CÁNCER DE PULMÓN

Curso de la ESO en español

17-18 febrero 2005
Coordinadores: M. Sánchez-Céspedes, ES - R. Rosell, ES

Auditorio Centro Nacional de Investigación Oncológicas (CNIO)

Melchor Fernández Almagro, 3
28029 Madrid
[Link]

La reproducción del material de este libro está condicionada a la obtención previa del permiso correspondiente de los ponentes.
 ÍNDICE
Introducción . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
Programa del curso . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
Lista de ponentes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Contribuciones de los ponentes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Sesión I: Etiología y bases moleculares del cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . 13
Moderador: Ángel López-Encuentra
Epidemiología del cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
José Franco
Factores de susceptibilidad al cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Juan Miguel Barros Dios
Carcinógenos y origen del cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
Julián Carretero
Alteraciones genético-moleculares en el cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . 45
Montserrat Sánchez-Céspedes
Telómeros y telomerasa en cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
Jean Charles Soria
Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón . . . . . . 71
Esteve Fernández-Muñoz
Sesión II: Alteraciones genético-moleculares en cáncer de pulmón: utilización clínica . . . . . . . . 81
Moderador: Rafael Rosell
Clasificación histológica y lesiones preneoplásicas en cáncer de pulmón . . . . . . . . . . . . 83
José Ramírez
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón . . 89
Luis M. Montuenga
Factores pronósticos en cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
Ángel López-Encuentra
Aplicación de las matrices de tejido ("tissue microarrays") al estudio de los carcinomas
de pulmón no microcíticos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
Fernando López-Ríos
Metilación y cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135
Manel Esteller
Sesión III: Perspectivas de las nuevas terapias en cáncer de pulmón . . . . . . . . . . . . . . . . . . . 155
Moderador: Montserrat Sánchez-Céspedes
Dianas moleculares y nuevas terapias . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
Rafael Rosell
Factores de resistencia a quimioterapia en cáncer de pulmón . . . . . . . . . . . . . . . . . . . 195
Miquel Taron
Terapia génica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205
Noemí Regüart
Cuidados de enfermería en las nuevas modalidades terapéuticas . . . . . . . . . . . . . . . . . 213
Ana Jiménez
Avances en el manejo multimodal del cáncer de pulmón no microcítico . . . . . . . . . . . . 231
Pilar Garrido
Actualización del tratamiento de cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . 247
José Miguel Sánchez

Índice 5
Introducción

En primer lugar les damos nuestra más cordial bienvenida a este segundo curso de la Escuela
Europea de Oncología (ESO) en el CNIO sobre cáncer de pulmón. El primero, que versó sobre cáncer
de mama, se celebró en octubre de 2003.

El cáncer de pulmón es la primera causa de muerte por cáncer en los países occidentales. El factor
etiológico responsable de la mayor parte de los casos es el tabaco. Durante este curso, además del
efecto de los carcinógenos del tabaco se tratará de los genes alterados en los tumores pulmonares así
como de otras anormalidades moleculares que tienen lugar durante el desarrollo de este tipo de cáncer.

El pronóstico de los pacientes con cáncer de pulmón depende claramente del estadio tumoral en que
se diagnostica la enfermedad. Varios estudios han demostrado que es posible detectar alteraciones
genéticas y moleculares en lavados broncoalveolares de pacientes con cáncer de pulmón y se están
llevando a cabo trabajos prospectivos que determinarán su posible uso en el diagnóstico precoz de
este tipo de cáncer. Otras investigaciones revelan factores moleculares relacionados con la respuesta a
la terapia, los patrones de toxicidad y el pronóstico del enfermo de cáncer de pulmón.

Como consecuencia de los estudios dedicados a la elucidación del conjunto de alteraciones genéticas
y de las vías moleculares que producen la formación de un tumor esperamos que se produzcan mejoras
en el tratamiento del cáncer en un futuro no muy lejano. Algunos de estos esfuerzos ya han dado sus
frutos con el diseño de drogas dirigidas a alteraciones genéticas concretas, como es el caso del fármaco
STI571 para el tratamiento de la Leucemia Mieloide Crónica.

Durante el curso se presentarán los fármacos que actualmente se están ensayando o se están desarrollando
para el tratamiento del cáncer de pulmón.

La contribución de cada ponente en esta publicación ha sido especificada en la por tadilla

correspondiente.

Esperamos sinceramente les sirva de referencia en el estudio de esta neoplasia.

Un saludo muy cordial,

Montserrat Sánchez-Céspedes
Jefe del Grupo de Cáncer de Pulmón
CNIO

Rafael Rosell
Jefe del Servicio de Oncología Médica
Institut Català d’Oncologia, Hospital Germans Trias i Pujol,

Introducción 7
 PROGRAMA

Jueves 17 de febrero
15.00 Bienvenida
Miguel Ángel Piris

Sesión I: Etiología y bases moleculares del cáncer de pulmón

Moderador: Ángel López-Encuentra

15.10 Epidemiología del cáncer de pulmón

José Franco

15.50 Factores de susceptibilidad al cáncer de pulmón

Juan Miguel Barros Dios

16.30 Carcinógenos y origen del cáncer de pulmón

Julián Carretero

17.10 Café

17.50 Alteraciones genético-moleculares en el cáncer de pulmón

Montserrat Sánchez-Céspedes

18.30 Telómeros y telomerasa en cáncer de pulmón

Jean Charles Soria

19.10 Lectura crítica de los artículos sobre factores etiológicos

del cáncer de pulmón
Esteve Fernández

Viernes 18 de febrero

Sesión II: Alteraciones genético-moleculares en cáncer de pulmón:

utilización clínica
Moderador: Rafael Rosell

09.00 Clasificación histológica y lesiones preneoplásicas en cáncer de pulmón

Josep Ramírez

09.40 Búsqueda de marcadores moleculares para la detección precoz

del cáncer de pulmón
Luis M. Montuenga

8 Cáncer de pulmón
10.20 Café

11.00 Factores pronósticos en cáncer de pulmón

Ángel López-Encuentra

11.40 Aplicación de las matrices de tejido ("tissue microarrays")

al estudio de los carcinomas de pulmón no microcíticos
Fernando López-Ríos

12.20 Metilación y cáncer de pulmón

Manel Esteller

13.00 Almuerzo

Sesión III: Perspectivas de las nuevas terapias en cáncer de pulmón

Moderador: Montserrat Sánchez-Céspedes

14.30 Dianas moleculares y nuevas terapias

Rafael Rosell

15.10 Factores de resistencia a quimioterapia en cáncer de pulmón

Miquel Taron

15.50 Café

16.20 Terapia génica

Noemí Regüart

17.00 Cuidados de enfermería en las nuevas modalidades terapéuticas

Ana Jiménez

17.40 Avances en el manejo multimodal del cáncer de pulmón no microcítico

Pilar Garrido

18.20 Actualización del tratamiento de cáncer de pulmón

José Miguel Sánchez

Programa 9
 PONENTES

Juan Miguel Barros Dios (mrbarros@[Link])

Universidad de Santiago de Compostela, Santiago de Compostela, ES

Julián Carretero (jcarretero@[Link])

Centro Nacional de Investigaciones Oncológicas, Madrid, ES

Manel Esteller (mesteller@[Link])

Centro Nacional de Investigaciones Oncológicas, Madrid, ES

Esteve Fernández (efernandez@[Link])

Institut Català d'Oncologia y Universitat de Barcelona, Barcelona, ES

José Franco (franco_jos@[Link])

Hospital Clínico Universitario, Valencia, ES

Pilar Garrido ([Link]@[Link])

Hospital Ramón y Cajal, Madrid, ES

Ana Jiménez (ajimenezarate@[Link])

Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Ángel López-Encuentra (lencuent@[Link])

Hospital Universitario 12 de Octubre, Madrid, ES

Fernando López-Ríos ([Link]@[Link])

Hospital Universitario 12 de Octubre, Madrid, ES

10 Cáncer de pulmón
Luis M. Montuenga (lmontuenga@[Link])
Centro de Investigación Médica Aplicada, Universidad de Navarra, Pamplona, ES

Miguel Ángel Piris (mapiris@[Link])

Centro Nacional de Investigaciones Oncológicas, Madrid, ES

José Ramirez (JRAMIREZ@[Link])

Hospital Clinic, Universitat de Barcelona, ES

Noemí Regüart (32497nra@[Link])

Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Rafael Rosell (rrosell@[Link])

Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

José Miguel Sánchez (jmst@[Link])

Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Montserrat Sánchez-Céspedes (msanchez@[Link])

Centro Nacional de Investigaciones Oncológicas, Madrid, ES

Jean-Charles Soria (soria@[Link])

Institut Gustave-Roussy, Paris, FR

Miquel Taron (mtaron@[Link])

Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES

Ponentes 11
 Sesión 1
ETIOLOGÍA Y BASES MOLECULARES
DEL CÁNCER DE PULMÓN

Moderador: Ángel López-Encuentra

 EPIDEMIOLOGÍA
DEL CÁNCER DE PULMÓN
José Franco
Hospital Clínico Universitario,
Valencia

Contenido:
Resumen de la ponencia
Bibliografía
Artículo del ponente
 Epidemiología del cáncer de pulmón
José Franco
Servicio de Neumología
Hospital Clínico Universitario, Valencia

l tabaco es la causa principal de cáncer de pulmón, siendo responsable de más del 90% de los
E casos no sólo directamente sino indirectamente (tabaquismo pasivo) y en asociación con otras
sustancias. Existen otras causas (polución ambiental, laboral o en los hogares) y factores modificadores
del riesgo individual como la dieta o la susceptibilidad genética. Sin embargo, el consumo de cigarrillos
es el elemento que confiere el carácter de epidemia a la enfermedad. Además, debido a la clara relación
entre tabaco y cáncer de pulmón, se puede considerar al cáncer de pulmón como marcador del
tabaquismo de una población.
El hábito de fumar se ha iniciado en momentos diferentes y ha seguido patrones distintos según
las características culturales y socioeconómicas de cada país. En países como Estados Unidos o el Reino
Unido se adquirió tempranamente en el siglo XX, primero en varones y poco después en mujeres, y
comenzó a declinar en los años 60. En España sin embargo, se desarrolló tardíamente respecto a estos
países y las mujeres se incorporaron a fumar mucho después que los varones.
La supervivencia global del cáncer de pulmón es baja (sólo del 10-13% a los 5 años) y no ha
cambiado sustancialmente durante las últimas 2 décadas a pesar del desarrollo de tratamientos
multidisciplinarios en pacientes con estadios más avanzados de la enfermedad. Esto determina una
estrecha correlación entre incidencia y mortalidad, de manera que se puede estudiar la evolución de
la epidemia en una población dada a partir de los datos de mortalidad.
El hábito de fumar se establece generalmente a una edad temprana y tiende a seguir patrones
específicos para cada generación (hábito generacional). Además existe un largo período de latencia de
unos 30 años entre el establecimiento del hábito de fumar y el desarrollo de la enfermedad, que se
manifiesta de forma más temprana en los individuos más jóvenes y se extiende posteriormente a los
de mayor edad. Así, de la misma manera que los datos de mortalidad por cáncer de pulmón son un
indicador del hábito tabáquico de la población durante las décadas pasadas, también los cambios recientes
en el hábito de fumar junto con las tendencias de la mortalidad en las jóvenes generaciones permiten
predecir el curso de la epidemia en el futuro.
Según datos de la Encuesta Nacional de Salud, el consumo de tabaco en la población española
mayor de 16 años ha disminuido en hombres del 64% en 1978 al 42% en 2001 y ha aumentado en
mujeres del 17% en 1978 al 27,2% en 2001. Este diferente comportamiento respecto al tabaco según
el género se refleja también en las tasas de mortalidad por cáncer de pulmón. En hombres, la tasa
estandarizada para todas las edades se ha doblado en las últimas décadas (de 31,4 x 100.000 en 1973
a 64,2 en 2001). Sin embargo, en mujeres las tasas han permanecido bajas hasta recientemente (6,3
en 1973 y 6,4 en 1997) difiriendo apenas de lo esperado en una población nunca fumadora, pero en
los últimos años empieza a observarse un incremento significativo (7,6 en 2001). Respecto a las tasas
específicas por edad, en varones se observan incrementos en todos los grupos mayores de 35 años,
pero en los más jóvenes (30-34 años) la mortalidad ha disminuido desde 1988. En mujeres el patrón
es muy diferente: las tasas disminuyen en la mayoría de los grupos de edad hasta finales de la década
de los 80 y después aumentan significativamente en los grupos más jóvenes.
Debido al carácter generacional del hábito tabáquico, el estudio de la mortalidad mediante
modelos edad-periodo-cohorte constituye una aproximación más exacta a la evolución de la epidemia

Epidemiología del cáncer de pulmón 17

de cáncer de pulmón. Utilizando este método se puede observar que el efecto cohorte aumenta en
varones hasta las generaciones nacidas alrededor de 1952, y después la mortalidad disminuye ligeramente
en los más jóvenes. En mujeres, sin embargo, el efecto cohorte disminuye hasta las generaciones nacidas
en 1932 y aumenta de forma marcada a partir de 1942.
En resumen, sobre la base de las variaciones de la mortalidad en las jóvenes generaciones y los
datos sobre el consumo de tabaco se pueden esperar cambios de tendencia en la evolución de la
epidemia de cáncer de pulmón en España. Así, en mujeres, el incremento de mortalidad observado en
las más jóvenes señala el comienzo de la epidemia de cáncer de pulmón debido al continuo aumento
de la prevalencia de mujeres fumadoras. Por el contrario en hombres, considerando la leve disminución
de la mortalidad en los más jóvenes, es posible prever una evolución más favorable de la epidemia si
la prevalencia de tabaquismo sigue disminuyendo. Por último, la discreta pero significativa disminución
de la mortalidad observada en mujeres hasta finales de los años 80 podría estar relacionada con una
menor exposición al tabaquismo pasivo en casa como consecuencia de la disminución del número de
varones fumadores.

Bibliografía:
Bray F, Tyczynski JE, Parkin DM. Going up or coming down? The changing phases of the
lung cancer epidemic from 1967 to 1999 in the 15 European Union countries. Eur J Cancer. 2004 Jan;
40(1):96-125.
Franco J, Pérez-Hoyos S, Plaza P. Changes in lung-cancer mortality trends in Spain. Int J Cancer. 2002
Jan 1; 97(1):102-5.

18 Cáncer de pulmón
Int. J. Cancer: 97, 102–105 (2002) Publication of the International Union Against Cancer

© 2002 Wiley-Liss, Inc.

CHANGES IN LUNG-CANCER MORTALITY TRENDS IN SPAIN

José FRANCO1*, Santiago PÉREZ-HOYOS2 and Pedro PLAZA3
1
Servicio de Neumologı́a, Hospital Clı́nico Universitario, Valencia, Spain
2
Escuela Valenciana de Estudios para la Salud, Valencia, Spain
3
Servicio de Neumologı́a, Hospital Universitario Dr. Peset, Valencia, Spain

Several changes in smoking patterns over the past decades tions of the Instituto Nacional de Estadı́stica (INE, National Insti-
in Spain can be expected to result in a shift in lung-cancer tute of Statistics). The population was that estimated at 1 July of
mortality rates. We examined time trends in lung-cancer each year by the INE based on official censuses. Deaths from lung
mortality from 1973–1997 using a log-linear Poisson age- cancer corresponded to code 162 of the International Classification
period-cohort model. The standardized lung-cancer mortal-
ity rate for men almost doubled, from 31.4 per 100,000 in of Diseases, Eighth and Ninth Revisions (ICD-8 and ICD-9).
1973 to 58.6 in 1997, with an average annual increase of 2.7%. From these data, age-specific death rates for 5 calendar periods
Mortality increased for male generations born until 1952 as a of 5 years each (1973–1977 to 1993–1997) and 9 age groups of 5
consequence of the increasing cigarette smoking in succes- years each (30 –34 to 70 –74 years) were derived. Using this
sive birth cohorts. However, the slight downward trend ob- classification of age and time, 13 overlapping birth cohorts of 10
served for the 2 youngest generations suggests a more favor- years each were identified and defined according to the central year
able outcome of the lung-cancer epidemic among Spanish
males in the coming years, if this trend continues. For of birth (1902/3 to 1962/3). Because death certification is less
women, mortality rates were 5 to 9 times lower than those reliable at elderly ages and problems arise from random variation
for men, 6.3 per 100,000 in 1973 and 6.4 in 1997. However, from small numbers at young ages, only the age groups between 30
the increasing mortality among younger generations born and 74 years were considered.7
since 1942 reflects the rise in the prevalence of smoking Age-standardized mortality rates were calculated for men and
women during the last decades and can be expected to
spread to older age groups as a cohort effect, indicating the women using the direct method with the Spanish population of
early phase of the smoking-related lung-cancer epidemic 1980 as the reference.
among Spanish females. The decreasing mortality trend ob- The percent annual change in age-specific rates was calculated
served in women until the late 1980s could be attributed to a from a regression equation after transforming the dependent vari-
lower exposure to environmental tobacco smoke at home as able (single calendar year rate) into natural logarithms, with the
a result of a significant reduction in the prevalence of smok- year as the independent variable. The coefficient B (slope) in the
ing men.
© 2002 Wiley-Liss, Inc. equation with a 95% confidence interval (CI) was considered the
mean annual percentage of variation.
Key words: lung-cancer mortality; Spain; smoking habits; age-peri- Based on the matrix of lung-cancer deaths and population bro-
od-cohort model; time trends ken down by 5-year calendar period and age group, the effects of
age, period and cohort were calculated through a log-linear Pois-
In Mediterranean countries and in Spain since 1990, malignant son model fitted using the S-PLUS program (Insightful Corp.,
tumors are the leading cause of death, whereas heart diseases are Seattle, WA) with the appropriate macro adapted from the Decarli
placed second.1 Lung cancer is the most frequent fatal cancer and La Vecchia8 GLIM macro. Estimates were derived from the
among men in Spain2 as well as in many other developed coun- model, including the 3 factors that minimize the sum of the
tries. Euclidean distances from the 3 possible 2-factor models: age
period (AP), age cohort (AC) and cohort period (CP). The proce-
Because of the poor survival from lung cancer, there is a close
dure of minimization is based on the least squares weighted on the
correlation between incidence and mortality. The overall 5-year
survival rate of 10 –13% has not changed over the past 2 decades, inverse of the log-likelihood of each 2-factor model.7
though the implementation of multimodality therapy in locally Log-likelihood ratio statistics (deviance) were used to test the
advanced disease has begun to modestly improve survival in goodness of fit, while the difference between 2 models was tested
patients with more advanced stages of disease.3 by comparing the change in the deviance with the degrees of
Cigarette smoking plays a dominant role in lung-cancer causa- freedom. This test, however, often indicates lack of fit in popula-
tion, being responsible for up to 90% of the lung-cancer epidemic, tion-based data even when the model appears qualitatively to
not only directly but indirectly (passive smoking) and in associa- describe the data well since the number of events (deaths) is often
tion with other substances such as asbestos and radon.4 Smoking large, so even small departures from the model are detected.9
patterns have changed markedly and in different directions in Assuming no period or cohort slope, the average of the period
several countries over the past decades; therefore, time trends in values was fixed at unity, as was the average of the cohort values;
lung-cancer mortality differ between countries, cohorts and sexes.5 thus, age values were of the same order of magnitude as age-
Several changes in smoking habits in Spain, such as a decline in specific rates.7
the prevalence of smoking among men and a rise among women, Because age, period and birth cohort variables are arithmetically
can be expected to result in a shift in lung-cancer mortality trends. interrelated, knowing 2 of them fixes the third, implying that the
Because tobacco smoking habits are generally established at an chosen solution is not unique,10 a problem known as nonidentifi-
early age and are characteristic for a given birth cohort,5 the
development of the lung-cancer epidemic can be analyzed most
accurately by studying age-specific rates by birth cohort.6 *Correspondence to: Servicio de Neumologı́a, Hospital Clı́nico Univer-
sitario, Avda. Vicente Blasco Ibáñez 17, 46010 Valencia, Spain.
We analyzed trends in lung-cancer mortality in Spain from Fax: ⫹34-96 3862657. E-mail: jfs01v@[Link]
1973–1997, using a Poisson log-linear age-period-cohort model.
Received 4 July 2000; Revised 17 April, 19 July 2001; Accepted 30 July
MATERIAL AND METHODS 2001
Population figures and data on deaths from lung cancer in Spain
during the period 1973–1997 were obtained from official publica-
 LUNG-CANCER MORTALITY IN SPAIN 103

FIGURE 1 – Age-standardized lung-cancer mortality rates for men

and women in Spain, from 1973–1997.

TABLE I – GOODNESS OF FIT FOR AND COMPARISONS BETWEEN

DIFFERENT AGE, PERIOD AND COHORT POISSON REGRESSION MODELS
OF LUNG-CANCER MORTALITY FOR MALES IN SPAIN
FIGURE 2 – Age-specific lung-cancer mortality rates by 5-year age
Residual Change intervals and birth cohort for Spanish males.
Model
Deviance d.f. Deviance d.f. p

Age (A) 6,031.9 36 5,641.5 4 ⬍0.0011

5,594.0 12 ⬍0.0012
Age-period (AP) 390.4 32 320.0 11 ⬍0.0013
Age-cohort (AC) 437.9 24 367.5 3 ⬍0.0014
Age-period-cohort 70.4 21
(APC)
1
A vs. AP.–2A vs. AC.–3AP vs. APC.–4AC vs. APC. d.f., degrees of
freedom.

TABLE II – GOODNESS OF FIT FOR AND COMPARISONS BETWEEN

DIFFERENT AGE, PERIOD AND COHORT POISSON REGRESSION MODELS
OF LUNG-CANCER MORTALITY FOR FEMALES IN SPAIN
Residual Change FIGURE 3 – Results of age, period and cohort modeling for Spanish
Model men. Age values are expressed as rates per 100,000 population. Peri-
Deviance d.f. Deviance d.f. p
od-of-death and cohort-of-birth values are expressed in relative terms
Age (A) 187.7 36 69.4 4 ⬍0.0011 against their weighted average set to unity.
117.1 12 ⬍0.0012
Age-period (AP) 118.3 32 91.6 11 ⬍0.0013
Age-cohort (AC) 70.6 24 43.9 3 ⬍0.0014 –1.1 to – 0.3) until 1988 and then an increase of 1.5% (95% CI
Age-period-cohort 26.7 21 1.1–1.9) annually.
(APC) Age-specific trends in lung-cancer mortality rates for men
1
A vs. AP.–2A vs. AC.–3AP vs. APC.–4AC vs. APC. d.f., degrees of showed a statistically significant annual increase over the whole
freedom. study period in all groups aged 35 years and over, ranging from
2.1% (95% CI 1.8 –2.4) annually for the age group 65 to 69 years
to 4.5% (95% CI 3.7–5.2) for the age group 40 to 44 years. In the
ability of parameters. Moreover, when the majority of age-specific youngest group (30 –34 years), rates increased until 1988, with an
rates are in the same direction, both cohort-of-birth and period-of- opposite trend thereafter of –5.4% (95% CI –10.1 to – 0.7) annu-
death patterns are similar and it is difficult to establish whether the ally.
major underlying trend is a cohort or period effect. Consequently, For women, the patterns were quite different: age-specific mor-
the results of the model should be chiefly viewed as a guide toward tality rates showed a statistically significant decrease over the
summarizing overall tendencies, and age-specific rates should be whole study period in groups aged 55 years and over, ranging from
considered before any conclusions are drawn.7 – 0.5% (95% CI – 0.1 to – 0.9) annually among 70- to 74-year-olds
to –1.0% (95% CI – 0.3 to –1.6) among 55- to 59-year-olds; this
decline was also observed until 1984 for groups aged 35 to 54
RESULTS years. However, since 1984, rates have increased significantly in
The standardized lung-cancer mortality rate for men almost younger groups (30 – 49 years), ranging from 3.9% (95% CI 1.6 –
doubled over the study period, from 31.4 per 100,000 in 1973 to 6.1) annually in 45- to 49-year-olds to 7.9% (95% CI 3.6 –12.1) in
58.6 in 1997, with an average annual increase of 2.7% (95% CI 35- to 39-year-olds.
2.4 –3.0). For women, mortality rates were 5 to 9 times lower than Tables I and II show the goodness of fit (scaled deviances) for
that for men (Fig. 1), 6.3 and 6.4 per 100,000 in 1973 and 1997, the age-period-cohort models and comparisons between models.
respectively; there was a slight annual decrease of – 0.7% (95% CI Mortality trends for both genders were better explained by the full
104 FRANCO ET AL.

