and is completely degraded into amino acids that deiminated, and this is believed to be necessary
constitute the NMF. Two recent reports in Nature for its dissociation from the matrix and subsequent
Genetics reinforced the importance of filaggrin in proteolysis. In vitro, filaggrin could be deiminated
epidermal barrier. Indeed, they demonstrated that by recombinant PAD1, 2 and 3, with an efficacy that
the loss-of-function mutations R510X and 2282del4 varied depending on the isoform [47]. The enzy-
in the gene encoding profilaggrin underlie ichthyosis matic properties of PAD1 and 3 and their co-locali-
vulgaris (OMIM 146700) and are strong predisposing zation with filaggrin within the fibrous matrix of
factors for atopic dermatitis (OMIM %603165) deep corneocytes strongly suggest that they are
[52,53]. In the stratum compactum, filaggrin is responsible for the deimination of this protein

Fig. 7 Co-localization of PAD3 in human hair follicles by confocal microscopy. Cryosections of human scalp skin were
analysed by confocal microscopy with anti-PAD3 antibodies, and with AE16, a monoclonal antibody specific for
trichohyalin and kindly provided by Prof. T.-T. Sun. The merge images show the co-location of PAD3 with thrichohyalin
in the inner root sheath and in the medulla cells at the periphery of trichohyalin granules (arrows).

266
Peptidylarginine deiminases and deimination in biology and pathology 69

Fig. 8 Role of PADs in the epidermis: a model. See text for details.

[47]. Therefore, these two isoforms participate in, 5. Conclusions and perspectives
and possibly control, the production of the NMF
(Fig. 8), and therefore play a major role in the Due to their importance in physiology and patho-
stratum corneum homeostasis. physiology, as shown in this review, PADs are now
In the epidermis, the extremities of cytokeratin K1 considered as potential drug targets. Paclitaxel, a
and K10 are also deiminated in the upper cornified molecule used in cancer therapy, was the first
layer [47,54] where only PAD1 has been detected noncompetitive inhibitor of PADs to be reported
[47,54]. PAD1 is therefore the isoform responsible [59]. More recently, two acetamidine-based (2-
for K1 and K10 deimination. The importance of this chloroacetamidine and N-a-benzoyl-N5-(2-fluoro-
deimination in the late stages of the cornification 1-iminoethyl)-L-ornithine amide) were shown to
process is not known. It is concomitant with and inhibit PAD4, probably through an irreversible inac-
therefore could be involved in the ultrastructural tivation of the active site [60,61]. This opens the
modifications of the intracorneocyte fibrous matrix way to the fine characterization of biochemical
[55] (Fig. 8). The epidermal targets and the function pathways in which deimination is involved, and
of PAD2 in the epidermis have still not been identified. to the design of new therapeutic molecules focus-
ing on PADs.

4. Deimination and cutaneous

diseases Acknowledgements

Decreased level of cytokeratin deimination was The authors would like to thank Prof. H. Takahara and
observed in the epidermis of patients with bullous T. Senshu for their contributions to the research
congenital ichthyosiform erythroderma (OMIM discussed in this review. Anti-modified citrulline anti-
113800) and psoriasis (OMIM 177900) ([56], M. Simon, body and monoclonal antibody AE16 were kind gifts of
unpublished data). Noteworthy, vitamin D increases Prof. T. Senshu and Prof. T.-T. Sun, respectively. The
the expression of PADI1—3 in keratinocytes grown in confocal microscopy was performed at the ‘‘Centre
vitro [57] and derivatives of this vitamin are bene- Européen de Recherche sur la Peau et les Epithéliums
ficial in the treatment of psoriasis. Therefore, it is de Revêtement’’ (Hôtel Dieu, Toulouse). The authors’
tempting to speculate that the 3 PADs expressed in the laboratory was supported in part by the CNRS, the
epidermis are possible therapeutic targets in psoria- Toulouse III University, the INSERM, the ‘‘Société de
sis. Surprisingly enough in this context, the PAD inhi- Recherche Dermatologique’’, the European Social
bitor paclitaxel has been shown, in a prospective Funds (ESF), the European Regional Development
phase II pilot study, to improve severe psoriasis [58]. Funds (ERDF) and the Pierre Fabre Research Institute.

267
70 S. Chavanas et al.

References [16] Lee YH, Coonrod SA, Kraus WL, Jelinek MA, Stallcup MR.
Regulation of coactivator complex assembly and function by
protein arginine methylation and demethylimination. Proc
[1] Arita K, Shimizu T, Hashimoto H, Hidaka Y, Yamada M, Sato M. Natl Acad Sci USA 2005;102:3611—6.
Structural basis for histone N-terminal recognition by human [17] Mizoguchi M, Manabe M, Kawamura Y, Kondo Y, Ishidoh K,
peptidylarginine deiminase 4. Proc Natl Acad Sci USA Kominami E, et al. Deimination of 70-kD nuclear protein
2006;103:5291—6. during epidermal apoptotic events in vitro. J Histochem
[2] Tarcsa E, Marekov LN, Mei G, Melino G, Lee SC, Steinert PM. Cytochem 1998;46:1303—9.
Protein unfolding by peptidylarginine deiminase. Substrate [18] Asaga H, Yamada M, Senshu T. Selective deimination of
specificity and structural relationships of the natural sub- vimentin in calcium ionophore-induced apoptosis of mouse
strates trichohyalin and filaggrin. J Biol Chem 1996; peritoneal macrophages. Biochem Biophys Res Commun
271:30709—16. 1998;243:641—6.
[3] Balandraud N, Gouret P, Danchin EG, Blanc M, Zinn D, [19] Liu GY, Liao YF, Chang WH, Liu CC, Hsieh MC, Hsu PC, et al.
Roudier J, et al. A rigorous method for multigenic families’ Overexpression of peptidylarginine deiminase IV features in
functional annotation: the peptidyl arginine deiminase apoptosis of haematopoietic cells. Apoptosis 2006;11:183—96.
(PADs) proteins family example. BMC Genomics 2005;6:153. [20] Hagiwara T, Hidaka Y, Yamada M. Deimination of histone H2A
[4] Chavanas S, Méchin MC, Takahara H, Kawada A, Nachat R, and H4 at arginine 3 in HL-60 granulocytes. Biochemistry
Serre G, et al. Comparative analysis of the mouse and human 2005;44:5827—34.
peptidylarginine deiminase gene clusters reveals highly con- [21] Hagiwara T, Nakashima K, Hirano H, Senshu T, Yamada M.
served non-coding segments and a new human gene, PADI6. Deimination of arginine residues in nudeophosmin/B23 and
Gene 2004;330:19—27. histones in HL-60 granulocytes. Biochem Biophys Res Com-
[5] Dong S, Kojima T, Shiraiwa M, Mechin MC, Chavanas S, Serre mun 2002;290:979—83.
G, et al. Regulation of the expression of peptidylarginine [22] Kubilus J, Baden HP. Purification and properties of a brain
deiminase type II gene (PADI2) in human keratinocytes enzyme which deiminates proteins. Biochim Biophys Acta
involves Sp1 and Sp3 transcription factors. J Invest Dermatol 1983;745:285—91.
2005;124:1026—33. [23] Asaga H, Ishigami A. Protein deimination in the rat brain
[6] Vossenaar ER, Zendman AJ, van Venrooij WJ, Pruijn GJ. PAD, after kainate administration: citrulline-containing proteins
a growing family of citrullinating enzymes: genes, features as a novel marker of neurodegeneration. Neurosci Lett
and involvement in disease. Bioessays 2003;25:1106—18. 2000;299:5—8.
[7] Dong S, Kanno T, Yamaki A, Kojima T, Shirawa M, Kawada A, [24] Asaga H, Nakashima K, Senshu T, Ishigami A, Yamada M.
et al. NF-Y and Spl/Sp3 are involved in the transcriptional Immunocytochemical localization of peptidylarginine dei-
regulation of the peptidylarginine deiminase type III minase in human eosinophils and neutrophils. J Leukoc Biol
gene (PADI3) in human keratinocytes. Biochem J 2006; 2001;70:46—51.
397:449—59. [25] Vincent SR, Leung E, Watanabe K. Immunohistochemical
[8] Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki localization of peptidylarginine deiminase in the rat brain.
M, et al. Functional haplotypes of PADI4, encoding citrulli- J Chem Neuroanat 1992;5:159—68.
nating enzyme peptidylarginine deiminase 4, are associated [26] Akiyama K, Sakurai Y, Asou H, Senshu T. Localization of
with rheumatoid arthritis. Nat Genet 2003;34:395—402. peptidylarginine deiminase type II in a stage-specific imma-
[9] Guerrin M, Ishigami A, Méchin MC, Nachat R, Valmary S, ture oligodendrocyte from rat cerebral hemisphere. Neu-
Sebbag M, et al. cDNA cloning, gene organization and rosci Lett 1999;274:53—5.
expression analysis of human peptidylarginine deiminase [27] Raijmakers R, Vogelzangs J, Croxford JL, Wesseling P, van
type I. Biochem J 2003;370:167—74. Venrooij WJ, Pruijn GJ. Citrullination of central nervous
[10] Asaga H, Akiyama K, Ohsawa T, Ishigami A. Increased and system proteins during the development of experimental
type II-specific expression of peptidylarginine deiminase in autoimmune encephalomyelitis. J Comp Neurol 2005;486:
activated microglia but not hyperplastic astrocytes follow- 243—53.
ing kainic acid-evoked neurodegeneration in the rat brain. [28] Moscarello MA, Pritzker L, Mastronardi FG, Wood DD. Pepti-
Neurosci Lett 2002;326:129—32. dylarginine deiminase: a candidate factor in demyelinating
[11] Kanno T, Kawada A, Yamanouchi J, Yosida-Noro C, Yoshiki A, disease. J Neurochem 2002;81:335—43.
Shiraiwa M, et al. Human peptidylarginine deiminase type [29] Moscarello MA, Wood DD, Ackerley C, Boulias C. Myelin in
III: molecular cloning and nudeotide sequence of the cDNA, multiple sclerosis is developmentally immature. J Clin Invest
properties of the recombinant enzyme, and immunohisto- 1994;94:146—54.
chemical localization in human skin. J Invest Dermatol [30] Nicholas AP, Sambandam T, Echols JD, Barnum SR. Expression
2000;115:813—23. of citrullinated proteins in murine experimental autoim-
[12] Nakashima K, Hagiwara T, Ishigami A, Nagata S, Asaga H, mune encephalomyelitis. J Comp Neurol 2005;486:254—66.
Kuramoto M, et al. Molecular characterization of peptidy- [31] Ishigami A, Ohsawa T, Hiratsuka M, Taguchi H, Kobayashi S,
larginine deiminase in HL-60 cells induced by retinoic add Saito Y, et al. Abnormal accumulation of citrullinated pro-
and 1alpha, 25-dihydroxyvitamin D(3). J Biol Chem 1999; teins catalyzed by peptidylarginine deiminase in hippocam-
274:27786—92. pal extracts from patients with Alzheimer’s disease. J
[13] Arita K, Hashimoto H, Shimizu T, Nakashima K, Yamada M, Neurosci Res 2005;80:120—8.
Sato M. Structural basis for Ca(2+)-induced activation of [32] Bhattacharya SK, Crabb JS, Bonilha VL, Gu X, Takahara H,
human PAD4. Nat Struct Mol Biol 2004;11:777—83. Crabb JW. Proteomics implicates peptidyl arginine deimi-
[14] Cuthbert GL, Daujat S, Snowden AW, Erdjument-Bromage H, nase 2 and optic nerve citrullination in glaucoma pathogen-
Hagiwara T, Yamada M, et al. Histone deimination antag- esis. Invest Ophthalmol Vis Sci 2006;47:2508—14.
onizes arginine methylation. Cell 2004;118:545—53. [33] Sebbag M, Chapuy-Regaud S, Auger I, Petit-Texeira E, Clavel
[15] Wang Y, Wysocka J, Sayegh J, Lee YH, Perlin JR, Leonelli L, C, Nogueira L, et al. Clinical and pathophysiological signifi-
et al. Human PAD4 regulates histone arginine methylation cance of the autoimmune response to citrullinated proteins
levels via demethylimination. Science 2004;306:279—83. in rheumatoid arthritis. Joint Bone Spine 2004;71:493—502.

