UNIVERSIDAD POLITÉCNICA DE MADRID

Escuela Técnica Superior de Ingeniería Agronómica, Alimentaria y de Biosistemas

GENÓMICA COMPARATIVA DE CEPAS DE Xanthomonas arboricola

ASOCIADAS A Prunus spp.: CARACTERIZACIÓN DE LOS
PROCESOS DE INFECCIÓN DE LA MANCHA BACTERIANA DE
FRUTALES DE HUESO Y ALMENDRO.

Tesis Doctoral

Jerson Martín Garita Cambronero

Licenciado en Biología

2016
 Departamento de Biotecnología

Escuela Técnica Superior de Ingeniería Agronómica, Alimentaria y de

Biosistemas

Universidad Politécnica de Madrid

Tesis Doctoral

Genómica comparativa de cepas de Xanthomonas arboricola asociada a

Prunus spp.: Caracterización de los procesos de infección de la mancha
bacteriana de frutales de hueso y almendro.

Autor

Jerson M. Garita Cambronero

Licenciado en Biología

Director Directora

Jaime Cubero Dabrio María Milagro López González

Dr. en Ciencias Biológicas Dr. Ingeniero Agrónomo

Tribunal nombrado por el Magfco. y Excmo. Sr. Rector de la Universidad Politécnica
de Madrid el día de de 201 .

Presidente

Secretario

Vocal

Vocal

Vocal

Suplente

Suplente

Realizado el acto de defensa de la tesis el día de de 2017 en la Escuela

Técnica Superior de Ingenieros Agrónomos de Madrid.

Calificación:

El Presidente El Secretario

Los Vocales

iii
 A Olga Cecilia, José Ángel y Andrés

v
“All in all it`s just another brick in the Wall”

(Pink Floyd)

v
 Reconocimientos

Este trabajo se ha realizado en el Departamento de Protección Vegetal del Instituto

Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), bajo la dirección
del Dr. Jaime Cubero Dabrio y de la Dra. María M. López González.

Para este estudio se contó además con la colaboración del Instituto Valenciano de
Investigaciones Agrarias (IVIA) y del Centro de Investigación y Tecnología
Agroalimentaria de Aragón (CITA).

En este trabajo han colaborado las siguientes personas:

Dr. Jaime Cubero Dabrio (INIA)

Dra. María M. López González (IVIA)

Dra. Ana Palacio Bielsa (IVIA)

Dra. Marta Sena Vélez (IVIA)

Dra. Pilar Sabuquillo Castrillo (INIA)

Elisa Ferragud Capó (INIA)

Ana Ruíz Padilla (INIA)

Isabel M. Berruete (CITA)

Jerson M. Garita Cambronero, contó para el desarrollo de esta tesis con un contrato de
Formación de Profesorado Universitario (FPU 1000/2012), financiado por el Ministerio
de Educación, Cultura y Deporte del Gobierno de España.

Este trabajo fue financiado por los siguientes proyectos: RTA2011-00140-C03-02,

RTA2014-00018-C02-01 y XAPDIAG EUPHRESCO Project II.

i
 Agradecimientos

Agradezco al Dr. Jaime Cubero Dabrio y a la Dra. María M. López González por
haberme dado la oportunidad de formar parte de sus grupos de investigación, así como
el haber aceptado dirigir este trabajo. Gracias además por haber compartido su
conocimiento, experiencia y amistad conmigo durante estos años. No tengo palabras
para expresar todo mi agradecimiento. Gracias infinitas.

A Ana Palacio-Bielsa por su amistad, toda su ayuda y su aporte en este trabajo, además
por todas las críticas constructivas y la información que me ha dado durante todos estos
años.

A mis compañeros de laboratorio y amigos, Elisa, Gema, Maite, Marta, Cristina, Pilar,
Iray, Ana y Carlos. Gracias por vuestra compañía y por echarme una mano siempre que
lo necesité en todo aspecto, incluso en lo personal, además por las discusiones y aportes
que siempre ayudaron a que mi vida y trabajo mejorara. Qué habría sido de mi sin
vosotros?.

A mi familia costarricense, Olga, José, Angie, Stuarth y Lubin por las palabras de
ánimo y muestras de cariño que siempre me dieron desde el otro lado del mundo.

A mi familia española-ecuatoriano-francesa: Andrés, Angélica, María, Ángel, Bea,

Mario, Diego, Flor y Nubia. Sin duda alguna lo mejor que España me ha dado. Quién
iba a pensar que tenía que “atravesar el charco” para encontrar a las personas que más
feliz me han hecho en mi vida, por suerte os encontré.

A Miguel Cambra e Iabel Berruete, por su amistad y por toda la ayuda que me dieron
durante este trabajo. Por enseñarme la enfermedad en campo, por las fotos de los
síntomas y por enviarme las cepas y estar pendientes de echarme una mano siempre que
lo necesité.

A Pablo López y Javier Peñalver por su amistad y ayuda con las cepas usadas del IVIA
y por la información de las mismas.

A mis colegas y amigos de la Universidad de Costa Rica Axel, Vanessa y Ethel, gracias
por estar siempre pendientes de mí y brindarme su ayuda y amistad.

x
Al sistema de educación pública del gobierno de Costa Rica y del Gobierno de España
quienes han permitido que hasta este momento haya podido estudiar toda mi vida
gracias a un sistema de educación gratuito y a diversas becas durante mi formación
universitaria y de posgrado.

“Gracias a la vida que me ha dado tanto”.

xii
Principales abreviaturas

ADN: Ácido desoxirribonucleico

AFLP: Polimorfismo en la longitud de fragmentos amplificados

ARNr: ARN ribosomal

BOX-PCR: "BOX-A1R-based repetitive extragenic palindromic-PCR"

CDS= regiones codificantes de proteínas

COG: “Cluster” de grupos ortólogos

di-GMP: diguanilato monofosfato cíclico

dpi: días post inoculación

DSF: factor de señal difusible

ELISA= Ensayo por inmuno adsorción ligado a enzimas

EPPO: "European and Mediterranean Plant Protection Organization"

ERIC-PCR: "Enterobacterial repetitive intergenic consensus-PCR"

ETI: "effector-triggered immunity"

FAFLP: AFLP fluorescente

GMP: Guanosin monofosfato

hpi: horas post inoculación

ITS: Espacio del transcrito interno

Kpb: Kilo pares de bases

LAMP= Amplificación isotérmica de ácidos nucleicos

MIGS: Información mínima requerida para la secuencia de un genoma

MLSA: Análisis de secuencias multilocus ("Multilocus sequence analysis")

x
MLVA: Análisis del número variable de secuencias repetidas en tandem en multiples
loci ("Moltilocus variable-number tandem repeats analysis")

NaCl: cloruro de sodio

ºC: Grado centígrado

ORF: "Open reading frame"

PCR: reacción en cadena de la polimerasa

pH: grado de acides

PTI: "PAMP-triggered immunity"

QTL= Locus de un carácter cuantitativo

REP-PCR: "Repetitive extragenic palindromic-PCR"

T2SS: Sistema de secreción tipo 2

T3SS: Sistema de secreción tipo 3

T4SS: Sistema de secreción tipo 4

T5SS: Sistema de secreción tipo 5

T6SS: Sistema de secreción tipo 6

TAL: "Transcription avtivator like effector"

tRNA: Ácido ribonucleico de transferencia

UFC o CFU= Unidades formadoras de colonias

VNTR: Número Variable de repeticiones en tándem

xi
 Tabla de Contenido
Reconocimientos ...................................................................................ix
Agradecimientos ...................................................................................xi
Principales abreviaturas .................................................................xiii
Resumen....................................................................................................xxi
Abstract...................................................................................................xxiv
Capítulo 1: Introducción............................................................................1
1.1 Descripción y Diversidad en el género Xanthomonas 4
1.2 Mecanismos Asociados al Desarrollo de Enfermedad en
Xanthomonas ..........................................................................................7
1.3 Mecanismos Iniciales de Infección en Xanthomonas 8
1.3.1 Adherencia al tejido vegetal y formación de biopelículas...........................8
1.3.2 Adhesinas fimbrilares y no fimbrilares asociadas a la adherencia
bacteriana................................................................................................................11
1.3.3 El pilus tipo IV y su relación con la adherencia y motilidad bacteriana. 12
1.3.4 Adhesinas no fimbrilares y otros componentes asociados a la adherencia
y formación de biopelículas bacterianas..............................................................14
1.3.5 Sistemas bacterianos de quorum sensing....................................................15
1.3.6 Otros sistemas sensores asociados a la percepción bacteriana de las
condiciones ambientales.........................................................................................18
1.3.7 La quimiotáxis como mecanismo de respuesta ambiental y su relación
con el movimiento celular......................................................................................21
1.3.8 Estructura y función del flagelo bacteriano................................................23
1.3.9 Tipos de movimiento bacteriano relacionados con el flagelo....................26
1.4 Sistemas de secreción y proteínas efectoras asociadas a
procesos tardíos de infección en Xanthomonas ..........................30
1.4.1 Sistema bacteriano de secreción tipo II.......................................................31
1.4.2 Sistema bacteriano de secreción tipo III.....................................................33
1.4.3 Sistema Bacteriano de secreción tipo IV.....................................................39
1.4.4 Sistemas bacteriano de secreción tipo V.....................................................42
1.4.5 Sistema bacteriano de secreción tipo VI.....................................................44

1.5 Xanthomonas arboricola como agente causal de

x
 enfermedad en diversos grupos de plantas de interés
económico .............................................................................................46
1.5.1 Descripción de la especie X. arboricola........................................................46
1.5.2 Diversidad genética de X. arboricola...........................................................46
1.5.3 Factores de virulencia de X. arboricola.......................................................48
1.5.4 Xanthomonas arboricola pv. corylina: agente causal de la podredumbre
bacteriana del avellano..........................................................................................49
1.5.5 Xanthomonas arboricola pv. juglandis: Agente causal de la podredumbre
bacteriana, la necrosis apical y la chancrosis del nogal......................................51
1.5.6 Xanthomonas arboricola pv. pruni: agente causal de la mancha
bacteriana en frutales del género Prunus.............................................................54
1.5.7 Diversidad genética y estructura poblacional.............................................54
1.5.8 Interacción huésped-patógeno-ambiente en el contexto de la mancha
bacteriana de los frutales de hueso y el almendro...............................................56
[Link] El patógeno.................................................................................................56
[Link] El huésped...................................................................................................57
[Link] El ambiente.................................................................................................60
1.5.9 Distribución geográfica e impacto económico de X. arboricola pv. pruni:
................................................................................................................................. 61
1.5.10 Sintomatología asociada a la mancha bacteriana de los frutales del
género Prunus.........................................................................................................63
1.5.11 Epidemiología de la mancha bacteriana de los frutales del género
Prunus......................................................................................................................65
1.5.12 Diagnóstico y control de la mancha bacteriana de los frutales del género
Prunus......................................................................................................................66
1.5.13 Condición fitosanitaria de X. arboricola pv. pruni...................................70
Capítulo 2: Secuenciación y características generales del genoma de
cinco cepas de X. arboricola aisladas de Prunus spp. en España.......71
2.1 Introducción......................................................................................................73
2.2 Draft genome sequence of Xanthomonas arboricola pv. pruni strain Xap33,
causal agent of bacterial spot disease on almond................................................78
2.2.1 Abstract..........................................................................................................78
2.2.2 Genome announcement.........................................................78
2.2.3 Nucleotide sequence accession numbers..............................79
2.2.4 Acknowledgments..................................................................79

xv
 2.3 Draft genome sequence for virulent and avirulent strains of Xanthomonas
arboricola isolated from Prunus spp. in Spain.....................................................81
2.3.1 Abstract..........................................................................................................81
2.3.2 Keywords.......................................................................................................81
2.3.3 Introduction...................................................................................................81
2.3.4 Organism information..................................................................................83
2.3.4 Genome sequencing information.................................................................87
2.3.5 Genome properties........................................................................................89
2.3.6 Insights from the genome sequence.............................................................92
2.3.7 Conclusions....................................................................................................94
2.3.8 Acknowledgements........................................................................................94
2.4 Draft genome sequence of two strains of Xanthomonas arboricola isolated
from Prunus persica which are dissimilar to strains that cause bacterial spot
disease on Prunus spp............................................................................................95
2.4.1 Abstract..........................................................................................................95
2.4.2 Genome announcement................................................................................95
2.4.3 Accession numbers........................................................................................96
2.4.4 Acknowledgments.........................................................................................97
Capítulo 3: Comparación genómica y caracterización fenotípica de
cepas patógenas y no patógenas de X. arboricola revela aspectos
relacionados con el proceso de infección de la mancha bacteriana de
los frutales de hueso.................................................................................71
3.1 Abstract...........................................................................................................101
3.2 Introduction....................................................................................................101
3.3 Results.............................................................................................................103
3.3.1 Molecular characterization using multilocus sequence analysis (MLSA),
genome based phylogeny and genome comparison...........................................103
3.3.2 Carbon sources utilization and chemotaxis profile..................................107
3.3.3 Flagella, fimbrial and non-fimbrial adhesins associated with motility and
attachment in X. arboricola.................................................................................110
3.3.4 Pathogenicity tests and genomic components associated with late stages
of infection in Prunus-associated strains............................................................114
3.4 Discussion........................................................................................................118
3.5 Materials and Methods..................................................................................125
3.5.1 Bacterial strains and culture conditions...................................................125

x
 3.5.2 Multi Locus Sequence Analysis (MLSA)..................................................126
3.5.3 Genomic Analysis........................................................................................127
3.5.44 Carbon sources utilization analysis and environmental sensors profile 128
3.5.5 Chemotaxis assay and repertoire of methyl accepting chemotaxis
proteins..................................................................................................................129
3.5.6 Motility in solid and semisolid surfaces and surfactant activity.............130
3.5.6 Pathogenicity tests on Prunus spp.............................................................131
3.6 Acknowledgments..........................................................................................133
3.7 Author contributions.....................................................................................133
Capítulo 4: El análisis pan genómico ha permitido diferenciar cepas
no patógenas y patógenas de Xanthomonas arboricola que cohabitan
en Prunus spp. así como elucidar los factores de la virulencia
bacteriana................................................................................................101
4.1 Abstract...........................................................................................................137
4.2 Introducción....................................................................................................138
4.3 Materials and Methods..................................................................................139
4.3.1 1 Bacterial strains and classification using multilocus sequence analysis 139
4.3.2 Study of the type III secretion system and type III effectors gene
repertory...............................................................................................................144
4.3.3 Pathogenicity tests.......................................................................................145
4.3.4 Genome sequencing and comparison........................................................146
4.3.5 A molecular tool to differentiate X. arboricola pv. pruni from atypical
strains of X. arboricola associated with Prunus spp..........................................149
4.3.6 Specificity of the real-time PCR test..........................................................149
4.3.7 Sensitivity of the real-time PCR test..........................................................150
4.4 Results.............................................................................................................151
4.4.1Characterization of atypical strains of X. arboricola associated with
Prunus spp.............................................................................................................151
4.4.2 T3SS and T3Es repertoire in Xap-look-a-like strains:.............................152
4.4.3 Pathogenicity of the Xap-look-a-like strains.............................................153
General features of whole genomes of X. arboricola strains CITA 14 and
4.4.4
CITA 124:.............................................................................................................155
4.4.5 Genes associated with pathogenicity in X. arboricola strains..................159
4.4.6 The real-time PCR test for xopE3 permitted to differentiate Xap from
atypical strains of X. arboricola isolated on Prunus spp...................................163

xv
 4.5 Discussion........................................................................................................165
4.6 Acknowledgments..........................................................................................173
Capítulo 5: Discusión general...............................................................136
Capítulo 6: Conclusiones.......................................................................136
Bibliografía..................................................................................................1
Material Suplementario..........................................................................136
Material suplementario, capítulo 3.....................................................................227
Material suplementario, capítulo 4.....................................................................230

x
 Resumen

Xanthomonas arboricola es una especie de bacterias asociada a plantas. Dentro de la

misma se han descrito nueve grupos infraespecíficos o patovares causantes de
enfermedad en diversas especies vegetales. Asimismo, se han identificado tanto cepas
patógenas como no patógenas que no se incluyen en ninguno de estos grupos. Entre los
grupos definidos como fitopatógenos se encuentra X. arboricola pv. pruni, agente
causal de la mancha bacteriana de los frutales de hueso y el almendro. Este patógeno de
aparición reciente en España, está considerado como organismo de cuarentena en la
Unión Europea.

En este trabajo se ha caracterizado, tanto molecular como fenotípicamente, una serie de

cepas de X. arboricola aisladas de Prunus spp. Un análisis de secuencias multilocus
determinó que junto a las cepas de X. arboricola pv. pruni, existían, cohabitando en los
mismos huéspedes, algunas cepas de la misma especie que no pertenecían a ninguno de
los grupos que se integran en X. arboricola. Además, según la caracterización fenotípica
basada en aspectos relacionados con la infección bacteriana, estas cepas no presentaban
la capacidad para producir enfermedad en Prunus spp.

La caracterización inicial de las cepas de Xanthomonas aisladas de Prunus spp. fue

aprovechada para seleccionar una cepa patógena de almendro y otra de ciruelo, CITA
33 e IVIA 2626.1 respectivamente, y tres cepas no patógenas, CITA 14, aislada de P.
mahaleb, así como CITA 44 y CITA 124, aisladas de melocotonero. El estudio de
genómica comparativa de estas cepas permitió identificar factores que podían estar
relacionados con el desarrollo de la enfermedad de la mancha bacteriana de los frutales
del género Prunus.

El análisis filogenético basado en el “core genome” de la especie, así como un análisis

de similitud basado en la presencia de los genes del pan genoma entre las diversas cepas
de X. arboricola, permitió corroborar que las cepas no patógenas formaban un grupo
filogenético diferente al del patovar pruni, junto con otras cepas de baja virulencia o no
patógenas aisladas de diferentes plantas huésped.

x
Además, la comparación de los diferentes genomas permitió encontrar diferencias en los
genes relacionados con mecanismos implicados en los estados iniciales de la infección,
tales como transportadores TonB-dependientes (TBDTs), sensores del sistema regulador
de dos componentes (STCRs) y proteínas aceptoras de grupos metilo (MCPs).
Asimismo, se observó en el patovar pruni la presencia de adhesinas no fimbrilares,
como FhaB2, que no estaban presentes en las cepas no patógenas. De la misma manera,
se encontró variación en cuanto al contenido de genes asociados al pilus tipo IV entre
ambos grupos bacterianos.

Respecto a la estructura del flagelo, tanto las cepas patógenas como las no patógenas
presentaron el mismo perfil en aquellos genes relacionados con su estructura y
biogénesis, sin embargo, se observó un cambio en la secuencia de aminoácidos de la
proteína flagelina de X. arboricola pv. pruni, la cual podría estar relacionada con la
respuesta de la bacteria frente a los mecanismos de defensa de la planta.

De igual manera, se encontraron diferencias entre las cepas patógenas y no patógenas en

caracteres asociados con etapas tardías de la infección. Una de ellas fue la presencia de
diferentes perfiles de genes codificantes de enzimas degradadoras de la pared celular.
Otra diferencia encontrada entre ambos grupos de organismos fue la referente al sistema
de secreción tipo III y sus efectores. Las cepas patógenas, identificadas como
pertenecientes al patovar pruni, presentaron todos los genes asociados a los
componentes estructurales y de regulación de este sistema de secreción, así como un
total de 21 efectores tipo III. Sin embargo, dos de las cepas no patógenas CITA 44 y
CITA 124, no presentaron sistema de secreción tipo III, ni ninguno de los efectores tipo
III descritos en Xanthomonas. La cepa no patógena CITA 14 presentó los componentes
génicos para un sistema de secreción tipo III funcional pero se identificó solamente un
repertorio de seis efectores.

Se seleccionó además el gen xopE3, que solamente está presente en el patovar pruni y
se desarrolló un protocolo de PCR tiempo real que permitió aumentar la especificidad
del protocolo de diagnóstico para la mancha bacteriana de los frutales de hueso y el
almendro, al permitir diferenciar de manera específica y sensible las cepas causantes de
la enfermedad de aquellas cepas no patógenas que cohabitan los frutales del género
Prunus.

xx
Este estudio ha permitido conocer una serie de componentes genéticos que podrían estar
asociados con el desarrollo de la enfermedad de la mancha bacteriana de los frutales del
género Prunus. De la misma manera ha permitido profundizar en el conocimiento sobre
la diversidad biológica de X. arboricola y ha generado datos que pueden marcar las
pautas de cómo ha podido ser la evolución de la patogenicidad y especificidad de
huésped en esta especie de bacterias. Los datos generados han permitido además el
desarrollo de un nuevo método de diagnóstico de esta enfermedad más preciso basado
en PCR en tiempo real.

x
 Abstract

Xanthomonas arboricola is a species of plant-associated bacteria, conformed by at least

nine infraspecific groups or pathovars. The species encompasses groups of bacteria with
diverse plant host range, as well as pathogenic and non-pathogenic strains that does not
belong to any of these nine pathovars. Within the plant pathogenic groups, X.
arboricola pv. pruni, which is the causal agent of bacterial spot disease of stone fruits
and almond, has been recently determined as present in Spain and it is regulated as a
quarantine pathogen in the European Union.

In this work, a group of Spanish strains of X. arboricola, isolated from Prunus spp. has
been characterized using molecular and phenotypic approaches. An initial molecular
characterization, conducted by using a multilocus sequence type analysis, determined
that there were two groups of strains that cohabited in these hosts. The first one was
composed by strains of X. arboricola pv. pruni and the second one by atypical strains
that did not belong to any of the nine well-stablished pathovars of X. arboricola. In
addition, according to the phenotypic analysis, none of the atypical strains were able to
cause disease on Prunus spp.

Based on these results, two pathogenic strains of X. arboricola pv. pruni, CITA 33 and
IVIA 2626.1, isolated from peach and plum respectively, and three non-pathogenic
strains of X. arboricola, CITA 14, isolated from P. mahaleb and CITA 44 and CITA
124, both isolated from peach, were selected for whole genome sequencing. The
genome comparative analysis of these strains permitted to find those genomic characters
that could be associated with the development of bacterial spot disease of stone fruits
and almond.

A phylogenetic analysis based in the core genome of X. arboricola as well as a

similarity analysis based on the pan-genome of this species, corroborated that the
atypical non-pathogenic strains formed cluster which was different to the one composed
by the strains of the pathovar pruni. These non-pathogenic strains clustered in a group
with other non-pathogenic or low-pathogenic strains isolated from a wide range of plant
hosts.

xx
Additionally, according to the gene content comparison, variants in the genes related to
the different stages of the disease process were found. For instance, both groups showed
a different repertoire of genes associated with the sensing of the environmental stimuli,
such as those related to the Ton-B dependent transporters (TBDTs), the sensors of the
two-component regulatory system (STCRs) and the methyl accepting chemotaxis
proteins (MCPs). Beside this, in X. arboricola pv. pruni, some non-fimbrial adhesins,
like FhaB2, as well as some components related to the type IV pilus that were absent in
the non-pathogenic strains, were found.

According to the gene content associated with the flagella structure and regulation, no
differences among gene profile of both groups of organisms were elucidated, however,
in the pathovar pruni, a variant in the flagellin protein sequence. This variant could be
associated with the ability of this bacterial group to avoid the initial steps of the plant
defence process.

In the same way, variations in the gene content of some key characters related to late
stages of the disease process were found. One of the differences was the dissimilar
profile of cell wall degrading enzymes between pathogenic and non-pathogenic strains.
Moreover, the most important difference observed between these two groups was found
in the gene content associated with the type III secretion system and its related effectors.
Plant pathogenic strains of X. arboricola pv. pruni harboured all the genetic
components related to the structure and regulation of the type III secretion system as
well as in a repertoire of 21 type III effectors. Nevertheless, non-pathogenic strains
CITA 44 and CITA 124 did not harbour this secretion system or none of the type III
effectors described in Xanthomonas. In the case of the non-pathogenic strain CITA 14,
this contained all the genes related to a functional type three secretion system but a
reduced profile of effectors composed by only six genes was determined.

In addition, the gene xopE3, which is present only in X. arboricola pv pruni, was
selected and used to design a real-timer PCR protocol which permitted to improve the
specificity of the available protocol to identify the bacteria associated to the spot disease
of stone fruit and almond. This protocol allowed to perform a specific and sensitive
differentiation of the disease-associated strains from those non-pathogenic strains that
cohabited on Prunus spp.

x
This study provides a global overview of the genetic components that could be
associated with the development of the bacterial spot disease of Prunus. At the same
time, it reveals new insights in some other elements of the biology of this bacterial
group such as its biological diversity and the potential process associated with the
evolution of pathogenicity and host specificity. All the data generated in this
investigation has also permitted to develop a new and more accurate real time PCR
diagnostic tool for this disease.

xx
Capítulo 1: Introducción
El dominio Bacteria está conformado por organismos unicelulares procariotas, con una
membrana compuesta por lípidos, predominantemente diésteres de diacilglicerol y con
ribosomas que contienen un ARN ribosomal (ARNr) de tipo eubacteriano (Woese et al.,
1990; Winker & Woese, 1991). Estos organismos son ubicuos, altamente abundantes y
no solo contribuyen al flujo de nutrientes en el planeta, sino que además constituyen una
proporción significativa de los nutrientes existentes en la biomasa viva. Debido a que
los estudios sobre bacterias se han basado principalmente en aquellas que son
cultivables, solamente se conoce aproximadamente el 1% de su diversidad total, que se
especula podría alcanzar los 10 billones de especies. Recientemente, y como
consecuencia de los estudios de metagenómica se ha avanzado considerablemente en el
conocimiento sobre la diversidad taxonómica y metabólica de estos organismos en el
ecosistema (Horner-Devine et al., 2004; Xu, 2006).

Desde el punto de vista del estudio de la actividad microbiana y su relación con el

ambiente y con otros organismos, se considera que las bacterias pueden actuar como
descomponedores de materia orgánica, como patógenos de plantas y animales, así como
desarrollar asociaciones mutualistas o incluso ser depredadores de otros
microorganismos (Xu, 2006).

Se han descrito variedad de interacciones entre estos microorganismos y las plantas,

algunas de ellas positivas y otras negativas. Las bacterias pueden potenciar el
crecimiento y estimular la respuesta de defensa de las plantas ante otros organismos
(Glick, 2015; Moreno-hagelsieb et al., 2016), asimismo, también son capaces de
penetrar en la planta como endófitos sin causar daño a su huésped e incluso desarrollar
relaciones simbióticas bacteria-planta (Rosenblueth & Martínez-Romero, 2006;
Gourion et al., 2015).

En contraposición a las interacciones previamente mencionadas, algunos grupos

bacterianos contenidos en Actinobacteria, Mollicutes y Proteobacteria (Loria et al.,
2006; Marcone, 2014; van der Wolf & De Boer, 2015), han desarrollado una relación
ecológica de tipo parasítica con las plantas, siendo causantes de un gran número de
enfermedades vegetales que pueden llegar a tener un efecto devastador en el
rendimiento de los cultivos (Tarkowski & Vereecke, 2014).

De acuerdo con “The International Society of Plant Pathology Committee on the

Taxonomy of Plant Pathogenic Bacteria (ISPP-CTPPB)” (Bull et al., 2010, 2012, 2014),

3
existen descritos al menos 39 géneros bacterianos que contienen organismos patógenos
en huéspedes vegetales, destacando dentro de estos como los más diversos, los géneros
Pseudomonas y Xanthomonas.

1.1 Descripción y Diversidad en el género Xanthomonas.

El género Xanthomonas (Dominio Bacteria, Phylum Proteobacteria, Clase

Gammaproteobacteria, Orden Lysobacterales, Familia Lysobacteraceae) (Dowson,
1939; Williams & Kelly, 2013; Naushad et al., 2015; Oren & Garrity, 2015), es un
grupo de bacterias con forma de bacilos y Gram negativas con un tamaño de entre 0,5 a
0,6 μm de ancho por 1,0 a 2,9 μm de largo. Fenotípicamente, según la reclasificación y
descripción realizada por Vauterin y colaboradores (1995), las colonias bacterianas de
este género se caracterizan por ser de color amarillo, tener borde liso y una consistencia
mucosa. Tanto el color como la consistencia de las colonias se deben principalmente a
la secreción de xanthomonadina y del exopolisacárido xanthano. Las células de
Xanthomonas, suelen además, ser mótiles y presentan un único flagelo polar.

En cuanto a su actividad enzimática, las bacterias de este género presentan actividad

catalasa, pero no actividad oxidasa ni ureasa, ni son capaces de producir indol ó
acetoína, o reducir el nitrato a nitrito. Al ser organismos quimiorganotrófos, utilizan
variedad de compuestos como fuentes de carbono o nitrógeno pero no L-ramnosa,
adonitol, sorbosa, D-sorbitol, meso-eritritol, glicina, L-glutamina y L-asparagina.
Xanthomonas presenta la capacidad de oxidar los siguientes compuestos presentes en el
sistema de microplaca Biolog GN, D-fructuosa, α-D-glucosa, D-manosa, metilpiruvato
y el ácido α-ketoglutático. Asimismo, presentan la incapacidad de oxidar la α-
ciclodextrina, adonitol, D-arabitol, meso-eritritol, meso-inositol, xilitol, ácido D-
glucosamínicio, ácido γ-hidroxibutítico, ácido itacónico, ácido sebásico, L-ornitina,
ácido L-piroglutámico, D-serina, DL-carnitina, ácido γ-aminobutírico, feniletilamina,
putrescina, 2-aminoetanol y 2,3 butanodiol.

Las bacterias de este género no son capaces de crecer en un pH menor a 4,5 y su rango
de crecimiento se encuentra entre los 4 y los 37 ºC (Vauterin et al., 1995). Su
crecimiento se ve inhibido a concentraciones de NaCl superiores al 6% y de glucosa al
30%, así como al 0,01% de verde de metilo, 0,01% de tionina, 0,01% de acetato, 0,1%
de trifenitetrazólio cloruro. Los miembros de este género suelen ser susceptibles a la

4
eritromicina y a la tetraciclina. Producen espermidina en cantidades detectables y
algunas cepas además cadaverina. Por último, el género Xanthomonas contiene nueve
ácidos grasos, de los cuales tres, el 11:0 iso, el 11:0 iso 3OH y el 13:0 iso 3OH son
característicos del género, por lo que son utilizados para su diferenciación de otros
grupos bacterianos (Vauterin et al., 1995).

El género Xanthomonas es un grupo de bacterias, principalmente fitopatógenas, que es

filogenéticamente complejo y que por su importancia económica ha sido ampliamente
estudiado. Los estudios filogenéticos en Xanthomonas han sido abordados utilizando
multitud de estrategias basadas en diversos caracteres. Entre ellas se pueden mencionar
el uso de caracteres fenotípicos, perfiles bioquímicos o de ácidos grasos, así como la
utilización de una serie de técnicas de caracterización molecular basadas en la
amplificación en cadena de la polimerasa o PCR, como lo son el BOX-PCR, el ERIC-
PCR y la REP-PCR (Vauterin et al., 2000).

Recientemente, el avance en las técnicas de secuenciación de ácidos nucleicos ha

permitido la generación de bases de datos de secuencias de regiones específicas que
permiten identificar cepas desconocidas por comparación con las previamente
clasificadas. La secuenciación de ácidos nucleicos se han revelado como una
herramienta rápida y eficiente de clasificación, por ejemplo utilizando los datos
disponibles para la subunidad beta de la DNA girasa (gyrB) (Parkinson et al., 2009).

Ha sido de gran utilidad para la taxonomía de este grupo el desarrollo de esquemas de

análisis de secuencias multilocus (MLSA), basado en las secuencias parciales de los
genes constitutivos asociados a la chaperona DnaK, el receptor tipo TonB, FyuA, la
subunidad beta de la DNA girasa, GyrB y el factor sigma de la RNA polimerasa, RpoD
(Young et al., 2008). El MLSA es actualmente el método más utilizado ya que tiene una
alta capacidad de diferenciación entre las especies de Xanthomonas, equivalente a la
hibridación DNA-DNA y además ha permitido, de manera relativamente fácil, la
descripción de nuevas especies de Xanthomonas (Young et al., 2010).

Más recientemente, gracias a la disponibilidad de genomas completos para este género,

se han llevado a cabo análisis filogenéticos basados en la secuencia concatenada de los
genes que conforman el “core genome”, que corresponde a las secuencias de aquellos
genes compartidos por todos los genomas que se analizan (Blom et al., 2009;
Rodriguez-R et al., 2012; Cesbron et al., 2015). Este método no es ampliamente

5
utilizado hoy en día por la dificultad que aún entraña la obtención de genomas
completos, pero sin duda en un futuro se convertirá en una metodología de gran
importancia.

El género Xanthomonas contiene actualmente un total de 29 especies bacterianas

principalmente asociadas a plantas y muy raramente encontradas en otros ambientes
(Hayward, 1993; Bull et al., 2010, 2012; Jacques et al., 2016). Este grupo de bacterias
se caracteriza por presentar poca variación fenotípica entre las diversas especies, lo cual
contrasta con su alta capacidad para infectar una gran diversidad de huéspedes. Las
especies de este género bacteriano se han encontrado en al menos 124 especies de
monocotiledóneas y 268 especies de dicotiledóneas (Jacques et al., 2016) afectando a
cultivos de gran interés económico y alimentario para la humanidad (Bull et al., 2010,
2012, 2014). Por ejemplo X. axonopodis, X. campestris y X. oryzae están consideradas,
entre los principales problemas bacterianos para la agricultura a nivel mundial
(Mansfield et al., 2012).

Las diversas cepas descritas dentro del género Xanthomonas, presentan como
característica su restringida gama de huéspedes (Jacques et al., 2016). Además se han
descrito grupos sub-infraespecíficos con una gama de huésped aún más limitada, la cual
en algunos casos como en X. oryzae, llega a presentarse a nivel de tejido dentro del
mismo huésped (Niño-Liu et al., 2006). Se ha creado una clasificación basada en el
término patovar, término que según “The Committee on the Taxonomy of Plant
Pathogenic Bacteria” (Vauterin et al., 2000), se refiere a una cepa o un grupo de cepas
con características fenotípicas similares y diferentes a nivel sub-infraespecífico de otras
cepas de la misma especie o subespecie, que presentan una patogenicidad distinta en
una o más plantas huésped. Actualmente, se han descrito patovares en al menos 14
especies de Xanthomonas, las cuales contienen entre dos (X. alfalfae, X. gardneri, X.
melonis y X. sacchari) y 56 (X. axonopodis) patovares (Jacques et al., 2016).

La diversidad conocida en el género Xanthomonas sin embargo puede estar subestimada

puesto que se ha prestado mayor interés por aquellas cepas que tienen capacidad de
producir enfermedad (Young et al., 2010). Sin embargo, hay evidencia sobre la
existencia de cepas oportunistas, las cuales no causan ningún tipo de enfermedad
aparente. Asimismo, en múltiples estudios se han encontrado cepas no patogénicas de
Xanthomonas en un gran número de plantas huésped con y sin síntomas de enfermedad.

6
Al caracterizar estas cepas, se ha observado que forman parte de poblaciones
heterogéneas y muchas de ellas no pueden ser clasificadas en ninguna de las categorías
taxonómicas existentes en este género, constatándose la amplia diversidad de este grupo
bacteriano hasta ahora subestimada (Vauterin et al., 1996; Fischer-Le Saux et al., 2015;
Jacques et al., 2016).

1.2 Mecanismos Asociados al Desarrollo de Enfermedad en

Xanthomonas.

Las especies del género Xanthomonas son capaces de producir enfermedad en

prácticamente todos los tejidos de la planta. Aunque son más importantes en los tejidos
y órganos aéreos, tales como troncos, tallos, hojas, yemas, brotes, flores, frutos y
semillas (Jacques et al., 2016). Además, algunas especies son capaces de penetrar e
infectar a través de las raíces, como es el caso de X. campestris pv. musacearum, agente
causal de la marchitez del plátano (Mwangi et al., 2007). Las especies de este género
pueden presentar una alta afinidad por determinados tejidos, identificándose como
patógenos vasculares a aquellos que infectan los elementos del xilema, por ejemplo X.
albilineans y X. oryzae pv. oryzae o patógenos mesofílicos, aquellos que infectan los
espacios intercelulares del tejido del mesófilo, como por ejemplo X. citri subsp. citri y
X. oryzae pv. oryzicola. Además hay casos como el de X. manihotis, especie capaz de
desarrollar infección tanto a nivel del mesófilo como a nivel de tejidos vasculares (Ryan
et al., 2011).

Los daños que las bacterias del género Xanthomonas producen en el huésped, se
manifiestan en gran variedad de síntomas, entre los que se incluyen chancros, pústulas,
podredumbres, manchas y estriados foliares, marchitez, hipertrofia, hiperplasia e incluso
la muerte del huésped (Ryan et al., 2011; Jacques et al., 2016).

Según Pfeilmeier y colaboradores (2016), en las plantas, las infecciones bacterianas se

inician por lo general con una etapa epífita, en la cual el organismo debe ser capaz de
adaptarse a las condiciones que presenta el medio y sobrevivir el tiempo suficiente para
continuar el proceso de infección. Estos mecanismos iniciales incluyen la activación de
una serie de cascadas de transducción como respuesta a los estímulos ambientales en las
poblaciones bacterianas. Posteriormente, los patógenos pueden migrar desde la
superficie vegetal al interior de la planta en procesos mediados por quimiotaxis,

7
penetrando por aperturas naturales, tipo estomas, hidátodos, lenticelas y nectarios o a
través de heridas. Una vez en la zona del apoplasto, las bacterias utilizan una serie de
sistemas de secreción para liberar enzimas degradadoras, fitotoxinas y proteínas
efectoras que desempeñan diversas funciones asociadas a la patogénesis. Durante todo
este proceso, las bacterias deben de enfrentar y superar los sistemas de defensa con los
que cuenta la planta.

En la infección por Xanthomonas están implicados numerosos mecanismos que en esta

memoria se han dividido en aquellos asociados al inicio de la infección, como son, la
capacidad de adherencia a los tejidos vegetales, la formación de biopelículas, la
percepción de los estímulos ambientales, la motilidad y la quimiotaxis y en aquellos
responsable de las fases más avanzadas del proceso infectivo, tales como la secreción de
enzimas degradadoras de pared celular y de efectores por los diversos sistemas de
secreción presentes en Xanthomonas. En los apartados siguientes se ha hecho un
resumen de dichos procesos.

1.3 Mecanismos Iniciales de Infección en Xanthomonas.

1.3.1 Adherencia al tejido vegetal y formación de biopelículas.

Las bacterias fitopatógenas, y entre ellas las del género Xanthomonas, producen gran
cantidad de polisacáridos extracelulares, que pueden estar formados por un solo tipo de
carbohidrato o por complejos de varios azúcares ordenados en unidades repetidas
(Denny, 1995). En Xanthomonas, es especialmente importante y característica la
producción del xanthano. Estructuralmente, este compuesto está formado por una
columna vertebral de unidades de D-glucosa unidas entre sí mediante enlaces β-1,4; a
esta columna vertebral se unen cadenas laterales formadas por manosa-(β-1,4)-ácido
glucurónico-(β-1,2)-manosa. Dichas cadenas laterales se unen de manera alterna a los
residuos de glucosa que conforman la columna vertebral por medio de enlaces α-1,3.
Los residuos de manosa están acetilados y piruvilados en sitios específicos (Figura 1)
(Dunger et al., 2007; Hamman, 2010). La síntesis, la polimerización y la secreción de
este polisacárido extracelular se lleva a cabo mediante un operón conformado por 12
genes denominados genes gum (gumB-gumM), los cuales están altamente conservados
entre las diferentes especies del género (Dunger et al., 2007).

8
Figura 1. A) Estructura química del xanthano (Hamman, 2010). B) representación esquemática del
operón gum de la especie X. campestris (Da Silva et al., 2001).

Además, al igual que todas las bacterias Gram negativas contienen como parte de su
membrana externa una capa de lipopolisacáridos, compuestos de un lípido A y un
núcleo de polisacáridos que contiene en su extremo unidades de antígeno O (Hori &
Matsumoto, 2010). En Xanthomonas los lipopolisacáridosestos están generalmente
compuestos de ácido urónico, glucosa, manosa y 2-keto-3-dioxitanato, y además
contienen fosfato orgánico y carbohidratos adicionales como ramnosa, xilosa, fucosa y
galactosa, en algunas de las especies del género (Volk, 1966). La biosíntesis de
lipopolisacáridos en X. campestris pv. campestris está asociada a 15 genes (Vorhölter et
al., 2001), cuyo porcentaje de identidad varía entre las diferentes especies del género.
Dicha variación puede estar asociada a la patogenicidad y gama de huésped a través del
antígeno O del lipopolisacárido, específico para cada patovar o cepa y con una de sus
funciones descrita como barrera en contra de las toxinas vegetales (da Silva et al., 2002;
Patil et al., 2007) (Figura 2).

9
Figura 2. A) Representación esquemática de la estructura del lipopolisacárido de X. citri subsp. citri
(Casabuono et al., 2011). B) Representación esquemática de la organización del cluster de genes
asociados a la biosíntesis de lipopolisacáridos en X. campestris pv. campestris (Vorhölter et al., 2001).

Ambos tipos de polisacáridos extracelulares junto con algunos apéndices proteicos son
los responsables de la unión de las bacterias con las superficies apropiadas (Hori &
Matsumoto, 2010). Los polisacáridos extracelulares se asocian principalmente con la
formación de biopelículas o biofilms que son conglomerados de células inmovilizadas
en una matriz orgánica conformada por exopolímeros de origen microbiano, con los
polisacáridos, proteínas, lípidos y ácidos nucleicos como principales componentes
(Morris & Monier, 2003; Sena-Vélez et al., 2016) (Figura 3). En estas estructuras, los
polisacáridos extracelulares se encargan principalmente de generar matrices que
mantienen a las células unidas entre sí (Rigano et al., 2007; Hori & Matsumoto, 2010).
En las superficies vegetales, además de participar en la adherencia, las biopelículas
sirven para proteger a la población bacteriana de agentes externos adversos tales como
la desecación y la radiación, así como evitar la exposición a los compuestos de defensa
generados por el huésped o por otro tipo de agentes antimicrobianos. Las biopelículas a
la vez son estructuras en las que se potencia el intercambio genético entre las células
que lo conforman (Morris & Monier, 2003). En X. citri subsp. citri se ha determinado
que la mutación de los genes wzt y rfb303, asociados con la biosíntesis del
lipopolisacárido, da lugar a una mayor sensibilidad de la población bacteriana a agentes
externos, tales como el peróxido de hidrógeno y agentes detergentes como el SDS.
Asimismo, se asoció a un fenotipo en la cepa mutante caracterizado principalmente por
presentar una disminución en la adhesión y la formación de biopelículas (Petrocelli et
al., 2012).

1
Figura 3. Representación esquemática de la estructura de una biopelícula y de las diferentes etapas que
llevan a su formación en X. fuscans subsp. aurantifolii. 1) y 2) Acceso de la bacteria a la superficie y
adhesión inicial causada por polisacáridos, apéndices adhesivos y adhesinas secretadas, 3) y 4)
Adherencia irreversible y formación de una biopelícula madura, etapas llevadas a cabo principalmente
por polisacáridos extracelulares, flagelo, estructuras tipo pili y DNA extracelular, 5) salida de la
biopelícula y paso de las células a fase planctónica, dirigida principalmente por cambios ambientales
percibidos por las células bacterianas que forman parte de la matriz (Moreira et al., 2010; Kostakioti et
al., 2013).

Debido a que la formación de biopelículas se ha asociado a la capacidad de desarrollar

infección, y debido a que los polisacáridos extracelulares forman parte primordial de su
estructura, es por lo que tanto a este tipo de polisacáridos como a las biopelículas se les
considera factores de virulencia bacterianos (Hori & Matsumoto, 2010). En el caso de
las Xanthomonas, se ha estudiado la actividad del polisacárido extracelular xanthano en
la formación de biopelículas y su relación con la virulencia en X. citri subsp. citri. Una
mutación en el gen gumB, en esta especie, eliminó la formación de este polisacárido y la
cepa mutante presentó una menor capacidad de adherencia a superficies tanto inertes
como a la superficie foliar de lima. Mediante microscopía se determinó que el mutante
además era incapaz de desarrollar una biopelícula con estructura compleja y sufría una
drástica disminución de su virulencia en comparación con la cepa silvestre (Rigano et
al., 2007).

1.3.2 Adhesinas fimbrilares y no fimbrilares asociadas a la adherencia bacteriana.

Entre los factores determinantes que promueven la adhesión y colonización bacteriana,

además de los polisacáridos extracelulares, juegan un papel importante las proteínas
superficiales de la célula bacteriana, estudiadas principalmente en bacterias patógenas
de animales. Estas proteínas una vez producidas en la bacteria deben ser translocadas a

1
la membrana externa celular o bien ser liberadas por procesos no activos como la lisis
celular. De los nueve sistemas de secreción descritos en bacterias Gram negativas,
solamente el sistema de secreción tipo VI no ha sido asociado con la secreción de
proteínas involucradas en la adhesión bacteriana o a la formación de biopelículas
(Chagnot et al., 2013).

En bacterias fitopatógenas, las proteínas asociadas a la adhesión, denominadas

adhesinas, se pueden dividir en dos tipos, fimbrilares y no fimbrilares. Las adhesinas
fimbrilares son aquellas que tienen una estructura de filamento proteico
estructuralmente relacionado con el sistema de secreción tipo II. Uno de los principales
ejemplares de este tipo de adhesinas es el pilus tipo IV), fundamental en diversas
actividades de la célula bacteriana (Büttner & Bonas, 2010).

1.3.3 El pilus tipo IV y su relación con la adherencia y motilidad bacteriana.

Como se ha mencionado, la adhesión bacteriana es promovida en parte por filamentos

conocidos como pili o fimbrias que se extienden desde la superficie bacteriana y están
compuestos mayoritariamente por una sola proteína conocida como pilina. Entre los
diferentes tipos de pili descritos, los pili tipo IV son los que se encuentran más
extendidos entre las diversas especies bacterianas, tanto en los Gram negativos como en
los Gram positivos (Figura 4) (Pelicic, 2008). Esta estructura polimérica se encuentra
relacionada a diversas actividades bacterianas además de la adherencia, participando
también en la motilidad sobre superficies sólidas, la formación de microcolonias y de
biopelículas, la señalización celular y la captación de DNA proveniente de procesos
como la transformación natural o la unión a bacteriófagos. Los pili tipo IV son
considerados por sí mismos como un factor de virulencia, ya que su disrupción en la
mayoría de especies Gram negativas lleva asociada una reducción de la virulencia
(Craig et al., 2004).

1
Figura 4. A) Microfotografía de fuerza atómica que muestra el pilus tipo IV (señalado con una flecha
amarilla) de Xylella fastidiosa cepa Temecula. B) Representación esquemática de la estructura del pilus
tipo IV nombrando las proteínas estructurales mínimas necesarias para su formación. Las proteínas se
nombran según la nomenclatura utilizada para Pseudomonas aeruginosa (Burdman et al., 2011).

Los pili tipo IV, son estructuras delgadas (5-8 nm de ancho), largas (varios micrómetros
de longitud), flexibles y extremadamente fuertes, formadas por miles de subunidades de
pilina. Estas proteínas, suelen variar entre especies, pero todas parecen conservar una
región N-terminal metilada, un residuo hidrofóbico en la posición 25 del extremo N-
terminal y un puente disulfuro en el extremo carboxilo-terminal. Las pilinas además,
según su secuencia de aminoácidos y su longitud, se dividen en los tipos IVa y IVb,
siendo el tipo IVa el que presentan las especies bacterianas Gram negativas que causan
enfermedad en las plantas (Craig et al., 2004).

El estudio del pilus tipo IV se ha basado principalmente en el modelo de la bacteria

Peudomonas aeruginosa. En cuanto a la estructura de los pili, los componentes
mínimos para que genere esta estructura macromolecular son aquellos codificados en
los genes pilA, pilB, pilC, pilD, pilQ y pilT. El filamento de este tipo de pilus está
conformado por subunidades de la pilina PilA, sintetizadas como prepilinas que son
cortadas y metiladas en su extremo N-terminal por la proteína PilD. Las subunidades de
PilA son ensambladas por la proteína de la membrana citoplasmática PilC.
Posteriormente el filamento es conducido fuera de la membrana exterior por la secretina
PilQ. Por último las ATPasas PilB y PilT se encargan del ensamblaje y desensamblaje
del filamento, que dan lugar a la extensión y retracción del pili respectivamente
(Burdman et al., 2011) (Figura 4).

1
En el caso de Xanthomonas, estructuralmente, se conoce que junto con PilC, las
proteínas PilM, PilN, PilO y PilP, conforman una plataforma estructural en la
membrana interna en la cual se da el ensamblaje del filamento. Asimismo, se ha
determinado que en adición a PilA, otras pilinas menores pueden ser agregadas al
filamento. Estas pilinas modulan diversas características como la especificidad de la
adhesión, la longitud del filamento o el balance entre retracción y extensión de los pili.
Se ha determinado que el número de genes asociados a la formación del pilus tipo IV en
Xanthomonas se encuentra entre 23, en X. transluscens pv. undulosa y 31 en la mayor
parte de especies del género (Dunger et al., 2016).

En cuanto a la relación del pilus tipo IV con la adherencia y la formación de

biopelículas, estudios funcionales llevados a cabo principalmente en la especie X. citri
subsp. citri, han demostrado que mutaciones en pilA, pilB, pilZ y fimX, conllevan a la
incapacidad de las cepas para formar biopelículas estables así como una notable
disminución en la capacidad de adherirse a la superficie foliar. Por otro lado, estas cepas
al ser infiltradas en el tejido foliar, presentaron una virulencia similar al fenotipo
silvestre, demostrando así la importancia del pilus tipo IV en las etapas iniciales de la
infección. Resultados similares se han obtenido en mutantes de pilA en X. fuscans
subsp. fuscans (Darsonval et al., 2009; Dunger et al., 2014).

1.3.4 Adhesinas no fimbrilares y otros componentes asociados a la adherencia

y formación de biopelículas bacterianas.

Junto con las adhesinas fimbrilares, las adhesinas no fimbrilares actúan también en los
procesos de adhesión. A diferencia de las anteriores, las adhesinas no fimbrilares están
constituidas por una sola proteína y se ha propuesto que participan principalmente en la
adhesión inicial de las células bacterianas a la superficie y no en las etapas posteriores
de agregación celular (Das et al., 2009). Las adhesinas no fimbrilares se incluyen dentro
de los autotransportadores triméricos del sistema de secreción tipo V y como sustratos
del sistema de secreción de dos componentes (Büttner & Bonas, 2010).

Los estudios de genómica comparativa han encontrado variedad de genes que podrían
codificar proteínas asociadas con la adhesión superficial (da Silva et al., 2002; Moreira
et al., 2010). En Xanthomonas, se han realizado estudios funcionales principalmente en
las adhesinas FhaB, las homólogas a XadA, XadB y el ortólogo de la proteína YapH de

1
Yersinia spp. Estos estudios, demuestran una variación en cuanto al papel que juegan
estas adhesinas en la virulencia; en X. oryzae pv. oryzae mutaciones en xadA y xadB
dan lugar a un disminución significativa de la capacidad de adhesión, penetración y
virulencia de las bacterias en el tejido foliar del arroz, mientras que mutantes en yapH
presentan solamente una disminución parcial en estas propiedades (Das et al. 2009). Sin
embargo, en X. fuscans subsp. fuscans, YapH parece jugar un papel primordial en la
capacidad de las bacterias para adherirse a superficies bióticas y abióticas así como para
la formación de biopelículas, mientras que mutaciones en los genes homólogos a xadA y
en el gen fhaB solo producen un fenotipo con una disminución parcial en la capacidad
de las células a adherirse a las semillas (Darsonval et al., 2009).

Adicionalmente, otro componente importante de la matriz que conforma la biopelícula,

tanto de bacterias Gram positivas como Gram negativas, es el DNA extracelular. Este
componente en especies como P. aeruginosa y Bacillus cereus, se ha mostrado
fundamental en la estabilidad de las biopelículas, la resistencia a antibióticos y como
fuente de fósforo, carbono y nitrógeno. Recientemente se ha descrito la presencia de
DNA extracelular en la matriz de las biopelículas de X. citri subsp. citri, demostrándose
su función asociada principalmente con los estadíos iniciales de la formación de estas
estructuras así como con su estabilidad (Sena-Vélez et al., 2016).

Los diversos factores que juegan un papel en la adherencia y la formación de

biopelículas, reflejan el carácter dinámico y no estático de estos procesos. Dependiendo
de las condiciones ambientales que rodean a las bacterias, éstas se adhieren y agregan
sobre las superficies del huésped, o se desagregan pasando a la forma planctónica para
dirigirse a sitios con condiciones más favorables para proseguir el proceso infectivo
(Kostakioti et al., 2013). Estos procesos implican a nivel celular sistemas de percepción
medioambiental y de motilidad, los cuales son descritos a continuación.

1.3.5 Sistemas bacterianos de quorum sensing.

Muchos de los procesos que desencadenan los mecanismos de patogénesis en las

bacterias, son dependientes de los niveles de población bacteriana y están sometidas a
respuestas, tanto a nivel inter como intraespecífico. En bacterias, este fenómeno, se ha
denominado quorum sensing y se basa en señalización química. Generalmente, a estas
señales químicas se las conoce como autoinductores y el aumento en su concentración

1
es directamente proporcional al aumento en la densidad poblacional. Cuando el aumento
de los autoinductores alcanza el umbral mínimo estimulatorio la expresión génica de la
bacteria se ve alterada y esto se produce ante diversas condiciones ambientales. La
respuesta es desarrollada de manera sincronizada a nivel poblacional por lo que la
colonia bacteriana llega incluso a actuar como un organismo pluricelular (Waters &
Bassler, 2005).

En bacterias Gram negativas, los autoinductores más extendidos entre los diversos
grupos filogenéticos son los conocidos como homoserin lactonas. En el género
Xanthomonas sin embargo, se produce un autoinductor diferente, el cis-11-metil-2-
ácido dodecenoico, conocido también como factor de señalización difusible (DSF).
Todas las moléculas de este tipo son sintetizadas por la proteína RpfF, la cual se
encuentra codificada en el cluster génico rpfA-rpfG. Además del DSF, en X. campestris
pv. campestris, se ha identificado la presencia de otro factor difusible denominado DF,
el cual está asociado al gen pigB. Ambos factores de señalización se encuentran
ampliamente conservados y producidos en la mayor parte de las especies de este género
bacteriano (Papenfort & Bassler, 2016).

La producción de DSF por RpfF, está regulada por un sistema de dos componentes que
percibe y transduce la señal del DSF y que está compuesto por las proteínas RpfC y
RpfG (He & Zhang, 2008). En la señalización mediada por el DSF también juegan un
importante papel el mensajero secundario di-GMP cíclico y el regulador transcripcional
global Clp (Ryan et al., 2011; Srivastava & Waters, 2012). En X. campestris pv.
campestris, a niveles de baja densidad bacteriana y baja concentración de DSF, la
proteína RpfC (con actividad quinasa), interactúa con RpfF (DSF sintasa), lo cual
genera una disminución en la cantidad de DSF. A bajas poblaciones bacterianas, el
dominio REC de RpfG se encuentra desfosforilado, dando lugar a que el dominio HD-
GYP (encargado de degradar el di-GMP cíclico) se encuentre enzimáticamente inactivo,
provocando así que las concentraciones celulares del di-GMP cíclico sean altas. Por otro
lado, cuando la densidad poblacional aumenta, RpfC percibe el DSF se autofosforila y
se produce la liberación de RpfF, una vez liberada esta proteína se sintetiza más DSF.
Además, RpfC fosforila el dominio receptor de RpfG, generando en esta enzima la
activación del dominio HD-GYP, que degrada el di-GMP cíclico y reduce su
concentración a nivel celular. Esta reducción en la concentración del di-GMP cíclico

1
estimula la activación de diversidad de procesos celulares, principalmente a través de la
transcripción del factor Clp (He & Zhang, 2008; Srivastava & Waters, 2012) (Figura 5).