FIGURE 6 – Prevalence of smoking among men and women aged 16

years and above in Spain, from 1978 –1997.

nately, in Spain, question-based studies on the general public’s

tobacco consumption are available only since 1978. Rates ob-
FIGURE 4 – Age-specific lung-cancer mortality rates by 5-year age served in young adults should reflect recent carcinogenic exposure
intervals and birth cohort for Spanish females. and can be expected to spread to older age groups in future years12
because smoking habits tend to be a characteristic of particular
generations. Our analysis of lung-cancer mortality in Spain shows
different trends for men and women.
In men, mortality increased for generations born up to 1952 as
a consequence of the increasing cigarette smoking in successive
birth cohorts. However, the decrease in the prevalence of smoking
men (Fig. 6) from 64% in 1978 to 45% in 199713,14 and the slight
decrease in mortality for the youngest cohorts observed in our
study suggest a more favorable outcome of the lung-cancer epi-
demic among Spanish males in the coming years, though major
efforts to discourage tobacco use should be made so that the
decreasing trend in the number of smoking men continues.
The relative risk of lung cancer decreases following smoking
cessation,15 and the impact of the decline in cigarette smoking on
FIGURE 5 – Results of age, period and cohort modeling for Spanish lung-cancer mortality would be expected to show up first in the
women. Age values are expressed as rates per 100,000 population. younger groups as a cohort effect. The downturn in cigarette
Period-of-death and cohort-of-birth values are expressed in relative
terms against their weighted average set to unity. consumption since the 1960s combined with lower tar content of
cigarettes was a clear precursor to the decline in lung-cancer
mortality rates in the United States and the United Kingdom.6
age ⫹ period ⫹ cohort (APC) model, though the APC model fit According to data from Tabacalera, a state owned company that
mortality data only for women (deviance ⫽ 26.7 on 21 degrees of monopolized the tobacco market in Spain until 1998, the contin-
freedom, p ⫽ 0.18). For men, deviances were greater than those uous increase in cigarette sales began to decline in the early 1990s,
for women and the APC model did not fit, probably due to the with a decrease of 17.1% from 2,685.5 cigarettes per adult aged 15
large number of deaths, though overdispersion could exist. One years and older in 1991 to 2,226.2 in 1996.16,17 However, sales of
must be cautious with the interpretation of the multiplicative age, black tobacco, which has been related to a higher risk of lung
period and cohort effects resulting from the modeling. Both period cancer in case-control studies,18 decreased over the last decades,
and cohort effects were statistically significant for men and women falling from 94% of total sales in 1961 to 31.3% in 1996, being
when the APC model was compared with the AC or AP submodel. replaced by Virginia tobacco.
As expected, mortality increased with age in both sexes. For men The low lung-cancer mortality rate observed among Spanish
(Figs. 2, 3), the cohort effect was steadily upward to the cohort women differs hardly at all from what might be expected if none
born around 1952, with a slight reversal downward for the 2 had ever smoked, suggesting that few of their lung-cancer deaths
youngest generations; also, a rising period effect was observed up are still due to smoking.19 However, the increasing mortality
to 1992. For women (Figs. 4,5), cohort values decreased moder- among younger generations born since 1942 reflects the rise in
ately until the cohort born around 1932, then leveled off and tobacco consumption among females during the last decades and
increased for young women born since 1942; moreover, there was can be expected to spread to older age groups in the coming years
evidence of a period effect downward until 1987 and upward as a cohort effect. The increasing prevalence of smoking women
thereafter. (Fig. 6) by 58.8%, from 17% in 1978 to 27% in 1997,13,14 and the
upward mortality trend in young adult life indicate the early phase
DISCUSSION
of the smoking-related lung-cancer epidemic among females. The
later onset of the epidemic in Spain compared with other devel-
Recent changes in mortality from lung cancer are mainly related oped countries can be attributed to smoking having become wide-
to changes in smoking patterns over the past decades.11 Unfortu- spread among women only in the last few decades as well as to the
 LUNG-CANCER MORTALITY IN SPAIN 105

latency period between the onset of exposure and the development after a 15-year period.23 Therefore, once a significant number of
of disease. smoking men quit, the reduction in risk for wives decreases as a
The small but statistically significant decrease of mortality ob- cohort effect and, by affecting all age groups simultaneously, can
served in Spanish women until 1988 is difficult to explain.5 Al- be manifest also as a period effect. Thus, the decreasing lung-
though caution is warranted in making inferences on the basis of cancer mortality trend observed among Spanish women until the
statistical modeling,20 the age-period-cohort analysis shows a co- late 1980s could be attributed to a lower exposure to ETS at home
hort effect for generations born up to 1932, aside from the decrease as a result of a significant reduction in the prevalence of smoking
in mortality with the period of death up to 1987. In addition, men.
age-specific rates decreased continuously for women aged 55 years The quality of official data on mortality can be affected in
and over and until the mid-1980s for younger women. different ways. Changes in the international death classification
In countries with a female population that smokes relatively rules or inaccuracy in certification may lead to variation in mor-
rarely and a high male smoking prevalence, the risk and population tality statistics. Two ICD revisions came into force in Spain during
burden of lung cancer due to environmental tobacco smoke (ETS) the study period; but code 162, assigned to malignant tumors of the
are considered relatively important.21 Therefore, because of the trachea, bronchus and lung, remains unchanged for both ICD-8
reduction in the prevalence of smoking men in Spain, we can and ICD-9 revisions. Previous studies on the quality of death
hypothesize that the decreasing mortality trend observed in women certificates in Spain have shown reliable data on the cause of death
might be related to changes in exposure to ETS at home, though with regard to malignant tumors.24,25
we cannot exclude a role of other modifiable risk factors, such as In summary, on the basis of the variations observed among
domestic radon, dietary factors, occupational carcinogens and air younger generations, changes in the epidemiologic trends of lung-
contamination. Exposure to ETS from a spouse is a risk factor for cancer mortality rates can be expected in Spain. The upward trend
lung cancer among nonsmoking women, and the risk increases observed in younger women shows the beginning of the smoking-
consistently with increasing levels of exposure.22 In Spain, for related lung-cancer epidemic due to the continuous increase in the
some decades, while smoking was rare among women, a great prevalence of smoking women. Conversely, considering the de-
number of nonsmoking wives would have been exposed to ETS creasing tobacco consumption among men and the decline in
from their husbands’ smoking. mortality observed in the youngest, an opposite downward trend
Changes in the prevalence of risk factors usually alter the can be expected if the prevalence of smoking men continues to
pattern of risk seen among birth cohorts; however, a substantial diminish. The decrease in mortality observed for women until the
decrease in a relatively common carcinogenic exposure could late 1980s could be related to a lower spousal ETS exposure.
cause a calendar-period decrease in risk after a sufficient latency
period. The effect of reducing tobacco carcinogen exposure on the ACKNOWLEDGEMENTS
late stage of the carcinogenic process will be seen soon after the
change in exposure.20 The risk of lung cancer decreases with time We thank Dr. V. Moreno from Institut Català d’Oncologia for
since cessation of ETS exposure, and there is no detectable risk providing the S-PLUS macro.

REFERENCES

1. Alonso I, Regidor E, Rodrı́guez C, et al. Principales causas de muerte 14. Ministerio de Sanidad y Consumo. Encuesta Nacional de Salud de
en España, 1992. Med Clin (Barc) 1996;107:441–5. España 1997. Madrid: Ministerio de Sanidad y Consumo, 1999.
2. Fernández E, Borrás JM, Levi F, et al. Mortalidad por cáncer en 15. Halpern MT, Gillespie BW, Warner KE. Patterns of absolute risk of
España, 1955–1994. Med Clin (Barc) 2000;114:449 –51. lung cancer mortality in former smokers. J Natl Cancer Inst 1993;85:
3. Reif MS, Socinski MA, Rivera MP. Evidence-based medicine in the 457– 64.
treatment of non-small-cell lung cancer. Clin Chest Med 2000;1:107– 16. Tabacalera SA. Series históricas de consumo de tabaco elaborado,
20. 1957–1991. Madrid: Tabacalera SA, 1992.
4. Yesner R. Pathogenesis and pathology. Clin Chest Med 1993;1:17– 17. Tabacalera SA. Memoria de actividades, 1992–1996. Madrid: Taba-
30. calera SA, 1997.
5. Coleman MP, Esteve J, Damiecki P, et al. Trends in cancer incidence 18. Armadans-Gil I, Vaqué-Rafart J, Rosselló J, et al. Cigarette smoking
and mortality. IARC Sci Publ 121. Lyon: IARC, 1993. and male lung cancer risk with special regard to type of tobacco. Int
6. Kubik AK, Parkin DM, Plesko I, et al. Patterns of cigarette sales and J Epidemiol 1999;28,614 –9.
lung cancer mortality in some central and eastern European countries, 19. Peto R, López AD, Boreham J, et al. Mortality from tobacco in
1960 –1989. Cancer 1995;75:2452– 60. developed countries: indirect estimation from national vital statistics.
7. La Vecchia C, Negri E, Levi F, et al. Cancer mortality in Europe: Lancet 1992;339:1268 –78.
effects of age, cohort of birth and period of death. Eur J Cancer 20. Jemal A, Chu KC, Tarone RE. Recent trends in lung cancer mortality
1998;34:118 – 41.
8. Decarli A, La Vecchia C. Age, period and cohort models: review of in the United States. J Natl Cancer Inst 2001;93:277– 83.
knowledge and implementation in GLIM. Riv Stat Appl 1987;20:32– 21. Lee CH, Ko YC, Coggins W, et al. Lifetime environmental exposure
46. to tobacco smoke and primary lung cancer of non-smoking Taiwanese
9. Moolgavkar SH, Lee JAH, Stevens RG. Analysis of vital statistics women. Int J Epidemiol 2000;29:224 –31.
data. In: Rothman KJ, Greenland S. Modern epidemiology. New 22. Zhong L, Goldberg MS, Parent ME, et al. Exposure to environmental
York: Raven Press, 1998. 481–97. tobacco smoke and the risk of lung cancer: a meta-analysis. Lung
10. Osmond C. Using age, period and cohort models to estimate future Cancer 2000;27:3–18.
mortality rates. Int J Epidemiol 1985;14:124 –9. 23. Boffetta P, Agudo A, Ahrens W, et al. Multicenter case-control study
11. Bailar JC, Gornik HL. Cancer undefeated. N Engl J Med 1997;336: of exposure to environmental tobacco smoke and lung cancer in
1569 –74. Europe. J Natl Cancer Inst 1998;90:1440 –50.
12. Doll R. Progress against cancer: an epidemiologic assessment. Am J 24. Benavides FG, Bolumar F, Peris R. Quality of death certificates in
Epidemiol 1991;134:675– 88. Valencia, Spain. Am J Public Health 1989;79:1352– 4.
13. Regidor E, Rodrı́guez C, Gutiérrez-Fisac JL. Indicadores de Salud. 25. Pañella H, Borrell C, Rodrı́guez C, et al. Validación de la causa
Tercera evaluación en España del programa regional europeo Salud básica de defunción en Barcelona, 1985. Med Clin (Barc) 1989;
para todos. Madrid: Ministerio de Sanidad y Consumo, 1995. 92:129 –34.
 FACTORES DE SUSCEPTIBILIDAD
AL CÁNCER DE PULMÓN
Juan Miguel Barros Dios
Universidad de Santiago de Compostela
Santiago de Compostela

Contenido:
Resumen de la ponencia
Publicaciones del grupo de investigación
Bibliografía
Se presenta una breve revisión, desde el punto de vista epidemiológico, del uso de biomarcadores
de susceptibilidad del cáncer de pulmón, definiéndolos y diferenciándolos del resto (exposición y
efecto) completada con esquemas del papel jugado por los mismos en el metabolismo de las diferentes
sustancias xenobióticas y el posible papel modulador de determinados polimorfismos de genes,
principalmente de Fase I y Fase II. Se acompaña de una extensa bibliografía.

Biomarcadores epidemiológicos
del cáncer de pulmón
Alberto Ruano-Raviña / Juan M. Barros Dios
Área de Medicina Preventiva e Saúde Pública
Universidade de Santiago de Compostela

TIPOS DE BIOMARCADORES
Los marcadores biológicos se clasifican habitualmente en tres grandes familias: marcadores de exposición,
marcadores de efecto o de respuesta y marcadores de susceptibilidad. Otra clasificación distingue
marcadores de dosis interna, marcadores de dosis biológicamente efectiva, marcadores de efecto biológico
y marcadores de susceptibilidad. Ambas clasificaciones son equivalentes salvo pequeños matices.

Marcadores de exposición
En esta clasificación entrarían los marcadores de dosis interna y de dosis biológicamente efectiva. Un
marcador de exposición puede ser un compuesto xenobiótico, un metabolito de ese compuesto dentro
del cuerpo u otro suceso relacionado con la exposición. Los marcadores de exposición deben ser
medidos en muestras apropiadas, como la sangre, suero u orina. Llamamos muestras apropiadas a
aquellas que sean de fácil acceso y conservación para su posible uso posterior. Fácil acceso implica poca
complejidad técnica para su obtención, que se puedan obtener en cualquier momento y que causen
pocas molestias para el sujeto.
Como ejemplos típicos de marcadores de dosis interna tenemos:
• PCBs (bifenilos policlorados) en el tejido adiposo procedentes de la contaminación ambiental
• Cotinina en plasma o en saliva procedente del tabaco.
• Derivados N-nitrosos en orina originados por el tabaco o la dieta. Estos dosímetros internos
tienen la ventaja de ser relativamente fáciles de vigilar y demuestran que la exposición ha
derivado en la bioactivación de carcinógenos.
Los marcadores de dosis biológicamente efectiva reflejan la cantidad de carcinógeno que ha
interactuado con macromoléculas celulares (DNA, RNA o proteínas). Este tipo de marcadores es más
relevante para la carcinogénesis que los de dosis interna, pero poseen más problemas analíticos. Los
aductos de DNA y proteínas pertenecen a este grupo.
Antes de proseguir hay que matizar los conceptos de dosis y de exposición. La dosis es la
cantidad de sustancia depositada en el cuerpo en un momento dado y la exposición es cualquier
condición que proporciona a un agente externo una oportunidad para actuar en el organismo. Por lo
tanto, de la misma exposición pueden resultar dosis significativamente diferentes. Las diferencias en las

Factores de susceptibilidad al cáncer de pulmón 25

dosis se ven influenciadas por la variabilidad fisiológica entre los individuos, debido a la absorción,
distribución o metabolización. Una misma exposición no es igual a una misma dosis.
El marcador ideal de exposición debería reunir las siguientes características:
a) La recogida de la muestra y su análisis deben ser simples y reproducibles.
b) El marcador debe ser específico para un tipo particular de exposición y tener una clara relación
con el grado de exposición.
c) El marcador sólo debe reflejar un cambio subclínico y reversible.
d) Podrán considerarse intervenciones u otras medidas preventivas si así lo indica el resultado
del biomarcador.
e) Su uso debe ser éticamente aceptable.
Un ejemplo en el que se usan marcadores de exposición es el de los estudios transversales para
determinar si los compuestos químicos en el ambiente o en la dieta son realmente absorbidos, ayudando
así a establecer la plausibilidad biológica de las asociaciones exposición-enfermedad descritas en
investigaciones anteriores. Esta utilidad ha jugado un importante papel al demostrar, por ejemplo, que
los compuestos presentes en el humo del tabaco pueden ser detectados en personas no fumadoras
expuestas al humo de otros individuos.

Validez de los BM de exposición

Algunos BM miden factores que son fijos y que no varían con el tiempo en las personas, por ejemplo
los genes de susceptibilidad que pueden interaccionar con factores xenobióticos en el origen del cáncer.
Otros BM miden parámetros que cambian con el tiempo (por ejemplo, los niveles de micronutrientes
varían de día a día). En los estudios epidemiológicos es importante que la principal exposición bajo
estudio sea analizada de un modo tiempo-dependiente, teniendo en cuenta una posible inducción y
períodos de latencia, y una relativa importancia etiológica de la intensidad de la exposición, la duración
de la exposición y la exposición acumulada. La aproximación más simple es analizar la exposición
acumulada de un modo tiempo-dependiente. Esto sería suficiente cuando el objetivo es simplemente
considerar si hay o no un efecto de la exposición.
Muchos BM actualmente disponibles sólo indican exposiciones relativamente recientes. Por ejemplo,
los niveles séricos de micronutrientes reflejan una ingesta reciente más que lejana. Debido al largo
período de inducción de muchos cánceres, las exposiciones de hace 10-30 años son las etiológicamente
relevantes. Esta es una importante limitación en los estudios de cohortes y casos y controles que buscan
medir los efectos de las exposiciones históricas. Algunos BM son mejores que otros en este aspecto,
pero incluso los mejores BM de exposición química reflejan sólo las ultimas semanas o meses de
exposición. Por otro lado, con algunos BM (niveles séricos de TCDD) puede ser posible estimar
exposiciones pasadas si el período de exposición es conocido, si la vida media es relativamente larga
(y es conocida) y si se asume que no ha habido exposiciones significativas recientemente o si se sabe
que los niveles de exposición han permanecido constantes en el tiempo.

Marcadores de efecto
Un marcador de efecto puede ser un compuesto endógeno, una medida de la capacidad funcional
(volumen de aire inspirado) u otro indicador del estado o equilibrio del cuerpo o de un órgano que
esté afectado por la exposición. Los marcadores de efecto suelen ser indicadores preclínicos de
alteraciones. Estos marcadores pueden ser específicos o no específicos. Los específicos indican un efecto

26 Cáncer de pulmón
biológico de una exposición particular, proporcionando una evidencia que puede ser usada con propósitos
preventivos. Los no específicos no señalan ninguna causa en particular del efecto, indican el efecto total
e integrado que podría deberse a una exposición múltiple.
Algunos autores clasifican los marcadores de efecto como marcadores de estructura alterada y
marcadores de función alterada (como, por ejemplo, alteraciones fisiológicas en el intercambio gaseoso).
Entre los marcadores de efecto se encuentran las aberraciones cromosómicas, intercambios de
cromátidas hermanas (Sister Chromatide Exchanges), la aparición de micronúcleos y las alteraciones en
oncogenes o genes supresores de tumores, que se verán más adelante. Se podrían incluir en este
apartado los marcadores tumorales, que se utilizan para el diagnóstico del cáncer.

Marcadores de susceptibilidad
Un marcador de susceptibilidad, heredado o inducido, es un indicador de que el individuo es
particularmente sensible al efecto de un agente xenobiótico o a los efectos de un grupo de estos
compuestos. El interés de este tipo de marcadores reside en la pregunta: ¿por qué, para un nivel dado
de exposición a un carcinógeno, sólo una proporción de los individuos expuestos desarrolla cáncer? Es
decir, ¿por qué personas con una misma exposición aparente tienen un riesgo diferente de enfermedad?
Para otros autores, los marcadores de susceptibilidad sólo son indicadores estadísticos cuyo valor
predictivo depende de la frecuencia con la cual aquellos individuos con ese marcador desarrollen la
alteración esperada. La susceptibilidad puede ser absoluta o parcial. Por ejemplo, si la susceptibilidad es
debida a un enzima, éste puede presentarse en unas cantidades menores de las normales (parcial), estar
ausente en el individuo (absoluta) o aparecer con una estructura diferente debido a alteraciones en el
DNA, implicando la pérdida de su función (absoluta). Podemos decir que una susceptibilidad es genética
si las diferencias se localizan a nivel del DNA. Se han propuesto diferentes subáreas para la susceptibilidad
genética: a) variaciones heredadas en los enzimas que metabolizan carcinógenos, b) mutaciones en líneas
celulares (germline) de genes asociados a tumores y, c) diferencias heredadas en la formación de aductos
de DNA y en sus mecanismos de reparación. Los individuos con predisposición hereditaria al cáncer
son portadores de una mutación en alguno de los genes críticos en el control de los procesos de
crecimiento y división celular. Esta mutación, en sí misma no es suficiente para el desarrollo de un tumor,
ya que requiere la acumulación adicional de alteraciones sobre otros genes críticos. Por ello, puede
afirmarse que las mutaciones heredadas sólo confieren una mayor susceptibilidad para desarrollar cáncer,
ya que necesitan de menos alteraciones adicionales que la población general para sufrir una transformación
maligna, lo que justifica la tendencia al desarrollo del cáncer en etapas más tempranas de la vida.

Efectos sobre el riesgo de los marcadores de susceptibilidad

E
Mayor N
F
E
R
M
O
Riesgo de enfermedad Efecto umbral fisiológico S
S
Individuos susceptibles A
N
O
S
Menor
Individuos normales

Factores de susceptibilidad al cáncer de pulmón 27

 El estudio de la interacción entre la dotación genética y el ambiente puede aumentar nuestra
capacidad de caracterizar riesgos relativamente bajos en la población. Además, estos estudios proporcionan
una aproximación a los mecanismos de la carcinogénesis, que pueden contribuir a establecer la plausibilidad
biológica de una asociación entre exposición y cáncer.
Conocer la intensidad con la que la susceptibilidad genética contribuye al riesgo de un individuo
de padecer cáncer (lo que se denomina penetrancia), es particularmente importante en situaciones
profesionales donde, con pocas excepciones, la exposición a sustancias químicas nocivas se desea reducir
a niveles que proporcionen un “riesgo aceptable”.
La epidemiología molecular ha introducido la posibilidad de estudiar los polimorfismos en el DNA,
los cuales son responsables de una parte de la susceptibilidad genética a los carcinógenos. Variaciones
habituales (ocurren en una frecuencia mayor del 1%) en la secuencia genética que pueden acabar en
una proteína alterada se denominan polimorfismos. Muchos polimorfismos no son funcionales, es decir,
no tienen fenotipo. Sin embargo, otros pueden dar origen a proteínas estructuralmente diferentes, lo
que provoca un impacto en la actividad enzimática. Como se ha podido determinar el locus genético
de muchos enzimas, se ha hecho posible la identificación de polimorfismos y la capacidad de distinguir
diferencias genotípicas y fenotípicas en la población. El conocimiento del exceso de riesgo (susceptibilidad)
en una población puede utilizarse para excluir individuos de un estudio, pues podrían alterar los resultados.

Ejemplos de marcadores de susceptibilidad del individuo

1. Variación metabólica: adquirida o heredada

Ejemplos: CYP1A1a, GSTM1b, NAT2c, colinesterasas
2. Estado nutricional
Ejemplos: β-caroteno, selenio, retinoides
3. Factores inmunogenéticos
Ejemplos: polimorfismos del MHCd de clase I y clase II

Fuente: elaboración propia

a: Gen de la familia del citocromo P450.
b: Glutation S-transferasa mu 1
c: N-acetil-transferasa 2
d: Complejo principal de histocompatibilidad
Los diseños de casos y controles son muy eficientes para examinar la interacción entre los
marcadores de susceptibilidad genética y las exposiciones ambientales, particularmente cuando disponemos
de datos de alta calidad sobre la exposición procedentes de cuestionarios o de vigilancia ambiental.
Las mejoras en el diseño de los estudios y en el ajuste de la estratificación de la población
combinando el uso de entrevistas y marcadores genéticos conduce a una nueva era en los estudios
de casos y controles al dotarlos de una potencia mucho mayor. Los factores genéticos no cambian con
el tiempo, no están afectados por el status de la enfermedad y son fáciles de medir retrospectivamente
comparados con los factores de riesgo ambientales. Los estudios de casos y controles son capaces de
estimar el riesgo de enfermedad en la población, ya que dan una información detallada sobre la presencia
o ausencia de un gen de susceptibilidad y permiten definir la magnitud de los riesgos y de la interacción
gen-ambiente, un paso crucial en la prevención de la enfermedad y en la promoción de la salud.

28 Cáncer de pulmón
Limitaciones
Con el uso de los biomarcadores surgen problemas de tipo ético o legal, originados por la determinación
de marcadores de susceptibilidad. Entre ellos está la posibilidad de que el genotipaje sea aplicado
prenatalmente, donde se podría ofrecer el aborto a los padres que hayan concebido un feto afectado.
Cuando la profilaxis o el tratamiento de esa susceptibilidad no pueden ser aplicados y el aborto es
rechazado, se podría argumentar que el conocimiento es más malo que bueno y podría generar una
grave carga psicológica en la persona afectada y/o su familia.
Por ahora es difícil sopesar la contribución de un polimorfismo particular al riesgo total de
enfermedad y sobre todo explicárselo a la población general. Un polimorfismo metabólico puede
proteger frente a un compuesto químico pero aumentar el riesgo de cáncer para otro. Puede aumentar
el riesgo de cáncer para un órgano pero proteger otro. Por esto es muy arriesgado generalizar para
todo el organismo las conclusiones obtenidas en el estudio concreto de un solo tipo de cáncer. Los
polimorfismos de dos o más enzimas diferentes en la misma persona pueden interactuar. En el supuesto
de que estos aspectos se conozcan y se haga posible la identificación de genes que confieran susceptibilidad
o resistencia a los cánceres inducidos por agentes exógenos (como las radiaciones ionizantes o los
compuestos químicos de las industrias), ¿hasta qué punto podría ser usada esta información? ¿Podrían
los empresarios de industrias químicas exigir que todos los potenciales empleados proporcionasen sus
genotipos a la hora de darles un puesto de trabajo? ¿Sería ético poner individuos con genotipos
“resistentes” en áreas de elevada exposición o denegar el empleo a personas con perfiles genéticos de
alto riesgo? ¿Sería posible bajar los estándares de higiene industrial al emplear una fuerza de trabajo
resistente?
Además de la limitación de obtener el consentimiento informado de los sujetos, también surge
la complicación de poder utilizar esas muestras para otros fines diferentes del original. Los investigadores
tienen la responsabilidad de interpretar correctamente los resultados de los estudios de biomarcadores.
Esto se debe a que la información obtenida puede ser usada de forma indebida o tener un efecto no
deseado en los sujetos del estudio.
Para muchos casos de cáncer, las exposiciones ocurridas hace 10-30 años son etiológicamente
relevantes. Incluso los mejores marcadores de exposición química reflejan sólo las últimas semanas o
meses de exposición. Otra dificultad es que no siempre está claro si estamos midiendo la exposición,
el efecto biológico o alguna etapa del proceso patológico.
Otro problema es que, en ausencia de enfermedad (o con ella), los individuos se resisten a
someterse a una toma de muestras invasiva (biopsias, aspirados). El uso de esas muestras hace esencial
para el desarrollo de la epidemiología molecular la colaboración eficaz de diversos especialistas, como
por ejemplo químicos analíticos, bioquímicos, biólogos moleculares, anatomo-patólogos, etc.
Aunque los ensayos de laboratorio generalmente se van mejorando con el tiempo, es casi inevitable
algún grado de mala clasificación (misclassification), especialmente durante la aplicación inicial del ensayo
a poblaciones humanas. Además, en las condiciones de campo comunes a la investigación epidemiológica,
hay factores externos al laboratorio que pueden aumentar la mala clasificación, como la variación en
el cumplimiento, por parte del sujeto, de protocolos fenotípicos y variaciones en la recolección de
muestras, procesado, tiempo de almacenamiento y condiciones de transporte. Las principales fuentes
de error para los ensayos fenotípicos metabólicos incluyen la exposición a medicamentos, ciertos
alimentos u otras exposiciones que inhiben o inducen la actividad enzimática y que podrían provocar
que los individuos que fuesen metabolizadores rápidos se clasificasen como lentos, y viceversa. También
puede haber una mala clasificación del genotipaje por algún fallo al reconocer una variante que contribuye

Factores de susceptibilidad al cáncer de pulmón 29

al genotipo de interés o por el empleo de un cebador erróneo cuando se hace una PCR (polymerase
chain reaction). Finalmente, errores de codificación en cualquier momento durante la recogida de la
muestra, el análisis en el laboratorio o en el procesado de los datos son casi inevitables y acumulables
en los resultados.
Por otra parte, existe también la dificultad de la validación. Hasta ahora, al ser un campo de
investigación que ha surgido hace poco tiempo no está muy claro si algunos biomarcadores reflejan
realmente lo que queremos medir. La validación de los biomarcadores implica la identificación sistemática
de los factores que influyen en la capacidad del marcador para predecir la exposición o un suceso en
la población a estudio. El primer paso, la validación en el laboratorio, implica averiguar factores tales
como el perfil de la curva dosis-respuesta, la sensibilidad a dosis bajas, la especificidad de las exposiciones
y la reproducibilidad del ensayo. En el segundo paso, la validación epidemiológica, se evalúan la sensibilidad
y especificidad en la población, la variación inter e intraindividual en la respuesta del biomarcador, la
persistencia, el nivel base, el valor predicitivo positivo y la posibilidad de realización y su relevancia
biológica.