268
Peptidylarginine deiminases and deimination in biology and pathology 71

[34] Cornells F, Faure S, Martinez M, Prud’homme JF, Fritz P, Dib [50] Rawlings AV. Trends in stratum corneum research and the
C, et al. New susceptibility locus for rheumatoid arthritis management of dry skin conditions. Int J Cosmet Sci
suggested by a genome-wide linkage study. Proc Natl Acad 2003;25:63—95.
Sci USA 1998;95:10746—50. [51] Kalinin A, Marekov L, PM S. Assembly of the epidermal
[35] Kang C, Lee H, Ju H, Cho H, Kang C, Bae S. A functional cornified cell envelope. J Cell Sci 2001;114:3069—70.
haplotype of the PADI4 gene associated with increased [52] Palmer CN, Irvine AD, Terron-Kwiatkowski A, Zhao Y, Liao H,
rheumatoid arthritis susceptibility in Koreans. Arthritis Lee SP, et al. Common loss-of-function variants of the
Rheum 2006;54:90—6. epidermal barrier protein filaggrin are a major predisposing
[36] Ikari K, Kuwahara M, Nakamura T, Momohara S, Hara M, factor for atopic dermatitis. Nat Genet 2006;38:441—6.
Yamanaka H, et al. Association between PADI4 and rheuma- [53] Smith FJ, Irvine AD, Terron-Kwiatkowski A, Sandilands A,
toid arthritis: a replication study. Arthritis Rheum 2005; Campbell LE, Zhao Y, et al. Loss-of-function mutations in the
52:3054—7. gene encoding filaggrin cause ichthyosis vulgaris. Nat Genet
[37] Plenge RM, Padyukov L, Remmers EF, Purcell S, Lee AT, 2006;38:337—42.
Karlson EW, et al. Replication of putative candidate-gene [54] Senshu T, Kan S, Ogawa H, Manabe M, Asaga H. Preferential
associations with rheumatoid arthritis in >4000 samples deimination of keratin K1 and filaggrin during the terminal
from North America and Sweden: association of suscept- differentiation of human epidermis. Biochem Biophys Res
ibility with PTPN22, CTLA4, and PADI4. Am J Hum Genet Commun 1996;225:712—9.
2005;77:1044—60. [55] Ishida-Yamamoto A, Senshu T, Eady RA, Takahashi H, Shimizu
[38] Iwamoto T, Ikari K, Nakamura T, Kuwahara M, Toyama Y, H, Akiyama M, et al. Sequential reorganization of cornified
Tomatsu T, et al. Association between PADI4 and rheumatoid cell keratin filaments involving filaggrin-mediated compac-
arthritis: a meta-analysis. Rheumatology (Oxford) 2006; tion and keratin 1 deimination. J Invest Dermatol 2002;
45:804—7. 118:282—7.
[39] Barton A, Bowes J, Eyre S, Spreckley K, Hinks A, John S, et al. [56] Ishida-Yamamoto A, Senshu T, Takahashi H, Akiyama K,
A functional haplotype of the PADI4 gene associated with Nomura K, Iizuka H. Decreased deiminated keratin K1 in
rheumatoid arthritis in a Japanese population is not asso- psoriatic hyperproliferative epidermis. J Invest Dermatol
ciated in a United Kingdom population. Arthritis Rheum 2000;114:701—5.
2004;50:1117—21. [57] Lu J, Goldstein KM, Chen P, Huang S, Gelbert LM, Nagpal S.
[40] Barton A, Bowes J, Eyre S, Symmons D, Worthington J, Transcriptional profiling of keratinocytes reveals a vitamin
Silman A. Investigation of polymorphisms in the PADI4 gene D-regulated epidermal differentiation network. J Invest
in determining severity of inflammatory polyarthritis. Ann Dermatol 2005;124:778—85.
Rheum Dis 2005;64:1311—5. [58] Ehrlich A, Booher S, Becerra Y, Borris DL, Figg WD, Turner ML,
[41] Caponi L, Petit-Teixeira E, Sebbag M, Bongiorni F, Moscato S, et al. Micellar paclitaxel improves severe psoriasis in a
Pratesi F, et al. A family based study shows no association prospective phase II pilot study. J Am Acad Dermatol
between rheumatoid arthritis and the PADI4 gene in a white 2004;50:533—40.
French population. Ann Rheum Dis 2005;64:587—93. [59] Pritzker LB, Moscarello MA. A novel microtubule indepen-
[42] Martinez A, Valdivia A, Pascual-Salcedo D, Lamas JR, Fer- dent effect of paclitaxel: the inhibition of peptidylarginine
nandez-Arquero M, Balsa A, et al. PADI4 polymorphisms are deiminase from bovine brain. Biochim Biophys Acta 1998;
not associated with rheumatoid arthritis in the Spanish 1388:154—60.
population. Rheumatology (Oxford) 2005;44:1263—6. [60] Luo Y, Knuckley B, Lee YH, Stallcup MR, Thompson PR. A
[43] Feng D, Imasawa T, Nagano T, Kikkawa M, Takayanagi K, fluoroacetamidine-based inactivator of protein arginine dei-
Ohsawa T, et al. Citrullination preferentially proceeds in minase 4: design, synthesis, and in vitro and in vivo evalua-
glomerular Bowman’s capsule and increases in obstructive tion. J Am Chem Soc 2006;128:1092—3.
nephropathy. Kidney Int 2005;68:84—95. [61] Stone EM, Schaller TH, Bianchi H, Person MD, Fast W.
[44] Urano Y, Watanabe K, Sakaki A, Arase S, Watanabe Y, Shigemi Inactivation of two diverse enzymes in the amidinotransfer-
F, et al. Immunohistochemical demonstration of peptidylar- ase superfamily by 2-chloroacetamidine: dimethylargini-
ginine deiminase in human sweat glands. Am J Dermato- nase and peptidylarginine deiminase. Biochemistry 2005;
pathol 1990;12:249—55. 44:13744—52.
[45] Chang X, Han J. Expression of peptidylarginine deiminase
type 4 (PAD4) in various tumors. Mol Carcinog 2006;45:183— Stéphane Chavanas, 37, trained in a
96. french grande école, INSA, Lyon, France.
[46] Nachat R, Méchin MC, Takahara H, Chavanas S, Charveron M, He was a PhD student in the laboratory of
Serre G, et al. Peptidylarginine deiminase isoforms 1—3 are Skin Biology and Pathophysiology in Nice
expressed in the epidermis and involved in the deimination Medical School, Nice, France, from 1995
of K1 and filaggrin. J Invest Dermatol 2005;124:384—93. to 1998 (Dr. Meneguzzi), and he spent 3
[47] Méchin MC, Enji M, Nachat R, Chavanas S, Charveron M, months in the Department of Cutaneous
Ishida-Yamamoto A, et al. The peptidylarginine deiminases Biology, Jefferson University, Philadel-
expressed in human epidermis differ in their substrate phia, USA, in 1996 (Pr Uitto). He received
specificities and subcellular locations. Cell Mol Life Sci his PhD degree with high honours from
2005;62:1984—95. the University of Nice-Sophia Antipolis, in 1998. He was appointed
[48] Rogers G, Taylor L. The enzymic derivation of citrulline as a Marie-Curie fellow by the Wellcome Trust Centre for Human
residues from arginine residues in situ during the biosynth- Genetics, University of Oxford, UK, from 1998 to 2000. He was
esis of hair proteins that are cross-linked by isopeptide recruited as a tenured scientist by the french National Institute
bonds. Adv Exp Med Biol 1977;86A:283—94. for Health and Medical Research (INSERM, France) in 2000. He has
[49] Nachat R, Méchin MC, Charveron M, Serre G, Constans J, been working in Pr Serre’s laboratory, University of Toulouse,
Simon M. Peptidylarginine deiminase isoforms are differen- France, since 2003. Stéphane Chavanas has characterized the
tially expressed in the anagen hair follicles and other human molecular and genetic aetiology of inherited skin disorders such
skin appendages. J Invest Dermatol 2005;125:34—41. as epidermolysis bullosa variants and Netherton disease. His

269
72 S. Chavanas et al.

group currently investigates the control of gene expression during went to Toulouse, France, in the University P. Sabatier (Prof.
epidermal keratinocyte differentiation. He characterized the G. Serre), where he characterized rheumatoid arthritis-asso-
peptidylarginine deiminase gene locus, and now studies the ciated autoantibodies, the so-called anti-keratin or anti-filaggrin
control of the differentiated expression of the PAD genes in antibodies. He was recruited as a tenured scientist by the
the epidermis using genetic and epigenetic approaches. National Institute for Health and Medical Research (INSERM,
France) in 1998. He currently heads a team focused on the
Dr Michel Simon got his PhD degree from characterization of the late steps in keratinocyte terminal dif-
the University of Geneva, Switzerland in ferentiation: function and properties of corneodesmosin, invol-
1988. Then he moved to the Department vement of proteases of the kallikrein family in desquamation,
of Ontogenesis and Molecular Genetic proteomic analysis of lamellar bodies, role, and regulation of the
(Prof. R.M. Tanguay) of Laval University expression of new therapeutic targets, the peptidylarginine dei-
in Quebec, Canada. In 1990, Dr Simon minases.

270
Bibliographie
Abercrombie M, Flint MH, James DW. (1956) Wound contraction in relation to collagen formation in
scorbutic guinea-pigs. J Embryol Exp Morphol 4:167-75.

Aberdam D. (2007) Réparer ou régénérer il faut choisir... Médecine/Sciences 23:783-807.

Abraar K, Ali A, Howard IM. (2009) Toxicologic implications of cutaneous barriers: a molecular,
cellular, and anatomical overview. J Appl Toxicol 29: 551-559.

Adoue V, Chavanas S, Coudane F, Méchin M-C, Caubet C, Ying S, et al. (2008a) Long-Range
Enhancer Differentially Regulated by c-Jun and JunD Controls Peptidylarginine Deiminase-3 Gene in
Keratinocytes. J Mol Biol 384:1048-57.

Adoue V. (2008b) Le contrôle de l'expression des PADs dans les kératinocytes associe des éléments
proximaux et une région intergénique distante, et implique les facteurs AP-1, c-jun,c-Fos et JunD. Un
modèle d'étude de la différenciation terminale épidermique. Thèse. Université Paul Sabatier,
Toulouse.

Aho S, Li K, Ryoo Y, McGee C, Ishida-Yamamoto A, Uitto J, et al. (2004) Periplakin Gene Targeting
Reveals a Constituent of the Cornified Cell Envelope Dispensable for Normal Mouse Development.
Mol Cell Biol 24:6410-8.

Akiyama K, Inoue K, Senshu T. (1989) Immunocytochemical study of peptidylarginine deiminase:

localization of its immunoreactivity in prolactin cells of female rat pituitaries. Endocrinology
125:1121-7.

Akiyama K, Inoue K, Senshu T. (1990) Immunocytochemical demonstration of skeletal muscle type

peptidylarginine deiminase in various rat tissues. Cell Biol Int Rep 14:267-73.

Akiyama K, Nagata S, Watanabe K, Watanabe G, Taya K, Sasamoto S, et al. (1995) Age-related

increase in peptidylarginine deiminase in the male rat pituitary. Mech Ageing Dev 81:119-29.

Akiyama K, Senshu T. (1999) Dynamic aspects of protein deimination in developing mouse

epidermis. Exp Dermatol 8:177-86.

Angel P, Szabowski A, Schorpp-Kistner M. (2001) Function and regulation of AP-1 subunits in skin
physiology and pathology. Oncogene 20:2413-23.

Arin M, Mueller F. (2007) Keratins and their associated skin disorders. Eur J Dermatol 17 (2): 123-9.

Arita K, Hashimoto H, Shimizu T, Nakashima K, Yamada M, Sato M. (2004) Structural basis for
Ca(2+)-induced activation of human PAD4. Nat Struct Mol Biol 11:777-83.

Arita K, Shimizu T, Hashimoto H, Hidaka Y, Yamada M, Sato M. (2006) Structural basis for histone
N-terminal recognition by human peptidylarginine deiminase 4. Proc Natl Acad Sci USA 103:5291-6.

Asaga H, Yamada M, Senshu T. (1998) Selective deimination of vimentin in calcium ionophore-

induced apoptosis of mouse peritoneal macrophages. Biochem Biophys Res Commun 243:641-6.

Bannister AJ, Schneider R, Kouzarides T. (2002) Histone methylation: Dynamic or static? Cell
109:801-6.

273
Barton A, Bowes J, Eyre S, Spreckley K, Hinks A, John S, et al. (2004) A functional haplotype of the
PADI4 gene associated with rheumatoid arthritis in a Japanese population is not associated in a United
Kingdom population. Arthritis Rheum 50:1117-21.

Basset-Seguin N, Escot C, Moles JP, Blanchard JM, Kerai C, Guilhou JJ. (1991) C-fos and c-jun
Proto-Oncogene Expression Is Decreased in Psoriasis: an In Situ Quantitative Analysis. J Invest
Dermatol 97:672-8.

Behne MJ, Meyer JW, Hanson KM, Barry NP, Murata S, Crumrine D, et al. (2002) NHE1 regulates
the stratum corneum permeability barrier homeostasis - Microenvironment acidification assessed with
fluorescence lifetime imaging. J Biol Chem 277:47399-406.