La deleción del gen asociado a la producción de DSF, así como de los genes del sistema
de dos componentes, produce una reducción en la virulencia de X. campestris pv.
campestris. Por ejemplo, mutantes en rpfF ven alterada su expresión en 165 que son
considerados los genes “core” del regulón DSF. De éstos, el 80% ven aumentada su
expresión ante la presencia del DSF mientras que en el otro 20% la reprimen. Estos
genes se encuentran asociados al menos a 12 categorías funcionales, dentro de las cuales
destacan, en el ámbito de la patogénesis, aquellos relacionados con la producción de
enzimas extracelulares, la síntesis y secreción de lipopolisacáridos y polisacáridos
extracelulares, la biosíntesis del flagelo, la motilidad, la quimiotaxis, la respuesta
hipersensible y el sistema de secreción tipo III (He & Zhang, 2008).

Figura 5. Representación esquemática del proceso de regulación asociado al sistema de comunicación

intercelular quorum sensing, basado en la especie X. campestris pv. campestris y conservado en las demás
especies del género Xanthomonas (Srivastava & Waters, 2012).

1
1.3.6 Otros sistemas sensores asociados a la percepción bacteriana de las
condiciones ambientales.

Además del sistema de dos componentes asociado con el fenómeno del quorum sensing,
las bacterias presentan otros sistemas de regulación de dos componentes, que son
esenciales para la percepción y adaptación de los microorganismos al ambiente. Estos
sistemas se encuentran muy conservados a través de los diversos grupos de organismos
y se caracterizan por tener una proteína perceptora con actividad histidin quinasa, y una
proteína reguladora citoplasmática que actúa como un factor de transcripción.
Estructuralmente, los sensores del sistema regulador de dos componentes, son por lo
general una proteína homodimérica integrada en la membrana cuyo dominio sensor se
encuentra contenido entre dos segmentos de la membrana, y un dominio transmisor que
se encuentra localizado en el citoplasma. Algunos de estos receptores histidin quinasa
presentan variaciones con respecto a esta estructura básica, pudiendo tener su dominio
incluido dentro de la membrana, o ser completamente citoplasmático (Cheung &
Hendrickson, 2010) (Figura 6).

La fase correspondiente a la percepción de la señal por la proteína sensora, es una de las

etapas del mecanismo de regulación de dos componentes que menos se conoce. La
dificultad estriba en el hecho de que cada proteína sensora parece que puede detectar
una amplia variedad de señales. El tipo de señales ambientales que detecta la bacteria a
través de este sistema es muy variable, pudiendo ser por ejemplo niveles de pH, oxígeno
o dióxido de carbono, compuestos de carbono, sustancias quimioatrayentes, productos
finales de rutas metabólicas, nutrientes, osmolaridad, luz y diferentes moléculas
procedentes del huésped. Una vez detectadas estas señales y transducidas a la proteína
reguladora, ésta dispara cambios en la expresión génica en aspectos celulares tales como
el metabolismo del carbono, el transporte y asimilación de nutrientes, respuestas al
estrés, motilidad, quorum sensing, homeostasis y virulencia (Runyen-Janecky, 2014).

Figura 6. Representación esquemática de la organización básica de los diversos dominios (dominio

transmembrana (TM), dominio sensor y dominio transmisor) encontrados en un receptor del tipo histidin
quinasa (Cheung & Hendrickson, 2010).

1
En el caso particular del género Xanthomonas, debido a la capacidad de las especies de
este género para adaptarse a gran variedad de ambientes, se ha sugerido que este grupo
cuenta con un amplio número de genes asociados a proteínas que interactúan en
sistemas reguladores de dos componentes. Estas observaciones han sido corroboradas
mediante la detección de dominios específicos, determinándose que en los genomas
disponibles se pueden encontrar al menos 632 genes hipotéticamente relacionados. A
nivel de genomas individuales, el número sigue siendo elevado ya que se han predicho
entre 92 y 121 genes (Qian et al., 2008).

Además del sistema de regulación de dos componentes descrito previamente para

quorum sensing en Xanthomonas, también se ha descrito funcionalmente el sistema de
dos componentes denominado RavS/RavR, el cual modula nos niveles de di-GMP
cíclico mediante la actividad fosfodiesterasa que tiene la proteína RavR en su dominio
GGDEF-EAL. La histidin kinasa RavS, que contiene dos sensores tipo PAS asociados a
la detección de los niveles bajos de oxígeno, activa a RavR, la cual actúa como factor de
transcripción de al menos 206 genes, entre los cuales se encuentran los asociados a la
protína Clp, los genes del sistema de secreción tipo III, enzimas extracelulares y la
producción de lipopolisacáridos o polisacáridos extracelulares. La coincidencia entre
este sistema regulador de dos componentes y el sistema regulado por RpfC/RpfG en
cuanto a la actividad de la proteína Clp, sugiere que la síntesis de factores de virulencia
en Xanthomonas está controlada tanto por quorum sensing como por la disminución en
las concentraciones de oxígeno (Büttner & Bonas, 2010).

En cuanto a los receptores del sistema regulador de dos componentes, en Xanthomonas

se ha estudiado un repertorio de siete sensores en las especies X. axonopodis, X.
campestris, X. citri, X. oryzae y X. vasicola, encontrándose distinto para cada especie e
incluso para patovares de la misma especie, sugiriéndose que estos receptores pueden
estar asociados con la especificidad por el huésped (Mhedbi-Hajri et al., 2011).

Las bacterias, además de estos sensores, presentan otro grupo de proteínas de membrana
asociadas a la deteccion y transporte de quelatos de hierro (denominados sideróforos),
vitamina B12, complejos de níquel y carbohidratos. Este tipo de transportadores se
denominan transportadores TonB-dependientes. Este sistema, transporta sustancias de
manera activa para lo que utiliza como recurso energético el complejo proteíco TonB,
ExbB, ExbD, el cual se encuentra en la membrana interna. Desde el punto de vista

1
estructural y funcional, todos los tranportadores tonB-dependientes presentan un
dominio N-terminal que se ubica dentro de un dominio del tipo barril beta ubicado en el
extremo C-terminal. Además, cerca del extremo N-terminal presenta una región
denominada caja TonB, la cual se sitúa hacia el periplasma pero se mantiene replegada
dentro del dominio barril beta en ausencia de ligando. Una vez se une el ligando a esta
región, se produce un cambio conformacional que expone la caja TonB, que
interacciona subsecuentemente con la proteín TonB, dándose así el transporte a través
de la membrana interna con ayuda de una proteína periplásmica de unión y un
transportador tipo ABC (Noinaj et al., 2010) (Figura 7).

Figura 7. Representación esquemática del transporte y regulación de sideroforos férricos mediante

transportadores TonB-dependientes (Noinaj et al., 2010).

En relación al estudio de este tipo de transportadores en Xanthomonas, se ha

determinado de manera predictiva que el repertorio de estos transportadores en los
diversos genomas es alto, por ejemplo en X. campestris se han predicho al menos 72,
muchos de los cuales se hipotetiza que pueden estar asociados con la adquisición de
carbohidratos. Entre éstos, el transportador TonB-dependiente SuxA presenta alta
afinidad por la sacarosa y se ha visto que actúa en conjunción con un transportador
interno de membrana, una amilosucrasa y y una proteína reguladora. Todos éstos
forman parte de un mismo locus, el cual ha sido denominado CUT. Bacterias mutantes
para este locus han mostrado un fenotipo poco virulento de este patógeno sobre

2
Arabidopsis thaliana, demostrando así la relación de estos transportadores con el
desarrollo de la enfermedad producida por X. campestris (Blanvillain et al., 2007).

Este tipo de asociación, además ha sido comprobado en X. citri subsp. citri, en la cual el
transportador TonB-dependiente XAC4131 ralentiza el desarrollo de la respuesta
hipersensible en tabaco. Asimismo, al ser la bacteria cultivada en medio inductor del
sistema de secreción tipo III (genes hrp), XAC4131, se controla indirectamente la
actividad del regulón hrpG a través de los genes rpoE y XAC4131 (Aini et al., 2010).
Por otro lado, al igual que en los sensores de dos componentes, el estudio comparativo
de la presencia de 27 transportadores TonB-dependientes, ha demostrado la existencia
de una gran variación a nivel de especie, e incluso a nivel de patovar, por lo que no se
descarta su asociación con la afinidad por un determinado huésped en los estadíos
iniciales de infección (Mhedbi-Hajri et al., 2011).

1.3.7 La quimiotáxis como mecanismo de respuesta ambiental y su relación con el

movimiento celular.

Uno de los sistemas más estudiados de respuesta como consecuencia de la percepción

de una determinada condición ambiental es la quimiotaxis, que regula la motilidad
bacteriana. La quimiotaxis es la base del movimiento de las células bacterianas hacia
regiones que contienen una mayor concentración de sustancias químicas beneficiosas, o
hacia sitios con una menor concentración de sustancias químicas tóxicas (Wadhams &
Armitage, 2004). Tanto las moleculas atrayentes como las repelentes son detectadas por
quimiorreceptores citosólicos o unidos a la membrana, llamados proteínas
quimiotácticas aceptoras de grupos metilo o MCPs (Jacques et al., 2016).

Desde el punto de vista estructural y funcional, las MCPs se han descrito como
homodímeros compuesto casi completamente por estructuras tipo alfa hélice (Wadhams
& Armitage, 2004). La estructura del dominio periplasmico de las MCPs suele ser muy
variable entre los diversos grupos bacterianos poseyendo además un amplio espectro de
ligandos que son detectados por estos quimiorreceptores. El proceso por el cual el
sistema quimiotáctico regula el movimiento bacteriano se inicia con la unión del
ligando al dominio periplasmico de la MCP, lo que altera las interacciones que se dan
entre las hélices transmembrana y permite propagar la señal a través de la membrana
bacteriana. En su región citoplasmática las MCPs se encuentran asociadas a dos

2
proteínas CheA y CheW. La proteína CheW, cuya estructura y función está muy
conservada entre las distintas especies, es la encargada de transducir la señal entre la
MCP y la proteína CheA. CheA, que es un dímero que interactúa con 3 dímeros de la
MCP y dos dominios de CheW, tiene la capacidad de autofosforilarse y aumenta su
actividad en respuesta a la disminución de la unión quimioatrayente, o por un
incremento en la unión de un quimiorrepelente al sensor MCP.

A su vez, otras proteínas citosólicas CheY y CheB compiten por unirse aldominio P2 de
CheA generándose una casacada de fosforilación desde el residuo His48 de CheA al
residuo Asp57 de CheY o Asp56 de CheB. La fosforilación de CheY, que es más afin y
rápida que la de CheB, permite que esta interactue con la proteína FliM, que forma parte
del complejo proteico que conforma el motor flagelar. Esta unión da lugar a un
movimiento del flagelo en dirección de las manecillas del reloj y hace que la célula
realice un tumbo y cambie de dirección. Este proceso acaba con la señal de finalización
dada por la proteína CheZ la cual defosforila a CheY, por lo que la actividad de CheZ se
asocia directamente con la concentración del CheY fosforilado que haya en el
citoplasma (Figura 8).

Figura 8. Diagrama esquemático del sistema de quimiorrecepción de Escherichia coli (Wadhams &
Armitage, 2004).

2
En el género Xanthomonas, la expresión de proteínas asociadas a quimiotáxis durante el
inicio de la infección ha sido estudiado en X. citri subsp. citri. En este caso se ha
comprobado la expresión de 26 protínas relacionadas a la quimiotáxis y 11 proteínas
relacionadas con la biogénesis y regulación del flagelo durante los primeros estadíos de
la infección. En cuanto a las MCPs, de las 21 proteínas predichas para este genoma,
solamente de dos no se demostrado su expresión. En relación a proteínas asociadas a la
transducción de la señal quimiotáctica, se ha detectado la expresión de CheA, CheB,
CheR, CheV, CheW, CheY y CheZ solamente cuando las bacterias son inoculadas en el
huésped. Este hecho demuestra que la maquinaria proteíca asociada a la respuesta
quimiotáctica es potenciada solamente cuando los sensores detectan determinados
metabolitos que son propios de la planta. Espor tanto un paso escencial para la
activación del flagelo en el espacio intercelular, y lleva a un proceso de colonización
más efectivo. Basado en el perfil proteómico a lo largo del tiempo, se ha observado una
activación previa adaptativa de las células mediante la expresión de las MCPs y la
posterior transducción de la señal por medio de las proteínas Che, lo que genera
seguidamente una expresión al unísono de los genes de regulación y actividad flagelar,
los genes asociados al pili tipo IV, la producción de xanthano y la secreción de efectores
del sistema de secreción tipo III (Moreira et al., 2015).

Al igual que lo observado para los otros sensores ambientales mencionados

previamente, se ha observado una variación en el número y el repertorio de MCPs
presente en las diversas especies y patovares del género Xanthomonas, siendo este más
amplio en las cepas de la especie X. axonopodis. Esta variación incluso a nivel
intraespecífico, indica que además de estar relacionados con el inicio de la infección al
detectar los metabolitos del hospedero, cumplen una función en cuanto a la gama de
huésped de las diversas cepas (Mhedbi-Hajri et al., 2011; Jacques et al., 2016).

1.3.8 Estructura y función del flagelo bacteriano.

Como se describe en apartados anteriores, el sistema de regulación quimiotáctica está

íntimamente relacionado con la actividad del flagelo. Según Rossez y colaboradores
(2015) esta organela, presenta dos actividades primordiales durante el inicio de la
colonización bacteriana, la primera de éstas se relaciona con el movimiento. El flagelo
está directamente implicado en el paso de las células desde un estado sésil a un estado
mótil en las etapas maduras de las biopelículas. Además, en condiciones en las que

2
disminuye la concentración de nutrientes el flagelo permite que células individuales
flageladas actúen como pioneras en busca de ambientes más favorables, potenciando la
formación de microcolonias.

En cuanto a la adherencia, se ha confirmado en algunos grupos de bacterias

fitopatógenas como P. syringae, y en bacterias fijadoras de nitrógeno como
Azospirillum brasilense, la necesidad del flagelo en procesos iniciales de adherencia.
Además se ha descrito que el flagelo puede intervenir en esta etapa de diversas maneras,
una de ellas estaría asociada con la longitud de la organela, ya que ésta al ser muy larga,
permitiría un anclaje inicial inéspecífico al tejido del huésped. Posteriormente, la
rotación del flagelo en las cercanías del tejido del huésped puede generar fuerzas que
propicien una interacción más cercana entre las membranas de ambos organismos. Por
último, el flagelo, al estar formado por gran cantidad de unidades repetidas de la
proteína flagelina, podría generar uniones iónicas no específicas con estructuras o
proteínas de la célula del huésped, que aunque son de baja afinidad, son muy
numerosas.

Desde una perspectiva estructural, el flagelo es un filamento delgado y largo, de hasta

20 μm, que sobresale desde el cuerpo celular. Esta organela se conforma de tres
estructuras, el cuerpo basal, conocido también como el motor flagelar, el filamento, el
cual actúa como un propulsor y la estructura denominada garfio, que sirve de unión
entre las dos anteriores (Chevance & Hughes, 2008).

El motor flagelar es la estructura proteica más compleja que se conoce en las células
bacterianas. Las proteínas que lo conforman abarcan desde el citoplasma hasta el
exterior de la célula, atravesando la membrana celular. El motor flagelar convierte el
flujo de iones que atraviesa la membrana citoplasmática en un torque que hace que el
flagelo rote, una rotación en contra del sentido de las manecillas del reloj permite a la
bacteria dirigirse hacia adelante, mientras que en sentido contrario permite a la célular
dar tumbos al azar que reorientan su dirección (Wadhams & Armitage, 2004).

El motor flagelar ha sido extensamente estudiado y se ha visto que está compuesto por
más de 20 proteínas que se organizan en varias estructuras (Chen et al., 2011), (Figura
9). La primera de éstas es el anillo M-S el cual se encuentra en la membrana interna y
esta formado solamente por la protína FliF. Seguidamente se encuentra el aparato
exportador que se encarga de exportar a través de la membrana las proteínas que

2
conforman la estructura tipo varilla, el garfio y el filamento. Este aparato consiste en
seis proteínas transmembrana (FlhA, FlhB, FliO, FliP, FliQ, FliR) y tres protéinas
solubles (FliH, FliI, FliJ). Alrededor del Anillo M-S y del aparato exportador se ubica el
anillo C, que se encuentra estructurado por las proteínas FliG, FliM y FLiN y está
asociado a la exportación, la generación del torque y el cambio en la dirección
rotacional. Seguidamente, en la parte superior del anillo S y actuando como un eje de
transmisión del torque desde el anillo M-S al garfio y al filamento, se encuentra la
estructura tipo varilla (“rod structure”), la cual está conformada por FliE, FlgB, FlgC,
FlgF y FlgG. Sobre esta estructura se encuentran los anillos L y P, que sirven como eje
de unión de la estructura a través de las capas de peptidoglicano y polisacárido
extracelular; las dos proteínas que lo conforman FlgH y FlgI son transportadas al
periplasma a trevés del sistema tipo Sec. Sobre el anillo C y rodeando el M-S se
encuentra el complejo iniciador, el cual junto con las proteínas del anillo C convierte el
flujo de H+ o Na+ en un torque que da energía al motor, este complejo está formado por
las proteínas MotA y MotB.

Figura 9. A) Representación esquemática de la estructura y de los componentes de flagelo de Salmonella

enterica (Chevance & Hughes, 2008). B) Imagen de microscopía electrónica y representación
esquemática de los componentes estructurales que conforman el motor flagelar de Escherichia coli (Chen
et al., 2011).

2
Finalmente, el motor flagelar está unido al filamento mediante el garfio que se compone
de las proteínas FlgE, FlgD, FliK, FlgK y FlgL. Una vez que se han exportado las
proteínas de la estructura tipo varilla y del garfio, este último se va ensamblando y al
alcanzar un tamaño aproximado de 50 nm, se produce una interacción entre la proteína
del garfio FliK, que actúa como una vara de medir molecular, y la proteína del sistema
transportador FlhB, lo cual genera un cambio de afinidad del sistema transportador,
haciendo que sea más afin a la exportación de las proteínas FliC, FliD y FliM, que son
las que conforman el filamento del flagelo (Chevance & Hughes, 2008) (Figura 9).

1.3.9 Tipos de movimiento bacteriano relacionados con el flagelo.

Dentro de los diversos tipos de movimiento descritos en bacterais, dos de ellos están
asociados a la utilización del flagelo, el movimiento tipo “swimming” y el movimiento
tipo “swarming”.

El primero de estos, es un movimiento compartido por un gran número de grupos

procariotas y se refiere al movimiento bacteriano en un ambiente líquido o viscoso. El
movimient tipo “swimming” (Figura 10) es individual y se producte generalmente de
forma directa como consecuencia de su activación por un mecanismo de la quimiotaxis.
Cuando el sistema quimiotáctico percibe un aumento en la concentración de un
atrayente, el sentido de rotación de los flagelos se da en contra de las manecillas del
reloj y la célula se propulsa en dirección y sentido del recurso atrayente. Cuando el
flagelo cambia el sentido de la rotación se produce un tumbo en la célula bacteriana y
un cambio de dirección en su desplazamiento, un cambio posterior en el sentido de la
rotación, hace que las células vuelvan a moverse mediante “swimming” hacia adelante.
Ante sustancias atrayentes, los tumbos de las células son suprimidos lo cual permite a la
célula ir directamente hacia el recurso (Girgis et al., 2007).

A diferencia del movimiento tipo “swimming”, el “swarming” no es un movimiento

asociado a células individuales sino que es un movimiento bacteriano rápido y
multicelular a través de una superficie (Figura 11). Este tipo de movimiento se ha
encontrado únicamente limitado a algunos grupos bacterianos presentes en Firmicutes,
Alfa proteobacteria y Gamma proteobacteria. En algunos casos las células bacterianas,
durante este poroceso, adquieren características fenotíipicas particulares, tales como un
aumento en su tamaño o la plurifalagelación (Kearns, 2010).

2
Figura 10. A) Representación esquemática del comportamiento de las células bacterianas de
Escherichia coli durante el proceso de movimiento tipo “swimming” (Terashima et al., 2008). B) Detalle
del fenotipo asociado al movimiento tipo swimming en medio de cultivo semisólido (medio MMA al
0,3% de Agar) de la bacteria Xanthomonas citri subsp. citri (Sena-Vélez et al., 2015).

Además del flagelo, para que se dé el movimiento tipo swarming, también son
requeridas la síntesis y secreción de sustancias surfactantes (surfactina, serrawetina ó
ramnolípidos) por parte de las células. Estas moléculas tienen como función reducir la
tensión entre la superficie y la célula, permitiendo así su propagación. La producción de
surfactantes está mediada por quorum sensing, por lo que son sintetizados y secretados
únicamente cuando hay una alta densidad poblacional bacteriana. En algunas bacterias
como E. coli, se ha observado la existencia de “swarming” pero no de sustancias
surfactantes, para estos casos, se ha comprobado que la misma actividad atribuida a
éstos es desarrollada de manera análoga por los lipopolisacáridos de la membrana
bacteriana (Kearns, 2010). En bacterias del género Pseudomonas, se ha demostrado que
además del flagelo y del surfactante es requerido el pilus tipo IV para realizar este tipo
de movimiento superficial (Kohler et al., 2000).

Se han sido descritos mediante estudios genómicos y fenotípicos, tanto la composición

como regulación de la síntesis del flagelo, así como la existencia de movimiento
dependiente del flagelo, en Xanthomonas. Estudios de genómica comparativa (da Silva
et al., 2002) permitieron conocer los genes asociados a las rutas biosintéticas del flagelo
y del sistema quimiotáctico en Xanthomonas. Además la descripción de nuevos
genomas de este género (Jacobs et al., 2015) han permitido determinar que están
organizados en cuatro grandes grupos de genes (fle, flg, flh y fli) en una región de
alrededor de 150 Kpb. Uno de estos grupos presenta además varios genes asociados a
MCPs que se encuentran en tandem, el número de MCPs en esta región varía
dependiendo de la especie de Xanthomonas. Estudios funcionales además han

2
demostrado que en Xanthomonas el regulador de la biosíntesis del flagelo es la proteína
FleQ. Bacterias mutantes en su gen codificante presentan fenotipos aflagelados y sin
capacidad de movimiento. La actividad reguladora de FleQ se ha comprobado
directamente sobre la expresión de los genes fliE, fliQ, fliL, flgG, flgB, flgH y flhF (Hu
et al., 2005).

Figura 11. A) diversos fenotipos de colonias bacterianas durante el movimiento tipo “swarming” (de
derecha a izquierda, Bacillus subtilis, Proteus mirabilis, Pseudomonas aeruginosa) (Kearns, 2010). B)
Diferenciación morfológica celular entre células de P. aeruginosa realizando movimiento tipo
“swarming” (izquierda) y células en fase estática (derecha) (Kohler et al., 2000).

Por otro lado, estudios desarrollados sobre una librería de 6000 mutantes de X. citri
subsp. citri, han permitido identificar que además de los genes asociados con la
estructura y biogénesis del flagelo, en esta especie, la mutación en 11 genes (XAC0019,
XAC0533, XAC0618, XAC0695, XAC0804, XAC1043, XAC1081, XAC1098,
XAC1495, XAC2113, XAC2583) produjo bacterias con fenotipos incapaces de
desarrollar movimiento tipo “swimming”, por lo que se deduce que son genes que
actúan de manera directa o indirecta sobre la funcionalidad del flagelo (Malamud et al.,
2013). Los estudios con mutantes han permitido determinar que la actividad flagelar en
X. oryzae pv. oryzae además de estar relacionada con los receptores ambientales tipo
MCP, también se asocia a otro tipo de estimulos ambientales, sistemas reguladores de
dos componentes conectados a otras actividades propias de la patogénesis en esta

2
especie como la producción de polisacáridos extracelulares. Estos sistemas de dos
componentes asociados a la regulación de la actividad del flagelo corresponden a los
relacionados con las proteínas RpfC/RpfG, PdeK/PdeR, ColS/ColR, StoS, SreK, SreR y
SreS (Zheng et al., 2016).

La constatación de papel que juega el sistema de dos componentes RpfC/RpfG, como

uno de los reguladores de la actividad flagelar y por lo tanto del movimiento bacteriano,
demuestra una vez más, la clara relación entre el sistema de quorum sensing y la
motilidad, tanto en X. citri subsp. citri (Malamud et al., 2011) como en X. campestris
(Jeong et al., 2008). En ambos modelos se ha observado que mutantes en componentes
asociados al quorum sensing como los genes rpfB, rpfC, rpfF y rpfG dan lugar a
fenotipos con una disminución significativa en la capacidad para moverse. Se ha
determinado además, que las proteínas que interconectan ambos sistemas en X.
campestris, son las codificadas por los CDS XC_0249 y XC_0420, ambas con actividad
sintasa para del diGMP-cíclico.

La necesidad del flagelo como organela relacionada con el proceso de patogénesis se ha

demostrado en Xanthomonas (Malamud et al., 2011) a partir de mutantes de los genes
fliC (flagelina) y flgE (garfio del flagelo) que presentando ausencia de flagelo, veían
reducida significativamente la motilidad tipo “swimming”, la formación de biofilm, la
adherencia y la virulencia en X. citri subsp. citri. Estas mismas variaciones fenotípicas
han sido también descritas en X. oryzae al mutar los genes flgD y flgE (Yin et al., 2011).

En cuanto al movimiento tipo swarming, en el género Xanthomonas, a pesar de

considerarse inicialmente que las especies X. citri y X. oryzae presentaban este tipo de
movimiento, actualmente se postula que en realidad corresponde al movimiento tipo
“sliding” que se define como la translocación pasiva sobre una superficie potenciada por
el crecimiento de la colonia bacteriana y que se produce tanto en células flageladas
como aflageladas (Malamud et al., 2011). Se ha observado la capacidad de realizar
movimiento tipo swarming en la especie X. perforans, pero únicamente asociado a
cambios ambientales provocados por otras especies bacterianas de su entorno, como
Proteus mirabilis, con capacidad para este tipo de movimiento (Hagai et al., 2014;
Venieraki et al., 2016).

Por otra parte, el movimiento tipo swimming ha sido observado en varias especies de
Xanthomonas. Estudios recientes han revelado la existencia de variación en este

2
fenotipo entre diversas cepas de la misma especie dependiendo de la gama de huésped
que las mismas presenten (Sena-Vélez et al., 2015). Es así, como para X. citri subsp.
citri, se ha descrito que en condiciones que asemejan el apoplásto de los cítricos,
aquellas cepas menos virulentas y con una gama de huésped restringida a lima mejicana
presentan mayor capacidad para moverse mediante este tipo de movimiento que
aquellas cepas más virulentas y con una gama de huésped más amplia.

Los mecanismos iniciales de infección descritos a lo largo de este apartado están

relacionados con procesos de supervivencia de la bacteriay establecimiento de su
población en el huésped. Una vez establecida ésta, se produce la expresión y secreción
de enzimas y proteínas efectoras que interactúan directamente sobre los procesos
fisiológicos de la planta.

1.4 Sistemas de secreción y proteínas efectoras asociadas a procesos

tardíos de infección en Xanthomonas.

Las bacterias poseen una serie estructuras macromoleculares encargadas de secretar

gran variedad de sustratos, entre ellos se encuentran pequeñas moléculas, proteínas y
DNA. Los sustratos secretados desarrollan actividades que son esenciales para la
supervivencia de las bacterias ante condiciones ambientales adversas así como para
desencadenar mecanismos relacionados con la patogenicidad. Dependiendo del sistema
de secreción, la molécula secretada puede mantenerse asociada a la membrana externa,
secretada al ambiente extracelular o ser inyectada directamente dentro de la célula del
huésped. La mayoría de los patógenos requieren la combinación de diversos sistemas de
secreción para colonizar de manera exitosa un determinado organismo huésped (Costa
et al., 2015).

El género Xanthomonas presenta al menos seis sistemas de secreción y dos vías por las
cuales se secretan enzimas degradadoras y proteínas efectoras al ambiente extracelular
(Büttner & Bonas, 2010).

3
1.4.1 Sistema bacteriano de secreción tipo II.

El sistema de secreción tipo II (T2SS) se encuentra ampliamente distribuido entre las

bacterias Gram negativas, tanto patógenas como no patógenas. Este sistema se encarga
de secretar proteínas desde el periplasma hasta el exterior de la célula y sus sustratos
corresponden a enzimas hidrolíticas y toxinas (Costa et al., 2015). Se compone por una
estructura macromolecular que contiene entre 12 y 15 proteínas que por lo general están
codificadas en un mismo operón. Se ha sugerido que la estructura del T2SS se expande
a través de la membrana interna y externa de la célula en donde cuatro diferentes
estructuras pueden ser distinguidas, el pseudopilus, el complejo de la membrana
externa, la plataforma de la membrana interna y la ATPasa de secreción (Korotkov et
al., 2012) (Figura 12).

Figura 12. Representación esquemática del sistema de secreción tipo II en bacterias Gram negativas, la
nomenclatura de las proteínas se basa en la vía general de secreción (Korotkov et al., 2012).

En especies como X. campestris pv. campestris y X. campestris pv. vesicatoria, se ha

demostrado que enzimas degradadoras, como las xylanasas, proteasas y lipasas, que son
inicialmente consideradas sustratos del sistema de secreción tipo II (T2SS), siguen
siendo secretadas incluso en mutantes defectivos para este sistema de secretor. Esto es

3
posible debido a que en estas especies, este grupo de enzimas se puede secretar también
a través de vesículas de la membrana externa (Solé et al., 2015). El T2SS se relacionado
con patogénesis en algunos grupos de bacterias fitopatógenas como Dickeya, Erwinia,
Pseudomonas, Ralstonia, Xanthomonas y Xylella (Jha et al., 2005). En estas especies,
se considera que las enzimas secretadas por el T2SS contribuyen a la degradación de la
pared celular. El T2SS podría facilitar el ensamble de apéndices extracelulares
asociados a la secreción de proteínas de virulencia, como lo es el sistema de secreción
tipo III (T3SS) (Büttner & Bonas, 2010). Un hallazgo a favor de esta hipótesis es el
hecho de que la regulación de este sistema de secreción en X. citri subsp. citri se
encuentra en parte regulado por el regulón HrpG, el cual es además un regulador clave
para la expresión del T3SS en Xanthomonas (Yamazaki et al., 2008).

Gracias a la secuenciación y comparación de genomas en Xanthomonas, se conoce que

este género presenta uno (X. oryzae) o dos (X. campestris pv. campestris, X. campestris
pv. vesicatoria y X. citri subsp. citri) T2SS, los cuales son conocidos como Xcs y Xps
(Büttner & Bonas, 2010). El organismo de este grupo en el que más se ha estudiado este
sistema secretor es X. campestris pv. vesicatoria en el cual se encuentra tanto el T2SS
Xcs (formado por el cluster xcsC-xcsN) como el Xps (formado por el cluster xpsD-
xpsN). Funcionalmente, se ha demostrado que el sistema Xps es promotor del desarrollo
de la enfermedad y además contribuye a la translocación de proteínas efectoras
secretadas por el T3SS. Los análisis transcriptómicos indican que este grupo génico es
activado por HrpG y HrpX, que constituyen los reguladores del T3SS. Por otro lado,
con respecto al sistema Xcs, mutantes en los componentes de este grupo génico no
presentan un cambio significativo en cuanto a su virulencia, consecuencia
probablemente de su complementación por los genes homólogos al sistema Xps
(Szczesny et al., 2010).

En estos grupos bacterianos, se ha demostrado como sustratos del T2SS una serie de
enzimas con actividad pectato liasa, celulasa, endoglucanasa, proteasa, α-amilasa,
xilanasa, cisteín proteasa, cellobiosidasa y lipasa/esterasa (Jha et al., 2005; Szczesny et
al., 2010). En las especies X. campestris pv. campestris, X. campestris pv. vesicatoria y
X. oryzae pv. oryzae, se ha demostrado mediante análisis de fenotipos mutantes que la
ausencia de estas proteínas secretadas da lugar a una disminución de la virulencia de las
cepas.

3
1.4.2 Sistema bacteriano de secreción tipo III.

Además del T2SS, uno de los principales factores de virulencia descrito en bacterias
Gram negativas, es el sistema de secreción tipo III (T3SS), cuyo origen evolutivo es
compartido con el flagelo. Se encuentra ampliamente distribuido en la naturaleza, tanto
en organismos no patógenos como patógenos de plantas, insectos y vertebrados (Galan
& Wolf-Watz, 2006). Esta estructura macromolecular se especializa en la transferencia
de proteínas efectoras hacia el citoplasma o la membrana plasmática del huésped. Una
vez dentro, estos efectores modulan o minan diversas funciones celulares específicas, lo
cual promueve la colonización e invasión bacteriana (Costa et al., 2015).

En bacterias fitopatógenas, el T3SS ha demostrado ser esencial para la patogénesis

bacteriana y la inducción de respuesta hipersensible en interacciones planta patógeno
compatibles e incompatibles, respectivamente. Este sistema secretor se encuentra
codificado en el “cluster” génico denominado hrp, el cual está compuesto por más de 20
genes organizados en diferentes unidades transcripcionales (Büttner & Bonas, 2010).

Nueve de los más de 20 componentes del T3SS identificados se encuentran conservados

tanto en patógenos de plantas como de animales. Son los denominados como genes hrc
y conforman el aparato secretor que se encuentra en las membranas interna y externa.
Ambos aparatos son estructuras proteicas con forma de anillo que están
presumiblemente conectadas entre sí mediante una estructura periplásmica cilíndrica.
Esta estructura como un todo conforma el cuerpo basal del T3SS. El cuerpo basal a su
vez se encuentra asociado a un pilus extracelular el cual forma en su extremo un
traslocón que permite la interacción con la membrana plasmática de la célula del
huésped. La energía requerida tanto para el acoplamiento como para el despliegue de los
sustratos del T3SS, es decir los componentes extracelulares del propio sistema y sus
proteínas efectoras, es probablemente provista por una ATPasa asociada al cuerpo basal
del T3SS en su extremo citoplasmático (Büttner, 2012) (Figura 13).

3
Figura 13. Representación esquemática de la estructura del sistema de secreción tipo III, presente en
bacterias Gram negativas (Büttner, 2012).

Como ya se ha mencionado, entre los sustratos translocados a través del T3SS, se

encuentran las proteínas denominadas efectores. El término efector se refiere a un grupo
de sustratos del T3SS que ejercen una función en el interior de la célula del huésped,
alterando una amplia variedad de procesos celulares y fisiológicos asociados a la
patogénesis. En patógenos vegetales, incluyen a las proteínas que pueden actuar como
factores de virulencia, promoviendo la enfermedad o como factores de avirulencia
cuando activan las defensas del huésped. La supresión de la respuesta inmune de la
planta juega un papel primordial en el establecimiento y multiplicación bacteriana en el
huésped (Büttner & Bonas, 2010). La mayoría de los efectores descritos en patógenos
vegetales han sido designados como proteínas de avirulencia o proteínas Avr. Otro
grupo de efectores han sido descritos al observar su capacidad de ser translocados por el
T3SS, estos son designados de diferente manera según la especie bacteriana, pero en el
caso de las Xanthomonas se les conoce como proteínas Xop (Alfano & Collmer, 2004;
Bogdanove et al., 2011; Feng & Zhou, 2012).

Las proteínas efectoras son reconocidas mediante una señal de 20-30 aminoácidos
localizada por lo general en el extremo N-terminal. A pesar de que este extremo de la
proteína no suele permanecer conservado entre los diversos efectores, la mayoría
contienen una composición o un patrón específico. Además, mediante ensayos de fusión

3
del extremo N-terminal de los efectores con una proteína reportadora, como la adenilato
ciclasa, se ha podido determinar que para su translocación estas proteínas requieren
además de una segunda región compuesta por 50-100 aminoácidos también en el
extremo N-terminal, la cual sirve como sitio de unión para las chaperonas
citoplasmáticas del T3SS (Büttner, 2012).

Gracias al avance de la genómica comparativa se han podido predecir gran cantidad de

efectores del T3SS, por ejemplo para varias cepas de P. syringae se han identificado
150 genes que podrían estar asociados a proteínas efectoras, de las cuales han sido
confirmados más de 40. Se ha observado que estas proteínas por lo general se
encuentran asociadas a elementos genéticos móviles y muchos parecen ser adquiridos
por transferencia génica horizontal, de ahí su bajo % de G+C en relación al resto del
genoma. Asimismo, muchos se encuentran formando parte de plásmidos o en regiones
hipervariables del genoma flanqueadas por genes de tRNA (Alfano & Collmer, 2004;
Gürlebeck et al., 2006).

En Xanthomonas se ha descrito la presencia del T3SS, como parte de islas genómicas

que pueden ir desde los 23,1 Kpb, en X. campestris pv. campestris, hasta los 35,3 Kpb
en X. campestris pv. vesicatoria. En estas islas se concentran hasta 25 genes que
conforman el “cluster” hrc/hrp, que ha sido encontrado en todas las especies de
Xanthomonas que contienen T3SS, excepto en X. albilineans, que presenta uno
semejante al descrito en el género Salmonella (Boch & Bonas, 2010) (Figura 14).

Figura 14. Representación esquemática y comparativa del “cluster” génico hrp presente en tres especies
del género Xanthomonas (Lee et al., 2005).

3
Las proteínas codificadas por hrpB y hrpE, se ha demostrado que además de ser
secretadas, y formar parte del apéndice extracelular del T3SS, son esenciales para que
se dé la secreción de otras proteínas a través de este sistema. Estudios realizados a partir
de mutantes para el “cluster” hrp en X. campestris pv. vesicatoria, han permitido
demostrar que los genes denominados hpa (genes asociados a hrp), contribuyen en la
patogénesis pero no son esenciales para ello. Por ejemplo, el gen hpaA, cuya proteína es
secretada, es necesario para una rápida y efectiva respuesta hipersensible por parte de la
planta, mientras que la proteína HpaB, que permanece en el citoplasma, es requerida
para el control de la exportación de las demás proteínas a través del T3SS (Gürlebeck et
al., 2006). Por otro lado, mutantes en el cluster hrp de X. citri subsp. citri, han permitido
reconocer a la proteína HrcN como la ATPasa que da la energía necesaria para que se
lleve a cabo este sistema de transporte proteico (Gottig et al., 2010) (Figura 15).

Figura 15. Representación gráfica del sistema de secreción tipo III en X. citri subsp. citri (Gottig et al.,
2010).

El T3SS de cada una de las especies de Xanthomonas, secreta un grupo diferente de

proteínas efectoras en el citoplasma de su huésped. Mediante análisis bioinformático así
como en trabajos de laboratorio, se han encontrado alrededor de 60 efectores ó posibles
efectores del T3SS en este género bacteriano (White et al., 2009). El repertorio varía

3
según la especie, habiéndose encontrado entre 24 efectores en X. citri subsp. citri hasta
37 en la especie X. oryzae pv. oryzae (Büttner & Bonas, 2010).

Los efectores de Xanthomonas se encuentran divididos en subgrupos según sea su

origen evolutivo, algunos ejemplos de estos subgrupos son los efectores de la familia
XopJ o los de la familia AvrBs3/PthA. El repertorio de efectores de este género refleja
ser producto de su adquisición mediante transferencia horizontal, y muchos de éstos
parecen proceder de otras especies fitopatógenas como Pseudomonas syringae,
Ralstonia solanacearum y Acidovorax avenae (Büttner & Bonas, 2010).

Funcionalmente, se ha determinado en varias especies de Xanthomonas que algunos de

sus efectores del T3SS disminuyen la respuesta de defensa de la planta, así como la
expresión de genes relacionados con la defenza de la planta (Figura 16). Por ejemplo, se
ha determinado que los efectores XopD, XopN y XopX reducen la PTI (“PAMP-
Triggered Immunity”) e inhiben la activación de rutas metabólicas relacionadas con la
ruta del ácido salicílico y la deposición de callosa, entre otros. La actividad de los
efectores, no solamente se ha visto asociada a la supresión de la PTI del huéped, sino
también a la respuesta de la planta asociada a la detección mediante su sistema de
defensa de los efectores del patógeno (ETI) (“Effector-Triggered Immunity”), la cual da
como resultado una rápida respuesta hipersensible. En Xanthomonas, la supresion de la
ETI se ha visto asociada por ejemplo al efector AvrBsT de X. oryzae pv. oryzae (Boch
& Bonas, 2010).

Por otro lado, determinados efectores del T3SS en este género bacteriano han sido
asociados con un aumento en la virulencia así como en la sintomatología de la
enfermedad. El ejemplo más visible ha sido el descrito en X. citri subsp. citri y en X.
oryzae pv. pryzae en los cuales mutaciones en el gen asociado al efector relacionado
con la activación de la transcripción (efectores tipo TAL) (“trascription activator-like”),
pthA, genera una marcada reducción en la capacidad del patógeno para dispersarse y de
provocar síntomas propios de la enfermedad. Un efecto semejante ha sido descrito en X.
campestris pv. vesicatoria con el efector tipo TAL AvrBs3 (Boch & Bonas, 2010). En
esta misma especie, aquellas cepas que no contienen XopD o XopN en su repertorio de
efectores, presentan en la planta poblaciones significativamente menores así como
muestran una reducción en la necrosis y la senesencia de la planta en etapas tardías de la
infección (Kim et al., 2013). Además, se ha visto en diversas especies Xanthomonas,

3
una disminución de la virulencia en cepas con mutaciones en los genes que codifican
para los efectores XopAE, XopAH, XopJ, XopX y XopZ (Song & Yang, 2010).

Figura 16. Representación gráfica del modelo molecular de como actúan los efectores del sistema de
secreción tipo III de Xanthomonas una vez son secretados en el citoplasma de la célula del hospedero. En
este caso se representa a través del efector XopD y del efector asociado a la activación de la transcripción
(efectores tipo TAL) AvrBs3 (Kay & Bonas, 2009).

Para el género Xanthomonas también se han llevado a cabo estudios sobre el proceso de
regulación asociado al T3SS y sus efectores. A pesar de que el sistema de quorum
sensing se ha comprobado que está involucrado en la regulación de los genes hrp, no es
único para la expresión de los mismos. La regulación de este grupo génico depende de
un regulador clave para la patogénesis en este género bacteriano, HrpG, asociado a la
expresión de los genes del T3SS de sus efectores y de al menos 29 sustratos asociados
al T2SS. La expresión de este regulador se produce cuando la bacteria entra en el
apoplasto o bien cuando se cultiva en medio mínimo (Guo et al., 2011).

3
HrpG activa la expresión de hrpX, el cual tiene un activador transcripcional tipo Ara-C
que se une a una región conservada del genoma conocida como región inducible por la
planta o “PIP-box” que está presente en la región promotora de la mayoría de genes
inducidos por HrpG. Sin embargo, también induce la expresión de otro grupo de genes
que no contienen el PIP-box por lo que esta región parece no ser indispensable para la
inducción por parte de HrpX. Mutantes tanto de hrpG y hrpX generan fenotipos no
patogénos (Büttner & Bonas, 2010). Además de estos dos reguladores, la expresión de
hrpC y hrpE es controlada por el sistema de dos componentes ColR/ColS, lo que
sugiere que diversas rutas metabólicas están implicadas en la regulación del “cluster”
hrp (Yan & Wang, 2011).

Junto con los reguladores mencionados, la proteína HpaS que es kinasa sensora que
forma parte de un sistema de dos componentes con el regulador HrpG, tiene un papel
primordial. Estudios mutacionales en hpaS indican una disminución de la fosforilación
de HrpG que implica una disminución de su actividad. HpaS no solamente conforma un
sistema regulador de dos componentes con HrpG, sino que también con la proteína
HpaR2, es requerida para expresar diversos factores de virulencia pero no para generar
una respuesta hipersensible (Li et al., 2014; Jacobs et al., 2015).

1.4.3 Sistema Bacteriano de secreción tipo IV.

Junto con los dos sistemas de secreción descritos previamente, otro sistema asociado a
la patogénesis bacteriana es el sistema de secreción tipo IV (T4SS). Este sistema
macromolecular encontrado tanto en Gram negativos como Gram positivos permite la
traslocacion tanto de DNA como de proteínas hacia el citoplasma de células procariotas
y eucariotas. El T4SS está implicado en la conjugación de plásmidos de DNA, por lo
que tiene un rol primordial en la transferencia de genes de resistencia a antibióticos
(Costa et al., 2015).

El T4SS más profundamente caracterizado es el codificado por el plásmido Ti de

Agrobacterium tumefaciens, que consta de 11 proteínas, VirB1-VirB11 y la proteína
VirD4. Estructuralmente, VirB3, VirB6, VirB7, VirB8, VirB9 y VirB10 conforman el
andamiaje del sistema así como el aparato de translocación, mientras que VirB2 y
VirB5 forman el pilus extracelular. VirB1, que es una transglicosilasa lítica, se encarga
de degradar la capa de peptidoglicano y además es requerido para el ensamble del pilus.

3
Por último, las proteínas VirB4, VirB11 y VirD4 son ATPasas cuya función es dar
energía al sistema (Darbari & Waksman, 2015) (Figura 17).

Figura 17. Representación esquemática de los componentes y de la estructura del sistema de secreción
tipo IV VirB/D4 de Agrobacterium tumefaciens, así como la representación de los operones virB y virD
en los cuales se codifican sus componentes (Christie et al., 2014).

Además del T4SS representado por el sistema VirB/D4, existen otros T4SS. Todos ellos
se clasifican en tres grandes grupos. El primero es el T4SS IVa y contiene al sistema
descrito previamente. El segunto es el IVb, se encuentra representado por el complejo
DoT/Icm de Legionella pneumophila y un tercer grupo designado como “otros tipos de
T4SS”, incluye a aquellos que se encuentran codificados en islas genómicas, por
ejemplo el T4SS tfc que se encuentra en la isla genómica ICE Hin1056 de Haemophius
influenzae, dedicado principalmente a la transferencia horizontal de material genético
(Nagai & Kubori, 2011; Darbari & Waksman, 2015).

La translocación de efectores por parte del T4SS ha sido estudiada principalmente en

bacterias Gram negativas y consiste en el transporte de factores de virulencia hacia el
citosol de la célula eucariota del huésped. A través de estas proteínas efectoras, el
patógeno es capaz de inducir cambios fisiológicos en la célula del huésped que permiten

4
el establecimiento de la relación, ya sea patogénica o simbiótica entre ambos
organismos. En cuanto a bacterias asociadas a plantas que contienen el sistema
VirB/D4, se han identificado una serie de efectores del T4SS asociados con la virulencia
y el desarrollo de la sintomatología, como el caso de las proteínas VirE2, VirE3, VirF y
VirD5 de A. tumefasciens directamente relacionadas con la formación de agallas. Para la
especie Mesorhizobium meliloti, se ha demostrado que los efectores Msi059 y Msi061,
una vez secretados en el citoplasma del hospedero, atraen determinadas proteínas con
las que conforman un complejo de ubiquitinación y proteólisis (Christie et al., 2005).

La gran cantidad de proyectos de secuenciación en las diversas especies del género

Xanthomonas, han permitido identificar loci homologos al sistema VirB/D4 en varias
especies del género, tales como, X. albilineans, X. campestris, X. citri, X. fuscans y X.
oryzae. Sin embargo, algunas especies como X. citri subsp. citri presentan un
megaplásmido que codifica para un segundo T4SS que probablemente esté relacionado
con la movilización del plásmido. Asimismo, algunas especies, como en X. campestris
pv. vesicatoria, se encuentran homólogos para el sistema Dot/Icm, propio de Legionella
(Potnis et al., 2011; Souza et al., 2011).

Una característica particular del T4SS virB/D4 de Xanthomonas, que corresponde a la

proteína VirB7, es el no presentar similitud con las proteínas de la familia VirB7
halladas en otros grupos bacterianos, sin embargo, esta proteína presenta la misma
función, lo cual permite que forme complejos con la proteína VirB9 (Souza et al.,
2011). Se ha demostrado que la unión de estas dos proteínas entre si, así como su
interacción con VirB10, en X. citri subsp. citri, es esencial para el ensamblaje y la
funcionalidad de este T4SS (Oliveira et al., 2016). Además, estudios recientes (Souza et
al., 2015), demuestran que en X. citri subsp. citri, el homólogo a VirD4, que tiene como
función el reclutamiento de los efectores que serán translocados, interactúa con una
serie de toxinas que son utilizadas por Xanthomonas para matar a otras células
bacterianas de su entorno, y así poseer una ventaja competitiva en presencia de otras
comunidades bacterianas mixtas.

Estudios relacionados con la inducción de la expresión de 18 ORFs asociados a los dos

T4SS que existen en X. citri subsp. citri indican que estos se ven reprimidos cuando la
bacteria infecta las hojas de los cítricos, por lo que al parecer puede que estos sistemas
de secreción no se vean implicados en la patogénesis sobre el huésped (Jacob et al.,

4
2014). Por otro lado se observó que en la especie X. campestris pv. campestris, un
mutante carente de T4SS presentaba una respuesta hipersensible más debil que el
fenotipo silvestre en una planta no huésped (Guo-feng et al., 2015). Además, la
expresión del T4SS en el fenotipo silvestre se inducía en condiciones de resistencia a
níquel, peróxido de hidrógeno y fenol, por lo que podría ser que en esta especie el T4SS
se encuentre relacionado con las etapas de contacto y reconocimiento propias del inicio
de la infección.

1.4.4 Sistemas bacteriano de secreción tipo V.

En cuanto a los sistemas de secreción tipo V y tipo VI, estos han sido menos estudiados
en bacterias fitopatógenas en general. El sistema de secreción tipo V (T5SS) o tambien
denominado sistema de autotransporte, tiene como característica única, que las proteínas
que se secretan contienen 3 o 4 dominios; el dominio transportador en el C-terminal que
forma el poro de secreción en la membrana externa de la bacteria, el dominio de unión,
el dominio pasajero, que contiene el dominio funcional de la proteína autotransportada y
en algunos casos se presenta un cuarto dominio proteasa el cual escinde la proteína una
vez haya atravesado el poro de la membrana externa. Las proteínas secretadas por el
T5SS atraviesan la membrana interna de la célula mediante el sistema Sec, por lo que
presentan un péptido señal en el N-terminal que se escinde una vez es transportado por
este sistema (Green & Mecsas, 2016) (Figura 18).

Este sistema de secrección se subdivide en varios tipos, T5SSVa-T5SSVe, e

independientemente del subtipo, todos son capaces de translocar grandes proteínas las
cuales adoptan una estructura de tipo barril β. Las funciones de las proteínas secretadas
por el T5SS incluyen serin proteasas, lipasas, citotoxinas y adhesinas, las cuales
colectivamente influyen en procesos de agregación y formación de biofilm y en la
virulencia (Costa et al., 2015).

En cuanto a la presencia de este sistema secreción en bacterias fitopatógenas, se han

identificado muchos sustratos candidatos de ser secretados por el T5SS, sin embargo, no
se ha comprobado de manera funcional que estos tengan relación con la virulencia de
los patógenos. En Dickeya dadantii, se ha informado sobre una adhesina con homología
de secuencia a las secretadas por el T5SS Vb que es necesaria para la adhesión a hojas,
mientras que un ortólogo a esta adhesina descritos en Xanthomonas y Xylella,

4
denominado XatA, se ha demostrado que es necesario para la agregación celular (Chang
et al., 2014).

Figura 18. Representación gráfica del sistema de secreción tipo V o sistema de autotransporte. Este
sistema consiste en una proteína con varios dominios dentro de los cuales destacan el dominio
transportador y el dominio pasajero (Chang et al., 2014).

Propiamente, en el caso de las Xanthomonas, gracias a la comparación de secuencias

genómicas, se han encontrado diversas proteínas que teóricamente podrían ser sustratos
del T5SS. Asimismo en el genoma de diversas especies como X. campestris pv.
vesicatoria, X. euvesicatoria, X. gardneri, X. oryzae pv. oryzae y X. perforans, se han
encontrado homólogos a adhesinas que pueden tener un rol importante en el inicio de la
infección, tal es el caso de la adhesina FhaB, la cual se ha visto como necesaria para la
adhesión al tejido foliar así como para la supervivencia en apoplasto y la formación de
biopelículas. Además, en X. oryzae pv. oryzae, las adhesinas XadA y XadB se ha
demostrado que promueven la virulencia al potenciar la colonización de la hoja y la
entrada al apoplasto a través de los hidatodos. En esta misma especie, la proteína YapH
se ha demostrado involucrada en la virulencia en etapas en las que el patógeno migra a
través de los vasos del xilema. Por último, Al lado de fhaB en el genoma de

4
Xanthomonas, se encuentra el operón hms que es homólogo al operón pga de E. coli,
por lo que podrían ser también sustratos del T5SS (Potnis et al., 2011).

1.4.5 Sistema bacteriano de secreción tipo VI.

En cuanto al último sistema de secreción descrito en Xanthomonas, el sistema de

secreción tipo VI (T6SS), es una estructura dedicada a la translocación de efectores
tóxicos dentro de células procariotas y eucariotas, por lo que podría tener un papel
importante tanto en la virulencia como en la competencia entre poblaciones bacterianas.
El T6SS, se encuentra distribuido principalmente en Proteobacteria y se compone de 13
componentes conservados esenciales y un número variable de componentes accesorios,
que se encuentran codificados por lo general en islas de patogenicidad. La transcripción
de estos genes se ha visto que es activada cuando el patógeno entra en contacto con el
huésped (Costa et al., 2015).

Los componentes esenciales del T6SS, se encuentran en el “cluster” génico tssA-tssM.

TssJ, TssL y TssM conforman el complejo de la membrana. La proteín TssK une a este
complejo con el complejo extracelular del T6SS, el cual se forma a partir de una
plataforma proteíca constituida por las proteínas VgrG y TssE. Posteriormente, se
ecuentra la estrcutura extracelular, conformada por unidades de la proteína Hcp, que es
homóloga a la cola tubular de los bacterifagos. TssB y TssC, forman heterodímeros que
rodean a la estructura tubular formando una envoltura. El mecanismo de secreción, se
cree que ha de ser similar al mecanismo de contracción presentado por las colas de los
fagos. La proteína ClpV que es una ATPasa podría ser la encargada de desensamblar la
envoltura formada por TssB-TssC generando así la contracción del aparato (Costa et al.,
2015; Green & Mecsas, 2016) (Figura 19).

Los efectores del T6SS presentan muchas formas y funciones, dentro de las cuales
destacan su actuación en contra de la pared celular y la membrana del huésped eucariota
o de otras bacterias. Muchos efectores del T6SS se encuentran codificados junto a un
gen que provee de inmunidad contra el efector, por lo que de esta manera se previene la
auto-intoxicación de la célula bacteriana (Green & Mecsas, 2016).

4
Figura 19. Representación esquemática del sistema de secreción tipo VI en bacterias Gram negativas
(Costa et al., 2015).