Validación necesaria de los biomarcadores en la epidemiología molecular

Laboratorio Epidemiológica
Curva dosis-respuesta Niveles base en población no expuesta
Reproducibilidad del ensayo Variación intraindividual en el tiempo
– de un ensayo a otro – sin alterar la exposición
– día a día – al finalizar la exposición
– de un laboratorio a otro (persistencia/vida media)
Límite de detección (sensibilidad a dosis bajas) Variación interindividual
Especificidad de la exposición – respuesta a una exposición dada
– persistencia del biomarcador
Niveles en el tejido sustituto frente al tejido
diana (en su caso)
Relevancia biológica para la enfermedad
Valor predicitvo positivo
Viabilidad
– cantidad y disponibilidad del tejido
– coste
– tiempo requerido para cada ensayo

Fuente: adaptado de Perera.

Otro aspecto de la validación comprende la contribución específica que un biomarcador puede

hacer a la epidemiología, por ejemplo el valor añadido que se gana con el uso del marcador. La mayoría
de los marcadores de dosis interna (exposición) tienen una vida media corta o son biológicamente
inestables, de manera que su uso en estudios epidemiológicos de cáncer es limitado. La estabilidad de
los marcadores debe ser elevada, de forma que el almacenamiento de material biológico durante años
sea válido y eficiente.

30 Cáncer de pulmón
 La contribución adicional de los biomarcadores debe ser medida siguiendo los principios que se
aplican para evaluar la efectividad de un test diagnóstico. Si suponemos que queremos medir
adecuadamente el hábito tabáquico de una población, y que el valor predictivo positivo de un cuestionario
es 0,94: ¿cuál es la ganancia adicional conseguida con la medida de la cotinina-nicotina? De acuerdo con
los conceptos utilizados en epidemiología clínica, 0,94 es la probabilidad pre-test de que el individuo
fume y la medida de la nicotina-cotinina representa la probabilidad post-test. La contribución del
biomarcador puede ser, por lo tanto, estimada como la diferencia entre las dos probabilidades. Una
consecuencia de este razonamiento es que el empleo del marcador es mejor en situaciones intermedias,
por ejemplo, cuando la probabilidad a priori no es ni muy alta ni muy baja. En otras palabras, el uso
de un biomarcador es justificable cuando se reduce significativamente la incertidumbre.

Factores de susceptibilidad al cáncer de pulmón 31

 Publicaciones sobre epidemiología
del cáncer de pulmón: factores de riesgo
Grupo de Investigación del Área de Medicna Preventiva e Saúde Pública.
Universidade de Santiago de Compostela
Juan M. Barros Dios

DARBY S, HILL D, AUVINEN A, BARROS-DIOS JM, et al.

RESIDENTIAL RADON AND LUNG CANCER: DETAILED RESULTS OF A COLLABORATIVE ANALYSIS OF
INDIVIDUAL DATA ON 7,148 SUBJECTS WITH LUNG CANCER AND 14,208 SUBJECTS WITHOUT LUNG
CANCER FROM 13 EPIDEMIOLOGICAL STUDIES IN EUROPE
SCANDINAVIAN JOURNAL OF WORK, ENVIRONMENT AND HEALTH (Aceptado para
publicar)

DARBY S, HILL D, AUVINEN A, BARROS-DIOS JM, BAYSSON H, BOCHICCHIO F, DEO H, FALK R,

FORASTIERE F, HAKAMA M, HEID I, KREIENBROCK L, KREUZER M, LAGARDE F, MÄKELÄINEN I,
MUIRHEAD C, OBERAIGNER W, PERSHAGEN G, RUANO-RAVINA A, RUOESTEENOJA E,
SCHAFFRATH ROSARIO A, TIRMARCHE M, TOMASECK L WHITLEY E, WICHMANN HE, DOLL R.
RADON IN HOMES AND LUNG CANCER RISK: COLLABORATIVE ANALYSIS OF INDIVIDUAL DATA FROM
13 EUROPEAN CASE-CONTROL STUDIES.
BRITHIS MEDICAL JOURNAL (Aceptado en edición normal) Versión on-line publicada el
21/12/2004.

RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.

TYPE OF WINE AND RISK OF LUNG CANCER: A CASE-CONTROL STUDY IN SPAIN.
THORAX 2004 (59): 981-85.

BARROS-DIOS JM, RUANO RAVIÑA A.

CÁNCER DE PULMÓN. FACTORES DE RIESGO.
INVESTIGACIÓN Y CIENCIA 2004 (37):31-33.

RUANO-RAVINA A, FIGUEIRAS A, MONTES-MARTÍNEZ A, BARROS-DIOS JM.

DOSE-RESPONSE RELATIONSHIP BETWEEN TOBACCO AND LUNG CANCER.
EUROPEAN JOURNAL OF CANCER PREVENTION
C: A 12(4) 257-63 2003

RUANO-RAVINA A, FIGUEIRAS A, LOIDI L, BARROS-DIOS JM.

GSTM1 AND GSTT1 POLYMORPHISMS, TOBACCO AND RISK OF LUNG CANCER: A CASE-CONTROL STUDY
FROM GALICIA, SPAIN.
ANTICANCER RESEARCH 23:4333-4338
C: A 23 4333-4338 2003

32 Cáncer de pulmón
RUANO-RAVINA A, FIGUEIRAS A, BARREIRO CARRACEDO MA, BARROS-DIOS JM.
OCCUPATION AND SMOKING AS RISK FACTORS FOR LUNG CANCER: A POPULATION-BASED CASE-
CONTROL STUDY.
AMERICAN JOURNAL OF INDUSTRIAL MEDICINE
C: A 43(2) 149-155 2003 UK

RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.

LUNG CANCER AND RELATED RISK FACTORS:AN UPDATE OF THE LITERATURE
PUBLIC HEALTH
C: A 117 149-156 2003 UK

RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.

MUSICIANS PLAYING WIND INSTRUMENTS AND RISK OF LUNG CANCER: IS THERE AN ASSOCIATION?
OCCUP ENVIRON MED
C: Carta 60: 143 2003 USA

RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.

NOXIOUS EXPOSURES IN LEISURE TIME AND RISK OF LUNG CANCER: A NEGLECTED EXPOSURE?
EPIDEMIOLOGY
C: Carta 13 (2): 235-6 2002 USA

BARROS-DIOS JM, BARREIRO MA, RUANO-RAVINA A, FIGUEIRAS A

EXPOSURE TO RESIDENTIAL RADON AND LUNG CANCER IN SPAIN: A POPULATION-BASED CASE-
CONTROL STUDY
AMERICAN JOURNAL OF EPIDEMIOLOGY
C: A 156(6) 548-555 2002 USA
PREMIO AL MEJOR ARTÍCULO DE INVESTIGACIÓN EPIDEMIOLÓGICA PUBLICADO EN 2002.
OTORGA: SOCIEDAD ESPAÑOLA DE EPIDEMIOLOGÍA

RUANO-RAVINA A, FIGUEIRAS A, DOSIL-DIAZ O, BARREIRO CARRACEDO MA, BARROS-DIOS JM.

A POPULATION-BASED CASE-CONTROL STUDY ON FRUIT AND VEGETABLE INTAKE AND LUNG CANCER:
A PARADOX EFFECT?
NUTRITION AND CANCER
C:A 43(1) 47-51 2002 USA

RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.

THE GENOMICS REVOLUTION: WILL THIS MEAN A RESURGENCE OF CUSTOMIZED PRESCRIPTIONS?
DRUG INFORMATION JOURNAL
C:Carta 36(4) 725-6 2002-11-10 USA

RUANO RAVIÑA A, FIGUEIRAS A, BARROS DIOS JM.

DIET AND LUNG CANCER: A NEW APPROACH.
EUROPEAN JOURNAL OF CANCER PREVENTION.
C: A 9(6) 395-400 2000 HOLANDA

Factores de susceptibilidad al cáncer de pulmón 33

RUANO RAVIÑA A; BARROS DIOS JM
UNA BREVE APROXIMACIÓN A LA EPIDEMIOLOGÍA DEL CÁNCER DE PULMÓN
APUNTES DE SALUD PÚBLICA
C: A 2(20) 15-17 1999 ESPAÑA

RUANO RAVIÑA A; BARROS DIOS JM

APLICACIÓN DE LOS BIOMARCADORES A LOS ESTUDIOS EPIDEMIOLÓGICOS
APUNTES DE SALUD PÚBLICA
C: A 2 (5) 5-9 1998 ESPAÑA

BARROS-DIOS JM, BARREIRO MA et al.

“CÁNCER DE PULMÓN Y RADÓN DOMÉSTICO. DESCRIPCIÓN DE UN ESTUDIO EN EL ÁREA SANITARIA
DE SANTIAGO DE COMPOSTELA:1992-1994”. En “La Sanidad Ambiental y la Salud Pública”, 1997:
117-122. ISBN-84-884 39-49-0

34 Cáncer de pulmón
 Bibliografía

1. Kawajiri K; Nakachi K; Imai K; Yoshii A; Shinoda N; Watanabe J. Identification of genetically high

risk individuals to lung cancer by DNA polymorphisms of the cytochrome P450IA1 gene. FEBS,
1990. 263 (1): 131-133.

2. Zhong S; Wyllie AH; Barnes D; Wolf CR; Spurr NK. Relationship between the GSTM1 polymorphism
and susceptibility to bladder, breast and colon cancer. Carcinogenesis, 1993. 14 (9): 1821-1824

3. Uematsu F; Ikewa S; Kikuchi H; Sagami I; Kanamaru R; Abe T; Satoh K Motomiya M; Watanabe M.

Restriction fragment length polymorphism of the human CYP2E1 (cytochrome P450IIE1) gene
and susceptibility to lung cancer: possible relevance to low smoking exposure. Pharmacogenetics,
1994. 4: 58-63.

4. Alexandrie AK, Sundberg MI, Seidegard J, Tornling G, Rannung A. Genetic susceptibility to lung
cancer with special emphasis on CYP1A1 and GSTM1: a study on host factors in relation to
age at onset, gender and histological cancer type. Carcinogenesis 1994;15(9):1785-90.

5. Wei Q, Cheng Lie, Hong WK, Spitz MR. Reduced DNA repair capacity in lung cancer patients.
Cancer Research 1996. 56: 4103-4107.

6. García-Closas M; Kelsey KT; Wiencke JK; Xu X; Wain JC; Christiani DC. A case-control study of
cytochrome P450 1A1, glutathione S-transferase M1, cigarette smoking and lung cancer
susceptibility (Massachusetts, United States). Cancer Causes and Control, 1997. 8: 544-553.

7. To-Figueras J; Gené M; Gómez-Catalán J; Galán MC; Fuentes M; Ramón JM; Rodamilans M; Huguet E;
Corbella J. Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) polymorphisms and lung
cancer risk among Northwestern Mediterraneans. Carcinogenesis, 1997. 18 (8): 1529-1533.

8. Kelsey KT, Spitz MR, Zuo ZF, Wiencke JK. Polymorphisms in the glutathione S-transferase class
mu and theta genes interact and increase susceptibility to lung cancer in minority populations
(Texas, United States). Cancer, Causes and Control 1997;8:554-59.

9. Rebbeck TR. Molecular epidemiology of the human Glutathione-S-transferase genotypes GSTM1

and GSTT1 in cancer susceptibility. Cancer Epidemiology, Biomarkers and Prevention 1997;
6: 733-743.

10. Jourenkova-Mironova N; Wikman H; Bouchardy C; Voho A; Dayer P; Benhamou S; Hirvonen A.

Role of Glutathione S-transferase GSTM1, GSTM3, GSTP1 and GSTT1 genotypes in modulating
susceptibility to smoking-related lung cancer. Pharmacogenetics 1998. 8:495-502.

11. Pianezza ML; Sellers EM; Tyndale RF. Nicotine metabolism defect reduces smoking. Nature, 1998.
393: 750.

12. Oscarson M; Gullstén H; Rautio A; Bernal ML; Sinues B; Dahl ML; Stengard JH; Pelkonen O;
Raunio H; Ingelman-Sundberg M. Genotyping of human cytochrome P450 2A6 (CYP 2A6), a
nicotine C-oxidase. FEBS Letters, 1998. 438: 201-205.

13. Butkiewicz D; Cole KJ, Phillips DH; Harris CC; Chorazy M. GSTM1, GSTP1, CYP1A1 and CYP2D6
polymorphisms in lung cancer patients from an environmentally polluted region of Poland:
correlation with lung DNA adduct levels. Eur J of Cancer Prevention 1999; 8 : 315-323.

Factores de susceptibilidad al cáncer de pulmón 35

14. To-Figueiras J, Gené M, Gómez-Catalán J, Piqué E, Borrego N, Carrasco JL, Ramón J, Corbella J.
Genetic polymorphims of glutathione-S-transferase P1 gene and lung cancer risk. Cancer Causes
and Control 1999;10:65-70.

15. Rojas M, Cascorbi I, Alexandrov K, Kriek E, Auburtin G, Mayer M, Kopp-Schneider A, Roots I,

Bartsch H. Modulation of benzo(a)pyrene diolepoxide-DNA adduct levels in human white blood
cells by CYP1A1, GSTM1 and GSTT1 polymorphism. Carcinogenesis 2000; 21 (1): 35-41.

16. Stücker I, Jacquet M, de Waziers I, Cénée S, Beaune Ph. Relation between inducibility of CYP1A1,
GSTM1 and lung cancer in a French population. Pharmacogenetics 2000;10:617-27.

17. Hou SM, Fält S, Nyberg F. Glutathione S-transferase T1-null genotype interacts synergistically with
heavy smoking on lung cancer risk. Environmental and Molecular Mutagenesis 2001;38:83-86.

18. Bouchardy .Ch, Benhamou S, Jourenkova N, Dayer P, Hirvonen A. Metabolic genetic polymorphims
and susceptibility to lung cancer. Lung Cancer 2001; 32:109-12.

19. To-Figueras J. Gené M, Gómez-Catalán J, Piqué E, Borrego N, Corbella J. Lung cancer susceptibility
in relation to combined polymorphims of microsomal epoxide hydrolase and glutathione S-
transferase P1. Cancer Letters 2001. 173: 155-162.

20. Zhou W, Liu G, Thurston SW, Xu LL, Miller DP, Wain JC, Lynch TJ, Su L, Christiani DC. Genetic
polymorphism in N-acetyltransferase-2 and microsomal epoxide hydrolase, cumulative cigarette
smoking, and lung cancer. Cancer Epidemiology, Biomarkers & Prevention 2002. 11: 15-21.

21. Stücker I, Hirvonen A, de Waziers I, Cabelguenne A, Mitrunen K, Cénée S, Koum-Besson E, Hémon D,

Beaune Ph, Loriot MA. Genetic polymorphims of glutathione S-transferases as modulators of
lung cancer susceptibility. Carcinogenesis 2002;9:1475-81.

22. Park JY, Lee SY, Jeon HS, Bae NC, Chae SC, Joo S, Kim CH, Park HO, Kam S, Kim IS, Jung TH.
Polymorphism of the DNA repair gene XRCC1 and risk of primary lung cancer. Cancer
Epidemiology, Biomarkers & Prevention 2002. 11: 23-27.

23. Miller DP, Liu G, De Vivo I, Lynch TJ, Wain JC, Su L, Christiani DC. Combinations of the variant
genotypes of GSTP1, GSTM1, and p53 are associated with an increased lung cancer risk. Cancer
Research 2002;62:2819-23.

24. Perera FP, Mooney LV, Stampfer M, Phillips DH, Bell DA, Rundle A, Cho S,Tsai WY, Ma J, Blackwood A,
Tang D. Associations between carcinogene-DNA damage, glutathione S-transferase genotypes,
and risk of lung cancer in the prospective Physicians´ Health Cohort Study. Carcinogenesis
2002;23:1641-46.

25. Paz-Elizur T, Krupsky M, Blumenstein S, Elinger D, Schechtman E, Livneh Z. DNA repair activity
for oxidative damage and risk of lung cancer. J Natl Can Inst 2003. 95 (17): 1312-19.

26. Miller DP, Neuberg D, de Vivo I, Wain JC, Lynch JC, Su L, Christian DC. Smoking and the risk of
lung cancer: susceptibility with GSTP1 polymorphims. Epidemiology 2003;14(5):545-51.

27. Ruano-Ravina A, Figueiras A, Loidi L, Barros-Dios JM. GSTM1 and GSTT1 polymorphims, tobacco
and risk of lung cancer: a case-control study From Galicia, Spain. Anticancer Research 2003;
23:4333-38.

36 Cáncer de pulmón
28. Alexandrie AK, Nyberg F, Warholm M, Rannug [Link] of CYP1A1, GSTM1, GSTT1, and
NQO1 genotypes and cumulative smoking dose on lung cancer risk in a Swedish population.
Cancer Epidemiology Biomarkers & Prevention 2004. 13 (6): 908-14.

29. Kiyohara C, Yoshimasu K, Shirakawa T, Hopkin JM. Genetic polymorphisms and environmental
risk of lung cancer: a review. Reviews on Environmental Health 2004. 19 (1): 15-38.

30. Marin MS, López-Cima MF, García-Castro L, Pascual T, Marrón MG,Tardón A. Poly (AT) polymorphims
in intron 11 of the XPC DNA repair gene enhances the risk of lung cancer. Cancer Epidemiol,
Biomarkers & Prevention 2004;13(11):1788-93.

31. Wenzlaff AS, Cote ML, Bock CH, Land SJ, Schwartz AG. GSTM1, GSTT1 and GSTP1 polymorphims,
environmental tobacco smoke exposure and risk of lung cancer among never smokers: a
population-based study. Carcinogenesis 2005;26(2):395-401.

32. Perera FP; Weinstein IB. Molecular epidemiology and carcinogen-DNA adduct detection: new
approaches to studies of human cancer causation. J of Chron Dis, 1982. 35: 581-600.

33. Taioli E, Zocchetti C, garte S. Models of interaction between metabolic genes and environmental
exposure in cancer susceptibility. Environ Health Perspect 1998; 106:67-70.

34. Sturgis EM, Castillo EJ, Li L, Zheng R, Eicher SA, Clayman GL, Strom SS, Spitz MR, Wei Q.
Polymorphims of DNA repair gene XRCC1 in squamous cell carcinoma of the head and neck.
Carcinogenesis 1999;20:2125-29.

35. Butkiewicz D, Rusin M, Enewold L, Shields PG, Chorazy M, Harris CC. Genetic polymorphims in
DNA genes and risk of lung cancer. Carcinogenesis 2001;22(4):593-97.

36. Garte S et al. Metabolic Gene Polymorphims frequencies in control populations. Cancer Epidemiol,
Biomarkers & Prev 2001;10:1239-48.

37. Garte S. Metabolic susceptibility genes as cancer risk factors: time for reassesment? Cancer
Epidemiol, Biomarkers & Prev 2001;10:1233-37. (Comentario)

38. Ingelmana-Sundberg M, Oscarson M, Daly AK, Garte S, Nebert DW. Human cytochrome P-450
(CYP) genes: a web page for the nomenclature of alleles. Cancer Epidemiol, Biomarkers & Prev
2001;10:1307-08 (Carta)

39. Lemon WJ, Bernert H, Sun H, Wang Y,You M. Identification of candidate lung cancer susceptibility
genes in mouse using oligonucleotide arrays. J Med Genetics 2002;39:644-55.

40. Hou SM, Fält S, Angelini S, Yang K, Nyberg F, Lambert B, Hemminki K. The XPD variant alleles
are associated with increased aromatic DNA adduct level and lung cancer risk. Carcinogenesis
2002;23(4):599-603.

Factores de susceptibilidad al cáncer de pulmón 37

 CARCINÓGENOS Y ORIGEN
DEL CÁNCER DE PULMÓN
Julián Carretero
Centro Nacional de Investigaciones Oncológicas (CNIO)
Madrid

Contenido:
Resumen de la ponencia
Bibliografía
 Carcinógenos y origen del cáncer de pulmón
Julián Carretero
Grupo de cáncer de pulmón
Cantro Nacional de Investigaciones Oncológicas (CNIO) Madrid

1. Introducción
El cáncer de pulmón es el tumor más importante en cuanto a mortalidad en el mundo occidental. La
carcinogénesis pulmonar es el resultado final de la acción de múltiples factores que de forma aislada, aditiva
o sinérgica, lesionan irreversiblemente el epitelio bronquial. El cáncer es una enfermedad genética, resultado
de las alteraciones que presentan las células cancerosas en genes relacionados con el control de la
proliferación y muerte celular. Sin embargo el origen de estas alteraciones (mutaciones) es, la mayor parte
de las veces, ambiental, y en el caso del cáncer de pulmón, el principal agente ambiental implicado en la
carcinogénesis es el tabaco, responsable del 90% de los casos en varones y del 55-80% de los casos entre
las mujeres en los paises de mayor incidencia. Además, también existe una asociación segura entre exposición
ocupacional a otras sustancias (asbestos, radón, arsénico, bis-cloro-metil-éster, berilio, cromo, gas mostaza,
níquel) y aparición de cáncer de pulmón. Sin embargo, no en todos los casos de cáncer de pulmón existe
una causa concreta detectada, ni la presencia de un agente etiológico conlleva siempre la aparición de
cáncer de pulmón ([Link]. sólo el 10-15% de los fumadores desarrollará un cáncer de pulmón a lo largo
de su vida). Estos hechos hacen pensar en la existencia de efectos aditivos y sinérgicos entre las distintas
causas para determinados casos; así como en la existencia de factores de predisposición y de riesgo para
el cáncer de pulmón que quizás por sí solos no son suficientes para la carcinogénesis pero asociados a
otros factores conducen a la aparición del tumor (p.e., factores de susceptibilidad genética).

2. Tabaco y cáncer de pulmón

Los estudios epidemiológicos y experimentales señalan al tabaco como el principal factor etiológico en
el cáncer de pulmón. La consistencia de estos estudios, su especificidad, la secuencia temporal entre la
exposición y la enfermedad, y la relación dosis-respuesta avalan la evidencia de la asociación entre el
consumo de cigarrillos y el cáncer de pulmón. El tabaco induce cualquiera de los grupos histológicos
más frecuentes, existiendo una fuerte asociación con los carcinomas escamosos y los indiferenciados
de célula pequeña.

2.1. Carcinogénesis inducida por el tabaco

El humo del tabaco contiene alrededor de 4.800 compuestos diferentes, que se pueden separar en
compuestos gaseosos y partículas. Al menos 60 de estos compuestos se consideran cancerígenos por
la Agencia Internacional para la Investigación del Cáncer (IARC) en base a evidencias epidemiológicas
y experimentales. La fase gaseosa contiene moléculas potencialmente carcinogénicas como óxidos de
nitrógeno, isopreno, butadieno, benzeno, estireno, formaldehído, acetaldehído, acroleína y furano, mientras
que la fase de partículas cuenta con carcinógenos como los hidrocarburos aromáticos policíclicos (PAH),
nitrosaminas, aminas aromáticas y metales (cromo, níquel, cadmio). Si bien el efecto individual de los
carcinógenos del tabaco es dificil de estudiar a nivel molecular ya que estamos tratando un problema
de exposición crónica a una mezcla compleja de moléculas carcinógenas y/o procarcinógenas, numerosas
evidencias experimentales han demostrado la implicación del tabaco en todos los pasos de la carcinogénesis.

Carcinógenos y origen del cáncer de pulmón 41

Los compuestos carcinogénicos del tabaco se absorben y son metabolizados en los individuos fumadores,
y muchos de estos compuestos reaccionan con el DNA provocando mutaciones, hechos comprobados
experimentalmente utilizando diferentes fracciones de condensados de humo de cigarrillos aplicados
sobre animales de laboratorio, y también en experimentos de inhalación, donde se inducen alteraciones
en el DNA, así como lesiones preneoplásicas.

2.2. Principales carcinógenos del humo del tabaco

• Hidrocarburos aromáticos policíclicos (PAH): el benzopireno es el más estudiado, y su capacidad

para inducir tumores en el pulmón tras la administración local o inhalatoria está plenamente
establecida. Además, existen otros PAH como el dibenzopireno, dibenzoantraceno y el
5-metilcriseno, cuya potencia carcinogénica es mayor pero que aparecen a menores
concentraciones en el humo del tabaco.

• Nitrosaminas: la 4-(metilnitrosamino)-1-(3-piridil)-1-butanona (NNK) es una nitrosamina específica

del humo del tabaco y un potente carcinógeno en roedores. De hecho, es el único carcinógeno
capaz de inducir tumores en el pulmón de los tres modelos murinos de experimentación
más utilizados. Además, es el carcinógeno más abundante del humo del tabaco.

• El 1,3-butadieno es otro de los compuestos que induce el desarrollo de tumores de pulmón

en roedores, aunque depende mucho de la capacidad detoxificadora de cada especie: en
ratones, el 1,3-butadieno es transformado en 1,2,3,4-diepoxibutano, un compuesto mucho más
reactivo y carcinogénico.