Bernard D, Mehul B, Thomas-Collignon A, Simonetti L, Remy V, Bernard MA, et al. (2003) Analysis
of proteins with caseinolytic activity in a human stratum corneum extract revealed a yet unidentified
cysteine protease and identified the so-called "Stratum Corneum Thiol Protease" as Cathepsin L2. J
Invest Dermatol 120:592-600.

Bennett JS. (2001) Platelet-Fibrinogen Interactions. Ann N Y Acad Sci 936:340-54.

Bhattacharya SK, Crabb JS, Bonilha VL, Gu X, Takahara H, Crabb JW. (2006) Proteomics implicates
peptidyl arginine deiminase 2 and optic nerve citrullination in glaucoma pathogenesis. Invest
Ophthalmol Vis Sci 47:2508-14.

Bikle DD, Ng D, Oda Y, Hanley K, Feingold K, Xie Z. (2002) The vitamin D response element of the
involucrin gene mediates its regulation by 1, 25-dihydroxyvitamin D3. J Invest Dermatol 119:1109-
13.

Bikle DD, Oda Y, Xie Z. (2004) Calcium and 1,25(OH)2D: interacting drivers of epidermal
differentiation. J Steroid Biochem Mol Biol 89-90:355-60.

Bikle DD, Pillai S. (1993) Vitamin D, calcium, and epidermal differentiation. Endocr Rev 14:3-19.

Brandner JM. (2009) Tight junctions and tight junction proteins in mammalian epidermis. Eur J
Pharm Biopharm 72:289-94.

Brandt E, Petersen F, Ludwig A, Ehlert JE, Bock L, Flad HD. (2000) The beta-thromboglobulins and
platelet factor 4: blood platelet-derived CXC chemokines with divergent roles in early neutrophil
regulation. J Leukoc Biol 67:471-8.

Brattsand M, Stefansson K, Lundh C, Haasum Y, Egelrud T. (2004) A Proteolytic cascade of

kallikreins in the stratum corneum. J Invest Dermatol 124:198-203.

Candi E, Oddi S, Paradisi A, Terrinoni A, Ranalli M, Teofoli P, et al. (2002) Expression of

transglutaminase 5 in normal and pathologic human epidermis. J Invest Dermatol 119:670-7.

Candi E, Schmidt R, Melino G. (2005) The cornified envelope: a model of cell death in the skin. Nat
Rev Mol Cell Biol 6:328-40.

Caponi L, Petit-Teixeira E, Sebbag M, Bongiorni F, Moscato S, Pratesi F, et al. (2004) A family-based

study shows no association between rheumatoid arthritis and the PADI4 gene in a French caucasian
population. Ann Rheum Dis 64:587-93.

Cassidy AJ, van Steensel MA, Steijlen PM, van Geel M, van der Velden J, Morley SM, et al. (2005) A
homozygous missense mutation in TGM5 abolishes epidermal transglutaminase 5 activity and causes
acral peeling skin syndrome. Am J Hum Genet 77:909-17.

273
Caubet C, Jonca N, Brattsand M, Guerrin M, Bernard D, Schmidt R, et al. (2004) Degradation of
corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and
SCCE/KLK7/hK7. J Invest Dermatol 122:1235-44.

Chang X, Han J. (2006) Expression of peptidylarginine deiminase type 4 (PAD4) in various tumors.
Mol Carcinog 45:183-96.

Chang X, Han J, Pang L, Zhao Y, Yang Y, Shen Z. (2009) Increased PADI4 expression in blood and
tissues of patients with malignant tumors. BMC Cancer 9:40.

Chapuy-Regaud S, Sebbag M, Baeten D, Clavel C, Foulquier C, De Keyser F, et al. (2005) Fibrin

deimination in synovial tissue is not specific for rheumatoid arthritis but commonly occurs during
synovitides. J Immunol 174:5057-64.

Chavanas S, Adoue V, Méchin MC, Ying S, Dong S, Duplan H, et al. (2008) Long-range enhancer
associated with chromatin looping allows AP-1 regulation of the peptidylarginine deiminase 3 gene in
differentiated keratinocyte. PLoS ONE 3:e3408.

Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, et al. (2000) Mutations in
SPINK5, encoding a serine protease inhibitor, cause Netherton syndrome. Nature Genet 25:141-2.

Chavanas S, Méchin MC, Nachat R, Adoue V, Coudane F, Serre G, et al. (2006) Peptidylarginine
deiminases and deimination in biology and pathology: relevance to skin homeostasis. J Dermatol Sci
44:63-72.

Chavanas S, Méchin MC, Takahara H, Kawada A, Nachat R, Serre G, et al. (2004) Comparative
analysis of the mouse and human peptidylarginine deiminase gene clusters reveals highly conserved
non-coding segments and a new human gene, PADI6. Gene 330:19-27.

Clark RA, Lanigan JM, DellaPelle P, Manseau E, Dvorak HF, Colvin RB. (1982) Fibronectin and
fibrin provide a provisional matrix for epidermal cell migration during wound reepithelialization. J
Invest Dermatol 79:264-9.

Clark RA. (2001) Fibrin and wound healing. Ann NY Acad Sci 936:355-67.

Clark RA. (2003) Fibrin is a many splendored thing. J Invest Dermatol 121:1210-6.

Claudinot SP, Nicolas M, Oshima H, Rochat A, Barrandon Y. (2005) Long-term renewal of hair
follicles from clonogenic multipotent stem cells. Proc Natl Acad Sci USA 102:14677-82.

Clayton E, Doupe DP, Klein AM, Winton DJ, Simons BD, Jones PH. (2007) A single type of
progenitor cell maintains normal epidermis. Nature 446:185-9.

Coulombe PA. (1993) The cellular and molecular biology of keratins: beginning a new era. Curr Opin
Cell Biol 5:17-29.

Coulombe PA. (2003) Wound epithelialization: accelerationg the pace of discovery. J Invest Dermatol
121:219-30.

Coulombe PA, Bousquet O, Ma L, Yamada S, Wirtz D. (2000) The 'ins' and 'outs' of intermediate
filament organization. Trends Cell Biol 10:420-8.

Crish JF, Eckert RL. (2008) Synergistic activation of human involucrin gene expression by Fra-1 and
p300- evidence for the presence of a multiprotein complex. J Invest Dermatol 128:530-41.

274
Cuthbert GL, Daujat S, Snowden AW, Erdjument-Bromage H, Hagiwara T, Yamada M, et al. (2004)
Histone deimination antagonizes arginine methylation. Cell 118:545-53.

Dale BA. (1985) Filaggrin, the matrix protein of keratin. Am J Dermatopathol 7:65-8.

Dale BA, Holbrook KA, Steinert PM. (1978) Assembly of stratum corneum basic protein and keratin
filaments in macrofibrils. Nature 276:729-31.

de Benedictis FM, Franceschini F, Hill D, Naspitz C, Simons FE, Wahn U, et al. (2009) The allergic
sensitization in infants with atopic eczema from different countries. Allergy 64:295-303.

De Fine Olivarius F, Wulf HC, Corosby J, Norval M. (1999) Sunscreen photoprotection against cis-
urocanic acid production in human skin. Acta Derm Venereol 79:426-430.

Denecker G, Hoste E, Gilbert B, Hochepied T, Ovaere P, Lippens S, et al. (2007) Caspase-14 protects
against epidermal UVB photodamage and water loss. Nat Cell Biol 9:666-74.

Denecker G, Ovaere P, Vandenabeele P, Declercq W. (2008) Caspase-14 reveals its secrets. J Cell
Biol 180:451-8.

Denis H, Deplus R, Putmans P, Yamada M, Métivier R. (2009) Functional connection between

deimination and deacetylation of histones. Mol Cell Biol. 29:4982-93.

Descargues P, Deraison C, Bonnart C, Kreft M, Kishibe M, Ishida-Yamamoto A, et al. (2005) Spink5-

deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease
hyperactivity. Nat Genet 37:56-65.

Desmoulière A, Chaponnier C, Gabbiani G. (2005) Tissue repair, contraction, and the myofibroblast.
Wound Repair Regen 13:7-12.

Desmouliere A, Redard M, Darby I, Gabbiani G. (1995) Apoptosis mediates the decrease in cellularity
during the transition between granulation tissue and scar. Am J Pathol 146:56-66.

Devalaraja RM, Nanney LB, Qian Q, Du J, Yu Y, Devalaraja MN. (2000) Delayed wound healing in
CXCR2 knockout mice. J Invest Dermatol 115:234-44.

Di Nardo A, Giannetti A, Seidenar S. (1998) Ceramide and cholesterol composition of the skin of
patients with atopic dermatitis. Acta Derm Vener 78:27-30.

DiColandrea T, Karashima T, Maatta A, Watt FM. (2000) Subcellular distribution of envoplakin and
periplakin: insights into their role as precursors of the epidermal cornified envelope. J Cell Biol
151:573-86.

DiPietro LA, Burdick M, Low Q, Kunkel SL, Strieter RM. (1998) MIP-1a as critical macrophage
chemoattractant in murine wound repair. J Clin Invest 101:1693-8.

DiPietro LA, Polverini PJ, Rahbe SM, Kovacs EJ. (1995) Modulation of JE/MCP-1 expression in
dermal wound repair. Am J Pathol 146:868-75.

Djian P, Easley K, Green H. (2000) Targeted Ablation of the Murine Involucrin Gene. J Cell Biol
151:381-8.

275
Dong S, Kanno T, Yamaki A, Kojima T, Shiraiwa M, Kawada A, et al. (2006) NF-Y and Sp1/Sp3 are
involved in the transcriptional regulation of the peptidylarginine deiminase type III gene (PADI3) in
human keratinocytes. Biochem J 397:449-59.

Dong S, Kojima T, Shiraiwa M, Mechin MC, Chavanas S, Serre G, et al. (2005) Regulation of the
expression of peptidylarginine deiminase type II gene (PADI2) in human keratinocytes involves Sp1
and Sp3 transcription factors. J Invest Dermatol 124:1026-33.

Dong S, Ying S, Kojima T, Shiraiwa M, Kawada A, Méchin MC, et al. (2008) Crucial roles of MZF1
and Sp1 in the transcriptional regulation of the peptidylarginine deiminase type I gene (PADI1) in
human keratinocytes. J Invest Dermatol 128:549-57.

Dong S, Zhang Z, Takahara H. (2007) Estrogen-enhanced peptidylarginine deiminase type IV gene

(PADI4) expression in MCF-7 cells is mediated by estrogen receptor-alpha-promoted transfactors
activator protein-1, nuclear factor-Y, and Sp1. Mol Endocrinol 21:1617-29.

Douguet D, Labesse G. (2001) Easier threading through web-based comparisons and cross-validations.
Bioinformatics 17:752-3.

Dove KL, Summer JS. (1992) Tetrahedra with integer edges and interger volume. Math Mag 65:104-
111.

Drew AF, Liu H, Davidson JM, Daugherty CC, Degen JL. (2001) Wound-healing defects in mice
lacking fibrinogen. Blood 97:3691-8.

Droin NM, Green DR. (2004) Role of Bcl-2 family members in immunity and disease. Biochim
Biophys Acta - Mol Cell Res 1644:179-88.

Dvorak HF, Harvey VS, Estrella P, Brown LF, McDonagh J.(1987) Fibrin containing gels induce
angiogenesis. Implications for tumor stroma generation and wound healing. Lab Invest 57:673-86.

Eckert RL, Crish JF, Robinson NA. (1997) The epidermal keratinocyte as a model for the study of
gene regulation and cell differentiation. Physiol Rev 77:397-424.

Egberts F, Heinrich M, Jensen JM, Winoto-Morbach S, Pfeiffer S, Wickel M, et al. (2004) Cathepsin
D is involved in the regulation of transglutaminase 1 and epidermal differentiation. J Cell Sci
117:2295-307.

Egozi EI, Ferreira AM., Burns AL, Gamelli RL, Dipietro LA. (2003) Mast cells modulate the
inflammatory but not the proliferative response in healing wounds. Wound Repair Regen 11:46-54.

Ehrhardt P, Johanna MB, Jens-Michael J. (2008) The skin: an indispensable barrier. Exp Dermatol
17:1063-72.

Ekholm IE, Brattsand M, Egelrud T. (2000) Stratum corneum tryptic enzyme in normal epidermis: a
missing link in the desquamation process? J Invest Dermatol 114:56-63.

Elias PM, Menon GK. (1991) Structural and lipid biochemical correlates of the epidermal
permeability barrier. Adv Lipid Res 24:1-26.

Elias PM, Ahn SK, Denda M, Brown BE, Crumrine D, Kimutai LK, et al. (2002) Modulations in
epidermal calcium regulate the expression of differentiation-specific markers. J Invest Dermatol
119:1128-36.

276
Elias PM, Crumrine D, Rassner U, Hachem J-P, Menon GK, Man W, et al. (2004) Basis for abnormal
desquamation and permeability barrier dysfunction in RXLI. J Invest Dermatol 122:314-9.