En el caso del género Xanthomonas, la evidencia experimental del rol que desempeña
este sistema de secrección en la virulencia de las especies es escasa. En X. populi y X.
codiaii, aquellas cepas que no contienen homólogos para los componentes esenciales
del T6SS presentan un fenotipo avirulento, por lo que se especula que podría estar
relacionado con la patogénesis en estos organismos (Shrivastava & Mande, 2008). Por
otro lado, mediante un estudio de genómica comparativa se ha determinado que X.
axonopodis, X. campestris pv. vesicatoria y X. perforans contienen dos T6SS de los
tipos A y C, mientras que X. euvesicatoria solamente presenta uno del tipo C. X.
campestris pv. campestris y X. gardneri no presentan ninguna copia de este sistema de
secreción (Potnis et al., 2011). Finalmente, los dos patovares de X. oryzae, presentan
tres copias del T6SS, dos de ellas semejantes a los tipos A y B presentes en otras
Xanthomonas y el tercero es más semejante al T6SS presente en R. solanacearum.

4
1.5 Xanthomonas arboricola como agente causal de enfermedad en
diversos grupos de plantas de interés económico.

1.5.1 Descripción de la especie X. arboricola.

X. arboricola se diferencia metabólicamente de las otras especies de Xanthomonas por

su capacidad para metabolizar los compuestos de carbono, dextrina, glicógeno, Tween
80, N-acetil-D-glucosamina, celobiosa, L-fucosa, D-galactosa, gentibiosa, maltosa, D-
psicossa, D-trealosa, monometilsuccinato, ácido acético, DL-ácido láctico, ácido
succínico, ácido bromosuccínico, ácido succinámico, L-ácido glutámico, ácido-glicil-L-
glutámico, y glicerol. Además, por la incapacidad de metabolizar los sustratos de
carbono N-acetil-D-galactosamina, L-arabinosa, D-manitol, β-metil-D-glucosida, D-
rafinosa, L-ramnosa, ácido fórmico, ácido-D-glacturónico, ácido-D-glucónico, ácido-D-
glucurónico, ácido-ρ-hidroxifenil acético, ácido α-ketovalérico, ácido quínico, ácido-D-
sacárido, glucuronamida, L-fenilalanina, timidina y glucosa 6 fosfato. El contenido de
G+C de esta especie está entre 66 y 67% y la cepa tipo de la especie es la cepa LMG747
(=ATCC 49083=CFBP 2528=ICMP 35=NCPPB 411) de X. arboricola pv. juglandis
(Vauterin et al., 1995).

X. arborícola es reconocida como una especie fitopatógena, dentro de la cual se

describen diversos grupos sub-infraespecíficos o patovares con una determinada gama
de huésped. Estos grupos son, X. arboricola pv. arracaciae, X. arboricola pv.
celebensis, X. arboricola pv. corylina, X. arboricola pv. fragariae, X. arboricola pv.
guizotiae, X. arboricola pv. juglandis, X. arboricola pv. populi, X. arboricola pv. pruni
y X. arboricola pv. zantesdeschiae. Además, sin ser incluidas en ningún patovar, se han
descrito cepas patogénicas en Zizyphus jujuba, Capsicum annum y Vitis vininifera
(Fischer-Le Saux et al., 2015).

1.5.2 Diversidad genética de X. arboricola.

La estructura genética de X. arboricola y sus relaciones filogenéticas a nivel

intraespecífico han sido objeto de discusión durante mucho tiempo. En los últimos años,
se ha podido profundizar en este tema por la utilización de herramientas moleculares
con mayor capacidad de resolución filogenética. Ha sido el caso de los estudios basados

4
en el análisis de secuencias multilocus (MLSA), así como el análisis del número de
secuencias repetidas en tándem en múltiples loci (MLVA) (Cesbron et al., 2014;
Essakhi et al., 2015; Fischer-Le Saux et al., 2015).

El análisis MLSA basado en seis genes constitutivos, atpD, dnaK, efp, glnA, gyrB y
rpoD y un gen que codifica para una proteína transmembrana, fyuA, permite formar
grupos filogenéticos claramente separados para cada uno de los patovares descritos. Los
patovares corylina, juglandis y pruni, que representan los grupos más virulentos y
económicamente más relevantes, son los que están genéticamente más relacionados y
cada uno de ellos conforma un único complejo clonal. Esta cercana relación corrobora
lo que previamente había sido observado según análisis de rep-PCR y de hibridación
DNA-DNA. Esta característica junto con otros caracteres como el origen geográfico de
estos patógenos, todos descritos en el siglo XX en Estados Unidos, así como un
repertorio semejante de efectores tipo III, podrían ser indicativos de un mismo origen
común para estos tres patovares provienen (Fischer-Le Saux et al., 2015).

Además, se apunta que el patovar populi, agente causal de bacteriosis en chopo, es el

más distante genéticamente de todos los patovares descritos en X. arboricola (Fischer-
Le Saux et al., 2015). También se ha observado una gran variación entre las cepas de
los patovares celebensis, agente causal de bacteriosis en banana y fragariae, asociado a
bacteriosis en fresa. Ambos grupos presentan diversos clusters dentro de cada patovar.
La diversidad genética de este grupo además muestra que ha existido recombinación
interespecífica en el gen atpD del patovar guizotiae y el gen rpoD del patovar populi,
pero no ha sido posible determinar exactamente cuál ha sido la especie de Xanthomonas
con la que ha habido recombinación. Por último, una serie de cepas aisladas son
ubicadas dentro de los grupos a los que se suponía debían pertenecer según su huésped
original. Éstas corresponden a cepas avirulentas o poco caracterizadas que se clasifican
como X. arboricola pero no presentan afiliación a ningún patovar de la especie.

En cuanto a los estudios de diversidad genética basados en MLVA, utilizando un grupo

de 17 repeticiones variables en tándem (VNTRs) (Cesbron et al., 2014), se ha podido
observar la estructura poblacional de la especie, contemplando cepas patogénicas
descritas para cada uno de los patovares y diversas cepas no patógenas aisladas por
ejemplo en nogal. En general, los resultados obtenidos mediante esta técnica de
genotipado, han corroborado la agrupación y diferenciación de los diversos patovares,

4
tal como se ha descrito con los estudios llevados a cabo mediante MLSA. Además,
permiten determinar que las cepas avirulentas del nogal se agrupan fuera de estos
“clusters” formando tres grupos basales en la especie que corresponden a linajes
claramente separados (Essakhi et al., 2015).

1.5.3 Factores de virulencia de X. arboricola.

Referente a los estudios relacionados con la caracterización de factores de virulencia

para la especie X. arboricola, aún son escasos y han consistido básicamente en
determinar mediante PCR la presencia del T3SS, así como de los efectores del T3SS
presentes en siete de los patovares de la especie (Hajri et al., 2012). Recientemente, se
han realizado estudios de genómica comparativa que han permitido obtener información
sobre otros factores de virulencia que podrían estar involucrados en la patogenicidad de
X. arboricola pv. juglandis, y que serán discutidos más adelante en el capítulo I de este
trabajo.

Los principales componentes asociados tanto a la estructura como a la regulación del

T3SS de Xanthomonas fueron analizados mediante PCR para las cepas patógenas de los
patovares celebensis, corylina, fragariae, jugladis, poisenttiicola y pruni. Asimismo, el
repertorio de efectores tipo III, mostró ser mayor en los patovares más virulentos de la
especie (corylina, juglandis y pruni) presentando entre 18 y 22 efectores. Por otro lado,
los patovares celebensis, poisenttiicola y fragariae mostraron el repertorio más pequeño
de X. arboricola con tan solo 6 efectores. Todas las cepas analizadas en este estudio,
independientemente de su patovar, presentaron un grupo común de efectores
codificados por los genes avrBs2, xopF1, xopA, hrpW, hpaA y xopR. Los patovares más
virulentos, compartieron además los efectores codificados por xopN, xopX, xopZ, xopQ,
xopK y xopV. Los efectores xopG, xopAF y xopE2 fueron compartidos por los patovares
corylina y pruni. Por último, los patovares más virulentos presentaron algunos efectores
únicos para cada uno de ellos, este es el caso de xopE3 en el patovar pruni, xopB en el
patovar juglandis y avrBs3 en el patovar corylina.

Se ha descrito que la variación observada en el repertorio de efectores del T3SS entre

las cepas de un mismo patovar es muy baja (Hajri et al., 2012). Sin embargo estas
diferencias se han encontrado por ejemplo, en el patovar corylina en el cual las cepas
aisladas de Coryllus avellana, contienen el efector xopH mientras que las cepas aisladas

4
de C. maxima no. En el patovar juglandis, estas diferencias fueron observadas entre los
miembros de los dos linajes que presenta este grupo. Así, el efector xopB solamente se
encontró en aquellas cepas que producen el chancro del nogal (denominado linaje
VOC), mientras que el efector xopAH se encontraba únicamente en el linaje asociado a
la bacteriosis del nogal (denominado WB) (Hajri et al., 2012).

Como ya ha sido mencionado, dentro de la especie X. arborícola, los patovares

corylina, juglandis y pruni, presentan una mayor virulencia y esto está asociada a su vez
con un mayor impacto económico. En Europa estos organismos son clasificados como
organismos de cuarentena (EU directiva 2000/29/CE y EPPO lista A2) (Lamichhane,
2014; Lamichhane & Varvaro, 2014) Durante la última década, los focos de enfermedad
causados por estos patovares han aumentado a nivel mundial y por ello se ha potenciado
su estudio con el objetivo de contener avance en las diversas regiones productoras y
evitar así futuras epidemias.

Para evitar o solucionar posibles cuadros epidémicos es necesario recabar la mayor

información posible referente al patógeno y los factores vinculados con su patogénesis,
la interacción de éste con su huésped y las condiciones ambientales asociadas a la
epidemiología de las enfermedades causadas por cada uno de estos grupos
intraespecíficos. A continuación, se presentará una breve descripción de las
enfermedades provocadas por estos tres patovares, dando un mayor énfasis al patovar
pruni y su relación con los huéspedes del género Prunus.

1.5.4 Xanthomonas arboricola pv. corylina: agente causal de la podredumbre

bacteriana del avellano.

X. arboricola pv. corylina, agente causal de la podredumbre bacteriana del avellano, fue
descrita por primera vez en Estados Unidos a inicios del siglo XX. Actualmente esta
enfermedad se encuentra distribuida a nivel mundial y en Europa se encuentra
clasificada como organismo de cuarentena según la lista A2 de la EPPO. El principal
huésped de esta bacteria es el avellano (C. avellana), sin embargo, también puede
encontrarse en otros huéspedes de este género como son C. colurna, C. maxima y C.
pontica (Scortichini, 2004) (Figura 20).

4
Figura 20. Mapa de distribución de X. arboricola pv. corylina a nivel mundial según la “European and
Mediterranean Plan Protection Organization” (tomado de EPPO actualizado a fecha 13 de octubre de
2015).

La sintomatología de esta enfermedad es posible observarla en la mayor parte de

órganos y tejidos de la parte aérea del árbol. Por lo general incluye afecciones en brotes,
hojas, ramas, tronco y frutos. En las hojas se producen manchas necróticas poligonales
y acuosas que empiezan siendo amarillentas y opacas pero que con el tiempo se tornan
rojizas o marrones y se presentan principalmente en la zona de goteo. En los tallos y en
las ramas suelen aparecer manchas acuosas de color verde oscuro que con el tiempo se
tornan marrones. Por lo general se acaba produciendo la muerte de las hojas y de las
ramillas, causando graves pérdidas económicas, puesto que es en éstas donde se
desarrolla el fruto. A nivel del tronco, suelen formase chancros de color marrón que
forman motas a lo largo del tronco aunque a veces son difíciles de ver, a menos que se
retire la corteza. Por último, los frutos suelen presentar manchas necróticas acuosas pero
son superficiales, por lo que no causan mayor daño a la avellana (Scortichini, 2004;
Lamichhane & Varvaro, 2014) (Figura 21).

Los principales productores de este fruto seco en el mundo son Turquía, Italia, España y
Estados Unidos. En este último país, este patógeno es considerado el principal problema
bacteriano para el avellano. La mayor parte de las pérdidas se dan en plantaciones con
árboles jóvenes de entre uno y cuatro años, edad en la cual pueden provocar hasta un
10% de muerte del huésped. Los árboles por encima de esta edad raramente mueren
pero suelen tener pérdidas de hasta el 10% de los frutos debido a la muerte de las

5
ramillas. Se han registrado pérdidas en Francia de hasta 250 000 plantas jóvenes y en
diversas plantaciones se ha registrado la muerte de hasta un 100% de los árboles
menores de cuatro años junto con una proporción muy baja de árboles mayores a esta
edad (Lamichhane & Varvaro, 2014).

Para el control químico de esta enfermedad se utilizan principalmente compuestos

basados en cobre, aunque resultan ser poco efectivos una vez que la bacteria penetra el
tejido de la planta pero pueden ser usados como métodos preventivos. Es necesario por
tanto el uso de otras técnicas tales como la poda de zonas infectadas y la eliminación del
material vegetal, así como la correspondiente desinfección de las herramientas de
trabajo y el material de poda. Además, se aconseja sellar las heridas provocadas con
materiales antibacterianos basados en cobre. El método más efectivo que se ha usado
para el control de la enfermedad hasta el momento es la prevención, basada en el uso de
material vegetal libre del patógeno, así como una política de vigilancia y detección
temprana (Lamichhane & Varvaro, 2014).

Figura 21. Sintomatología propia de la mancha bacteriana del avellano, causada por X. arboricola pv.
corylina (Lamichhane & Varvaro, 2014).

1.5.5 Xanthomonas arboricola pv. juglandis: Agente causal de la podredumbre

bacteriana, la necrosis apical y la chancrosis del nogal.

X. arboricola pv. juglandis, es el agente causal de la mancha bacteriana, la necrosis

apical y la chancrosis del nogal. Esta enfermedad, descrita en Estados Unidos a inicios
del siglo XX, actualmente se encuentra distribuida a nivel mundial (Lamichhane, 2014)

5
(Figura 22). X. arboricola pv. juglandis no es considerado patógeno de cuarentena en la
Unión Europea y su único huésped es la especie Juglans regia (Marcelletti et al., 2010).

Estudios de variabilidad genética poblacional para este patovar, inicialmente

desarrollados con F-AFLPs (Hajri et al., 2010) y corroborados posteriormente mediante
MLSA y MLVA (Essakhi et al., 2015; Fischer-Le Saux et al., 2015), han demostrado la
existencia de dos linajes, uno de ellos asociado a la podredumbre bacteriana y la
necrosis apical, denominado WB y otro relacionado con la chancrosis del nogal,
denominado VOC (Hajri et al., 2010).

Figura 22. Mapa de distribución de X. arboricola pv. juglandis a nivel mundial según la “European and
Mediterranean Plan Protection Organization” (tomado de EPPO actualizado a fecha 17 de marzo de
2015).

La sintomatología propia de esta enfermedad incluye la deformación de las hojas y la

presencia de manchas necróticas en las mismas, chancros necróticos en las ramillas y el
tronco que exudan durante el verano creando manchas en la madera. La severidad de la
enfermedad puede ser muy alta viéndose reducida la producción de fruta debido a su
caída o disminuida su calidad como consecuencia de la decoloración de la nuez. En
etapas tardías, la necrosis apical, no se debe solamente a la actividad bacteriana sino
también a la presencia de algunos hongos oportunistas de los géneros Alternaria y
Fusarium (Scortichini, 2010) (Figura 23).

El inóculo primario de este patógeno lo conforman las infecciones latentes en brotes, las
cicatrices de las hojas y los chancros. Una vez se inicia una nueva etapa vegetativa, las

5
bacterias pasan del estado saprófito al estado parasítico y penetran en el interior del
tejido vegetal, ya sea por los estomas o por heridas. Las infecciones suelen ser más
severas en la primavera, cuando hay mayor cantidad de precipitaciones (Lamichhane,
2014). Se ha visto predisposición a infecciones graves en suelos arenosos ácidos y con
deficiencias en fósforo, calcio y magnesio (Scortichini, 2010).

El control de esta enfermedad se basa en el uso de diversas estrategias, empezando por

el uso de material vegetal libre del patógeno. Una vez establecido el agente causal, se
recomienda realizar aplicaciones de compuestos cúpricos, la eliminación de las zonas
infectadas del árbol y la optimización de la fertilización y el riego. Se recomienda
además eliminar las malas hierbas presentes en las plantaciones, que podrían servir
como reservorios de la bacteria. En relación al uso de control biológico, se han
documentado cepas bacterianas del género Pseudomonas que son capaces de reducir la
severidad de la enfermedad entre un 41 y un 77% en árboles jóvenes (Ozaktan et al.,
2012; Lamichhane, 2014).

Figura 23. Sintomatología propia de la mancha bacteriana y la necrosis apical del nogal (panel superior)
y del chancro del nogal (panel inferior), causado por X. arboricola pv. juglandis (Ozaktan et al., 2012;
Lamichhane, 2014).

5
1.5.6 Xanthomonas arboricola pv. pruni: agente causal de la mancha bacteriana en
frutales del género Prunus.

X. arboricola pv. pruni (Vauterin et al., 1995) (sinónimo, X. campestris pv. pruni
Smith; X. campestris Dowson), es el agente causal de la mancha bacteriana de los
frutales de hueso y el almendro, enfermedad descrita en Estados Unidos en 1903
afectando ciruelo japonés (Boudon et al., 2005). A continuación, se tratarán diversos
aspectos sobre este organismo.

1.5.7 Diversidad genética y estructura poblacional:

A pesar de que la enfermedad de la mancha bacteriana se encuentra presente en Italia

desde 1920 y en Rumanía desde 1941 (Boudon et al., 2005), no es hasta finales del siglo
XX cuando se inician los estudios dirigidos a la caracterización molecular de sus
poblaciones y su diversidad genética en Europa.

En un primer trabajo, se llevó a cabo el análisis de la diversidad poblacional en una

colección de cepas italianas, incluyendo también algunas provenientes de otros
continentes (Zaccardelli et al., 1999). El perfil de AFLPs mostrado por las 109 cepas
analizadas, permitió distinguir 12 diferentes grupos que presentaban una similitud muy
alta del 90-99%.

Posterior a este estudio, Boudon y colaboradores (2005), determinaron mediante

análisis de la secuencia del ITS del operón rrn y mediante MLSA utilizando los genes
atpD, dnaK, efp y glnA que la secuencia de nucleótidos era idéntica para todas las cepas
de X. arboricola pv. pruni independientemente del lugar y la fecha de aislamiento, lo
cual evidenciaba una muy alta similitud dentro de este grupo filogenético. Por otro lado
utilizando FAFLPs, se determinó la existencia de 14 genotipos, pero la mayoría de
cepas, representantes de cinco países y cuatro continentes pertenecían a un único grupo,
lo cual corroboraba la baja diversidad genética media observada en el patovar (0,29 ±
0.11%). Se encontró además, que la diversidad genotípica era mayor en las cepas
europeas (H= 0,8) que en aquellas cepas aisladas de Estados Unidos (H= 0,48).

5
Además, estudios basados en el perfil de integrones y casetes génicos y BOX-PCR,
llevados a cabo para este patógeno (Barionovi & Scortichini, 2006), han permitido
profundizar más en los estudios sobre la variabilidad de las cepas. Se encontraron dos
patrones de amplificación de los casetes, que sin embargo no presentaban ninguna
relación a otra característica asociada a las cepas, como pueden ser su origen geográfico
o su huésped original. De igual manera, el genotipado basado en la amplificación de
secuencias repetidas de los elementos BOX mostró poca variabilidad entre las cepas,
además ésta no concordaba con los resultados obtenidos mediante la técnica anterior.
Estos resultados podrían indicar que a pesar de la uniformidad en los perfiles de casete
génico, existen diferentes linajes dentro de este patovar.

Más recientemente, en nuevo intento de observar la composición poblacional basado en

un esquema de MLSA utilizando los genes atpD, dnaK, efp, fyuA, glnA, gyrB y rpoD
(Fischer-Le Saux et al., 2015), determinó que todas las cepas del patovar pruni que se
analizaron, formaban un grupo monofilético con un bajo grado de polimorfismo,
corroborando que este grupo conforma un grupo casi clonal.

Dado que todos estos métodos han presentado poca resolución para poder analizar la
variación genética existente dentro del patovar, en especial para determinar diferencias
entre cepas con una reciente separación espacio-temporal, se ha procedido a realizar el
genotipado de este patovar mediante el uso del MLVA, al tratarse éste de un método
eficiente para analizar la diversidad de patógenos bacterianos monomórficos (López-
Soriano et al., 2016). Se ha desarrollado un esquema de MLVA basado en el genoma de
X. arboricola pv. pruni con el fin de diferenciar los diferentes patovares de la especie,
utilizando un total de 26 loci VNTR polimórficos que se encuentran presentes en todas
las cepas de la especie (Essakhi et al., 2015).

Utilizando un esquema basado en seis loci VNTR polimórficos, se estudiaron 25 cepas

del patovar pruni aisladas de P. laurocerasus en Holanda. La diversidad genética
observada mediante esta técnica fue baja puesto que solo se lograron identificar dos
diferentes haplotipos y tal como se ha observado con otras técnicas de genotipado
usadas en este patovar, no fue posible entablar relación alguna entre el grupo de MLVA
y su origen geográfico (Bergsma-Vlami et al., 2012).

Recientemente, haciendo uso de esta misma técnica, se ha estudiado la diversidad

genética de las cepas de X. arboricola pv. pruni aisladas en España (López-Soriano et

5
al., 2016). Un total de 239 cepas españolas y 25 cepas de referencia procedentes de
diversas regiones geográficas fueron analizadas utilizando un esquema de MLVA
basado en 23 loci polimórficos. El esquema incluía la combinación de dos marcadores
moleculares, los mini y micro satélites. Se logró identificar un total de 119 haplotipos
de MLVA, los cuales se agruparon en 18 “cluster” génicos, cada uno agrupando a
aquellos haplotipos que se diferenciaban en menos de 4 loci de secuencias repetidas.
Estos haplotipos, también se agruparon en 16 complejos clonales y 34 singletones. Al
comparar el perfil de MLVA de las 239 cepas de España con las 25 cepas procedentes
de diferentes regiones del mundo, se observó una clara diferencia entre ambos grupos,
donde las cepas españolas presentaron variaciones entre 4 y 15 loci. El hecho de que al
menos el 50% de las cepas analizadas presentaran diferentes haplotipos, demostró que
el MLVA es una técnica apropiada para analizar molecularmente la variación entre
cepas que han tenido una historia evolutiva muy próxima. Finalmente, se determinó que
la introducción de este patovar en España no es consecuencia de un único evento en el
tiempo sino que ha sido introducido en varias ocasiones y por al menos cuatro “cluster”
génicos diferentes.

1.5.8 Interacción huésped-patógeno-ambiente en el contexto de la mancha

bacteriana de los frutales de hueso y el almendro:

De manera clásica, la interacción entre los componentes que permiten el desarrollo de

una enfermedad es representada mediante el llamado triángulo de la enfermedad, en el
cual los vértices representan a la planta, el patógeno y el ambiente. En este apartado, se
tratará cada uno de los componentes que intervienen en el triángulo de la mancha
bacteriana de los frutales del género Prunus así como sus interacciones.

[Link] El patógeno

En cuanto al patógeno, la información existente sobre los diversos factores asociados a

la patogénesis es muy reducida. Con respecto a los mecanismos iniciales de la
infección, solamente se han estudiado aspectos asociados al lipopolisacáridos y a la
goma xanthano, mientras que en relación a etapas más tardías de la infección, se ha
determinado mediante PCR el repertorio de efectores tipo III de este patovar.

5
Con respecto a la estructura del polisacárido específico O que forma parte del
lipopolisacárido, ésta ha sido estudiada en la cepa NCPPB 416 de este patovar
(Molinaro et al., 2003), observándose que se encuentra compuesta por tres
monosacáridos, glucosa, ramnosa y xilosa. El espectro observado por resonancia
magnética nuclear ha permitido dilucidar una estructura muy irregular en la cual se da la
repetición de cinco unidades distintas.

La producción de la goma xanthano en esta especie ha sido estudiada en al menos 48

cepas que presentan una producción variable. Todos los polímeros producidos presentan
un comportamiento pseudoplástico con una viscosidad que aumenta de manera
proporcional a la concentración de manosa. La mayor viscosidad de este polisacárido se
observó después de 24 horas de fermentación (Moreira et al., 2001). Además, en la
composición química del xanthano en esta bacteria intervienen los compuestos glucosa,
ramnosa, manosa y ácido glucurónico (Borges & Vendruscolo, 2008).

Por último en cuanto a los factores de virulencia estudiados en X. arboricola pv. pruni,
las cepas virulentas de esta especie presentan un T3SS del tipo hrc/hrp típico de
Xanthomonas, el cual está compuesto por los genes hrcC, hrcJ, hrcN, hrcR, hrcS, hrcT,
hrcU, hrcV, hrpB1, hrpD5 y hrpF. Mientras que el perfil de efectores tipo III para esta
bacteria fitopatógena está compuesto por al menos 21 efectores identificados todos ellos
mediante PCR. Los efectores presentes en el patovar pruni son: avrBs2, avrXccA1,
avrXccA2, hpaA, hrpW, xopA, xopAF, xopAH, xopAI, xopE2, xopE3, xopF1, xopG,
xopK, xopL, xopN, xopQ, xopR, xopV, xopX y xopZ (Hajri et al., 2012).

[Link] El huésped.

Con respecto al segundo vértice del triángulo de la enfermedad de esta bacteriosis, los
huéspedes naturales para este patógeno corresponden a frutales, ornamentales y plantas
silvestres del género Prunus. Dentro de las especies cultivadas, aquellas en las que esta
bacteria produce mayores daños son, el albaricoquero (P. armeniaca), el almendro (P.
amygdalus), el ciruelo (P. salicina y P. japonica) y sus correspondientes híbridos, así
como el melocotonero (P. persica) y sus correspondientes híbridos. Otros huéspedes en
los cuales se ha identificado la presencia de este patógeno son, el endrino (P.
domestica), el cerezo (P. avium), el guindo (P. cerasus), el lauroceraso (P.
laurocerasus), el melocotón silvestre chino (P. davidiana), P. buergeriana, P. crassipes

5
y P. donarium. Por lo general los patrones portainjertos utilizados son resistentes a la
enfermedad (EPPO, 2003; Stefani, 2010; EFSA, 2014).

A pesar de que la gran mayoría de especies del género Prunus se encuentran en las
regiones templadas del hemisferio norte, en el continente europeo la producción de
albaricoque, almendro, ciruelo, melocotón y nectarinas se da principalmente en la
región mediterránea. En este ámbito geográfico, España es el primer productor de
almendro (561,5 Tm/1000 Ha) y albaricoquero (48 Tm/1000 Ha), el segundo productor
de melocotón (51,9 Tm/ 1000 Ha) y nectarino (25,7 Tm/1000 Ha) y el tercer productor
europeo de cerezo (24,1 Tm/1000 Ha) y de ciruelo (19,1 Tm/ 1000 Ha) (EFSA, 2014).
Además, España, es el tercer productor mundial de melocotón y nectarino y el segundo
productor mundial de almendro. Debido a lo anterior, X. arboricola pv. pruni representa
una importante amenaza para la fruticultura y su impacto económico puede llegar a ser
muy alto (Palacio-Bielsa et al., 2014).

La resistencia por parte del huésped a X. arboricola pv. pruni ha sido estudiada en
albaricoquero, ciruelo y melocotonero, tanto en condiciones de invernadero como en
campo, encontrándose una variación en la susceptibilidad entre las distintas especies.
Sin embargo, aún los huéspedes menos susceptibles presentan síntomas de la mancha
bacteriana, no existiendo una resistencia completa. La existencia de un mapa físico del
melocotonero y la secuenciación de su genoma, ha permitido generar mapas de diversos
loci de carácter cuantitativo (QTL) relacionados con la resistencia a patógenos, los
cuales gracias a la alta sintenia presente entre las diversas especies de Prunus pueden
extrapolarse a otras especies (Socquet-Juglard et al., 2013a).

Se ha estudiado además la resistencia a Xanthomonas arboricola pv. pruni en una

población de ciruelo derivada del cruce entre las variedades “Harostar” x “Rouge de
Mauves” con el fin desarrollar un análisis de QTLs para la resistencia a este patógeno.
Como resultado, se encontró un QTL con un efecto mayoritario sobre la variación
fenotípica observada. Éste se encontró en el grupo de ligamiento 5 del parental “Rouge
de Mauves” que segrega junto con el microsatélite UDAp-452. Al dividir la población
analizada según los alelos observados para este microsatélite, se observó que aquellos
con el alelo favorable presentaron una reducción del 35,6% en la severidad de la
enfermedad (Socquet-Juglard et al., 2013a).

5
El uso de variedades susceptibles se encuentra entre los factores críticos para la
aparición de brotes severos y la distribución a larga escala de la enfermedad. Los
cultivares más susceptibles para el ciruelo son, Calita, Angeleno, Frontier, Santa Rosa,
the “Black” group, Anna y T.C. Sun. Mientras que los cultivares más susceptibles para
el melocotonero corresponden a Summer Rich, O’Henry, Rich Lady, Red Valley,
Elegant Lady, Big Top, Flavorcrest, Flavortop y Cassiopea (Scortichini, 2010).

En relación a la interacción de los huéspedes del género Prunus con X. arboricola pv.
pruni, los estudios realizados con microscopía electrónica (Plessis, 1984),
inmulocalización y la histocitopatología (Aarrouf et al., 2008), han permitido
determinar cómo se da el ingreso y la colonización del tejido por parte de la bacteria
tanto en ciruelo como en melocotonero.

En el caso del ciruelo (Plessis, 1984), se estableció que X. arboricola pv. pruni infecta
las ramillas de manera sistémica a través de los peciolos de las hojas infectadas. El
patógeno fue observado en los tejidos del xilema de los peciolos de las hojas inoculadas
y además se encontró en el tejido del córtex de las ramillas en la zona adyacente a los
peciolos infectados. De igual manera, se determinó que la bacteria es capaz de dirigirse
de manera sistémica hasta el tejido meristemático de los brotes. Posteriormente, en
melocotonero (Aarrouf et al., 2008), se demostró que el patógeno es capaz de ingresar
al tejido del mesófilo a través de los estomas, colonizando el espacio intercelular,
degradando los componentes de la pared celular, colapsando las células y dando lugar a
lesiones necróticas. El análisis de secciones de la nervadura central tomadas a diversas
distancias desde la lámina infectada, permitió observar la presencia de la bacteria en los
tubos cribosos y en el xilema lo que podría sugerir el tráfico sistémico del patógeno.

La respuesta de la planta ante la infección del X. arborícola pv. pruni, ha sido estudiada
en hojas de melocotonero. Inicialmente se procedió a analizar los factores de respuesta
asociados a etileno (Sherif et al., 2012), los cuales corresponden a factores de
transcripción asociados al desarrollo y la inmunidad de las plantas. Se estudió el rol
desempeñado por cinco de estos factores de transcripción durante el desarrollo de la
mancha bacteriana. Todos éstos, correspondieron a activadores transcripcionales y dos
de ellos (Pp-ERF2.b y Pp-ERF2.c) fueron localizados núcleo celular. La inducción
cinética de estas proteínas, después de la inoculación con X. arboricola pv. pruni,
estudiada mediante PCR cuantitativa, demostró que todos incrementaron su expresión

5
de manera rápida y muy marcada en aquellos cultivares de melocotonero más
resistentes. Estos activadores transcripcionales también aumentaron su expresión al
tratar las plantas con etileno o ácido jasmónico, lo que sugiere una actividad sinérgica
de ambas rutas metabólicas durante el proceso de defensa contra X. arboricola pv.
pruni.

Posteriormente se analizó el efecto del patógeno sobre el huésped mediante el examen

del transcriptoma del melocotonero (Socquet-Juglard et al., 2013b) a las 2 h y 12 h
posteriores a la inoculación. De los 19.781 genes conocidos en el melocotonero, 34 y
263 fueron diferencialmente expresados en cada uno de los tiempos analizados
respectivamente Aquellos genes asociados a procesos metabólicos y respuesta a estrés
fueron reprimidos a 2 h, mientras que a 12 h fueron los que presentaron el mayor grado
de expresión. Dentro de éstos, han sido de particular interés aquellos asociados a
receptores de PAMPs, como por ejemplo los de la familia RPM1. Otros genes
relacionados con la fotosíntesis, la reorganización de la pared celular y las rutas
metabólicas hormonales fueron también diferencialmente expresados. Por último, una
serie de genes con función desconocida también sufren cambios en su expresión, por lo
que son dianas interesantes para desarrollar futuros estudios sobre la defensa en Prunus
a este patógeno bacteriano.

[Link] El ambiente.

Desde el punto del ambiente, el suelo parece jugar un papel importante en la severidad
observada en esta enfermedad en los diferentes huéspedes. Se considera que suelos
arenosos y arcillosos son factores que predisponen para la aparición de brotes severos
de la mancha bacteriana (Scortichini, 2010). Los síntomas de esta enfermedad, no se
han desarrollado cuando los árboles han sido plantados en suelos arenosos con una
mezcla de limo y vermiculita (Zehr et al., 1996). De la misma manera se ha visto un
incremento considerable de la susceptibilidad a la enfermedad por parte del huésped
cuando este se encuentra en suelos infestados con el nematodo Criconemella xenplax
(Shepard et al., 1999).

En cuanto a las condiciones ambientales, la influencia de la congestión hídrica, el

período de mojadura foliar y la temperatura, han sido estudiadas en melocotonero
cultivar Suwanee a 24 y 30 ºC. Se determinó, que la congestión hídrica en la hoja

6
seguida por un periodo de mojadura foliar, con una humedad relativa cercana al 100%,
por al menos 36 h y en suelos arenosos, conforman las condiciones óptimas para el
desarrollo de síntomas. La aparición de síntomas a 24 ºC fue más lenta que a 30 ºC. Para
que se desarrollaran síntomas severos a temperaturas de 24 ºC, se requirió de periodos
de mojadura foliar superiores a 18 h (Zehr et al., 1996).

1.5.9 Distribución geográfica e impacto económico de X. arboricola pv. pruni:

X. arboricola pv. pruni se encuentra distribuida a nivel mundial en las principales zonas
productoras de frutales del género Prunus (Figura 24). En Europa, los casos más
severos de la mancha bacteriana se han encontrado en zonas de la región mediterránea,
como en el centro y este de España, el sureste de Francia y el valle del rio Po al norte de
Italia (EFSA, 2014). Además, por países, se ha informado la presencia de este patógeno
en Italia, donde es considerado endémico y ha sido catalogado como enfermedad
emergente en Alemania, Bélgica, España, Francia, Holanda, Suiza y diversos países de
Europa del Este (López-Soriano et al., 2016). La dispersión de este patógeno desde una
zona geográfica a otra se debe principalmente al movimiento de material vegetal
(portainjertos o plantas injertadas) principalmente con infecciones latentes. A corta
distancia el patógeno se disemina fácilmente gracias a las lluvias abundantes y las
tormentas acompañadas de fuertes vientos (EFSA, 2014).

España es uno de los principales productores de fruta del género Prunus. Se dedican
alrededor de 562.616 Ha a la producción de almendro, 76.730 a la producción de
melocotón y nectarina, 24.304 Ha a la producción de cereza, 19.226 Ha a la producción
de albaricoque y 18.489 Ha a la de ciruelo. X. arboricola pv. pruni se encontró por
primera vez en el año 2002 en Badajoz en ciruelo japonés y posteriormente en el año
2004 en nectarina y ciruelo japonés en viveros de plantones en Valencia. En el año 2006
fue identificada en almendro en Alicante y en el año 2008 en melocotonero y ciruelo en
Zaragoza y Huesca, así como sobre melocotonero y nectarina en Lérida. En el año 2009,
fue encontrado en almendro en Navarra, Zaragoza y Huesca y finalmente en el año 2010
fue informada su presencia en Mallorca afectando ciruelo japonés. En todos los casos se
implementaron programas de erradicación por lo que actualmente se sigue considerando
una enfermedad emergente y de cuarentena (Roselló et al., 2012; Palacio-Bielsa et al.,
2014).

6
Los síntomas asociados a este patógeno son la defoliación, la formación de chancros en
el tronco y eventualmente se puede provocar la muerte del árbol, así como producirse
pérdidas en la producción o la obtención de fruta no apta para la venta, todo ello
conlleva cuantiosas pérdidas en los cultivos (EFSA, 2014). En Estados Unidos se
informó en 1932 que las pérdidas en plantaciones de ciruelo japonés podían estar entre
el 25 y 75% de la fruta producida (Stefani, 2010). En Uruguay, en años con condiciones
ambientales favorables para la enfermedad, las pérdidas en variedades sensibles de
melocotonero pueden llegar a superar el 50% y si se consideran las pérdidas generadas
por la imposibilidad de comercializar el fruto sintomático, éstas pueden llegar a superar
el 80% en variedades susceptibles de nectarina (Palacio-Bielsa et al., 2015a).

Figura 24. Mapa de distribución de X. arboricola pv. pruni a nivel mundial según la “European and
Mediterranean Plan Protection Organization” (tomado de EPPO actualizado a fecha 30 de setiembre de
2016)

En Europa, una estimación de lo que significaría económicamente la mancha bacteriana

ha determinado que las pérdidas que se producirían serían de hasta 11.200 euros por
hectárea en el caso de la variedad Golden o 9.500 euros en el caso de la variedad
Angeleno (Stefani, 2010). En España, sólo se han estimado las pérdidas en almendro en
Aragón, las cuales en el año 2013 oscilaron entre 23 y 47%, y dependían éstas
principalmente de las condiciones ambientales y a el uso de cultivares sensibles
(Palacio-Bielsa et al., 2014, 2015a).

6
1.5.10 Sintomatología asociada a la mancha bacteriana de los frutales del género
Prunus:

De manera general, tanto los tejidos herbáceos, como hojas, brotes, frutos, así como los
tejidos lignificados, ramillas, ramas y el tronco; pueden ser afectados por este patógeno.
Sin embargo, no se han observado daños en las flores. Los síntomas en nectarinos,
melocotoneros y almendros suelen observarse principalmente en las hojas y los frutos,
mientras que los chancros en las ramas y el tronco suelen observarse en ciruelo
(Lamichhane, 2014).

Los síntomas foliares se inician como pequeñas manchas de color verde pálido que
derivan hacia manchas necróticas poligonales que por lo general se encuentran
delimitadas por las nervaduras de las hojas y pueden estar rodeadas por un halo
clorótico (Palacio-Bielsa et al., 2014). El mayor daño suele observarse en el punto de
goteo de la hoja, tanto en melocotonero como en nectarino. Desde el punto de goteo
hacia el peciolo de la hoja es común observar un gradiente de color marrón-amarillo-
verde y en infecciones severas se puede producir defoliación. En el caso del almendro
se pueden observar los mismos síntomas, excepto que no se produce clorosis de la hoja
ni se da la defoliación (Figuras 25 y 26).

Los síntomas en fruto se describen como manchas pardas rodeadas de un halo clorótico.
En etapas iniciales de la infección, estas manchas pueden extenderse y necrosarse,
produciendo hundimiento del mesocarpio y la secreción de exudados conforme el fruto
crece. En el almendro los síntomas suelen ser muy característicos y conspicuos, estos se
inician como manchas oscuras y hundidas en el mesocarpio que presentan
frecuentemente la producción de exudados. Al deshidratarse el mesocarpio, la zona de
las heridas sobresale de la superficie del fruto y se quedan adheridas al endocarpio. Se
suele producir la caída prematura del fruto o éste permanecer adherido al árbol tras la
cosecha. Las infecciones severas pueden generar también problemas a nivel de la
semilla, ya sea deshidratándola o provocando manchas de color pardo (Palacio-Bielsa et
al., 2014).

6
Figura 25. Sintomatología propia de la mancha bacteriana causada por X. arboricola pv. pruni tanto en
hojas (A y B) y frutos (C, D y E) de melocotonero. Hojas (F) y fruto (G) de albaricoquero así como la
presencia de chancros en el tronco de ciruelo (H) (Lamichhane, 2014).

Figura 26. Sintomatología propia de la mancha bacteriana provocada por X. arboricola pv. pruni en
hojas (A) y frutos (B, C y D) de almendro (Lamichhane, 2014).

6
1.5.11 Epidemiología de la mancha bacteriana de los frutales del género Prunus:

X. arboricola pv. pruni sobrevive el invierno en brotes latentes desde los cuales una vez
iniciada la etapa vegetativa del ciclo productivo y los brotes empiezan a crecer, cambia
a fase parasítica y coloniza el tejido foliar y los frutos. La bacteria penetra al interior del
tejido foliar a través de los estomas o mediante heridas producidas por las labores
agrícolas, la caída de hojas, las heladas, el granizo o el viento. Para que la infección sea
exitosa, se requiere que los tejidos se encuentren en estado de congestión hídrica, haya
temperaturas entre 19 y 30 ºC y una elevada humedad relativa. En el caso del ciruelo,
los chancros de los troncos y ramas también pueden actuar como fuentes de inóculo
primario de este patógeno. Muy pocas infecciones se producen en condiciones
ambientales secas y cálidas (Scortichini, 2010; Lamichhane, 2014; Palacio-Bielsa et al.,
2014).

Como resultado de esta primera infección se producen las lesiones de primavera, a partir
de los cuales y mediante la producción de exudado la bacteria se disemina a otras
regiones del árbol dando lugar a las lesiones de verano. En el otoño las infecciones se
dan en los brotes latentes que serán los sitios donde la bacteria persista durante el
invierno. A corta distancia, entre árboles de una misma plantación, la bacteria se
disemina mediante el efecto aerosol generado por la lluvia y el viento, aunque también
mediante la maquinaria agrícola. Se ha determinado que la bacteria es capaz de
permanecer en el suelo en los restos vegetales, por lo que no se pueden descartar como
fuentes de inóculo primario (Scortichini, 2010; Palacio-Bielsa et al., 2014) (Figura 27).

6
 Chancros de primavera
Primeros síntomas
primavera (infecciones
primarias)

Proliferación en Diseminación por

condiciones agua de lluvia,
favorables viento y labores
culturales
(infecciones
secundarias)

Distribución desde
chancros y yemas

Supervivencia en restos Chancros de verano

vegetales en el suelo,
yemas y chancros

Figura 27. Ciclo de la enfermedad de la mancha bacteriana de los frutales del género Prunus provocada
por X. arboricola pv. pruni (Palacio-Bielsa et al., 2014).

1.5.12 Diagnóstico y control de la mancha bacteriana de los frutales del género

Prunus:

Al igual que en la mayoría de las bacteriosis de plantas, el control de la mancha

bacteriana no es una tarea fácil, por lo que es necesario recurrir a una estrategia de
control integrado que incluya y combine diferentes métodos. Para evitar la dispersión
del patógeno hacia zonas libres del mismo es necesario realizar una detección temprana
y para ello es imprescindible contar con sistemas de detección y diagnóstico eficaces
que permitan determinar la presencia del patógeno tanto en material vegetal sintomático
como asintómatico.

Para el diagnóstico de X. arboricola pv. pruni se han desarrollado diversas

herramientas. Se han descrito al menos dos medios semiselectivos para este patógeno, el
primero de ellos, el XCP1, permite diferenciar las colonias del patógeno, ya que éstas se
observan de color amarillo, mucoides y rodeadas de un halo translúcido como producto

6
de la degradación del Tween 80 (Palacio-Bielsa et al., 2012). Un segundo medio de
cultivo semiselectivo es el XPSM (Civerolo et al., 1982) que permite observar al
patógeno después de 6-7 días a 27 ºC como colonias de color gris claro, convexas y
opacas. Realizar el diagnóstico únicamente basado en la utilización de estos medios de
cultivo no es recomendable ya que se han observado fenotipos semejantes con otras
bacterias del género.

En cuanto al uso de métodos serológicos, se aconseja el uso de antisueros y kits

disponibles comercialmente para este patógeno, tanto para su uso en inmuno-
fluorescencia como para ensayos de tipo ELISA. El uso de estas técnicas ha sido
validado tanto en ciruelo como en melocotonero. Sin embargo, el hecho de que los
anticuerpos disponibles sean antisueros policlonales, hace que la detección no sea
específica para X. arboricola pv. pruni. Además, los antisueros disponibles presentan
reacción cruzada con otras especies de Xanthomonas, por lo que su uso solo se aconseja
para determinar de manera rápida, si la muestra contiene bacterias de este género
bacteriano, pero no para un diagnóstico preciso de la mancha bacteriana (López et al.,
2010).

En relación a los métodos de detección moleculares, se han desarrollado protocolos de

PCR, PCR en tiempo real y de amplificación isotérmica de ácidos nucleicos (LAMP).
Los protocolos basados en PCR convencional, han sido ampliamente utilizados basados
en los cebadores Y17CoF/Y17CoR, que amplifican un fragmento de 943 pb,
correspondiente a una región parcial del gen hipotético ftsX que perece corresponder a
un transportador tipo ABC. A pesar de que permite identificar a X. arboricola pv. pruni,
el método no resulta ser lo suficientemente sensible, por lo que no es aconsejado para
ser usado con muestras vegetales asintomáticas. Además también se ha informado de su
reacción cruzada con X. arboricola pv. corylina (López et al., 2010).

Otro protocolo utilizado para detectar X. arboricola pv pruni mediante PCR

convencional es el basado en los cebadores XapF/XapR, los cuales amplifican una
región de 243 pb asociada al cluster hrp de Xanthomonas (Park et al., 2010). Según sus
autores, este protocolo resulta ser específico para el patovar pruni y ha sido útil para
detectar el patógeno tanto en hojas como en frutas naturalmente infectadas. Este método
tiene una sensibilidad de hasta 3 pg de DNA bacteriano puro, lo cual corresponde
aproximadamente a 300 células.

6
También han sido desarrollado un método de PCR convencional utilizando la variante
de PCR multiplex (Pothier et al., 2011a). Este método se basa en el uso de un primer
par de cebadores que concuerdan con los descritos previamente para la amplificación de
una región de 943 pb del gen ftsX, y un segundo par de cebadores (XarbQ-F/XarbQ-R)
que amplifica una región de 402 pb del gen qumA asociado al metabolismo del quinato.
Al utilizar ambas parejas de cebadores en modo multiplex, ambas regiones se
amplifican en todas las cepas del patovar pruni, pero también en las cepas de X.
arboricola pv. corylina. La sensibilidad de este método a partir de cultivo puro o de
muestras inoculadas se encuentra en el rango de 5x102 UFC/ml.

Asimismo, se han descritos dos métodos de PCR tiempo real, el primero de ellos se
basa en el uso de cebadores así como una sonda TaqMan sintetizados a partir de la
región del gen ftsX descrita previamente (Palacio-Bielsa et al., 2011, 2015b). Los
cebadores Xap-2F/Xap-2R así como la sonda Xap-2p, permiten amplificar un fragmento
de 72 pb. Este método, resulta ser altamente específico y sensible y ha sido validado por
diversos laboratorios tanto en muestras sintomáticas como asintomáticas de
melocotonero, almendro y ciruelo; llegándose a detectar en planta hasta 10 2 UFC/ml.
Este protocolo es de los más utilizados actualmente, sin embargo, presenta reacción
cruzada con X. arboricola pv. corylina.

Otro método de PCR tiempo real pero basado en la tecnología SYBR Green es el
desarrollado a partir de los cebadores 29F/29R, que amplifican una región de 344 pb.
Este método resulta ser específico para Xanthomonas arboricola pv. pruni y presenta
una sensibilidad de 103 UFC/ml en cultivo puros y de 0.1 pg de DNA a partir de DNA
bacteriano puro. Debido a que la sensibilidad observada en muestras vegetales
naturalmente infectadas no fue lo suficientemente alta, se aconseja para esos casos
utilizarlo en su versión de Bio-PCR, en el cual se añade un paso previo a la reacción de
PCR en tiempo real consistente en un enriquecimiento de la población bacteriana
mediante su cultivo en el medio semiselectivo XPSM (Ballard et al., 2011).

Finalmente, entre los métodos moleculares, también se ha desarrollado un estrategia de

detección basada en la tecnología LAMP (Bühlmann et al., 2013). Este método presenta
una sensibilidad semejante a la obtenida en el método de PCR tiempo real basado en la
tecnología de sondas TaqMan descrito previamente (Palacio-Bielsa et al., 2015b), por lo

6
que resulta ser un método rápido, específico y sensible para la detección de la mancha
bacteriana y el diagnóstico de X. arboricola pv. pruni.

Además de un diagnóstico rápido y eficiente, para el control de esta enfermedad,

también se aconseja el uso de material vegetal con baja susceptibilidad a este patógeno.
Los cultivares que se han encontrado, sin embargo, no presentan las características
deseadas para la producción de fruta de calidad, por lo que en general, se recomienda
utilizar dentro de lo posible, cultivares diferentes a los descritos como más susceptibles
en Francia e Italia (Palacio-Bielsa et al., 2014).

En relación al control químico, de modo preventivo, se aconseja utilizar componentes

químicos basados en el cobre, sin embargo el uso excesivo de este tipo de materiales
podrían llevar a la generación de resistencia por parte del patógeno (Lamichhane, 2014).
Cuando el patógeno ya ha sido detectado en el área de producción, se aconseja que los
tratamientos con cobre se den en otoño, una vez se dé la caída de las hojas, para evitar
que las bacterias pasen el invierno en las heridas de las hojas o en los brotes latentes. En
primavera se aconseja también su aplicación con el fin de disminuir las infecciones
primarias (Palacio-Bielsa et al., 2014).

Entre las medidas agronómicas a tomar en cuenta para el control de la mancha

bacteriana de los frutales de hueso y del almendro también se encuentran la selección de
suelos aptos para el cultivo, ya que zonas de suelo arenoso y arcilloso o con capacidad
de retener mucha humedad pueden favorecer el desarrollo de la enfermedad. Además, se
aconseja podar durante el invierno aquellas zonas del árbol que se han visto afectadas,
así como los chancros de ramas y troncos. Todos estos restos vegetales, así como los
que se encuentren en el suelo deben ser eliminados y la herramienta de trabajo debe ser
convenientemente desinfectada al realizar las tareas de poda (Palacio-Bielsa et al.,
2014).

En cuanto al control biológico de este patógeno, se han descrito varias cepas bacterianas
epífitas con efecto antagonista sobre X. arboricola pv. pruni. En experimentos
realizados in vitro, una cepa de P. fluorescens fue seleccionada debido a su mayor
potencial inhibitorio. Durante dos diferentes ciclos productivos la cepa biocontroladora
seleccionada dio lugar a una reducción en la severidad de la enfermedad en plantaciones
de melocotonero y nectarino analizadas (Biondi et al., 2009). Además de esta cepa,
también se ha utilizado la cepa de P. aeruginosa LV. El sobrenadante liofilizado de

6
cultivos de esta bacteria aplicado a una concentración de 450 μg/ml sobre las plantas en
condiciones de invernadero, produjo una reducción considerable de la severidad de la
enfermedad. Además, sobre el patógeno, se observó un efecto sobre la producción de
exopolisacárido y generó cambios en su morfología celular (Silva Vasconcellos et al.,
2014). De la misma manera, se ha comprobado la capacidad controladora de dos cepas
no patógenas de X. campestris (AZ98101 y AZ98106), en ensayos de campo sobre
diversos cultivares de melocotonero. De manera general, se observó una reducción
significativa en aquellas parcelas inoculadas con cualquiera de las dos cepas, por lo que
se han considerado como buenos candidatos para el control de X. arboricola pv. pruni
(Kawaguchi, 2014). El uso de fagos para el control de esta bacteria también ha sido
descrito (Randhawa & Civerolo, 1986). En ensayos sobre hoja, al aplicar 5 μl de una
suspensión de los fagos purificados previamente de cultivos del patógeno en la zona de
inoculación, producían una reducción de la población de bacteria tanto sobre la hoja
como en el interior de la misma. Sin embargo, se observó que cerca del 50% de la
población bacteriana era resistente al fago.

1.5.13 Condición fitosanitaria de X. arboricola pv. pruni:

X. arboricola pv. pruni agente causal de la mancha bacteriana de los frutales de hueso y
el almendro, así como de especies ornamentales y silvestres del género Prunus, es
considerado organismo de cuarentena según la legislación fitosanitaria de la Unión
Europea (Directiva de la EU 2009/29/CE) y según la “European and Mediterranean
Plant Protection Organization” (EPPO). Esta información se encuentra recogida en la
lista A2 de la EPPO de organismos para los cuales se recomienda regulación (Roselló et
al., 2012; Lamichhane, 2014).

7
 Capítulo 2: Secuenciación y características generales del
genoma de cinco cepas de X. arboricola aisladas de Prunus
spp. en España.

Draft genome sequence of X. arboricola pv. pruni strain Xap 33, Causal agent of
bacterial spot disease on almond.

J. Garita-Cambronero1, M. Sena-Vélez1, A. Palacio-Bielsa2, J. Cubero1.

1
Departamento de Protección Vegetal, Laboratorio Bacteriología, Instituto Nacional de Investigación y
Tecnología Agraria y Alimentaria (INIA), Madrid, Spain. 2Centro de Investigación y Tecnología
Agroalimentaria de Aragón (CITA), Zaragoza, Spain.

Genome Announcements 2014 May-Jun; 2(3): e00440-14. DOI: 10.1128/genomeA.00440-14

Draft genome sequence for virulent and avirulent strains of Xanthomonas

arboricola isolated from Prunus spp. in Spain.

J. Garita-Cambronero1, A. Palacio-Bielsa2, M. M. López3, J. Cubero1.

1
Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain. 2Centro
de Investigación y Tecnología Agroalimentaria de Aragón, Zaragoza, Spain. 3Instituto Valenciano de
Investigaciones Agrarias, Valencia, Spain.

Standards in Genomic Sciences 2016 11:12. DOI: 10.1186/s40793-016-0132-3

Draft genome Sequence of two strains of Xanthomonas arboricola isolated from

Prunus persica which are dissimilar to strains that cause bacterial spot disease on
Prunus spp.

J. Garita-Cambronero1, A. Palacio-Bielsa2, M. M. López3, J. Cubero1.

1
Departamento de Protección Vegetal, Instituto Nacional de Investigación y Tecnología Agraria, Madrid,
Spain. 2Centro de Investigación y Tecnología Agroalimentaria de Aragón, Instituto Agroalimentario de
Aragón-IA2 (CITA-Universidad de Zaragoza), Zaragoza, Spain. 3Instituto Valenciano de Investigaciones
Agrarias, Valencia, Spain.

Genome Announcements 4(5):e00974-16. DOI:10.1128/genomeA.00974-16.

2.1 Introducción:

La secuenciación y los análisis de genomas bacterianos han cambiado drásticamente

desde su inicio en el año 1995, hasta el punto que actualmente, gracias al avance de la
tecnología disponible y la reducción en su coste, se han convertido en prácticas
habituales en muchos laboratorios de microbiología. Como resultado de este avance,
actualmente se cuenta con decenas de miles de genomas bacterianos disponibles (30.000
públicamente accesibles en el “National Center for Biotechnology Information” (NCBI)
hasta 2015), los cuales sin duda, han contribuido a obtener toda una nueva visión sobre
el mundo de las bacterias. La abundancia de datos disponibles ha provocado que la
dificultad haya cambiado de obtener la secuencia de un genoma bacteriano, a la
capacidad de ensamblar, analizar y tener un buen control de las secuencias obtenidas
(Land et al., 2015).