• Radicales libres y oxidantes. En el humo del tabaco hay importantes cantidades de radicales
libres que se generan en la combustión, derivados del nitrógeno, como el óxido nítrico, o
derivados del oxígeno, como el radical superóxido o el peróxido de hidrógeno. Estas especies
altamente reactivas son capaces de oxidar, y por tanto dañar, todo tipo de macromoléculas,
entre ellas el DNA. Además, al entrar en contacto el humo del tabaco con los alveolos
pulmonares se van a activar los macrófagos alveolares, los cuales liberarán más radicales libres
que contribuyen a la inflamación. La inflamación crónica se considera hoy en dia como una
situación potencialmente carcinogénica precisamente por la genotoxicidad de las especies
oxidantes y también porque induce la activación de rutas moleculares que fomentan la
transformación tumoral.

• Otros compuestos carcinogénicos: etilcarbamato, óxido de etileno, níquel, cromo, cadmio,

arsénico, hidrazina, formaldehído, acetaldehído.

2.3. Mecanismos de genotoxicidad inducida por el humo del tabaco

La respuesta del organismo a los carcinógenos es similar a la que ocurre durante la exposición a
cualquier xenobiótico. Muchos de estos compuestos son de naturaleza lipófila, cualidad que les permite
atravesar las membranas biológicas, y por esta misma razón son difícilmente eliminables por la principal
vía de excreción, que es la orina. Con el objeto de incrementar esta excreción el organismo somete
al xenobiótico a una serie de transformaciones que se clasifican en dos grupos:

• Reacciones de Fase I: biotransformaciones que aumentan la hidrosolubilidad del compuesto

mediante la introducción de grupos o funciones de carácter polar, como hidroxilaciones, que
capacitan al compuesto para experimentar la fase siguiente. Estas reacciones son llevadas a
cabo por oxidorreductasas, entre las que se encuentran las enzimas de la familia citocromo
P450 (CYP-P450).

42 Cáncer de pulmón
 • Reacciones de Fase II: son reacciones de conjugación en las que los compuestos con los
grupos polares aludidos se unen a reactivos endógenos, como el glutatión, para formar derivados
más hidrosolubles, a través de la reacción catalizada por las glutatión-S-transferasas (GST).
Si bien las enzimas del sistema del citocromo P450 aumentan la polaridad de los compuestos
potencialmente tóxicos con el fin de hacerlas más fácilmente eliminables, estas mismas enzimas de
hidroxilación activan los compuestos carcinogénicos del tabaco (nitrosaminas, benzopirenos), haciéndolos
más reactivos y confiriéndoles capacidad mutagénica. Los carcinógenos activados reaccionan con el DNA
formando aductos con las bases nitrogenadas. Si estos aductos no se reparan convenientemente mediante
los mecanismos celulares pertinentes (nucleotide excision repair pathway) pueden llevar a que, durante
la replicación del DNA, se introduzcan errores en la copia, dando lugar a mutaciones. La existencia de
diferentes polimorfismos en estas enzimas detoxificadoras de xenobióticos (CYP, GST) explicarían en
parte las diferentes susceptibilidades individuales a la acción de los carcinógenos, al igual que ocurre
con las proteínas responsables de la reparación del DNA, que podríamos considerar como genes
supresores de tumores.
En el caso del benzopireno, este carcinógeno es activado por los sistemas de detoxificación para
dar benzopirenol-epóxido (BPDE), un intermediario altamente reactivo capaz de unirse covalentemente
al grupo amino exocíclico de la deoxiguanosina (dG) y formar el aducto BPDE-dG, el cual, si no es
corregido, introducirá una mutación puntual con el cambio de G por T (transversión). En el caso concreto
de la inactivación del gen supresor tumoral p53, el cual se encuentra mutado en un 40% de los casos
de cáncer de pulmón humano, se ha encontrado un patrón mutacional específico de los fumadores
relacionado con la formación de aductos BPDE-dG, en concordancia con datos experimentales obtenidos
tras tratar células del epitelio bronquial con BPDE. La selectividad de la reacción del BPDE con la
deoxiguanosina de los codones “calientes” 157, 158, 245, 248 y 273 de p53 se debería a que la formación
del aducto está facilitada cuando existe 5-metilcitosina en el dinucleótido CpG, algo que ocurre
precisamente en todas las secuencias CpG de los exones cinco al nueve de p53.
Las nitrosaminas activadas metabólicamente, el 1,3-butadieno o el cloruro de vinilo, median
reacciones de alquilación del DNA, dando lugar a sitios abásicos que al ser replicados introducirán
mutaciones, predominantemente transversiones de G a T.

3. Otros agentes cancerígenos

Como hemos explicado anteriormente, los carcinógenos del tabaco son los responsables de la mayoria
de los cánceres de pulmón, si bien existen importantes carcinógenos, especialmente relacionados con
exposiciones ocupacionales, como los asbestos o el radón. Otros factores carcinogénicos reconocidos
serían la contaminación atmosférica y la menor ingesta de vegetales y frutas frescas, alimentos ricos en
antioxidantes naturales, que hipotéticamente implicaría menor protección frente al daño oxidativo inducido
por otros carcinógenos.

3.1. Asbestos
El asbesto aumenta el riesgo de cáncer de pulmón, mesotelioma y asbestosis. Mineros, molineros,
trabajadores del textil, del cemento, frenos, máscaras y aislamientos, materiales de calefacción, constructores
de embarcaciones y similares son profesionales habitualmente expuestos al asbesto; entre ellos, el 20%
fallece de cáncer de pulmón y el 5-10% de mesotelioma. La exposición tiene un efecto dosis-respuesta
y un sinergismo con el tabaco. El riesgo relativo para el cáncer de pulmón es de 1,5 a 13,1 cuando se

Carcinógenos y origen del cáncer de pulmón 43

combinan ambos factores. Todos los tipos histológicos pueden verse aumentados, y habitualmente se
localizan en lóbulos inferiores o en localizaciones periféricas. Su acción carcinogénica se explica por la
inflamación crónica que ocasionan las fibras largas y delgadas que penetran, se retienen en los pulmones
y que los alvéolos son incapaces de expulsar. La genotoxicidad estaría mediada por la generación de
especies reactivas del oxígeno y del nitrógeno capaces de dañar al DNA. En este sentido se ha
demostrado experimentalmente que las partículas inducen por sí mismas, incubándolas en medio acuoso
junto con DNA, la generación de radicales libres como el hidroxilo, capaz de provocar oxidaciones en
las cuatro bases y roturas de la hebra de DNA. Además, cuando las partículas de asbesto son captadas
por las células fagocitarias inducen la inflamación y posterior generación de especies reactivas genotóxicas.
El producto de la oxidación del DNA más estudiado es la 8-hidroxideoxiguanosina (8-OhdG), cuya
aparición provoca transversiones de G a T y que se utiliza como marcador de daño oxidativo al DNA
al ser fácilmente detectable en muestras de tejido y orina de animales de experimentación tratados
con asbesto.

3.2. Radón
El radón es un gas inerte derivado del [Link] un débil poder radiactivo y alguno de sus subproductos
emite partículas alfa, que pueden irradiar el epitelio de las vías respiratorias; el efecto carcinogénico
vendría dado por la acción directa de la radiación, capaz de inducir roturas cromosómicas y alteraciones
en las bases nitrogenadas, y por acción indirecta al provocar la formación de radicales libres a partir
de la radiolisis o rutura homolítica del agua. Los trabajadores de las minas de uranio tienen un riesgo
mayor de muerte por cáncer de pulmón con una ratio de 12,7. El radón se ha relacionado, sobre todo,
con una mayor incidencia de carcinoma microcítico de pulmón. Aunque el radón ambiental se encuentra
en el subsuelo, en el aire, en el agua y en los materiales de construcción de los edificios, no está claro
que las observaciones de los trabajadores de las minas de uranio, con niveles de exposición más altos,
puedan extrapolarse a la población general.

Bibliografía:
1. DeMarini DM. Genotoxicity of tobacco smoke and tobacco smoke condensate: a review. Mutat
Res. 2004 Nov;567(2-3):447-74.
2. Donaldson MS. Nutrition and cancer: A review of the evidence for an anti-cancer diet. Nutr J.
2004 Oct 20; 3(1):19.
3. Gazdar A, Franklin WA, Brambilla E, Hainaut P, Yakota J, Harris CC. Genetic and molecular
alterations. In: Pathology and genetics, tumours of the lung, pleura, thymus and heart, Travis WD,
Brambilla E, Müller-Hermelink K, Harris CC, eds. IARC Press, publisher. 2004.
4. Knaapen AM, Borm PJ, Albrecht C, Schins RP. Inhaled particles and lung cancer. Part A: Mechanisms.
Int J Cancer. 2004 May 10;109(6):799-809.
5. Pfeifer GP, Denissenko MF, Olivier M, Tretyakova N, Hecht SS, Hainaut P. Tobacco smoke
carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene. 2002
Oct 21; 21(48):7435-51.
6. IARC monograph on the evaluation of carcinogenic risk to humans: tobacco smoke and involuntary
smoking. Volume 83, IARC, Lyon, 2004.

44 Cáncer de pulmón
 ALTERACIONES
GENÉTICO-MOLECULARES
EN EL CÁNCER DE PULMÓN
Montserrat Sánchez-Céspedes
Centro Nacional de Investigaciones Oncológicas (CNIO)
Madrid

Contenido:
Resumen de la ponencia
Bibliografía
 Alteraciones genético-moleculares
en el cáncer de pulmón
Montserrat Sánchez-Céspedes
Grupo de cáncer de pulmón
Cantro Nacional de Investigaciones Oncológicas (CNIO) Madrid

pesar de los avances, el cáncer de pulmón es la primera causa de muerte por cáncer en nuestro
A país. Evidentemente, el mayor logro conseguido hasta el momento ha sido identificar el consumo
de tabaco como el principal factor responsable de la aparición de cáncer de pulmón. A pesar de ello,
mucha gente seguirá desarrollando durante los próximos años este tipo de cáncer y, por lo tanto, es
necesario aumentar los esfuerzos para comprender los mecanismos biológicos que contribuyen a su
aparición y a su evolución.
El proceso de carcinogénesis se inicia y progresa debido a la acumulación de alteraciones en
genes esenciales para el crecimiento y división celular. Un objetivo básico de la investigación molecular
del cáncer es la identificación de todos aquellos genes implicados en el desarrollo tumoral y la elucidación
de sus características funcionales. Hasta la fecha se han descrito diversas alteraciones genéticas y
moleculares que caracterizan a la célula tumoral, las cuales son diversas y suelen producirse en vías
bioquímicas muy concretas. Sin embargo, no todas las proteínas implicadas en una determinada vía
bioquímica son susceptibles de alterarse genética o epigenéticamente en la célula tumoral. De hecho,
hasta la fecha tan sólo se han identificado unos pocos genes con anormalidades en la secuencia del
DNA. Las principales rutas bioquímicas que contienen genes con alteraciones genéticas o epigenéticas
y que, por lo tanto, se encuentran anormalmente reguladas en tumores incluyen: la división celular,
detección y reparación del daño al DNA, muer te celular programada (o apoptosis), factores de
transcripción, vías transductoras de señales y moléculas de adhesión celular. A continuación se describirán
las principales moléculas alteradas genéticamente en tumores pulmonares.

1. Alteraciones genéticas en componentes del ciclo celular en el cáncer de pulmón

Las alteraciones genéticas en componentes reguladores del ciclo celular son muy comunes en el cáncer.
En el caso del cáncer de pulmón los principales genes alterados son los genes supresores tumorales
retinoblastoma (Rb) y p16. Rb se altera principalmente en cáncer de pulmón de célula pequeña (CPCP)
y p16 en cáncer de pulmón de célula no pequeña (CPCNP). En ambos casos las alteraciones son
mediante mutaciones puntuales, deleciones génicas y, en el caso de p16, hipermetilación de su región
promotora. Otra alteración menos frecuente es la amplificación génica del oncogén ciclina D1. Además
de alteraciones a nivel del gen, existen alteraciones en los niveles de distintas proteínas implicadas en
el ciclo celular. Como se comentará en algunas de las sesiones del presente curso, es frecuente la
pérdida de los inhibidores del ciclo P21, P27, así como incrementos en los niveles de distintas ciclinas
(ciclina A, B, E, D) y quinasas dependientes de ciclinas (CDK1, CDK2, CDK4, CDK6) que promueven
la progresión del ciclo celular. En definitiva, todas estas anormalidades conllevan una desregularización
del ciclo celular permitiendo que se produzca una división celular constante en la célula tumoral.

Alteraciones genético-moleculares en el cáncer de pulmón 47

2. Alteraciones génicas en vías transductoras de señales bioquímicas
Las alteraciones en estas vías dan lugar a la transmisión de un estímulo constante al interior de la célula,
independientemente de los factores reguladores. El resultado suele ser un efecto mitogénico, es decir,
transmisión de señales que inducen a la célula a dividirse. De entre las mutaciones más frecuentes de
esta categoría en cáncer de pulmón están las mutaciones en Kras, en tumores de tipo histológico
adenocarcinomas. Otros genes habitualmente mutados son PTEN y LKB1, el primero en CPCP y el
segundo en adenocarcinomas. Además de alteraciones génicas existen, como en el caso anterior,
alteraciones en los niveles de ciertas proteínas implicadas en dichas vías que participan en el proceso
carcinogénico de estos tumores.

3. Alteraciones génicas en la vía de la apoptosis

La apoptosis es la muerte celular programada de una célula ante ciertos daños que son incompatibles
con su buen funcionamiento. Así, por ejemplo, cuando se produce un excesivo daño al DNA (p.e. un
exceso de radiación ionizante) se activan dentro de la célula mecanismos que promueven la reparación
de ese daño genético o, si el daño es irreparable, se promueve la apoptosis. Entre las moléculas que
regulan estos mecanismos y que se encuentran alteradas en cáncer de pulmón tenemos p53 y p14,
ambas alteradas en distintas proporciones en los distintos tipos histológicos de cáncer de pulmón.
Además de alteraciones genéticas o epigenéticas de estos componentes son comunes los cambios
en los niveles de distintas proteínas implicadas en la apoptosis como los reguladores fas, survivina,
NFKB, etc.

4. Alteraciones génicas en reguladores de la transcripción génica

En tumores pulmonares se encuentran frecuentemente amplificados los genes de la familia myc en el
CPCP. Además, se ha demostrado la presencia de mutaciones y alteraciones en los niveles de proteínas
implicadas en la regulación transcripcional a través de la remodelación de la cromatina. Así pues, son
comunes las pérdidas de BRG1/SMARCA4, el componente con actividad ATPasa del sistema regulador
de la cromatina denominado SWI/SNF.
Los genes que se han descrito alterados hasta el momento son probablemente una pequeña
parte del conjunto de genes que participan en el desarrollo del cáncer de pulmón. Estudios de alteraciones
cromosómicas globales basados en cariotipos, alelotipos, CGH (Comparative Genome Hybridization) y
otros indican que existen distintos cromosomas que presentan frecuentes ganancias o pérdidas de
material genético, lo que sugiere que debe existir oncogenes y genes supresores tumorales todavía por
identificar. De entre estas regiones cromosómicas se encuentran los cromosomas 6q, 8q, 19q y 3p.
Un aspecto muy interesante, aunque todavía poco estudiado del cáncer de pulmón, es la
identificación de genes cuyas alteraciones en línea germinal conllevan un elevado riesgo de desarrollar
cáncer de pulmón. Tal y como se expondrá en alguna de las presentes sesiones, polimorfismos en genes
que metabolizan ciertos carcinógenos parecen contribuir a un mayor riesgo de desarrollar tumores
asociados al consumo de tabaco, como cáncer de pulmón y tumores de cabeza y cuello. Además,
recientes estudios parecen demostrar que existe un gen en el cromosoma 6 responsable de la elevada
predisposición a cáncer de pulmón en individuos fumadores.
Finalmente, en la última década se están desarrollando tecnologías de análisis masivo que permiten
el estudio de la expresión global (cDNA microarrays) y de tejidos (tissue microarrays), y que impulsarán
el descubrimiento de nuevas moléculas con importancia en el desarrollo del cáncer de pulmón y permitirá
la detección de marcadores moleculares útiles en el manejo del enfermo de cáncer. En algunas de las
sesiones del presente curso se darán a conocer algunos resultados y ejemplos del uso de estas tecnologías.

48 Cáncer de pulmón
 En definitiva, la descripción de las alteraciones genético-moleculares de los tumores tiene un
amplio potencial para el manejo del enfermo de cáncer ya que, en un futuro próximo, podrían ser
utilizadas a varios niveles: a) identificación de individuos con susceptibilidad a padecer cáncer; b) nuevos
marcadores para el diagnóstico precoz en individuos de alto riesgo; c) posibles marcadores con aplicación
en el pronóstico y respuesta a tratamiento del enfermo de cáncer; d) nuevas dianas para el diseño y
nuevas terapias diseñadas de forma específica a dichas alteraciones.

Bibliografía:
1. Sánchez-Céspedes M. Dissecting the genetic alterations implicated in lung carcinogenesis. Lung
Cancer, 40(2):111-21 (2003).
2. Osada H & Takahashi T. Genetic alterations of multiple tumor suppressors and oncogenes in the
carcinogenesis and progression of lung cancer. Oncogene, 21(48): 7421-7434 (2002).
3. Sánchez-Céspedes M & Sidransky D. DNA-based detection of neoplastic cells for clinical cancer
management. Revista de Oncologia, .1 (6): 284-290 (2001).
4. Sekido Y, Fong KM, Minna JD. Progress in understanding the molecular pathogenesis of human
lung cancer. Biochim Biophys Acta. 1378(1): F21-59 (1998).

Alteraciones genético-moleculares en el cáncer de pulmón 49

 TELÓMEROS Y TELOMERASA
EN CÁNCER DE PULMÓN
Jean-Charles Soria
Institut Gustave Roussy
Villejuif, Francia

Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
 Telomerase and telomeres in lung carcinogenesis
Jean-Charles Soria
Institut Gustave Roussy
Villejuif, France

Background
Human telomeres are simple repeated sequences of TTAGGG located at the ends of chromosomes.
Those guanine-rich structures capping the chromosome termini are essential to prevent aberrant
recombination, protect chromosomes against exonucleolytic DNA degradation and appear to be important
for the regulation of genes at distal loci (Blackburn et al, 1991; Zakian et al, 1995). Furthermore telomeres
are supposed to be involved in senescence and immortalization of normal cells. Increasing evidence
indicates that telomeric DNA shortens during the maturation of various human somatic cells (Allsopp
et al, 1995; Harley et al, 1990). Senescence of these cells may occur as a result of a checkpoint arrest
in response to shortened telomeres. The loss of telomeric repeats after each cell division may constitute
a biological clock limiting the proliferative life span of somatic cells (Allsopp et al, 1995). To compensate
for the shrinking of telomeres that results from incomplete terminal replication, germline, immortalized
and tumor cells express an RNA-dependent DNA polymerase named telomerase. The ribonucleoprotein
enzyme synthetizes the telomeric DNA repeats by using an RNA template, termed hTR, subunit of the
telomerase holoenzyme (Feng et al, 1999). The second major component, hTERT, is the catalytic sub-
unit of the telomerase. The expression of hTERT is regulated (both positively and negatively) and tightly
correlated to the enzymatic activity (Liu et al, 1999; Oh et al, 1999). Various other proteins are also
associated with the telomerase complex (e.g. TP1, the chaperonin hsp90, and Ku, which is involved in
repair of DNA double-strand breaks), the duplex telomeric region (e.g. TRF1 and associated proteins
tankyrase and TIN2), and the single-stranded G-rich telomeric overhang (e.g. TRF2 and associated proteins
MRE11 and RAD50) (Steensel et al, 1997; Kim et al, 2000; Zhu et al, 2000; Smith et al, 2000).

Telomerase and cancer

Telomerase has been detected in the great majority of tumours investigated, establishing it as the most
widespread marker of cancer currently under study. Although, overall, telomerase activity is detectable
in around 90% of tumour samples, some specific tumour types, such as glioblastomas, astrocytomas, and
retinoblastomas, show a low proportion of telomerase positive samples (Dhaene et al, 2000). Telomerase
is preferentially expressed in tumor cells with short telomeres and is not expressed in most somatic
cells, which usually have longer telomeres. Telomerase is expressed in 80-85% of NSCLC and in almost
all SCLC (Albanell et al, 1997).

Telomerase and lung tumorigenesis

Histological changes associated with chronic smoking and cancer includes loss of cilia, cellular atypia,
reserve cell hyperplasia, squamous metaplasia and dysplasia, and carcinoma in situ. Treatment or control
of precancerous lesions may be a way to avoid the development of invasive cancers. Growing evidence
links hTERT to a multi-step model of lung cancer progression. An important question is where exactly
in cancer progression for telomerase-positive tumors is the enzyme switched on? Telomerase activity is
detected in precancerous lesions of the lung, reflecting the early involvement of the molecule in lung
tumorigenesis (Yashima et al, 1997, Soria et al, 2003). It is therefore believed that the progression from
hyperplasia to dysplasic pre-cancerous lesions is accompanied by telomerase on-switching in lung cancer.

Telómeros y telomerasa en cáncer de pulmón 53

Telomerase as a prognostic biomarker
The data supporting a role for telomerase as a prognostic indicator are compelling in several cancer
types and especially in early stage NSCLC. Telomerase activity has been correlated with cell proliferation,
higher TNM tumor stage, and node invasion (Albanell et al, 1997). The following table summarizes those
studies:

Prognostic value of hTERT in different cancer types:

Reference Cancer Prognostic value
Hiyama et al. 1995 Neuroblastoma Overall survival
Hiyama et al. 1995 Gastric Overall survival
Langford et al.1996 Meningioma Overall survival
Clark et al. 1997 Breast Overall survival
Tatsumoto et al. 2000 Colon Overall survival
Marchetti et al 1999 Lung Overall survival
Wang et al 2002 Lung Overall survival

Telomerase and telomeres as a therapeutic targets (Hahn et al 1999, Hamilton et la, 1999, Raymond
et al, 2000; Kelland et al, 2001)

Targeting hTERT
• Reverse transcriptase inhibitors that can block telomerase because of its RNA-dependent
telomerase activity:
• AZT (IC50 mM to nM), ddG
The results are inconsistent and may be related to mitochondrial DNA replication
inhibition.

• Dominant negative hTERT approach

• Transfection of dominant-negative constructs into tumor cells
The telomerase becomes catalytically inactive but able to sequester hTR (and hTERT?)
Very promising and fits the criteria of telomerase inhibition selectivity. A problem is the
cell delivery (target cancer cells and uptake of the vector)

• Immunotherapy
hTERT is an ideal tumor antigen and hTERT can be processed by the proteosomes and
presented in an MHC context as an Ag recognized by CTLs. It has been shown that hTERT-
derived peptides can be recognized in this setting. Different working groups have isolated
hTERT-specific CTL able to lyse cancer cell lines and tumors in a telomerase and MHC-
restricted fashion. hTERT-derived peptides can be identified for several of the prevalent
MHC haplotypes. There might be a risk of auto-immunity.

54 Cáncer de pulmón
 Targeting hTR
• Ribozymes
Those are molecules that can cleave other RNAs in a sequence specific manner.
When used against hTR, there is a good telomerase inhibition and cell growth delay but
no reduction in telomere length. Use this strategy against the against hTERT messenger
RNA could be even more promising.
• Antisense oligonucleotides
Tests with standard oligodesoxynucleotides have shown disappointing results with limited
stability and bioavailability. The use of peptic nucleic acids, PNA, (analogs of DNA and RNA),
resistant to the degradation of exo and endonucleases, is more promising because PNAs
act through a specific inhibition of telomerase and fit the criteria of telomerase inhibition
selectivity. The main obstacle is still how to ensure optimal cell delivery.

Targeting the telomeres and associated proteins

The G-rich singlestrand telomere overhang can fold back on itself in vitro to form fourstrand G
quadruplex (or tetraplex) structures that then inhibit the elongation steps catalysed by telomerase.
49 Searches for compounds that bind selectively to G-quadruplexes rather than duplex DNA
resulted in the discovery of the first potent small-molecule inhibitors of telomerase. Inhibition of
telomerase by stabilization of the G-quadruplexes by porphyrin derivatives, acridine derivatives,
anthraquinones and fluorenone-based compounds are the most promising ones.

Conclusion
Telomerase has a key role in the multistep carcinogenic process of the lung, is frequently expressed in
invasive NSCLC tumors and is associated with poor outcome for some authors. The rationale for
targeting telomerase in NSCLC is robust. The first telomerase inhibitors have entered clinical trials and
may represent an exciting novel approach to cancer chemotherapy (Kelland et al, 2001). However, much
more needs to be learned rapidly, to integrate the biological properties of this enzyme to the optimum
clinical use of inhibitors. Other questions such as which tumours should be targeted, and what are
relevant pharmacodynamic markers of inhibition, must also be answered.

References
1. Albanell J, Lonardo F, Rusch V, Engelhardt M, Langenfeld J, Han W et al. High telomerase activity
in primary lung cancers : association with increased cell proliferation rates and advanced pathologic
state. J Natl Cancer Inst 1997 ; 89 : 1609-15.
2. Blackburn EH. Structure and function of telomeres. Nature 1991; 350: 569–72.
3. Blackburn EH. Telomere states and cell fates. Nature 2000; 408: 53–56.
4. Dhaene K, Marck EV, Parwaresch R.; Telomeres, telomerase and cancer: an update; Virchows
Arch. 2000; 437: 1-16.
5. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human
cancer cells. Nat Med 1999; 5:1164–70.