Eming SA, Krieg T, Davidson JM. (2007a) Inflammation in wound Repair: molecular and cellular
mechanisms. J Invest Dermatol 127:514-25.

Eming SA, Werner S, Bugnon P, Wickenhauser C, Siewe L, Utermohlen O. (2007b) Accelerated

wound closure in mice deficient for interleukin-10. Am J Pathol 170:188-202.

Engelhardt E, Toksoy A, Goebeler M, Debus S, Brocker E, Gillitzer R. (1998) Chemokines IL-8,

GROa, MCP-1, IP-10, and Mig are sequentially and differentially expressed during phase-specific
infiltration of leukocyte subsets in human wound healing. Am J Pathol 153:1849-60.

Escamez MJ, Garcia M, Larcher F, Meana A, Munoz E, Jorcano JL, et al. (2004) An in vivo model of
wound healing in genetically modified skin-humanized mice. J Invest Dermatol 123:1182-91.

Esposito G, Vitale AM, Leijten FP, Strik AM, Koonen-Reemst AM, Yurttas P, et al. (2007)
Peptidylarginine deiminase (PAD) 6 is essential for oocyte cytoskeletal sheet formation and female
fertility. Mol Cell Endocrinol 273:25-31.

Fallon PG, Sasaki T, Sandilands A, Campbell LE, Saunders SP, Mangan NE, et al. (2009) A
homozygous frameshift mutation in the mouse Flg gene facilitates enhanced percutaneous allergen
priming. Nat Genet 41:602-8.

Farago B, Talian GC, Maasz A, Magyari L, Horvatovich K, Kovacs B, et al. (2007) Prevalence of
functional haplotypes of the peptidylarginine deiminase citrullinating enzyme gene in patients with
rheumatoid arthritis: no influence of the presence of anti-citrullinated peptide antibodies. Clin Exp
Rheumatol 25:523-8.

Feingold KR. (2007) Thematic review series: Skin Lipids. The role of epidermal lipids in cutaneous
permeability barrier homeostasis. J Lipid Res 48:2531-46.

Feng YQ, Warin R, Li T, Olivier E, Besse A, Lobell A, et al. (2005) The human beta-globin locus
control region can silence as well as activate gene expression. Mol Cell Biol 25:3864-74.

Florin L, Knebel J, Zigrino P, Vonderstrass B, Mauch C, Schorpp-Kistner M. (2006) Delayed wound

healing and epidermal hyperproliferation in mice lacking JunB in the skin. J Invest Dermatol 126:902-
11.

Fluhr JW, Kao J, Jain M, Ahn SK, Feingold KR, Elias PM. (2001) Generation of free fatty acids from
phospholipids regulates stratum corneum acidification and integrity. J Invest Dermatol 117:44-51.

Foulquier C, Sebbag M, Clavel C, Chapuy-Regaud S, Al Badine R, Mechin MC, et al. (2007) Peptidyl
arginine deiminase type 2 (PAD-2) and PAD-4 but not PAD-1, PAD-3, and PAD-6 are expressed in
rheumatoid arthritis synovium in close association with tissue inflammation. Arthritis Rheum 56:3541-
53.

Frank S, Kampfer H, Wetzler C, Stallmeyer B, Pfeilschifter J. (2000) Large induction of the

chemotactic cytokine RANTES during cutaneous wound repair: a regulatory role for nitric oxide in
keratinocyte-derived RANTES expression. Biochem J 1:265-73.

Freinkel RK, Traczyk TN. (1985) Lipid composition and acid hydrolase content of lamellar granules
of fetal rat epidermis. J Invest Dermatol 85:295-8.

277
Fuchs E, Weber K. (1994) Intermediate filaments: structure, dynamics, function, and disease. Annu
Rev Biochem 63:345-82.

Fuchs TA, Abed U, Goosmann C, Hurwitz R, Schulze I, Wahn V, et al. (2007) Novel cell death
program leads to neutrophil extracellular traps. J Cell Biol 176:231-41.

Fujisaki M, Sugawara K (1981) Properties of peptidylarginine deiminasePeptidylarginine Deiminase

from the epidermisEpidermis of newborn [Link] Rats. J Biochem (Tokyo) 89:257-63.

Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, et al. (2002) Claudin-based tight
junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J
Cell Biol 156:1099-111.

Gailit J, Clarke C, Newman D, Tonnesen MG, Mosesson MW, Clark RAF. (1997) Human fibroblasts
bind directly to fibrinogen at RGD sites through integrin αvβ3. Exp Cell Res 232:118-26.

Galliano M-F, Toulza E, Gallinaro Hln, Jonca N, Ishida-Yamamoto A, Serre G, et al. (2006) A Novel
Protease Inhibitor of the α2-Macroglobulin Family Expressed in the Human Epidermis. J Biol Chem
281:5780-9.

Gallucci RM, Someonova PP, Matheson JM, Kommineni C, Guriel JL, Sugawara T. (2000) Impaired
cutaneous wound healing in IL-6-deficient and immunosuppressed mice. FASEB J 14:2525-31.

Gandarillas A. (2000) Epidermal differentiation, apoptosis, and senescence: common pathways? Exp
Gerontol 35:53-62.

Garlick JA, Taichman LB. (1994) Fate of human keratinocytes during reepithelialization in an
organotypic culture model. Lab Invest 70:916-24.

Garrod DR, Merritt AJ, Nie Z. (2002) Desmosomal cadherins. Curr Opin Cell Biol 14:537-45.

Ghadially R, Reed JT, Elias PM. (1996) Stratum corneum structure and function correlates with
phenotype in psoriasis. J Invest Dermatol 107:558-64.

Gibson DF, Ratnam AV, Bikle DD. (1996) Evidence for separate control mechanisms at the message,
protein, and enzyme activation levels for transglutaminase during calcium-induced differentiation of
normal and transformed human keratinocytes. J Invest Dermatol 106:154-61.

Gillitzer R, Goebeler M. (2001) Chemokines in cutaneous wound healing. J Leukoc Biol 69:513-21.

Gilliver SC, Ashworth JJ, Ashcroft GS. (2007) The hormonal regulation of cutaneous wound healing.
Clin Dermatol 25:56-62.

Ginsberg MH, Du X, Plow EF. (1992) Inside-out integrin signalling. Cur Opin Cell Biol 4:766-71.

Girbal-Neuhauser E, Durieux JJ, Arnaud M, Dalbon P, Sebbag M, Vincent C, et al. (1999) The
epitopes targeted by the rheumatoid arthritis-associated antifilaggrin autoantibodies are
posttranslationally generated on various sites of (pro)filaggrin by deimination of arginine residues. J
Immunol 162:585-94.

Grayson S, Johnson-Winegar AG, Wintroub BU, Isseroff RR, Epstein EH Jr., Elias PM. (1985)
Lamellar body-enriched fractions from neonatal mice: preparative techniques and partial
characterization. J Invest Dermatol 85:289-94.

Green H. (1977) Terminal differentiation of cultured human epidermal cells. Cell 11:405-16.

278
Greer DJ, Andreadis. (2003) A novel role of fibrin in epidermal healing: Plasminogen-mediated
migration and selective detachment of differentiated keratinocytes. J Invest Dermatol 121:1210-6.

Grimson A, Farh KK-H, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP. (2007) MicroRNA
targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27:91-105.

Grose R, Werner S. (2004) Wound-healing studies in transgenic and knockout mice. Mol Biotechnol
28:147-66.

Gu L-H, Coulombe PA. (2007) Keratin function in skin epithelia: a broadening palette with surprising
shades. Cur Opin Cell Biol 19:13-23.

Guerrin M, Ishigami A, Mechin MC. (2003) cDNA cloning, gene organization and expression analysis
of human peptidylarginine deiminase type I. Biochem J 370:167-74.

Guex N, Peitsch MC. (1997) Swiss-Model and the sxiss-Pdb viewer: An environment for comparative
protein modeling. Electroph 18:2714-23.

Gurtner GC, Werner S, Barrandon Y, Longaker MT. (2008) Wound repair and regeneration. Nature
453:314-21.

Hachem J-P, Crumrine D, Fluhr J, Brown BE, Feingold KR, Elias PM. (2003) pH directly regulates
epidermal permeability barrier homeostasis, and stratum corneum integrity/cohesion. J Invest
Dermatol 121:345-53.

Hachem J-P, Houben E, Crumrine D, Man M-Q, Schurer N, Roelandt T, et al. (2006) Serine protease
signaling of epidermal permeability barrier homeostasis. J Invest Dermatol 126:2074-86.

Haftek M, Simon M, Kanitakis J, Marechal S, Claudy A, Serre G, et al. (1997) Expression of

corneodesmosin in the granular layer and stratum corneum of normal and diseased epidermis. Br J
Dermatol 137:864-73.

Hagiwara T, Nakashima K, Hirano H, Senshu T, Yamada M. (2002) Deimination of arginine residues

in nucleophosmin/B23 and histones in HL-60 granulocytes. Biochem Biophys Res Commun 290:979-
83.

Halvorsen EH, Pollmann S, Gilboe IM, van der Heijde D, Landewe R, Odegard S, et al. (2008) Serum
IgG antibodies to peptidylarginine deiminase 4 in rheumatoid arthritis and associations with disease
severity. Ann Rheum Dis 67:414-7.

Hardman MJ, Sisi P, Banbury DN, Byrne C. (1998) Patterned acquisition of skin barrier function
during development. Development 125:1541-52.

Harris ML, Darrah E, Lam GK, Bartlett SJ, Giles JT, Grant AV, et al. (2008) Association of
autoimmunity to peptidyl arginine deiminase type 4 with genotype and disease severity in rheumatoid
arthritis. Arthritis Rheum 58:1958-67.

Hatano Y, Man M-Q, Uchida Y, Crumrine D, Scharschmidt TC, Kim EG, et al. (2009) Maintenance
of an Acidic Stratum Corneum Prevents Emergence of Murine Atopic Dermatitis. J Invest Dermatol
129:1824-35.

Hennings H, Michael D, Cheng C, Steinert P, Holbrook K, Yuspa SH. (1980) Calcium regulation of
growth and differentiation of mouse epidermal cells in culture. Cell 19:245-54.

279
Hirotani T, Manabe M, Ogawa H, Murayama K, Sugawara T. (1982) Isolation and characterization of
horny cell membrane. Arch Dermatol Res 274:169-77.

Holleran WM, Takagi Y, Menon GK, Legler G, Feingold KR, Elias PM. (1993) Processing of
epidermal glucosylceramides is required for optimal mammalian cutaneous permeability barrier
function. J Clin Invest 91:1656-64.

Horikoshi T, Arany I, Rajaraman S, Chen SH, Brysk H, Lei G, et al. (1998) Isoforms of cathepsin D
and human epidermal differentiation. Biochimie 80:605-12.

Hosomi J, Hosoi J, Abe E, Suda T, Kuroki T. (1983) Regulation of terminal differentiation of cultured
mouse epidermal cells by 1 alpha,25-dihydroxyvitamin D3. Endocrinol 113:1950-7.

Howell MD, Fairchild HR, Kim BE, Bin L, Boguniewicz M, Redzic JS, et al. (2008) Th2 cytokines
act on S100/A11 to downregulate keratinocyte differentiation. J Invest Dermatol 128:2248-58.

Howell MD, Kim BE, Gao P, Grant AV, Boguniewicz M, Debenedetto A, et al. (2007) Cytokine
modulation of atopic dermatitis filaggrin skin expression. J Allergy Clin Immunol 120:150-5.

Huber M, Rettler I, Bernasconi K, Frenk E, Lavrijsen SP, Ponec M, et al. (1995) Mutations of
keratinocyte transglutaminase in lamellar ichthyosis. Science 267:525-8.

Iba Y, Shibata A, Kato M, Masukawa T. (2004) Possible involvement of mast cells in collagen
remodelling in the late phase of cutaneous wound healing in mice. Int Immunopharmacol 4:1873-80.

Igarashi S, Takizawa T, Yasuda Y, Uchiwa H, Hayashi S, Brysk H, et al. (2004) Cathepsin D, but not
cathepsin E, degrades desmosomes during epidermal desquamation. Br J Dermatol 151:355-61.

Ikari K, Kuwahara M, Nakamura T, Momohara S, Hara M, Yamanaka H, et al. (2005) Association

between PADI4 and rheumatoid arthritis: a replication study. Arthritis Rheum 52:3054-7.

Irvine AD. (2007) Fleshing Out Filaggrin Phenotypes. J Invest Dermatol 127:504-7.

Ishida-Yamamoto A, McGrath JA, Judge MR, Leigh IM, Lane EB, Eady RA. (1992) Selective
involvement of keratins K1 and K10 in the cytoskeletal abnormality of epidermolytic hyperkeratosis
(bullous congenital ichthyosiform erythroderma). J Invest Dermatol 99:19-26.