El primer genoma secuenciado de una bacteria fitopatógena fue el de Xylella fastidiosa,

agente causal de la clorosis variegada de los cítricos (Simpson et al., 2000). En
Xanthomonas, la era de la secuenciación de genomas se inició en el año 2002 con la
obtención del genoma completo de X. citri subsp. citri 306 y de X. campestris pv.
campestris ATCC 33913 (da Silva et al., 2002). Este estudio pionero, junto con la
secuenciación del genoma de X. oryzae pv. oryzae KACC 10331 (Lee et al., 2005)
marcaron el inicio de la genómica comparativa en este género bacteriano. Estos trabajos
iniciales permitieron la identificación de un amplio número de genes hipotéticamente
relacionados con patogenicidad, convirtiendo a estos tres organismos en auténticos
modelos para estudios de genómica funcional de Xanthomonas. Asimismo, fue un punto
de partida para los estudios posteriores de genómica comparativa entre las diferentes
especies del género.

Actualmente (octubre de 2016), existen disponibles en las bases de datos del NCBI al
menos 521 genomas de Xanthomonas spp. de éstos, 72 son secuencias completas del
genoma que cuentan con una anotación de sus genes curada manualmente y 21 genomas
se encuentran completamente secuenciados pero su anotación ha sido realizada de
manera automática. Por último, 428 genomas se encuentran en estado de “draft”, es
decir, son menos precisos que un genoma completo, pero generalmente presentan una

7
alta calidad y al menos 90% de nucleótidos secuenciados. La secuencia de estos 428
genomas se encuentra representada en diversos segmentos o “contigs” (Collins, 1998).

El contar con este tipo de información genómica, tanto de cromosomas completos como
incompletos, resultan de gran valor en actividades como el desarrollo de análisis
filogenéticos más completos y precisos que permiten clasificar los diversos grupos
bacterianos. Asimismo, es posible estudiar la diversidad genómica a nivel
intraespecífico, por ejemplo, mediante el estudio de su pan genoma, lo cual permite
determinar aquellos genes asociados con funciones biológicas básicas para la vida y el
fenotipo de la especie, así como aquellos genes que contribuyen en la diversidad de la
especie. Muchos de estos genes no son esenciales para la vida pero confieren ventajas
selectivas como pueden ser la adaptación a un determinado nicho, la resistencia a
antibióticos o la capacidad de colonizar un nuevo huésped (Tettelin et al., 2008; Land et
al., 2015).

Este tipo de estudios se han llevado a cabo en el género Xanthomonas mediante la

comparación de 10 genomas que representaban a tres especies del género. De esta
manera se pudo conocer que el pan genoma de este grupo de cepas consiste en 12.951
secuencias codificantes (CDS), de las cuales 2.156 CDS representan el “core genome”,
es decir, son compartidas por todas las cepas. El estudio filogenético basado en este
grupo de genes permitió además determinar que la cepa de X. campestris pv. vesicatoria
85-10, en realidad es filogenéticamente distante al complejo de X. campestris, por lo
que se propuso renombrarla como una nueva especie, X. vesicatoria (Blom et al., 2009).

Posteriormente (Rodriguez-R et al., 2012), se realizó un análisis filogenético basado en

989 grupos de genes orthologos compartidos por las especies X. albilineans, X.
axonopodis, X. campestris, X. euvesicatoria, X. fuscans, X. oryzae y X. vasicola. Esta
reconstrucción filogenética muestra que en general, el género Xanthomonas no es
monofilético y cada una de las especies analizadas representa un clado diferenciado de
los demás, excepto las especies X. axonopodis, X. euvesicatoria y X. fuscans, las cuales
conforman un solo grupo. Por otro lado, en el caso de X. albilineans, ésta quedó
contemplada en un grupo basal tanto de Xanthomonas como de Xylella, por lo que
debería considerarse un género distinto con el fin de que la taxonomía del grupo
concuerde con su filogenia.

7
En la especie X. arboricola, los trabajos de genómica comparativa se iniciaron con el
uso de la hibridación genómica basada en el uso de microarreglos de ADN (Mayer et
al., 2011). Mediante esta tecnología, se comparó el contenido del genoma de X.
arboricola pv. pruni 109 al hibridarlo con un chip de microarreglos de ADN de las
especies X. campestris pv. campestris B100 y X. campestris pv. vesicatoria 85-10. Se
obtuvo inicialmente, que la cepa del patovar pruni presenta una similitud de entre 93,3 y
94,8% con estas especies y comparten al menos un total de 2.826 CDS. Además, este
estudio permitió identificar la presencia en el genoma de X. arboricola pv. pruni de 101
genes asociados con la producción de xanthano, la biosíntesis y el uso de azúcares,
diversas exoenzimas, genes asociados a la estructura del T3SS, genes asociados a la
regulación del quorum-sensing, así como algunos receptores del sistema TonB.

El estudio genómico de X. arboricola, basado en la secuenciación y análisis de sus

genomas, se inicia en el año 2012 con la secuenciación del genoma de X. arboricola pv
juglandis, cepa NCPPB 1447, posteriormente, se han publicado, según las bases de
datos del NCBI a noviembre de 2016, un total de 24 genomas así como la secuencia del
plásmido pXap41 de X. arboricola pv. pruni (Pothier et al., 2011c).

Del total de genomas disponibles para X. arboricola, cinco han sido secuenciados como
parte de este trabajo y son tratados más adelante en este mismo capítulo. Los restantes
19 genomas, se dividen en dos cepas de X. arboricola pv. celebensis, NCPPB 1630 y
NCPPB 1638 (Harrison et al., 2016), causantes de la marchitez de la banana; uno de X.
arboricola pv. corylina (Ibarra Caballero et al., 2013), agente causal de la podredumbre
bacteriana del avellano; nueve genomas de X. arboricola pv. juglandis, cepas CFBP
2528, CFBP 7179, J303, NCPPB 1447, Xaj2, Xaj4.1, Xaj43a y XajA3 (Higuera et al.,
2015; Pereira et al., 2015; Cesbron et al., 2015) causantes tanto de la necrosis apical
como del chancro del nogal. Cuatro genomas de X. arboricola pv. pruni, cepas CFBP
3894, MAFF 301420, MAFF301427 y MAFF 311562 (López-Soriano et al., 2016),
causantes de la mancha bacteriana de los frutales del género Prunus y por último, tres
cepas de X. arboricola que no pertenecen a ninguno de los nueve patovares descritos en
esta especie. De estos últimos, la cepa 3004 (Ignatov et al., 2015), ha sido descrita como
causante de enfermedad en cebada, mientas que las cepas CFBP 7634 y CFBP 7651,
aisladas de nogal, son consideradas no patógenas (Cesbron et al., 2015).

7
A excepción de las cepas patógenas (CFBP 2528 y CFBP 7179) y no patógenas aisladas
de nogal (CFBP 7634 y CFBP 7651), en las que se ha realizado un análisis más
profundo, de todas las demás cepas, solamente se conocen las características generales
sobre su secuenciación, ensamblaje y anotación inicial. Sobre ellas no existe más
información que la presente en las bases de datos del NCBI o en publicaciones,
realizadas a manera de nota corta con el respectivo anuncio genómico (Tabla 1).

En cuanto a las cuatro cepas de nogal mencionadas previamente (Cesbron et al., 2015),
el análisis comparativo de sus genomas permitió conocer que las cepas patógenas
presentan un rango más amplio de elementos genéticos móviles que las cepas no
patógenas y por ejemplo, la cepa CFBP 7179, contiene un elemento integrativo y
conjugativo que le confiere resistencia al cobre. Se ha determinado además que el
repertorio de efectores del T3SS es mayor en las cepas patógenas que en las no
patógenas y por ejemplo para la cepa CFBP 7634, se encontró que no presentaba T3SS
y contenía solamente ocho potenciales efectores, mientras que las cepas patógenas
contenían entre 24 y 25. De igual manera sucedió con el T4SS el cual parece no estar
completo en ninguna de las cepas estudiadas y sus potenciales efectores en cepas
patógenas se presentaron en un mayor número (17-18 efectores), en comparación con
aquellas no patógenas (14 efectores). Entre ambos grupos de cepas, según este mismo
estudio, también se dieron diferencias en relación al repertorio de enzimas degradadoras
de pared y en el correspondiente a las adhesinas no fimbrilares, dentro de las cuales
FhaB y YadA, solamente estaban presentes en las cepas no patógenas.

En este capítulo de la tesis, se presentarán las características generales asociadas al

proyecto de secuenciación del genoma de cinco cepas de X. arboricola aisladas de
Prunus spp. en España. Los resultados de este trabajo inicial y exploratorio se han dado
a conocer a través de tres publicaciones en las cuales se describe el trabajo realizado de
forma global, dirigido a dilucidar aspectos moleculares asociados a la patogénesis en X:
arboricola. Las diversas publicaciones se muestran en orden cronológico y son la base
sobre la cual se desarrolla el análisis genómico que se presentará en capítulos
posteriores de este trabajo.

7
Tabla 1. Características de los genomas disponibles en la base de datos del NCBI para la especie X.
arboricola.

GenBank Tamaño
Taxon Cepa acceso (Mb) GC% Genes Proteínas
Xanthomonas arboricola CITA 14 LXIB01 486.444 65,6 4.061 3.870
Xanthomonas arboricola CITA 44 LJGM01 476.048 65,8 4.002 3.728
Xanthomonas arboricola CITA 124 LXKK01 475.224 65,8 4.086 3.798
Xanthomonas arboricola CFBP 7634 JZEH01 493.518 65,6 4.110 4.006
Xanthomonas arboricola CFBP 7651 JZEI01 503.201 65,5 4.191 4.086
Xanthomonas arboricola 3004 AZQY01 47.659 66,0 3.997 3.775
Xanthomonas arboricola pv. celebensis NCPPB 1630 JPHE01 498.021 65,5 4.113 3.977
Xanthomonas arboricola pv. celebensis NCPPB 1832 JPHC01 490.802 65,6 4.081 3.967
Xanthomonas arboricola pv. corylina NCCB 100457 APMC02 522.658 65,5 4.365 4.089
Xanthomonas arboricola pv. juglandis Xaj 417 CP012251.1 521.894 65,4 4.358 4.188
Xanthomonas arboricola pv. juglandis J303 LSGZ01 506.642 65,5 4.262 4.040
Xanthomonas arboricola pv. juglandis CFBP 2528 JZEF01 508.448 65,5 4.263 4.095
Xanthomonas arboricola pv. juglandis CFBP 7179 JZEG01 515.746 65,4 4.351 4.194
Xanthomonas arboricola pv. juglandis NCPPB 1447 AJTL01 502.168 65,4 4.308 3.921
Xanthomonas arboricola pv. juglandis Xaj2 LHBK01 510.122 65,4 4.266 4.081
Xanthomonas arboricola pv. juglandis Xaj43a LHBT01 514.414 65,4 4.314 4.115
Xanthomonas arboricola pv. juglandis XajA3 LHBS01 511.898 65,6 4.283 4.093
Xanthomonas arboricola pv. juglandis Xaj4.1 LHBL01 511.626 65,6 4.285 4.102
Xanthomonas arboricola pv. pruni CITA 33 JHUQ01 510.066 65,4 4.222 3.720
Xanthomonas arboricola pv. pruni IVIA 2626.1 LJGN01 502.767 65,4 4.253 3.849
Xanthomonas arboricola pv. pruni CFBP 3894 LOMI01 505.907 65,4 4.228 3.967
Xanthomonas arboricola pv. pruni MAFF301420 BAVC01 500.276 65,3 4.315 3.601
Xanthomonas arboricola pv. pruni MAFF301427 BAVD01 490.544 65,4 5.180 4.686
Xanthomonas arboricola pv. pruni MAFF311562 BAVB01 508.549 65,3 5.422 4.897

7
 2.2 Draft genome sequence of Xanthomonas arboricola pv. pruni strain Xap33,
causal agent of bacterial spot disease on almond.

2.2.1 Abstract

We report the annotated genome sequence of Xanthomonas arboricola pv. pruni strain
Xap33 (CITA 33), isolated from almond leaves showing bacterial spot disease
symptoms in Spain. The availability of this genome sequence will aid our understanding
of the infection mechanism of this bacterium as well as its relationship to other species
of the same genus.

2.2.2 Genome announcement

Xanthomonas arboricola pv. pruni (synonym Xanthomonas campestris pv. pruni) is a

Gram-negative plant-pathogenic bacterium that causes bacterial spot disease of stone
fruits and almond, one of the major threats of Prunus fruit crops. Symptoms occur on
leaves, fruits, and twigs, ranging from necrotic angular lesions on leaves and sunken
lesions on fruits to cankers on twigs. X. arboricola pv. pruni can be very damaging
when severe infections occur on highly susceptible cultivars (Stefani, 2010; Roselló et
al., 2012; Socquet-Juglard et al., 2012; Tjou-Tam-Sin et al., 2012). This bacterium is
considered a quarantine pathogen in the European Union phytosanitary legislation and
in the European and Mediterranean Plant Protection Organization (EPPO) (Anonymous,
2000; EPPO, 2003). Here we report the draft genome sequence of X. arboricola pv.
pruni strain Xap33 (CITA33), isolated from symptomatic almond leaves (Prunus
amygdalus cv. Guara) cultivated in Aragón, Spain.

The genome of X. arboricola pv. pruni strain Xap33 was sequenced by the Ion Torrent
Personal Genome Machine (PGM) (Life Technologies) instrument (579.53 Mb; 95-fold
coverage). De novo assembly using CLC Genomics Workbench 7.0 (CLC bio,
Denmark) produced a total length of 5,104,864 bp (G+C content, 65.43%) placed in 501
contigs with an N50 of 34,438 bp and a maximum contig length of 126,681 bp. The
annotation for the Xap33 genome sequence was conducted using the automated
Bacterial Annotation System (BASys) (Van Domselaar et al., 2005), the Rapid
Annotation using Subsystem Technology server (RAST) (Aziz et al., 2008), and the

7
Prokaryotic Genome Annotation Pipeline (Tatusova et al., 2013). RNAmmer 1.2 and
tRNAscan-SE 1.21 were used to predict rRNAs and tRNAs, respectively (Lowe &
Eddy, 1997; Lagesen et al., 2007).

The annotation for the Xap33 genome sequence detected 4,348 coding sequences, 3
rRNAs, and 50 tRNAs, representing 436 subsystems compared to 461 subsystems found
in Xanthomonas axonopodis pv. citri strain 306, which is the most closely related
bacterium based on nucleotide similarity in the RAST database. 16S rRNA comparison
analysis performed with BLASTn (Morgulis et al., 2008) detected 99 to 100% identity
to other Xanthomonas strains, including the X. arboricola pv. juglandis strain LMG
747. In addition, whole-genome nucleotide comparison using BLASTn against 214
complete and draft genomes from several Xanthomonas strains determined that the
Xap33 genome sequence has 99% identity to the draft genome sequences of
Xanthomonas arboricola pv. pruni strains MAFF301420, MAFF301427, and
MAFF31562. Furthermore, in order to check the robustness of the Xap33 genome
sequence, a multilocus sequence analysis using partial sequences of the housekeeping
genes dnaK, fyuA, gyrB, and rpoD (Young et al., 2008; Kaluzna et al., 2014) clustered
the strain Xap33 in the X. arboricola pv. pruni phylogroup, revealing a high similarity
(99.89%) to the type strain X. arboricola pv. pruni ICMP 51 (CFBP 2535). The genome
information presented here will allow genetic analysis and manipulation of X.
arboricola pv. pruni Xap33, as well as future comparative studies with other
Xanthomonas arboricola pathovars. This new information will help in understanding
the molecular mechanisms in the plant-pathogen interactions related to bacterial spot
disease on almond.

2.2.3 Nucleotide sequence accession numbers.

This whole-genome shotgun project has been deposited in DDBJ/EMBL/GenBank

under the accession no. JHUQ00000000. The version described in this paper is version
JHUQ01000000.

2.2.4 Acknowledgments

This work was supported financially by the Instituto Nacional de Investigación y

Tecnología Agraria y Alimentaria (INIA) project RTA2011-00140-C03-02. J. Garita-

7
Cambronero held a Ph.D. fellowship from the Spanish Government (Ministerio de
Educación, Cultura y Deporte; fellowship FPU12/01000).

We thank Carla Clemente and Magdalena Lewicka from the STAB VIDA Pvt., Ltd.,
NGS Laboratory for their assistance with sequencing and analyses

8
 2.3 Draft genome sequence for virulent and avirulent strains of Xanthomonas
arboricola isolated from Prunus spp. in Spain

2.3.1 Abstract

Xanthomonas arboricola is a species in genus Xanthomonas which is mainly comprised

of plant pathogens. Among the members of this taxon, X. arboricola pv. pruni, the
causal agent of bacterial spot disease of stone fruits and almond, is distributed
worldwide although it is considered a quarantine pathogen in the European Union.
Herein, we report the draft genome sequence, the classification, the annotation and the
sequence analyses of a virulent strain, IVIA 2626.1, and an avirulent strain, CITA 44, of
X. arboricola associated with Prunus spp. The draft genome sequence of IVIA 2626.1
consists of 5,027,671 bp, 4,720 protein coding genes and 50 RNA encoding genes. The
draft genome sequence of strain CITA 44 consists of 4,760,482 bp, 4,250 protein coding
genes and 56 RNA coding genes. Initial comparative analyses reveals differences in the
presence of structural and regulatory components of the type IV pilus, the type III
secretion system, the type III effectors as well as variations in the number of the type IV
secretion systems. The genome sequence data for these strains will facilitate the
development of molecular diagnostics protocols that differentiate virulent and avirulent
strains. In addition, comparative genome analysis will provide insights into the plant-
pathogen interaction during the bacterial spot disease process.

2.3.2 Keywords

Xanthomonas arboricola, Prunus spp., Stone fruits, Bacterial spot disease, Plant
pathogenic bacteria.

2.3.3 Introduction

Xanthomonas arboricola (Vauterin et al., 1995) are plant associated bacteria in nine
pathovars with a diverse range of biotic relationships (Bull et al., 2010; Fischer-Le Saux
et al., 2015). Within this taxon, plant pathogenic strains with non-pathogenic strains
have been described. Bacterial spot of Prunus spp. (X. arboricola pv. pruni), bacterial
blight of Juglans spp. (X. arboricola pv. juglandis) and Corylus spp. (X. arboricola pv.

8
corylina) are among the most harmful diseases of these tree hosts. These bacterial
diseases are distributed worldwide and the causal bacteria are regulated in several
countries including the European Union, where X. arboricola pv. pruni is a quarantine
pathogen (Scortichini et al., 2002; Lamichhane, 2014).

Within the pathovars, X. arboricola pv. pruni is a major threat to cultivated, exotic and
ornamental Prunus species. This bacterium has been identified as a pathogen of P.
armeniaca, P. avium, P. buergeriana, P. cerasus, P. crassipes, P. davidiana, P.
domestica, P. donarium, P. dulcis, P. laurocesasus, P. mume, P. persica and P. salicina
(EFSA, 2014). During the last decade, some local outbreaks of bacterial spot in Spain
have been reported on almond, peach, nectarine and plum (Palacio-Bielsa et al., 2014).
For initial characterization of the bacterial strains isolated from Spanish outbreaks of
bacterial spot, we performed a polyphasic study based on a multilocus sequence
analysis, as well as some phenotypic characters (Garita-Cambronero et al., 2013). After
the characterization that showed the presence of different molecular and phenotypic
variants, selected strains were analysed to assess the differences at the whole genome
level.

Genome sequencing of X. arboricola strains has been completed for five strains isolated
from walnut, three from peach, two from Musa sp., one from almond (Garita-
Cambronero et al., 2014), one from barley (Ignatov et al., 2015) and one from Turkish
hazel (Ibarra Caballero et al., 2013). Genome sequencing includes the plasmid pXap41
(Pothier et al., 2011c), present in the X. arboricola pv. pruni strains. All these
sequences have been deposited in the NCBI database. Four genome sequences are
available for pathogenic strains from Prunus, identified as X. arboricola pv. pruni.
However, with the exception of the strain CITA 33 isolated from almond (P.
amygdalus, syn. P. dulcis) in Spain (Garita-Cambronero et al., 2014), no detailed
information about features of those genomes have been published. In the same way,
there are no sequenced strains isolated from Japanese plum (P. salicina) or cherry
rootstock (P. mahaleb). In addition, no avirulent strain of X. arboricola from Prunus
spp. has been analysed at the whole-genome level. The occurrence of avirulent strains is
of particular importance for a quarantine pathogen like X. arboricola pv. pruni with
respect to accurate diagnosis of virulent strains.

8
Herein we present draft genome sequences for two X. arboricola strains: an avirulent
strain, CITA 44, isolated from P. mahaleb, and X. arboricola pv. pruni strain, IVIA
2626.1, isolated from P. salicina cv. Fortuna, which differs from other sequenced
strains in phenotypical features and virulence on several hosts (Garita-Cambronero et
al., 2014). The genome analysis of these two strains as well as comparison with other
related strains should provide insight into the genetics of the pathogenesis process in X.
arboricola strains associated with the bacterial spot disease of stone fruits and almond.

2.3.4 Organism information

Classification and features:

Strain CITA 44 was isolated in 2009 from asymptomatic leaves of Santa Lucía SL-64
cherry rootstock (P. mahaleb) in a nursery located in the north-eastern Spanish region
of Aragón. This strain showed flagella associated swarming and swimming motility on
0.5 % agar PYM plates and 0.3 % agar MMA plates, respectively. Additionally, strain
CITA 44 showed type IV pili associated twitching motility in the interstitial surface
between 1.5 % agar PYM layer and the plastic plate surface. According to the atomized
oil assay (Burch et al., 2010), this strain produced surfactant compounds on 1.5 % agar
LB plates after 24 h at 27 °C. In accordance with a detached leaf assay, conducted with
a cotton swap damped with 1 × 108 CFU/ml, on almond cv. Ferraduel, apricot cv.
Canino, peach cv. Calanda and European plum (P. domestica) cv. Golden Japan, X.
arboricola strain CITA 44 did not cause bacterial spot symptoms at 28 days post
inoculation (dpi). Despite this lack of symptoms, the bacterium could be re-isolated
after such period.

X. arboricola pv. pruni strain IVIA 2626.1 was isolated from symptomatic leaves of
Japanese plum (P. salicina cv. Fortune) in the southwestern Spanish region of
Extremadura in 2002. This strain showed swarming, swimming and twitching type
motility as well as production of surfactant compounds in the same culture conditions
described above for strain CITA 44. In addition, according to the detached leaf assay
described previously, strain IVIA 2626.1 was able to produce bacterial spot symptoms
on almond, peach and European plum but not on apricot after 28 dpi.

8
Classification of the strains was performed using an MLSA approach based on the
partial sequences of the housekeeping genes atpD, dnaK, efP, fyuA, glnA, gyrB and
rpoD of the strains CITA 44 and IVIA 2626.1 as well as related strains of X. arboricola
(Fischer-Le Saux et al., 2015). Nucleotide sequences were aligned with ClustalW and
both ends of each alignment were trimmed (atpD 750 bp, dnaK 759 bp, efP 339 bp,
fyuA 753 bp, glnA 675 bp, gyrB 735 bp and rpoD 756 bp) and concatenated to a total
length sequence of 4,620 nucleotide positions. The phylogenetic tree was constructed
using the maximum likelihood method implemented in MEGA 6.0 (Tamura et al.,
2013) using 1,000 bootstrap re-samplings. According to the phylogenetic analysis,
strain CITA 44 belongs to the species X. arboricola, nevertheless, this strain could not
be associated to any of the pathovars of this species. The concatenated sequence
similarity among this strain and the other X. arboricola strains analysed varied from
97.08 % to 98.79 %. In contrast, strain IVIA 2626.1 was clustered in a group with the
pathotype strain X. arboricola pv. pruni CFBP 2535, isolated from P. salicina in New
Zealand, with a sequence similarity of 100%.

X. arboricola CITA 44 and X. arboricola pv. pruni IVIA 2626.1 strains are Gram-
negative, non-sporulating, rod-shaped, motile cells with a single polar flagellum. Rod-
shaped cells of CITA 44 are approximately 0.6 μm in width and 1.4–2.5 μm in length.
Rod-shaped cells of IVIA 2626.1 are approximately 0.7 μm in width and 1.7–2.5 μm in
length. These strains formed 2.0–3.0 mm colonies within 48 h at 27 °C on YPGA 1.5 %
agar plates (Trébaol et al., 2001). Both strains formed mucoid, circular, yellow colonies
with a convex elevation and an entire margin (Fig. 1). Strains CITA 44 and IVIA
2626.1 grew in the nutritive culture media PYM (Siciliano et al.) and LB (Macwilliams
& Liao, 2006), as well as in the minimal medium A (Sena-Vélez et al., 2015).
According to the Biolog GN2 system, both strains metabolized α-D-glucose, α-keto
glutamic acid, bromosuccinic acid, D-cellobiose, D-fructuose, D-mannose, D-psicose,
D-threalose, glycyl-L-glutamic acid, L-glutamic acid, L-serine, pyruvic acid methyl
ester, succinic acid, succinic acid mono-methyl-ester, sucrose and Tween 40. The
carbon compound D-saccharic acid was only utilized by strain CITA 44. Dextrin and L-
proline were only metabolized by strain IVIA 2626.1. In addition to this analysis, strain
CITA 44 hydrolysed casein and starch, while strain IVIA 2626.1 did not (Table 1).

8
Minimum information about genome sequence (Field et al., 2008) of X. arboricola
strain CITA 44 and X. arboricola pv. pruni strain IVIA 2626.1, as well as their
phylogenetic position, are provided in Table 1 and Fig. 2.

Fig. 1. Images of X. arboricola CITA 44 (up) and X. arboricola pv. pruni IVIA 2626.1 (down) cells
using contrast-phase microscopy (left) and the appearance of the colony morphology after 48 h growing
on YPGA agar medium at 27 °C (right). Flagella was stained (left) as described previously (Kraiselburd
et al., 2013).

Fig. 2. Phylogenetic tree highlighting the position of two X. arboricola strains (shown in bold) relative
to the pathotype strains (PT) of X. arboricola. X. citri subsp. citri str. 306 (Gabriel et al., 1989; Euzéby,
2007) was used as an outgroup. The tree was built based on the comparison of concatenated nucleotide
sequences of seven housekeeping genes (atpD, dnaK, efP, fyuA, glnA, gyrB and rpoD) (Fischer-Le Saux

8
et al., 2015). Sequences were first aligned and concatenated. The phylogenetic tree was constructed by
using MEGA 6.0 software (Tamura et al., 2013) with Maximum Likelihood method based on Tamura-
Nei model. Bootstrap values (1,000 replicates) are shown at the branch points. GenBank accession
number of X. citri subsp. citri str. 306 genome sequence is shown in parenthesis; accession numbers
associated to the housekeeping loci of the pathotype strains can be found in a previous study(Fischer-Le
Saux et al., 2015).

Table 1. Classification and general features of two Xanthomonas arboricola strains according to the
MIGS recommendation (Field et al., 2008) published by the Genomic Standards Consortium (Field et al.,
2011).

1:(Vauterin et al., 1995), 12: (Pothier et al., 2011c), 54: (Woese et al., 1990); 55: (Garrity et al., 2005a), 56: (Garrity et al., 2005b), 57: (Euzéby, 2004),
58: (Williams & Kelly, 2013), 59: (Christensen & Cook, 1978), 60: (Naushad et al., 2015), 61: (Van den Mooter & Swings, 1990), 62: (Ashburner et
al., 2000).

8
2.3.4 Genome sequencing information

Genome Project history

X. arboricola strain CITA 44 and X. arboricola pv. pruni strain IVIA 2626.1 were
selected for comparative whole sequencing analysis as X. arboricola strains isolated
from Prunus spp. with several different phenotypic characters including virulence.
Comparative genomics among the avirulent strain CITA 44 and the available Prunus-
pathogenic strains including IVIA 2626.1 should be useful for identifying the molecular
determinants associated with pathogenesis as well as those associated with host
resistance and for diagnostic characterization of X. arboricola strains causing bacterial
spot of Prunus spp. Whole Genome Shotgun Projects have been deposited at
DDBJ/EMBL/GenBank under the accession numbers LJGM00000000 and
LJGN00000000. The versions described in this paper are versions LJGM01000000 and
LJGN01000000. Table 2 summarizes the project information and its association with
MIGS.

Table 2. Project information

Growth conditions and genomic DNA preparation

X. arboricola strain CITA 44 and X. arboricola pv. pruni strain IVIA 2626.1 are
deposited and available at the bacterial collections of the Instituto Valenciano de
Investigaciones Agrarias (IVIA, Valencia, Spain) and the Centro de Investigación y

8
Tecnología Agroalimentaria de Aragón (CITA, Zaragoza, Spain). Both strains were
streaked on 1.5 % agar LB plates and were grown for 48 h at 27 °C. A single colony of
each strain was inoculated separately in 30 ml of LB broth and grown on an orbital
shaker for 24 h at 27 °C. DNA from pure bacterial cultures was extracted using a
QIAamp DNA miniKit (Qiagen, Barcelona, Spain) according to the manufacturer
instructions. DNA quality and quantity were determined by 1 % agarose gel
electrophoresis, as well as using the Qubit flurometer (Invitrogen) according to the
Quant-it dsDNA BR Assay Kit (Invitrogen) manufacturer instructions, and by a
spectrophotometry (NanoDrop 2000 spectrophotometer, Thermo Scientific). A 2.0 μg/μl
aliquot of 200 ng/μl sample was submitted for the sequencing.

Genome sequencing and assembly

The draft genome sequences for strains CITA 44 and IVIA 2626.1 were generated at the
STAB VIDA Next Generation Sequencing Laboratory (Caparica, Portugal) using the
Ion Torrent sequencing technology. Draft genome assembly of strain CITA 44 was
based on 3,060,638 usable reads with a total base number of 948,933,067. The mean
read length was 361.70 ± 93.50 and the mode read length was 385 bp. The draft genome
assembly of IVIA 2626.1 was based on 2,317,319 reads, with a total base number of
461,361,072. The mean read length and the mode read length for this strain were
201.80 ± 85.30 bp and 241 bp, respectively. Genomic assemblies were constructed
using MIRA 4.0 (Chevreux et al., 1999). From the total of contigs generated, only those
with a contig size above 500 bp and an average coverage above 99 in the case of CITA
44, and 40, in the case of IVIA 2626.1 were considered significant. Finally, 71 contigs
(N50 = 120,981 bp; largest contig = 352,479 bp; average coverage = 198X) were
generated for strain CITA 44 and for strain IVIA 2626.1, 214 contigs (N50 = 47,650;
largest contig = 115,385; average coverage = 92X) were generated.

Genome annotation

The assembled draft genome for both strains was annotated using the RAST platform
and the gene-caller GLIMMER 3.02 (Delcher, 1999; Aziz et al., 2008). RNAmmer
version 1.2 (Lagesen et al., 2007) and tRNAscan-SE version 1.21 (Schattner et al.,

8
2005) were used to predict rRNAS and tRNAS, respectively. Signal peptides and
transmembrane domains were determined using the SignalP 4.1 server (Petersen et al.,
2011) and the TMHMM server version 2.0 (Krogh et al., 2001), respectively.
Assignment of genes to the COG database (Tatusov, 2000) and Pfam domains (Finn et
al., 2014) was performed with the NCBI conserved domain database using an expected
value threshold of 0.001 (Marchler-Bauer et al., 2014).

Major structural components associated with the flagellum (Blocker et al., 2003;
Chevance & Hughes, 2008), the type IV pilus (Dunger et al., 2014), the type III
secretory system (White et al., 2009; Büttner & Bonas, 2010; Abby & Rocha, 2012) and
the type III effectors (White et al., 2009; Hajri et al., 2012) as well as the type IV
secretory system and effectors (Christie et al., 2014; Waksman & Orlova, 2014;
Guglielmini et al., 2014), were identified in the draft genome sequence for each strain.
Initially, the query of those genes was based on the coding sequence regions
automatically annotated by RAST, and were confirmed using the BLASTn and
BLASTx tools available at NCBI. Those components which were not automatically
annotated were found in the genome sequence using the progressive Mauve alignment
method (Darling et al., 2010). Nucleotide sequences of the genes used for these
alignments were obtained from other xanthomonads in the NCBI gene database. Finally,
the nucleotide sequence of the aligned regions was analysed using the BLAST
approaches mentioned above. Those sequences with query coverage and identity
percentage higher than 90 % were annotated. Additionally, the core components of the
T3SS and T4SS were searched using the T346Hunter application (Martínez-García et
al., 2015). T3Es and T4Es genes were predicted using the Effective database (Jehl et al.,
2011) after selection of the “gram-” parameter as organism type and the “plant set”
parameter as classification module, and the SecReT4 tool (Bi et al., 2013), respectively.
All the predicted genes were corroborated and annotated according to the BLAST
parameters mentioned above.

2.3.5 Genome properties

The draft genome sequence of X. arboricola strain CITA 44 was 4,760,482 bp in length
with an average GC content of 65.8 %, which is similar to that for other genomes of this

8
species (65.4 to 66.0 %) reported in the NCBI genome database. For this strain, 4,306
genes were predicted and 4,250 were determined as protein coding genes. From these
protein coding genes, 3,330 genes were assigned to a putative function and the
remaining 920 were designated as hypothetical proteins. This strain presented 3 rRNA
and 53 tRNA genes. In the case of the X. arboricola pv. pruni strain IVIA 2626.1, the
draft genome sequence was 5,027,671 bp in length with an average GC content of 65.4
%, which is the same as for other strains of X. arboricola pv. pruni according to the
NCBI database. A total of 4,770 genes were predicted and, among them, 4,720 were
predicted as protein coding genes with 69.17 % assigned to a function and 30.83 %
designated as hypothetical proteins. 50 RNA genes (3 rRNA and 47 tRNA genes) were
predicted for this strain. The properties and characteristics associated with these
genomes are presented in Table 3. The classification of the predicted protein coding
genes into COG functional categories (Galperin et al., 2015) is summarized in Fig. 3
and Table 4.

Fig. 3. Graphical circular representation of the draft genome of X. arboricola CITA 44 and X.
arboricola pv. pruni IVIA 2626.1. The contigs of both strains were ordered by Mauve (Darling et al.,
2004) using the genome sequence of X. campestris pv. campestris ATCC 33913 (Dowson, 1939;
Skerman et al., 1980) as the reference. COG categories were assigned to genes by NCBI’s conserved
domain database (Marchler-Bauer et al., 2014). The circular map was constructed using CGView
(Stothard & Wishart, 2005). From outside to center: Genes on forward strand (colored by COG
categories); genes on reverse strand (colored by COG categories); GC content; GC skew.

9
Table 3. Genome statistics

Table 4. Number of genes associated with general COG functional categories.

9
2.3.6 Insights from the genome sequence

Based on the phenotypic differences between CITA 44 and IVIA 2626.1 strains,
selected genes associated with motility and pathogenicity were analysed (Table 5). No
differences were observed for the structural components associated with bacterial
flagella. A total of 30 out of the 31 components described for this organelle were
identified (Chevance & Hughes, 2008), but neither of the two strains contained a
homolog of the flhE gene. Regarding the 27 components associated with type IV pilus
biogenesis and regulation in Xanthomonas (Dowson, 1939; Skerman et al., 1980;
Dunger et al., 2014), fimX, pilD, pilE, pilL and pilW genes were absent in strain CITA
44, whereas strain IVIA 2626.1 sequence did not contain homologs for fimX and pilL
genes.

In the genus Xanthomonas, 24 structural and regulatory components of the T3SS have
been determined. They are present in the hrp gene cluster which is regulated by the
master regulons HrpG and HrpX (Guo et al., 2011). Strain CITA 44 did not contain any
of the 24 components of this gene cluster except two coding sequences which
correspond to hrpG and hrpX homologs. The absence of T3SS has also been reported
for another X. arboricola strain isolated from barley as well as for X. cannabis (Ignatov
et al., 2015; Jacobs et al., 2015). The absence of the genes hrcC, hrcJ, hrcN, hrcR, hrcS,
hrcT, hrcU, hrcV, hrpB1, hrpD5 and hrpF was corroborated by conventional PCR as
previously described (Hajri et al., 2012). In the case of strain IVIA 2626.1, 22 out of the
24 components, as well as homologs for the two master regulons were present, but no
homologs for hpaF and hrpB5 were found. Homologs for these two genes were also
absent in all the genome sequences of X. arboricola publicly available. Sixty T3Es
described in genus Xanthomonas were absent in strain CITA 44 and absence of 21 of
them, identified in X. arboricola pv. pruni, was corroborated by conventional PCR
using specific primers (Hajri et al., 2012). On the other hand, strain IVIA 2626.1
contained 22 T3Es, 21 of them were described previously in other X. arboricola pv.
pruni strains (Hajri et al., 2012). In addition to these effectors, a homolog of xopAQ was
found. Both strains contained all 12 components associated with Agrobacterium
tumefaciens (Conn, 1942; Skerman et al., 1980) VirB/VirD4 T4SS (Guglielmini et al.,
2014). Additionally, strain IVIA 2626.1 harbored a gene cluster homologous to the type
four conjugation cluster (tfc). This cluster is composed by 24 genes associated with the

9
expression of a conjugative pilus which is involved in the propagation of genomic
islands (Juhas et al., 2007). In strain IVIA 2626.1, 17 out of the 24 genes associated
with the T4SS were found and, within them, tfc2, tfc4, tfc12, tfc14, tfc16, tfc22 and
tfc23 were identified as the core components required for the functioning of this T4SS
(Juhas et al., 2007).

An additional feature of the X. arboricola pv. pruni sequence is the presence of the
plasmid pXap41 (41,102 Kbp) (Pothier et al., 2011c). This plasmid is exclusively in X.
arboricola pv. pruni strains and is associated with virulence because it contains some
T3Es such as XopE3. Genome alignment of the plasmid pXap41 nucleotide sequence
and the draft genome sequence for strain IVIA 2626.1 showed a region of 41.1 Kbp
which was 99.90 % similar to the pXap41 plasmid of X. arboricola pv. pruni strain
CFBP 5530. Conversely, no sequence region in the strain CITA 44 draft genome was
similar to this plasmid. Negative results in the amplification of the genes repA1, repA2
and mobC associated with pXap41 (Pothier et al., 2011c) confirmed the absence of this
plasmid in strain CITA 44.

Table 5. Molecular components putatively involved in motility and pathogenesis

9
2.3.7 Conclusions

Here we report and describe the draft genome sequence for two X. arboricola strains,
CITA 44 and IVIA 2626.1, isolated from Prunus in Spain and associated with bacterial
spot of stone fruits and almond by PCR protocols for identification of this pathovar
(Pagani, 2004; Palacio-Bielsa et al., 2011). The phenotype of these two strains varied
for motility and virulence. Initial genomic analysis identified several differences
associated with motility (Type IV pilus) and virulence (T3SS, T3Es and T4SS),
including the presence of the putative virulence plasmid pXap41 only in X. arboricola
pv. pruni IVIA 2626.1 and the absence of the T3SS, T3Es and the plasmid pXap41 in
the avirulent strain CITA 44. All these features make the avirulent strain a candidate for
comparative studies to elucidate the molecular processes associated with the plant host
interaction and virulence for strains of X. arboricola on Prunus species. Likewise,
comparative genomic studies with related strains could provide target sequences for
design of molecular diagnostics for the different pathovars of X. arboricola, as well as
to differentiate between virulent and avirulent strains. Further functional studies will
also provide insights into the pathogenesis process for X. arboricola strains associated
with bacterial spot of stone fruits and almond.

2.3.8 Acknowledgements

This work was supported by the Instituto Nacional de Investigación y Tecnología

Agraria y Alimentaria (INIA) grants projects RTA2011-00140-C03-02, RTA2014-
00018-C02-01 and XAPDIAG EUPHRESCO II project. JGC held a PhD fellowship
from the Spanish Government (Ministerio de Educación, Cultura y Deporte fellowship
FPU12/01000). We like to express our gratitude to Dr. James H. Graham from the
University of Florida, Citrus Research and Education Center (CREC), for the scientific
and English revision of this manuscript.

9
2.4 Draft genome sequence of two strains of Xanthomonas arboricola isolated from
Prunus persica which are dissimilar to strains that cause bacterial spot disease on
Prunus spp.

2.4.1 Abstract

The draft genome sequences of two strains of Xanthomonas arboricola, isolated from
asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do
not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of
bacterial spot disease of stone fruits and almonds.

2.4.2 Genome announcement

Xanthomonas arboricola is a Gram-negative species that comprises nine subspecific

phylogroups (Vauterin et al., 1995; Fischer-Le Saux et al., 2015). In addition, some
strains that differ from the pathovars X. arboricola pv. pruni and X. arboricola pv.
juglandis, isolated from the plant genera Prunus and Juglans, have also been described.
These strains are unable to cause disease because they lack some essential
characteristics related to pathogenesis, such as the type III secretion system and related
effectors (Cesbron et al., 2015; Garita-Cambronero et al., 2016a).

The two new genomes presented here, which belong to the avirulent strains CITA 14
and CITA 124, were compared to the genomes of other X. arboricola strains (Ibarra
Caballero et al., 2013; Garita-Cambronero et al., 2014; Higuera et al., 2015; Ignatov et
al., 2015; Harrison et al., 2016) and could be helpful in understanding the pathogenesis
and evolution in this species. Moreover, the genomes will be useful for generating
accurate diagnostic tools to differentiate the quarantine pathogen X. arboricola pv.
pruni from other nontarget strains, thereby avoiding unnecessary control measures that
could result in high economic losses as occurred with other xanthomonads (Graham &
Gottwald, 1991; Jalan et al., 2011).

Strains CITA 14 and CITA 124 were isolated from asymptomatic peach trees (Prunus
persica) in Spain and were deposited in the Centro de Investigación y Tecnología
Agroalimentaria de Aragón (CITA) in Zaragoza, Spain. To confirm their identification,

9
a multilocus sequence analysis using partial sequences of the housekeeping genes dnaK,
fyuA, gyrB, and rpoD was performed (Young et al., 2008). By means of such analysis,
these strains were not clustered into any of the established pathovars of X. arboricola.
CITA 14 and CITA 124 were enclosed in a group with CITA 44, another atypical strain
of X. arboricola isolated from the rootstock Santa Lucía SL-64 (Prunus mahaleb)
(Garita-Cambronero et al., 2016a), which shows sequence identities of 98.3% with
strain CITA 14 and 98.9% with strain CITA 124.

Genome sequencing was performed using Ion Torrent sequencing technology (PGM,
Life Technologies) at STAB VIDA, Caparica, Portugal (733.06 Mb, 100-fold coverage
for CITA 14 and 403.99 Mb, 50-fold coverage for CITA 124). De novo assembly was
conducted using CLC Genomics Workbench version 8.5.1 (CLC bio, Denmark) and
MIRA version 4.0 (Chevreux et al., 1999) and the subsequent merging of the two
assemblies was done using Sequencher version 5.4 (Gene Codes Corporation, USA).
Total lengths of 4,746,212 bp (65.60% G+C content) and 4,752,241 bp (65.8% G+C
content) were generated and placed in 72 (N50, 108,424 bp; maximum contig length,
265,354 bp) and 128 contigs (N50, 60,818 bp; maximum contig length 189,085) for
CITA 14 and CITA 124, respectively.

Annotations were conducted using the NCBI Prokaryotic Genome Annotation Pipeline
version 3.1 (Angiuoli et al., 2008) and the Rapid Annotations using Subsystem
Technology server (Aziz et al., 2008). The annotation for strain CITA 14 detected 3,974
coding sequences, four rRNAs, and 53 tRNAs, representing 439 subsystems;
meanwhile, for strain CITA 124, 3,797 coding sequences, three rRNAs, and 50 tRNAs,
representing 442 subsystems, were detected. A detailed genome comparative analysis
will be addressed in a future publication.

2.4.3 Accession numbers.

These whole-genome shotgun projects have been deposited in DDBJ/EMBL/GenBank

under the accession numbers LXIB00000000 for strain CITA 14 and LXKK00000000
for strain CITA 124. The versions described in this paper are the first versions,
LXIB01000000 and LXKK01000000.

9
2.4.4 Acknowledgments

This work was supported financially by the Instituto Nacional de Investigación y

Tecnología Agraria y Alimentaria (INIA) project RTA2014-00018-CO2-01. J. Garita-
Cambronero held a Ph.D. fellowship from the Spanish Government (Ministerio de
Educación, Cultura y Deporte; fellowship FPU12/01000).

9
 Capítulo 3: Comparación genómica y caracterización
fenotípica de cepas patógenas y no patógenas de X. arboricola
revela aspectos relacionados con el proceso de infección de la
mancha bacteriana de los frutales de hueso.

Comparative genomic and phenotypic characterization of pathogenic and non-

pathogenic strains of Xanthomonas arboricola reveals insights into the infection
process of bacterial spot disease of stone fruits.

J. Garita-Cambronero1, A. Palacio-Bielsa2, M. M. López3, J. Cubero1.

1
Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain. 2Centro
de Investigación y Tecnología Agroalimentaria de Aragón, Zaragoza, Spain. 3Instituto Valenciano de
Investigaciones Agrarias, Valencia, Spain.

PLoS ONE 11(8): e0161977. doi:10.1371/[Link].0161977.

3.1 Abstract

Xanthomonas arboricola pv. pruni is the causal agent of bacterial spot disease of stone
fruits, a quarantinable pathogen in several areas worldwide, including the European
Union. In order to develop efficient control methods for this disease, it is necessary to
improve the understanding of the key determinants associated with host restriction,
colonization and the development of pathogenesis. After an initial characterization, by
multilocus sequence analysis, of 15 strains of X. arboricola isolated from Prunus, one
strain did not group into the pathovar pruni or into other pathovars of this species and
therefore it was identified and defined as a X. arboricola pv. pruni look-a-like. This
non-pathogenic strain and two typical strains of X. arboricola pv. pruni were selected
for a whole genome and phenotype comparative analysis in features associated with the
pathogenesis process in Xanthomonas. Comparative analysis among these bacterial
strains isolated from Prunus spp. and the inclusion of 15 publicly available genome
sequences from other pathogenic and non-pathogenic strains of X. arboricola revealed
variations in the phenotype associated with variations in the profiles of TonB-dependent
transporters, sensors of the two-component regulatory system, methyl accepting
chemotaxis proteins, components of the flagella and the type IV pilus, as well as in the
repertoire of cell-wall degrading enzymes and the components of the type III secretion
system and related effectors. These variations provide a global overview of those
mechanisms that could be associated with the development of bacterial spot disease.
Additionally, it pointed out some features that might influence the host specificity and
the variable virulence observed in X. arboricola.

3.2 Introduction

Xanthomonas arboricola (Vauterin et al., 1995) is a species of Gram negative, rod-

shaped bacteria exclusively associated with plants. Most of the strains of this species
cause diseases on several herbaceous and woody plants of agricultural interest. Beside
these, some other strains have been identified as non-pathogenic, saprophytic or
opportunistic pathogens. Based on the host specialization of the pathogenic strains, nine
pathovars have been recently proposed (Fischer-Le Saux et al., 2015).

10
X. arboricola pv. pruni, causal agent of bacterial spot disease on at least 13 species of
the genus Prunus, is considered one of the most economically important pathovars
within X. arboricola. This pathogen, which is classified as a quarantinable organism in
the European Union, causes damages on leaves, fruits, twigs, branches and trunks of the
trees (EFSA, 2014). Damages in 25-75% of the peach fruits in orchards in the USA
have been reported (Stefani, 2010).

Previous molecular typing analysis of a selection of strains isolated from Prunus has
demonstrated the low diversity on X. arboricola pv. pruni, which forms a monophyletic
group comprised of a unique clonal complex regardless of the host, the continent or the
year of isolation, corresponding to a pandemic lineage that stays as a monomorphic
group during evolution (Boudon et al., 2005; Fischer-Le Saux et al., 2015).

Next generation sequencing approaches have provided valuable information related to

the genomics of the genus Xanthomonas, allowing understanding of the role of several
pathogenic factors as well as the key determinants of bacterial adaptation and host
restriction (Denancé et al., 2016). Since 2012, genome sequencing projects have started
for X. arboricola, generating at least one complete genome and 15 draft genome
sequences, comprising meaningful information for understanding pathogenesis in this
species and for the improvement of diagnostic tools addressed to disease prevention.
Comparative genomic studies in X. arboricola are attracting increased interest in this
species and have started to bring important results. For instance, in a study on X.
arboricola pv. juglandis, causal agent of bacterial blight on walnut (Juglans spp.), a
group of non-pathogenic strains isolated from J. regia were identified and classified as
phylogenetically distant from the pathogenic strains. Complete genome analysis of these
atypical strains revealed differences from pathogenic strains in features related to the
initial steps of bacterial infection, such as those connected to structural components of
the flagellar system, non-fimbrial adhesins and chemosensors. Furthermore, the profile
of type III effectors was correlated with the capacity to produce disease on walnut
(Essakhi et al., 2015; Cesbron et al., 2015).

Previous studies of plant-pathogen interaction in other models such as X. citri (Vernière

et al., 2003; Gordon et al., 2015), X. campestris (Kamoun & Kado, 1990; da Silva et al.,
2002; Crossman & Dow, 2004) and X. oryzae (Qian et al., 2008; Triplett et al., 2011),
have demonstrated that the study of phenotypic and genotypic features associated with

10
bacterial sensing and attachment, chemotaxis, motility, xanthan production, biofilm
organization, the metabolism of carbon sources, as well as secretion of virulence
factors, were basic for improving the knowledge of the bacterial ability to penetrate the
plant tissue and to cause disease in a specific host range of plants.

The general genome features of two X. arboricola pv. pruni pathogenic strains, isolated
from almond (Prunus amygdalus, syn. P. dulcis) and Japanese plum (Prunus salicina),
as well as one of a non-pathogenic strain isolated from Santa Lucía SL-64 rootstock
(Prunus mahaleb) were described in a previous work (Garita-Cambronero et al., 2014,
2016a). Herein, our goal was to associate the genomic content of these xanthomonads
with the phenotypic features of X. arboricola pv. pruni that causes bacterial spot of
stone fruits. Differences in key aspects associated with bacterial sensing, motility,
attachment and secretion of cell-wall degrading enzymes as well as type III effectors
were determined in pathogenic and non-pathogenic strains of X. arboricola.

3.3 Results

3.3.1 Molecular characterization using multilocus sequence analysis (MLSA),

genome based phylogeny and genome comparison.

As an initial approach to characterize a group of strains phenotypically similar to

Xanthomonas isolated from Prunus in Spain, one Xanthomonas strain isolated from
asymptomatic leaves of P. mahaleb (strain CITA 44), and 14 Xanthomonas strains
isolated from Prunus spp. with symptoms of bacterial spot disease, were typed at four
loci (dnaK, fyuA, gyrB and rpoD) in order to determine their taxonomic position (Young
et al., 2008) (Table 1).

Analysis of the concatenated sequence (2,858 nucleotide positions) revealed a percent

of similarity from 96.86 to 100% within the group encompassed by six X. arboricola
reference strains and the 15 strains isolated from Prunus spp. Despite this, strain CITA
44, according to the maximum likelihood analysis, could not be consistently associated
with any of the reference strains (Fig 1). The remaining 14 strains isolated from
symptomatic hosts were clustered into a group with all the reference strains of X.

10
arboricola pv. pruni. Comparative analysis between these two intra-specific groups
revealed a total of 43 nucleotide variations in the concatenated sequence of CITA 44 (11
variable nucleotide sites for dnaK, nine for fyuA, 16 for gyrB and seven for rpoD
genes), or a sequence similarity of 98.49% between this strain and all the other X.
arboricola isolated from Prunus. These nucleotide changes could be associated with
silent mutations, due to the fact that the translated amino acid sequence of each locus
showed a 100% of sequence coverage and 99-100% of sequence identity to several
strains of X. arboricola according to the Blastp results.

Table 1. Xanthomonas arboricola strains used in this study.

10
Fig 1. Maximum likelihood tree of concatenated nucleotide sequences for partial sequences of the
genes dnaK, fyuA, gyrB and rpoD of selected strains of X. arboricola isolated from Prunus. Target
strains are in bold. For comparative purposes other X. arboricola strains are included. X. citri subsp. citri
strain ICMP 24 was considered as outgroup. Bootstrap values (1,000 replicates) are indicated below and
above the branches.

Fig 2. Phylogenetic analysis of 18 strains of X. arboricola based on the core genome sequence of the
species (2,525 CDS). Sequences were aligned using MAFFT and Maximum likelihood analysis was
carried out using RaxML. Bootstrap values (1,000 replicates) are presented above or below the branches.
The strain of X. campestris pv. campestris ATCC 33913 was used as an outgroup.

10
Phylogenetic analysis of the 18 X. arboricola strains, based on the core genome
sequence (S1 and S2 Tables), showed that the three strains that cause disease on stone
fruits and almond (CITA 33, IVIA 2626.1 and MAFF 301420) clustered according to
the pathovar classification, as observed previously using the multilocus sequence
analysis (MLSA) approach. In the same manner, strain CITA 44 did not cluster with the
other xanthomonads isolated from Prunus nor to any of the well-established pathovars
described for X. arboricola. Instead, CITA 44 was included in a clade along with the
strain 3004 of X. arboricola, recently described as the causal agent of disease on barley
(Hordeum vulgare) (Ignatov et al., 2015) (Fig 2).

After automatic annotation of 18 genome sequences publicly available of X. arboricola

(Ibarra Caballero et al., 2013; Garita-Cambronero et al., 2014, 2016a; Higuera et al.,
2015; Ignatov et al., 2015; Pereira et al., 2015; Cesbron et al., 2015; Harrison et al.,
2016), 3,927 protein coding sequences (CDS) were predicted for CITA 44, whereas in
the draft genome sequence of the other X. arboricola strains that did not represent a
well-established pathovar (strains 3004, CFBP 7634 and CFBP 7651), a total of 5,221
different CDS were determined. For the strains of the pathovars celebensis, juglandis
and pruni, 4,485; 5,700 and 5,048 CDS were predicted, respectively (S1 Table). The
core genome sequence of the analyzed strains was comprised by at least 2,525 CDS (S2
Table). CITA 44 shared 3,387 CDS with the three strains of the pathovar pruni (Fig 3A,
S1 Fig) and 3,720 CDS with all the strains of X. arboricola (Fig 3B). This strain shared
the highest number of CDS with strain 3004 of X. arboricola (3,485 CDS), not
classified in any pathovar, whereas the lowest number of CDS was shared with the
strain MAFF 301420 of the pathovar pruni (3,181 CDS). Unique CDS for strains CITA
44, CITA 33 and IVIA 2626.1 were predicted. CITA 44 showed 206 exclusive CDS, 55
of which were classified into 18 clusters of orthologous groups (COG) functional
categories, being predominantly those related to cell motility and carbohydrate transport
and metabolism. Signal peptide cleavage sites and transmembrane helices were
predicted only in 19 and 33 CDS, respectively. In the case of the X. arboricola pv. pruni
strains, 149 unique CDS were found, 54 of them were classified into 20 COG functional
categories, with a predominant presence of CDS related to cell wall/membrane
biogenesis and amino acids transport and metabolism. Additionally, 17 CDS showed
signal peptide cleavage sites and transmembrane helices were predicted in 33 CDS (Fig
3C, S3 Table).

10
Fig 3. Venn diagram representing the CDS shared among X. arboricola. CDS shared by Prunus-
pathogenic strains and CITA 44 (A), CDS shared by CITA 44 and X. arboricola (B). The distribution of
the unique CDS found in in the draft genome sequences of CITA 44, CITA 33 and IVIA 2626.1 that have
been classified into the COGs functional categories are also represented (C). Different letters represent
the standardized code of the COGs functional categories.