Telómeros y telomerasa en cáncer de pulmón 55

 6. Hiyama E, Hiyama K, Yokoyama T, et al. Correlating telomerase activity levels with human
neuroblastoma outcomes. Nat Med1995; 1: 249–55.
7. Kelland LR. Telomerase: biology and phase I trials. Lancet Oncol 2001; 2: 95–102
8. Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with
immortal cells and cancer. Science 1994; 266: 2011–15.
9. Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity as a prognostic indicator in stage I
non-small cell lung cancer. Clin Cancer Res 1999; 5: 2077–81.
10. Raymond E, Soria JC, Izbicka E, Boussin F, Hurley L, Von Hoff DD. DNA G-quadruplexes,
telomere-specific proteins and telomere-associated enzymes as potential targets for new anticancer
drugs. Invest New Drugs, 2000, 18: 123-37.
11. Soria JC, Xu X, Liu DD, Lee JJ, Kurie J, Morice RC, Khuri F, Mao L, Hong WK, Lotan R. Retinoic
Acid receptor Beta and telomerase catalytic subunit expression in bronchial epithelium of heavy
smokers. J Natl Cancer Inst 2003; 95: 165-168.
12. Wang L, Soria JC , Kemp BL, Liu DD, Mao L, Khuri FR. hTERT Expression Is a Prognostic Factor
of Survival in Patients with Stage I Non-Small Cell Lung Cancer. Clin Cancer Res 2002; 8: 2883-2889.
13. Yashima K, Litzky LA, Kaiser L, et al. Telomerase expression in respiratory epithelium during the
multistage pathogenesis of lung carcinomas. Cancer Res 1997; 57: 2373-7.

56 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 57
58 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 59
60 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 61
62 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 63
64 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 65
66 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 67
68 Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón 69
 LECTURA CRÍTICA
DE LOS ARTÍCULOS
SOBRE FACTORES ETIOLÓGICOS
DEL CÁNCER DE PULMÓN
Esteve Fernández
Institut Català d’Oncologia
Institut d’Investigació Biomèdica de Bellvitge (IDIBELL)
Barcelona

Contenido:
Resumen de la ponencia
 Lectura crítica de los artículos sobre factores
etiológicos del cáncer de pulmón
Esteve Fernández
Servicio de Prevención y Control del Cáncer
Institut Català d’Oncologia, IDIBELL
Departamento de Salud Pública
Universitat de Barcelona

Texto preparado a partir de los materiales del curso sobre “Preparación de publicaciones biomédicas”
del Master a distancia en “Metodología de la investigación: Diseño y Estadística en Ciencias de la Salud”
de la Universitat Autònoma de Barcelona (Fernández E., García A.M. Cómo evaluar y leer artículos
científicos. Barcelona: Signo; 2005).

Agradecimientos
A Ana M. García y Josep Maria Domènech por la oportunidad de haber reflexionado y trabajado con
ellos acerca de diferentes aspectos de la publicación científica y sobre la lectura crítica de la literatura.
Se agradece la financiación de las Redes Cooperativas de Investigación en “Cáncer” (C03/010) y
“Epidemiología y Salud Pública” (C03/09) del Instituto de Salud Carlos III.

1. Introducción
La lectura crítica y sistemática de la literatura nos ayudará a conocer bien la literatura, a separar el
grano de la paja, tanto en la preparación de nuestros trabajos como en la revisión o evaluación que
podamos hacer de otros trabajos para alguna revista. En esta sesión se dan unas normas o criterios
generales para evaluar críticamente la literatura y se entra de manera individualizada en los principales
tipos de diseño y de artículos relevantes en el estudio etiológico del cáncer de pulmón.

2. Objetivos
1. Conocer los criterios generales de lectura crítica de la literatura.
2. Conocer los criterios específicos de lectura crítica de acuerdo con los principales tipos de
diseño de investigación observacional sobre el cáncer de pulmón.

3. Criterios generales para la lectura crítica de artículos

En demasiadas ocasiones se ha sacralizado “la letra impresa”: es decir, se da por válido y relevante
cualquier información que venga avalada por el peer review de una prestigiosa (o no tan prestigiosa)
revista. Es evidente que no se puede “dudar” de todo lo que cae en nuestras manos, pero sería incluso
más peligroso aceptarlo todo sin evaluación crítica. Cuando tengamos en nuestras manos un trabajo
que vayamos a incorporar a nuestro “cuerpo de conocimiento” es acertado plantearse una duda
razonable y ser sistemáticos en la lectura de ese artículo. Debemos utilizar, en la medida de lo posible,
una serie de criterios que nos ayuden a discernir acerca de si los resultados o las evidencias presentadas
son válidos, es decir, próximas a la verdad, y para decidir si los resultados son importantes.

Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón 73
 Vamos a identificar cuestiones que tienen que ver con la dimensión del diseño y de los resultados
obtenidos, en términos de validez interna y externa, relevancia y utilidad práctica, que repasaremos
sistemáticamente según la presentación habitual del trabajo, es decir, según los apartados en que se
estructuran la mayoría de trabajos científicos (estructura “IMRD”). Es decir, cuando leamos críticamente
un artículo deberemos “responder” sistemáticamente a las cuestiones planteadas según la presentación
clásica del artículo para pasar a decidir sobre las cuestiones de validez, relevancia y utilidad.

Respecto a la validez interna del estudio, se tratará de evaluar si los resultados obtenidos en el
estudio se desvían o no de la realidad, es decir, si el estudio está libre de sesgos o error sistemático y
por tanto tiene una alta validez interna o no. En algunas ocasiones, grandes estudios que responden a
hipótesis y objetivos bien planteados presentan deficiencias metodológicas que hipotecan cualquier
resultado que se pueda derivar, sencillamente porque el estudio no está bien hecho. Buena parte de
los criterios sugeridos para la lectura tienen que ver con la validez interna del estudio. Si un trabajo
carece de validez interna puede ser incluso recomendable no proseguir con su lectura, puesto que
cualquier inferencia o conclusión que se pueda derivar de él carecerá realmente de valor. En muchas
ocasiones no existe una respuesta dicotómica (es válido/no es válido) a esta pregunta, y las diferentes
preguntas sobre el diseño del estudio, los pacientes incluidos y excluidos o sobre cómo se recogió la
información, ayudan a situar la respuesta en una escala entre el “absolutamente inválido” y el “absolutamente
válido”.

Algunos de los criterios que se van a presentar tienen que ver con la relevancia de los resultados,
es decir, saber qué resultados se han obtenido y con qué precisión se han estimado, para poder valorar
su importancia sanitaria, social o clínica. Por ejemplo, un estudio sobre riesgo de cáncer de pulmón y
exposición al radón puede determinar que existe un RR de 1,12 estadísticamente significativo para una
exposición al radón en el cuartil superior de su distribución (concentración 1.000 veces más elevada
que la habitual). ¿Qué importancia daremos a esa estimación?

Finalmente, la dimensión sobre utilidad de los resultados tiene que ver con su aplicabilidad en
nuestra experiencia profesional y ello tiene que ver tanto con nuestro contexto como con el contexto
en que se ha realizado la investigación cuyos resultados abordamos críticamente, es decir, con su validez
externa, entendida como generabilidad de los resultados. Por ejemplo, la efectividad de un programa
poblacional de detección precoz del cáncer de pulmón mediante PET en un estudio realizado en
Estocolmo, donde la participación es elevada (del 75%). Su aplicabilidad en nuestro ámbito (por ejemplo,
una ciudad de mediano tamaño española) puede quedar muy lejana, dado que conocemos que este
tipo de dispositivos está disponible sólo en algunos centros de alta tecnología y que la participación
en este tipo de programas no alcanzaría el 35% de nuestra población.

Debemos recordar en último lugar que la lectura crítica de artículos es una actividad (personal
o de grupo) encaminada a discernir la validez de trabajos escritos por otros colegas para nuestros
objetivos de investigación. No debemos confundir la “lectura crítica” con la lectura que haríamos para
realizar una revisión editorial por encargo como evaluadores externos (aunque los criterios propuestos
pueden servir de ayuda para ello). Por ejemplo, al valorar la “utilidad” de un artículo cuando actuamos
como evaluadores externos debemos pensar en la audiencia de la revista, mientras que en la lectura
crítica pensamos fundamentalmente en nuestra propia práctica profesional. Por ello, es conveniente
finalizar la lectura del artículo y la aplicación de los criterios respondiendo, como decíamos anteriormente,
a tres cuestiones básicas: 1) ¿el artículo es válido?, 2) ¿sus resultados son relevantes?, y 3) ¿el artículo
nos es útil?

74 Cáncer de pulmón
4. Criterios para la lectura crítica de artículos de casos y controles
Aunque en algunos textos de epidemiología los estudios de casos y controles son considerados muy
inferiores en calidad a los estudios de cohortes y mucho más susceptibles a la acción de diferentes
tipos de sesgos sistemáticos, muchos epidemiólogos consideran que un estudio de casos y controles
bien diseñado presenta muchas ventajas y muy pocos inconvenientes en comparación con los costosos
estudios de cohortes. En relación con la lectura crítica de los estudios de casos y controles se deben
considerar cuestiones comunes a la lectura de cualquier otro diseño de investigación y aspectos más
específicos de este tipo de estudios. En la Tabla 1 se resumen los criterios propios para la lectura crítica
de los estudios de casos y controles.
Un aspecto especialmente determinante de la validez en los estudios de casos y controles es la
selección de los grupos a comparar. En los estudios de casos y controles la representatividad poblacional
no es la cuestión relevante. La clave se encuentra en la medida en la que casos y controles representan
la misma población fuente o de origen. Puesto que la selección de los casos suele anteceder a la de
los controles, lo fundamental será elegir un grupo control que represente adecuadamente la población
de la que proceden los casos. Por ejemplo, si los casos se eligen a través de los servicios de un hospital,
en principio los controles más adecuados serían los que llegaran a través de la misma fuente que los
casos, es decir, la población usuaria de dicho hospital. El objetivo fundamental es que los controles
permitan estimar la distribución de la exposición o exposiciones de interés en la población base de la
que proceden los casos. Así, los controles serán los individuos que, de haber desarrollado la enfermedad,
se encontrarían en el grupo de casos incluidos en el estudio o, al menos, en el grupo de casos elegibles
para el estudio.
En un artículo que presente los resultados de un estudio de casos y controles podemos fijar
nuestro interés inicial en los casos. En primer lugar, la correcta identificación de la población origen de
los casos deberá permitirnos valorar la adecuación en el proceso de selección de los controles. En
segundo lugar, los propios criterios de selección de los casos (incidentes/prevalentes, criterios diagnósticos,
criterios de inclusión/exclusión) nos permitirán valorar la validez del estudio y las conclusiones que
podremos extraer del mismo. En principio un estudio de casos y controles basado en casos incidentes
es más sólido que si se trata de casos prevalentes. De hecho, cuando se trata de casos incidentes es
muy fácil asimilar el estudio de casos y controles al estudio de cohortes (los casos equivaldrían a los
casos que aparecerían en el estudio de cohortes y los controles serían una muestra representativa de
las cohortes de origen de los casos). Cuando se trabaja con casos prevalentes las conclusiones del
trabajo pueden ser más inciertas.
Elementos también importantes en la selección de casos y controles es la garantía de su calidad
como tales (es decir, que los casos no sean “falsos positivos” de la enfermedad, o los controles “falsos
negativos” de la misma). Los autores deberán explicar claramente los criterios diagnósticos aplicados para
la selección de los casos y los criterios utilizados para descartar la condición de interés en los controles.
Otro aspecto fundamental en ambos grupos es su representatividad respecto a los sujetos inicialmente
seleccionados (es decir, las características de la no respuesta en casos y controles). En este último sentido,
al igual que en otros tipos de diseño, es muy conveniente que los autores puedan describir las características
de participantes y no participantes en el estudio o, al menos, hagan algunas asunciones respecto al efecto
que pueda haber tenido la falta de participación de los sujetos inicialmente considerados para su inclusión
en la investigación tanto en el grupo de los casos como en el de los controles.
La medida adecuada de la exposición u otros factores de interés es igualmente importante, no
sólo en este diseño sino en cualquier otro tipo de investigación. En los estudios de casos y controles
la exposición se mide típicamente de manera retrospectiva, y por lo tanto los errores de clasificación

Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón 75
respecto a esta variable son potencialmente más probables. Tanto si la exposición se mide a través de
marcadores biológicos (que pueden utilizarse, por ejemplo, para caracterizar la exposición a sustancias
persistentes en el organismo, como es el caso de los compuestos organoclorados), como si se aborda
a través de los clásicos cuestionarios, los autores deben proporcionar toda la información relevante al
respecto para que podamos caracterizar adecuadamente la validez en la medida de la exposición y
otras variables de interés.
Por otra parte, en la presentación de los resultados, tal y como se presenta en los criterios de
la Tabla 1, deberá valorarse adecuadamente la precisión del estudio (intervalos de confianza, tamaño
muestral), así como controlar adecuadamente por las variables de confusión relevantes. Asimismo, al
tratarse de estudios fundamentalmente de naturaleza etiológica (es decir, con el objetivo de aportar
evidencias para evaluar las relaciones de causa-efecto entre la exposición o exposiciones de interés y
la enfermedad o proceso que presentan los casos) es muy importante encontrar en la discusión una
valoración adecuada de los criterios de causalidad, por ejemplo siguiendo la bien conocida propuesta
de Hill (Hill A.B. The environment and disease: association or causation? Proc R Soc Med 1965; 58: 295-
300): la consistencia se evaluará de acuerdo con los resultados de estudios previos sobre el mismo
tema, la secuencia temporal y el gradiente dosis-respuesta en base a la calidad y validez de la información
disponible en relación con la exposición de interés, la plausibilidad y coherencia en función del conocimiento
disponible sobre los mecanismos de acción biológica de dicha exposición y su relación con los procesos
de desarrollo de la enfermedad, etc. Por último, deberemos encontrar en el artículo una discusión
razonada y suficientemente exhaustiva de las ventajas (¿qué cualidades presenta este estudio respecto
a la investigación previa disponible en el área?) y limitaciones (¿qué problemas de precisión y validez
pueden haber afectado los resultados del estudio y de qué forma?) del estudio.

5. Criterios para la lectura crítica de artículos de cohortes

El estudio de cohortes es el diseño más lógico y directo para determinar la existencia de una asociación
entre una exposición o determinante de interés y la aparición o desarrollo de un estado de salud.
Según se defina el período de seguimiento de los participantes en un estudio de cohortes, hablamos
de cohortes prospectivas, retrospectivas o bidireccionales (prospectivas y retrospectivas). Por otra parte,
en función de los criterios de entrada y salida de los individuos de la cohorte se definen las denominadas
cohortes fijas y cohortes dinámicas. En algunos casos, en los estudios de cohortes se incluye una cohorte
única, y a continuación se clasifican los individuos en función de su estado de exposición (comparación
interna). Este es el caso del estudio de los efectos del tabaco en médicos británicos, en el cual se
clasificó a los sujetos a posteriori en función de su consumo de tabaco. En otros casos, en el estudio
se selecciona inicialmente una cohorte de individuos expuestos y se utiliza como grupo de referencia
la población general de origen de la cohorte (comparación con la población general). Por ejemplo, en
un estudio de cohortes se puede comparar la mortalidad por diferentes tipos de cáncer en trabajadores
de la industria textil con las tasas de mortalidad por esta misma enfermedad en la población general.
En ocasiones el estudio se basa en la comparación de dos cohor tes definidas y seleccionadas
deliberadamente en función de su estado de exposición al factor de interés (comparación externa).
Por ejemplo, una cohorte de personas usuarias de teléfono móvil (cohorte expuesta) con otra cohorte
de personas que no lo utilizan (cohorte no expuesta). Al igual que se comentaba en relación con los
estudios de casos y controles, en la lectura crítica de los estudios de cohortes hay aspectos más
específicos y propios de este tipo de estudios y otros comunes con cualquier diseño de investigación.
En la Tabla 2 se presentan los criterios propios a considerar en los estudios de cohortes.
Los autores deben definir claramente las características de la cohorte o cohortes en el estudio:
tipo de cohorte (fija/dinámica, retrospectiva/prospectiva, etc.), tiempos de seguimiento, criterios de

76 Cáncer de pulmón
entrada de los individuos en la cohorte, etc. En caso de una comparación con la población general se
debe presentar también la información disponible sobre la misma que pueda de alguna manera afectar
las comparaciones. Para una mínima comparabilidad entre la cohorte expuesta y la población general,
o la cohorte de comparación, habitualmente las tasas de mortalidad o la incidencia se presentarán
estandarizadas por edad. Es posible también estandarizar por otras variables que puedan relacionarse
de forma decisiva con los resultados, o bien calcular los estimadores ajustados por estas variables.
También los criterios y resultados de la medida de la exposición y la enfermedad en los estudios
de cohortes deben presentarse con toda la información necesaria para evaluar adecuadamente su
validez. La medida de la exposición puede basarse en marcadores biológicos o ambientales, cuestionarios
u otro tipo de registros o instrumentos. Aunque los estudios de cohortes tienen ventajas evidentes
para caracterizar la exposición en comparación con los estudios de casos y controles, pueden igualmente
existir problemas de validez en la aproximación utilizada para la medida de la exposición y los autores
deben proporcionar toda la información adecuada para que el lector pueda valorar críticamente este
elemento. Por otra parte, idealmente la experiencia de enfermedad se debe cuantificar de forma completa
y válida en todos los sujetos de la cohorte. La capacidad de los investigadores para conseguir este
objetivo determina de forma crucial la validez del estudio de cohortes. Asimismo, para evitar sesgos
diferenciales, es importante garantizar un nivel aceptable de equivalencia en los métodos aplicados sobre
las cohortes en comparación y sobre todos los individuos incluidos en las mismas.
La definición del período de seguimiento durante el cual se observa la experiencia de enfermedad
en los sujetos incluidos en la cohorte es clave. Este período de tiempo debe decidirse y justificarse en
función del conocimiento disponible sobre los mecanismos etiopatogénicos y el período de inducción
de la enfermedad. Por otra parte, al igual que en los estudios de casos y controles un problema
fundamental puede ser la no respuesta, en los estudios de cohortes uno de los problemas más frecuentes
serán las pérdidas de seguimiento, y los investigadores deben proporcionar la información necesaria
acerca de cómo abordaron esta cuestión y, en su caso, como minimizaron el problema. Algunos
epidemiólogos fijan el máximo admisible de pérdidas en los estudios de cohortes en el 20%, aunque
este criterio puede ser variable.
Los criterios relativos a la lectura crítica de los resultados y discusión no difieren sustancialmente
entre los estudios de casos y controles y los de cohortes. En estos últimos, los autores deberán presentar
los estimadores de frecuencia adecuados en función del tipo de diseño de cohortes (tasas de incidencia,
incidencia acumulada, tasas estandarizadas por edad, etc.) y los respectivos estimadores de asociación
(riesgos relativos, razones de incidencia, razones de mortalidad, etc.), crudos y, en su caso, estandarizados
o ajustados por las variables de confusión relevantes. Los intervalos de confianza y el tamaño muestral
nos permitirán evaluar la precisión del estudio.
Por último, en la discusión deberemos encontrar la adecuada comparación de los resultados más
relevantes con las evidencias procedentes de estudios previos. También es muy conveniente que se
incluya una reflexión respecto a los criterios habituales de causalidad, tales como la evaluación de las
relaciones dosis-respuesta o la plausibilidad y/o coherencia biológica de la asociación entre la exposición
y la enfermedad de interés. A diferencia de los estudios de casos y controles, y especialmente de los
estudios transversales, el adecuado establecimiento de la secuencia temporal es menos o nada problemática
en los estudios de cohortes, ya que precisamente en el seguimiento se obtiene información directa
sobre la relación temporal entre la exposición al factor de estudio y el desarrollo de la enfermedad.
Finalmente, la discusión debe siempre incluir la adecuada valoración crítica de los puntos fuertes y
débiles del estudio, señalando su potencial influencia sobre los resultados y las conclusiones que puedan
derivarse de los mismos.

Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón 77
Tabla 1. Criterios para una lectura crítica de los estudios de casos y controles
1. Respecto a los casos:
• ¿Cuál es la fuente y base del estudio de donde provienen los casos?
• ¿Son casos incidentes (entran en el estudio al inicio de la enfermedad) o prevalentes?
• ¿Se describen claramente los criterios diagnósticos de la enfermedad?
• ¿Se describen claramente los criterios de inclusión y, en su caso, los criterios de exclusión?
• ¿Se describen claramente las pérdidas en la inclusión de los casos (casos identificados vs. casos
incluidos finalmente)?
2. Respecto a los controles:
• ¿Cuál es la fuente y base del estudio de donde provienen los controles?
• ¿Tienen la misma probabilidad de exposición que los casos?
• En caso de que enfermaran por el proceso de interés, ¿seguirían un proceso asistencial similar
al de los casos?
• Si son una muestra sesgada de todos los posibles controles, ¿es este sesgo similar al que pueda
haber determinado la selección de los casos?
• En el caso de existir más de un grupo control, ¿qué diferencias existen entre estos grupos y
cómo pueden afectar estas diferencias a las estimaciones de ORs? De otra forma, ¿qué sesgos
se ponen de manifiesto al utilizar los diferentes grupos de controles?
• ¿Se describen claramente los criterios de inclusión y, en su caso, los criterios de exclusión?
• ¿Se describen claramente las pérdidas en la identificación e inclusión de los controles (controles
identificados vs. controles incluidos finalmente)?
3. Respecto a los casos y los controles:
• ¿Provienen los casos y controles de la misma base del estudio?
• ¿Se han hecho los mismos esfuerzos para detectar/descartar la enfermedad en los casos y los
controles (es necesario asegurarse de que los controles lo son realmente)?
4. Respecto a la exposición:
• ¿Se ha definido y medido claramente (criterios, marcadores, duración, dosis, instrumentos y
cuestionarios validados, etc.)?
• ¿Se ha determinado la exposición de manera no sesgada respecto a la enfermedad estudiada
(se ha hecho el mismo esfuerzo para recoger información sobre la exposición en casos y en
controles)?
• ¿Se ha hecho el esfuerzo necesario para garantizar que la exposición es previa a la aparición
de la enfermedad en los casos?
5. Respecto a los resultados:
• ¿Se expresan con sus intervalos de confianza las estimaciones de las ORs?
• ¿Se ha tenido en cuenta tanto la significación estadística como la relevancia clínico-epidemiológica?
• En el caso de resultados no significativos estadísticamente, ¿era suficiente el tamaño del estudio?
• ¿Se controlan los resultados por las variables de confusión relevantes?
6. Respecto a la discusión:
• ¿Se valoran adecuadamente los criterios de causalidad (consistencia, secuencia temporal, gradiente
dosis-respuesta, plausibilidad y coherencia, etc.)?
• ¿Discuten adecuadamente los autores las ventajas y limitaciones del estudio (potenciales sesgos
de selección e información y confusión y su efecto sobre los resultados)?

Adaptado a partir de:

Fletcher RH, Fletcher SW, Wagner EH. Epidemiología clínica. Barcelona: eds. Consulta; 1989.
Sackett DL, Haynes B, Guyatt GH, Tugwell P. Epidemiología Clínica. Una ciencia básica para la Medicina
Cínica. Madrid: Editorial Médica Panamericana; 1994.

78 Cáncer de pulmón
Tabla 2. Criterios para una lectura crítica de los estudios de cohortes
1. Respecto a la definición de la cohorte o cohortes:
• ¿Se describen suficientemente las características de la cohorte (origen, tipo de cohorte, tiempo
de seguimiento, criterios de inclusión y exclusión de los individuos en la cohorte)?
2. Respecto a la definición de la exposición:
• ¿Se ha definido y medido claramente (criterios, marcadores, duración, dosis, instrumentos y
cuestionarios validados, etc.)?
• ¿Se determinaron sin sesgos (se hizo el mismo esfuerzo para recoger la información en todos
los miembros de la cohorte)?
• ¿Se ha hecho el esfuerzo necesario para garantizar que la exposición es previa a la aparición
de la enfermedad?
3. Respecto a la condición de interés o enfermedad:
• ¿Se describen claramente los criterios diagnósticos de enfermedad?
• ¿Se ha realizado el mismo esfuerzo para recoger la información sobre la enfermedad en todos
los miembros de la cohorte?
4. Respecto al seguimiento:
• ¿Se describe adecuadamente el seguimiento para todos los miembros de la cohorte? (momento
de entrada en la cohorte, de salida o censura, y de desarrollo de la condición de estudio)
• ¿Se realizó el mismo esfuerzo en el seguimiento de todos los miembros de la cohorte?
• ¿Está definido de forma adecuada el tiempo de seguimiento (suficiente para observar el suceso
de interés)?
5. Respecto a los resultados:
• ¿Se expresan con intervalos de confianza las estimaciones de incidencia y del RR?
• ¿Se ha tenido en cuenta tanto la significación estadística como la relevancia clínico-epidemiológica?
• En el caso de resultados no significativos estadísticamente, ¿era suficiente el tamaño del estudio?
• ¿Se controlan los resultados por las variables de confusión relevantes?
6. Respecto a la discusión:
• ¿Se valoran adecuadamente los criterios de causalidad (consistencia, secuencia temporal, gradiente
dosis-respuesta, plausibilidad y coherencia, etc.)?
• ¿Discuten adecuadamente los autores las ventajas y limitaciones del estudio (potenciales sesgos
de selección e información y confusión y su efecto sobre los resultados)?

Adaptado a partir de:

Fletcher RH, Fletcher SW, Wagner EH. Epidemiología clínica. Barcelona: eds. Consulta; 1989.
Sackett DL, Haynes B, Guyatt GH, Tugwell P. Epidemiología Clínica. Una ciencia básica para la Medicina
Cínica. Madrid: Editorial Médica Panamericana; 1994.

Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón 79
 Sesión II
ALTERACIONES GENÉTICO-MOLECULARES
DEL CÁNCER DE PULMÓN:
UTILIZACIÓN CLÍNICA

Moderador: Rafael Rosell

 CLASIFICACIÓN HISTOLÓGICA
Y LESIONES PRENEOPLÁSICAS
EN CÁNCER DE PULMÓN
José Ramírez
Hospital Clínic
Universitat de Barcelona
Barcelona

Contenido:
Resumen de la ponencia
Bibliografía
 Clasificación histológica y lesiones preneoplásicas
en cáncer de pulmón
José Ramírez
Servicio de Anatomía Patológica
Hospital Clínic. Universitat de Barcelona

1. Clasificación histológica del cáncer de pulmón

Cáncer de pulmón es un término que incluye todas aquellas neoplasias malignas que la Organización
Mundial de la Salud (OMS) define en su última clasificación de 1999(1).
El número total de variantes de cáncer pulmonar es de 46, si bien las que corresponden a más
del 95% son siempre de tipo epitelial (carcinomas), por lo que los diversos subgrupos, se reducen a
cinco tipos principales, que se indican con cursiva en la siguiente tabla:

Neoplasias malignas epiteliales de pulmón

• Carcinoma escamoso
• Carcinoma de células pequeñas
• Adenocarcinoma
• Carcinoma de células grandes
• Carcinoma adenoescamoso
• Carcinoma con elementos pleomórficos, sarcomatosos o sarcomatoides
• Tumor carcinoide
• Carcinoma tipo glándula salival
• Carcinoma inclasificable

Tabla 1

Teniendo en cuenta que el procedimiento diagnóstico y la actitud terapéutica inicial del carcinoma
de pulmón distingue solo dos tipos, frecuentemente se habla únicamente de ellos: carcinoma de células
pequeñas (microcítico) y carcinoma de células no-pequeñas (no microcítico). Frecuentemente se confunden
los términos, de forma que no es excepcional en conferencias, e incluso en la literatura que se describa
cáncer de células pequeñas en lugar de carcinoma, que sería lo correcto.
Otra particularidad del carcinoma pulmonar es que es histopatológicamente heterogéneo. La
literatura acepta desde hace muchos años(2) éste hecho, a pesar de lo cual hasta la última clasificación
de la OMS(1) no se ha considerado abiertamente. Es en esta clasificación donde se establece que hasta
el 50% de los carcinomas tienen un segundo componente minoritario en el estudio histológico. Teniendo
en cuenta este hecho y de forma arbitraria, la OMS decide que será clasificado como carcinoma mixto
aquel que tenga al menos un 10% del componente minoritario. En el campo de la Oncología, los
carcinomas mixtos se consideran infrecuentes, por lo que siempre se indica la terapéutica de acuerdo
con el subtipo predominante.

Clasificación histológica y lesiones preneoplásicas 85

 La utilización de técnicas inmunohistoquímicas para diagnóstico tumoral ha permitido conocer
con más detalle los rasgos de las células del carcinoma. Estas técnicas han permitido el estudio de
diferentes filamentos intermedios y la localización de proteínas estructurales que han dado como
resultado una diversidad de respuesta ante la aplicación de anticuerpos como citoqueratinas. La posibilidad
de realizar evaluaciones del subtipo inmunohistoquímico cruzadas con marcadores proliferativos abre
nuevas expectativas a la clasificación morfo-funcional de los carcinomas(3-4).
La generalización de técnicas de biología molecular aplicadas al conocimiento de las neoplasias
aporta por una parte la confirmación de la heterogeneidad de este grupo de neoplasias, pero por otra
parte puede conducir a la renovación completa de la clasificación. No podemos cerrar nuestra mente
a que, a medio plazo, los estudios de expresión génica permitan la clasificación de los carcinomas
pulmonares mediante subgrupos con grandes diferencias sobre los conceptos morfológicos actuales,
tanto en carcinoma de células pequeñas(5), como en otros subtipos(6).
Los criterios básicos de clasificación de éstos carcinomas se inician con la demostración de que
son tumores con rasgos de malignidad cuyas células son epiteliales y presentan o no cantidades apreciables
de citoplasma. Aquellos tumores con escaso citoplasma cuyas células se agrupan, adaptándose los núcleos
entre sí, corresponden al carcinoma de células pequeñas. Por el contrario, los tumores con células de
citoplasma amplio, que pueden diferenciarse hacia formaciones tubulares, secreción o formación de
escamas de queratina, corresponderían al grupo de los carcinomas de células no pequeñas. Estos subtipos,
si bien en el momento inicial suponen una actitud terapéutica similar, pueden recibir tratamientos
diversos, lo que hace necesaria esta amplia tipificación.
Hay dos grupos de tumores de especial interés por la dificultad diagnóstica y el confusionismo
terminológico.
En primer lugar los carcinomas neuroendocrinos. Estos tumores quedan reflejados en la Clasificación
de la OMS en varios grupos, sin homogeneizarlos, a pesar de la consideración generalmente aceptada
de que éstos tumores representan un abanico desde carcinomas poco agresivos, de bajo grado, como
el Tumor Carcinoide hasta otros de alto grado, entre los cuales se diferencia el carcinoma de células
pequeñas y el carcinoma de neuroendocrino de células grandes. El punto de confluencia de estos
tumores es la demostración de diferenciación neuroendocrina, ya sea mediante estudio inmunohistoquímico
(Sinaptofisina, Cromogranina, Enolasa Neuronal Específica o CD56) o bien mediante estudio por
microscopía electrónica.
En segundo lugar el Adenocarcinoma Bronquioloalveolar (AB), variante de adenocarcinoma que
puede presentarse con patrón puro o también con patrón mixto.
El patrón que permite el diagnóstico, siguiendo las pautas de la OMS, se corresponde con un
tumor "in situ", es decir, sin objetivarse invasión. Dentro de este concepto, hay diferente grado de
reacción estromal, siendo esto y su tamaño, criterios que algunos autores correlacionan con el pronóstico.
La generalización de la utilización de los sistemas de radiología avanzada, como el TAC helicoidal, han
permitido describir lesiones incipientes, cuya distinción entre el AB, lesiones hiperplásicas y otros tipos
de adenocarcinoma es difícil. Es aceptado que definir el componente de tipo bronquioloalveolar en
cualquier adenocarcinoma, es importante, ya que estos patrones se correlacionan con mejor pronóstico.
De esta forma, se ha demostrado que adenocarcinomas con más del 50% de patrón bronquioloalveolar
tienen mejor pronóstico a los 5 años(7).
Como comentario a esta clasificación, conviene resaltar que la caracterización definitiva de un
tumor pulmonar como carcinoma requiere el conocimiento de la clasificación de la OMS para no solo
limitarse a dividir los carcinomas en células pequeñas y no-pequeñas; sino para llegar a un diagnóstico
más exacto.

86 Cáncer de pulmón
 La posibilidad de aplicar tratamientos específicos obliga a llegar al máximo en la caracterización
histológica, ya que sabemos que la diversidad celular de éstos tumores puede dificultar su tipificación.

2. Lesiones preneoplásicas bronco-pulmonares

Consideramos que las lesiones preneoplásicas son alteraciones celulares que comportan pasos intermedios
hacia el desarrollo de la neoplasia maligna. Este concepto se mezcla con el de lesiones pre-invasivas,
siendo ambos sinónimos, desde el punto de vista morfológico(1-7). Los cambios moleculares o genéticos
no se hallan bien definidos, si bien hay alteraciones morfológicas que pueden demostrarse
microscópicamente. Estos cambios morfológicos son las que a continuación se describen y se separan
en las de origen en la vía aérea, en parénquima pulmonar o en células neuroendocrinas.
Lesiones de la vía aérea. Agrupamos aquellas lesiones de la mucosa bronquial, referidas siempre
al componente epitelial y que podemos considerarlas como una progresión desde la primera, más
simple, a la más agresiva:
Hiperplasia de células basales. Consiste en el incremento del número de capas de estas células,
que representa una alteración en el equilibrio del epitelio, con predominio del componente proliferativo
sobre el maduro, ciliado, superficial.
Metaplasia escamosa. Es un proceso que habitualmente se desarrolla sobre el previo, con sustitución
del epitelio superficial, ciliado por un epitelio más resistente como es el escamoso poliestratificado. Si
bien este nuevo epitelio es anómalo, su morfología no muestra rasgos atípicos.
Displasia leve. Cuando el epitelio escamoso metaplásico comienza a sufrir alteraciones citológicas,
entramos en el concepto de displasia. En su grado inicial es una simple distorsión epitelial del área
metaplásica.
Displasia moderada. La OMS no define de forma exacta esta fase intermedia, dejando a una
evidente subjetividad su diagnóstico. En áreas de la patología diferentes del pulmón, se ha separado
únicamente la lesión displásica de alto grado de la de bajo grado, en un intento de mejorar la correlación
entre los diferentes patólogos. En el momento actual aún no ha consolidado este concepto (Kerr 2001).
Displasia severa. Esta lesión muestra ya cambios citológicos de evidente proliferación, con atipia
e imágenes de mitosis, siendo difícil de separar del carcinoma.
Carcinoma in situ. Es la lesión de máxima alteración epitelial escamosa, siempre en la superficie,
sin superar la membrana basal.
Hiperplasia adenomatosa atípica (HAA): Consiste en proliferación focal del epitelio bronquiolar
y alveolar que cubre los septos, con células cuboideas monótonas, moderadamente atípicas, con núcleo
hipercromático y citoplasma escaso, dando lugar a área sutil, de difícil visualización macroscópica, con
diámetro inferior a 5 mm. Su variable atipia y el carácter multicéntrico ocasional, le confieren una gran
dificultad diagnóstica(8). Al ser su aparición casi siempre subclínica, incidental en el estudio de una pieza
quirúrgica, su trascendencia clínica aún no se halla establecida. Su presentación puede ser como lesión
única o múltiple(1).
Proliferaciones neuroendocrinas: Son lesiones incipientes, que se han relacionado con el desarrollo
de carcinomas neuroendocrinos y cuya aparición se relaciona con simultaneidad de estos tumores.
Desde el punto de vista morfológico se encuadran como Hiperplasia Difusa Idiopática Neuroendocrina.
Únicamente se observan asociadas a otros tumores neuroendocrinos, siendo excepcional su aparición
de forma aislada.

Clasificación histológica y lesiones preneoplásicas 87

Bibliografía:
1. Travis et al. Tumors of the lung and pleura. W.H.O. Springer, 1999.
2. Roggli VL et al. Lung cancer heterogeneity: a blinded and randomized study of 100 consecutive
cases. Hum Pathol 1985; 16: 569-579.
3. Bombi JA et al. Ultrastructural and molecular heterogeneity in non-small cell lung carcinomas:
Study of 110 cases and review of the literature. Ultrast Pathol 2002; 26: 211-218.
4. Tsubokawa F et al. Heterogeneity of expresión of cytokeratin subtypes in squamous cell carcinoma
of the lung: with especial reference to CK14 overexpression in cancer of high proliferative and
lymphogenous metastatic potential. Pathol Internat 2002; 52: 286-293.
5. Anbazhagan R et al. Classification of small cell lung cancer and pulmonary carcinoid by gene
expression profiles. Cancer Research 1999; 59: 5119-5122.
6. Bhattacharjee A et al. Classification of lung carcinoma by mRNA expression profiling reveals distinct
adenocarcinoma subclasses. Proc Natl Acad Aci USA 2001; 98: 13790-13795.
7. Kerr KM. Pulmonary preinvasive neoplasia. J Clin Pathol 2001; 54: 257-271.
8. Niho S, Yokose T, Suzuki K, Kodama T, Nishiwaki Y, Mukai K. Monoclonality of atypical adenomatous
hyperplasia of the lung. Am J Pathol 1999; 154: 249-254.

88 Cáncer de pulmón
 BÚSQUEDA DE MARCADORES
MOLECULARES PARA
LA DETECCIÓN PRECOZ
DEL CÁNCER DE PULMÓN
Luis M. Montuenga
Centro de Investigación Médica Aplicada (CIMA)
Universidad de Navarra
Pamplona

Contenido:
Resumen de la ponencia
Bibliografía
 Búsqueda de marcadores moleculares
para la detección precoz del cáncer de pulmón
Luis M. Montuenga, María J. Pajares, María D. Lozano, Maribel Zudaire,
Jackeline Agorreta, María Collantes, Silvestre Vicent, Gorka Bastarrika,
Rubén Pío, Javier Zulueta
Área de Oncología, Centro de Investigación Médica Aplicada,
Área de Cáncer de Pulmón, Clínica Universitaria de Navarra
y Departamentos de Histología y Anatomía Patológica y Bioquímica
Universidad de Navarra

l cáncer de pulmón es la neoplasia más común y con mayor tasa de mortalidad en los países
E occidentales. En España, la incidencia de cáncer de pulmón en la población masculina en los noventa
era de 78,4 casos por cada 100.000 habitantes, muy próxima a los 79,3 de la media europea. En cuanto
a la población femenina, el cáncer de pulmón ha pasado a ocupar en países como EEUU el primer
puesto en mortalidad entre los tumores malignos, incluso por delante del cáncer de mama que había
sido tradicionalmente el tipo de tumor más letal(1). Las tendencias en cuanto a incidencia y mortalidad
por cáncer de pulmón en las mujeres españolas comienzan a ser también inquietantes(2).
Además de ser el cáncer más frecuente, el pronóstico del carcinoma pulmonar es pobre y, lo
que es más preocupante, los innegables avances terapéuticos de los últimos 20 años han tenido escasa
repercusión en las expectativas de supervivencia de esta neoplasia. Hoy en día y de forma global, la
supervivencia a 5 años de los pacientes con carcinoma de pulmón no supera el 15%(1). Sin embargo,
el pronóstico de esta enfermedad es muy diferente según el estadio clínico-patológico en el momento
del diagnóstico. Mientras que en los estadios precoces, mediante resección quirúrgica, se consiguen
supervivencias a los cinco años próximas al 80%, en los tumores avanzados las expectativas de larga
supervivencia son menores del 10%. Desgraciadamente, tan sólo el 15% de los tumores malignos de
pulmón se encuentran en fases precoces en el momento del diagnóstico(3). La reducción de la mortalidad
por cáncer de pulmón es una prioridad en la política sanitaria. Esta reducción de la mortalidad sólo se
conseguirá en la medida en que se desarrollen estrategias eficaces en tres direcciones: disminución de
los hábitos tabáquicos, detección precoz y nuevas terapias dirigidas contra dianas moleculares.

Detección precoz mediante TAC de baja dosis

Dado que, a diferencia de otras neoplasias, no existe todavía una prueba estadísticamente validada para
la detección precoz del cáncer de pulmón, la actitud recomendada actualmente para esta neoplasia es
esperar a que aparezcan síntomas o sospechas de la enfermedad. El interés por la detección precoz
del cáncer de pulmón se ha intensificado de modo muy notable tras la publicación en 1999 en la revista
Lancet del estudio ELCAP (Early Lung Cancer Detection Program) desarrollado por Henschke y cols
en la Universidad de Cornell(4). Este estudio demostró que la utilización del TAC (Tomografía Axial
Computerizada) helicoidal con baja dosis de radiación permite detectar nódulos pulmonares malignos
de pequeño tamaño en personas de riesgo (Fig 1) y propuso esta prueba como potencial herramienta
de cribado. Asimismo se ha demostrado que el TAC helicoidal mejora notablemente la capacidad de
detección de tumores en estadios iniciales en relación a las técnicas utilizadas hasta el momento
(radiografía de tórax y citología de esputo). Entre las ventajas que se han mencionado para esta técnica
de detección precoz está la rapidez (se puede analizar el pulmón entero en menos de 10 segundos),

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 91

su sensibilidad, la baja dosis de radiación, y la posibilidad de reconstrucción tridimensional y cuantificación
automatizada. Todos estos aspectos están siendo objeto de investigación por parte de los técnicos de
desarrollo en este campo y probablemente se refinarán aún más en el futuro inmediato. Aunque hay
aspectos que deben ser estudiados a fondo antes de proponerlo formalmente a los sistemas de salud
pública, los estudios que se han publicado desde entonces siguen sugiriendo que esta técnica puede
ser una excelente herramienta para estrategias de cribado en poblaciones de alto riesgo(5-7). Es importante,
por tanto, invertir esfuerzos para validar y refinar esta tecnología de detección precoz de cáncer de
pulmón.

Figura 1: Imagen de un nódulo pulmonar detectado por TAC helicoidal de baja dosis

La experiencia en el diagnóstico precoz de otras neoplasias como mama o próstata, sugieren

que éste es el camino correcto para reducir la mortalidad por cáncer de pulmón, siempre y cuando
se cumplan una serie de requisitos técnicos y organizativos(8). A continuación (Tabla 1) traducimos la
tabla publicada por Warner y Mulshine(8) que resume los criterios que cualquier protocolo de detección
precoz debe reunir para que pueda justificarse su uso generalizado en el sistema sanitario.

TABLA 1: Criterios necesarios para poner en marcha un protocolo de cribado

en individuos de riesgo (traducido de referencia 8)

• La enfermedad que se busca ha de ser un problema sanitario de importancia

• La enfermedad debe tener un periodo de latencia o presintomático
• La historia natural de la enfermedad, incluida el paso del estadio latente al sintomático,
debe ser adecuadamente comprendida
• Debe existir una prueba adecuada con la que hacer el cribado
• La prueba debería ser aceptable a la población
• Debe existir un tratamiento eficaz para los pacientes con enfermedad temprana
• Debe existir un consenso sobre a quiénes considerar pacientes de la enfermedad
• El costo (incluido el diagnóstico y el tratamiento de los pacientes diagnosticados) debe
ser proporcional al gasto sanitario general por la enfermedad
• La búsqueda de nuevos casos debe ser un proceso continuado, no algo que se lleve a
cabo una única vez

92 Cáncer de pulmón
 No es este el momento para detenernos a comentar cada uno de estos criterios. Sin embargo,
es preciso señalar que las nuevas tecnologías de diagnóstico precoz por TAC helicoidal de baja dosis
han permitido dar pasos de gigante en relación al cumplimiento de estos criterios. Es, en efecto,
necesario seguir investigando en diversas direcciones sobre esta técnica para responder a diversos
interrogantes. Por ejemplo, conviene aclarar el efecto del uso de esta tecnología en la disminución de
la mortalidad por cáncer de pulmón en una población concreta (ensayos diagnósticos aleatorizados).
Asimismo, es preciso determinar su pertinencia desde el punto de vista del coste-beneficio. Por último,
es imprescindible aclarar muchos aspectos de la biología de las lesiones que se resecan en estos
individuos(9). No obstante, todos los datos de los estudios observacionales apuntan a que en breve
tendremos una excelente herramienta para poner en marcha estrategias de detección precoz de
cáncer pulmonar a nivel poblacional.

Biomarcadores en la detección precoz

Para que las técnicas de imagen sean realmente eficaces en programas de cribaje poblacional de detección
precoz, es necesario conseguir niveles altos de sensibilidad y especificidad. En este sentido, resulta también
especialmente interesante la posibilidad de combinar estas técnicas radiológicas con el uso de marcadores
moleculares que confirmen la presencia de células transformadas en el tracto respiratorio del paciente,
o que nos permitan conocer su perfil molecular o predecir su respuesta biológica ante tratamientos
concretos(10). En los años recientes se han identificado algunos biomarcadores que pueden ayudar a
clarificar más o menos ajustadamente la naturaleza/clasificación de una determinada neoplasia, su
pronóstico, o su capacidad de producir metástasis o responder a determinadas pautas quimioterapéuticas.
Sin embargo, la identificación de biomarcadores para la detección precoz y para lesiones premalignas
ha tenido un éxito relativamente limitado. Algunos de los trabajos se han basado en el estudio de
muestras obtenidas por métodos invasivos y caros (por ejemplo la broncoscopia) y que tienen cierto
riesgo para el paciente. Es probable que los biomarcadores que finalmente vayan a ser de utilidad
práctica para la detección precoz del cáncer de pulmón en el entorno clínico se determinen en muestras
más asequibles y menos invasivas. Un buen biomarcador que tenga posibilidades de éxito, equivalente
al PSA en próstata (aunque también tiene sus limitaciones), debería tener una serie de características,
que se resumen en la Tabla 2

TABLA 2: Características de un buen biomarcador

• Diferente expresión en células (pre)neoplásicas respecto a células normales; o expresión

en células no neoplásicas en presencia de un cáncer
• Presente y detectable en muestras mínimamente invasivas
• Existe un criterio claro de validación en el tiempo, por ejemplo una situación clínico-
patológica concreta y bien definida
• Hay un sistema bien establecido para cuantificar sus niveles
• Detectable en muestras pequeñas
• Estable con el tiempo y el procesamiento de las muestras
• Se puede establecer un método rutinario y automatizado de análisis

En los intentos de desarrollar nuevos biomarcadores para la detección precoz del cáncer de
pulmón, la investigación ha de recorrer necesariamente diversas fases, algunas de las cuales han sido
resumidas recientemente por Chanin y cols(11). En primer lugar hay que conocer mejor la biología de

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 93

la progresión tumoral en los diversos tipos de cáncer de pulmón. En segundo lugar, hay que delimitar
algunos candidatos entre los genes (DNA y RNA) y las proteínas alteradas, en el proceso de carcinogénesis.
Después, conviene desarrollar herramientas técnicas robustas y sencillas para analizar estas alteraciones
moleculares en muestras mínimamente invasivas. Por último, hay que validar estas tecnologías en
poblaciones de riesgo. Los protocolos de investigación organizados para validar el TAC helicoidal como
herramienta de detección precoz son el contexto idóneo para llevar adelante el análisis y la validación
de los posibles biomarcadores. De hecho, nosotros estamos recogiendo muestras de sangre y esputo
de todos los participantes en el proyecto ELCAP de la Clínica Universitaria de Navarra. A continuación
comentaremos algunos aspectos de la situación de cada una de estas fases de la investigación en relación
a los biomarcadores de detección precoz.

Genes candidatos
Para el desarrollo de tecnologías diagnósticas, basadas en marcadores moleculares, es necesario conocer
mejor las alteraciones moleculares implicadas en el desarrollo del carcinoma pulmonar, como por ejemplo
las alteraciones cromosómicas, genéticas y epigenéticas. De hecho, la urgencia por desarrollar nuevas
estrategias de detección y estrategias terapéuticas novedosas ha conducido a una búsqueda muy activa
y productiva de alteraciones cromosómicas, genéticas, epigenéticas y fenotípicas asociadas al cáncer de
pulmón. El número de genes, vías metabólicas y regiones cromosómicas relacionadas con la carcinogénesis
pulmonar es muy abundante.
La citogenética convencional y molecular ha aportado numerosos datos que demuestran abundantes
cambios cromosómicos somáticos implicados en la patogénesis del cáncer de pulmón. A pesar de la
complejidad de los cambios genómicos observados en estas neoplasias, se han detectado algunos
patrones comunes o más frecuentes. En el carcinoma escamoso, por ejemplo, son frecuentes las pérdidas
en 2q, 3p, 3q, 4q, 7p, 9q, 13q, 16q, 17p y 21q, así como las ganancias en 3q. Las ganancias en 1q23, 7p,
15q y 20q y la deleción en 6q, 13q, 18q y 19q22 se han asociado a adenocarcinomas. Sin embargo,
todavía se conoce poco de los genes localizados en esas regiones en las que probablemente puedan
hallarse oncogenes (regiones amplificadas) y genes supresores de tumores (regiones de pérdidas). Varios
grupos en todo el mundo se están especializando en el análisis de las alteraciones cromosómicas en
cáncer de pulmón, utilizando la técnica de FISH con una o múltiples sondas(12) y la técnica de hibridación
genómica comparada (CGH). Nosotros estamos desarrollando una técnica que combina el Multi-FISH
con el inmunofenotipaje, y que recibe el nombre de FICTION(13). Los estudios que han utilizado arrays
CGH como herramienta de análisis de series amplias de pacientes(14) han demostrado una alta frecuencia
de aumento selectivo de copias en varias regiones cromosómicas, así como regiones en las que el
número de copias está frecuentemente disminuido (Tabla 3).

TABLA 3: Regiones cromosómicas más frecuentemente alteradas en carcinoma

no microcítico de pulmón (NSCLC), según estudios de arrays de CGH(11)
Regiones con ganancias cromosómicas
1q31 3q25-27
5p13-14 8q23-24

Regiones con pérdidas cromosómicas

3p21 8p22 9p21-22
13q22 17p12-13

94 Cáncer de pulmón
 Existen algunos rasgos moleculares específicos de la célula tumoral, resumidos magistralmente
por Hannahan y Weinberg en su revisión “The hallmarks of cancer”(15), que suelen venir determinados
por alteraciones moleculares genéticas o epigenéticas. Muchas de estas alteraciones se han asociado
específicamente a la carcinogénesis pulmonar [Link] mutaciones puntuales de genes, amplificaciones
o deleciones cromosómicas, pérdidas de heterocigosidad o alteraciones de microsatélites pueden activar
oncogenes o inactivar genes supresores de tumores, perturbando por ejemplo la regulación de la
proliferación, apoptosis y angiogénesis, invasión y metástasis. La alteración epigenética mejor estudiada
es la hipermetilación del promotor de genes determinados, en especial de genes supresores de tumores.
La Tabla 4 resume los cambios moleculares más estudiados en cáncer de pulmón, que han sido revisados
recientemente por Sekido y cols(16).