Ishida-Yamamoto A, Senshu T, Eady RA, Takahashi H, Shimizu H, Akiyama M, et al. (2002)

Sequential reorganization of cornified cell keratin filaments involving filaggrin-mediated compaction
and keratin 1 deimination. J Invest Dermatol 118:282-7.

Ishida-Yamamoto A, Senshu T, Takahashi H, Akiyama K, Nomura K, Iizuka H. (2000) Decreased

deiminated keratin K1 in psoriatic hyperproliferative epidermis. J Invest Dermatol 114:701-5.

Ishida Y, Kondo T, Takayasu T, Iwakura Y, Mukaida N. (2004) The essential involvement of cross-
talk between IFN-γ and TGF-β in the skin wound healing process. J Immunol 172:1848-55.

Ishigami A, Ohsawa T, Asaga H, Akiyama K, Kuramoto M, Maruyama N. (2002) Human

peptidylarginine deiminase type II: molecular cloning, gene organization, and expression in human
skin. Arch Biochem Biophys 407:25-31.

Ishigami A, Ohsawa T, Hiratsuka M, Taguchi H, Kobayashi S, Saito Y, et al. (2005) Abnormal

accumulation of citrullinated proteins catalyzed by peptidylarginine deiminase in hippocampal extracts
from patients with Alzheimer's disease. J Neurosci Res 80:120-8.

280
Ito M. (2005) Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of
the epidermis. Nature Med 11:1351-4.

Ito M. (2007) Wnt-dependent de novo hair follicle regeneration in adult mouse skin after wounding.
Nature 447:316-20.

Jackson SM, Williams ML, Feingold KR, Elias PM. (1993) Pathobiology of the stratum corneum.
West J Med 158:279-85.

Jang B, Kim E, Choi J-K, Jin J-K, Kim J-I, Ishigami A, et al. (2008) Accumulation of Citrullinated
Proteins by Up-Regulated Peptidylarginine Deiminase 2 in Brains of Scrapie-Infected Mice: A
Possible Role in Pathogenesis. Am J Pathol 173:1129-42.

Jang S-I, Steinert PM, Markova NG. (1996) Activator protein 1 activity is involved in the regulation
of the cell type-specific expression from the proximal promoter of the human profilaggrin gene. J Biol
Chem 271:24105-14.

Jang SI, Karaman-Jurukovska N, Morasso MI, Steinert PM, Markova NG. (2000) Complex
interactions between epidermal POU domain and activator protein 1 transcription factors regulate the
expression of the profilaggrin gene in normal human epidermal keratinocytes. J Biol Chem 275:15295-
304.

Jang SI, Steinert PM. (2002) Loricrin expression in cultured human keratinocytes is controlled by a
complex interplay between transcription factors of the Sp1, CREB, AP1, and AP2 families. J Biol
Chem 277:42268-79.

Janmey PA, Winer JP, Weisel JW. (2009) Fibrin gels and their clinical and bioengineering
applications. J R Soc Interface 6:1-10.

Jensen JM, Schutze S, Forl M, Kronke M, Proksch E. (1999) Roles for tumor necrosis factor receptor
p55 and sphingomyelinase in repairing the cutaneous permeability barrier. J Clin Invest 104:1761-70.

Jessen BA, Qin Q, Rice RH. (2000) Functional AP1 and CRE response elements in the human
keratinocyte transglutaminase promoter mediating Whn suppression. Gene 254:77-85.

Johansen C, Kragballe K, Rasmussen M, Dam TN, Iversen L. (2004) Activator protein 1 DNA binding
activity is decreased in lesional psoriatic skin compared with nonlesional psoriatic skin. Br J Dermatol
151:600-7.

John AM. (2008) Filaggrin and the great epidermal barrier grief. Aust J Derm 49:67-74.

Jonca N, Caubet C, Guerrin M, Simon M, Serre G. (2009) Corneodesmosomal proteins. In Skin

Moizturization, 2nd [Link] AV, Leyden JJ Ed. Informa Healthcare, New-York, 99-122.

Jonca N, Guerrin M, Hadjiolova K, Caubet Cc, Gallinaro Hln, Simon M, et al. (2002)
Corneodesmosin, a component of epidermal corneocyte desmosomes, displays homophilic adhesive
properties. J Biol Chem 277:5024-9.

Kalinin AE, Kajava AV, Steinert PM. (2002) Epithelial barrier function: assembly and structural
features of the cornified cell envelope. Bioessays 24:789-800.

Kamata Y, Taniguchi A, Yamamoto M, Nomura J, Ishihara K, Takahara H, et al. (2009) Neutral

cysteine protease bleomycin hydrolase is essential for the breakdown of deiminated filaggrin into
amino acids. J Biol Chem 284:12829-36.

281
Kang CP, Lee HS, Ju H, Cho H, Kang C, Bae SC. (2006) A functional haplotype of the PADI4 gene
associated with increased rheumatoid arthritis susceptibility in Koreans. Arthritis Rheum 54:90-6.

Kanno T, Kawada A, Yamanouchi J. (2000) Human peptidylarginine deiminase type III: Molecular
cloning and nucleotide sequence of the cDNA, properties of the recombinant enzyme, and
immunohistochemical localization in human skin. J Invest Dermatol 115:813-23.

Katagiri C, Sato J, Nomura J, Denda M. (2003) Changes in environmental humidity affect the water-
holding property of the stratum corneum and its free amino acid content, and the expression of
filaggrin in the epidermis of hairless mice. J Dermatol Sci 31:29-35.

Keilhoff G, Prell T, Langnaese K, Mawrin C, Simon M, Fansa H, et al. (2007) Expression pattern of
peptidylarginine deiminase in rat and human Schwann cells. Dev Neurobiol 68:101-14.

Kim JK, Mastronardi FG, Wood DD, Lubman DM, Zand R, Moscarello MA. (2003) Multiple
Sclerosis: an important role for post-translational modifications of myelin basic protein in
pathogenesis. Mol Cell Proteomics 2:453-62.

Kim SY, Bae CD. (1998) Calpain inhibitors reduce the cornified cell envelope formation by inhibiting
proteolytic processing of transglutaminase 1. Exp Mol Med 30:257-62.

King IA, Sullivan KH, Bennett R, Jr., Buxton RS. (1995) The desmocollins of human foreskin
epidermis: identification and chromosomal assignment of a third gene and expression patterns of the
three isoforms. J Invest Dermatol 105:314-21.

Kizawa K, Takahara H, Troxler H, Kleinert P, Mochida U, Heizmann CW. (2008) Specific

citrullination causes assembly of a globular S100A3 homotetramer. J Biol Chem 283:5004-13.

Klareskog L, Stolt P, Lundberg K, Källberg H, Bengtsson C, Grunewald J, et al. (2006) A new model
for an etiology of rheumatoid arthritis: smoking may trigger HLA-DR (shared epitope)-restricted
immune reactions to autoantigens modified by citrullination. Arthritis Rheum 54:38-46.

Kubo M, Van De Water L, Plantefaber LC. (2001) Fibrinogen and fibrin are anti-adhesive for
keratinocytes: A mechanism for fibrin eschar slough during wound repair. J Invest Dermatol
117:1369-81.

Kuempel D, Swartzendruber DC, Squier CA, Wertz PW. (1998) In vitro reconstitution of stratum
corneum lipid lamellae. Biochim Biophys Acta 1372:135-40.

Kurokawa I, Mizutani H, Kusumoto K, Nishijima S, Tsujita-Kyutoku M, Shikata N, et al. (2006)

Cytokeratin, filaggrin, and p63 expression in reepithelialization during human cutaneous wound
healing. Wound Repair Regen 14:38-45.

Laethem AV, Claerhout S, Garmyn M, Agostinis P. (2005) The sunburn cell: regulation of death and
survival of the keratinocyte. Int J Biochem Cell Biol 37:1547-53.

Langton AK, Herrick SE, Headon DJ. (2007) An extended epidermal response heals cutaneous
wounds in the absence of a hair follicle stem cell contribution. J Invest Dermatol 128:1311-8.

Lechler T, Fuchs E. (2005) Asymmetric cell divisions promote stratification and differentiation of
mammalian skin. Nature 437:275-80.

Leclerc EA, Huchenq A, Mattiuzzo NR, Metzger D, Chambon P, Ghyselinck NB, et al. (2009)
Corneodesmosin gene ablation induces lethal skin-barrier disruption and hair-follicle degeneration
related to desmosome dysfunction. J Cell Sci 122:2699-709.

282
Lee SH, Elias PM, Proksch E, Menon GK, Mao-Quiang M, Feingold K. (1992) Calcium and
potassium are important regulators of barrier homeostasis in murine epidermis. J Clin Invest 89:530-8.

Lee Y-H, Coonrod SA, Kraus WL, Jelinek MA, Stallcup MR. (2005) Regulation of coactivator
complex assembly and function by protein arginine methylation and demethylimination. Proc Natl
Acad Sci USA 102:3611-6.

Leech SN, Moss C. (2007) A current and online genodermatosis database. Br J Dermatol 156:1115-
48.

Levy V, Lindon C, Harfe BD, Morgan BA. (2005) Distinct stem cell populations regenerate the
follicle and interfollicular epidermis. Dev Cell 9:855-61.

Li G. (2003) c-Jun is essential for organization of the epidermal leading edge. Dev Cell 4:865-77.

Li P, Yao H, Zhang Z, Li M, Luo Y, Thompson PR, et al. (2008) Regulation of p53 Target Gene
Expression by Peptidylarginine Deiminase 4. Mol Cell Biol 28:4745-58.

Lippens S, Denecker G, Ovaere P, Vandenabeele P, Declercq W. (2005) Death penalty for

keratinocytes: apoptosis versus cornification. Cell Death Differ 12:1497-508.

Lippens S, Hoste E, Vandenabeele P, Agostinis P, Declercq W. (2009) Cell death in the skin.
Apoptosis 14:549-69.

Lippens S, Kockx M, Knaapen M, Mortier L, Polakowska R, Verheyen A, et al. (2000) Epidermal

differentiation does not involve the pro-apoptotic executioner caspases, but is associated with caspase-
14 induction and processing. Cell Death Differ 7:1218-24.

List K, Szabo R, Wertz PW, Segre J, Haudenschild CC, Kim S-Y, et al. (2003) Loss of proteolytically
processed filaggrin caused by epidermal deletion of Matriptase/MT-SP1. J Cell Biol 163:901-10.

Liu GY, Liao YF, Chang WH, Liu CC, Hsieh MC, Hsu PC, et al. (2006) Overexpression of
peptidylarginine deiminase IV features in apoptosis of haematopoietic cells. Apoptosis 11:183-96.

Loos T, Mortier A, Gouwy M, Ronsse I, Put W, Lenaerts J-P, et al. (2008) Citrullination of CXCL10
and CXCL11 by peptidylarginine deiminase: a naturally occurring posttranslational modification of
chemokines and new dimension of immunoregulation. Blood 112:2648-56.

Loos T, Opdenakker G, Van Damme J, Proost P. (2009) Citrullination of CXCL8 increases its potency
to mobilize neutrophils in the blood circulation. Haematol 94:1346-53

Lorand L, Graham RM. (2003) Transglutaminases: crosslinking enzymes with pleiotropic functions.
Nat Rev Mol Cell Biol 4:140-56.

Lu J, Goldstein KM, Chen P, Huang S, Gelbert LM, Nagpal S. (2005) Transcriptional profiling of
keratinocytes reveals a vitamin D- regulated epidermal differentiation network. J Invest Dermatol
124:778-85.

Lundstrom A, Serre G, Haftek M, Egelrud T. (1994) Evidence for a role of corneodesmosin, a protein
which may serve to modify desmosomes during cornification, in stratum corneum cell cohesion and
desquamation. Arch Dermatol Res 286:369-75.

283
Luo Y, Knuckley B, Lee YH, Stallcup MR, Thompson PR. (2006) A fluoroacetamidine-based
inactivator of protein arginine deiminase 4: design, synthesis, and in vitro and in vivo evaluation. J Am
Chem Soc 128:1092-3.

Lutolf MP, Hubbell JA. (2005) Synthetic biomaterials as instructive extracellular microenvironments
for morphogenesis in tissue engineering. Nature Biotechnol 23:47-55.

Maass K, Ghanem A, Kim J-S, Saathoff M, Urschel S, Kirfel G, et al. (2004) Defective epidermal
barrier in neonatal mice lacking the C-terminal region of connexin 43. Mol Biol Cell 15:4597-608.

Maatta A, DiColandrea T, Groot K, Watt FM. (2001) Gene targeting of envoplakin, a cytoskeletal
linker protein and precursor of the epidermal cornified envelope. Mol Cell Biol 21:7047-53.

Mack JW, Steven AC, Steinert PM. (1993) The mechanism of interaction of filaggrin with
intermediate filaments. The ionic zipper hypothesis. J Mol Biol 232:50-66.