3.3.2 Carbon sources utilization and chemotaxis profile.

The profile of carbon sources metabolized by CITA 44 was determined using the
BIOLOG GN2 microplate system and compared to that obtained from the strains of the
pathovars corylina, juglandis, populi and pruni (Table 1). Seventeen carbon sources
compounds over 95 were utilized by CITA 44, meanwhile 45 carbon sources were not
utilized and 33 showed variable reactions and, consequently, were considered as not
informative. On the other hand, the profile observed in 20 strains isolated from Prunus
and identified as X. arboricola pv. pruni, as well as the patterns observed in the
remaining strains of X. arboricola, were different compared to CITA 44, as represented
in the dendrogram obtained from the similarity analysis (Fig 4). All the strains of the

10
pathovar pruni, unlike CITA 44, were able to metabolize dextrin and proline and unable
to metabolize D-saccharic acid.

In order to determine the chemotactic effect of 18 carbon compounds on CITA 44 and

on two reference strains of X. arboricola pv. pruni, a microtiter plate chemotaxis assay
was conducted (Sena-Vélez, 2015). Strain CITA 44 was attracted only by serine (200
mM), and repelled by citric acid (10 mM), galacturonic acid (10 mM), glucuronic acid
(10 mM), arginine (10 mM), cysteine (10 mM) and galactose (10 mM). No chemotactic
activity was recorded toward the remaining compounds assayed. Strains CFBP 5530
and CITA 33 showed a different chemotactic pattern compared to CITA 44. The first
two strains were attracted to glycerol (2%), maltose (10 mM) and serine (10 mM and
200 mM), and repelled by citric acid (10 mM), galacturonic acid (10 mM), glucuronic
acid (10 mM) and cysteine (10 mM). Detailed chemotactic patterns for each strain are
shown in Table 2.

Fig 4. Carbon compounds utilization profile of X. arboricola. Biolog GN2 profile for CITA 44 (A),
comparative cluster analysis including carbon compounds profile from X. arboricola isolates (B). Cluster
analysis was constructed based on 63 informative substrates. Data were computed using the UPGMA
model. Reliability of the tree was determined by the cophenetic correlation index (r > 0.98).

10
Table 2. Chemotactic profile of 18 carbon compounds of three representative strains of Xanthomonas
arboricola isolated from Prunus spp.

In addition to the phenotypic variants observed in the features mentioned above,

genome comparison also revealed variants in the profile of the environmental receptors
studied within this species. X. arboricola strains harbored 14 of the 28 TonB-dependent
transporters (TBDTs) analyzed (Mhedbi-Hajri et al., 2011) (S4 Table), and from these,
only two homologs to the TBDTs encoded by the loci XAC3620 (outer membrane
receptor FepA) and XCC3595 (ferric pseudobactin receptor), described in X. citri and X.
campestris, respectively, were shared by all the X. arboricola strains.

All strains isolated from Prunus spp., both pathogenic and non-pathogenic, harbored
eight TBDTs. The presence of homologous sequences to the TonB-dependent receptor
loci XCC1719 and XAC3077, and the absence of XCC0304 and XCC2867 in the
strains of X. arboricola pv. pruni, differentiated them from the non-pathogenic strain
CITA 44. The distribution of the TBDTs revealed that none of these variations was
unique for those strains that inhabit the Prunus hosts. Nevertheless, the TBDT cirA
(XAC3077) was found only in those strains that caused disease on stone fruits and
Turkish hazel (Corylus colurna).

10
Regarding the distribution of sensors of two-component regulatory system (STCRS)
(Mhedbi-Hajri et al., 2011), 58 orthologous CDS of 86 genes previously described in
Xanthomonas were found in X. arboricola. All the analyzed strains shared 44 STCRS
(S4 Table), and CITA 33, CITA 44 and IVIA 2626.1 have 53 STCRS in common.
Homologous CDS to a diguanylate cyclase of X. citri (XAC2804) was only present in
the pathogenic strains, meanwhile homologues of four STCRS (XAC1819, XAC2804,
XAC0136 and XAC1345) were only found in CITA 44. Additionally, as compared to
other X. arboricola strains, CITA 33 and IVIA 2626.1 presented two unique STCRS
homologous to the loci XAC0136 and XAC1345 of X. citri, respectively (Fig 5).

Out of 26 methyl-accepting chemotaxis proteins (MCPs) previously described (Mhedbi-

Hajri et al., 2011), 22 were found in the genome sequences of X. arboricola (S4 Table).
The number of MCPs varied from 16 in strain CFBP 7634 to 22 in strains 3004, CFBP
7651 and NCPPB 1630; all the X. arboricola strains shared a MCPs pattern composed
by 13 genes (S4 Table). Prunus-associated strains shared 20 MCPs, pathogenic strains
differed from CITA 44 in the existence of a CDS orthologous to the MCP XCV1933
and the absence of the MCP XCV1938, both described in X. campestris pv. vesicatoria.
No MCPs could be detected as specific for a particular host plant, however, orthologous
CDS for three MCPs described in X. citri and X. campestris pv. vesicatoria (XAC3768,
XCV1952 and XCV1938) were absent only in the strain that causes disease on Turkish
hazel (S4 Table).

X. arboricola genome sequences harbored 15 to 17 genes homologous to the

chemotactic related che genes (Mhedbi-Hajri et al., 2011) (S4 Table). Pathogenic strains
of Prunus had 17 homologous CDS for these genes, and CITA 44 had 16 CDS. CITA
44 did not show homologous CDS to the locus XAC2447 (cheW) described in X. citri,
which was present in all the remaining genome sequences of X. arboricola (Fig 5).

3.3.3 Flagella, fimbrial and non-fimbrial adhesins associated with motility and
attachment in X. arboricola.

Swarming motility was evaluated in all the 21 X. arboricola strains isolated from
Prunus (Table 3). Two kinds of swarmer colony phenotype were observed. Dendritic
pattern, encompassed by several tendrils that extended away from a central colony, was
observed in CITA 44 as well as in other 13 strains of the pathovar pruni after 12-15

11
hours post inoculation (hpi). Despite this, CITA 44 showed some unique characteristic
such as the presence of shorter and wider tendrils in the swarming colony (Fig 6A). The
second colony morphology was characterized by a circular shape shown by seven
strains of X. arboricola pv. pruni (Fig 6A). Light and electron microscopy observations
discarded the existence of hyper-flagellated bacterial cells in the swarming colony for
all strains, including CITA 44 (S2 Fig).

Fig 5. Graphical circular representation of the CDS associated with pathogenesis in X. arboricola
isolated from Prunus. The contigs of the draft genome sequence of strains CITA 33, CITA 44 and IVIA
2626.1 were arranged by Mauve (Darling et al., 2004), using the genome sequence of X. arboricola pv.
juglandis Xaj 417 as the reference. The circular map was constructed using CGview. From outside to
center: CDS on forward strand, CDS on reverse strand, GC content and GC skew.

Table 3. Motility profiles of 21 strains of Xanthomonas arboricola on semisolid surfaces.

11
Fig 6. Flagella and type IV pilus mediated motility on semisolid and solid surfaces in some
representative strains of Xanthomonas arboricola. Swarming dendritic (A1 and A2) and circular (A3)
phenotypes were determined on PYM 0.5% agar plates after 24 hpi. Variable swimming phenotypes (B1,
B2 and B3) observed after 72 hpi on MMA 0.3% agar plates. Twitching type motility (C1, C2 and C3)
was observed after 72 hpi on polyestyrene plate surface after inoculation through PYM 1.5% agar (40X).
Each motility assay was conducted in three independent experiments with three replicates.

Surfactant activity was evaluated for the 21 strains mentioned above according to the
atomized oil assay (Burch et al., 2010). A bright halo, associated with a change in the
surface tension, was observed around the colonies of all the strains tested. Surfactant
production, estimated as the ratio between the radius of the bright halo and the area of
the colony, was variable among strains (Table 3). CITA 44 showed a mean ratio of 3.69
± 0.54 (mean ± standard deviation), meanwhile strains of the pathovar pruni showed a
mean ratio of 3.94 ± 2.62. Strains IVIA 3162 and IVIA 3847–1 showed mean ratios of
0.52 ± 0.10 and 11.98 ± 0.89, being the lowest and the highest activity identified,
respectively (Table 3).

The swimming ability of these strains was also assayed on 0.3% agar MMA plates.
After inoculation, all the strains showed a circular and turbid growth around the
inoculating point (Fig 6B). This activity, recorded as the radius of the bacterial colony,
was variable among the strains (Table 3). CITA 44 presented the highest activity with
an average of the radius of the halo of 2.42 ± 0.10, meanwhile the mean for pathogenic
strains was 0.65 ± 0.46, with a maximum value of 1.25 ± 0.05 for CFBP 5724 and a
minimum value of 0.30 ± 0.05 for IVIA 2626.1.

Twitching motility, which is carried out by type IV pilus (Mattick, 2002), was observed
in all the strains on the plastic surface of the culture plate, after crystal violet staining
(Fig 6C). Microscopic observation at the edge of the colony revealed a twitching zone

11
composed by bacterial rafts moving away from the colony, creating a concentric pattern
preceded by a lattice like network and microcolonies.

Genome analysis performed to characterize the presence of the major structural

components of the two motility and adherence structures described above (Chevance &
Hughes, 2008; Mhedbi-Hajri et al., 2011), revealed that 33 (X. arboricola 3004 and X.
arboricola pv. corylina) to 35 (X. arboricola pv. pruni and X. arboricola CFBP 7634
and CFBP 7651) flagellar components were found in X. arboricola. The genomes in
these species shared 29 CDS (S4 Table). The strains isolated from Prunus presented 34
(CITA 44) and 35 (CITA 33 and IVIA 2626.1) structural components; CITA 44 did not
show homologous sequence to fliD (XAC1974), which is present in all the analyzed
strains (Fig 5, S4 Table). Despite the similar pattern of flagellar components observed
among the X. arboricola strains, variants in the amino acid sequence of the flagellin
protein were observed between pathogenic strains (CFBP 7179, CITA 33, IVIA 2626.1,
MAFF 301420 and NCCB 100457), which showed the identical protein
WP_039814449.1, and the non-pathogenic or low-pathogenic strains (3004, CFBP
7634, CFBP 7651, NCPPB 1630 and CITA 44), which showed the identical protein
WP_024939608.1. Both proteins showed 354 identical amino acids of a total of 399
(pairwise identity of 88.7%). A remarkable difference, associated with the potential to
infect in other xanthomonads, is the substitution of aspartic acid by valine in the amino
acid position 43 of the N-terminal region of the flagellin gene in the pathovars corylina,
juglandis and pruni (S3 Fig).

Regarding the structural and regulatory components of the type IV pilus, 22 out of 31
CDS homologous to the components described in X. citri subsp. citri strain 306 (Dunger
et al., 2016) were found in the nine genome sequences of X. arboricola; 16 of these
CDS were shared by all the strains (S4 Table). The other Prunus-associated strains
presented the same components, including CITA 44. The remaining strains of X.
arboricola showed a similar pattern, with the exception of NCPPB 1630, CFBP 7634
and CFBP 7651, which did not have homologous sequence to the locus XAC0259 of X.
citri. No sequence associated with pilF was observed in strain CFBP 7634 and none
homologues of pilQ was found in strain 3004 (S4 Table).

Regarding the presence of the genes associated with type IV pilus, that are present in
most of the Xanthomonas species, the cluster pilB, C, D, R, S was found in all the

11
strains, as well as the cluster that encodes the minor pilins, pilE, V, W, X, Y1 and fimT,
that showed a sequence identity lower than 80.0%. Presence of pilE, pilV, pilY1 and
fimT was variable among the strains, meanwhile pilW and pilX were found in all the
genome sequences. Prepilin pilA was found in all the strains of X. arboricola, despite its
identity to the locus XAC3505 of X. citri was lower than 80.0% (S4 Table).

In addition to the fimbrial adhesins described above, the repertoire of non-fimbrial

adhesins (Mhedbi-Hajri et al., 2011) of X. arboricola comprised five genes (S4 Table).
All the strains shared homologous CDS to panB (XAC1816), yapH (XAC2151) and
xadA (XCV3670) of X. citri and X. campestris pv. vesicatoria. Prunus-pathogenic
strains harbored an adhesin homologous to the locus XAC3672 of X. citri which was
absent in CITA44 (Fig 5; S4 Table). Finally, the hemagglutinin encoded by the locus
XAC444 of X. citri was found only in those strains that were able to colonize hosts of
the genus Corylus, Junglans and Prunus.

3.3.4 Pathogenicity tests and genomic components associated with late stages of
infection in Prunus-associated strains.

Detached leaf assay was carried out by inoculating 21 X. arboricola strains, isolated
from Prunus spp., on almond (cv. Ferraduel), apricot (cv. Canino), peach (cv. Calanda)
and European plum (cv. Golden Japan). CITA 44 did not cause bacterial spot disease
symptoms on almond, apricot, peach or plum 28 days post inoculation (dpi). Significant
differences (p < 0.05) in the virulence among strains of the pathovar pruni were shown
(Table 4). These strains were able to induce disease symptoms on almond, peach and
European plum but none of them caused clear disease symptoms on apricot.
Representatives of this assay are shown in Fig 7.

The secretory pathway components, and plant cell wall-degrading enzymes, were also
analyzed in X. arboricola genomes (S4 Table). Regarding the encoding elements for the
two type II secretory systems (T2SS) described in Xanthomonas (Filloux, 2004;
Szczesny et al., 2010), all strains harbored the 11 genes of the xps cluster but, in the
case of the xcs cluster, only CDS homologous to xcsD, xcsE, xcsF, xcsG and xcsJ were
found. The remaining seven components of this secretory system were automatically
annotated, but amino acid sequence analysis showed for all of them an identity lower
than 80% when compared with the xcs cluster described in X. campestris pv. campestris
(Szczesny et al., 2010).

11
Table 4. Differences in the virulence of 24 Xanthomonas arboricola strains isolated from Prunus on
detached leaves of almond, apricot, peach and European plum.

Fig 7. Schematic representation of bacterial spot symptoms observed on almond, apricot, peach
and European plum 28 dpi. Detached leaves were inoculated with a sterile cotton swap damped with
1x108 CFU/mL of bacteria or with 10 mM MgCl2 as negative control and maintained on 0.5% water agar
plates.

11
Variability in the profile of type II secreted virulence factors was found in X. arboricola
(S4 Table). A total of 11 pectolytic enzymes (da Silva et al., 2002; Vandroemme et al.,
2013) were found in this species and only the polygalacturonase, encoded by the locus
XCC3459, and the rhamnogalacturonan acetylesterase, encoded by XCC0154 in X.
campestris, were shared by all the strains. With respect to the strains isolated from
Prunus, they shared, in addition, one pectate lyase (XCC2815), one polygalacturonase
(XCC2266) and one rhamnogalacturonase (XAC3505). CITA 44 had homologous
sequences to a pectate lyase (XCC0112), a pectin methylesterase (XCC0121) and a
pectinmethylesterase (XCC2265) that were absent in strains CITA 33 and IVIA 2626.1,
meanwhile these two pathogenic strains had a homologous sequence to the degenerated
pectate lyase of X. citri (XAC2373) which was absent in CITA 44 (Fig 5).

Variation in the profile of cellulolytic enzymes (da Silva et al., 2002) was also found in
X. arboricola, 14 of these degrading molecules were present in this species but only
nine of them were shared by all the strains. None of the enzymes were unique in those
strains isolated from Prunus spp. Pathogenic strains differed from CITA 44 in the
presence of a homologous CDS to a beta-glucosidase (XCC1775), and in the absence of
the cellulases encoded by the loci XAC3516 and XCC2387, which were present only in
CITA 44 (Fig 5, S4 Table).

Moreover, 11 CDS homologous to hemicellulolytic enzymes, previously reported for

Xanthomonas (da Silva et al., 2002), were found in X. arboricola and eight of these
were shared by all the strains (S4 Table). CITA 33 and IVIA 2626.1 presented a
xylosidase which was absent in CITA 44 (Fig 5, S4 Table). Those strains of X.
arboricola which belongs to the pathovars corylina, juglandis and pruni harbored a
xylosidase/arabinosidase enzyme which was absent in all the non-pathogenic strains of
X. arboricola and in those strains with a lower pathogenic ability, such as the one
described from the pathovar celebensis. Finally, the lipase virulence factor, LipA
(Subramoni et al., 2010), was found in all the genomes analyzed. The gum gene cluster,
associated with the biosynthesis of xanthan in Xanthomonas (Vorhölter et al., 2008),
was analyzed. None of the strains presented homologous sequences to gumG, and CITA
44 and 3004 did not show homologous sequences to the gumF. (S4 Table).

Other crucial pathogenic elements analyzed were the T3SS components and the type III
effectors (Bonas et al., 1989; da Silva et al., 2002; White et al., 2009; Bogdanove et al.,

11
2011; Potnis et al., 2011; Guo et al., 2011; Hajri et al., 2012; Vandroemme et al., 2013;
Li et al., 2014) in the nine genome sequences of X. arboricola (S4 Table). All the
strains harbored CDS that encoded for HpaR2, HpaS, HrpG and HrpX, which are
involved in the regulation of the T3SS, and for many of the T3Es and some cell-wall
degrading enzymes (Jacobs et al., 2015). However, the strains 3004, CFBP 7634 and
CITA 44, as described before (Ignatov et al., 2015; Cesbron et al., 2015; Garita-
Cambronero et al., 2016a), did not present the components of the T3SS that have been
found in other Xanthomonas. Besides the master regulons mentioned above, all the
remaining X. arboricola strains encompassed and shared 14 hypersensitive response and
pathogenicity genes (hpa2, hpaB, hrcC, hrcJ, hrcN, hrcR, hrcS, hrcT, hrcU, hrcV,
hrpB1, hrpB2, hrpB5, hrpD6) (S4 Table).

The T3E profile of X. arboricola composed of 22 virulence effectors (avrBs2,

avrXccA2, hpaA, hrpW, xopA, xopAF, xopAH, xopAI, xopAQ, xopB, xopE2, xopE3,
xopF1, xopG, xopK, xopL, xopN, xopQ, xopR, xopV, xopX and xopZ1). The non-
pathogenic strain CITA 44 from Prunus, and the pathogen of barley strain 3004, did not
have any T3Es. The remaining non-pathogenic strains, CFBP 7634 and CFBP 7651,
harbored two (avrsB2 and xopR) and six (avrsB2, hpaA, hrpW, xopA, xopF1 and xopR)
T3Es, respectively (Cesbron et al., 2015) (S4 Table). In addition, the pathogenic strain
NCPPB 1630 from Musa sp. showed six T3Es, the pathogenic strain CFBP 7179 from
J. regia showed 16 T3Es and the strain NCCB 100457, that causes disease on C.
colurna, showed 19 T3Es. X. arboricola pv. pruni strains CITA 33 from P. amygdalus
and IVIA 2626.1 from P. salicina harbored 21 T3Es. All the strains, regardless of their
hosts, shared six T3Es (avrBs2, hpaA, hrpW, xopA, xopF1 and xopR). The effector xopB
was unique in the strain that causes disease on Juglans, meanwhile xopAQ, which has
not been previously reported in X. arboricola, and xopE3, were only found in those
strains that cause disease on Prunus. CDS homologous to these two T3Es were
specifically present in the plasmid pXap41, which is unique in the strains of the
pathovar pruni (Pothier et al., 2011c) (Fig 8).

11
3.4 Discussion

MLSA has been shown to be useful to characterize strains of X. arboricola (Boudon et

al., 2005; Young et al., 2008; Burokiene & Pulawska, 2012; Kaluzna et al., 2014;
Fischer-Le Saux et al., 2015). In this work, we utilized a MLSA scheme proposed by
Young and collaborators (2008), which is based in the analysis of partial sequences of
the genes dnaK, fyuA, gyrB and rpoD. Here, we have concluded that for 14 X.
arboricola strains isolated from Prunus, the selected MLSA scheme was a good
approach to characterize and discriminate the members of the pathovar pruni from
atypical or commensal strains of X. arboricola.

Fig 8. Nucleotide sequence similarity among the sequence of the exclusive plasmid of X. arboricola
pv. pruni pXap41 and the draft genome sequences of nine strains of X. arboricola. Blastn was used
for the comparative sequence analysis with an expected value threshold of 0.001. Circular graphic
representation was constructed using the BLAST Ring Image Generator (BRIG) tool. See legend for
information related to each ring of the map.

11
Classification of CITA 44 as an atypical strain of X. arboricola was corroborated by the
phylogenetic analysis conducted with 2,525 genes identified as the components of the
core genome of this species. This atypical strain isolated from Prunus did not present
the same phylogenetic origin as the pathogenic strains classified as pathovar pruni, but
it was more similar to strain 3004 of X. arboricola, which did not cluster within any of
the well-established pathovars of this taxon. Even though CITA 44 was closely related
to 3004, this strain did not produce symptoms on inoculated barley in assays performed
in our group. This result is similar to a previous work on X. arboricola strains isolated
from walnut that were more similar to strains isolated from Musa sp. than to those of the
pathovar juglandis isolated from walnut (Cesbron et al., 2015).

Moreover, the study of these atypical strains, found on barley, walnut and here in P.
mahaleb, open the discussion about the origin and evolution of pathogenicity in this
species as it has been proposed previously for the genus Xanthomonas (Jacobs et al.,
2015). Based in the current data, it is not possible to determine if these non-pathogenic
strains were predecessors of the pathogenic groups or the result of the loss of their
pathogenicity. Further exploratory studies regarding some other Prunus-associated
strains with other phenotypic and genotypic variants are needed to elucidate the
evolutionary process of pathogenicity in this bacterial species.

In addition, this study contributes to our understanding of the diversity of X. arboricola

associated with stone fruit trees and almond. Moreover, it also provides information to
develop tools to identify and discriminate pathogenic and non-pathogenic Xanthomonas
strains found in Prunus spp. This precise characterization of atypical strains of X.
arboricola will avoid bacterial identification mistakes, as occurred sometimes in other
bacterial models which implied unnecessary control measures and resulted in high
economic losses (Graham & Gottwald, 1991; Jalan et al., 2011).

The phylogenetic variation among strains of X. arboricola isolated from Prunus

concurred with the existence of differences in several phenotypic features including
pathogenicity. Additionally, genomic information generated from xanthomonads
isolated from Prunus (Garita-Cambronero et al., 2014, 2016a) and from other X.
arboricola (Ibarra Caballero et al., 2013; Higuera et al., 2015; Ignatov et al., 2015;
Pereira et al., 2015; Cesbron et al., 2015; Harrison et al., 2016), has been used to reveal
those features which could be involved in the disease process.

11
Carbon source utilization profiles, as expected (Vauterin et al., 1995; Boudon et al.,
2005; Fischer-Le Saux et al., 2015), showed high homogeneity among strains of the
pathovar pruni. Nevertheless, the profile of carbon sources utilization shown by CITA
44 was different to the one presented by the other strains as well as the one provided in
the description of X. arboricola species (Vauterin et al., 1995). This disparity from the
original metabolic description of the species has been also described for some strains of
other Xanthomonas species, such as X. vesicatoria (Stoyanova et al., 2014) and X.
campestris pv. campestris (Massomo et al., 2003). The discordant profile of CITA 44
could be due to the fact that the original description of the species X. arboricola was
based on strains of seven pathogenic pathovars which presented a high intra-pathovar
homogeneity (Vauterin et al., 1995; Fischer-Le Saux et al., 2015) and did not consider a
wider ecological diversity including the atypical non-pathogenic strains currently of
great research interest.

Initial stages of bacterial adaptation and host colonization encompass a series of sensors
and receptors that detect stimuli, providing to the cells the information of their biotic
and abiotic environment which triggers a series of processes such as the cell motility,
chemotaxis, quorum sensing, biofilm formation and many other cellular events (Qian et
al., 2008; Pieretti et al., 2012). At this stage, a group of protein complexes denominated
TBDTs, STCRS and MCPs play a crucial role (Mhedbi-Hajri et al., 2011).

The repertoire of TBDTs in X. arboricola, which are bacterial outer membrane proteins
associated with the transport of different substrates including carbohydrates (Noinaj et
al., 2010), was extensive compared to other species of this genus (Mhedbi-Hajri et al.,
2011; Vandroemme et al., 2013), resulting similar to the one observed in X. campestris
and other epiphytic xanthomonads (Mhedbi-Hajri et al., 2011). Additionally, this
repertoire is in accordance with the one previously observed in two not publicly
available genome sequences of X. arboricola pv. fragariae (strains LMG 19145 and
LMG 19146) and one of X. arboricola pv. pruni (strain LMG 25862) (Vandroemme et
al., 2013). This high number of TBDTs has been associated in other xanthomonads with
the need for carbohydrates scavenging in variable conditions encountered in epiphytic
niches (Blanvillain et al., 2007).

Bacterial sensing and chemotaxis are essential components of the initial infection
processes (Wadhams & Armitage, 2004). Regarding STCRS proteins, which are part of

12
the dominant molecular mechanism by which unicellular organisms respond to
environmental stimuli, the large repertoire observed in Xanthomonas arboricola was
similar to that observed in X. campestris (Mhedbi-Hajri et al., 2011), and it was in
accordance with the number of STCRS observed in most of the complete genome
sequences of Xanthomonas, with the exception of those species which inhabit in
restricted niches such as X. albilineans (Qian et al., 2008; Pieretti et al., 2012).
Evaluation of TBDTs and STCRS content revealed differences between CITA 44 and X.
arboricola pv. pruni strains, despite of the general low variability observed among the
different X. arboricola strains evaluated.

Beside this, CITA 44, compared to strains of the pathovar pruni, also showed a distinct
chemotactic pattern, being influenced by just a few compounds. This kind of
intraspecific chemotactic variability has been also observed in other xanthomonads
models like X. citri subsp. citri with dissimilar pathogenic ability (Sena-Vélez, 2015).

In order to explain these chemotactic behaviors, MCP content was evaluated. MCPs
sense beneficial or toxic environmental compounds and transduce the signal to the
cytoplasm by CheW protein, causing changes in the flagella direction and rotation
speed, which finally guides bacterial cells to favourable environments (Wadhams &
Armitage, 2004; Moreira et al., 2015). Here, we have found that the core repertoire of
the MCPs in nine genome sequences of X. arboricola included at least 13
chemoreceptors. Differences in the MCPs content were observed among the genome-
sequenced strains and could be associated with their host range. Differences in MCPs
content were found between CITA 44 and other xanthomonads from Prunus spp.
Moreover, a variation in the cheW locus was also identified.

Although functional analyses are necessary to confirm the role of these sensors at initial
stages of the infection process, our results point out that these processes and the genes
involved may mark the diverse behaviour of the different strains. Moreover, the very
initial stages of the bacterial-host interaction described above could trigger other
molecular routes which involve components such as the flagella and the type IV pilus,
that are related not only to motility on liquid or solid environments, but also with
attachment to the host or the development of biofilm structures (Kearns, 2010;
Malamud et al., 2011; Dunger et al., 2016). Motility on solid and semisolid surfaces,
which are controlled by flagella or type IV pilus, was also variable among the assayed

12
strains of X. arboricola isolated from Prunus. This variability among different strains in
swimming, swarming and twitching motility have been shown in other xanthomonads
such as X. citri (Sena-Vélez et al., 2015), as well as in X. arboricola strains isolated
from walnut (Cesbron et al., 2015). Strain CITA 44 showed the higher ability to swim
that maybe connected to a more restricted niche to survive and higher requirements to
locate it. Similarly, this enhanced ability to swim has been described in other bacterial
models like X. citri subsp. citri, which less virulent strains were described to have a
higher swimming ability (Sena-Vélez et al., 2015). In relation to the surface motility in
X. arboricola, two different colony phenotypes were observed; the circular one matched
with the one observed for other species such as X. oryzae and X. citri (Shen et al., 2001;
Gottig et al., 2009), described previously as independent of flagella and defined as
sliding type motility instead of swarming (Malamud et al., 2011). Contrary to this, some
other strains showed dendritic swarmer colonies, which had not been previously
described in Xanthomonas but confirmed in other bacterial species such as
Pseudomonas aeruginosa as a real swarming type motility (Kohler et al., 2000). In
addition, these strains showed other swarming-related features such as the production of
surfactants and a rapid outward migration (Verstraeten et al., 2008). Again, CITA 44
showed a different pattern to that of X. arboricola pv. pruni, presenting a colony with
an intermediate phenotype between dendritic and circular and also an intermediate
surfactant production.

Genome analysis of the flagellum components in CITA 44 revealed an interesting

amino acid substitution in the N-terminal region of the flagellin that was also found in
other non-pathogenic xanthomonads. Previously, Cesbron and collaborators (2015)
reported an amino acid polymorphism (Asp-43/Val-43) in the flagellin domain flg22
among pathogenic and non-pathogenic strains of X. arboricola isolated from walnut.
Here we report that this variation is not only present in X. arboricola pv. juglandis
strains but it is also found in the other two major pathogenic pathovars of this species,
corylina and pruni. In X. campestris, strains with Val-43 in flg22 were not detected by
the flagellin sensing 2 kinase (FLS2) of Arabidopsis, therefore they did not elicit the
pathogen-associated molecular (PAMP)-triggered immunity and, additionally, these
strains were more virulent than those with an Asp-43 residue in flg22 (Sun et al., 2006).
The genomic analysis also revealed the absence of fliD in CITA 44. In several bacterial
species the absence of fliD was associated with non-flagellated and non-motile cells

12
(Ikeda et al., 1996; Kim et al., 1999). This is not the case of CITA 44, which showed a
single polar flagellum like X. arboricola pv. pruni strains (Garita-Cambronero et al.,
2016a).

The type IV pilus is an important structure related to the movement across the surface,
adhesion, microcolony formation, secretion of proteases and colonization factors, being
a key pathogenesis factor (Craig & Li, 2008). In general, strains isolated from Prunus,
despite their pathogenicity, harbor all the four subcomplexes that permit the biogenesis
and function of this structure (Dunger et al., 2016); additionally these components were
demonstrated as functional in the twitching motility assay.

As the type IV pilus, non-fimbrial adhesins are involved in bacterial attachment to host
surfaces; in X. oryzae, they play an important role in pathogenesis and are particularly
involved at the initial stage of leaf attachment and penetration into the host (Ray et al.,
2002; Das et al., 2009). X. arboricola, shows various combinations of adhesins among
the different strains studied. This variability could be associated to the different
bacterial-plant compatible interactions of the different strains and hosts (Ryan et al.,
2011). Once more, CITA 44 lacked one of the genes involved in adhesion synthesis
which was present in X. arboricola pv. pruni. Further functional studies in this way
could be valuable to define the definitive role of these adhesins in the pathogenicity and
host specificity observed in the pathovars of X. arboricola.

After the very initial stages of pathogenesis described above, some virulence genes
related to host colonization, multiplication and development of symptoms are
expressed. T2SS permits the export of proteins from the bacterial cell and it is involved
in the translocation of degradative enzymes which causes damage to the host cells and
tissues (Cianciotto, 2005). Most species of Xanthomonas encode the components of two
T2SS. One of them is Xps, which contributes to bacterial virulence by the secretion of
xylanases and proteases in X. campestris and X. oryzae (Szczesny et al., 2010). In X.
arboricola, all the components of the xps gene cluster were conserved. As in all the
Xanthomonas species, X. arboricola showed a core repertoire of cell wall degrading
enzymes which is formed by at least 30 CDS. Beside this, a high variation in the
repertoire of these enzymes was also found among the analyzed strains. These
variations could be related to the different cell wall composition of the hosts or tissues
and the requirements to produce symptoms during the infection (Ryan et al., 2011).

12
Differences in the profile of degrading enzymes were identified among the Prunus-
pathogenic strains and other strains of X. arboricola, including CITA 44.

Another gene cluster associated with pathogenesis in Xanthomonas is the xanthan

producing gum gene cluster which is composed by 12 genes. Deletion of this group of
genes inhibits the disease development in X. campestris on Arabidopsis and Nicotiana
(Yun et al., 2006). In X. arboricola, this cluster was conserved, with the exception of
gumG that was absent in all the sequenced strains and the O-acetyltransferases encoded
by gumF lacking in strains CITA 44 and 3004. Nevertheless, the absence of these two
genes has been demonstrated to not affect the xanthan polymerization (Katzen et al.,
1998).

T3SS, as well as the T3Es, plays an essential role in pathogenicity once bacteria have
penetrated the host tissue and could be related to host specificity in Xanthomonas
(White et al., 2009). As occurred in other Xanthomonas species, all the X. arboricola
strains harbored orthologs CDS to the genes that encode HpaR2, HpaS, HrpG and
HrpX, which are involved in the regulation of T3SS, T3Es as well as other pathogenic
factors such as those encoded by pehA and pehD genes (Jacobs et al., 2015). This was
also previously reported in the strains isolated from walnut as well as for strains 3004,
CITA 44 and IVIA 2626.1 (Jacobs et al., 2015; Cesbron et al., 2015; Garita-
Cambronero et al., 2016a).

It is important to note the localization in X. arboricola of an ortholog to the T3E, called

xopAQ, in the plasmid pXap41, next to other two virulence associated proteins, xopE3
and mltB (Pothier et al., 2011c). This effector has been previously found in the
chromosome of X. citri and X. gardneri and a similar sequence has been found in
Ralstonia solanacearum (Potnis et al., 2011; Jalan et al., 2013). Nucleotide sequence
analysis revealed a high pairwise nucleotide identity (99.7%) to the xopAQ sequence of
X. citri subsp. citri Aw12879, as well as a putative plant-inducible promoter box (PIP-
box) sequence 67 bps upstream the start codon, but this conserved sequence associated
with the regulon HrpX showed a variant in one nucleotide (S4 Fig). The presence of at
least three T3Es in pXap41 reinforces the hypothesis that this plasmid may contribute to
the virulence of this pathovar as well as to the specialization of the pathovar pruni
towards hosts of the Prunus genus (Pothier et al., 2011c). CITA 44 did not show xopAQ
or any of the T3Es found, which is consistent with the absence of pXap41 and its non-

12
pathogenic character. Currently, functional studies on the effect of pXap41 and its
related T3Es are being conducted in our group to confirm their role in the pathogenicity
and the host specificity of the pathovar pruni strains.

In conclusion, this study of strains with diverse virulence range, and particularly strain
CITA 44, has provided an opportunity to elucidate essential mechanisms in the host-
bacteria interaction in Xanthomonas arboricola pv. pruni. In addition, it is useful to
understand the evolution of the pathogenicity in this species. Furthermore, the
comparative analysis reported here highlights several differences regarding to key
genotypic and phenotypic features of initial and late stages of the infection process. The
different TBDT, STCR, MCP profiles, the genomic variation in the components of
flagellin, the type IV pilus and in cell-wall degrading enzymes repertoire, and the
alteration in main virulence factors provide information that contributes to explain the
phenotypic differences observed between pathogenic and non-pathogenic strains.
Although the work presented shows a global overview of mechanisms involved in
virulence, further functional studies are needed to test and improve the understanding of
the role of all the virulence-related features mentioned here.

3.5 Materials and Methods

3.5.1 Bacterial strains and culture conditions

X. arboricola strain CITA 44, isolated from asymptomatic leaves of P. mahaleb in the
Spanish region of Aragón, and fourteen bacterial strains of X. arboricola pv. pruni
isolated from trees showing bacterial spot symptoms in Spain and Italy, were used in
this study (Table 1). From these fourteen strains, three were isolated from almond
[Prunus amygdalus Batsch, syn. P. dulcis (Miller) D. A. Webb], four from peach
[Prunus persica (L.) Batsch], six from Japanese plum (Prunus salicina Lindley) and
one from the hybrid rootstock Garnem (GxN15) (P. persica x P. amygdalus). Reference
strains of X. arboricola pv. pruni (10.0343, 10.0400, 10.439, CFBP 3894, CFBP 5530,
CFBP 5724), X. arboricola pv. corylina (CFBP 1846), X. arboricola pv. populi (CFBP
3123) and X. arboricola pv. juglandis (IVIA 2113) were also included in this study
(Table 1). Strains were routinely cultured on 1.5% agar plates of Luria Bertani (LB) or
in LB broth at 27°C for 48 h. All Xanthomonas strains are conserved in the collections

12
of Centro de Investigación y Tecnología Agroalimentaria de Aragón (CITA, Aragón,
Spain) and Instituto Valenciano de Investigaciones Agrarias (IVIA, Valencia, Spain)
and no specific permission was required for their use.

3.5.2 Multi Locus Sequence Analysis (MLSA).

Bacterial DNA was extracted from cultures in LB broth obtained after 24 h incubation
at 27°C, using a QIAamp DNA miniKit according to the manufacturer's instructions
(Qiagen, Barcelona, Spain). DNA was used for PCR or stored at -20°C until further use.
Degenerate primers, previously determined as useful in MLSA analysis conducted in
Xanthomonas (Young et al., 2008; Kaluzna et al., 2014), were used for PCR
amplification of partial sequences of the housekeeping genes dnaK, fyuA, gyrB and
rpoD. PCR amplifications were carried out in a 50 μL volume containing 1X PCR
buffer (10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100 [pH 9.0]); 0.2 μM of each
primer; 1.25 U Taq DNA polymerase (Biotools, Madrid, Spain); 0.2 mM each dNTP
(Biotools Madrid, Spain); 1.5 mM MgCl2 and 1.0 μg/μL of DNA template. All PCR
reactions were performed in an ABI 2720 thermal cycler (Applied Biosystems, Foster
Urban district, CA, USA) with an initial denaturation at 94°C for 5 min, 40 cycles of
denaturation at 94°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 2
min, and a final extension step at 72°C for 10 min. PCR products were visualized under
UV light in 2% agarose gels stained with ethidium bromide and purified with the
Wizard SV Gel and PCR Clean-up System Kit (Promega Corporation, Madison, USA).
PCR products were sequenced at STAB VIDA (Lisbon, Portugal), and edited using
BioEdit Sequence Alignment Editor (Hall, 2011). Additionally, sequences of the
housekeeping genes used for MLSA analysis from X. arboricola pathovars celebensis
(ICMP 1488), corylina (ICMP 5726) and juglandis (ICMP 35) as well as X. axonopodis
pv. citri strain ICMP 24, included as outgroup, were obtained from the National Center
for Biotechnology Information database (NCBI) ([Link]

Nucleotide sequences were aligned with ClustalW version 1.83 (Goujon et al., 2010)
using default parameters. Both ends of each alignment were trimmed to the following
sizes: dnaK, 864 positions; fyuA, 607 positions; gyrB, 631 positions and rpoD, 756
positions. Nucleotide sequences from all strains analyzed here and from those
Xanthomonas spp. available in databases (Young et al., 2008) were aligned and

12
concatenated to give a total length of 2,858 nucleotide positions. The programs
jModelTest 0.1.1 (Posada, 2008) and MEGA 5.05 (Tamura et al., 2011) were used to
determine the best model of evolution for Maximum Likelihood analysis (ML) based in
the akaike information criterion (AIC) (Posada & Buckley, 2004). For the concatenated
gene dataset the model selected was TN93+G. Maximum likelihood trees, using 1,000
bootstrap re-samplings, were generated in MEGA 5.05.

Nucleotide sequences were deposited in GenBank. Accession numbers for the partial
sequences of the genes used in this study are: KR054426 to KR054449 for dnaK;
KR054450 to KR054473 for fyuA; KR054474 to KR054497 for gyrB and KR054498 to
KR054521 for rpoD.

3.5.3 Genomic Analysis

Based in the MLSA analysis, three X. arboricola strains, CITA 33 (Synonymy Xap 33),
CITA 44 and IVIA 2626.1, were selected for complete genome sequencing and genome
features for these strains have been previously announced (Garita-Cambronero et al.,
2014, 2016a). Nucleotide sequences of the draft genome sequences of these three strains
(Deposited at DDBJ, EMBL, GenBank under the accession numbers JHUQ00000000
for CITA 33, LJGM00000000 for CITA 44, and LJGN00000000 for IVIA 2626.1), as
well as nucleotide sequences of three strains of X. arboricola (3004, CFBP 7634 and
CFBP 7651) (Ignatov et al., 2015; Cesbron et al., 2015), two strains of X. arboricola
pv. celebensis (NCPPB 1630 and NCPPB 1832) (Harrison et al., 2016), one strain of X.
arboricola pv. corylina (NCCB 100457) (Ibarra Caballero et al., 2013), eight strains of
X. arboricola pv. juglandis (CFBP 2528, CFBP7179, NCPPB 1447, XajA3, Xaj2, Xaj4-
1, Xaj43a and Xaj417) (Higuera et al., 2015; Pereira et al., 2015; Cesbron et al., 2015)
and one strain of X. arboricola pv. pruni (MAFF 301420) were obtained from the NCBI
´s genome database (S1 Table). Genome scaffolds presented in each one of the bacterial
genomes mentioned above were arranged and oriented by Mauve (Darling et al., 2004)
using the complete genome sequence of X. arboricola pv. juglandis strain Xaj417
(Pereira et al., 2015) as reference.

12
For the purpose of homogeneity for further comparison, all the genome sequences were
annotated using Prokka (Seemann, 2014). GFF3 archives generated by Prokka were
used as the input to determine the core and the dispensable accessory genes in the
analyzed genomes using Roary (Page et al., 2015). The online tool available at
[Link], was used to generate the Venn diagram to compare the
genome composition of the Prunus-isolated strains with the remaining subspecific
groups of X. arboricola. Signal peptides and transmembrane domains for the unique
protein coding sequences (CDS) of X. arboricola CITA 44 and X. arboricola pv. pruni
CITA 33 or IVIA 2626.1, were determined using the signalP 4.1 server and the
TMHMM server version 2.0 (Krogh et al., 2001; Petersen et al., 2011). Beside this, the
assignment of these genes to the clusters of orthologous groups (COG) database
(Tatusov, 2000) was performed with the NCBI`s conserved domain database using an
expected value of 0.001 (Marchler-Bauer et al., 2014).

The core genome sequence obtained for each strain was aligned using MAFFT (Katoh
et al., 2002) for further phylogenetic analysis. Subsequently, a maximum likelihood
tree, using 1,000 bootstrap resamplings, was constructed to accurately determine the
phylogenetic position of the atypical strain isolated from Prunus, CITA 44, within X.
arboricola. Maximum likelihood tree was carried out using the RaxML tool
(Stamatakis, 2014) and the dendrogram obtained was visualized using Dendroscope
(Huson et al., 2007). X. campestris pv. campestris strain ATCC 33913 was used as an
outgroup in the analysis.

3.5.4 Carbon sources utilization analysis and environmental sensors profile

To prepare the inocula, bacterial strains used in the MLSA analysis (Table 1) were
cultured in LB plates and resuspended in sterile phosphate-buffered saline (PBS)
(OD600=0.3). Suspensions (150 µL) were inoculated into each well of the Biolog GN2
microplates (Biolog Inc., USA). Microplates were read at 570 nm using a Labsystems
Multiskan RC spectrophotometer (Fisher Scientific, Walthman, USA) after 24 h
incubation at 27°C (Vernière et al., 1993; Vauterin et al., 1995). Three independent
assays were performed, each including two microplates per strain and three reads per
well. Means from all the reads were performed and used in further analysis.

12
Three substrate utilization levels were defined based in the percentage of utilization
referred to water control (Maharjan et al., 2007): positive (+, > 160%); borderline,
considered as non-informative (±, 130-160%) and negative (-, < 130%).

The carbon sources utilization profile of strain CITA 44 was determined and compared
with those obtained for strains of the pathovars corylina, juglandis, populi and pruni;
results were converted to a binary form by scoring the metabolism observed for each
compound as 0 (no catabolism of the carbon source) and 1 (catabolism of the carbon
source). Similarity for pairs was calculated according to the Jaccard´s coefficient and
was subjected to Unweight Pair Group Method with Arithmetic Mean (UPGMA) cluster
analysis. Finally, the reliability of the similarity trees was determined using the
cophenetic correlation index. All the analysis were computed on NTSYS 2.11T (Exeter
Software, Setauket, NY).

Profiles of sensors of two-component regulatory system (STCRS) and TonB-dependent

transporters (TBDTs) for X. arboricola strains isolated from Prunus (CITA 33, CITA
44 and IVIA 2626.1) and six other Xanthomonas (3004, CFBP 7634, CFBP 7651,
NCPPB 1630, NCCB 100457 and CFBP 7179) (S1 Table) were determined based in the
analysis of the complete genomes and the search of homologous sequences for 86
STCRS and 28 TBDTs previously described in other Xanthomonas species (Mhedbi-
Hajri et al., 2011). Sequence homology searches were conducted using the Blast tool
according to the protocol proposed by the NCBI (NCBI, 2016), using the nucleotide
sequence that encodes each one as the input. Those CDS which presented an identity
and a query coverage percentage over 80% were considered as orthologous genes in the
target genomes of X. arboricola.

3.5.5 Chemotaxis assay and repertoire of methyl accepting chemotaxis proteins

Eighteen carbon compounds that induce variation in the chemotactic response in other
Xanthomonas (Sena-Vélez, 2015) were evaluated to determine differences in the
chemotactic profile between the atypical strain CITA 44 and X. arboricola pv. pruni
strains CITA 33 and CFBP 5530, for which complete genome sequence had been
already obtained (Pothier et al., 2011b; Garita-Cambronero et al., 2014, 2016a). The
chemotactic compounds tested were: alanine (10 and 250 mM), arginine (10 and 100
mM), citric acid (10 mM), cysteine (10 mM), fructose (10 mM), galactose (10 mM),

12
galacturonic acid (10 mM), glucose (10 mM), glucuronic acid (10 mM), glycerol (0.2
and 2%), leucine (10 and 150 mM), maltose (10 mM), mannitol (0.2%), serine (10 and
200 mM), sodium citrate (10 mM), succinic acid (10 mM), sucrose (10 mM) and xylose
(10 mM).

The chemotactic effect of the carbon compounds was evaluated according to a

microtiter plate chemotaxis assay previously developed (Sena-Vélez, 2015). Briefly, 10
μL tips containing 5 μL of the carbon source tested were inserted into 48 of a 96 wells
plate previously inoculated with 200 μL of bacterial suspension in 10 mM MgCl2 (10 8
CFU/mL). The number of bacteria that moved into the tip during one hour was
estimated by means of serial dilutions of the tip content plated on 1.5% agar LB plates.
Significant differences (p < 0.05) between the means from each carbon source tested
and the negative control (10 mM MgCl2) were determined by an analysis of variance
(ANOVA) according to the Student-Newman-Keuls method. Statistical analyses were
performed using STATGRAPHICS Plus v.5.1 (Manugistics Inc. Rockville Maryland,
USA). A carbon source was considered as a chemoattractant when the average number
of bacteria contained in the tip (6 replicates in 2 independent assays) was significantly
higher to the blank control (10 mM MgCl2), and considered as a chemorepellent when
the average was significantly lower (p < 0.05).

Orthologous genes for the 26 methyl accepting chemotaxis proteins (MCPs) as well as
for 18 specific-chemotaxis che genes (Mhedbi-Hajri et al., 2011), described in X.
campestris pv. campestris, X. campestris pv. vesicatoria, X. citri subsp. citri and X.
oryzae, were searched in the genome sequences of nine X. arboricola strains as
mentioned above. Those CDS with more than 80% of identity and more than 80% of
sequence coverage containing MCPs periplasmic domains were considered as
orthologous genes.

3.5.6 Motility in solid and semisolid surfaces and surfactant activity

Swarming, swimming and twitching motility assays were conducted for strain CITA 44
as well as for 20 strains classified as X. arboricola pv. pruni by MLSA. Bacterial
cultures in exponential growth phase were centrifuged at 6,350 g for 15 min, then
washed and resuspended in 10 mM MgCl2 (OD600=1.0). To analyze swarming
motility, 0.5% agar PYM swarming plates (peptone 0.5%, yeast extract 0.3%, malt

13
extract 0.3%, glucose 1.0%) were inoculated with 10 μL of bacterial suspension. For
swimming motility assay, cultures resuspended in 10 mM MgCl2 were centrifuged at
6,350 g during 15 min and the pellets were inoculated using a sterile toothpick in the
center of semisolid 0.3% agar minimal medium A (MMA) plates (K2HPO4 0.7%,
KH2PO4 0.3%, MgSO4·7H2O 0.01%, (NH4)2SO4 0.1%, sodium citrate 0.005%,
glycerol 0.2%). For twitching assay, bacterial cultures were prepared as mentioned
above, and then inoculated with a sterile toothpick through a 5 mm PYM 1.5% agar
layer to the bottom of the plate. After 72 h, culture medium was removed and the
bottom of the plate was stained with 0.3% crystal violet for 15 min and washed using
sterile distilled water.

Surfactant production, which is closely related to bacterial motility on solid surfaces,

was also assessed according to the atomized oil assay (Burch et al., 2010). Briefly,
bacteria were inoculated using a sterile toothpick on 1.5% agar LB plates, and after 24
hpi, a fine mist of mineral oil droplets were sprayed on the colony. Bacterial strains that
instantaneously showed a bright halo around the colony were recorded as surfactant
producers.

Plates from swarming motility and surfactant activity assays were incubated at 27°C
during 24 h, whilst swimming and twitching plates were incubated for 72 h. Images
from all the plates were recorded. All assays were performed in three independent
experiments with three replicates each time.

Homologous CDS to the major structural components associated with flagellum

(Blocker et al., 2003; Chevance & Hughes, 2008; Mhedbi-Hajri et al., 2011) as well as
the fimbrial adhesin type IV pilus (Dunger et al., 2016) and a group of non-fimbrial
adhesins (Mhedbi-Hajri et al., 2011) were identified in the three genomes of X.
arboricola isolated from Prunus and in other six X. arboricola strains as described
above.

3.5.6 Pathogenicity tests on Prunus spp.

Bacteria were grown on 1.5% agar LB plates and incubated at 27ºC for 48 h, then a
single bacterial colony was resuspended in 30 mL of LB broth and incubated at 27ºC on
a rotary shaker for 24 h. After incubation, cultures were centrifuged at 6,350 g for 15

13
min and washed three times with 10 mM MgCl2. Finally, cultures were adjusted to 10 8
CFU/mL (OD600= 0.1) and used to inoculate detached leaves of different Prunus
species.

Young, fully expanded leaves from greenhouse-grown plants of almond (cv. Ferraduel),
apricot (cv. Canino), peach (cv. Calanda) and European plum (cv. Golden Japan) were
collected, brought to the laboratory and washed three times in sterile distilled water.
After surface sterilization with 70% ethanol and 0.05% sodium hypochlorite, the leaves
were rinsed three times with sterile distilled water and dried on a hood. Three leaves per
host were selected randomly for being inoculated with each strain in three independent
assays.

Surface sterilized leaves were placed on 0.5% water agar plates and the abaxial surfaces
were gently inoculated using a sterile cotton swab damped with the bacterial inoculum.
Sealed plates were incubated in a grow chamber adjusted at 27ºC, 80-90% relative
humidity and 12 h photoperiod. Inoculated leaves were digitally recorded at 28 dpi and
the percentage of symptomatic area per host and strain was quantified using the ImageJ
1.45s software. Samples, inoculated with sterile 10 mM MgCl2, were used as blank
control for comparison.

Additionally to the genomic analysis related to the early events in the bacteria-host
interaction described below, homologous CDS to several genes associated with later
stages of pathogenesis, like the type III secretory system (T3SS) and the type III
effectors (T3Es), were searched in the genome of the nine strains of X. arboricola
according to the percentage of the sequence length and identity with the amino acid
sequence of the genes previously associated with these features (Bonas et al., 1989;
Hajri et al., 2009; White et al., 2009; Büttner & Bonas, 2010; Bogdanove et al., 2011;
Potnis et al., 2011; Guo et al., 2011; Abby & Rocha, 2012). In the same manner,
orthologous CDS to other remarkable processes and features associated with virulence
such as the quorum sensing (He & Zhang, 2008), the xanthan biosynthesis (Vorhölter et
al., 2008), the type II secretion system (Filloux, 2004; Szczesny et al., 2010) as well as
the cellulolytic, hemicellulolytic, pectolytic and lipases enzymes, previously described
in other species of Xanthomonas (da Silva et al., 2002; Subramoni et al., 2010;
Vandroemme et al., 2013; Nascimento et al., 2016), were searched in the genome

13
sequences of the nine strains of X. arboricola. Only those CDS with a percentage of
coverage and identity over 80.0% were considered as orthologous sequences.

Finally, the presence of the plasmid pXap41 (Pothier et al., 2011c), putatively involved
in virulence in X. arboricola pv. pruni, was searched in the analyzed genomes based in
the nucleotide sequence similarity and graphically represented using the BLAST Ring
Image Generator (BRIG) tool (Alikhan et al., 2011); blastn was used for the sequence
comparative analysis with an expected value threshold of 0.001. All the CDS associated
with pathogenesis, mentioned above, were represented in a circular genome map using
CGView (Grant & Stothard, 2008). For this purpose, contigs of the draft genome
sequence of CITA 33, CITA 44 and IVIA 2626.1 were arranged by Mauve (Darling et
al., 2004) using the circularized genome sequence of X. arboricola pv. juglandis strain
Xaj 417 as the reference (Pereira et al., 2015).

3.6 Acknowledgments

We would like to thank to Elisa Ferragud and Isabel M. Berruete for technical
assistance on the phenotypic features evaluated as well as to Pilar Sabuquillo for
assistance on searching orthologous genes.

3.7 Author contributions

Conceptualization: JGC, JC, AP, MML. Methodology: JGC, JC. Software: JGC.
Validation: JGC, JC, AP. Formal analysis: JGC, JC. Investigation: JC, JGC Resources:
JC, AP, ML. Data curation: JGC. Writing (original draft preparation): JGC, JC. Writing
(review and editing): JGC, JC, AP, MML. Visualization: JGC. Supervision: JC, AP,
MML. Project administration: JC, APB. Funding acquisition: JC, AP, MML.

13
 Capítulo 4: El análisis pan genómico ha permitido diferenciar
cepas no patógenas y patógenas de Xanthomonas arboricola que
cohabitan en Prunus spp. así como elucidar los factores de la
virulencia bacteriana.

Pan-genomic analysis permitted to differentiate non-pathogenic and pathogenic

strains of Xanthomonas arboricola that cohabit Prunus spp. and elucidate bacterial
virulence factors.

J. Garita-Cambronero1, A. Palacio-Bielsa2, M. M. López3, J. Cubero1.

1
Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA), Madrid, Spain. 2Centro
de Investigación y Tecnología Agroalimentaria de Aragón, Zaragoza, Spain. 3Instituto Valenciano de
Investigaciones Agrarias, Valencia, Spain.

Enviado a Frontiers in Microbiology.

4.1 Abstract

X. arboricola is a plant-associated bacterial species which comprises nine pathovars that

cause disease on several economically important plant hosts. One of the most virulent
pathovars within this genus is X. arboricola pv. pruni (Xap), the causal agent of
bacterial spot disease of stone fruits and almond. Recently, a non-pathogenic Xap-look-
alike strain isolated from Prunus was characterized and its genome compared to
pathogenic strains of Xap. This study revealed differences in the profile of virulence
factors between pathogenic and non-pathogenic strains. For instance, the non-
pathogenic strain did not contain genes related to the type III secretion system (T3SS),
type III effectors (T3Es) nor the putative virulence-related plasmid pXap41. The
existence of this atypical strain arouses several questions associated with the abundance,
the pathogenicity and the evolutionary context of X. arboricola on Prunus hosts. After
an initial characterization of a collection of xanthomonads strains isolated from Prunus
bacterial spot outbreaks in Spain during the past decade, six Xap-look-alike strains, that
did not clustered with the pathogenic strains of Xap according to a multi locus sequence
analysis, were identified. Pathogenicity of these strains were analysed and based in this
character, the genome sequence of two Xap-look-alike strains, CITA 14 and CITA 124,
selected by their non-pathogenicity characteristic, were obtained and compared to those
available genomes of the Prunus-associated strains of X. arboricola. Differences were
found among the pathogenic and non-pathogenic strains in several characters related to
the pathogenesis process. Additionally, a pan-genomic analysis that included the
available genomes of X. arboricola, revealed that the atypical strains associated with
Prunus were related to a group of non-pathogenic or low pathogenic strains isolated
from a wide host range. The repertoire of the genes related to T3SS and T3Es varied
among the strains of this cluster and those strains related to the most pathogenic
pathovars of the species, corylina, juglandis and pruni. This variability provides
information about the potential evolutionary process associated to the acquisition of
pathogenicity and host specificity in X. arboricola. Finally, based in the genomic
differences observed between pathogenic and non-pathogenic strains, a sensitive and
specific real-time PCR protocol to identify and detect Xap strains was designed; this
method avoids miss-identifications due to atypical strains of X. arboricola that can
cohabit Prunus.