TABLA 4: Principales alteraciones genéticas

y epigenéticas asociadas al cáncer de pulmón

Alteraciones génicas SCLC NSCLC

Mutaciones en ras < 1% 15-20%
Amplificación de myc 15-30% 80%
Sobreexpresión de bcl-2 75-95% 10-35%
Mutación en p53 75-100% 50%
Expresión anormal de p53 40-70% 40-60%
Baja o nula expresión de Rb > 90% 15-30%
Mutación en p16 < 1% 10-40%
Ausencia de expresión de p16 0-10% 30-70%

Hipermetilación del promotor SCLC NSCLC

CDH1 (E-cadherina) 60% 18-33%
CDH13 (H-cadherina) 15% 43-45%
p16 5% 25-40%
APC 15% 46-96%
RARβ 45% 40-43%
FHIT 64% 37%
RASSF1A 79-85% 30-40%
TIMP-3 / 20-26%
DAPK / 16-44%
MGMT 16% 16-27%

En cáncer de pulmón K-ras está mutado en un 15-20% de todos los carcinomas no microcíticos
de pulmón (Non Small Cell Lung Cancer, NSCLC) y en un 20-30% de los adenocarcinomas. Las mutaciones
ocurren preferentemente en el codón 12 de K-ras, y con menor frecuencia en los codones 13 y 61.
Los genes supresores de tumores más frecuentemente alterados en el cáncer de pulmón son p53, p16

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 95

y Rb. La elevada frecuencia de deleciones en 3p21 ha generado multitud de estudios en busca de otros
posibles genes supresores localizados en esta región. Estudios mediante polimorfismos de fragmentos
de restricción (RFLPs), RT-PCR y marcadores de pérdida de heterocigosidad (LOH) han sugerido el
posible papel supresor de varios genes localizados en 3p21.3. Así, se han descrito deleciones homocigóticas
en una región de 120 kb en 3p21.3 afectando a CACNA2D2, 101F6, NPRL2, BLU, FUS1, HYAL2,
HYAL1, SEMA3B, SEMA3F y RBM5/H37, entre otros. Sin embargo, la tasa de mutación para estos genes
es muy baja (menos de 5% de los casos) en la mayoría de los estudios, sugiriendo que, en el caso de
ser supresores tumorales, la vía de inactivación no es la mutación genómica. Uno de los mecanismos
de inactivación de genes supresores frecuente en pulmón es la hipermetilación del promotor, descrita
en genes como RASSF1A (también en 3p21), RARß, TIMP-3, CDKN2A/p16, MGMT, DAPK, ECAD,
GSTP1 y también FHIT. En nuestro laboratorio estamos estudiando un potencial nuevo gen supresor
de tumores en esa región cromosómica: el gen que codifica para la proteína unidora de RNA alfaCP4(17).
También estamos investigando las alteraciones en los mecanismos de procesamiento de RNA y su
efecto en la regulación de la expresión génica en cáncer de pulmón(18).
En ciertos tumores, incluido el cáncer de pulmón, la señalización a través de factores de crecimiento
está anormalmente intensificada. La expresión de factor de crecimiento transformante beta-1 (TGF-ß1)
en cáncer de pulmón se ha asociado con angiogénesis, progresión tumoral, mal pronóstico y menor
supervivencia(19-21). El factor de crecimiento fibroblástico-2 (fibroblast growth factor-2, FGF-2) induce la
angiogénesis, proliferación y migración y algunos estudios sugieren que protege frente a la apoptosis.
FGF-2 se expresa en tumores NSCLC y esta expresión se correlaciona con mal pronóstico y menor
supervivencia(22). Asimismo, niveles elevados en suero de FGF-2 se correlacionan con un mal pronóstico
en pacientes con NSCLC y carcinoma microcítico de pulmón (Small cell lung cancer, SCLC)(22). El factor
de crecimiento epidérmico (EGF) actúa a través de su receptor (EGF receptor, EGFR/erbB1/HER1), que
tiene actividad quinasa de tirosinas y que se encuentra sobreexpresado en muchos tumores pulmonares(23).
Tras la unión al ligando, el EGFR forma homo o heterodímeros con alguno de los otros tres receptores
de su misma familia (ErbB-2, también llamado HER2/neu, ErbB-3 y ErbB-4). El EGFR se encuentra
sobreexpresado en el 40-80% de los NSCLC. HER2/neu, se encuentra sobreexpresado con frecuencia
en carcinomas pulmonares. Se ha demostrado que la sobreexpresión de HER2/neu y la sobreexpresión
simultanea de EGFR y HER2/neu, correlacionan con una peor evolución de la enfermedad en NSCLC(23).
El factor de crecimiento de hepatocitos (hepatocyte growth factor, HGF) actúa a través de un receptor
quinasa de tirosinas denominado c-met, que se encuentra sobreexpresado tanto en SCLC como en
NSCLC. Sin embargo, la sobreexpresión de HGF se ha detectado sólo en NSCLC(24). La alta expresión
de HGF en NSCLC se asocia con una menor supervivencia de los pacientes(29). En nuestro laboratorio
hemos estudiado la relevancia de un factor de crecimiento, la adrenomedulina, presente en células
normales y tumorales. También nos hemos interesado por la activación de la vía del las MAPKs en
cáncer de pulmón y su potencial utilidad diagnóstica o como diana terapéutica(25,26)
La técnica de arrays de expresión aplicada al cáncer de pulmón está proporcionando asimismo
una gran cantidad de datos y diversas listas de genes aparentemente asociados a la carcinogénesis
pulmonar. Los estudios pioneros de Garber y cols(27) analizaron la expresión génica en 67 carcinomas
pulmonares, e identificaron un patrón de expresión génica característico de cada tipo histológico. Casi
simultáneamente, Bhattacharjee y cols(28) Analizaron 186 tumores pulmonares y 17 muestras normales
y también definieron un patrón de expresión génica que diferenciaba cada tipo de carcinoma pulmonar,
distinguiendo incluso 4 subcategorías dentro de los adenocarcinomas. El estudio de Beer y cols(29) fue
diseñado específicamente para identificar patrones de expresión génica que predicen supervivencia en
cáncer de pulmón. Tras la interpretación de sus datos, seleccionaron un conjunto de 50 genes cuya
expresión podría discriminar entre grupos de pacientes de carcinoma pulmonar en estadio I con mejor

96 Cáncer de pulmón
o peor supervivencia. En su estudio sugieren que la identificación de este grupo de pacientes carcinoma
pulmonar en estadio precoz de “alto riesgo”, puede ayudar a determinar qué pacientes podrían beneficiarse
de la quimioterapia adyuvante. Estos tres estudios fueron los pioneros en la utilización de microarrays
en cáncer de pulmón. En los últimos dos años, se han seguido publicado numerosos artículos describiendo
el perfil de expresión génica del carcinoma no microcítico de pulmón en diversas series de pacientes
y utilizando diversas plataformas. Los distintos trabajos informan de perfiles de expresión génica del
cáncer de pulmón comparando situaciones variadas: mayor o menor actividad metastásica(30); grupos de
genes que distinguen el adenocarcinoma de la célula epitelial pulmonar normal(31); tumores más o menos
diferenciados(32); patrones de genes relacionados con la respuesta o la resistencia a quimioterapia(33,34,35),
etcétera.
Son ya más de 30 los artículos sobre expresión génica diferencial en cáncer de pulmón. La
combinación de arrays de CGH con arrays de expresión está generando muchos datos, que requieren
ser integrados, y abre el camino hacia una clasificación molecular de los carcinomas pulmonares. En
muchos casos las plataformas de análisis que se utilizan son diversas y los diseños experimentales y
criterios de interpretación difieren notablemente. De ahí que recientemente se estén haciendo esfuerzos
importantes en la línea de la integración, comparación y validación estadística de los datos que se
generan por las diversas tecnologías. La bioinformática tiene mucho que decir en estos momentos, para
llegar a disponer de una lista suficientemente robusta de genes que puedan ser utilizados como marcadores
diagnósticos de cáncer de pulmón(36, 37). Parmigiani y colaboradores(36) han publicado recientemente un
trabajo de comparación de los datos sobre expresión génica en cáncer de pulmón obtenidos por los
tres grupos pioneros en la utilización de los microarrays en cáncer de pulmón que ya hemos citado
anteriormente(27-29). Estos grupos utilizaron plataformas y diseños distintos. Se trata de un estudio
bioinformático complejo, con grandes dificultades metodológicas, motivadas por la gran diversidad de
los datos de partida. En su estudio concluyen que hay acuerdo, aunque incompleto, entre el patrón de
genes relacionados con la biología del cáncer de pulmón, y de hecho presentan una lista de genes que
predicen reproduciblemente el curso de la enfermedad (Tabla 5). Sin embargo, observan también niveles
importantes de variabilidad entre los estudios que puede ser el reflejo de la variabilidad biológica entre
las muestras de partida, las divergencias tecnológicas, o simplemente del azar.
Otra de las áreas de mayor interés en el campo de los biomarcadores, y en especial en la
detección precoz, es la de la proteómica. Los datos obtenidos por arrays de cDNA han proporcionado
listas amplias de genes, sin embargo la expresión de mRNA correlaciona pobremente con la de proteínas.
En la medida en que podamos analizar los patrones de expresión de proteínas de modo global y rápido
mejoraremos notablemente nuestra capacidad de comprensión de las complejidades moleculares de las
células tumorales. Los estudios iniciales de proteómica de cáncer en el contexto clínico, publicados por
el grupo de Liotta del NCI, han sugerido que el uso de los perfiles protéomicos del suero pueden
discernir entre pacientes con cáncer e individuos sanos. El estudio de Petricoin y cols(38) obtuvo el perfil
proteómico tras espectrometría de masas a partir de sueros de 50 pacientes de cáncer de ovario y
de 50 controles. Un algoritmo de análisis fue capaz de distinguir entre ambos perfiles, identificando un
patrón discriminatorio. Este patrón de picos, específico de cáncer, se utilizó para examinar otro grupo
de muestras independiente y adivinar las que eran de cáncer ovárico con un 100% de sensibilidad y
un 95% de especificidad. Más recientemente, el grupo de Carbone, ha publicado en Lancet el primer
estudio de perfiles de proteómica en cáncer de pulmón(39). En este estudio se han obtenido los perfiles
de expresión proteica de las células neoplásicas mediante la técnica de MALDI-TOF, y basados en sus
resultados han podido clasificar los tumores pulmonares en subgrupos biológicamente homogéneos,
correspondientes a las variables clinicopatológicas clásicas. Este resultado (la utilización de una tecnología
muy sofisticada para clasificar tumores ya clasificados por microscopía de luz) no tendría mayor relevancia

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 97

 TABLA 5: Genes identificados como predictores significativos
de supervivencia concordantes en los tres estudios pioneros de array
de expresión en cáncer de pulmón (referencia 19)
*
Nombre UID
Glypican 3 119651
BENE protein 185055
Iroquois homeobox protein 5 25351
Fibroblast growth factor rec. 2 278581
Folate receptor 1 (adult) 73769
Tyrosinase-related protein 1 75219
Syntaxin 1A 75671
Immunoglobulin J polypeptide 76325
MAD2 mitotic arrest def-like 1 79078
Vasc. endoth. growth factor C 79141
KIAA0101 gene product 81892
Interleukin 6 signal transducer 82065
Selectin L 82848
Rho GDP diss inhib (GDI) β 83656

* UID: unigene ID

clínica de por sí. Sin embargo, el análisis de sus datos también ha proporcionado un patrón de picos
de espectrometría de masas que clasifican a los pacientes en dos grupos de buen y mal pronóstico.
Asimismo, ha identificado dos proteínas (SUMO-2 y timosina β-4) como potenciales proteínas marcadoras
de NSCLC. Más recientemente, se han publicado otros dos estudios de proteómica en cáncer de
pulmón(40,41). El estudio de Chen y cols(40) identificó por electroforesis bidimensional una serie de puntos
aparentemente específicos de cáncer de pulmón, 33 de los cuales parecían asociados a supervivencia.
De ellos, 12 proteínas candidatas fueron confirmadas por inmunohistoquímica. En combinación con un
estudio paralelo de cDNA se identificaron 11 proteínas de la vía glicolítica como asociadas con
supervivencia baja, y en especial los niveles en suero de fosfogliceratoquinasa 1 como un ajustado
biomarcador de mal pronóstico. Ninguno de los dos estudios propone por ahora el uso de la proteómica
como biomarcador de detección precoz.

De genes específicos a biomarcadores

Hasta ahora, muchos de los esfuerzos se han dirigido a identificar los posibles genes o grupos de genes
alterados en el proceso de carcinogénesis pulmonar. Se han buscado básicamente herramientas para
una clasificación molecular del cáncer de pulmón, y para entender mejor el proceso de carcinogénesis.
Recientemente Meyerson y cols(42) han resumido los datos disponibles hasta la actualidad en esta fase
del descubrimiento de biomarcadores. Chanin y cols(11) han realizado el esfuerzo de compilar una lista
de biomarcadores prometedores para la detección precoz, aunque el grado de desarrollo de cada uno

98 Cáncer de pulmón
es muy variable, y ninguno está validado. En el supuesto de que lleguemos pronto a consensuar una
lista de estas alteraciones, habremos llegado sólo a cubrir un primer paso de nuestro trayecto, que
terminará con la utilización rutinaria de marcadores moleculares para el diagnóstico precoz. El siguiente
paso es desarrollar técnicas para detectar estas alteraciones, no sólo en los tejidos tumorales sino en
otras muestras biológicas que puedan obtenerse en la rutina clínica y de modo mínimamente invasivo.
Al proceso de descubrimiento de marcadores candidatos, le sigue la puesta a punto de técnicas para
demostrarlo en las muestras clínicas. ¿Qué muestras clínicas pueden ser informativas de la presencia de
un tumor pulmonar en estadios precoces? A continuación, mencionaremos el tipo de muestras biológicas
de las que se puede obtener información desde el punto de vista de los biomarcadores (Fig 2). Nos
referiremos, en concreto, sangre, a biopsias del tumor, cepillado bronquial, lavado bronquioalveolar,
punción aspirativa con aguja fina (FNA), esputo inducido, y exhalado respiratorio, poniendo algunos
ejemplos en relación a la posible utilidad de estas muestras y señalando ventajas e inconvenientes.

Figura 2: Posibles fuentes de biomarcadores: A: sangre; B: lavado bronquioalveolar y esputo; C: exhalado

respiratorio

Biomarcadores en sangre
La gran ventaja del análisis de biomarcadores en sangre, sea suero o plasma, es la facilidad de obtener
y procesar las muestras, la mínima invasividad y el hecho de que se han desarrollado ya numerosas
tecnologías para el análisis masivo y rápido de numerosos casos. De hecho, la búsqueda de biomarcadores
de cáncer de pulmón en sangre es la que comenzó más tempranamente. El gran inconveniente de este
tipo de muestra es que los cambios en el medio interno pueden provenir de cualquier localización del
organismo y no tienen por qué reflejar únicamente las alteraciones que ocurren en el pulmón. La
presencia de células tumorales de cáncer de pulmón circulantes es conocida desde hace tiempo(43), pero
probablemente sea menos relevante en los tumores de estadio precoz muy localizados. En todo caso,
el biomarcador en sangre, paralelo por ejemplo a lo que ocurre con el PSA, sería sin duda un biomarcador
ideal. En este sentido, los trabajos sobre detección en suero o plasma de mutaciones de k-ras(44,45)
o p53(46), alteraciones de microsatélites(46,47), DNA circulante(48), LOH para varias regiones(49), y metilación
aberrante de diversos promotores(50,51,52) son buenas bases para el desarrollo de los biomarcadores de
detección precoz basados en en análisis de sangre. Es muy probable que la estrategia de desarrollo de
biomarcadores se concrete más adelante en forma de un análisis simultáneo de una batería más o
menos amplia de alteraciones. El trabajo publicado recientemente por el grupo de Pastorino y Sozzi,
es un ejemplo en esta línea. Su estudio(46) presenta un análisis simultáneo de mutaciones de p53, y
alteraciones de microsatélite para el lugar de FHIT y otras regiones de 3p en pacientes de carcinoma

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 99

pulmonar. Existen también propuestas para el análisis de niveles de algunos factores de crecimiento en
suero, como VEGF, que parecen tener valor pronóstico(53). Además, la concentración en suero de
VEGF-C parece que puede tener utilidad diagnóstica en combinación con TAC helicoidal(54). Sin embargo,
una revisón reciente comparando los resultados de diversas publicaciones arroja cierta duda sobre la
utilidad de la medida de factores de crecimiento como marcadores tumorales en cáncer de pulmón(55).
Según ese mismo estudio los datos más convincentes son los que se refieren a la medida en suero del
marcador Cyfra 21-1 (fragmentos de citoqueratina 19), para el que la mayoría de los trabajos publicados
han presentado resultados positivos como marcador de NSCLC. Los niveles de Cyfra 21-1 han sido
analizados en poblaciones amplias de pacientes con resultados significativos en cuanto a su valor
pronóstico(56).
Como se puede deducir por lo expuesto hasta ahora, ninguna de las publicaciones mencionadas
plantea por el momento el análisis prospectivo de individuos de alto riesgo con intenciones de detección
precoz. Como hemos dicho más arriba, estamos todavía en los primeros pasos de la investigación
dirigida a encontrar el biomarcador más adecuado para la detección precoz.

Análisis de biomarcadores en otras muestras biológicas

Como hemos dicho anteriormente, la desventaja del análisis de biomarcadores en suero o plasma es
que la presencia de un biomarcador en sangre no es informativa en relación al origen local de ese
biomarcador. Otras muestras biológicas como el lavado bronquioalveolar, el esputo o las biopsias
(obtenidas por broncoscopia o punción por aguja fina) nos proporcionan datos que proceden de la
composición molecular de fluidos procedentes de las vías áreas, es decir, “geográficamente” mucho más
cercanos a las posibles células neoplásicas o preneoplásicas del pulmón. Las muestras citadas se pueden
comparar al parte meteorológico emitido por la estación local, que es siempre mucho más exacto y
ajustado, en comparación a la información que proporciona sobre esa misma localidad el servicio
meteorológico nacional, basado en la información general de todo el planeta obtenida por el satélite.
El análisis de las biopsias que proporciona el broncoscopista, las células de un aspirado de aguja fina
de un nódulo periférico, del material exfoliativo del cepillado bronquial, del lavado bronquioalveolar, del
esputo inducido o del exhalado respiratorio nos informan única y exclusivamente de los cambios
celulares o moleculares que ocurren en el epitelio del pulmón o las vías aéreas. De ahí su ventaja
teórica de partida.
Desde el punto de vista del conocimiento de la historia natural y la carcinogénesis de los nódulos
detectados por TAC helicoidal, el material biológico más preciado son las células enteras y los restos
celulares obtenidos en la punción de aguja fina de estos nódulos. Son todavía pocos los grupos
multidisciplinares que tienen incorporada la FNA de los nódulos detectados por TAC helicoidal, en
especial en el caso de los nódulos de tamaño más reducido. Aunque hay algunas publicaciones referidas
al análisis citológico de estas células, utilizando técnicas de tinción convencional(57), no existen estudios
moleculares con este material realizados en relación a la detección precoz mediante TAC helicoidal.
Fuera de este contexto, el análisis morfológico de muestras citológicas obtenidas por punción de aguja
fina o broncoscopia es un método importante en el diagnóstico del carcinoma broncogénico. Sin
embargo, la sensibilidad de este método no es completa (entre el 60 y el 80%). Warner y cols(58) han
utilizado RT-PCR semicuantitativa para evaluar la expresión relativa de c-myc, E2F1 y p21 como
metodología complementaria al análisis morfológico, aumentando notablemente la sensibilidad diagnóstica.
El análisis molecular de las biopsias obtenidas por broncoscopia es equivalente al que se puede
hacer en cualquier muestra de resección. Se han llevado a cabo numerosos estudios en relación a este
material, cuyo resumen está fuera del objetivo de este trabajo. El material de broncoscopia es muy útil

100 Cáncer de pulmón

para el diagnóstico de lesiones preneoplásicas y neoplásicas en las vías aéreas más centrales y es un
material muy valioso para estudiar los cambios moleculares sucesivos en el proceso de carcinogénesis
pulmonar, en especial del carcinoma escamoso(59, 60). Sin embargo, se obtiene por medios relativamente
invasivos y caros, y difícilmente se impondrá como estrategia de rutina para la detección precoz. McWilliams
y cols.(61) han proporcionado algunos datos que sugieren que el cribado de individuos de alto riesgo
mediante una combinación de tres técnicas, TAC helicoidal y broncoscopia de fluorescencia, tras análisis
previo de la citología del esputo, podría constituir un nuevo paradigma para organizar la detección precoz
a nivel poblacional. La complejidad de esta propuesta desde el punto de vista logístico, y su dudosa
eficiencia desde el punto de vista del coste-beneficio han sido subrayadas recientemente(62).
Desde el punto de vista del análisis rutinario de biomarcadores, probablemente el lavado
bronquioalveolar (BAL), pueda llegar a ser más informativo y práctico que la biopsia,. De hecho, son
numerosos los trabajos recientes que informan de la detección de potenciales biomarcadores de cáncer
de pulmón (DNA, RNA o proteínas) en lavado bronquioalveolar. Por ahora, la mayor parte de los
estudios son ensayos de desarrollo tecnológico (proof of concept) en un número limitado de muestras.
Con técnicas suficientemente sensibles, se pueden detectar en el BAL alteraciones de microsatélites
propias del cáncer de pulmón(63). Carstensen y cols(64) pudieron encontrar, tanto en sobrenadante como
en la fracción celular del BAL, DNA amplificable y de calidad. Casi el 50% de los pacientes de cáncer
de pulmón fueron positivos para alteraciones de microsatélites en el BAL. Existen también varios trabajos
recientes en la literatura que demuestran que en el BAL se puede analizar la metilación aberrante del
promotor de diversos genes, y sugieren que esta técnica podría ser eficaz en la detección precoz del
cáncer de pulmón(65,66,67)
Desde el punto de vista de la detección precoz, hay muchas esperanzas puestas en el uso del
esputo como fuente de detección de biomarcadores de cáncer de pulmón. El esputo es una muestra
no invasiva y fácil de obtener, aunque normalmente requiere un protocolo de inducción que garantice
la calidad de la muestra, de modo que sea informativa no sólo de las vías altas, sino también del pulmón
periférico. Recientemente, Thunnissen(68) ha revisado los datos disponibles en la literatura sobre el análisis
de esputo y su papel en la detección del cáncer de pulmón. La citología convencional de esputo,
buscando células epiteliales anormales, es una técnica de rutina. El estudio citopatológico rutinario ha
demostrado poca eficacia relativa en los protocolos de cribado de individuos de alto riesgo para la
detección precoz de cáncer de pulmón que se llevaron a cabo a finales de los años 70(69). Sin embargo,
algunos estudios recientes subrayan la utilidad del análisis de anormalidades del esputo como marcadores
del desarrollo de cáncer de pulmón en una población de alto riesgo(70,71). El desarrollo de las técnicas
de biología molecular y de análisis de imagen han abierto nuevas perspectivas muy prometedoras para
el uso del esputo como fuente de información sobre la presencia o el perfil biológico de un carcinoma
pulmonar. La citometría semiautomatizada del esputo se ha propuesto como una herramienta
potencialmente útil para protocolos de cribado y detección precoz(72). El análisis inmunocitoquímico del
esputo con anticuerpos contra proteínas propias de las células neoplásicas es otro campo de interés.
De hecho, el análisis del esputo con anticuerpos contra hnRNP A2/B1 se propuso hace unos años
como una herramienta potencialmente útil(73), sin embargo la afinidad y especificidad de los anticuerpos
monoclonales utilizados no los hace óptimos como herramienta de cribado. Posteriormente se propuso
utilizar otros anticuerpos contra hnRNP B1(74), pero esta técnica también requiere refinamiento y validación.
En todo caso, la aproximación inmunohistoquímica es sin duda una manera de aumentar la sensibilidad
de la técnica citológica. Nuestro grupo está desarrollando en este momento una tecnología teóricamente
mucho más informativa que combina el inmunofenotipaje de las células con el análisis de alteraciones
genéticas mediante la técnica de multi-FISH(13).

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 101
 El objetivo de la detección precoz con muestras de esputo son las células neoplásicas o
preneoplásicas presentes en la muestra, que normalmente suponen una fracción muy pequeña de todas
las células (frecuentemente menos de un 1%). Además de las células, es posible que haya restos celulares
disueltos en el fluido, que también puedan ser informativos, por ejemplo por su contenido en DNA
desnudo de las células tumorales. La baja cantidad relativa de DNA tumoral (menos de un 1%) respecto
al resto supone que las técnicas de análisis que se utilicen para estudiarlo han de ser especialmente
sensibles. En su revisión, Thunnissen(68) describe con detalle las diversas tecnologías que se han propuesto
para el estudio de alteraciones en el DNA. Utilizando tecnología especialmente sensible, se detectan
ya en muestras de esputo mutaciones de k-ras(75,76,77). En los últimos años se han publicado artículos
sobre detección de alteraciones de microsatélite y metilación aberrante de promotores(78,79). En el trabajo
de Palmisano y cols(79) se demuestra que la alteración molecular es detectable en el esputo inducido
hasta 3 años antes del diagnóstico clínico. El reto de la utilización del esputo como fuente de información
sobre el epitelio respiratorio y, en especial, sobre la presencia de marcadores (pre)neoplásicos es un
reto puramente técnico. Por ejemplo, en relación a lo comentado hasta ahora, es imprescindible asegurar
unos niveles muy altos de robustez, control de calidad y reproducibilidad, de modo que se puedan
confirmar estos hallazgos iniciales esperanzadores en poblaciones de alto riesgo más numerosas. En el
caso de la metilación es de especial importancia la homogeneización de protocolos y la protección
frente a falsos positivos o negativos. También es un reto técnico poner a punto técnicas para valorar
los perfiles de expresión y la presencia de determinados mRNA y proteínas utilizando como muestra
de partida el esputo, que es un fluido cargado de proteasas y RNasas. De ahí que el avance de la
tecnología microarray y de la proteómica sea todavía muy lento en cuanto se pretende estudiar el
esputo inducido.