Madison KC. (2003) Barrier function of the skin: "la raison d'être" of the epidermis. J Invest Dermatol
121:231-41.

Madison KC, Swartzendruber DC, Wertz PW, Downing DT. (1987) Presence of intact intercellular
lipid lamellae in the upper layers of the stratum corneum. J Invest Dermatol 88:714-8.

Madlener M, Parks WC, Werner S. (1998) Matrix Metalloproteinases (MMPs) and their physiological
inhibitors (TIMPs) are differentially expressed during excisional skin wound repair. Exp Cell Res
242:201-10.

Maijgren S, Sur I, Nilsson M, Toftgard R. (2004) Involvement of RFX proteins in transcriptional

activation from a Ras-responsive enhancer element. Arch Dermatol Res 295:482-9.

Makrygiannakis D, af Klint E, Lundberg IE, Lofberg R, Ulfgren AK, Klareskog L, et al. (2006)
Citrullination is an inflammation-dependent process. Ann Rheum Dis 65:1219-22.

Makrygiannakis D, Hermansson M, Ulfgren AK, Nicholas AP, Zendman AJW, Eklund A, et al.
(2008) Smoking increases peptidylarginine deiminase 2 enzyme expression in human lungs and
increases citrullination in BAL cells. Ann Rheum Dis 67:1488-92.

Manabe M, Sanchez M, Sun TT, Dale BA. (1991) Interaction of filaggrin with keratin filaments
during advanced stages of normal human epidermal differentiation and in ichthyosis vulgaris.
Differentiation 48:43-50.

Mansbridge JN, Knapp M. (1987) Changes in keratinocyte maturation during wound Healing. J Invest
Dermatol 89:253-63.

Mao-Qiang M, Feingold KR, Jain M, Elias PM. (1995) Extracellular processing of phospholipids is
required for permeability barrier homeostasis. J Lipid Res 36:1925-35.

Mao-Qiang M, Jain M, Feingold KR, Elias PM. (1996) Secretory phospholipase A2 activity is
required for permeability barrier homeostasis. J Invest Dermatol 106:57-63.

Marshall D, Hardman MJ, Nield KM, Byrne C. (2001) Differentially expressed late constituents of the
epidermal cornified envelope. Proc Natl Acad Sci USA 98:13031-6.

Martin N, Patel S, Segre JA. (2004) Long-range comparison of human and mouse Sprr loci to identify
conserved noncoding sequences involved in coordinate regulation. Genome Res 14:2430-8.

284
Martin P. (1997) Wound Healing--Aiming for Perfect Skin Regeneration. Science 276:75-81.

Martin P, Leibovich SJ. (2005) Inflammatory cells during wound repair: the good, the bad and the
ugly. Trends Cell Biol 15:599-607.

Martinez J, Ferber A, Bach TL, Yaen CH. (2001) Interaction of Fibrin with VE-Cadherin. Ann N Y
Acad Sci 936:386-405.

Maruoka Y, Harada H, Mitsuyasu T, Seta Y, Kurokawa H, Kajiyama M, et al. (1997) Keratinocytes

become terminally differentiated in a process involving programmed cell death. Biochem Biophys Res
Commun 238:886-90.

Masson-Bessiere C, Sebbag M, Girbal-Neuhauser E, Nogueira L, Vincent C, Senshu T, et al. (2001)

The major synovial targets of the rheumatoid arthritis-specific antifilaggrin autoantibodies are
deiminated forms of the {{alpha}}- and {{beta}}-chains of fibrin. J Immunol 166:4177-84.

Mastronardi FG, Wood DD, Mei J, Raijmakers R, Tseveleki V, Dosch H-M, et al. (2006) Increased
citrullination of histone H3 in multiple sclerosis brain and animal models of demyelination: a role for
tumor necrosis factor-induced peptidylarginine deiminase 4 translocation. J Neurosci 26:11387-96.

Matsuki M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, et al. (1998)

Defective stratum corneum and early neonatal death in mice lacking the gene for transglutaminase 1
(keratinocyte transglutaminase). Proc Natl Acad Sci USA 95:1044-9.

McGrath J, A. (2008a) Filaggrin and the great epidermal barrier grief. Austr J Dermatol 49:67-74.

McGrath JA, Uitto J. (2008b) The filaggrin story: novel insights into skin-barrier function and disease.
Trends Mol Med 14:20-7.

McKay IA, Leigh IM. (1995) Altered keratinocyte growth and differentiation in psoriasis. Clin
Dermatol 13:105-14.

McKinley-Grant LJ, Idler WW, Bernstein IA, Parry DA, Cannizzaro L, Croce CM, et al. (1989)
Characterization of a cDNA clone encoding human filaggrin and localization of the gene to
chromosome region 1q21. Proc Natl Acad Sci USA 86:4848-52.

Méchin MC, Enji M, Nachat R, Chavanas S, Charveron M, Ishida-Yamamoto A, et al. (2005) The
peptidylarginine deiminases expressed in human epidermis differ in their substrate specificities and
subcellular locations. Cell Mol Life Sci 62:1984-95.

Méchin MC, Sebbag M, Arnaud J, Nachat R, Foulquier C, Adoue V, et al. (2007) Update on
peptidylarginine deiminases and deimination in skin physiology and severe human diseases. Int J
Cosmet Sci 29:147-68.

Mehic D, Bakiri L, Ghannadan M, Wagner EF, Tschachler E. (2005) Fos and jun proteins are
specifically expressed during differentiation of human keratinocytes. J Invest Dermatol 124:212-20.

Melino G, Knight RA, Nicotera P. (2005) How many ways to die? How many different models of cell
death? Cell Death Differ 12:1457-62.

Menon GK, Feingold KR, Elias PM. (1992) Lamellar Body Secretory Response to Barrier Disruption.
J Invest Dermatol 98:279-89.

Michalik L. (2001) Impaired skin wound healing in peroxisome proliferator-activated receptor

(PPAR)[alpha] and PPAR[beta] mutant mice. J Cell Biol 154:799-814.

285
Mizoguchi M, Manabe M, Kawamura Y, Kondo Y, Ishidoh K, Kominami E, et al. (1998) Deimination
of 70-kD nuclear protein during epidermal apoptotic events in vitro. J Histochem Cytochem 46:1303-
9.

Moscarello M, Mastronardi F, Wood D. (2007) The Role of Citrullinated proteins suggests a novel
mechanism in the pathogenesis of multiple sclerosis. Neurochem Res 32:251-6.

Moscarello MA, Pritzker L, Mastronardi FG, Wood DD. (2002) Peptidylarginine deiminase: a
candidate factor in demyelinating disease. J Neurochem 81:335-43.

Mosesson MW, Siebenlist KR, Meh DA. (2001) The structure and biological features of fibrinogen
and fibrin. Ann NY Acad Sci 936:11-30.

Musse AA, Li Z, Ackerley CA, Bienzle D, Lei H, Poma R, et al. (2008) Peptidylarginine deiminase 2
(PAD2) overexpression in transgenic mice leads to myelin loss in the central nervous system. Dis
Mods Mech 1:229-40.

Nachat R. (2005) Identification et caractérisation des Peptidyl-Arginine Désiminases épidermique, de

nouvelles cibles pharmacologiques impliquées dans la production du Facteur Naturel d'Hydratation et
la fonction barrière de l'épiderme. Thèse, Université Paul Sabatier, Toulouse.

Nachat R, Méchin MC, Charveron M, Serre G, Constans J, Simon M. (2005a) Peptidylarginine

deiminase isoforms are differentially expressed in the anagen hair follicles and other human skin
appendages. J Invest Dermatol 125:34-41.

Nachat R, Méchin MC, Takahara H, Chavanas S, Charveron M, Serre G, et al. (2005b)

Peptidylarginine deiminase isoforms 1-3 are expressed in the epidermis and involved in the
deimination of K1 and filaggrin. J Invest Dermatol 124:384-93.

Nagata S, Senshu T. (1990) Peptidylarginine deiminase in rat and mouse hemopoietic cells.
Experientia 46:72-4.

Nakashima K, Hagiwara T, Ishigami A. (1999) Molecular characterization of peptidylarginine

deiminase in HL-60 cells induced by retinoic acid and 1alpha,25-dihydroxyvitamin D(3). J Biol Chem
274:27786-92.

Nakashima K, Hagiwara T, Yamada M. (2002) Nuclear localization of peptidylarginine deiminase V

and histone deimination in granulocytes. J Biol Chem 277:49562-8.

Nakayama-Hamada M, Suzuki A, Furukawa H, Yamada R, Yamamoto K. (2008) Citrullinated

fibrinogen inhibits thrombin-catalysed fibrin polymerization. J Biochem 144:393-8.

Nakayama-Hamada M, Suzuki A, Kubota K, Takazawa T, Ohsaka M, Kawaida R, et al. (2005)

Comparison of enzymatic properties between hPADI2 and hPADI4. Biochem Biophys Res Commun
327:192-200.

Neeli I, Khan SN, Radic M. (2008) Histone deimination as a response to inflammatory stimuli in
neutrophils. J Immunol 180:1895-902.

Nemes Z, Fésüs L, and Steinert P. (1999) A novel function for transglutaminase 1: attachment of long-
chain ω-hydroxyceramides to involucrin by ester bond formation. Proc Natl Acad Sci USA 96: 8402-7.

Neub A, Houdek P, Ohnemus U, Moll I, Brandner JM. (2007) Biphasic regulation of AP-1 subunits
during human epidermal wound healing. J Invest Dermatol 127:2453-62.

286
Ng DC, Shafaee S, Lee D, Bikle DD. (2000) Requirement of an AP-1 site in the calcium response
region of the involucrin promoter. J Biol Chem 275:24080-8.

Nickoloff BJ, Bonish BK, Marble DJ, Schriedel KA, DiPietro LA, Gordon KB, et al. (2006) Lessons
learned from psoriatic plaques concerning mechanisms of tissue repair, remodeling, and inflammation.
J Invest Dermatol Symp P 11:16-29.

Odland GF, Holbrook K. (1981) The lamellar granules of epidermis. Curr Probl Dermatol 9:29-49.

Odland G, Ross R. (1968) Human wound repair: I. Epidermal Regeneration. J Cell Biol 39:135-51.

Ohman H VA. (1994) In vivo studies concerning a pH gradient in human stratum corneum and upper
epidermis Acta Derm Venereol 74:375-9.

Okumura N, Haneishi A, Terasawa F. (2009) Citrullinated fibrinogen shows defects in FPA and FPB
release and fibrin polymerization catalyzed by thrombin. Clin Chim Acta 401:119-23.

Oshima H, Rochat A, Kedzia C, Kobayashi K, Barrandon Y. (2001) Morphogenesis and renewal of

hair follicles from adult multipotent stem cells. Cell 104:233-45.

Paladini RD, Takahashi K, Bravo NS, Coulombe PA. (1996) Onset of re-epithelialization after skin
injury correlates with a reorganization of keratin filaments in wound edge keratinocytes: defining a
potential role for keratin 16. J Cell Biol 132:381-97.

Palmer CNA, Irvine AD, Terron-Kwiatkowski A, Zhao Y, Liao H, Lee SP, et al. (2006) Common
loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for
atopic dermatitis. Nat Genet 38:441-6.

Palmer HG, Anjos-Afonso F, Carmeliet G, Takeda H, Watt FM. (2008) The vitamin D receptor is a
Wnt effector that controls hair follicle differentiation and specifies tumor type in adult epidermis.
PLoS ONE 3:e1483.

Pandit AS, Wilson DJ, Feldman DS. (2000) Fibrin scaffold as an effective vehicle for the delivery of
acidic fibroblast growth factor (FGF-1). J Biomater Appl 14:229-42.

Patel GK, Wilson CH, Harding KG, Finlay AY, Bowden PE. (2005) Numerous keratinocyte subtypes
involved in wound re-epithelialization. J Invest Dermatol 126:497-502.

Pearton D, Nirunsuksiri W, Rehemtulla A, Lewis SP, Presland R, Dale B, Presland RB. (2002)
Functional analysis of the profilaggrin N-terminal peptide: identification of domains that regulate
nuclear and cytoplasmic distribution. J Invest Dermatol 119:661-9.

Pearton DJ, Nirunsuksiri W, Rehemtulla A, Lewis SP, Presland RB, Dale BA. (2001) Proprotein
convertase expression and localization in epidermis: evidence for multiple roles and substrates. Exp
Dermatol 10:193-203.

Pillai S, Bikle DD, Mancianti ML, Cline P, Hincenbergs M. (1990) Calcium regulation of growth and
differentiation of normal human keratinocytes: modulation of differentiation competence by stages of
growth and extracellular calcium. J Cell Physiol 143:294-302.