Keywords: Stone fruits, Almond, Comparative genomics, Bacterial spot disease.

13
4.2 Introducción

Xanthomonas arboricola is a species of plant pathogenic bacteria associated with a

wide range of hosts plants (Vauterin et al., 1995). Due to their distinctive pathogenicity
towards a delimited host range as well as to other genomic determinants, this species
has been divided at infrasubspecific level in at least nine different pathovars (Vauterin
et al., 1995; Fischer-Le Saux et al., 2015). Among these bacterial groups, the pathovars
corylina, juglandis and pruni, which cause disease on nut stone fruit trees and almond,
are considered the most relevant (Lamichhane & Varvaro, 2014). Several outbreaks of
the pathovar pruni, which is regulated by quarantine policies in the European Union and
the possibility of future epidemics and spread to disease-free producing zones, have
potentiated the efforts to understand the molecular diversity of the species (EFSA,
2014).

Very recent studies conducted by multilocus sequence typing and genome-wide based
techniques, have provided a significant increase in the knowledge associated with the
genetic structure and diversity of the strains of X. arboricola. As occurred in other
Xanthomonas species (White et al., 2009; Hajri et al., 2012; Jacobs et al., 2015), most
significant genomic differences associated with virulence in X. arboricola strains are
related to type three secretion system (T3SS) and type three effectors (T3Es) predicted
by the available genomes (Ibarra Caballero et al., 2013; Garita-Cambronero et al., 2014,
2016a; Essakhi et al., 2015; Higuera et al., 2015; Ignatov et al., 2015; Pereira et al.,
2015; Cesbron et al., 2015; Harrison et al., 2016).

Besides this, phylogenetic analysis based in the core genome sequence of X. arboricola
(Cesbron et al., 2015; Garita-Cambronero et al., 2016b), revealed that three non-
pathogenic strains did not group together with pathogenic strains isolated from walnut
stone fruit or almond. Instead, these non-pathogenic strains, isolated from walnut and
mahaleb cherry (Prunus mahaleb), were comprised in a group with several other low
pathogenic strains, such as the low pathogenic strains of the pathovar celebensis, a
pathogen of banana (Musa spp.) (Harrison et al., 2016), or with the strain 3004 of X.
arboricola isolated from barley (Ignatov et al., 2015).

The existence of non-pathogenic strains has aroused the concern on how abundant are
these strains and the possibility of their misidentification as pathogenic strains by the

13
current diagnostic approaches. Moreover, they could be useful to obtain some clues
related to the evolution of pathogenesis within X. arboricola. Recalling all these recent
advances, our goal was to deepen the characterization of the genomic features of three
atypical strains isolated from Prunus spp., in order to determine how these key features
associated with pathogenesis varied among atypical and pathogenic strains of X.
arboricola, as well as to determine if these variants could be used to design precise
molecular tools to differentiate these two groups when they are cohabiting the same
host.

4.3 Materials and Methods

4.3.1 Bacterial strains and classification using multilocus sequence analysis

A selection of 31 previously characterized strains of X. arboricola (Garita-Cambronero

et al., 2016b) from the pathovars corylina, juglandis, populi and pruni were utilized.
Besides, 40 strains phenotypically similar to Xanthomonas, collected during the Spanish
outbreaks of bacterial spot disease of stone fruits as well as from routine screenings
performed on Spanish nurseries (Table 1), were screened for identification as
Xanthomonas arboricola pv. pruni (Xap). All the bacterial strains listed in Table 1 are
available in the bacterial collections from the Instituto Valenciano de Investigaciones
Agrarias (IVIA, Valencia, Spain) and the Centro de Investigación y Tecnología
Agroalimentaria de Aragón (CITA, Aragón, Spain).

Bacterial strains were routinely cultured on Luria Bertani (LB) 1.5 % agar plates or in
LB broth at 27 °C for 48 h. The commensal bacterial strains, isolated from Prunus and
used in this study (Table 1), were identified to genus level based on the partial sequence
of the 16S rDNA gene according to a method described previously (Lagacé et al.,
2004).

For Xap classification, the real-time PCR for an ABC transporter developed by Palacio-
Bielsa and collaborators (Palacio-Bielsa et al., 2011, 2015b) was used. Due to the fact,
demonstrated in previous studies, that the presence of the plasmid pXap41 (Pothier et
al., 2011c) differentiated between Xap and the atypical strain CITA 44 of X. arboricola

13
isolated from Prunus (Garita-Cambronero et al., 2016b), the presence of this plasmid
was also tested by using a previously reported multiplex PCR protocol based on the
plasmid-related genes repA1, repA2 and mobC (Pothier et al., 2011c). Those strains that
showed a positive result in the real-time assay (Palacio-Bielsa et al., 2011) but did not
show amplification for the three genes associated with pXap41 (Pothier et al., 2011c),
were considered as Xap-look-a-like strains, and were further identified according to a
multilocus sequence typing scheme (MLSA) based in the partial sequences of the
housekeeping genes dnaK, fyuA, gyrB and rpoD (Young et al., 2008), which was used
to characterize and discriminate the members of the pathovar pruni from the atypical or
commensal strain CITA 44 of X. arboricola (Garita-Cambronero et al., 2016b).

Additionally, sequences of these housekeeping genes from the non-pathogenic X.

arboricola strain CITA 44 and sequences from X. arboricola pathovars corylina
(CFBP1159=ICMP 5726 and CFBP 1846), celebensis (CFBP3523=ICMP 1488),
juglandis (CFBP2528=ICMP 35 and IVIA 2113), populi (CFBP 3123) and pruni
(CFBP 2535=ICMP 51, CFBP 5530, Xap 33=CITA 33 and IVIA 2626.1), as well as X.
citri subsp. citri strain CFBP 2525=ICMP 24 included as outgroup, were obtained from
the National Center for Biotechnology Information database (NCBI)
([Link]

Purified PCR products were sequenced at STAB VIDA (Lisbon, Portugal), and edited
using Geneious (Kearse et al. 2012). Obtained nucleotide sequences were aligned with
ClustalW version 1.83 (Hall, 2011) using default parameters. Both ends of each
alignment were trimmed to the following sizes: dnaK, 842 positions; fyuA, 601
positions; gyrB, 631 positions and rpoD, 759 positions. Then, they were aligned and
concatenated to give a total length of 2,836 nucleotide positions. For the analysis of the
concatenated gene dataset, Tamura-Nei (TN93) model was selected and maximum
likelihood trees, using 1,000 bootstrap re-samplings, were generated using MEGA 6.0
software (Tamura et al., 2013)

Nucleotide sequences were deposited in GenBank. Accession numbers for the partial
sequences of the genes used in this study are: KX357115 to KX357120 for dnaK;
KX357133 to 357138 for fyuA; KX357127 to KX357132 for gyrB and KX357121 to
KX357126 for rpoD.

14
Table 1. Bacterial strains used in this study.

Taxa Strain Origin Host ftsx xopE3 pXap41

Xanthomonas arboricola
Prunus laurocerasus
X. arboricola pv. pruni* 100.343 Zuidwolde (Netherlands) cv. Caucasica + + +
Prunus laurocerasus
X. arboricola pv. pruni* 100.400 Zuidwolde (Netherlands) cv. Grüner Teppich + + +
Prunus laurocerasus
X. arboricola pv. pruni* 100.439 Elburg (Netherlands) + + +
cv. Zabeliana
CFBP
X. arboricola pv. pruni* New Zealand Prunus salicina + + +
3894PT
X. arboricola pv. pruni* CFBP 5530 Italy Prunus persica + + +
X. arboricola pv. pruni* CFBP 5724 United States Prunus amygdalus + + +
Prunus persica cv.
X. arboricola pv. pruni* CITA 4 Aragón (Spain) Catherine + + +
Prunus persica cv.
X. arboricola pv. pruni* CITA 9 Zaragoza (Spain) + + +
Merrill O`Henry
Prunus persica cv.
X. arboricola pv. pruni* CITA 11 Huesca (Spain) Richard Lady + + +
Prunus amygdalus
X. arboricola pv. pruni* CITA 33 Huesca (Spain) + + +
cv. Guara
Prunus persica cv.
X. arboricola pv. pruni* CITA 46 Navarra (Spain) Summer Lady + + +
Prunus persica x
X. arboricola pv. pruni* CITA 70 Zaragoza (Spain) + + +
Prunus amygdalus
X. arboricola pv. pruni CITA 154 Zaragoza (Spain) Prunus amygdalus + + +
Prunus salicina cv.
X. arboricola pv. pruni* IVIA 2626.1 Badajoz (Spain) Fortuna + + +
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2626.3 Badajoz (Spain) Fortuna + + +
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2626.6 Badajoz (Spain) Fortuna + + +
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2626.7 Badajoz (Spain) Fortuna + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2647.1.3 Badajoz (Spain) Larry Ann + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni* 2647.1-2 Badajoz (Spain) Larry Ann + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2647.1-13 Badajoz (Spain) Larry Ann + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2647.3-2 Badajoz (Spain) Friar + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni* Badajoz (Spain) + + +
2647.3-1 Friar
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2649.10 Badajoz (Spain) Friar + + +
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2649.3 Badajoz (Spain) + + +
Friar
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2649.7 Badajoz (Spain) + + +
Friar
X. arboricola pv. pruni IVIA 2758.2 Badajoz (Spain) Prunus salicina + + +
X. arboricola pv. pruni IVIA 2758.3 Badajoz (Spain) Prunus salicina + + +
Prunus salicina cv.
X. arboricola pv. pruni* IVIA 2826.1 Valencia (Spain) Anna Gold + + +
IVIA Prunus persica cv.
X. arboricola pv. pruni Valencia (Spain) + + +
2826.10 Zephir

14
 (Table1 continuation)

Taxa Strain Origin Host ftsx xopE3 pXap41

IVIA Prunus persica cv.
X. arboricola pv. pruni Valencia (Spain) + + +
2826.11 Zephir
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2826.3 Valencia (Spain) Anna Gold + + +
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2826.4 Valencia (Spain) + + +
Anna Gold
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2826.5 Valencia (Spain) Anna Gold + + +
Prunus salicina cv.
X. arboricola pv. pruni IVIA 2826.6 Valencia (Spain) + + +
Anna Gold
Prunus persica cv.
X. arboricola pv. pruni IVIA 2826.9 Valencia (Spain) Zephir + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni* 2832.10 Valencia (Spain) Angeleno + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2832.17 Valencia (Spain) Larry Ann + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2832.19 Valencia (Spain) Larry Ann + + +
IVIA Prunus persica cv.
X. arboricola pv. pruni 2832.21 Valencia (Spain) Zephir + + +
IVIA Prunus salicina cv.
X. arboricola pv. pruni 2832.24 Valencia (Spain) Anna Gold + + +
IVIA Prunus persica cv.
X. arboricola pv. pruni 2832.26 Valencia (Spain) 58CC70 + + +
IVIA Prunus persica x P.
X. arboricola pv. pruni 2832.30 Valencia (Spain) davidiana + + +
Prunus persica x P.
X. arboricola pv. pruni IVIA 2832.5 Valencia (Spain) davidiana + + +
Prunus amygdalus
X. arboricola pv. pruni* IVIA 3161.2 Alicante (Spain) + + +
cv. Rumbeta
Prunus amygdalus
X. arboricola pv. pruni* IVIA 3162 Alicante (Spain) cv. Rumbeta + + +
IVIA Prunus amygdalus
X. arboricola pv. pruni Alicante (Spain) + + +
3177.1-6 cv. Rumbeta
IVIA Prunus amygdalus
X. arboricola pv. pruni 3177.3-4 Alicante (Spain) cv. Rumbeta + + +
IVIA Prunus amygdalus
X. arboricola pv. pruni Alicante (Spain) + + +
3177.3-8 cv. Rumbeta
IVIA Prunus amygdalus
X. arboricola pv. pruni 3181.3-1 Alicante (Spain) cv. Rumbeta + + +
IVIA Prunus amygdalus
X. arboricola pv. pruni Alicante (Spain) + + +
3181.3-3 cv. Rumbeta
X. arboricola pv. pruni* IVIA 3487.1 Huesca (Spain) Prunus armeniaca + + +
Prunus amygdalus
X. arboricola pv. pruni IVIA 4490.1 Teruel (Spain) cv. Rumbeta + + +
Prunus amygdalus
X. arboricola pv. pruni IVIA 4491.1 Huesca (Spain) cv. Rumbeta + + +
Prunus amygdalus
X. arboricola pv. pruni IVIA 4493 Huesca (Spain) cv. Rumbeta + + +
Prunus persica cv.
X. arboricola-look-a-like CITA 14 Zaragoza (Spain) Luciana + - -
Prunus mahaleb
X. arboricola-look-a-like CITA 42 Zaragoza (Spain) rootstock (Santa + - -
Lucía SL-64)
Prunus
X. arboricola-look-a-like* CITA 44 Zaragoza (Spain) mahaleb + - -
rootstock (Santa
Lucía SL-64)
X. arboricola-look-a-like CITA 49 Zaragoza (Spain) Prunus sp. + - -
X. arboricola-look-a-like CITA 51 Zaragoza (Spain) Prunus amygdalus + - -
X. arboricola-look-a-like CITA 124 Badajoz (Spain) Prunus persica + - -

14
 (Table1 continuation)

Taxa Straina Origin Host ftsx xopE3 pXap41

X. arboricola-look-a-like CITA 149 Guipúzcoa (Spain) Prunus laurocerasus + - -
X. arboricola pv. corylina* CFBP 1846 France Corylus avellana + - -
X. arboricola pv. corylina* IVIA 3978 Spain Corylus avellana + - -
X. arboricola pv. corylina* RIPF-X08 Poland Corylus avellana - - -
CFBP
X. arboricola pv. fragariae* Italy Fragaria x ananassa - - -
6771PT
X. arboricola pv. juglandis* IVIA 2113 Badajoz (Spain) Juglans regia - - -
X. arboricola pv. juglandis* Xaj-2 Zaragoza (Spain) Juglans regia - - -
Zaragoza (Spain)
X. arboricola pv. juglandis* Xaj-3 Juglans regia - - -
Zaragoza (Spain)
X. arboricola pv. juglandis* Xaj-4 Juglans regia - - -

X. arboricola pv. juglandis* Xaj-5 Zaragoza (Spain) Juglans regia - - -

Populus x
CFBP
X. arboricola pv. populi* Netherlands euroamericana cv. - - -
3123PT
Robusta
Other pathogenic species
Xanthomonas spp.
X. axonopodis Xp-2 Navarra (Spain) Pelargonium sp. - + -
X. fuscans subsp. fuscans NCPPB 381 Canada Phaseolus vulgaris - + -
IVIA
X. fuscans subsp. fuscans La Rioja (Spain) Phaseolus vulgaris - + -
151835DA
X. campestris Xca-1 Teruel (Spain) Brasssica oleraceae - - -
X. campestris Xca-2 Tarragona (Spain) Brasssica oleraceae - - -
X. campestris IVIA 2734.1 Spain Brassica mathis - + -
X. citri subsp. citri 306 Brazil Citrus sinensis + + -
X. citri subsp. citri IVIA 2889-1 Argentina Citrus sinensis - + -
X. citri subsp. citri IVIA 3026-1 Spain Citrus sinensis - + -
X. hortorum IVIA 1575.1 Spain Pelargonium peltatus - - -
X. vesicatoria IVIA 3619-1 Spain Capsicum annum - + -
Agrobacterium
Agrob-1
A. tumefasciens B1- 360-1 NA NA - - NA
(biovar 1)
A. tumefasciens Agrob-9 Zaragoza (Spain) Prunus persica - - NA
IVIA 1245- Prunus persica cv.
Agrobacterium sp. 80 Spain Adafuel - - NA
IVIA 2304- Prunus persica cv.
Agrobacterium sp. Spain - - NA
10 Red Candel
Pantoea
Olea europea cv.
Pantoea sp. IVIA 2261-1 Spain - - NA
Picual
Pseudomonas
Citrus sinensis cv.
P. syringae pv. syringae IVIA 3514-2 Spain - - NA
Valencia Late
P. syringae pv. syringae Psy-3 Zaragoza (Spain) Prunus avium - - NA
P. syringae pv. syringae Psy-13 Zaragoza (Spain) Prunus amygdalus - - NA

14
 (Table1 continuation)

Taxa Straina Origin Host ftsx xopE3 pXap41

Commensal strains on Prunus spp.

Puigmoreno (Teruel, Prunus amygdalus
Curtobacterium sp. EP-2.2 - - NA
Spain) cv. Guara
Puigmoreno (Teruel, Prunus amygdalus
Curtobacterium sp. EP-18.1 - - NA
Spain) cv. Guara
Puigmoreno (Teruel, Prunus amygdalus
Microbacterium sp. EP-16.1 - - NA
Spain) cv. Guara
Puigmoreno (Teruel, Prunus amygdalus
Pantoea sp. EP-14.1 - - NA
Spain) cv. Guara
Puigmoreno (Teruel, Prunus amygdalus
Pseudomonas sp. EP-17.1 - - NA
Spain) cv. Guara
Prunus persica cv.
Pseudomonas sp. 21/14-12.B8 Caspe (Zaragoza, Spain) - - NA
Guayox 30
Puigmoreno (Teruel, Prunus amygdalus
Sphingomonas sp. EP-16.2 - - NA
Spain) cv. Guara
Puigmoreno (Teruel, Prunus amygdalus
Terrabacter sp. EP-16.6 - - NA
Spain) cv. Guara

PT:Pathotype strain; NA: not available information, +: Positive PCR resul; -: Negative PCR result.

a
CFBP, Collection Française de Bactéries Phytopathogénes, Angers, France; IVIA, Instituto Valenciano de Investigaciones
Agrarias, Valencia, Spain; CITA, Centro de Investigación y Tecnología Agroalimentaria de Aragón, Zaragoza, Spain; ICMP,
International Collection of Microorganisms from Plants, Auckland, New Zealand.

*Strains characterized previously as Xanthomonas arboricola and used in this study as control during the molecular
characterization.

4.3.2 Study of the type III secretion system and type III effectors gene repertory

Six strains isolated from Prunus spp. and classified as Xap-look-a-like, as well as the
pathogenic Xap strains CITA 33 and CFBP 5530, and the Prunus-non-pathogenic strain
CITA 44, were typed by PCR for 11 genes related to structural and regulatory
components of the type III secretory system and for 21 genes coding for the type III
effectors predicted in Xap (Hajri et al., 2012; Garita-Cambronero et al., 2016b). PCR
reactions were performed according to the conditions proposed previously (Hajri et al.,
2012) with the exception of the T3SS genes, hrpD5 and hrpF, and the T3Es genes
hpaA, xopAQ and xopZ, for which new sets of primers were designed based in
orthologues available in databases for X. arboricola using Primer-BLAST designing
tool (Table 2). PCR amplifications with the primers for hrpD5, hrpF, hpaA, xopAQ and
xopZ were performed in 20 μl of PCR reaction containing 1X PCR buffer (10 mM Tris-
HCl, 50 mM KCl, 0.1% Triton X-100 [pH 9.0]); 0.5 μM of each primer; 0.25 U Taq

14
DNA polymerase (Biotools, Madrid, Spain); 0.2 mM each dNTP (Biotools Madrid,
Spain); 1.5 mM MgCl2 and 1.0 μg/μl of DNA template. PCR conditions consisted in an
initial denaturation step of 94 ºC for 2 min, 30 cycles of denaturation at 94 ºC for 1 min,
annealing at 60 ºC for 1 min, extension at 72 ºC for 2 min and a final extension step at
72 ºC for 10 min.

Table 2. PCR primers used to amplify a partial region of some genes associated with type III secretion
system (T3SS) and type III effector (T3E) genes in X. arboricola.

T3SS/T3E gene Forward primer Reverse primer Fragment size (pb)

hpaA ATGATCCGGCGCATTTCG GCGATGCTGACCCGGC 269
hrpD5 ATCGAGGTGGATGCAGATGG CGGCAGGGAAGTCAGGTG 795
hrpF* TCTACCTCTGACGGATGACG GTCGCCCTGCGAGCC 516
hrpF¥ TCTACCTCTGACGGATGACG GGTCGGCAAAGTCGTAGAGG 947
xopAQ ATCGGGAGACACAGGGTGTA CTTCTGAGGTAGCGGAC 146
xopZ CATTCGTCGCGGATCAACAC GAAAGCCGGGAAGGATGTCT 196

*Primers used to amplify the ortholog of hrpF in pathogenic strains of X. arboricola pathovars corylina, juglandis and pruni.

¥
Primers used to amplify the ortholog of hrpF in X. arboricola pv. celebensis and non-pathogenic strains of X. arboricola.

4.3.3 Pathogenicity tests

Pathogenicity tests on Hordeum vulgare, Nicotiana benthamiana, N. tabacum, P.

persica (rootstock GF-305) and tomato (Solanum lycopersicum) were carried out for the
six Xap-look-a-like strains as well as for the pathogenic strain of Xap CITA 33 and the
non-pathogenic strain of X. arboricola CITA 44. Bacterial suspensions were prepared
by inoculating a single bacterial colony on 30 ml of LB broth culture medium and
maintained during 12-14 h at 26 ºC on a rotatory shaker at 200 rpm. Subsequently,
cultures were centrifuged at 6,350 g for 15 min and the pellet resuspended in sterile
phosphate buffered saline (PBS pH= 7.5) to a final concentration of 1x106 colony
forming units (CFU)/ml. Bacterial suspensions were infiltrated in three leaves per plant
using a syringe without needle and sterile PBS was used as blank control. All the
infiltrated plants were kept in a grown chamber with high humidity, 16 h of light and 8
h of darkness at 26 ºC and 22 ºC, respectively. Infiltration results were addressed and
graphically recorded at zero, seven, 14 and 21 days post inoculation (dpi). After 21 dpi,
the infiltrated leaves were macerated on sterile distilled water and tenfold dilutions of
the macerated were plated on YPGA (0.5% yeast extract, 0.5% bactopeptone, 1.0%

14
glucose, 2.0% agar) plates, supplemented with 250 mg/l of cycloheximide. Colonies
showing a Xanthomonas-like phenotype (mucoid, yellow colonies with a convex
elevation and an entire margin) were selected and confirmed as Xap-look-a-like using a
real time PCR protocol indicated above (Palacio-Bielsa et al., 2011). Additionally, for
P. persica rootstock GF-305, colonies were counted in order to determine the bacterial
concentration in the inoculated tissue at the end of the assay (Ah-You et al., 2007).

4.3.4 Genome sequencing and comparison

From the six Xap-look-a-like strains analyzed previously, one representative of each
cluster, according to the MLSA analysis (Table 1; Figure 1), was selected for genome
sequencing. Genome sequencing conditions and features for the genome sequence of
CITA 44 have been discussed in a previous paper (Garita-Cambronero et al., 2016b). In
addition, in this study the genome features of the Xap-look-a-like strains CITA 14 and
CITA 124 are described. For these two strains, the genome sequencing and assembly
conditions have been previously announced and deposited at DDBJ, EMBL, GenBank
databases under the accession numbers LXIB00000000 for CITA 14 and
LXKK00000000 for CITA 124 (Garita-Cambronero et al., 2016c).

The assembled draft genome sequence of strains CITA 14 and CITA 124 were
automatically annotated using the NCBI`s prokaryotic annotation pipeline (Tatusova et
al., 2013). Signal peptides and transmembrane domains were predicted using the
signalP 4.1 (Petersen et al., 2011) and the TMHMM 2.0 (Krogh et al., 2001) servers,
respectively. The assignment of genes to each cluster orthologous group (COG) and its
Pfam domain was performed with the NCBI´s conserved domain database using an
expected value threshold of 0.001 (Marchler-Bauer et al., 2014). The circular genome
maps of the draft genome sequences of X. arboricola strains CITA 14 and CITA 124
representing the COG categories of the genes, were constructed using CGView
(Stothard & Wishart, 2005).The contigs of both strains were arranged by Mauve
(Darling et al., 2004, 2010) using the complete genome sequence of X. arboricola pv.
juglandis Xaj417 as the reference.

The genome sequence variation among CITA 14, CITA 124 and the publicly available
genomes of X. arboricola (strains 3004, CFBP 7634, CFBP 7651 and CITA 44)
(Ignatov et al., 2015; Cesbron et al., 2015; Garita-Cambronero et al., 2016a), X.

14
arboricola pv. celebensis (NCPPB 1630 and NCPPB 1832) (Harrison et al., 2016), X.
arboricola pv. corylina (NCCB 100457) (Ibarra Caballero et al., 2013), X. arboricola
pv. juglandis (CFBP 2528, CFBP 7179, Xaj2 and Xaj417) (Higuera et al., 2015; Pereira
et al., 2015; Cesbron et al., 2015) and X. arboricola pv. pruni (CITA 33, IVIA 2626.1,
MAFF 301420 and MAFF 301427) (Garita-Cambronero et al., 2014, 2016a), were
determined by using a sequence-based approach and a sequence content approach
(Snipen & Ussery, 2010).

The sequence-based approach, which consists in the comparison among genome

sequences based on sequence alignment and evolutionary analysis based in the shared
protein coding sequences (CDS) were determined using Roary (Page et al., 2015).
Contigs of the 17 genome sequences of X. arboricola were ordered by Mauve as
mentioned above. Afterwards, all the genome sequences were automatically annotated
using PROKKA (Seemann, 2014) and used as the input for the search of shared
homologous genes among the studied strains.

The concatenated sequences of the genes that composed the core genome sequence of
the 17 analyzed strains were aligned using the PRANK alignment algorithm (Löytynoja
& Goldman, 2008) and subsequently, a maximum likelihood tree using 1,000 bootstrap
resamplings, was constructed to determine the phylogenetic position of the strains CITA
14 and CITA 124 within X. arboricola. Maximum likelihood tree was performed with
RaxML (Stamatakis, 2014) and the dendrogram obtained was visualized using
Dendroscope (Huson et al., 2007).

Additionally, the gene-content comparison, which is based in determining the distance

among the 17 genomes using the presence/absence of the genes contained in the
pangenome of X. arboricola, were performed using the R implemented package for
microbial-pangenomics micropan (Snipen & Liland, 2015). The CDS were obtained
from nucleotide genome sequences of the 17 strains mentioned above available in the
NCBI database using Prodigal v2.6.1 (Hyatt et al., 2010). To determine the similarity of
the proteins within and across the genomes, a reciprocal all-against-all BLAST search
was performed using the blastAll package. BLAST distance between sequences was
obtained using the bDist package. A hierarchical clustering was performed using bClust,
and a complete linkage function was selected with a liberal threshold of 0.80. A
similarity matrix, with the number of protein sequences contained in each cluster for

14
each genome, was constructed using the panMatrix function and Jaccard distance was
calculated. The matrix was used to perform a principal component analysis for showing
how the genomes are distributed in the space according to the two first principal
components which revealed the dominant differences between them, and this was
computed using the panpca and plotScores functions. Additionally, the similarity of the
analyzed genomes was represented in a pan-genome tree computed according to the
method described previously by (Snipen & Ussery, 2010), using the panTree function.
Tree construction was based in the distance between genomes according to the
Manhattan distance. Bootstrap values were calculated by re-sampling the columns of the
similarity matrix and the re-clustering of these data, therefore, the bootstrap value
represented was the percentage of the re-sampled trees that showed a similar node.

Additionally, the profile of gene clusters (potential groups of orthologous genes)

associated with tonB-dependent transporters (TBDTs), the sensors of the two-
component regulatory system (STCRs), the methyl accepting chemotaxis proteins
(MCPs), the components of the flagella, the type IV pilus, the non-fimbrilar adhesins,
the components associated to the production of xanthan, the quorum-sensing regulation,
the repertoire of cell-wall degrading enzymes, the components of the type II, III and IV
secretion systems, as well as the type three effectors, previously reported in
Xanthomonas spp. (da Silva et al., 2002; Filloux, 2004; Vorhölter et al., 2008; Wang et
al., 2008; Chevance & Hughes, 2008; He & Zhang, 2008; White et al., 2009;
Subramoni et al., 2010; Szczesny et al., 2010; Mhedbi-Hajri et al., 2011; Potnis et al.,
2011; Ryan et al., 2011; Guo et al., 2011; Hajri et al., 2012; Vandroemme et al., 2013;
Li et al., 2014; Guglielmini et al., 2014; Cesbron et al., 2015; Dunger et al., 2016;
Nascimento et al., 2016) were determined for strains CITA 14 and CITA 124.

The presence of the putatively virulence-associated plasmid pXap41 (Pothier et al.,

2011c) was also evaluated in the analyzed genomes based in the nucleotide sequence
similarity, and graphically represented using the BLAST Ring Image Generator (BRIG)
tool (Alikhan et al., 2011) and blastn was used for the sequence comparative analysis
with an expected value threshold of 0.001.

14
4.3.5 A molecular tool to differentiate X. arboricola pv. pruni from atypical strains
of X. arboricola associated with Prunus spp.

In order to discriminate Xap from other pathovars, a partial sequence of the xopE3 gene
that is enclosed in pXap41 plasmid, described as specific for Xap (Pothier et al., 2011c),
was used. Sequences of the xopE3 gene available in GenBank database from strains
CITA 33 (GenBank locus tag DK27_00095), IVIA 2626.1 (AN652_04270), MAFF
301420 (XPR_2580), MAFF 301427 (XPN_1257) and CFBP 5530
(XAP_pXAP410005) were aligned with ClustalW and the consensus sequence,
generated using Bioedit v. 7.2.5, was used as template for xopE3 primers and probe
design using the ABI PRISM Primer Express software v. 2 (Applied Biosystems, Foster
City, CA). Specificity of the primers was firstly evaluated in silico using the Primer-
BLAST tool available at NCBI. Graphical representation of the probe and the primers
hybridization was performed in a set of X. arboricola genome sequences using the
BRIG software as previously mentioned.

Real-time PCRs were conducted using the same conditions described previously for
reactions using primers for ABC transporter (Palacio-Bielsa et al., 2011). Briefly,
reactions were conducted in a total volume of 25 µl containing, 12.5 µl of GoTaq probe
qPCR MasterMix (Promega), 0.4 µM of each primer and 150 nM of TaqMan probe and
5 µl of sample. Real-time PCR amplifications were conducted in an ABI 7500 Fast
thermocycler (Applied Biosystems, Foster city, CA) and consisted of an initial
denaturation step of 95 ºC for 5 min followed by 45 cycles, each one of 1 min at 95 ºC
and 1 min at 59 ºC.

4.3.6 Specificity of the real-time PCR test

Specificity of the real-time PCR test was assessed in 99 bacterial strains, which
comprised 54 strains of Xap, seven strains of Xap-look-a-like, ten strains from other
pathovars of X. arboricola, 11 strains from other species of Xanthomonas, eight strains
from other phytopathogenic bacteria and nine strains from the natural microbiota of
Prunus spp. (Table 1). Bacterial suspensions of 108 CFU/ml were treated at 95 ºC
during 10 min and used for real-time PCR reactions and sterile distilled water was used

14
as negative control. Additionally, a real-time PCR protocol previously described
(Palacio-Bielsa et al., 2011) was also applied on all the 99 bacterial strains tested for
xopE3 gene.

4.3.7 Sensitivity of the real-time PCR test

Serial dilutions from 108 to 10 CFU/ml of a 48 h LB broth culture, of strain CITA 33

were prepared on sterile distilled water and heat-treated (95 ºC for 10 min) for real-time
PCR reactions. Additionally, a serial dilution of pure bacterial DNA, extracted using the
QIamp DNA miniKit (Qiagen) as mentioned above, ranging from 10 8 pg/µl to 0.001
pg/µl was also prepared on sterile distilled water. For amplification, 5 µl of each
dilution was used as template, according to the protocol described previously. Seven
replicates of each sample were evaluated in each experiment and the experiment was
repeated in three independent assays. Appropriate negative controls containing no
bacteria or no DNA were subjected to the same procedure. The limit of detection of the
test was defined as the lowest target amount giving positive results in at least 15 of the
21 total reactions tested in the three independent assays (Caraguel et al., 2011).
Analysis of variance was used to test for differences in the threshold cycles (C Ts) at each
bacterial concentration in the three independent assays. Statistical analyses were
performed by using Statgraphics Plus v.5.1 software. The amplification efficiency of the
protocol for each kind of sample was calculated as described previously (Palacio-Bielsa
et al., 2011, 2015b). Linear regression curves representing the C Ts of each reaction were
plotted against the logarithmic values of bacterial or DNA concentration. The slope of
the curves (k) was used to determine the amplification efficiency (E) according to the
equation E = 10[_-1/k], where E= 2 corresponded to 100% efficiency.

15
4.4 Results

4.4.1 Characterization of atypical strains of X. arboricola associated with Prunus

spp.

A total of 40 strains isolated from Prunus spp. and phenotypically similar to

Xanthomonas arboricola were initially identified as Xap by using a real time PCR
protocol (Palacio-Bielsa et al., 2015b). Additionally, the plasmid pXap41, which is
considered a unique feature of Xap, was not detected by PCR amplification of the genes
repA1, repA2 and mobC (Pothier et al., 2011c), from strains CITA 14, CITA 42, CITA
49, CITA 51, CITA 124 and CITA 149 and, therefore, they were not considered as Xap
but Xap-look-a-like strains.

In order to further characterization, six Xap-look-a-like strains mentioned above and the
reference non-pathogenic strain CITA 44 (Garita-Cambronero et al., 2016a), were
analyzed using a MLSA scheme based in partial sequences of the genes dnaK, fyuA,
gyrB and rpoD (Young et al., 2008). The Maximum likelihood analysis of the
concatenated sequences revealed that none of the Xap-look-a-like strains was
consistently clustered with any of the reference strains that belong to the described
pathovars of X. arboricola. Contrary to this, they were distributed in three separated
clusters, one composed by strains CITA 14 and CITA 149, another composed by strains
CITA 44 and CITA 49, and a third one composed by strains CITA 42, CITA 51 and
CITA 124. These clusters were located in a basal phylogenetic position with respect to
most of the strains used as reference. Sequence analysis of the concatenated sequence
(2,836 nucleotide positions) revealed a mean similarity of 98.30 ± 0.2% between the
Xap-look-a-like strains and the remaining ten strains of X. arboricola (Figure 1).

15
Figure 1. Maximum likelihood tree of concatenated sequences of the genes dnak, fyuA, gyrB and
rpoD of non-pathogenic X. arboricola strains isolated from Prunus spp. For comparative purposes
pathogenic strains of X. arboricola pv. pruni isolated from Prunus spp. and X. arboricola strains isolated
from other hosts are included. X. citri subsp. citri was used as outgroup. Bootstrap values of 1,000
replicates are represented above or below the branches. Selected strains for subsequent whole genome
sequencing are in bold.

4.4.2 T3SS and T3Es repertoire in Xap-look-a-like strains

Conventional PCR typing of 32 genetic determinants of the T3SS and its related T3Es
brought out a variable repertoire in the seven Xap-look-a-like strains. The structural and
regulatory components of the T3SS were only detected in strains CITA 14 and CITA
149, which harbored all the 11 components tested. In the same manner, only strains
CITA 14 and CITA 149 harbored five and two T3Es, respectively. On the other hand,
CITA 42, CITA 49, CITA 51 and CITA 124 did not harbor any of these genes. As
expected, Xap strains CITA 33 and CFBP 5530 showed positive amplification from all
the analyzed genes, meanwhile the non-pathogenic strain CITA 44 resulted negative
(Table 3).

15
4.4.3 Pathogenicity of the Xap-look-a-like strains

In addition to the variability found in the T3SS components and its related effectors, the
ability of the Xap-look-a-like strains to cause disease symptoms after bacterial
infiltration on leaves of barley, N. benthamiana, N. tabacum, tomato and the susceptible
peach rootstock GF-305 was evaluated. None of the assayed strains were able to cause
disease symptoms on barley, with the exception of strain CITA 14, which caused
necrosis and chlorosis in the infiltrated zone. Strains CITA 14 and Xap strain CITA 33
were able to cause necrosis and chlorosis in N. benthamiana and N. tabacum. On the
contrary, strains CITA 42, CITA 49, CITA 51, CITA 124, CITA 149 and the Prunus-
non-pathogenic strain CITA 44 only showed a chlorosis effect after 21 dpi. In tomato,
all the assayed strains, with the exception of CITA 44, were able to cause necrosis and,
in most of the cases, the necrotic area was surrounded by a chlorotic halo. Infiltration on
peach rootstock GF-305 showed that only CITA 44 did not cause damage on the leaves;
however, the remaining strains CITA 14, CITA 42, CITA 49, CITA 51, CITA 124 and
CITA 149 caused necrosis in the infiltrated area after 7 dpi, but these necrotic spots did
not expand beyond this zone and were different to typical bacterial spot symptoms.

On the other hand, the Xap strain CITA 33, caused necrosis in the infiltrated area and
these necrotic zones were surrounded by a chlorotic halo (Supplementary Figure 1). In
addition, in GF-305, variation in bacterial populations on the infiltrated leaves was
determined after 21 dpi and all the Xap-look-a-like strains, as well as strain CITA 44,
showed a reduction in their bacterial populations leading to concentrations equal or
lower than 105 CFU/ml. On the other hand, for strain CITA 33, the bacterial
concentration increased from 106 to 1010 CFU/ml by the end of the assay (Table 3).
Positive results in real-time PCR analysis of the isolated colonies after 21 dpi, using the
standardized protocol for Xap detection (Palacio-Bielsa et al., 2011, 2015b),
corroborated that the re-isolated strains corresponded to the same inoculated at the
beginning of the study.

15
 Table 3. Components of the type three secretion system, repertoire of the type three effectors, presence of
the plasmid pXap41 and pathogenicity of X. arboricola strains isolated from Prunus spp.

CITA CITA CITA CITA CITA CITA CITA CFBP CITA

Gene/Strains 14 42 44 49 51 124 149 5530P 33P
hrcC
III secretion system

hrcJ
Components of the type

hrcN
hrcR
hrcS
hrcT
hrcU
hrcV
hrpB1
hrpD5
hrpF
avrBs2
avrXccA2
hpaA
hrpW
xopA
xopAF
xopAH
xopAI
XopAQ
effectors
Type III

xopE2
xopE3
xopF1
xopG
xopK
xopL
xopN
xopQ
xopR
xopV
xopX
xopZ
repA1
pXap4

rpoA2
mobC
1

H. vulgare N, C NS NS NS NS NS NS ND NS
N. benthamiana N, C C C MC C MC C ND N, C
N. tabacum N C C C C C C ND N
Pathogenicity

NS,
S. lycopersicum N MN, C N, C N, C N, C N, C ND N, C
MC
P. persica (GF
MN N NS N N MN N ND N, C
305)
CFU/ml 21 dpi 0-105 101-105 102-104 102-104 103-105 103-105 103-105 ND 106-1010
Real-time PCR* + + + + + + + ND +

Positive/negative PCR amplification are represented in grey or white respectively; N: necrosis; C: chlorosis; NS: Not visible
symptoms; MN: mild necrosis; MC: mild chlorosis; ND: no data. P: Prunus pathogenic strains of X. arboricola pv. pruni (Xap), the
remaining tested strains were considered as atypical Xap-look-alike strains. *: according to the protocol described by Palacio-Bielsa
et al. 2011; 2015b.

15
4.4.4 General features of whole genomes of X. arboricola strains CITA 14 and
CITA 124

According to the results obtained in the MLSA analysis, one member of each one of the
three clusters (CITA 44, CITA 14 and CITA124) observed for the Xap-look-a-like
strains, was selected for whole genome sequencing (Figure 1). The draft genome
sequence of the non-pathogenic strain CITA 44 has been reported and analyzed
previously (Garita-Cambronero et al., 2016b). Moreover, main sequencing and
structural features of CITA 14 and CITA 124 genome sequences have been previously
announced (Garita-Cambronero et al., 2016c).

Draft genome sequence of CITA 14 was 4,864,444 bp in length with an average GC

content of 65.6%; 3,870 over 3,974 genes predicted were identified as protein coding
genes and a putative function was assigned to 2,991 of them (Supplementary Table 1).
Additionally, this strain presented 4 rRNAs and 53 tRNAs. In the case of CITA 124, its
draft genome sequence was 4,752,241 bp in length with an average GC content of
65.8%. A total of 4,004 genes were predicted and, among them, 3,798 were identified as
protein coding genes with a putative function assigned to 2,838 of them. In addition, 3
rRNA and 50 tRNA genes were predicted (Table 4). From the total of genes with a
predicted function, a COG functional category was assigned to 3,090 and 2,668 genes in
CITA 14 and CITA 124, respectively. Those genes related to the amino acid and
carbohydrate transport and metabolism as well as those associated with translation and
ribosomal structure and biogenesis were predominant for both strains (Figure 2). In
addition, CITA 14 and CITA 124 presented 3,320 and 2,668 genes, respectively, with a
protein domain in the Pfam database. Finally, a total of 942 and 625 genes of CITA 14
presented transmembrane helices and peptide cleavage signals, respectively.
Meanwhile, in CITA 124, 954 genes with transmembrane helices and 569 genes with
peptide cleavage sites were predicted (Table 4, Supplementary Table 1).

A comparative gene content analysis was performed among the genome sequences of
the two non-pathogenic Xap-look-a-like strains, CITA 14 and CITA 124, and 15
genome sequences of other pathogenic and non-pathogenic strains of X. arboricola. As
result, a total of 7,074 potential groups of homologous genes were found in the 17
analyzed genomes, from which 2,714 were shared by all the X. arboricola strains and
comprised the core group of orthologus genes. CITA 14 and CITA 124 presented 76

15
and 124 unique cluster genes, respectively, which distinguished them from the other 15
strains (Figure 3A; Supplementary Table 2). Strains CITA 14 and CITA 124, the
pathogenic Xap strains CITA 33 and IVIA 2626.1 and the non-pathogenic CITA 44, all
isolated from Prunus spp. in Spain, shared 3,103 groups of homologous genes. A total
of 889 cluster genes were found only in the non-pathogenic strains, meanwhile 708
cluster genes were found in the two Spanish strains of Xap (Figure 3B). Additionally,
236 CDS, 17 CDS and 131 CDS, were unique for the pathovar corylina, juglandis and
pruni, respectively (Supplementary Table 2).

The mean of the gene content similarity among the analyzed genomes according to the
Jaccard distance distribution was 0.23, which means that the analyzed genomes shared a
mean of 77% of their gene content, meanwhile, the remaining 23% is unique for each
one of them (Supplementary Figure 2A).

Figure 2. Graphical circular representation of the draft genome of the non-pathogenic of X.

arboricola strains CITA 14 and CITA 124. The contigs were arranged by Mauve, using the genome
sequence of X. arboricla pv. juglandis strain Xaj417 as reference. COG categories were assigned to
predicted genes using the NCBI´s conserved domain [Link] map was constructed using
CGview. From outside to center: Genes on forward strand; genes on reverse strand; GC content; GC
skew.

15
Table 4. Genome sequence information and statistics of the non-pathogenic strains of X. arboricola
strains CITA 14 and CITA 124, isolated from Prunus.

Property/Attribute CITA 14 CITA 124

Value Value
Sequencing platform Ion Torrent PGM Ion Torrent PGM
Fold coverage 100x 50x
Assemblers CLC and MIRA 4.0 CLC and MIRA 4.0
Genome annotation NCBI-PGAP NCBI-PGAP
Locus tag A7D01 A7D35
Genbank ID LXIB00000000 LXKK00000000
Genome size (bp) 4,864,444 4,752,241
DNA G+C (%) 65.60 65.80
Total genes 4,061 4,086
Protein coding genes 3,870 3,798
RNA genes 87 82
Pseudo genes 104 206
Genes with function prediction 2,991 2,838
Genes assigned to COGs 3,090 2,668
Genes with Pfam domains 3,320 2,668
Genes with signal peptides 625 569
Genes with transmembrane helices 942 954
CRISPR repeat unit 1 0

Figure 3. Potential groups of orthologous genes present in X. arboricola. Core, shell and cloud groups
of orthologous genes shared by 17 genome sequences of X. arboricola (A). Venn diagram showing the
groups of orthologous genes share by five genome sequences of pathogenic (CITA 33 and IVIA 2626.1)
and non-pathogenic (CITA 14, CITA 44 and CITA 124) strains of X. arboricola isolated from Prunus
spp. (B).

15
Based in the gene cluster content of each genome, a principal component analysis
showed that only 41.0% of the total difference is due to the variation by the two first
principal components (Supplementary Figure 2B). Three distinct clusters were
elucidated, one of them was comprised by the non-pathogenic strains (CITA 14, CITA
44, CITA 124, CFBP 7634 and CFPB 7651) and the strains with low-pathogenic
activity (3004, NCPPB 1630 and NCPPB 1832) which cause disease on barley and
banana. The pathogenic strains of the pathovar pruni formed another cluster that
comprised two subgroups, one formed by the strains isolated in Spain (CITA 33 and
IVIA 2626.1) and another by the strains MAFF 301420 and MAFF 301427 isolated in
Japan. Strains from the pathovar juglandis (CFBP 2528, CFBP 7179, Xaj2 and Xaj417)
formed the third group. Finally, the strain NCCB 100457 from the pathovar corylina
tended to group together with the strains isolated from Juglans spp. (Supplementary
Figure 2B).

The difference in the gene content cluster was illustrated using a pan-genome tree
(Snipen & Liland, 2015) after computing the distance among the genomes using the
Manhattan distance algorithm. The pan-genome tree for the 17 analyzed genomes
(Figure 4) showed the same clustering organization that was visualized previously with
the principal component analysis. Besides this, a division of the cluster comprised by
the low-pathogenic and non-pathogenic strains was shown. A first group was composed
by those strains that harbored components of the T3SS and T3Es, isolated from banana
(NCPPB 1630 and NCPPB 1832), walnut (CFBP 7634 and CFBP 7651) and peach
(CITA 14). A total of 10 CDS differentiated this group from all the remaining clusters
observed. The second group was comprised by the strain 3004 isolated from barley, and
the strains CITA 44 and CITA 124 isolated from Prunus, and 27 CDS differentiated this
cluster from all the other analyzed strains (Supplementary Table 2). The same strains
grouping and distribution was obtained using a Maximum likelihood phylogenetic
analysis based in the concatenated sequence of the genes that comprised the core
genome sequence of the 17 analyzed strains according to a sequence based methodology
recently described (Page et al., 2015) (Supplementary Figure 3).

15
Figure 4. Pangenome tree for pathogenic and non-pathogenic strains of Xanthomonas arboricola.
Tree construction was based in the distance between genomes according to the Manhattan distance.
Bootstrap values over 50% are showed at the branch points.

4.4.5 Genes associated with pathogenicity in X. arboricola strains:

In addition to the gen content comparison, the profiles of genetic components associated
with pathogenesis were determined for CITA 14 and CITA 124 and compared to those
in other strains of X. arboricola isolated from Prunus in Spain, especially in the two
pathogenic strains of Xap, CITA 33 and IVIA 2626.1, and in the non-pathogenic strain
of X. arboricola CITA 44.

Regarding the profiles of cell degrading enzymes, a total of ten genes that encoded for
pectolytic enzymes were found in the five strains. CITA 14 and CITA 124 showed
seven and eight of these genes, respectively. For these enzymes, two orthologs,
NP_635517.1 and NP_635516.1, were shared by the non-pathogenic strains, meanwhile
the degenerated pectate lyase AAM37225.1 was only found in Xap strains CITA 33 and

15
IVIA 2626.1 (Supplementary Table 2). Regarding the profile of cellulolytic enzymes,
nine enzymes were shared over 11 genes found in all the strains. In this case, only the
presence of the cellulolase AAM38359, described in X. citri subsp. citri 306,
differentiated non-pathogenic strains from Xap (Supplementary Table 3). In the case of
the hemilcellulolytic enzymes, a total of 11 orthologs were found in the Prunus-
associated strains; pathogenic strains of Xap were differentiated from the non-
pathogenic strains due to the presence of the genes that encoded the xylanase
NP_638385.1 and the xylosidase/arabinosidase NP_637752.1, both described
previously in X. campestris pv. campestris strain ATCC 33913. Finally, orthologous
genes for the virulence associated lipases NP_638797.1 and AAO29541.1 from X.
campestris pv. campestris ATCC 33913 and Xylella fastidiosa strain Temecula, were
found in the five genomes (Supplementary Table 3).

The profiles of genes related to sensing and chemotaxis varied among the analyzed
strains. Four of the five Spanish Prunus-isolated strains presented the same gene profile
for those genes associated with chemotaxis. However, CITA 124 did not harbor
homologous genes to cheD (AAM36751.1), cheZ (AAM36793.1) and cheA
(AAM36792.1) described in X. citri subsp. citri 306. Variants in other sensing
mechanisms such as TBDTs were found in the Prunus-associated strains of X.
arboricola; from the 17 TBDTs encoding genes found, those homologues of the
proteins NP_635515.1, NP_635700.1, NP_635699.1 and NP_639391.1, initially
described in X. campestris pv. campestris ATCC 33913, differentiated non-pathogenic
strains from Xap. Additionally, a large repertoire of 60 genes associated with STCRs
was found in the analyzed genomes and, from them, 55 were shared for all the strains
isolated from Prunus. In addition, the STCRs AAM36681.1, AAM35218.1,
AAM37649.1 and NP_637535.1 were only present in the non-pathogenic strains CITA
14, CITA 44 and CITA 124. Finally, from a total of 26 MCPs genes, 11 were found in
all Prunus-associated strains, but the absence of an ortholog to CAJ23610.1, described
in X. campestris pv. vesicatoria 85-10, in strains CITA 14 and CITA 124 differentiated
them from the remaining strains (Supplementary Table 3).

Besides to those genes related to environmental sensing, variations in some other genes
associated with the initial steps of the pathogenesis process, such as motility,
attachment, biopolimerization of the xanthan gum and the inter-cellular cross-talk
process controlled by the quorum-sensing system, were also found (Supplementary

16
Table 3). Pathogenic and non-pathogenic strains of stone fruit and almond shared 35
orthologs associated with molecular components of the flagellar system. The exception
to this was the non-pathogenic strain CITA 124, which did not have homologous genes
to the flagellar components of X. citri subsp. citri 306, flhF (AAM36797.1), fliH
(AAM36814.1), fliJ (AAM36812.1) and motB (AAM38537.1). In addition, an
interesting polymorphism was observed in the flagellin protein, encoded by fliC, of non-
pathogenic strains. In CITA 14 and CITA 124, this problem was identical to protein
WP_024939608.1, which has been previously associated with all the non-pathogenic
strains of X. arboricola or with low pathogenic strains of the pathovar celebensis.
Meanwhile, pathogenic strains of Xap harbored a flagellin protein identical to protein
WP_039814449.1, which present a substitution of aspartic acid for valine in the amino
acid 45 of the N-terminal region that has been associated to pathogenic strains in other
species of Xanthomonas (Sun et al., 2006; Cesbron et al., 2015).

Another bacterial structure related to motility, as well as to attachment, is the type IV

pilus. The pathogenic Xap strains CITA 33 and IVIA 26262.1 harbored 25 orthologs to
the 31 genes described in X. citri subsp. citri meanwhile the non-pathogenic strains
CITA 14, CITA 44 and CITA 124 were differentiated for the absence of orthologs to
the genes fimA (AAM38084.1), fimT (AAM37516.1), pilV (AAM37515.1), pilW
(AAM37514.1), pilX (AAM37513.1) and pilY1 (AAM37512.1). With regard to the
attachment function carried out by the non-fimbrial adhesins, most of the non-
pathogenic strains shared five of the six genes found, with the exception of CITA 14,
which did not harbor a homolog to fhaB1 of X. campestris pv. vesicatoria 85-10
(CAJ23537.1). Presence of a homologous gene to fhaB2 (CAJ23538.1) of Xanthomonas
campestris pv. vesicatoria differentiated Xap from non-pathogenic strains.

Pathogenic and non-pathogenic strains of X. arboricola isolated from Prunus shared the
same profile of xanthan-associated genes, which are involved in bacterial attachment
and biofilm formation. None of the strains had homologous sequences to gumG
(NP_637802.1) which is found in other xanthomonads (Lee et al., 2005). Regarding
quorum sensing system, which is associated with the regulation of the pathogenic
activity, from the 12 genes related to this process in Xanthomonas (He & Zhang, 2008),
all the analyzed strains, with the exception of CITA 14, harbored the same gene pattern
conformed by 11 genes. In addition, CITA 14 harbored an ortholog to the

16
transcriptional regulator NP_636589.1 described in X. campestris pv. campestris ATCC
33913 (Supplementary Table 3).

Bacterial type II, III and IV secretory systems (T2SS, T3SS and T4SS), which are
related to the secretion of proteins and DNA, also play a crucial role in pathogenesis
(Ryan et al., 2011). Regarding to T2SS, CITA 14 and CITA 124 presented 19 and 18
orthologs, respectively, of the 23 genes associated with xcs and xps T2SS gene clusters
described in Xanthomonas (Filloux, 2004; Szczesny et al., 2010). The only difference
among non-pathogenic strains and Xap was the presence in the latter of an ortholog to
the gen xcsK (NP_638764.1) (Supplementary Table 3).

Pronounced differences were observed among pathogenic and non-pathogenic strains

regarding the gene profile associated with T3SS and its related effectors, as well as with
T4SS. T3SS-related gene profile in CITA 14 was comprised by 24 orthologs of the 28
T3SS described in Xanthomonas, and this profile was the same observed in pathogenic
strains of X. arboricola (Cesbron et al., 2015; Garita-Cambronero et al., 2016b). On the
other hand, CITA 124 only harbored four T3SS-related genes (hpaS, hpaR2, hrpG and
hrpX) which correspond to the regulons of this secretory system (Jacobs et al., 2015).
For this strain as for the non-pathogenic strain CITA 44, none of the genes that
composed the macromolecular structure of the T3SS were found (Supplementary Table
3). Regarding to the T3SS related effectors, from the 61 T3Es described in
Xanthomonas, the genome sequence of CITA 14 presented a total of six orthologs to the
genes avrBs2, hpaA, hrpW, xopA, xopF1 and xopR, meanwhile genome sequence of
CITA 124 did not present any of these effectors. Moreover X. arboricola strains isolated
from Prunus showed variants in the number of T4SSs. Most of the strains, regardless of
their pathogenic activity, contained ten of the 12 components associated with the
VirB/VirD4 T4SS of Agrobacterium tumefaciens (Christie, 2004). In addition, the
absence of orthologs to the core components associated with the type IV conjugation
cluster tfc, described in Haemophilus influenzae, in the non-pathogenic strains CITA 14
and CITA 124 differentiated them from the Xap strains.

Finally, comparative sequence analysis among the nucleotide sequence of the plasmid
pXap41 and the draft genome sequence corroborated the absence of this plasmid in both
non-pathogenic strains (Figure 5).

16
Figure 5. Presence of the plasmid pXap41 in pathogenic and non-pathogenic strains of X.
arboricola. Comparative sequence analysis was performed using Blastn with an expected value threshold
of 0.001 and graphically represented by the BRIG tool. Each concentric circle represents one of the
analysed genomes.

4.4.6 The real-time PCR test for xopE3 permitted to differentiate Xap from
atypical strains of X. arboricola isolated from Prunus spp.

In silico analysis of the primers XopE3F (5`-TCAGCGATCACGCATCCA-3`),

XopE3R (5`-CGCACCAGATCGACAAACAC-3`) and the probe XopE3p (5`-
CATGCGCAGGCCGCACAT-3`), indicated that they were able to amplify in X.
arboricola the gene xopE3 only in those sequences from the pathovar pruni. Sequence
analysis on the available complete genome sequences of X. arboricola showed that
xopE3 was only present in those strains of the pathovar pruni (Figure 6). In addition,
this set of primers and the designed probe were also able to amplify the XopE3 gene in
other species of Xanthomonas such as X. citri [Link] 306 and X. fuscans subsp.
fuscans strain 4834-R (Supplementary Figure 4).

Besides the nucleotide sequence-based analysis, the specificity of the real-time PCR
assay was conducted by testing the protocol on the bacterial strains listed in Table 1.
Among the X. arboricola strains, only those determined previously as Xap, by the

16
presence of the plasmid pXap41 and with a positive result for the standardized real-time
protocol that amplify a gene ftsX related to the ABC transporter in Xap (Palacio-Bielsa
et al., 2011, 2015b), presented consistent positive results. None of the seven Xap-look-
a-like strains (CITA 14, CITA 42, CITA 44, CITA 49, CITA 51, CITA 124 and CITA
149) were amplified. Undesired specific PCR results for xopE3 were observed from
three strains of X. axonopodis (Xp-2, NCPPB 381 and IVIA 151835DA), one strain of
X. campestris (IVIA 2734-1), three strains of X. citri subsp. citri (306, IVIA 2889-1 and
IVIA 3026-1) and the strain 3619-1 of X. vesicatoria (Table 1). When the analyzed
strains were amplified using the real-time PCR protocol for the ABC transporter-
associated gene ftsX (Palacio-Bielsa et al., 2011), positive results were obtained with all
the strains of Xap, the seven strains of Xap-look-a-like, two strains of X. arboricola pv.
corylina (CFBP 1846 and IVIA 3978) and the strain of X. citri subsp. citri 306. Double
positive PCR results, using xopE3 or ABC primers, were only observed for all the Xap
strains but also for the strain 306 of X. citri subsp. citri (Table 1).

Figure 6. In silico representation of the presence of xopE3 and ftsX and the hybridization zone for
the primers and probes used for real-time PCR amplification in Xanthomonas arboricola.
Comparative sequence analysis was performed using Blastn with an expected value of 0.001. The circular
graphic has been constructed using BRIG. Each concentric circle represents one of the analysed genomes.

16
No significant differences were found among the three independent assays conducted to
determine the sensitivity of the real-time PCR protocol to amplify xopE3 using heat-
treated cells or purified DNA as samples. Calibration curves, obtained from serial
dilutions of heat-treated cells of Xap strain CITA 33, demonstrated that the real-time
PCR assay showed a sensitivity of 10 CFU/ml or 100 pg/µl of DNA, with a PCR
efficiency of 2.2 ±0.22 or 1.8 ±0.03 for bacterial cells or purified DNA from strain
CITA 33, respectively (Figure 7).

Figure 7. Calibration curves for detection of xopE3 in Xanthomonas arboricola pv. pruni. Calibration
curves have been obtained from dilution series of purified DNA (A) and bacterial cells (B) of X.
arboricola pv. pruni strain CITA 33. Real time PCR amplification was performed in three independent
assays using the primers XopE3F/R and the TaqMan probe XopE3p.

4.5 Discussion

The results obtained in the initial characterization of the X. arboricola strains isolated
from Prunus spp. pointed out that one of the most widely used real-time PCR protocol
for detecting Xap (Palacio-Bielsa et al., 2011 2015b) was not able to differentiate
bacterial strains of this pathovar from those atypical strains of the same species, which
are part of the Prunus microbiota. Actually, in silico analysis, based in the nucleotide
sequence comparison among the available genome sequences of X. arboricola and the
target genomic regions proposed for the identification of Xap in a variety of other
published PCR protocols (Park et al., 2010; Pothier et al., 2011a) (Supplementary
Figure 5), demonstrated that none of them could be able to discriminate between these
two groups of Prunus-associated strains.

16
The MLSA analysis conducted with the housekeeping genes dnak, fyuA, gyrB and
rpoD, resulted useful to characterize typical and atypical strains of X. arboricola as
proposed in recent articles (Essakhi et al., 2015; Garita-Cambronero et al., 2016b) and
corroborated the existence of genomic variants among the atypical strains of X.
arboricola isolated from Prunus spp.

An initial evaluation of the pathogenic activity of the seven atypical strains of X.

arboricola detected by MLSA revealed variations in their virulence; for instance, all of
them cause necrosis on the susceptible peach rootstock GF-305, but after 21 dpi their
populations in the inoculated leaves decreased reflecting a non-compatible plant-
microbe interaction described also for other Xanthomonas (Ah-You et al., 2007).
Therefore, these strains must be considered non-pathogenic in this host. The interaction
of these atypical strains with other hosts plants showed differences among the strains
and hosts; for example, all atypical strains, with exception of CITA 44, showed necrotic
spot in the infiltrated tomato leaf-zone, meanwhile only CITA 14 was able to cause
necrosis on Nicotiana spp. These variations concurred with the results obtained
previously in a linage of non-pathogenic strains of X. arboricola isolated from Juglans
regia (Essakhi et al., 2015). As in that study, the linage of non-pathogenic X. arboricola
strains isolated from Prunus spp. (Hajri et al., 2012; Cesbron et al., 2015; Garita-
Cambronero et al., 2016b) showed a non-canonical T3SS and T3Es repertoire in CITA
14 and CITA 149, or the absence of T3SS and T3Es, as in strains CITA 42, CITA 49,
CITA 51 and CITA 124.

A global overview of these results led us to the question why, even in the absence of the
canonical T3SS or the T3Es described in such strains (White et al., 2009), some of them
were able to cause hypersensitive response on Nicotiana spp., tomato and the peach
rootstock GF-305, meanwhile others like strain CITA 44 did not cause apparent effect
on the assayed hosts.

Due to the fact that this variants could not be clarified only based in the PCR typing of
the components for the T3SS and its related effectors, a more in-depth analysis based on
other pathogenicity determinants that could play a role in this plant-microbe interaction
was needed. Consequently, a whole-genome comparative analysis was performed on the
strains CITA 14, CITA 44 and CITA 124, which are representatives of the three MLSA
clusters that enclosed non-pathogenic strains isolated from Prunus.

16
Whole genome sequencing of these three strains permitted to accurately infer their
phylogenetic position within X. arboricola. After a presence/absence comparative
analysis of the groups of orthologous genes found in the pangenome of X. arboricola, it
was possible to explore the spatial distribution of the strains according to the two
principal components that contributed more to the variability among these genomes.
This explorative analysis permitted to infer a clear pathovar-based clustering of the
strains, as reported previously in other strains of X. arboricola isolated from Juglans
regia with non-canonical T3SS. These non-pathogenic strains, CITA 14 and CITA 124,
isolated from P. persica were closely related to those strains of X. arboricola that do not
cause disease (CFBP 7634, CFPB 7651 and CITA 44) (Cesbron et al., 2015; Garita-
Cambronero et al., 2016b), or have a low pathogenic ability (3004, NCPPB 1630 and
NCPPB 1832) (Ignatov et al., 2015; Harrison et al., 2016). Additionally, a similarity
analysis based in the content of all the groups of orthologous genes, as well as a
phylogenetic analysis based in the concatenated nucleotide sequences of all the genes
shared by the studied strains, have corroborated the assignment of CITA 14 and CITA
124 to a cluster that included the strains mentioned above, which is located in a basal
phylogenetic position within the species X. arboricola.

Besides this, a clear division of these strains in two subgroups could be established, one
cluster composed for those strains that harbored the components for a canonical or non-
canonical T3SS as well as some T3Es, and a second cluster composed by those that did
not have neither this secretory system nor its related effectors. Considering the
distribution of the T3SS and related T3Es within the subinfraspecific groups, and based
in the hypothesis of evolution of the virulence gene and regulator acquisition previously
proposed for Xanthomonas (Jacobs et al., 2015), a possible hypothesis about how
evolution has worked on the acquisition of T3SS-associated virulence in this species
could be proposed.

X. arboricola, as a member of the phylogenetic group 2 of Xanthomonas (Jacobs et al.,

2015), harbor homologues of the key regulators of the T3SS and T3Es such as hpaR2,
hpaS, hrpG and hrpX, as well as other pathogenic-related features like pehA and pehD,
and promoters such as the PIP-boxes associated with HrpX and, as suggested by Jacobs
and colleagues (2015), it is possible, that could evolve to adapt to these master regulons.
Actually, preceding genome analyses on X. arboricola (Cesbron et al., 2015; Garita-
Cambronero et al., 2016b) have shown the presence of all these molecular components

16
in all the available genomes of the species and, in the same manner, in our work they
have been found in strains CITA 14 and CITA 124. Later on, an ancestral basal group
of non-pathogenic strains, such as the one conformed by CITA 44 and CITA 124, could
acquire a T3SS and some T3Es, but only those that presented minimum core group of
T3Es, which in X. arboricola seems to be comprised by six genes (Hajri et al., 2012),
could surpass the plant immunity and developed a compatible plant-pathogen
interaction. This could be the case of strains from the pathovar celebensis, which are
within the sequenced strains, the pathogenic group with a lower pathogenic activity and
had the smallest repertoire of T3Es. The subsequent acquisition of accessory effectors
by some strains, as could be the case of the T3Es xopE3 and xopAQ in pathovar pruni,
identical to those found in other Xanthomonas spp., could alter the host range of the
species. These events allowed some strains to become specialized in a specific host, as
could be the case of the three most pathogenic pathovars, corylina, pruni and juglandis,
of X. arboricola.

Genome comparative analysis also showed variants among CITA 14, CITA 124 and the
available genomes of X. arboricola in a large list of genes that have been associated
with different stages of the pathogenic process in Xanthomonas spp. (Suplmental Table
3). On one hand, in these two strains, slight differences, related to environmental
sensing such as the MCPs, TBDTs and the STCRs, were found. On the other hand,
major differences were found in those features associated with the flagellin protein
sequences as well as with the molecular components of the type IV pilus. In other
xanthomonads, the flagellin polymorphism observed here between pathogenic and non-
pathogenic strains of Prunus has been associated to the ability of the plant to detect this
microbial associated feature and to trigger the plant immune response associated to the
initial stages of the plant-pathogen interaction (Sun et al., 2006).

In Xanthomonas, the type IV pilus seems to play an important role in bacterial host-
interaction and pathogenesis, in twitching motility, in the formation of mature biofilms
and in the interaction with bacteriophages (Dunger et al., 2016). In X. arboricola all the
described non-pathogenic strains and strains CITA 14 and CITA 124 (Cesbron et al.,
2015; Garita-Cambronero et al., 2016b) showed a gene arrangement similar to the one
previously observed in X. translucens pv. undulosa strain Xtu 4699, which is
characterized by the absence of homologues of fimA, fimT, pilV, pilW, pilX and pilY1
(Dunger et al., 2016). In the Prunus non-pathogenic strain CITA 44, the absence of

16
these minor pilins does not alter the twitching type motility (Garita-Cambronero et al.,
2016b). From all the variants found in the molecular components of this
macromolecular structure, only mutants in the orthologue of pilY1 have shown a
reduction in virulence in the non-vascular pathogen Xanthomonas oryzae pv. oryzicola
(Burdman et al., 2011). In all the pathogenic pathovars of X. arboricola, included the
strain NCPPB 1630 of the pathovar celebensis, homologues of the minor pilins
mentioned above were found, but all of them showed a percentage of identity lower
than 80% with respect their orthologues in Xanthomonas citri subsp. citri 306 (Dunger
et al., 2014).

As reported in previous studies (Essakhi et al., 2015; Cesbron et al., 2015; Garita-
Cambronero et al., 2016b), remarkable differences have been found among pathogenic
and non-pathogenic strains of X. arboricola with respect to the T3SS and T3Es. Non-
pathogenic strains of this species were separated in two different groups, one composed
for those strains described in X. arboricola (CITA 14, CFBP 7651, NCPPB 1630 and
NCPPB 1832), isolated from banana, stone fruits or walnut, that harbored the molecular
components of the T3SS and shared the six core T3Es, avrBs2, hpaA, hrpW, xopA,
xopF1 and xopR. One exception to this group was strain CFBP 7634, isolated from
walnut, which only harbored two of the T3Es, xopR and avrBs2, and did not showed
homologues for the T3SS (Cesbron et al., 2015). To perform pathogenicity tests of the
strains isolated from Junglans and Prunus on banana in tropical conditions could be
interesting to determine if those closely related strains are able to cause disease on this
host. A second group, comprised by the non-pathogenic strains CITA 44 and CITA 124
isolated from Prunus spp. and the pathogenic strain 3004 isolated from barley, was
characterized by the absence of T3SS and T3Es. Due to the fact that these strains are
closely related according to the phylogenetic analysis, it was tested if strains CITA 44
and CITA 124 caused disease on barley, but negative results pointed out that the ability
of strain 3004 to cause disease on this crop could be related to other molecular features
that are not shared among this strain and strains CITA 44 and CITA 124.

In addition to the flagellin polymorphism mentioned above and its possible role on the
plant immune response, a recent study on X. euvesicatoria described 17 T3Es that
inhibit the plant immunity triggered by the domain flg22 in Arabidopsis thaliana
(Popov et al., 2016) and, from these, the T3Es xopB, xopE2, xopF1, xopL, xopN, xopV,
xopX and xopZ have been predicted in X. arboricola. Those pathogenic strains that

16
cause disease on hazelnut, stone fruits and walnut presented seven of these T3Es,
meanwhile the non-pathogenic CFBP 7651, CITA 14, and the banana-pathogenic
strains NCPPB 1630 and NCPPB 1832, only harbored the T3E xopF1. Further
functional studies comprising these PTI inhibitors will be useful to understand their role
to sidestep the initial plant defense mechanisms and the development of a compatible
plant-pathogen interaction. For these purposes, the use of non-pathogenic strains, such
as CITA 14, could be useful to determine if these T3Es are playing a key role inhibiting
the PTI in Prunus.

Regarding the type IV secretion systems, which are molecular structures adapted to
translocate large molecules, like proteins or protein-DNA complexes, through multiple
cell membranes (Guglielmini et al., 2014), the VirB/VirD4 system has been found in all
the strains of X. arboricola. Nevertheless, the profile of proteins associated with this
T4SS was almost the same in all the strains, with the exception of the homologues of
VirB6, which is scattered within the members of the X. arboricola. According to the
studies of mutants of virB6 in A. tumefaciens, this gene is essential for the biogenesis of
the T pilus and the secretion channel (Jakubowski et al., 2003). But in X. citri subsp.
citri and in X. campestris pv. campestris, this T4SS has been described as not playing a
main role in virulence (Jacob et al., 2014) because the presence of the complete core of
components for its expression in X. arboricola varies among strains, regardless of the
pathogenic activity. Therefore, VirB/VirD4 secretion system may not be essential for
virulence in this species. Despite this, functional experiments with T4SS-deleted
mutants are required for testing this hypothesis.

Evidence of a group of genes putatively related to the tfc T4SS of H. influenza, which is
related to bacterial conjugation, have been obtained after searching for homologues
using the Blast tool from the NCBI, and also corroborated using the web-based tool for
prediction of T4SS-related genes T346Hunter (Martínez-García et al., 2015); but the
identity of the putative orthologous genes found in X. arboricola showed an amino acid
sequence identity lower than 80% for all the genes. Despite of this, the presence of this
group of genes, annotated as integrating conjugative elements, varied among X.
arboricola strains and were only present in those pathogenic organisms from the
pathovars juglandis and pruni.

17
As a final result of this comparative analysis, the absence of the recalcitrant plasmid
pXap41 observed by the multiplex-PCR approach (Pothier et al., 2011c) was
corroborated in CITA 14 and CITA124, and as proposed previously, it was only found
in members of the pathovar pruni. Presence of this plasmid has been useful not only to
differentiate such pathovar from the other pathovars of the species as proposed
previously (Pothier et al., 2011c), but also to distinguish pathogenic strains of Xap from
other strains of X. arboricola that coexist in the same plants hosts. In addition to this
feature, the pangenomic analysis pointed out a series of unique genes for each
infrasubspecific group of X. arboricola that could be interesting targets for developing
new precise diagnostic tools.

Due to the fact that this plasmid contains at least three virulence factors, xopAQ, xopE3
and mltB, which are unique in Xap, it is confirmed to be a good target for conducting
studies of host specialization in the Xap-Prunus relationship. Additionally, it is useful as
a genomic marker to differentiate Xap from all the other members of the species,
especially from those non-pathogenic strains found in Prunus hosts.

In this article, the use of pXap41, specifically a partial sequence of the virulence-
associated gene xopE3, was explored for designing a sensitive and specific real-time
PCR-based test to differentiate Xap from other X. arboricola strains. As shown here, the
developed test was highly sensitive on both heat-treated bacterial cells and purified
DNA, but showed unwanted positive amplification in X. axonopodis, X. campestris, X.
citri, X. fuscans and X. vesicatoria. To our knowledge, there is not record of the
presence of these species causing disease on Prunus, and consequently to find one of
them in natural conditions on these hosts could be only possible as a fortuitous event.
The previously developed real-time PCR for detecting Xap (Palacio-Bielsa et al.,
2015b), as well as the other PCR-based methods designed for this purposes, with the
exception of the Bio-PCR protocol proposed by Ballard and colleagues (2011), were not
able to differentiate those members of the pathovars corylina and pruni (Supplementary
Figure 5). But the most important problem was that as has been shown here, the
methods described were not able to differentiate Xap from non-pathogenic strains of
Prunus. Therefore, based in our results we propose for Prunus-isolated strains this real-
time PCR amplification protocol that could be used in conjunction with the method
proposed by Palacio-Bielsa and collaborators (2011) for routine detection and
identification and diagnosis of this quarantine pathogen responsible for bacterial spot of

17
stone fruits and almond. A combined result of both tests gives a precise identification of
the xanthomonads detected in the plant. If both test result positive, the organism tested
could be identified as Xap and, on the other hand if the target organism shows positive
results only for the ABC-method it could be designated as member of the Xap-look-a-
like group. Both the multiplex conventional PCR described by Pothier and colleagues
(2011c) and the proposed combination of two real-time PCR protocols porposed here
are suitable for differentiate Xap strains. However, the latter offers advantages since it
allows detecting Xap from plant material (including asymptomatic samples) (Peñalver
et al., 2016), whereas the protocol proposed by Pothier and collaborators (2011) has
only been assayed using pure bacterial cultures. Xanthomads group associated to
Prunus spp. requires further taxonomic analyses for more accurate description of the
taxonomic status of the different strains. Exploration of the transcriptome and the
metabolome of such strains could also help in identifying factors contributing to their
diversity.

There is an scarce number of pangenomes of species of plant pathogenic bacteria now

available, but this type of studies previously performed in other bacterial species have
shown that the genomes of few species are not sufficient and that sequences from
multiple genomes are required. As whole, the pangenome of X. arboricola and the
characterization of the atypical X. arboricola strains found on Prunus spp., as well as
their use to study the genomic diversity of X. arboricola, has revealed and corroborated
the existence of a distinct phylogenetical basal lineage of this species which is
associated with a wide host range. From the strains including in this group, those
considered as low-pathogenic seemed to cause disease in two species of monocotyledon
plants (banana and barley). After an extensive comparative analysis of those virulence-
related genes, it was determined that this bacterial lineage slightly differed from those
which are considered as highly pathogenic in several features associated with the initial
or later stages of the pathogenicity process. To improve the knowledge on the
pathogenic ability and diversity of this species will eventually open the way for the
development of innovative control strategies to the diseases they cause.

17
4.6 Acknowledgments

We would like to thank to Elisa Ferragud, Ana Ruíz Padilla and Isabel M. Berruete for
technical assistance. This work was supported financially by the Instituto Nacional de
Investigación y Tecnología Agraria y Alimentaria (INIA) project RTA2014-00018-
CO2-01. J. Garita-Cambronero held a Ph.D. fellowship from the Spanish Government
(Ministerio de Educación, Cultura y Deporte; fellowship FPU12/01000).

17
Capítulo 5: Discusión general
Como resultado de los diversos brotes de X. arboricola pv. pruni que han surgido en
España en los últimos años (Roselló et al., 2012; Palacio-Bielsa et al., 2014), se aislaron
una serie de cepas bacterianas que presentaban colonias con un fenotipo típico de
Xanthomonas. Dichas cepas fueron inicialmente identificadas, utilizando un protocolo
estandarizado, como X. arboricola pv. pruni (Palacio-Bielsa et al., 2011, 2015b). Una
selección de estas cepas, representativa de los huéspedes y las regiones geográficas de
España en las que se encontró este patógeno, fue utilizada para realizar una
caracterización tanto fenotípica como molecular de caracterers que se relacionan con los
procesos de infección de las bacterias fitopatógenas. El objetivo final era conocer,
aunque fuera parcialmente, aquellos factores que podrían estar vinculados al desarrollo
de la mancha bacteriana de frutales de hueso y el almendro.

Una primera caracterización de las cepas realizada siguiendo un esquema de MLSA

basado en los genes dnaK, fyuA, gyrB y rpoD (Young et al., 2008), definido útil para
caracterizar cepas de X. arboricola pv. juglandis (Kaluzna et al., 2014), confirmó que la
mayor parte de las cepas aisladas se identificaban como X. arboricola pv. pruni.
Además, el método de caracterización demostró ser lo suficientemente resolutivo para
identificar una cepa aislada de Prunus mahaleb, CITA 44, dentro de esta especie pero
filogenéticamente diferente a los nueve patovares descritos en X. arboricola (Garita-
Cambronero et al., 2016a,b). Este tipo de cepas atípicas habían sido ya descritas
mediante MLSA, en otras especies de plantas, siendo la mayoría de ellas identificadas
dentro de la especie X. arboricola (Fischer-Le Saux et al., 2015; Jacques et al., 2016).

La caracterización, de las cepas aisladas de Prunus spp. se acompañó de una

caracterización fenotípica tanto de las cepas identificadas como patovar pruni como de
la cepa atípica CITA 44. Este análisis incluyó diversos caracteres asociados con los
estadíos iniciales de la infección en planta, como son la capacidad de metabolizar
diversos compuestos de carbono y la respuesta quimiotáctica hacia algunos de ellos, la
capacidad de movimiento tanto en superficie (“swarming” y “twitching”) como en
medio líquido o semisólido (“swimming”), la capacidad de secretar sustancias
surfactantes y finalmente su virulencia en diversos huéspedes del género Prunus
(Garita-Cambronero et al., 2016b). Una primera característica fenotípica encontrada en
las cepas de X. arboricola estudiadas fue su capacidad motil asociada tanto a flagelo
como a pilus tipo IV. Estos tipos de movimiento habían sido observados en otras
especies como X. citri (Sena-Vélez, 2015), pero en el caso de motilidad mediada por

17
flagelo, únicamente se había descrito el movimiento tipo “swimming”. En este trabajo
se describe por primera vez para Xanthomonas otro movimiento dependiente de flagelo
que se asocia a colonias de tipo dendrítico en medio de cultivo sólido, tanto en cepas de
X. arboricola pv. pruni (por ejemplo la cepa CITA 33) como en la cepa atípica CITA
44. Este fenotipo es típico del movimiento tipo “swarming”, el cual generalmente está
conectado con la capacidad de agregación y formación de biopelículas en superficie, tal
y como ocurre en X. arboricola pv. pruni (Sabuquillo & Cubero, 2016).

Otro aspecto fenotípico importante observado en este análisis, ha sido la variación en

cuanto a la virulencia de las cepas aisladas en los diversos huéspedes analizados. El
hecho de que ninguna de las cepas estudiadas produjera infección en albaricoquero (P.
armeniaca) hace pensar en una posible súper-especialización de las cepas de X.
arboricola de este huésped que podrían presentar unas características especiales que no
han sido analizadas en este trabajo y que sin embargo serían objeto interesante de
trabajos futuros. Por otro lado, el efecto observado en los diferentes huéspedes
estudiados permitió determinar que las diferencias encontradas a través de la
caracterización molecular en la cepa atípica CITA 44 iban asociadas a su incapacidad
para desarrollar síntomas de enfermedad, por lo que se consideró como una cepa no
patógena semejante a X. arboricola pv. pruni (Garita-Cambronero et al., 2016b)

Además, se observaron diferencias entre ambos tipos de cepas en cuanto al perfil de

metabolismo de compuestos de carbono y el patrón quimiotáctico. En el caso de la cepa
CITA 44, la utilización de estos compuestos no solamente fue diferente al observado en
las cepas del patovar pruni, sino que también varió con respecto al descrito para la
especie X. arboricola (Vauterin et al., 1995), dejando entrever que la descripción inicial
de la especie, basada únicamente en cepas virulentas, ha podido subestimar la
diversidad de la misma tanto filogenéticamente como metabólicamente. El presente
trabajo aporta información que aumenta el conocimiento sobre la verdadera diversidad
de esta especie bacteriana.

En base a los datos obtenidos en esta caracterización inicial, tres cepas de X. arboricola
fueron seleccionadas con el objetivo de secuenciar sus genomas y mediante análisis
genómico determinar aquellos factores que pudiesen estar asociados con la patogénesis
bacteriana. En primer lugar se obtuvo la secuencia correspondiente al genoma completo
de la cepa CITA 33 de X. arboricola pv. pruni, aislada de P. amygdalus var. Guara.

17
Este genoma constituye el primero públicamente disponible para este patovar y para el
cual se describieron las características generales. (Garita-Cambronero et al., 2014).
Posteriormente, se publicaron las características de los genomas de una cepa patógena
en ciruelo (P. salicina) IVIA 2626.1, que difería de CITA 33 en aspectos fenotípicos
como la motilidad superficial, y de la cepa no patógena CITA 44 (Garita-Cambronero et
al., 2016a).

El aumento de las enfermedades provocadas por X. arboricola a nivel mundial hace

necesario el desarrollo de nuevas y eficientes estrategias de control, para lo cual es
necesario comprender los mecanismos de patogénesis, al menos de los patovares más
virulentos como son, corylina, juglandis y pruni (Lamichhane, 2014; Lamichhane &
Varvaro, 2014). En los últimos años esta necesidad ha conducido a la realización de
numerosos estudios genomicos de la especie (Ibarra Caballero et al., 2013; Higuera et
al., 2015; Ignatov et al., 2015; Pereira et al., 2015; Cesbron et al., 2015; Harrison et al.,
2016). La disponibilidad de dicha información genómica ha permitido en la realización
en este trabajo de un primer análisis comparativo entre las tres cepas españolas de X.
arboricola, aisladas de Prunus spp., y otras 15 cepas de X. arboricola aisladas en
plantas de los géneros Corylus, Hordeum, Junglans y Prunus (Garita-Cambronero et al.,
2016b).

En esta comparativa se ha podido profundizar en el conocimiento sobre la filogenia de

estas cepas al poder ser realizado un análisis filogenético basado en secuencias
concatenadas de los genes compartidos por las 18 cepas analizadas. Este análisis
confirmó el resultado obtenido mediante MLSA, situando la cepa CITA 44 en un clado
diferente al de las cepas patógenas de Prunus, presentando mayor similitud con cepas
poco virulentas aisladas de cebada y banana, así como con cepas no patógenas aisladas
de nogal. Este resultado concuerda con los obtenidos para dos cepas no patógenas de
nogal (CFBP 7634 y CFBP 7651) en trabajos anteriores. Dichas cepas se consideraron
diferentes a las cepas del patovar Juglandis según el análisis de MLSA basado tanto en
un esquema compuesto por siete genes como en el análisis del “core genome” (Fischer-
Le Saux et al., 2015; Cesbron et al., 2015).

Una vez determinada de forma precisa la posición taxonómica de las cepas analizadas,
en el presente trabajo, se abordó el estudio de genes potencialmente relacionados con
patogénesis en los diversos grupos de X. arboricola, haciendo énfasis en las cepas

17
aisladas de Prunus, y teniendo en cuenta aquellos descritos en otras especies de
Xanthomonas así como en otras especies bacterianas (da Silva et al., 2002; Filloux,
2004; Vorhölter et al., 2008; Wang et al., 2008; Chevance & Hughes, 2008; He &
Zhang, 2008; White et al., 2009; Subramoni et al., 2010; Szczesny et al., 2010; Mhedbi-
Hajri et al., 2011; Potnis et al., 2011; Ryan et al., 2011; Guo et al., 2011; Hajri et al.,
2012; Vandroemme et al., 2013; Li et al., 2014; Guglielmini et al., 2014; Cesbron et al.,
2015; Dunger et al., 2016; Nascimento et al., 2016).

El análisis comparativo permitió identificar diferencias existentes entre cepas patógenas

y no patógenas de Prunus con respecto a mecanismos asociados con los primeros
estadíos de la infección, tales como son la percepción de estímulos ambientales,
reflejado en el análisis de la presencia de genes relacionados con los trasportadores
TonB-dependientes, los sensores del sistema regulatorio de dos componentes, las
proteínas aceptoras del grupo metilo, las proteínas asociadas a la ruta metabólica de la
quimiotáxis o el quorum sensing así como genes relacionados con la adhesión
bacteriana y la motilidad mediante flagelo o el pilus tipo IV. Además, se encontraron
diferencias también en aspectos propios de las etapas más tardías de la infección
bacteriana, como los sistemas de secreción tipo II, III y IV y sus respectivas enzimas o
proteínas efectoras de cada uno de ellos.

Como parte de estos resultados, la diferencia más significativa entre las cepas patógenas
y la cepa no patógena aisladas de Prunus fue la ausencia del sistema de secreción tipo
III (T3SS) y de sus proteínas efectoras (T3Es), así como la ausencia del plásmido
hipotéticamente asociado a virulencia, pXap41, en la cepa CITA 44. Este tipo de
variaciones han sido descritas en otras especies de Xanthomonas (Jacobs et al., 2015).
En X. arboricola además se ha descrito el genoma de la cepa 3004 que, a pesar de no
presentar ni T3SS ni sus efectores asociados, es capaz de producir enfermedad en
cebada (Ignatov et al., 2015). También en el caso de las dos cepas no patógenas de X.
arboricola aisladas de nogal, se han descrito diferencias en el T3SS y sus proteínas
secretadas; mientras que la cepa CFBP 7634 no presentó T3SS y contenía un número
reducido de efectores, la cepa CFBP 7651 contenía todos los genes para un T3SS
funcional y un número reducido de efectores (Cesbron et al., 2015). En cuanto al
plásmido pXap41, se corroboró, como había sido descrito previamente (Pothier et al.,
2011c), que es exclusivo de X. arboricola pv. pruni por lo que resulta útil como

18
herramienta para diferenciar las cepas del patovar pruni de aquellas cepas no patógenas
presentes en los frutales del género Prunus.

El haber encontrado y caracterizado una cepa de X. arboricola en Prunus

filogenéticamente diferente a las cepas del patovar pruni, incapaz de producir infección
e imposible de diferenciar mediante el protocolo de PCR tiempo real recomendado para
el diagnóstico de la mancha bacteriana de los frutales de hueso y almendro (Palacio-
Bielsa et al., 2015b), planteó una serie de preguntas, cuyas respuestas son abordadas en
el capítulo 4 de este trabajo. ¿Cómo de comunes son estas cepas atípicas?; si el caso de
la cepa CITA 44 no es un caso aislado, ¿todas las cepas atípicas son no patógenas en
Prunus?, de ser así ¿es la ausencia del T3SS y de sus efectores un factor común a todas
las cepas atípicas?; ¿es posible diferenciar de alguna manera estas cepas atípicas de
aquellas que pertenecen al patovar pruni? Y por último, ¿los perfiles variables del T3SS
y de sus efectores en X. arboricola podría dar alguna pauta sobre la posible evolución
de la patogenicidad en esta especie?.

Con el fin de obtener datos que ayudaran a dar respuesta a estas cuestiones, se realizó
una prospección dentro de colecciones españolas disponibles de este patógeno. La
selección se abordó utilizando el protocolo de PCR multiplex descrito para determinar
la presencia de plásmido pXap41 (Pothier et al., 2011c). Se encontró que además de la
cepa CITA 44, seis cepas no presentaron amplificación para las tres regiones de este
plásmido analizadas, por lo que se consideraron cepas atípicas.

Un posterior análisis mediante MLSA corroboró que estas cepas no pertenecían al

mismo grupo filogenético que las cepas del patovar pruni. Concordando con lo descrito
para otras cepas de X. arboricola aisladas de diferentes huéspedes (Essakhi et al., 2015;
Fischer-Le Saux et al., 2015). Se hizo un estudio sobre la virulencia de estas cepas en
huéspedes pertenecientes, tanto al género Prunus como a otros géneros vegetales, y se
encontró que ninguna de ellas era patógena en Prunus y solo algunas de ellas inducían
algún tipo de síntoma en otros huéspedes. Asimismo, se estudió el perfil de genes
asociados al T3SS y sus efectores mediante PCR. Al igual que lo observado en las cepas
de nogal (Cesbron et al., 2015), las cepas atípicas aisladas en Prunus no presentaron
T3SS ni efectores o bien presentaron un T3SS completo pero un número reducido de
efectores (Essakhi et al., 2015).

18
Con el fin de determinar si la variación observada en cuanto a la virulencia se asociaba
solamente a los perfiles de genes correspondientes al T3SS, o además estaba
relacionado con otro tipo de factores relacionados con la patogénesis, se realizó la
secuenciación del genoma de dos cepas atípicas CITA 14, en la que se habían detectado
tanto T3SS como T3Es y CITA 124, que no contenía T3SS ni T3Es. Ambas cepas junto
con la cepa CITA 44 eran representativas de la diversidad de cepas atípicas encontradas
en este estudio. El estudio pan genómico situó la cepas en su contexto taxonómico,
confirmándose que no pertenecían al patovar pruni. El análisis de las secuencias
relacionadas a la patogenicidad, de estos genomas ha permitido hipotetizar sobre los
posibles pasos evolutivos que llevaron al desarrollo de la patogenicidad en X.
arboricola, basándose en la hipótesis sobre el origen de la patogenicidad en
Xanthomonas propuesta por Jacobs y colaboradores (2015).

Brevemente, esta hipótesis plantea que en determinado momento de la historia evolutiva

del género Xanthomonas, aquellas especies que pertenecen al denominado grupo
taxonómico 2, dentro del cual se encuentra X. arboricola, adquirieron los reguladores
maestros asociados a patogénesis HpaR2, HpaS, HrpG y HrpX. Esta adquisición pudo
provocar que los genomas evolucionaran para adaptarse a dichos reguladores. Un
ejemplo sería la aparición de secuencias tipo “PIP-Box” en los genomas para adaptarse
a HrpX. En X. arboricola, un ancestro basal no patógeno, como podrían ser CITA 44 y
CITA 124, pudo haber adquirido los genes asociados al T3SS, así como algunos
efectores mínimos necesarios para causar una relación compatible entre la planta y la
bacteria. Este grupo mínimo de efectores podría estar constituido por aquellos seis
compartidos por todos los patovares patógenos y presentes en grupos de baja virulencia
como el patovar celebensis. La adquisición posterior de otros efectores tipo III por
algunas cepas, pudo alterar la gama de huésped de la especie y generar la
especialización por huésped, como puede ser el caso actual de los patovares, corylina,
juglandis y pruni.

Finalmente, el análisis pan genómico realizado en este trabajo ha proporcionado

información sobre una serie de genes únicos para cada uno de los grupos
intraespecíficos analizados, La secuencia de uno de estos genes, el xopE3, se ha
utilizado para el diseño de una estrategia de detección por PCR en tiempo real de X.
arboricola pv. pruni que evita la identificación errónea de cepas filogenéticamente
cercanas

18
El trabajo desarrollado en esta tesis doctoral aporta información valiosa desde el punto
de vista fenotípico y genómico de la especie X. arboricola y ahonda en los factores
implicados en la patogenicidad de los diversos grupos que conforman esta especie,
enfatizando en aquellos caracteres relacionados con el desarrollo de la macha bacteriana
en los frutales del género Prunus. Los datos generados en este trabajo, obtenidos
mayormente desde estrategias genómicas, deberían ser el punto de partida de futuros
estudios que confirmen o no, desde un punto de vista funcional, las hipótesis planteadas
en torno al papel que juegan los genes identificado en el trabajo.

Solo el conocimiento profundo de los mecanismos implicados en los procesos de

patogénesis permitirá el futuro desarrollo de nuevos métodos de control de
enfermedades, siendo especialmente importante en aquellas de reciente aparición y con
graves consecuencias en agricultura, como es el caso de la mancha bacteriana de los
frutales de hueso y el almendro.

18
Capítulo 6: Conclusiones
1. La técnica de caracterización molecular mediante MLSA ha permitido
determinar la existencia de cepas atípicas de X. arboricola asociadas a diversas especies
de Prunus. Estas cepas no fueron agrupadas con ningún otro patovar de los nueve
descritos en esta especie.

2. Las cepas atípicas, aisladas de Prunus spp., presentaron fenotipos diferentes a

las cepas patógenas de X. arboricola pv. pruni, especialmente con respecto a su
patogenicidad y virulencia, no desarrollando infección en frutales del género Prunus.

3. La cepa no patógena de X. arboricola CITA 44 presentó diferencias fenotípicas

en cuanto a la utilización de compuestos de carbono, quimiotáxis y motilidad con
respecto a las cepas de X. arboricola pv. pruni.

4. Por primera vez en el género Xanthomonas se ha descrito el movimiento tipo

swarming asociado a la formación de colonias de tipo dendrítico en medio de cultivo
sólido, tanto en cepas patógenas como no patógenas de X. arboricola aisladas de Prunus
spp.

5. Las cepas no patógenas de Xanthomonas aisladas de Prunus no presentaron los

genes asociados a la estructura del sistema de secreción tipo III ni a sus efectores o bien,
sólo un número reducido de éstos. Además, según el análisis por PCR de los genes
repA1, repA2, y mobC, estas cepas no poseen el plásmido pXap41, potencialmente
asociado a virulencia en cepas del patovar pruni.

6. Se ha obtenido la secuencia completa de dos cepas de X. arboricola pv. pruni:

CITA 33 (Xap33), aislada de almendro. E IVIA 2626.1 aislada de ciruelo, además de las
cepas atípicas CITA 44, aislada de P. mahaleb y CITA 14 y CITA 124, aisladas de
melocotonero. Todas ellas son representativas de los grupos obtenidos después de
análisis genómicos y fenotípicos.

7. El análisis filogenético basado en el “core genome” de X. arboricola, así como

el análisis de similitud basado en los genes del pan genoma de esta especie, permitieron
corroborar que las cepas atípicas de X. arboricola conforman un grupo basal en la
especie, el cual contiene cepas avirulentas o cepas poco virulentas, como las descritas
para el patovar celebensis o la cepa 3004 patógena de cebada

18
8. El estudio realizado durante este trabajo representa el primer análisis de
genómica comparativa de la especie X. arboricola, y en él se ha hecho un especial
énfasis en las diferencias entre los genomas de cepas patógenas y cepas no patógenas
aisladas de Prunus, lo que ha permitido dilucidar potenciales factores de virulencia
asociados a la mancha bacteriana de los frutales de hueso y el almendro.

9. En cuanto a los transportadores dependientes de TonB (TBDTs), asociados al

transporte de diversas sustancias, 17 genes fueron encontrados en las cepas
secuenciadas, sin embargo se identificó la presencia exclusiva de tres de estos genes en
las cepas no patógenas aisladas de Prunus spp.

10. Con respecto al sistema regulador de dos componentes (STCRs),relacionados

con la respuesta bacteriana a cambios en estímulos ambientales, las cepas patógenas
aisladas de Prunus presentaron dos que son únicos para X. arboricola pv. pruni. Por
otro lado, las cepas no patógenas aisladas de Prunus presentaron cuatro loci exclusivos.

11. Se observaron además diferencias en cuanto a las proteínas aceptoras de grupos

metilo (MCPs), asociadas a la percepción de señales químicas implicadas en
quimiotaxis. La presencia de una MCP presente en las cepas patógenas del patovar
pruni diferenció a este grupo del de las cepas no patógenas.

12. En cuanto a la estructura y regulación del flagelo, en general, se ha observado un

perfil génico muy similar entre las cepas de X. arboricola, sin embargo se encontró un
polimofismo en la flagelina que diferenciaba a las cepas de los patovares más virulentos
de aquellas cepas menos virulentas o no patógenas. Este polimorfismo correspondió a
un cambio de ácido aspártico por valina en las cepas de los patovares corylina,
juglandis y pruni.

13. Las cepas patógenas presentaron un perfil génico diferente al de las cepas no
patógenas de Prunus en relación al pilus tipo IV. En las cepas no patógenas, se encontró
un patrón semejante al de X. translucens pv. undulosa en el cual los homólogos a fimA,
fimT, pilV, pilW, pilX y pilY1 de X. citri, no se encontraron o presentaron un porcentaje
de identidad y cobertura menor al 80%.

14. El repertorio de adhesinas no fimbrilares de las cepas patógenas de Prunus se

diferenció del de las cepas no patógenas en la presencia del gen homólogo a fhaB2 de X.

18
campestris pv. vesicatoria. Además, la hemaglutinina homóloga a XAC0444 de X. citri,
solamente se encontró en los tres patovares más virulentos de la especie.

15. El análisis de los procesos asociados a etapas tardías de la patogénesis demostró

que todas las cepas, independientemente de su patogenicidad, presentaron el sistema de
secreción tipo II Xps, asociado con virulencia. Sin embargo, se encontró variación en el
perfil de enzimas secretadas por este sistema. Las cepas de X. arboricola pv. pruni
presentaron una pectato liasa, una xilanasa y una xilosidasa que no estaban presentes en
las cepas no patógenas aisladas de Prunus spp.

16. Todas las cepas de X. arboricola presentaron genes homólogos a los

componentes del sistema de secreción VirB/VirD4 de A. tumefaciens. Además, solo las
cepas de los patovares más virulentos, corylina, juglandis y pruni, presentaron
homólogos al sistema tfc descrito en H. influenzae.

17. La principal diferencia entre cepas patógenas y no patógenas de la especie X.

arboricola se encontró en la presencia del sistema de secreción tipo III y de sus
efectores asociados. En el caso de las cepas aisladas de Prunus, todas las cepas
presentaron homólogos para los reguladores de este sistema, HpaS, HpaR2, HrpG y
HrpX. Las cepas no patógenas CITA 44 y CITA 124, no presentaron homólogos para
los genes que conforman este sistema de secreción así como ninguno de sus efectores
asociados. Asimismo, la cepa CITA 124 presentó homólogos para todos los genes
requeridos para la expresión del T3SS y se diferenció de las cepas patógenas del patovar
pruni al presentar únicamente seis efectores de tipo III.

18. Las cepas patógenas de X. arboricola pv. pruni presentaron el mayor número de
efectores tipo III de la especie X. arboricola. Los efectores XopE3 y XopAQ, predicho
por primera vez para esta especie en este trabajo, son únicos para este patovar.

19. La identificación del gen xopE3 como específico de las cepas causantes de la
mancha bacteriana de los frutales de hueso y almendro, ha permitido el desarrollo de un
protocolo de PCR tiempo real que ha mejorado la precisión en el diagnóstico de esta
enfermedad y permite diferenciar las cepas patógenas y no patógenas de X. arboricola
que cohabitan Prunus spp.

20. El conjunto de resultados de este trabajo abre la puerta a futuros estudios

funcionales que confirmarán o no la implicación de los genes identificados aquí

18
presumiblemente involucrados en las diferentes etapas de infección en la mancha
bacteriana de los frutales de hueso y el almendro. Los datos obtenidos han permitido
además la mejora del método de diagnóstico de esta enfermedad por PCR.

19
Bibliografía
1. Aarrouf J, Garcin A, Lizzi Y, El Maâtaoui M, 2008. Immunolocalization and
histocytopathological effects of Xanthomonas arboricola pv. pruni on naturally
infected leaf and fruit tissues of peach (Prunus persica L. Batsch). Journal of
Phytopathology 156, 338–345.

2. Abby SS, Rocha EPC, 2012. The non-flagellar type III secretion system evolved
from the bacterial flagellum and diversified into host-cell adapted systems. PLoS
genetics 8, e1002983.

3. Ah-You N, Gagnevin L, Chiroleu F, Jouen E, Neto JR, Pruvost O, 2007.

Pathological variations within Xanthomonas campestris pv. mangiferaeindicae
support its separation into three distinct pathovars that can be distinguished by
amplified fragment length polymorphism. Phytopathology 97, 1568–1577.

4. Aini LQ, Hirata H, Tsuyumu S, 2010. A TonB-dependent transducer is

responsible for regulation of pathogenicity-related genes in Xanthomonas
axonopodis pv. citri. Journal of General Plant Pathology 76, 132–142.

5. Alfano JR, Collmer A, 2004. Type III secretion system effector proteins :
Double Agents in Bacterial Disease and plant defense. Annual review of
phytopathology 42, 385–414.

6. Alikhan N-F, Petty NK, Ben Zakour NL, Beatson SA, 2011. BLAST Ring
Image Generator (BRIG): simple prokaryote genome comparisons. BMC
genomics 12, 402.

7. Angiuoli S V, Gussman A, Klimke W et al., 2008. Toward an online repository

of Standard Operating Procedures (SOPs) for (meta)genomic annotation.
Omics : a journal of integrative biology 12, 137–41.

8. Anonymous, 2000. Council directive 2000/29/EC of 8 May 2000 on protective

measures against the introduction into the community of organism harmful to
plants or plant products and against their spread within the community. Off. J.
Eur. Commun L169, 1–112

1
9. Ashburner M, Ball CA, Blake JA et al., 2000. Gene Ontology: tool for the
unification of biology. Nat Genet 25, 25–29.

10. Aziz RK, Bartels D, Best AA et al., 2008. The RAST Server: rapid annotations
using subsystems technology. BMC genomics 9, 75.

11. Ballard E, Dietzgen R, Sly L, Gouk C, Horlock C, Fegan M, 2011. Development

of a Bio-PCR protocol for the detection of Xanthomonas arboricola pv. pruni.
Plant Disease 95, 1109–1115.

12. Barionovi D, Scortichini M, 2006. Assessment of integron gene cassette arrays

in strains of Xanthomonas fragariae and X. arboricola pvs. fragariae and pruni.
Journal of Plant Pathology 88, 279–284.

13. Bergsma-Vlami M, Martin W, Koenraadt H et al., 2012. Molecular typing of

Dutch isolates of Xanthomonas arboricola pv. pruni isolated from ornamental
cherry laurel. Journal of Plant Pathology 94, S1.29-S1.35.

14. Bi D, Liu L, Tai C, Deng Z, Rajakumar K, Ou H-Y, 2013. SecReT4: a web-

based bacterial type IV secretion system resource. Nucleic acids research 41,
D660-5.

15. Biondi E, Dallai D, Brunelli A, Bazzi C, Stefani E, 2009. Use of a bacterial

antagonist for the biological control of bacterial leaf/fruit spot of stone fruits.
IOBC Bulletin 43, 277–281.

16. Blanvillain S, Meyer D, Boulanger A et al., 2007. Plant carbohydrate

scavenging through TonB-dependent receptors: A feature shared by
phytopathogenic and aquatic bacteria. PLoS ONE 2, e244.

17. Blocker A, Komoriya K, Aizawa S-I, 2003a. Type III secretion systems and
bacterial flagella: insights into their function from structural similarities.
Proceedings of the National Academy of Sciences of the United States of
America 100, 3027–30.

18. Blom J, Albaum SP, Doppmeier D et al., 2009. EDGAR: a software framework
for the comparative analysis of prokaryotic genomes. BMC bioinformatics 10,
154.

19
19. Boch J, Bonas U, 2010. Xanthomonas AvrBs3 family-type III effectors:
discovery and function. Annual review of phytopathology 48, 419–36.

20. Bogdanove AJ, Koebnik R, Lu H et al., 2011. Two new complete genome
sequences offer insight into host and tissue specificity of plant pathogenic
Xanthomonas spp. Journal of Bacteriology 193, 5450–5464.

21. Bonas U, Stall RE, Staskawicz B, 1989. Genetic and structural characterization
of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria.
Molecular & general genetics 218, 127–136.

22. Borges CD, Vendruscolo CT, 2008. Xanthan synthesized by strains of

Xanthomonas campestris pv pruni: production, viscosity and chemical
composition. Bioscience Journal 23, 67-73.

23. Boudon S, Manceau C, Nottéghem J-L, 2005. Structure and origin of

Xanthomonas arboricola pv. pruni populations causing bacterial spot of stone
fruit trees in western Europe. Phytopathology 95, 1081–1088.

24. Bühlmann A, Pothier JF, Tomlinson JA et al., 2013. Genomics-informed design

of loop-mediated isothermal amplification for detection of phytopathogenic
Xanthomonas arboricola pv. pruni at the intraspecific level. Plant Pathology 62,
475–484.

25. Bull CT, de Boer SH, Denny TP et al., 2010. Comprehensive list of names of
plant pathogenic bacteria, 1980-2007. Journal of Plant Pathology 92, 551–592.

26. Bull CT, De Boer SH, Denny TP et al., 2012. List of new names of plant
pathogenic bacteria (2008-2010). Journal of Plant Pathology 94, 21–27.

27. Bull CT, De Boer SH, Denny TP et al., 2014. List of new names of plant
pathogenic bacteria (2008-2010). Journal of Plant Pathology 94, 21–27.

28. Burch AY, Shimada BK, Browne PJ, Lindow SE, 2010. Novel high-throughput
detection method to assess bacterial surfactant production. Applied and
environmental microbiology 76, 5363–72.

29. Burdman S, Bahar O, Parker JK, de la Fuente L, 2011. Involvement of type IV

pili in pathogenicity of plant pathogenic bacteria. Genes 2, 706–735.

19
30. Burokiene D, Pulawska J, 2012. Characterization of Xanthomonas arboricola
pv. juglandis isolated from walnuts in Lithuania. Journal of Plant Pathology 94,
S1.23-S1.27.

31. Büttner D, 2012. Protein Export According to Schedule: Architecture,

Assembly, and Regulation of Type III Secretion Systems from Plant- and
Animal-Pathogenic Bacteria. Microbiology and Molecular Biology Reviews 76,
262–310.

32. Büttner D, Bonas U, 2010. Regulation and secretion of Xanthomonas virulence

factors. FEMS Microbiology Reviews 34, 107–133.

33. Caraguel CGB, Stryhn H, Gagne N, Dohoo IR, Hammell KL, 2011. Selection of
a cutoff value for real-time polymerase chain reaction results to fit a diagnostic
purpose: analytical and epidemiologic approaches. Journal of Veterinary
Diagnostic Investigation 23, 2–15.

34. Casabuono A, Petrocelli S, Ottado J, Orellano EG, Couto AS, 2011. Structural
analysis and involvement in plant innate immunity of Xanthomonas axonopodis
pv. citri lipopolysaccharide. Journal of Biological Chemistry 286, 25628–25643.

35. Cesbron S, Briand M, Essakhi S et al., 2015. Comparative genomics of

pathogenic and nonpathogenic strains of Xanthomonas arboricola unveil
molecular and evolutionary events linked to pathoadaptation. Frontiers in plant
science 6, 1126.

36. Cesbron S, Pothier J, Gironde S, Jacques MA, Manceau C, 2014. Development

of multilocus variable-number tandem repeat analysis (MLVA) for
Xanthomonas arboricola pathovars. Journal of Microbiological Methods 100,
84–90.

37. Chagnot C, Zorgani M a, Astruc T, Desvaux M, 2013. Proteinaceous

determinants of surface colonization in bacteria: bacterial adhesion and biofilm
formation from a protein secretion perspective. Frontiers in microbiology 4,
303.

19
38. Chang JH, Desveaux D, Creason AL, 2014. The ABCs and 123s of bacterial
secretion systems in plant pathogenesis. Annual review of phytopathology 52,
317–45.

39. Chen S, Beeby M, Murphy GE et al., 2011. Structural diversity of bacterial

flagellar motors. The EMBO journal 30, 2972–81.

40. Cheung J, Hendrickson WA, 2010. Sensor domains of two-component

regulatory systems. Current Opinion in Microbiology 13, 116–123.

41. Chevance FF V, Hughes KT, 2008. Coordinating assembly of a bacterial

macromolecular machine. Nature reviews. Microbiology 6, 455–65.

42. Chevreux B, Wetter T, Suhai S, 1999. Genome sequence assembly using trace
signals and additional sequence information. In: Wingender E, ed. Computer
Science and Biology: Proceedings of the German Conference on Bioinformatics
(GCB) 99. Hannover, Germany: GBF-Braunschweig, Department of
Bioinfrormatics, 45–56.

43. Christensen P, Cook FD, 1978. Lysobacter, a New Genus of Nonhiting, Gliding
Bacteria with a High Base Ratio. International Journal of Systematic
Bacteriology 28, 367–393.

44. Christie PJ, 2004. Type IV secretion: the Agrobacterium VirB/D4 and related
conjugation systems. Biochimica et Biophysica Acta (BBA)-Molecular Cell
Research 1694, 219–234.

45. Christie PJ, Atmakuri K, Krishnamoorthy V, Jakubowski S, Cascales E, 2005.

biogenesis, architecture, and function of bacterial type IV secretion systems.
Annual review Microbiogy 59.

46. Christie PJ, Whitaker N, González-Rivera C, 2014. Mechanism and structure of

the bacterial type IV secretion systems. Biochimica et biophysica acta 1843,
1578–1591.

47. Cianciotto NP, 2005. Type II secretion: A protein secretion system for all
seasons. Trends in Microbiology 13, 581–588.

19
48. Civerolo E, Sasser M, Helkie C, Burbage D, 1982. Selective medium for
Xanthomonas campestris pv. pruni. Plant Disease 66, 39–43.

49. Collins FS, 1998. New goals for the U. S. Human Genome Project: 1998-2003.
Science 282, 682–689.

50. Conn HJ, 1942. Validity of the Genus Alcaligenes. Journal of Bacteriology 44,
353–360.

51. Costa TRD, Felisberto-Rodrigues C, Meir A et al., 2015. Secretion systems in

Gram-negative bacteria: structural and mechanistic insights. Nature Reviews
Microbiology 13, 343–359.

52. Craig L, Li J, 2008. Type IV pili: paradoxes in form and function. Current
opinion in structural biology 18, 267–77.

53. Craig L, Pique ME, Tainer JA, 2004. Type IV pilus structure and bacterial
pathogenicity. Nature Reviews Microbiology 2, 363–378.

54. Crossman L, Dow JM, 2004. Biofilm formation and dispersal in Xanthomonas
campestris. Microbes and infection 6, 623–9.

55. Darbari V, Waksman G, 2015. Structural biology of bacterial Type IV secretion

systems. Annual review of biochemistry 84, 603–29.

56. Darling ACE, Mau B, Blattner FR, Perna NT, 2004. Mauve: multiple alignment
of conserved genomic sequence with rearrangements. Genome Research 14,
1394–1403.

57. Darling AE, Mau B, Perna NT, 2010. progressiveMauve: multiple genome
alignment with gene gain, loss and rearrangement. PloS one 5, e11147.