Poumay Y, Herphelin F, Smits P, De Potter IY, Pittelkow MR. (1999) High-cell-density phorbol ester
and retinoic acid upregulate involucrin and downregulate suprabasal keratin 10 in autocrine cultures of
human epidermal keratinocytes. Mol Cell Biol Res Commun 2:138-44.

287
Poumay Y, Pittelkow MR. (1995) Cell density and culture factors regulate keratinocyte commitment
to differentiation and expression of suprabasal K1/K10 keratins. J Invest Dermatol 104:271-6.

Presland RB, Boggess D, Lewis SP, Hull C, Fleckman P, Sundberg JP. (2000) Loss of normal
profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin
disease ichthyosis vulgaris. J Invest Dermatol 115:1072-81.

Presland RB, Coulombe PA, Eckert RL, Mao-Qiang M, Feingold KR, Elias PM. (2004) Barrier
function in transgenic mice overexpressing k16, involucrin, and filaggrin in the suprabasal epidermis.
J Invest Dermatol 123:603-6.

Presland RB, Kimball JR, Kautsky MB, Lewis SP, Lo CY, Dale BA. (1997) Evidence for specific
proteolytic cleavage of the N-terminal domain of human profilaggrin during epidermal differentiation.
J Invest Dermatol 108:170-8.

Pritzker LB, Moscarello MA. (1998) A novel microtubule independent effect of paclitaxel: the
inhibition of peptidylarginine deiminase from bovine brain. Biochim Biophys Acta 1388(1):154-60.

Proksch E, Feingold KR, Elias PM. (1992) Epidermal HMG CoA reductase activity in essential fatty
acid deficiency: barrier requirements rather than eicosanoid generation regulate cholesterol synthesis.
J Invest Dermatol 99:216-20.

Proost P, Loos T, Mortier A, Schutyser E, Gouwy M, Noppen S, et al. (2008) Citrullination of CXCL8
by peptidylarginine deiminase alters receptor usage, prevents proteolysis, and dampens tissue
inflammation. J Exp Med 205:2085-97.

Qiu C, Coutinho P, Frank S, Franke S, Law LY, Martin P. (2003) Targeting connexin 43 expression
accelerates the rate of wound repair. Curr Biol 13:1697-703.

Raijmakers R, Vogelzangs J, Croxford JL, Wesseling P, van Venrooij WJ, Pruijn GJ. (2005)
Citrullination of central nervous system proteins during the development of experimental autoimmune
encephalomyelitis. J Comp Neurol 486:243-53.

Raijmakers R, Vogelzangs J, Raats J, Panzenbeck M, Corby M, Jiang H, et al. (2006) Experimental

autoimmune encephalomyelitis induction in peptidylarginine deiminase 2 knockout mice. J Comp
Neur 498:217-26.

Raja K, Sivamani MS, Garcia RR, Isseroff RR (2007) Wound re-epithelialization: modulating
keratinocyte migration in wound healing. Front Biosci 12:2849-68.

Ratnam AV, Bikle DD, Cho JK (1999) 1,25 dihydroxyvitamin D3 enhances the calcium response of
keratinocytes. J Cell Physiol 178:188-96.

Rawlings AV. (2005) Stratum corneum moisturization at the molecular level : an update in relation to
the dry skin cycle. J Investig Dermatol 124:1099-110.

Rawlings AV, Harding CR. (2004) Moisturization and skin barrier function. Dermatol Ther 17 Suppl
1:43-8.

Raymond AA, Méchin MC, Nachat R, Toulza E, Tazi-Ahnini R, Serre G, et al. (2007) Nine
procaspases are expressed in normal human epidermis, but only caspase-14 is fully processed. BrJ
Dermatol 156:420-7.

Reichrath J. (2007) Vitamin D and the skin: an ancient friend, revisited. Exp Dermatol 16:618-25.

288
Rennekampff H-O, Hansbrough JF, Kiessig V, Doré C, Sticherling M, Schröder J-M. (2000) Bioactive
interleukin-8 is expressed in wounds and enhances wound healing. J Surg Res 93:41-54.

Resing KA, Walsh KA, Haugen-Scofield J, Dale BA. (1989) Identification of proteolytic cleavage
sites in the conversion of profilaggrin to filaggrin in mammalian epidermis. J Biol Chem 264:1837-45.

Rheinwald JG, Green H. (1975) Serial cultivation of strains of human epidermal keratinocytes: the
formation of keratinizing colonies from single cells. Cell 6:331-43.

Richardson DL, Pepper DS, Kay AB. (1976) Chemotaxis for Human Monocytes by Fibrinogen-
derived Peptides. Br J Haematol 32:507-14.

Rippke F, Schreiner V, Doering T, Maibach HI. (2004) Stratum Corneum pH in Atopic Dermatitis:
Impact on Skin Barrier Function and Colonization with Staphylococcus Aureus. Am J Clin Dermatol
5:217-23.

Rogers G, Harding, HWJ, Llewellyn-Smith, IJ. (1977) The origin of citrulline-containing proteins in
the hair follicle and the chemical nature of trichohyalin, an intracellular precursor. Biochim Biophys
Acta 495: 159–75.

Rogers GE, Taylor LD. (1977) The enzymic derivation of citrulline residues from arginine residues in
situ during the biosynthesis of hair proteins that are cross-linked by isopeptide bonds. Adv Exp Med
Biol 86A:283-94.

Romer J, Bugge TH, Fyke C, Lund LR, Flick MJ, Degen JL, et al. (1996) Impaired wound healing in
mice with a disrupted plasminogen gene. Nat Med 2:287-92.

Roop, D. (1995). Defects in the barrier. Science. 267:474-5.

Roth W, Deussing J, Botchkarev VA, Pauly-Evers M, Saftig P, Hafner A, et al. (2000) Cathepsin L
deficiency as molecular defect of furless: hyperproliferation of keratinocytes and pertubation of hair
follicle cycling. Faseb J 14:2075-86.

Rozen S, Skaletsky H. (2000) Primer3 on the www for general users and for biologist programmers.
Methods Mol Biol 132:365-86.

Salomon D, Masgrau E, Vischer S, Ullrich S, Dupont E, Sappino P, et al. (1994) Topography of

mammalian connexins in human skin. J Invest Dermatol 103:240-7.

Sambandam T, Belousova M, Accaviti-Loper MA, Blanquicett C, Guercello V, Raijmakers R, et al.

(2004) Increased peptidylarginine deiminase type II in hypoxic astrocytes. Biochem Biophys Res
Commun 325:1324-9.

Sandilands A, O'Regan GM, Liao H, Zhao Y, Terron-Kwiatkowski A, Watson RM, et al. (2006)
Prevalent and rare mutations in the gene encoding filaggrin cause ichthyosis vulgaris and predispose
individuals to atopic dermatitis. J Invest Dermatol 126:1770-5.

Sandilands A, Smith FJD, Irvine AD, McLean WHI. (2007) Filaggrin's fuller figure: a glimpse into the
genetic architecture of atopic dermatitis. J Invest Dermatol 127:1282-4.

Santoro MM, Gaudino G. (2005) Cellular and molecular facets of keratinocyte reepithelization during
wound healing. Exp Cell Res 304:274-86.

289
Sarafian V, Jans R, Poumay Y. (2006) Expression of lysosome-associated membrane protein 1 (Lamp-
1) and galectins in human keratinocytes is regulated by differentiation. Arch Dermatol Res 298:73-81.

Sato J, Denda M, Nakanishi J, Nomura J, Koyama J. (1998) Cholesterol sulfate inhibits proteases that
are involved in desquamation of stratum corneum. J Invest Dermatol111:189-93.

Sato Y, Ohshima T, Kondo T. (1999) Regulatory role of endogenous IL-10 in cutaneous inflammatory
response of murine wound healing. Biochem Biophys Res Comm 265:194-9.

Schmuth M, Man MQ, Weber F, Gao W, Feingold KR, Fritsch P, et al. (2000) Permeability barrier
disorder in Niemann-Pick disease: sphingomyelin-ceramide processing required for normal barrier
homeostasis. J Invest Dermatol 115:459-66.

Schweizer J, Bowden PE, Coulombe PA, Langbein L, Lane EB, Magin TM, et al. (2006) New
consensus nomenclature for mammalian keratins. J Cell Biol 174:169-74.

Scott IR, Harding CR. (1986) Filaggrin breakdown to water binding compounds during development
of the rat stratum corneum is controlled by the water activity of the environment. Dev Biol 115:84-92.

Sebbag M, Chapuy-Regaud S, Auger I, Petit-Texeira E, Clavel C, Nogueira L, et al. (2004) Clinical

and pathophysiological significance of the autoimmune response to citrullinated proteins in
rheumatoid arthritis. Joint Bone Spine 71:493-502.

Sebbag M, Simon M, Vincent C, Masson BC, Girbal E, Durieux JJ, et al. (1995) The antiperinuclear
factor and the so-called antikeratin antibodies are the same rheumatoid arthritis-specific
autoantibodies. J Clin Invest 95:2672-9.

Seitz CS, Freiberg RA, Hinata K, Khavari PA. (2000) NF-kB determines localization and features of
cell death in epidermis. J Clinl Invest 105:253-60.

Senshu T, Akiyama K, Kan S, Asaga H, Ishigami A, Manabe M. (1995) Detection of deiminated

proteins in rat skin: probing with a monospecific antibody after modification of citrulline residues. J
Invest Dermatol 105:163-9.

Senshu T, Kan S, Ogawa H, Manabe M, Asaga H. (1996) Preferential deimination of keratin K1 and
filaggrin during the terminal differentiation of human epidermis. Biochem Biophys Res Commun
225:712-9.

Senshu T, Sato T, Inoue T, Akiyama K, Asaga H. (1992) Detection of citrulline residues in deiminated
proteins on polyvinylidene difluoride membrane. Anal Biochem 203:94-100.

Serre G, Mils V, Haftek M, Vincent C, Croute F, Reano A, et al. (1991) Identification of late
differentiation antigens of human cornified epithelia, expressed in re-organized desmosomes and
bound to cross-linked envelope. J Invest Dermatol 97:1061-72.

Sevilla LM, Nachat R, Groot KR, Klement JF, Uitto J, Djian P, et al. (2007) Mice deficient in
involucrin, envoplakin, and periplakin have a defective epidermal barrier. J Cell Biol 179:1599-612.

Simon M, Girbal E, Sebbag M, Gomes-Daudrix V, Vincent C, Salama, et al. (1993) The cytokeratin
filament-aggregating protein filaggrin is the target of the so-called "antikeratin antibodies,"
autoantibodies specific for rheumatoid arthritis. J Clin Invest 92:1387-93.

Simon M, Jonca N, Guerrin M, Haftek M, Bernard D, Caubet C, et al. (2001) Refined characterization
of corneodesmosin proteolysis during terminal differentiation of human epidermis and its relationship
to desquamation. J Biol Chem 276:20292-9.

290
Simon M, Montézin M, Guerrin M, Durieux J-J, Serre G. (1997) Characterization and Purification of
Human Corneodesmosin, an Epidermal Basic Glycoprotein Associated with Corneocyte-specific
Modified Desmosomes. J Biol Chem 272:31770-6.

Simpson DM, Ross R. (1972) The neutrophilic leukocyte in wound repair. A study with antineutrophil
serum. J Clin Invest 51:2009-23.

Singer AJ, Clark RAF. (1999) Cutaneous Wound Healing. N Engl J Med 341:738-46.

Smith FJ, Irvine AD, Terron-Kwiatkowski A, Sandilands A, Campbell LE, Zhao Y, et al. (2006) Loss-
of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris. Nat Genet 38:337-42.

South AP, Cabral A, Ives JH, James CH, Mirza G, Marenholz I, et al. (1999) Human epidermal
differentiation complex in a single 2.5 Mbp long continuum of overlapping DNA cloned in bacteria
integrating physical and transcript maps. J Invest Dermatol 112:910-8.

Steinert PM, Kartasova T, Marekov LN. (1998) Biochemical evidence that small proline-rich proteins
and trichohyalin function in epithelia by modulation of the biomechanical properties of their cornified
cell envelopes. J Biol Chem 273:11758-69.

Steinert PM, Marekov LN. (1997) Direct evidence that involucrin is a major early isopeptide cross-
linked component of the keratinocyte cornified cell envelope. J Biol Chem 272:2021-30.

Steinert PM, Marekov LN. (1999) Initiation of assembly of the cell envelope barrier structure of
stratified squamous epithelia. Mol Biol Cell 10:4247-61.

Stone EM, Schaller TH, Bianchi H, Person MD, Fast W. (2005) Inactivation of two diverse enzymes
in the amidinotransferase superfamily by 2-chloroacetamidine: dimethylargininase and
peptidylarginine deiminase. Biochemistry 44:13744-52.

Struyf S, Noppen S, Loos T, Mortier A, Gouwy M, Verbeke H, et al. (2009) Citrullination of CXCL12
Differentially Reduces CXCR4 and CXCR7 Binding with Loss of Inflammatory and Anti-HIV-1
Activity via CXCR4. J Immunol 182:666-74.

Su MJ, Bikle DD, Mancianti ML, Pillai S. (1994) 1,25-Dihydroxyvitamin D3 potentiates the
keratinocyte response to calcium. J Biol Chem 269:14723-9.

Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, et al. (2003) Functional haplotypes
of PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are associated with
rheumatoid arthritis. Nat Genet 34:395-402.

Swartzendruber DC, Wertz PW, Kitko DJ, Madison KC, Downing DT. (1989) Molecular models of
the intercellular lipid lamellae in mammalian stratum corneum. J Invest Dermatol 92:251-7.

Sybert VP, Dale BA, Holbrook KA. (1985) Ichthyosis vulgaris: identification of a defect in synthesis
of filaggrin correlated with an absence of keratohyaline granules. J Invest Dermatol 84:191-4.

Szpaderska A, Egozi EI, Gamelli RL, DiPietro LA. (2003) The effect of thrombocytopenia on dermal
wound healing. J Invest Dermatol 120:1130-7.

Takahara H, Kusubata M, Tsuchida M, Kohsaka T, Tagami S, Sugawara K. (1992) Expression of

peptidylarginine deiminase in the uterine epithelial cells of mouse is dependent on estrogen. J Biol
Chem 267:520-5.

291
Takahara H, Tsuchida M, Kusubata M, Akutsu K, Tagami S, Sugawara K. (1989) Peptidylarginine
deiminase of the mouse. Distribution, properties, and immunocytochemical localization. J Biol Chem
264:13361-8.

Tan NS, Michalik L, Noy N, Yasmin R, Pacot C, Heim M, et al. (2001) Critical roles of
PPARbeta/delta in keratinocyte response to inflammation. Genes Dev 15:3263-77.

Tarcsa E, Marekov LN, Andreoli J, Idler WW, Candi E, Chung SI, et al. (1997) The fate of
trichohyalin. Sequential post-translational modifications by peptidyl-arginine deiminase and
transglutaminases. J Biol Chem 272:27893-901.

Tarcsa E, Marekov LN, Mei G, Melino G, Lee SC, Steinert PM. (1996) Protein unfolding by
peptidylarginine deiminase. Substrate specificity and structural relationships of the natural substrates
trichohyalin and filaggrin. J Biol Chem 271:30709 - 16.

Taylor G, Lehrer MS, Jensen PJ, Sun TT, Lavker RM. (2000) Involvement of follicular stem cells in
forming not only the follicle but also the epidermis. Cell 102:451-61.

Thacher SM, Rice RH. (1985) Keratinocyte-specific transglutaminase of cultured human epidermal
cells: relation to cross-linked envelope formation and terminal differentiation. Cell 40:685-95.

Tipton JB, Dingman RO. (1966) Some aspects of wound healing in the germfree animal. Plast
Reconstr Surge 38:499-506.

Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. (2002) Myofibroblasts and mechano-
regulation of connective tissue remodelling. Nat Rev Mol Cell Biol 3:349-63.

Tommasi C, Petit-Teixeira E, Cournu-Rebeix I, Caponi L, Pierlot C, Fontaine B, et al. (2006) PADI4

gene in multiple sclerosis: a family-based association study. J Neuroimmunol 177:142-5.

Tonnesen MG, Feng X, Clark RAF. (2000) Angiogenesis in Wound Healing. J Investig Dermatol
Symp Proc 5:40-6.

Toulza E, Mattiuzzo NR, Galliano MF, Jonca N, Dossat C, Jacob D, et al. (2007) Large-scale
identification of human genes implicated in epidermal barrier function. Genome Biol 8:R107.

Trautmann A, Altznauer F, Akdis M, Simon H-U, Disch R, Brocker E-B, et al. (2001) The
Differential Fate of Cadherins during T-Cell-Induced Keratinocyte Apoptosis Leads to Spongiosis in
Eczematous Dermatitis.J Invest Dermatol 117:927-34.

Tunggal JA, Helfrich I, Schmitz A, Schwarz H, Gunzel D, Fromm M, et al. (2005) E-cadherin is
essential for in vivo epidermal barrier function by regulating tight junctions. EMBO J 24:1146-56.

Ugarova TP, Yakubenko VP. (2001) Recognition of fibrinogen by leukocyte integrins. Ann N Y Acad
Sci. 936:368-85.

Urano Y, Watanabe K, Sakaki A (1990) Immunohistochemical demonstration of peptidylarginine

deiminase in human sweat glands. Am J Dermatopathol 12:249-55.

Usui ML, Underwood RA, Mansbridge JN, Muffley LA, Carter WG, Olerud JE. (2005)
Morphological evidence for the role of suprabasal keratinocytes in wound reepithelialization. Wound
Repair Regen 13:468-79.

292
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. (2002) Accurate
normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal
control genes. Genome Biol 3: 34.1–34.11.

Vossenaar ER, Smeets TJ, Kraan MC, Raats JM, van Venrooij WJ, Tak PP. (2004a) The presence of
citrullinated proteins is not specific for rheumatoid synovial tissue. Arthritis Rheum 50:3485-94.

Vossenaar ER, Radstake TR, van der Heijden A, van Mansum MA, Dieteren C, de Rooij DJ, et al.
(2004b) Expression and activity of citrullinating peptidylarginine deiminase enzymes in monocytes
and macrophages. Ann Rheum Dis 63:373-81.

Vossenaar ER, Zendman AJ, van Venrooij WJ, Pruijn GJ. (2003) PAD, a growing family of
citrullinating enzymes: genes, features and involvement in disease. Bioessays 25:1106-18.

Wang Y, Li M, Stadler S, Correll S, Li P, Wang D, et al. (2009) Histone hypercitrullination mediates

chromatin decondensation and neutrophil extracellular trap formation. J Cell Biol 184:205-13.

Wang Y, Wysocka J, Sayegh J. (2004) Human PAD4 regulates histone arginine methylation levels via
demethylimination. Science 306:179-283.

Watanabe K, Akiyama K, Hikichi K, Ohtsuka R, Okuyama A, Senshu T. (1988) Combined

biochemical and immunochemical comparison of peptidylarginine deiminases present in various
tissues. Biochim Biophys Acta 966:375-83.

Watanabe K, Hikichi K, Nagata S, Senshu T. (1990) Estrous cycle dependent regulation of

peptidylarginine deiminase transcripts in female rat pituitary. Biochem Biophys Res Commun 172:28-
34.

Weitzman JB, Fiette L, Matsuo K, Yaniv M. (2000) JunD protects cells from p53-dependent
senescence and apoptosis. Mol Cell 6:1109-19.

Welch MP, Odland GF, Clark RA. (1990) Temporal relationships of F-actin bundle formation,
collagen and fibronectin matrix assembly, and fibronectin receptor expression to wound contraction. J
Cell Biol 110:133-45.

Weller K, Foitzik K, Paus R, Syska W, Maurer M. (2006) Mast cells are required for normal wound
healing of skin wound in mice. FASEB J 20:2366-8.

Welter JF, Eckert RL. (1995) Differential expression of the fos and jun family members c-fos, fosB,
Fra-1, Fra-2, c-jun, junB and junD during human epidermal keratinocyte differentiation. Oncogene
11:2681-7.

Werner S, Grose R. (2003) Regulation of wound healing by growth factors and cytokines. Physiol Rev
83:835-70.

Wertz PW. (2006) Biochemistry of human stratum corneum lipids. Taylor & Francis: New York, 33-
42.

Wojcik SM, Bundman DS, Roop DR. (2000) Delayed wound healing in keratin 6a knockout mice.
Mol Cell Biol 20:5248-55.

Wood DD, Ackerley CA, Brand B, Zhang L, Raijmakers R, Mastronardi FG, et al. (2008) Myelin
localization of peptidylarginine deiminases 2 and 4: comparison of PAD2 and PAD4 activities. Lab
Invest 88:354-64.

293
Xie Z, Komuves L, Yu QC, Elalieh H, Ng DC, Leary C, et al. (2002) Lack of the vitamin D receptor is
associated with reduced epidermal differentiation and hair follicle growth. J Invest Dermatol 118:11-6.

Yamakoshi A, Ono H, Nishijyo T, Shiraiwa M, Takahara H. (1998) Cloning of cDNA encoding a

novel isoform (type IV) of peptidylarginine deiminase from rat epidermis. Biochim Biophys Acta
1386:227-32.

Yamazaki M, Ishidoh K, Suga Y, Saido TC, Kawashima S, Suzuki K, et al. (1997) Cytoplasmic
processing of human profilaggrin by active mu-calpain. Biochem Biophys Res Commun 235:652-6.

Ying S, Dong S, Kawada A, Kojima T, Chavanas S, Mechin MC, et al. (2009) Transcriptional
regulation of peptidylarginine deiminase expression in human keratinocytes. J Dermatol Sci 53:2-9.

Zeeuwen PL. (2004) Epidermal differentiation: the role of proteases and their inhibitors. Eur J Cell
Biol 83:761-73.

Zenz R, Eferl R, Kenner L, Florin L, Hummerich L, Mehic D. (2005) Psoriasis-like skin disease and
arthritis caused by inducible epidermal deletion of Jun proteins. Nature 437:369-75.

Zenz R, Wagner EF. (2006) Jun signalling in the epidermis: From developmental defects to psoriasis
and skin tumors. Int J Biochem Cell Biol 38:1043-9.

Zhang J, Dai J, Zhao E, Lin Y, Zeng L, Chen J, et al. (2004) cDNA cloning, gene organization and
expression analysis of human peptidylarginine deiminase type VI. Acta Biochim Pol 51:1051-8.

Zhao Y, Terron-Kwiatkowski A, Liao H, Lee SP, Allen MH, Hull PR, et al. (2007) Filaggrin null
alleles are not associated with psoriasis. J Invest Dermatol 127:1878-82.

294
Fonctions et régulation des peptidyl-arginine désiminases dans l’épiderme et au cours de la cicatrisation
cutanée
Les peptidyl-arginine désiminases (PADs) catalysent une modification post-traductionnelle appelée désimination
ou citrullination. Le rôle physiologique de la désimination est encore mal compris mais les Pads sont
associées à de nombreuses pathologies. Dans l’épiderme, seules les PAD1, 2 et 3 sont exprimées. La
désimination de la filaggrine par les PAD1 et 3 joue un rôle majeur dans les fonctions de barrière épidermique,
alors que le rôle de la PAD2 n’est pas encore connu.
Nous avons mis en évidence une régulation complexe de la désimination, en particulier post-transcriptionnelle.
A l’aide de modèles in vitro et in silico, nous avons montré que les PADs sont capables d’auto-désimination et
que celle-ci réduit leur activité. Nous avons ensuite analysé l’expression des Pads et des protéines désiminées in
vivo, au cours de la cicatrisation cutanée chez la souris. La Pad3 est co-localisée avec la (pro)filaggrine dans les
kératinocytes du néo-épiderme et pourrait être impliquée dans le rétablissement de la barrière épidermique. Dans
le caillot fibrino-plaquettaire, la fibrine est désiminée par la Pad4, une isoforme normalement absente de
l’épiderme et spécifique des cellules du sang. Enfin, l’analyse du phénotype cutané des souris Padi2-/- a montré
que l’absence de Pad2 ne modifie pas le taux des protéines désiminées et la différenciation des kératinocytes, et
n’influence ni la cicatrisation ni la désimination des protéines du caillot.

Peptidylarginine deiminase functions and regulation in the epidermis and during cutaneous wound
healing

Deimination or citrullination is a post-translational modification catalyzed by peptidylarginine deiminases

(PADs). The physiological role of deimination remains to be fully identified but PADs were found to be
associated with numerous pathological mechanisms. Three PAD isoforms, PAD1, 2 and 3, are expressed in the
epidermis. PAD1 and 3 are involved in the deimination of filaggrin, and are essential for skin hydration and
barrier functions, whereas the role of PAD2 remains unknown.
We first evidenced a complex regulation of deimination, including at various post-transcriptional levels. In vitro
and in silico analysis showed that auto-deimination could decrease PAD activity by increasing the distance
between the four major amino-acids of their active site. Using a murine model of cutaneous wound closure, we
showed that Pad3 is coexpressed with (pro)filaggrin in differentiating keratinocytes of the neo-epidermis, and
could thus be necessary for the recovery of the epidermal barrier. In the clot, fibrin was found to be deiminated
by Pad4, an isotype usually not expressed in the epidermis in basal conditions but specific to blood cells.
Finally the analysis of the cutaneous phenotype of Padi2-/- mice showed that the absence of Pad2 did not modify
epidermal differentiation, skin barrier functions, wound healing and fibrin deimination

Mots-Clés
Citrulline
Modification post-traductionnelle
Epiderme
Peptidyl-arginine désiminases
Cicatrisation cutanée
Désimination
Peau
Filaggrine