58. Darsonval A, Darrasse A, Durand K, Bureau C, Cesbron S, Jacques M-A, 2009.

Adhesion and fitness in the bean phyllosphere and transmission to seed of
Xanthomonas fuscans subsp. fuscans. Molecular plant-microbe interactions 22,
747–757.

19
59. Das A, Rangaraj N, Sonti R V, 2009. Multiple adhesin-like functions of
Xanthomonas oryzae pv. oryzae are involved in promoting leaf attachment,
entry, and virulence on rice. Molecular plant-microbe interactions 22, 73–85.

60. Delcher A, 1999. Improved microbial gene identification with GLIMMER.

Nucleic Acids Research 27, 4636–4641.

61. Denancé N, Lahaye T, Noël LD, 2016. Editorial: Genomics and effectomics of
the crop killer Xanthomonas. Frontiers in plant science 7, 71.

62. Denny TP, 1995. Involvement of bacterial polysaccharides in plant

pathogenesis. Annual Review of Phytopathology 33, 173–197.

63. Van Domselaar GH, Stothard P, Shrivastava S et al., 2005. BASys: a web server
for automated bacterial genome annotation. Nucleic Acids Research 33, 455–
459.

64. Dowson DW, 1939. On the systematic position and generic names of the Gram
negative bacterial plant pathogens. Zentralblatt fur Bakteriologie,
Parasitenkunde und Infektionskrankheiten, 100, 177–193.

65. Dunger G, Guzzo CR, Andrade MO, Jones JB, Farah CS, 2014. Xanthomonas
citri subsp. citri type IV pilus is required for twitching motility, biofilm
development, and adherence. Molecular plant-microbe interactions : MPMI 27,
1132–47.

66. Dunger G, Llontop E, Guzzo CR, Farah CS, 2016. The Xanthomonas type IV
pilus. Current Opinion in Microbiology 30, 88–97.

67. Dunger G, Relling VM, Tondo ML et al., 2007. Xanthan is not essential for
pathogenicity in citrus canker but contributes to Xanthomonas epiphytic
survival. Archives of Microbiology 188, 127–135.

68. EFSA, 2014. Scientific opinion on pest categorisation of Xanthomonas

arboricola pv . pruni (Smith , 1903). EFSA Journal 12, 1–25.

69. European and Mediterranean Plant Protection Organization (EPPO), 2003. Data
sheets on quarantine pests. Xanthomonas arboricola pv. pruni. 1-5

19
70. Essakhi S, Cesbron S, Fischer-Le Saux M, Bonneau S, Jacques M-A, Manceau
C, 2015. Phylogenetic and VNTR analysis identified non-pathogenic lineages
within Xanthomonas arboricola lacking the canonical type three secretion
system. Applied and Environmental Microbiology 81, 5395-5410.

71. Euzéby J, 2004. Validation of publication of new names and new combinations
previously effectively published outside the IJSEM. International Journal of
Systematic and Evolutionary Microbiology 54, 1909–1910.

72. Euzéby J, 2007. List of new names and new combinations previously
effectively, but not validly, published. International Journal of Systematic and
Evolutionary Microbiology 57, 893–897.

73. Feng F, Zhou JM, 2012. Plant-bacterial pathogen interactions mediated by type
III effectors. Current Opinion in Plant Biology 15, 469–476.

74. Field D, Amaral-Zettler L, Cochrane G et al., 2011. The genomic standards

consortium. PLoS biology 9, e1001088.

75. Field D, Garrity G, Gray T et al., 2008. The minimum information about a
genome sequence (MIGS) specification. Nature Biotechnology 26, 541–547.

76. Filloux A, 2004. The underlying mechanisms of type II protein secretion.

Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1694, 163–
179.

77. Finn RD, Bateman A, Clements J et al., 2014. Pfam: the protein families
database. Nucleic acids research 42, D222-30.

78. Fischer-Le Saux M, Bonneau S, Essakhi S, Manceau C, Jacques MA, 2015.

Aggressive emerging pathovars of Xanthomonas arboricola represent
widespread epidemic clones distinct from poorly pathogenic strains, as revealed
by multilocus sequence typing. Applied and Environmental Microbiology 81,
4651–4668.

79. Gabriel DW, Kingsley MT, Hunter JE, Gottwald T, 1989. Reinstatement of
Xanthomonas citri (ex Hasse) and X. phaseoli (ex Smith) to species and

20
 reclassification of all X. campestris pv. citri strains. International Journal of
Systematic and Evolutionary Microbiology 39, 14–22.

80. Galan JE, Wolf-Watz H, 2006. Protein delivery into eukaryotic cells by type III
secretion machines. Nature 444, 567–573.

81. Galperin MY, Makarova KS, Wolf YI, Koonin E V, 2015. Expanded microbial
genome coverage and improved protein family annotation in the COG database.
Nucleic acids research 43, D261-9.

82. Garita-Cambronero J, Palacio-Bielsa A, López MM, Cubero J, 2016a. Draft

genome sequence for virulent and avirulent strains of Xanthomonas arboricola
isolated from Prunus spp. in Spain. Standards in Genomic Sciences 11, 12.

83. Garita-Cambronero J, Palacio-Bielsa A, López MM, Cubero J, 2016b.

Comparative genomic and phenotypic characterization of pathogenic and non-
pathogenic strains of Xanthomonas arboricola reveals insights into the infection
process of bacterial spot disease of stone fruits. PLoS ONE 11, e0161977.

84. Garita-Cambronero J, Palacio-Bielsa A, López MM, Cubero J, 2016c. Draft

genome sequence of two strains of Xanthomonas arboricola isolated from
Prunus persica which are dissimilar to strains that cause bacterial spot disease
on Prunus spp. Genome Announcements 4, e00974-16.

85. Garita-Cambronero J, Sena-Vélez M, Palacio-Bielsa A, Cubero J, 2014. Draft

Genome Sequence of Xanthomonas arboricola pv. pruni Strain Xap33, Causal
Agent of Bacterial Spot Disease on Almond. Genome announcements 2,
e00440-14.

86. Garita-Cambronero J, Sena-Vélez M, Sabuquillo P et al., 2013. Early steps in

the infection process in two Xanthomonas spp. models: chemotaxis and biofilm
formation. Acta Phytopathologica Sinica 43, 419.

87. Garrity GM, Bell J, Lilburn T, 2005a. Phylum XIV . Proteobacteria phyl. Nov.
In (GM Garrity, D Brenner, N Krieg, J Staley, Eds,) Bergey´s Manual of
Systematic Bacteriology. Volume 2 (Part B). 2nd Ed. New York: Springer.

20
88. Garrity GM, Bell J, Lilburn T, 2005b. Class III: Gammaproteobacteria Class.
nov. In (D Brenner, N Krieg, J Staley, G Garrity, Eds,) Bergey´s Manual of
Systematic Bacteriology. Volume 2 (Part B). 2nd Ed. New York: Springer.

89. Girgis HS, Liu Y, Ryu WS, Tavazoie S, 2007. A comprehensive genetic
characterization of bacterial motility. PLoS Genetics 3, 1644–1660.

90. Glick BR, 2015. Beneficial plant-bacterial interactions. Beneficial Plant-

Bacterial Interactions, 1–243.

91. Gordon JL, Lefeuvre P, Escalon A et al., 2015. Comparative genomics of 43

strains of Xanthomonas citri pv. citri reveals the evolutionary events giving rise
to pathotypes with different host ranges. BMC Genomics 16, 1098.

92. Gottig N, Garavaglia BS, Garofalo CG et al., 2010. Mechanisms of infection

used by Xanthomonas axonopodis pv . citri in citrus canker disease. Current
Research, Technology and Education Topics in Applied Microbiology and
Microbial Biotechnology, 196–204.

93. Gottig N, Garavaglia BS, Garofalo CG, Orellano EG, Ottado J, 2009. A
filamentous hemagglutinin-like protein of Xanthomonas axonopodis pv. citri,
the phytopathogen responsible for citrus canker, is involved in bacterial
virulence. PLoS ONE 4, e4358.

94. Goujon M, McWilliam H, Li W et al., 2010. A new bioinformatics analysis

tools framework at EMBL-EBI. Nucleic Acids Research 38, W695–W699.

95. Gourion B, Berrabah F, Ratet P, Stacey G, 2015. Rhizobium-legume symbioses:

The crucial role of plant immunity. Trends in Plant Science 20, 186–194.

96. Graham JH, Gottwald TR, 1991. Research perspectives on eradication of citrus
bacterial diseases in Florida. Plant Disease 75, 1193.

97. Grant JR, Stothard P, 2008. The CGView Server: a comparative genomics tool
for circular genomes. Nucleic acids research 36, 181–184.

98. Green ER, Mecsas J, 2016. Bacterial secretion systems – An overview.

Microbiology spectrum 4, 10.1128.

20
99. Guglielmini J, Néron B, Abby SS, Garcillán-Barcia MP, de la Cruz F, Rocha
EPC, 2014. Key components of the eight classes of type IV secretion systems
involved in bacterial conjugation or protein secretion. Nucleic acids research 42,
5715–27.

100. Guo-feng J, Lei-Lei W, Zheng-chun Z et al., 2015. Type IV secretion

system of Xanthomonas campestris pv. campestris is induced in MMX and
related to stress resistance. Acta Phytopathologica Sinica 45, 486–493.

101. Guo Y, Figueiredo F, Jones J, Wang N, 2011. HrpG and HrpX play
global roles in coordinating different virulence traits of Xanthomonas
axonopodis pv. citri. Molecular plant-microbe interactions : MPMI 24, 649–61.

102. Gürlebeck D, Thieme F, Bonas U, 2006. Type III effector proteins from
the plant pathogen Xanthomonas and their role in the interaction with the host
plant. Journal of Plant Physiology 163, 233–255.

103. Hagai E, Dvora R, Havkin-Blank T et al., 2014. Surface-motility

induction, attraction and hitchhiking between bacterial species promote dispersal
on solid surfaces. The ISME journal 8, 1147–51.

104. Hajri A, Brin C, Hunault G et al., 2009. A «repertoire for repertoire»

hypothesis: Repertoires of type three effectors are candidate determinants of host
specificity in Xanthomonas. PLoS ONE 4, e6632.

105. Hajri A, Meyer D, Delort F, Guillaumès J, Brin C, Manceau C, 2010.

Identification of a genetic lineage within Xanthomonas arboricola pv. juglandis
as the causal agent of vertical oozing canker of Persian (English) walnut in
France. Plant Pathology 59, 1014–1022.

106. Hajri A, Pothier JF, Saux MF Le et al., 2012. Type three effector gene
distribution and sequence analysis provide new insights into the pathogenicity of
plant-pathogenic Xanthomonas arboricola. Applied and Environmental
Microbiology 78, 371–384.

107. Hall T, 2011. BioEdit: an important software for molecular biology.

GERF Bulletin Biosciences 2, 60–61.

20
108. Hamman JH, 2010. Chitosan based polyelectrolyte complexes as
potential carrier materials in drug delivery systems. Marine Drugs 8, 1305–
1322.

109. Harrison J, Grant MR, Studholme DJ, 2016. Draft genome sequences of
two strains of Xanthomonas arboricola pv. celebensis isolated from banana
plants. Genome announcements 4, e01705-15.

110. Hayward AC, 1993. The hosts of Xanthomonas. In (Swings JG, Civerolo
EL) Xanthomonas. London, United Kingdom: Chapman & Hall. pp. 1-119.

111. He Y-W, Zhang L-H, 2008. Quorum sensing and virulence regulation in
Xanthomonas campestris. FEMS microbiology reviews 32, 842–57.

112. Higuera G, González-Escalona N, Véliz C, Vera F, Romero J, 2015.

Draft genome sequences of four Xanthomonas arboricola pv. juglandis strains
associated with walnut blight in Chile. Genome announcements 3, e01160-15.

113. Hori K, Matsumoto S, 2010. Bacterial adhesion: From mechanism to

control. Biochemical Engineering Journal 48, 424–434.

114. Horner-Devine MC, Carney KM, Bohannan BJM, 2004. An ecological

perspective on bacterial biodiversity. Proceedings. Biological sciences 271,
113–122.

115. Hu R-M, Yang T-C, Yang S-H, Tseng Y-H, 2005. Deduction of
upstream sequences of Xanthomonas campestris flagellar genes responding to
transcription activation by FleQ. Biochemical and Biophysical Research
Communications 335, 1035–1043.

116. Huson DH, Richter DC, Rausch C, Dezulian T, Franz M, Rupp R, 2007.
Dendroscope: an interactive viewer for large phylogenetic trees. BMC
bioinformatics 8, 460.

117. Hyatt D, Chen G-L, Locascio PF, Land ML, Larimer FW, Hauser LJ,
2010. Prodigal: prokaryotic gene recognition and translation initiation site
identification. BMC bioinformatics 11, 119.

20
118. Ibarra Caballero J, Zerillo MM, Snelling J, Boucher C, Tisserat N, 2013.
Genome sequence of Xanthomonas arboricola pv. corylina, isolated from
Turkish filbert in Colorado. Genome announcements 1, e00246-13.

119. Ignatov AN, Kyrova EI, Vinogradova S V, Kamionskaya AM, Schaad

NW, Luster DG, 2015. Draft genome sequence of Xanthomonas arboricola
strain 3004, a causal agent of bacterial disease on barley. Genome
announcements 3, e01572-14.

120. Ikeda T, Oosawa K, Hotani H, 1996. Self-assembly of the filament

capping protein, FliD, of bacterial flagella into an annular structure. Journal of
molecular biology 259, 679–686.

121. Jacob TR, De Laia ML, Moreira LM et al., 2014. Type IV secretion
system is not involved in infection process in citrus. International Journal of
Microbiology 2014, 763575.

122. Jacobs JM, Pesce C, Lefeuvre P, Koebnik R, 2015. Comparative

genomics of a cannabis pathogen reveals insight into the evolution of
pathogenicity in Xanthomonas. Frontiers in plant science 6, 431.

123. Jacques M-A, Arlat M, Boulanger A et al., 2016. Using ecology,

physiology, and genomics to understand host specificity in Xanthomonas.
Annual Review of Phytopathology 54, 163–187.

124. Jakubowski SJ, Krishnamoorthy V, Christie PJ, 2003. Agrobacterium

tumefaciens VirB6 protein participates in formation of VirB7 and VirB9
complexes required for type IV secretion. Journal of Bacteriology 185, 2867–
2878.

125. Jalan N, Aritua V, Kumar D et al., 2011. Comparative genomic analysis

of Xanthomonas axonopodis pv. citrumelo F1, which causes citrus bacterial spot
disease, and related strains provides insights into virulence and host specificity.
Journal of Bacteriology 193, 6342–6357.

126. Jalan N, Kumar D, Yu F, Jones JB, Graham JH, Wang N, 2013.

Complete genome sequence of Xanthomonas citri subsp. citri strain Aw12879, a

20
 restricted-host-range citrus canker-causing bacterium. Genome Announcements
1, e00235-13.

127. Jehl M-A, Arnold R, Rattei T, 2011. Effective-a database of predicted

secreted bacterial proteins. Nucleic acids research 39, D591-5.

128. Jeong K-S, Lee S-E, Han J-W et al., 2008. Virulence reduction and
differing regulation of virulence genes in rpf mutants of Xanthomonas oryzae
pv. oryzae. The Plant Pathology Journal 24, 143–151.

129. Jha G, Rajeshwari R, Sonti R V, 2005. Bacterial type two secretion

system secreted proteins: double-edged swords for plant pathogens. Molecular
plant-microbe interactions 18, 891–898.

130. Juhas M, Crook DW, Dimopoulou ID et al., 2007. Novel type IV

secretion system involved in propagation of genomic islands. Journal of
Bacteriology 189, 761–771.

131. Kaluzna M, Pulawska J, Waleron M, Sobiczewski P, 2014. The genetic

characterization of Xanthomonas arboricola pv. juglandis, the causal agent of
walnut blight in Poland. Plant Pathology 63, 1404–1416.

132. Kamoun S, Kado CI, 1990. Phenotypic switching affecting chemotaxis,

xanthan production, and virulence in Xanthomonas campestris. Applied and
environmental microbiology 56, 3855–60.

133. Katoh K, Misawa K, Kuma K, Miyata T, 2002. MAFFT: a novel method

for rapid multiple sequence alignment based on fast Fourier transform. Nucleic
acids research 30, 3059–3066.

134. Katzen F, Ferreiro DU, Oddo CG et al., 1998. Xanthomonas campestris

pv. campestris gum mutants: effects on xanthan biosynthesis and plant
virulence. Journal of Bacteriology 180, 1607–1617.

135. Kawaguchi A, 2014. Genetic diversity of Xanthomonas arboricola pv.

pruni strains in Japan revealed by DNA fingerprinting. Journal of General Plant
Pathology 80, 366–369.

20
136. Kay S, Bonas U, 2009. How Xanthomonas type III effectors manipulate
the host plant. Current Opinion in Microbiology 12, 37–43.

137. Kearns DB, 2010. A field guide to bacterial swarming motility. Nature
reviews. Microbiology 8, 634–44.

138. Kim JS, Chang JH, Chung S Il, Yum JS, 1999. Molecular cloning and
characterization of the Helicobacter pylori fliD gene, an essential factor in
flagellar structure and motility. Journal of Bacteriology 181, 6969–6976.

139. Kim JG, Stork W, Mudgett MB, 2013. Xanthomonas type III effector
XopD desumoylates tomato transcription factor SlERF4 to suppress ethylene
responses and promote pathogen growth. Cell Host and Microbe 13, 143–154.

140. Kohler T, Curty LK, Barja F, van Delden C, Pechere J-C, 2000.
Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling
and requires flagella and pili. Journal of Bacteriology 182, 5990–5996.

141. Korotkov K V, Sandkvist M, Hol WGJ, 2012. The type II secretion

system: biogenesis, molecular architecture and mechanism. Nature Reviews
Microbiology 10, 336–351.

142. Kostakioti M, Hadjifrangiskou M, Hultgren SJ, 2013. Bacterial biofilms:

development, dispersal, and therapeutic strategies in the dawn of the
postantibiotic era. Cold Spring Harbor perspectives in medicine 3, 1–23.

143. Kraiselburd I, Daurelio LD, Tondo ML et al., 2013. The LOV protein of
Xanthomonas citri subsp. citri plays a significant role in the counteraction of
plant immune responses during citrus canker. PloS ONE 8, e80930.

144. Krogh A, Larsson B, von Heijne G, Sonnhammer EL, 2001. Predicting

transmembrane protein topology with a hidden Markov model: application to
complete genomes. Journal of molecular biology 305, 567–80.

145. Lagacé L, Pitre M, Jacques M, Roy D, 2004. Identification of the

bacterial community of maple sap by using amplified ribosomal DNA ( rDNA )
restriction analysis and rDNA sequencing. Applied and Environmental
Microbiology 70, 2052–2060.

20
146. Lagesen K, Hallin P, Rødland EA, Staerfeldt H-H, Rognes T, Ussery
DW, 2007. RNAmmer: consistent and rapid annotation of ribosomal RNA
genes. Nucleic acids research 35, 3100–8.

147. Lamichhane JR, 2014. Xanthomonas arboricola diseases of stone fruit,

almond, and walnut trees: progress toward understanding and management.
Plant Disease 98, 1600–1610.

148. Lamichhane JR, Varvaro L, 2014. Xanthomonas arboricola disease of

hazelnut: current status and future perspectives for its management. Plant
Pathology 63, 243–254.

149. Land M, Hauser L, Jun S-R et al., 2015. Insights from 20 years of
bacterial genome sequencing. Functional & integrative genomics 15, 141–61.

150. Lee BM, Park YJ, Park DS et al., 2005. The genome sequence of
Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight
pathogen of rice. Nucleic Acids Research 33, 577–586.

151. Li RF, Lu GT, Li L et al., 2014. Identification of a putative cognate

sensor kinase for the two-component response regulator HrpG, a key regulator
controlling the expression of the hrp genes in Xanthomonas campestris pv.
campestris. Environmental Microbiology 16, 2053–2071.

152. López-Soriano P, Boyer K, Cesbron S et al., 2016. Multilocus variable

number of tandem repeat analysis reveals multiple introductions in Spain of
Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot disease of
stone fruits and almond. PLoS ONE 11, e0163729.

153. López MM, Roselló M, Palacio-Bielsa A, 2010. Diagnosis and detection

of the main bacterial pathogens of stone fruit and almond. Journal of Plant
Pathology 92.

154. Loria R, Kers J, Joshi M, 2006. Evolution of plant pathogenicity in

Streptomyces. Annual review of phytopathology 44, 469–487.

20
155. Lowe TM, Eddy SR, 1997. tRNAscan-SE: a program for improved
detection of transfer RNA genes in genomic sequence. Nucleic Acids Research
25, 955–964.

156. Löytynoja A, Goldman N, 2008. Phylogeny-aware gap placement

prevents errors in sequence alignment and evolutionary analysis. Science (New
York, N.Y.) 320, 1632–5.

157. Macwilliams MP, Liao M, 2006. Luria broth ( LB ) and Luria agar ( LA )
media and their uses protocol. In ASM MicrobeLibrary. American Society for
Microbiology.
[Link]

158. Maharjan RP, Seeto S, Ferenci T, 2007. Divergence and redundancy of

transport and metabolic rate-yield strategies in a single Escherichia coli
population. Journal of bacteriology 189, 2350–8.

159. Malamud F, Homem RA, Conforte VP et al., 2013. Identification and

characterization of biofilm formation-defective mutants of Xanthomonas citri
subsp. citri. Microbiology (United Kingdom) 159, 1911–1919.

160. Malamud F, Torres PS, Roeschlin R et al., 2011. The Xanthomonas

axonopodis pv. citri flagellum is required for mature biofilm and canker
development. Microbiology 157, 819–829.

161. Mansfield J, Genin S, Magori S et al., 2012. Top 10 plant pathogenic

bacteria in molecular plant pathology. Molecular plant pathology 13, 614–29.

162. Marcelletti S, Ferrante P, Scortichini M, 2010. Multilocus sequence

typing reveals relevant genetic variation and different evolutionary dynamics
among strains of Xanthomonas arboricola pv. juglandis. Diversity 2, 1205–
1222.

163. Marchler-Bauer A, Derbyshire MK, Gonzales NR et al., 2014. CDD:

NCBI’s conserved domain database. Nucleic acids research 43, D222-6.

164. Marcone C, 2014. Molecular biology and pathogenicity of phytoplasmas.

Annals of Applied Biology 165, 199–221.

20
165. Martínez-García PM, Ramos C, Rodríguez-Palenzuela P, 2015.
T346Hunter: A novel web-based tool for the prediction of type III, type IV and
type VI secretion systems in bacterial genomes. PLoS ONE 10, e0119317.

166. Massomo SMS, Nielsen H, Mabagala RB, Mansfeld-Giese K,

Hockenhull J, Mortensen CN, 2003. Identification and characterisation of
Xanthomonas campestris pv. campestris strains from Tanzania by pathogenicity
tests, biolog, rep-PCR and fatty acid methyl ester analysis. European Journal of
Plant Pathology 109, 775–789.

167. Mattick JS, 2002. Type IV pili and twitching motility. Annual review of
microbiology 56, 289–314.

168. Mayer L, Vendruscolo CT, Silva WP da, Vorhölter FJ, Becker A, Pühler
A, 2011. Insights into the genome of the xanthan-producing phytopathogen
Xanthomonas arboricola pv. pruni 109 by comparative genomic hybridization.
Journal of Biotechnology 155, 40–49.

169. Mhedbi-Hajri N, Darrasse A, Pigné S et al., 2011. Sensing and adhesion

are adaptive functions in the plant pathogenic xanthomonads. BMC evolutionary
biology 11, 67.

170. Molinaro A, Evidente A, Cantore P lo et al., 2003. Structural

determination of a novel O-chain polysaccharide of the lipopolysaccharide from
the bacterium Xanthomonas campestris pv. pruni. European Journal of Organic
Chemistry, 2254–2259.

171. Van den Mooter M, Swings J, 1990. Numerical analysis of 295

phenotypic features of 266 Xanthomonas strains and related strains and an
improved taxonomy of the genus. International journal of systematic
bacteriology 40, 348–369.

172. Moreira LM, Almeida NF, Potnis N et al., 2010. Novel insights into the
genomic basis of citrus canker based on the genome sequences of two strains of
Xanthomonas fuscans subsp. aurantifolii. BMC Genomics 11, 238.

173. Moreira LM, Facincani AP, Ferreira CB et al., 2015. Chemotactic signal
transduction and phosphate metabolism as adaptive strategies during citrus

21
 canker induction by Xanthomonas citri. Functional and Integrative Genomics
15, 197–210.

174. Moreira AS, Vendruscolo JLS, Gil-Turnes C, Vendruscolo CT, 2001.

Screening among 18 novel strains of Xanthomonas campestris pv pruni. Food
Hydrocolloids 15, 469–474.

175. Moreno-hagelsieb G, Santoyo G, Moreno-hagelsieb G, Orozco-

mosqueda C, 2016. Santoyo et al 2016. Plant growth-promoting bacterial
endophytes. Microbiological Research 118, 92-99.

176. Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R,

Schäffer AA, 2008. Database indexing for production MegaBLAST searches.
Bioinformatics 24, 1757–64.

177. Morris CE, Monier J-M, 2003. The ecological significance of biofilm
formation by plant-associated bacteria. Annual Review of Phytopathology 41,
429–453.

178. Mwangi M, Bandyopadhyay R, Ragama P, Tushemereirwe WK, 2007.

Assessment of banana planting practices and cultivar tolerance in relation to
management of soilborne Xanthomonas campestris pv musacearum. Crop
Protection 26, 1203–1208.

179. Nagai H, Kubori T, 2011. Type IVB secretion systems of Legionella and
other gram-negative bacteria. Frontiers in Microbiology 2, 1–12.

180. Nascimento R, Gouran H, Chakraborty S et al., 2016. The type II

secreted lipase/esterase LesA is a key virulence factor required for Xylella
fastidiosa pathogenesis in grapevines. Scientific reports 6, 18598.

181. Naushad S, Adeolu M, Wong S, Sohail M, Schellhorn HE, Gupta RS,

2015. A phylogenomic and molecular marker based taxonomic framework for
the order Xanthomonadales: proposal to transfer the families Algiphilaceae and
Solimonadaceae to the order Nevskiales ord. nov. and to create a new family
within the order Xanthomonadales, . Antonie van Leeuwenhoek 107, 467–485.

21
182. National Center for Biotechnology Information (NCBI), 2016. How to:
find a homolog for a gene in another organism.
[Link]

183. Niño-Liu DO, Ronald PC, Bogdanove AJ, 2006. Xanthomonas oryzae
pathovars: model pathogens of a model crop. Molecular Plant Pathology 7,
303–324.

184. Noinaj N, Guillier M, Barnard TJ, Buchanan SK, 2010. TonB-dependent

transporters: regulation, structure, and function. Annual review of microbiology
64, 43–60.

185. Oliveira LC, Souza DP, Oka GU et al., 2016. VirB7 and VirB9
interactions are required for the assembly and antibacterial activity of a type IV
secretion system. Structure 24, 1707–1718.

186. Oren A, Garrity GM, 2015. Notification of changes in taxonomic opinion

previously published outside the IJSEM. International Journal of Systematic
and Evolutionary Microbiology 65, 2028–2029.

187. Ozaktan H, Erdal M, Akkopru a, Aslan E, 2012. Biological control of

bacterial blight of walnut by antagonistic bacteria. Journal of Plant Pathology
94, S1.53-S1.56.

188. Pagani M, 2004. An ABC transporter protein and molecular diagnoses of

Xanthomonas arboricola pv. pruni causing bacterial spot of stone fruits.

189. Page AJ, Cummins CA, Hunt M et al., 2015. Roary: rapid large-scale
prokaryote pan genome analysis. Bioinformatics 31, 3691–3693.

190. Palacio-Bielsa A, Beruete I, López MM et al., 2015a. La mancha

bacteriana de los frutales de hueso y del almendro (Xanthomonas arboricola pv.
pruni) en España y Sudamérica. Phytoma 271, 21–28.

191. Palacio-Bielsa A, Cambra MA, Cubero J, Garita-Cambronero J, Roselló

M, López MM, 2014. La mancha bacteriana de los frutales de hueso y del
almencro (Xanthomonas arboricola pv. pruni), una grave enfermedad emergente
en España. Phytoma 259, 36–42.

21
192. Palacio-Bielsa A, Cubero J, Cambra MA, Collados R, Berruete IM,
López MM, 2011. Development of an efficient real-time quantitative PCR
protocol for detection of Xanthomonas arboricola pv. pruni in Prunus species.
Applied and Environmental Microbiology 77, 89–97.

193. Palacio-Bielsa A, López-Soriano P, Bühlmann A et al., 2015b.

Evaluation of a real-time PCR and a loop-mediated isothermal amplification for
detection of Xanthomonas arboricola pv. pruni in plant tissue samples. Journal
of microbiological methods 112, 36–9.

194. Palacio-Bielsa A, Pothier J, Roselló M, Duffy B, López MM, 2012.

Detection and identification methods and new tests as developed and used in the
framework of cost 873 for bacteria pathogenic to stone fruits and nuts. Journal
of Plant Pathology 94, S1.135-S1.146.

195. Papenfort K, Bassler BL, 2016. Quorum sensing signal-response systems

in Gram-negative bacteria. Nature reviews. Microbiology 14, 576–88.

196. Park SY, Lee YS, Koh YJ, Hur JS, Jung JS, 2010. Detection of
Xanthomonas arboricola pv. pruni by PCR using primers based on DNA
sequences related to the hrp genes. Journal of Microbiology 48, 554–558.

197. Parkinson N, Cowie C, Heeney J, Stead D, 2009. Phylogenetic structure

of Xanthomonas determined by comparison of gyrB sequences. International
Journal of Systematic and Evolutionary Microbiology 59, 264–274.

198. Patil PB, Bogdanove AJ, Sonti R V, 2007. The role of horizontal transfer
in the evolution of a highly variable lipopolysaccharide biosynthesis locus in
xanthomonads that infect rice, citrus and crucifers. BMC evolutionary biology 7,
243.

199. Pelicic V, 2008. Type IV pili: e pluribus unum? Molecular Microbiology

68, 827–837.

200. Peñalver J, Navarro I, López MM, Marco-Noales E, 2016. Optimización

de protocolod de detección de Xanthomonas arboricola pv. pruni en frutales de
hueso y almendro. In: XVIII Congreso de la Sociedad Española de
Fitopatología. Palencia, España, 321.

21
201. Pereira UP, Gouran H, Nascimento R, Adaskaveg JE, Goulart LR,
Dandekar AM, 2015. Complete genome sequence of Xanthomonas arboricola
pv. juglandis 417, a copper-resistant strain isolated from Juglans regia L.
Genome announcements 3, e01126-15.

202. Petersen TN, Brunak S, von Heijne G, Nielsen H, 2011. SignalP 4.0:
discriminating signal peptides from transmembrane regions. Nature methods 8,
785–6.

203. Petrocelli S, Tondo ML, Daurelio LD, Orellano EG, 2012. Modifications
of Xanthomonas axonopodis pv. citri lipopolysaccharide affect the basal
response and the virulence process during citrus canker. PLoS ONE 7, e40051.

204. Pfeilmeier S, Caly DL, Malone JG, 2016. Bacterial pathogenesis of

plants: future challenges from a microbial perspective: challenges in bacterial
molecular plant pathology. Molecular plant pathology 7, 1298–1313.

205. Pieretti I, Royer M, Barbe V et al., 2012. Genomic insights into strategies
used by Xanthomonas albilineans with its reduced artillery to spread within
sugarcane xylem vessels. BMC genomics 13, 658.

206. Plessis H Du, 1984. Scanning electron microscopy of Xanthomonas

campestris pv . pruni in plum petioles and buds. Phytopathologische Zeitschrift
109, 277–284.

207. Popov G, Fraiture M, Brunner F, Sessa G, 2016. Multiple Xanthomonas

euvesicatoria type III effectors inhibit flg22-Triggered immunity. Molecular
plant-microbe interactions 29, 651–660.

208. Posada D, 2008. jModelTest: phylogenetic model averaging. Molecular

biology and evolution 25, 1253–6.

209. Posada D, Buckley TR, 2004. Model selection and model averaging in
phylogenetics: advantages of akaike information criterion and bayesian
approaches over likelihood ratio tests. Systematic biology 53, 793–808.

210. Pothier JF, Pagani MC, Pelludat C, Ritchie DF, Duffy B, 2011a. A
duplex-PCR method for species- and pathovar-level identification and detection

21
 of the quarantine plant pathogen Xanthomonas arboricola pv. pruni. Journal of
Microbiological Methods 86, 16–24.

211. Pothier JF, Smits THM, Blom J et al., 2011b. Complete genome
sequence of the stone fruit pathogen Xanthomonas arboricola pv. pruni.
Phytopathology 101, S144–S145.

212. Pothier JF, Vorhölter FJ, Blom J et al., 2011c. The ubiquitous plasmid
pXap41 in the invasive phytopathogen Xanthomonas arboricola pv. pruni:
complete sequence and comparative genomic analysis. FEMS Microbiology
Letters 323, 52–60.

213. Potnis N, Krasileva K, Chow V et al., 2011. Comparative genomics

reveals diversity among xanthomonads infecting tomato and pepper. BMC
genomics 12, 146.

214. Qian W, Han Z-J, He C, 2008. Two-component signal transduction

systems of Xhanthomonas spp.: a lesson from genomics. Molecular plant-
microbe interaction 21, 151–161.

215. Randhawa P, Civerolo E, 1986. Interaction of Xanthomonas campestris

pv. pruni with pruniphage and epiphytic bacteria on detached peach leaves.
Phytopathology 76, 549–553.

216. Ray SK, Rajeshwari R, Sharma Y, Sonti R V., 2002. A high-molecular-

weight outer membrane protein of Xanthomonas oryzae [Link] exhibits
similarity to non-fimbrial adhesins of animal pathogenic bacteria and is required
for optimum virulence. Molecular Microbiology 46, 637–647.

217. Rigano L a, Siciliano F, Enrique R et al., 2007. Biofilm formation,

epiphytic fitness, and canker development in Xanthomonas axonopodis pv. citri.
Molecular plant-microbe interactions 20, 1222–1230.

218. Rodriguez-R LM, Grajales A, Arrieta-Ortiz M, Salazar C, Restrepo S,

Bernal A, 2012. Genomes-based phylogeny of the genus Xanthomonas. BMC
Microbiology 12, 43.

21
219. Roselló M, Santiago R, Palacio-Bielsa A et al., 2012. Current status of
bacterial spot of stone fruits and almond caused by Xanthomonas arboricola pv.
pruni in Spain. Journal of Plant Pathology 94, 15–21.

220. Rosenblueth M, Martínez-Romero E, 2006. Bacterial endophytes and

their interactions with hosts. Molecular plant-microbe interactions : MPMI 19,
827–837.

221. Rossez Y, Wolfson EB, Holmes A, Gally DL, Holden NJ, 2015.
Bacterial flagella: twist and stick, or dodge across the kingdoms. PLoS
Pathogens 11, e1004483.

222. Runyen-Janecky L, 2014. Transduction of environmental signals by

prokaryotic two-component regulatory systems. Molecular life Sciences, 1-7.

223. Ryan RP, Vorhölter F-J, Potnis N et al., 2011. Pathogenomics of

Xanthomonas: understanding bacterium-plant interactions. Nature reviews.
Microbiology 9, 344–355.

224. Sabuquillo P, Cubero J, 2016. Composición de la matriz extracelular de

biofilms en Xanthomonas arboricola pv. pruni. In: XVIII Congreso de la
Sociedad Española de Fitopatología. Palencia, España, 101.

225. Schattner P, Brooks AN, Lowe TM, 2005. The tRNAscan-SE, snoscan
and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic
acids research 33, W686-9.

226. Scortichini M, 2004. Xanthomonas arboricola pv. corylina. EPPO

Bulletin 34, 179–181.

227. Scortichini M, 2010. Epidemiology and predisposing factors of some

major bacterial diseases of stone and nut fruit trees species. Journal of Plant
Pathology 92, S73–S78.

228. Scortichini M, Rossi MP, Marchesi U, 2002. Genetic, phenotypic and

pathogenic diversity of Xanthomonas arboricola pv. corylina strains question
the representative nature of the type strain. Plant Pathology 51, 374–381.

21
229. Seemann T, 2014. Prokka: rapid prokaryotic genome annotation.
Bioinformatics 30, 2068–2069.

230. Sena-Vélez M, 2015. Mecanismos implicados en las etapas iniciales de

infección en la cancrosis de los cítricos provocada por Xanthomonas citri subsp.
citri. Doctoral dissertation. Politechnic University of Madrid.
[Link]

231. Sena-Vélez M, Redondo C, Gell I et al., 2015. Biofilm formation and

motility of Xanthomonas strains with different citrus host range. Plant
Pathology 64, 767–775.

232. Sena-Vélez M, Redondo C, Graham JH, Cubero J, 2016. Presence of

extracellular DNA during biofilm formation by Xanthomonas citri subsp. citri
strains with different host range. PLoS ONE 11, 1–17.

233. Shen Y, Chern M, Silva FG, Ronald P, 2001. Isolation of a Xanthomonas

oryzae pv. oryzae flagellar operon region and molecular characterization of flhF.
Molecular plant-microbe interactions 14, 204–13.

234. Shepard DP, Zehr EI, Bridges WC, 1999. Increased susceptibility to
bacterial spot of peach trees growing in soil infested with Criconemella
xenoplax. Plant Disease 83, 961–963.

235. Sherif S, El-Sharkawy I, Paliyath G, Jayasankar S, 2012. Differential

expression of peach ERF transcriptional activators in response to signaling
molecules and inoculation with Xanthomonas campestris pv. pruni. Journal of
Plant Physiology 169, 731–739.

236. Shrivastava S, Mande SS, 2008. Identification and functional

characterization of gene components of type VI secretion system in bacterial
genomes. PLoS ONE 3, e2955.

237. Siciliano F, Torres P, Sendín L et al. Analysis of the molecular basis of

Xanthomonas axonopodis pv. citri pathogenesis in Citrus limon. Electronic
Journal of Biotechnology 9, 200-204.

21
238. da Silva a CR, Ferro J a, Reinach FC et al., 2002. Comparison of the
genomes of two Xanthomonas pathogens with differing host specificities.
Nature 417, 459–463.

239. Da Silva FR, Vettore AL, Kemper EL, Leite A, Arruda P, 2001.
Fastidian gum: the Xylella fastidiosa exopolysaccharide possibly involved in
bacterial pathogenicity. FEMS Microbiology Letters 203, 165–171.

240. Silva Vasconcellos FC Da, de Oliveira AG, Lopes-Santos L et al., 2014.

Evaluation of antibiotic activity produced by Pseudomonas aeruginosa LV
strain against Xanthomonas arboricola pv. pruni. Agricultural Sciences 5, 71–
76.

241. Simpson AJ, Reinach FC, Arruda P et al., 2000. The genome sequence of
the plant pathogen Xylella fastidiosa. The Xylella fastidiosa consortium of the
organization for nucleotide sequencing and analysis. Nature 406, 151–159.

242. Skerman VBD, Sneath PHA, McGowan V, 1980. Approved lists of

bacterial names. International Journal of Systematic and Evolutionary
Microbiology 30, 225–420.

243. Snipen L, Liland KH, 2015. micropan: an R-package for microbial pan-
genomics. BMC Bioinformatics 16, 79.

244. Snipen L, Ussery DW, 2010. Standard operating procedure for

computing pangenome trees. Standards in Genomic Sciences 2, 135–141.

245. Socquet-Juglard D, Duffy B, Pothier JF, Christen D, Gessler C, Patocchi

A, 2013a. Identification of a major QTL for Xanthomonas arboricola pv. pruni
resistance in apricot. Tree Genetics and Genomes 9, 409–421.

246. Socquet-Juglard D, Kamber T, Pothier JF et al., 2013b. Comparative

RNA-seq analysis of early-infected peach leaves by the invasive phytopathogen
Xanthomonas arboricola pv. pruni. PloS one 8, e54196.

247. Socquet-Juglard D, Patocchi A, Pothier JF, Christen D, Duffy B, 2012.

Evaluation of Xanthomonas arboricola pv. pruni inoculation techniques to

21
 screen for bacterial spot resistance in peach and apricot. Journal of Plant
Pathology 94, S1.91-S1.96.

248. Solé M, Scheibner F, Hoffmeister A-K et al., 2015. Xanthomonas

campestris pv. vesicatoria secretes proteases and xylanases via the Xps type II
secretion system and outer membrane vesicles. Journal of Bacteriology 197,
2879–2893.

249. Song C, Yang B, 2010. Mutagenesis of 18 type III effectors reveals

virulence function of XopZ (PXO99) in Xanthomonas oryzae pv. oryzae.
Molecular plant-microbe interactions 23, 893–902.

250. Souza DP, Andrade MO, Alvarez-Martinez CE, Arantes GM, Farah CS,
Salinas RK, 2011. A component of the Xanthomonadaceae type IV secretion
system combines a VirB7 motif with a NO domain found in outer membrane
transport proteins. PLoS Pathogens 7, e1002031.

251. Souza DP, Oka GU, Alvarez-Martinez CE et al., 2015. Bacterial killing
via a type IV secretion system. Nature Communications 6, 6453.

252. Srivastava D, Waters CM, 2012. A tangled web: regulatory connections

between quorum sensing and cyclic Di-GMP. Journal of Bacteriology 194,
4485–4493.

253. Stamatakis A, 2014. RAxML version 8: a tool for phylogenetic analysis

and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313.

254. Stefani E, 2010. Economic significance and control of bacterial

spot/canker of stone fruits caused by Xanthomonas arboricola pv. pruni.
Journal of Plant Pathology 92, S1.99-S1.103.

255. Stothard P, Wishart DS, 2005. Circular genome visualization and

exploration using CGView. Bioinformatics 21, 537–9.

256. Stoyanova M, Vancheva T, Moncheva P, Bogatzevska N, 2014.

Differentiation of Xanthomonas spp. causing bacterial spot in Bulgaria based on
Biolog system. International journal of microbiology, 495476.

21
257. Subramoni S, Suárez-Moreno ZR, Venturi V, 2010. Lipases as
pathogenicity factors of plant pathogens. In (Timmis KN, eds) Handbook of
hydrocarbon and lipid microbiology. Springer, 3269–3277.

258. Sun W, Dunning FM, Pfund C, Weingarten R, Bent AF, 2006. Within-
species flagellin polymorphism in Xanthomonas campestris pv campestris and
its impact on elicitation of Arabidopsis FLAGELLIN SENSING2-dependent
defenses. The Plant cell 18, 764–79.

259. Szczesny R, Jordan M, Schramm C et al., 2010. Functional

characterization of the Xcs and Xps type II secretion systems from the plant
pathogenic bacterium Xanthomonas campestris pv vesicatoria. New Phytologist
187, 983–1002.

260. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S, 2011.

MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Molecular biology
and evolution 28, 2731–9.

261. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013. MEGA6:

molecular evolutionary genetics analysis version 6.0. Molecular biology and
evolution 30, 2725–9.

262. Tarkowski P, Vereecke D, 2014. Threats and opportunities of plant

pathogenic bacteria. Biotechnology Advances 32, 215–229.

263. Tatusov RL, 2000. The COG database: a tool for genome-scale analysis
of protein functions and evolution. Nucleic Acids Research 28, 33–36.

264. Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Ciufo S, Li W,

2013. Prokaryotic Genome Annotation Pipeline. In (J Beck, D Benson, J
Coleman, et al., Eds,) NCBI Handbook. Bethesda (MD), US: National Center
for Biotechnology Information.
[Link]

265. Terashima H, Kojima S, Homma M, 2008. Flagellar Motility in Bacteria.

Structure and Function of Flagellar Motor. International Review of Cell and
Molecular Biology 270, 39-85.

22
266. Tettelin H, Riley D, Cattuto C, Medini D, 2008. Comparative genomics:
the bacterial pan-genome. Current Opinion in Microbiology 11, 472–477.

267. Tjou-Tam-Sin NNA, van de Bilt JLJ, Bergsma-Vlami M et al., 2012.

First report of Xanthomonas arboricola pv. pruni in ornamental Prunus
laurocerasus in the Netherlands. Plant Disease 96, 759.

268. Trébaol G, Manceau C, Tirilly Y, Boury S, 2001. Assessment of the

genetic diversity among strains of Xanthomonas cynarae by randomly amplified
polymorphic DNA analysis and development of specific characterized amplified
regions for the rapid identification of X. cynarae. Applied and Environmental
Microbiology 67, 3379–3384.

269. Triplett LR, Hamilton JP, Buell CR et al., 2011. Genomic analysis of
Xanthomonas oryzae isolates from rice grown in the united states reveals
substantial divergence from known X. oryzae pathovars. Applied and
Environmental Microbiology 77, 3930–3937.

270. Vandroemme J, Cottyn B, Baeyen S, De Vos P, Maes M, 2013. Draft

genome sequence of Xanthomonas fragariae reveals reductive evolution and
distinct virulence-related gene content. BMC genomics 14, 829.

271. Vauterin L, Hoste B, Kersters K, Swings J, 1995. Reclassification of

Xanthomonas. International Journal of Systematic Bacteriology 45, 472–489.

272. Vauterin L, Rademaker J, Swings J, 2000. Synopsis on the taxonomy of

the genus Xanthomonas. Phytopathology 90, 677–682.

273. Vauterin L, Yang P, Alvarez A et al., 1996. Identification of non-

pathogenic Xanthomonas strains associated with plants. Systematic and Applied
Microbiology 19, 96–105.

274. Venieraki A, Tsalgatidou PC, Georgakopoulos DG, Dimou M, Katinakis

P, 2016. Swarming motility in plant-associated bacteria. Hellenic Plant
Protection Journal 9, 16–27.

22
275. Vernière CJ, Gottwald TR, Pruvost O, 2003. Disease development and
symptom expression of Xanthomonas axonopodis pv. citri in various citrus plant
tissues. Phytopathology 93, 832–43.

276. Vernière C, Pruvost O, Civerolo EL, Gambin O, Jacquemoud-Collet JP,

Luisetti J, 1993. Evaluation of the Biolog substrate utilization system to identify
and assess metabolic variation among strains of Xanthomonas campestris pv.
citri. Applied and environmental microbiology 59, 243–9.

277. Verstraeten N, Braeken K, Debkumari B et al., 2008. Living on a

surface: swarming and biofilm formation. Trends in microbiology 16, 496–506.

278. Volk W, 1966. Cell wall lipopolysaccharides from Xanthomonas species.

Journal of Bacteriology 91, 39–42.

279. Vorhölter FJ, Niehaus K, Pühler A, 2001. Lipopolysaccharide

biosynthesis in Xanthomonas campestris pv. campestris: A cluster of 15 genes is
involved in the biosynthesis of the LPS O-antigen and the LPS core. Molecular
Genetics and Genomics 266, 79–95.

280. Vorhölter F-J, Schneiker S, Goesmann A et al., 2008. The genome of

Xanthomonas campestris pv. campestris B100 and its use for the reconstruction
of metabolic pathways involved in xanthan biosynthesis. Journal of
biotechnology 134, 33–45.

281. Wadhams GH, Armitage JP, 2004. Making sense of it all: bacterial
chemotaxis. Nature reviews. Molecular cell biology 5, 1024–1037.

282. Waksman G, Orlova E V, 2014. Structural organisation of the type IV

secretion systems. Current Opinion in Microbiology 17, 24–31.

283. Wang L, Rong W, He C, 2008. Two Xanthomonas extracellular

polygalacturonases, PghAxc and PghBxc, are regulated by type III secretion
regulators HrpX and HrpG and are required for virulence. Molecular Plant-
Microbe Interactions 21, 555–563.

22
284. Waters CM, Bassler BL, 2005. Quorum sensing: cell-to-cell
communication in bacteria. Annual Review of Cell and Developmental Biology
21, 319–346.

285. White FF, Potnis N, Jones JB, Koebnik R, 2009. The type III effectors of
Xanthomonas. Molecular Plant Pathology 10, 749–766.

286. Williams KP, Kelly DP, 2013. Proposal for a new class within the
phylum Proteobacteria, Acidithiobacillia classis nov., with the type order
Acidithiobacillales, and emended description of the class Gammaproteobacteria.
International Journal of Systematic and Evolutionary Microbiology 63, 2901–
2906.

287. Winker S, Woese CR, 1991. A definition of the domains Archaea,

Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics.
Systematic and applied microbiology 14, 305–310.

288. Woese CR, Kandler O, Wheelis ML, 1990. Towards a natural system of
organisms: proposal for the domains Archaea, Bacteria, and Eucarya.
Proceedings of the National Academy of Sciences of the United States of
America 87, 4576–4579.

289. van der Wolf J, De Boer SH, 2015. Phytopathogenic bacteria. In

(Lutenberg B, eds) Principles of Plant-Microbe Interactions. Switzerland.
Springer International Publishing, 65–77.

290. Xu J, 2006. Microbial ecology in the age of genomics and metagenomics:

concepts, tools, and recent advances. Molecular Ecology 15, 1713–1731.

291. Yamazaki A, Hirata H, Tsuyumu S, 2008. HrpG regulates type II

secretory proteins in Xanthomonas axonopodis pv. citri. Journal of General
Plant Pathology 74, 138–150.

292. Yan Q, Wang N, 2011. The ColR/ColS two-component system plays

multiple roles in the pathogenicity of the citrus canker pathogen Xanthomonas
citri subsp. citri. Journal of Bacteriology 193, 1590–1599.

22
293. Yin F, Zhao Y, Liu C et al., 2011. Analysis of the flgD and flgE genes
regulated by diffusible signal factor in Xanthomonas oryzae pv. oryzicola. Acta
microbiologica Sinica 51, 891–897.

294. Young JM, Park D-C, Shearman HM, Fargier E, 2008. A multilocus
sequence analysis of the genus Xanthomonas. Systematic and applied
microbiology 31, 366–77.

295. Young JM, Wilkie JP, Park DC, Watson DRW, 2010. New Zealand
strains of plant pathogenic bacteria classified by multi-locus sequence analysis;
proposal of Xanthomonas dyei sp. nov. Plant Pathology 59, 270–281.

296. Yun MH, Torres PS, El Oirdi M et al., 2006. Xanthan induces plant
susceptibility by suppressing callose deposition. Plant physiology 141, 178–87.

297. Zaccardelli M, Ceroni P, Mazzucchi U, 1999. Amplified fragment length

polymorphism fingerprinting of Xanthomonas arboricola pv. pruni. Journal of
Plant Pathology 81, 173–179.

298. Zehr EI, Shepard DP, Bridges Jr WC, 1996. Bacterial spot of peach as
influenced by water congestion, leaf wetness duration, and temperature. Plant
Disease 80, 339–341.

299. Zheng D, Yao X, Duan M et al., 2016. Two overlapping two-component

systems in Xanthomonas oryzae pv. oryzae contribute to full fitness in rice by
regulating virulence factors expression. Scientific Reports 6, 22768.

22
Material Suplementario
Material suplementario, capítulo 3:

S1 Fig. Nucleotide genome sequence comparison of X. arboricola pv. pruni strains CITA 33 and
IVIA 2626.1 and the non-pathogenic strain CITA 44. Genome sequences were compared against each
other based on Blastn results and represented as a circular map using the CGview tool. From outside to
center: strain CITA 33, strain IVIA 2626.1, strain CITA 44, GC content, GC skew + and GC skew -.
doi:10.1371/[Link].0161977.s001

S2 Fig. Transmission electron microscopy of X. arboriola strain CITA 44. Negative staining showed
monoflagellated cell from the edge of the dendritic swarming colony 24 hpi in 0.5% PYM agar plates.
doi:10.1371/[Link].0161977.s002

22
S3 Fig. Amino acid alignment of two variants of the FliC found in X. arboricola. Sequence alignment,
performed using ClustalW, showed the amino acid change in the position number 43 of the amino
terminal region of FliC. doi:10.1371/[Link].0161977.s003

S4 Fig. Nucleotide alignment of type III effector xopAQ and the PIP-box found in X. arboricola pv.
pruni. Sequence alignment, performed using ClustalW, showed slight variation among X. arboricola and
other Xanthomonas (A) as well as a variant in PIP-box sequence (B).
doi:10.1371/[Link].0161977.s004

2
Nota: Las tablas referentes al material suplementario se encuentran disponibles de
manera digital en los siguientes enlaces:

S1 Table. Genome statistics of 18 X. arboricola strains according to the automatic annotation performed
using Prokka.

doi:10.1371/[Link].0161977.s005

S2 Table. Annotated protein sequences shared by 18 pathogenic and non-pathogenic strains of X.

arboricola.

doi:10.1371/[Link].0161977.s006

S3 Table. Unique protein coding sequences (CDS) and related features found in the draft genome
sequence of X. arboricola strain CITA 44 and X. arboricola pv. pruni strains CITA 33 and IVIA 26262.1.

doi:10.1371/[Link].0161977.s007

S4 Table. Orthologous protein coding sequences (CDS) of nine strains of X. arboricolaassociated with
pathogenesis.

doi:10.1371/[Link].0161977.s008

22
Material suplementario, capítulo 4:

Supplementary figure 1. Schematic representation of bacterial-caused symptoms on P. persica (GF-

305), H. vulgare, N. benthamiana; N. tabacum and S. lycopersicum 21 dpi. Leaves were infiltrated with
108 CFU/mL of bacteria or with sterile phosphate saline buffer (PBS) as negative control.

Supplementary figure 2. Comparative statistics among pathogenic and non-pathogenic strains of X.

arboricola based in the distribution of the orhtolog clusters of gene contained in the analysed genome
sequences. (A) Histogram representing the Jaccard distance distribution among the analysed genomes.
(B) Principal component analysis based in the ortholog clusters gene present in the pangenome of X.
arboricola showing how the genomes are located in the space spanned by the two first principal
components.

2
Supplementary figure 3. Phylogenetic analysis of 17 strains of X. arboricola based on the core genome
sequence (2,714 potential groups of homologous genes) and representation of the distribution of the
potential ortholog cluster genes of the pangenome (7,074) within the analysed genome sequences.
Sequences were aligned using PRANK and maximum likelihood analysis was carried out using RaxML.
Bootstrap values (1,000 replicates) are presented above or below the branches.

Supplementary figure 4. Primers and TaqMan probe designed to amplify xopE3 using real time PCR in
Xanthomonas spp. Xap and CFBP 5530: X. arboricola pv. pruni; Xcc: X. citri subsp. citri, Xff: X. fuscans
subsp. fuscans.

23
Supplementary figure 5. In silico representation of the hybridization zone for the primers used in two
PCR amplification protocols published to identify X. arboricola pv. pruni. Comparative sequence
analysis was performed using Blastn with an expected value of 0.001. The circular graphic has been
constructed using BRIG. Each concentric circle represents one of the analysed genomes. Full references
of the two methods are available in the article.

Nota: Las tablas referentes al material suplementario se encuentran disponibles de

manera digital en los siguientes enlaces:

Supplementary Table 1. Genome statistics of 17 pathogenic and non-pathogenic strains of X.

arboricola.

[Link]

Supplementary Table 2. Unique clusters of orthologous genes encoded in the genome sequence of the
non-pathogenic strains of X. arboricola CITA 14 and CITA 124 as well as those encoded in the
pathogenic strains of the pathovars corylina, juglandis and pruni.

[Link]

Supplementary Table 3. Orthologous protein coding sequences (CDS) of seventeen strains of

Xanthomonas arboricola associated with pathogenesis.

[Link]