Estrategias de futuro
Después de referirnos a muestras en las que se está estudiando activamente, terminaremos con algunos
datos sobre una nueva estrategia de detección de biomarcadores para cáncer de pulmón, que se han
propuesto recientemente. Nos referimos en concreto al análisis de biomarcadores en el exhalado
respiratorio. Dentro de las cavidades respiratorias (alvéolos y sacos alveolares) se da un activo intercambio
gaseoso, y también una salida de algunos fluidos al medio extracelular. Algunos de esos fluidos y gases
pueden contener información valiosa, que en teoría, con técnicas suficientemente sensibles podría ser
detectable. El análisis del exhalado respiratorio está en su infancia más absoluta, pero sin duda es una
idea prometedora, que podría ayudar en los protocolos de detección precoz por imagen, quizás
informando de la presencia de un núcleo de células tumorales oculto al radiólogo. El concepto teórico
que subyace a estos análisis es el de que hay numerosos compuestos orgánicos volátiles en la sangre
y en el aire exhalado de cualquier individuo, y que la concentración o composición relativa de estos
compuestos son diferentes en el aíre exhalado por un paciente con cáncer y un paciente normal(80).
Un reciente estudio va más allá al demostrar la posibilidad de detectar DNA secuenciable, y en concreto
mutaciones de p53, en el condensado del aire exhalado. El condensado se obtiene haciendo respirar
al paciente durante 10-20 minutos a través de un dispositivo de recogida que condensa la humedad
del aire respirado enfriándolo rápidamente(81). Todavía no hay datos comparativos con casos pareados
entre estas tecnologías que analizan el aire exhalado y otras tecnologías propuestas para la búsqueda
de biomarcadores.
Antes de que se pueda poner marcha un protocolo eficaz de cribado para la detección precoz
del cáncer de pulmón se requiere una serie de condiciones, que por ahora ningún biomarcador para
esta neoplasia reúne. Uno de los beneficios de tener un reto tan exigente es que el desarrollo tecnológico
mantiene un ritmo muy fuerte y poco conformista. Se trata de aumentar la sensibilidad y especificidad

102 Cáncer de pulmón

de las tecnologías, incidiendo no sólo en aspectos clave como el procesamiento y conservación de las
muestras, sino también desarrollando nuevas tecnologías más eficaces. Algunos ejemplos de reciente
desarrollo tecnológico, publicados en la literatura de la detección precoz de cáncer de pulmón son: la
mejora de las técnicas de hibridación cromosómica (FISH) para células exfoliativas(82,83), y el intento de
poner a punto protocolos de proteómica sobre muestras obtenidas de microdisección (aunque para
este trabajo requirieron 15.000 golpes de láser por muestra…)(84) Brambilla y cols(85) subrayan como
conclusión de un reciente artículo de revisión sobre biomarcadores en cáncer de pulmón que los
biomarcadores entrarán en el contexto clínico en la medida en que se llegue a la automatización y
miniaturización perfecta de estas técnicas, lo que también permitirá que sean aplicadas de modo extenso
una vez validadas clínicamente. Recientemente, por ejemplo, se ha presentado una tecnología que analiza
de modo automatizado las mutaciones del codón 12 de k-ras en muestras de cáncer de pulmón(86).
Como acabamos de ver, en los últimos tres o cuatro años se han llevado a cabo numerosos
estudios basados en diversas tecnologías, incluidas las tecnologías microarray y proteómica, para definir
el perfil propio de expresión de génica del cáncer de pulmón. Aunque la interpretación de estos estudios
en su conjunto no es fácil, se trabaja con una lista de genes que podrían ser buenos candidatos como
biomarcadores. Probablemente, el análisis de biomarcadores para detección precoz no se llevará a cabo
en el futuro sobre un único gen, sino en baterías de varios genes estudiados con diversas tecnologías.
También hemos mencionado que existen una serie de genes clave, que están alterados en un porcentaje
alto de tumores pulmonares y que en la actualidad están siendo analizados en series más amplias de
pacientes. Por último, hemos comentado las diversas muestras sobre las que se puede diseñar el análisis
con las variadas herramientas tecnológicas disponibles.
Imaginemos que ya hemos conseguido el análisis más sencillo del biomarcador más prometedor
en la muestra más asequible. ¿Hemos terminado el trabajo? Por supuesto que no. Falta la validación de
los resultados en poblaciones amplias de individuos, para demostrar que en efecto ese biomarcador es
útil en el contexto clínico. Henscke insiste en un reciente editorial(62) que los investigadores implicados
en el desarrollo de biomarcadores deben reconocer que ningún biomarcador será aceptado a menos
que se demuestre que es efectivo en un estudio clínico cuidadosamente diseñado. Nuestro grupo trabaja
activamente en un proyecto de validación de biomarcadores para la detección precoz del cáncer de
pulmón que se está llevando a cabo en el Grupo Europeo de Detección Precoz de Cáncer de Pulmón
(EU-ELCDG)(87). En estudiamos una batería de marcadores bien conocidos desde diversos puntos de
vista: optimización y estandaríación, validación y análisis de numerosas muestras. En febrero de 2005
habremos reclutado 1200 pacientes de estadios iniciales de cáncer de pulmón y 2500 controles y
habremos procesado las muestras biológicas (sangre, biopsia de resección tumoral y normal, sangre,
lavado bronquioalveolar) de estos pacientes. De ellos un porcentaje relativamente bajo se presentarán
más adelante con un segundo primario. Nuestro estudio persigue identificar una lista de biomarcadores
que sea capaz de predecir la aparición de un segundo primario de pulmón.
En una revisión muy reciente, Petty y colaboradores(88) se preguntan cómo llevar los impresionantes
hallazgos de la Biología Molecular del cáncer de pulmón de la mera Biología a la aplicación clínica real.
Hay muchas preguntas concretas que se pueden hacer también en relación a la aplicación clínica de
los biomarcadores en la detección precoz del cáncer de pulmón. Estas preguntas hay que ir resolviéndolas
en los próximos años. Mientras tanto, nuestro papel es seguir construyendo con esfuerzo y entusiasmo
el edificio de la detección precoz, apoyándolo sobre los sólidos cimientos que se han construido en
los últimos años.

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 103
Bibliografía:
1. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, and Thun MJ. Cancer statistics, 2003; CA Cancer
J Clin. 53: 5-26, 2003.
2. Franco J, Perez-Hoyos S, and Plaza P. Changes in lung-cancer mortality trends in Spain; Int J Cancer.
97: 102-105, 2002.
3. Merrill RM, Henson DE, and Barnes M. Conditional survival among patients with carcinoma of
the lung; Chest. 116: 697-703, 1999.
4. Henshke CI, McCauley DI, Yankelevitz DF, Naidich DP, McGuinness G, Miettinen OS, Libby DM,
Pasmantier MW, Koizumi J, Altorki NK, and Smith JP. Early Lung Cancer Action Project: overall
design and findings from baseline screening; Lancet. 354: 99-105, 1999.
5. Henschke CI, Naidich DP,Yankelevitz DF, McGuinness G, McCauley DI, Smith JP, Libby D, Pasmantier
M, Vázquez M, Koizumi J, Flieder D, Altorki N, and Miettinen OS. Early lung cancer action project:
initial findings on repeat screenings; Cancer. 92: 153-9, 2001.
6. Mulshine JL and Henschke CI. Prospects for lung-cancer screening; Lancet. 355: 592-593, 2000.
7. Pastorino U, Bellomi M, Landoni C, De Fiori E, Arnaldi P, Picchio M, Pelosi G, Boyle P, and Fazio
F. Early lung-cancer detection with spiral CT and positron emission tomography in heavy smokers:
2-year results; Lancet. 362: 593-597, 2003.
8. Warner EE and Mulshine JL. Lung Cancer Screening with spiral CT: toward a working strategy;
Oncology. 18: 564-587, 2004.
9. Bach PB, Kelley MJ, Tate RC and McCrory DC. Screening for lung cancer. A review of the current
literature; Chest. 123: 72S-82S, 2003.
10. Montuenga LM and Mulshine JL. New molecular strategies for early lung cancer detection; Cancer
Invest. 18: 555-63, 2000.
11. Chanin TD, Merrick DT, Franklin WA and Hirsh FR. Recent developments in biomarkers for the
early detection of lung cancer: perspectives based on publications 2003 to present; Curr Opin
Pulmonol. 10: 242-247, 2004.
12. Berrieman HK, Ashman JN, Cowen ME, Greenman J, Lind MJ and Cawkwell L. Chromosomal
analysis of non-small-cell lung cancer by multicolour fluorescent in situ hybridization; Br J Cancer.
90: 900-905, 2004.
13. Zudaire I, Pío R, Martín-Subero I, Lozano MD, Blanco D, García López JJ, Odero de Dios MD,
Rey N, Zulueta J, Siebert R, Calazanz MJ and Montuenga LM. FICTION as a new tool to early
lung cancer diagnosis; An Sist Sanit Navar. 25: 305-315, 2002.
14. Balsara BR and Testa JR. Chromosomal imbalances in human lung cancer; Oncogene. 21: 6877-
6883, 2002.
15. Hanahan D and Weinberg RA. The hallmarks of Cancer; Cell. 100: 57-70, 2000.
16. Sekido Y, Fong KM and Minna JD. Molecular genetics of cancer; Annu Rev Med. 54: 73-87, 2003.
17. Pío R, Zudaire I, Pino I, Castaño Z, Zabalegui N, Vicent S, García-Amigot F, Odero MD, Lozano
MD, García-Foncillas J, Calasanz MJ and Montuenga LM. AlphaCP-4, a putative tumor suppressor
gene at 3p21, but not its alternative splice variant alphaCP-4, is underexpressed in lung cancer;
Cancer Res. 64: 4171-4179, 2004.

104 Cáncer de pulmón

18. Pino I, Pío R, Toledo G, Zabalegui N, Vicent S, Rey N, Lozano MD, Torre W, García-Foncillas J and
Montuenga LM. Altered patterns of expression of members of the heterogeneous nuclear
ribonucleoprotein (hnRNP) family in lung cancer; Lung Cancer. 41: 131-143, 2003.

19. Barthelemy-Brichant N, David JL, Bosquee L, Bury T, Seidel L, Albert A, Bartsch P, Baugnet-Mahieu
L and Deneufbourg JM. Increased TGFbeta1 plasma level in patients with lung cancer: potential
mechanisms; Eur J Clin Invest. 32: 193-198, 2002.

20. Hasegawa Y, Takanashi S, Kanehira Y, Tsushima T, Imai T and Okumura K. Transforming growth factor-
beta1 level correlates with angiogenesis, tumor progression, and prognosis in patients with nonsmall
cell lung carcinoma; Cancer. 91: 964-971, 2001.

21. Bennett WP, el-Deiry WS, Rush WL, Guinee DG Jr, Freedman AN, Caporaso NE, Welsh JA, Jones
RT, Borkowski A, Travis WD, Fleming MV, Trastek V, Pairolero PC, Tazelaar HD, Midthun D, Jett JR,
Liotta LA and Harris CC. p21waf1/cip1 and transforming growth factor beta 1 protein expression
correlate with survival in non-small cell lung cancer; Clin Cancer Res. 4: 1499-1506, 1998.

22. Iwasaki A, Kuwahara M, Yoshinaga Y and Shirakusa T. Basic fibroblast growth factor (bFGF) and
vascular endothelial growth factor (VEGF) levels, as prognostic indicators in NSCLC; Eur J Cardiothorac
Surg. 25: 443-448, 2004.

23. Franklin WA, Veve R, Hirsch FR, Helfrich BA and Bunn PA Jr. Epidermal growth factor receptor
family in lung cancer and premalignancy; Semin Oncol. 29: 3-14, 2002.

24. Maulik G, Shrikhande A, Kijima T, Ma PC, Morrison PT and Salgia R. Role of the hepatocyte growth
factor receptor, c-Met, in oncogenesis and potential for therapeutic inhibition; Cytokine Growth
Factor Rev. 13: 41-59, 2002.

25. Vicent S, Garayoa M, López-Picazo JM, Lozano MD, Toledo G, Thunnissen FB, Manzano RG and
Montuenga LM. Mitogen-activated protein kinase phosphatase-1 is overexpressed in non-small
cell lung cancer and is an independent predictor of outcome in patients; Clin Cancer Res. 10: 3639-
3649, 2004.

26. Vicent S, López-Picazo JM, Toledo G, Lozano MD, Torre W, García-Corchón C, Quero C, Soria
JC, Martín-Algarra S, Manzano RG and Montuenga LM. ERK1/2 is activated in non-small-cell lung
cancer and associated with advanced tumours; Br J Cancer. 90: 1047-1052, 2004.

27. Garber ME, Troyanskaya OG, Schluens K, Petersen S, Thaesler Z, Pacyna-Gengelbach M, van de
Rijn M, Rosen GD, Perou CM, Whyte RI, Altman RB, Brown PO, Botstein D and Petersen I.
Diversity of gene expression in adenocarcinoma of the lung; Proc Natl Acad Sci U S A. 98: 13784-
13789, 2001.

28. Bhattacharjee A, Richards WG, Staunton J, Li C, Monti S, Vasa P, Ladd C, Beheshti J, Bueno R,
Gillette M, Loda M, Weber G, Mark EJ, Lander ES, Wong W, Johnson BE, Golub TR, Sugarbaker
DJ and Meyerson M. Classification of human lung carcinomas by mRNA expression profiling reveals
distinct adenocarcinoma subclasses; Proc Natl Acad Sci U S A. 98: 13790-5, 2001.

29. Beer DG, Kardia SL, Huang CC, Giordano TJ, Levin AM, Misek DE, Lin L, Chen G, Gharib TG,
Thomas DG, Lizyness ML, Kuick R, Hayasaka S, Taylor JM, Iannettoni MD, Orringer MB and Hanash
S. Gene-expression profiles predict survival of patients with lung adenocarcinoma; Nat Med. 8:
816-24, 2002.

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 105
30. Hoang CD, D’Cunha J, Tawfic SH, Gruessner AC, Kratzke RA and Maddaus MA. Expression profiling
of non-small cell lung carcinoma identifies metastatic genotypes based on lymph node tumor
burden; J Thorac Cardiovasc Surg. 127: 1332-1341, 2004.

31. Kobayashi K, Nishioka M, Kohno T, Nakamoto M, Maeshima A, Aoyagi K, Sasaki H, Takenoshita S,

Sugimura H and Yokota J. Identification of genes whose expression is upregulated in lung
adenocarcinoma cells in comparison with type II alveolar cells and bronchiolar epithelial cells in
vivo; Oncogene. 23: 3089-3096, 2004.

32. Creighton C, Hanash S and Beer D. Gene expression patterns define pathways correlated with
loss of differentiation in lung adenocarcinomas; FEBS Lett. 540: 167-170, 2003.

33. Kikuchi T, Daigo Y, Katagiri T, Tsunoda T, Okada K, Kakiuchi S, Zembutsu H, Furukawa Y, Kawamura
M, Kobayashi K, Imai K and Nakamura Y. Expression profiles of non-small cell lung cancers on
cDNA microarrays: identification of genes for prediction of lymph-node metastasis and sensitivitycto
anti-cancer drugs; Oncogene. 22: 2192-2205, 2003.

34. Taxman DJ, MacKeigan JP, Clements C, Bergstralh DT and Ting JP. Transcriptional profiling of targets
for combination therapy of lung carcinoma with paclitaxel and mitogen-activated protein/extracellular
signal-regulated kinase kinase inhibitor; Cancer Res. 63: 5095-104, 2003.

35. Whiteside MA, Chen DT, Desmond RA, Abdulkadir SA and Johanning GL. A novel time-course
cDNA microarray analysis method identifies genes associated with the development of cisplatin
resistance; Oncogene. 23: 744-52, 2004.

36. Parmigiani G, Garrett-Mayer ES, Anbazhagan R and Gabrielson E. A cross-study comparison of

gene expression studies for the molecular classification of lung cancer; Clin Can Res. 10: 2922–2927,
2004.

37. Jiang H, Deng Y, Chen HS,Tao L, Sha Q, Chen J,Tsai CJ and Zhang S. Joint analysis of two microarray
gene-expression data sets to select lung adenocarcinoma marker genes; BMC Bioinformatics. 5: 81,
2004.

38. Petricoin EF, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, Steinberg SM, Mills GB, Simone C,
Fishman DA, Kohn EC and Liotta LA. Use of proteomic patterns in serum to identify ovarian
cancer; Lancet. 359: 572-577, 2002.

39. Yanagisawa K, Shyr Y, Xu BJ, Massion PP, Larsen PH, White BC, Roberts JR, Edgerton M, González
A, Nadaf S, Moore JH, Caprioli RM and Carbone DP. Proteomic patterns of tumour subsets in
non-small-cell lung cancer; Lancet. 362: 433-439, 2003.

40. Chen G, Gharib TG, Wang H, Huang CC, Kuick R, Thomas DG, Shedden KA, Misek DE, Taylor
JM, Giordano TJ, Kardia SL, Iannettoni MD, Yee J, Hogg PJ, Orringer MB, Hanash SM and Beer DG.
Protein profiles associated with survival in lung adenocarcinoma; Proc Natl Acad Sci U S A. 100:
13537-13542, 2003.

41. Xiao X, Liu D, Tang Y, Guo F, Xia L, Liu J, He D. Development of proteomic patterns for detecting
lung cancer; Dis Markers. 19: 33-39, 2004.

42. Meyerson M, Franklin WA and Kelley MJ. Molecular classification and molecular genetics of human
lung cancers; Semin Oncol. 31: 4-19, 2004.

106 Cáncer de pulmón

43. Kurusu Y, Yamashita J and Ogawa M. Detection of circulating tumor cells by reverse transcriptase-
polymerase chain reaction in patients with resectable non-small-cell lung cancer; Surgery. 126: 820-
826, 1999.

44. Kimura T, Holland WS, Kawaguchi T, Williamson SK, Chansky K, Crowley JJ, Doroshow JH, Lenz H,
Gandara DR and Gumerlock PH. Mutant DNA in plasma of lung cancer patients: potential for
monitoring response to therapy; Ann.N.Y. Acad. Sci. 1022: 55–60, 2004.

45. Ramírez JL, Sarriés C, de Castro PL, Roig B, Queralt C, Escuin D, de Aguirre I, Sánchez JM, Manzano
JL, Margeli M, Sánchez JJ, Astudillo J, Taron M and Rosell R. Methylation patterns and K-ras mutations
in tumor and paired serum of resected non-small-cell lung cancer patients; Cancer Lett. 193: 207-
216, 2003.

46. Andriani F, Conte D, Mastrangelo T, Leon M, Ratcliffe C, Roz L, Pelosi G, Goldstraw P, Sozzi G
and Pastorino U. Detecting lung cancer in plasma with the use of multiple genetic markers; Int J
Cancer. 108: 91-96, 2004.

47. Chen XQ, Stroun M, Magnenat JL, Nicod LP, Kur t AM, Lyautey J, Lederrey C and Anker P.
Microsatellite alterations in plasma DNA of small cell lung cancer patients; Nat Med. 2: 1033-
1035, 1996.

48. Sozzi G, Conte D, León M, Ciricione R, Roz L, Ratcliffe C, Roz E, Cirenei N, Bellomi M, Pelosi G,
Pierotti MA and Pastorino U. Quantification of free circulating DNA as a diagnostic marker in
lung cancer; J Clin Oncol. 21: 3902-3908, 2003.

49. Sánchez-Céspedes M, Monzó M, Rosell R, Pifarré A, Calvo R, López-Cabrerizo MP and Astudillo

J. Detection of chromosome 3p alterations in serum DNA of non-small-cell lung cancer patients;
Ann Oncol. 9: 113-116, 1998.

50. Esteller M, Sánchez-Céspedes M, Rosell R, Sidransky D, Baylin SB and Herman JG. Detection of
aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small
cell lung cancer patients; Cancer Res. 59: 67-70, 1999.

51. Usadel H, Brabender J, Danenberg KD, Jerónimo C, Harden S, Engles J, Danenberg PV, Yang S and
Sidransky D. Quantitative adenomatous polyposis coli promoter methylation analysis in tumor
tissue, serum, and plasma DNA of patients with lung cancer; Cancer Res. 62: 371-375, 2002.

52. Bearzatto A, Conte D, Frattini M, Zaffaroni N, Andriani F, Balestra D, Tavecchio L, Daidone MG

and Sozzi G. p16(INK4A) hypermethylation detected by fluorescent methylation-specific PCR in
plasmas from non-small cell lung cancer; Clin Cancer Res. 8: 3782-3787, 2002.

53. Imoto H, Osaki T, Taga S, Ohgami A, Ichiyoshi Y and Yasumoto K. Vascular endothelial growth factor
expression in non-small-cell lung cancer: prognostic significance in squamous cell carcinoma; J
Thorac Cardiovasc Surg.115: 1007-1014, 1998.

54. Tamura M, Oda M, Tsunezuka Y, Matsumoto I, Kawakami K, Ohta Y and Watanabe G. Chest CT
and serum vascular endothelial growth factor-C level to diagnose lymph node metastasis in patients
with primary non-small cell lung cancer; Chest. 126: 342-346, 2004.

55. Nieder C, Andratschke N, Jeremic B and Molls M. Comparison of serum growth factors and
tumor markers as prognostic factors for survival in non-small cell lung cancer; Anticancer Res. 23:
5117-5123, 2003.

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 107
56. Pujol JL, Molinier O, Ebert W, Daures JP, Barlesi F, Buccheri G, Paesmans M, Quoix E, Moro-Sibilot
D, Szturmowicz M, Brechot JM, Muley T and Grenier J. CYFRA 21-1 is a prognostic determinant
in non-small-cell lung cancer: results of a meta-analysis in 2063 patients; Br J Cancer. 90: 2097-
2105, 2004.

57. Yankelevitz DF, Vázquez M and Henschke CI. Special techniques in transthoracic needle biopsy of
pulmonary nodules; Radiol Clin North Am. 38: 267-279, 2000.

58. Warner KA, Crawford EL, Zaher A, Coombs RJ, Elsamaloty H, Roshong-Denk SL, Sharief I, Amurao
GV, Yoon Y, Al-Astal AY, Assaly RA, Hernandez DA, Graves TG, Knight CR, Harr MW, Sheridan TB,
DeMuth JP, Zahorchak RJ, Hammersley JR, Olson DE, Durham SJ and Willey JC. The c-myc x E2F-
1/p21 interactive gene expression index augments cytomorphologic diagnosis of lung cancer in
fine-needle aspirate specimens; J Mol Diagn. 5: 176-183, 2003.

59. Jeanmart M, Lantuejoul S, Fievet F, Moro D, Sturm N, Brambilla C and Brambilla E. Value of
immunohistochemical markers in preinvasive bronchial lesions in risk assessment of lung cancer;
Clin Cancer Res. 9: 2195-2203, 2003.

60. Wistuba II, Mao L and Gazdar AF. Smoking molecular damage in bronchial epithelium; Oncogene.
21: 7298-7306, 2002.

61. McWilliams A, Mayo J, MacDonald S, leRiche JC, Palcic B, Szabo E and Lam S. Lung cancer screening:
a different paradigm; Am J Respir Crit Care Med. 168: 1167-1173, 2003.

62. Henschke CI. Medicine on lung cancer screening. A Different Paradigm; Am J Respir Crit Care Med.
168: 1143-1143, 2003.

63. Field JK and Liloglou T. Fluorescent microsatellite analysis in bronchial lavage as a potential diagnostic
tool for lung cancer; Methods Mol Med. 75: 251-262, 2003.

64. Carstensen T, Schmidt B, Engel E, Jandrig B, Witt C and Fleischhacker M. Detection of cell-free
DNA in bronchial lavage fluid supernatants of patients with lung cancer; Ann N Y Acad Sci. 1022:
202-210, 2004.

65. Kim H, Kwon YM, Kim JS, Lee H, Park JH, Shim YM, Han J, Park J and Kim DH. Tumor-specific
methylation in bronchial lavage for the early detection of non-small-cell lung cancer; J Clin Oncol.
22: 2363-2370, 2004.

66. Topaloglu O, Hoque MO, Tokumaru Y, Lee J, Ratovitski E, Sidransky D and Moon CS. Detection
of promoter hypermethylation of multiple genes in the tumor and bronchoalveolar lavage of
patients with lung cancer; Clin Cancer Res. 10: 2284-2288, 2004.

67. Grote HJ, Schmiemann V, Kiel S, Bocking A, Kappes R, Gabbert HE and Sarbia M. Aberrant
methylation of the adenomatous polyposis coli promoter 1A in bronchial aspirates from patients
with suspected lung cancer; Int J Cancer. 110: 751-755, 2004.

68. Thunnissen FB. Sputum examination for early detection of lung cancer; J Clin Pathol. 56: 805-810,
2003.

69. Frost JK, Ball WC Jr, Levin ML, Tockman MS, Baker RR, Carter D, Eggleston JC, Erozan YS, Gupta
PK, Khouri NF, et al. Early lung cancer detection: results of the initial (prevalence) radiologic and
cytologic screening in the Johns Hopkins study; Am Rev Respir Dis. 130: 549-554, 1984.

108 Cáncer de pulmón

70. Prindiville SA, Byers T, Hirsch FR, Franklin WA, Miller YE, Vu KO, Wolf HJ, Baron AE, Shroyer KR,
Zeng C, Kennedy TC and Bunn PA. Sputum cytological atypia as a predictor of incident lung
cancer in a cohort of heavy smokers with airflow obstruction; Cancer Epidemiol Biomarkers Prev.
12: 987-993, 2003.

71. Kennedy TC, Miller Y and Prindiville S. Screening for lung cancer revisited and the role of sputum
cytology and fluorescence bronchoscopy in a high-risk group; Chest; 117: 72S-79S, 2000.

72. Marek W, Kotschy-Lang N, Muti A, Kohler CH, Nielsen L, Topalidis TH, Atay Z and Nakhosteen
JA. Can semi-automated image cytometry on induced sputum become a screening tool for lung
cancer? Evaluation of quantitative semi-automated sputum cytometry on radon- and uranium-
exposed workers; Eur Respir J. 18: 942-950, 2001.

73. Tockman MS, Mulshine JL, Piantadosi S, Erozan YS, Gupta PK, Ruckdeschel JC, Taylor PR, Zhukov
T, Zhou WH, Qiao YL and Yao SX. Prospective detection of preclinical lung cancer: results from
two studies of hnRNP A2/B1 overexpression; Clin Cancer Res. 3: 2237-2246, 1997.

74. Sueoka E, Goto Y, Sueoka N, Kai Y, Kozu T and Fujiki H. Heterogeneous nuclear ribonucleoprotein
B1 as a new marker of early detection for human lung cancers; Cancer Res. 59: 1404-1407, 1999.

75. Mao L, Hruban RH, Boyle JO, Tockman M and Sidransky D. Detection of oncogene mutations in
sputum precedes diagnosis of lung cancer; Cancer Res. 54: 1634-1637, 1994.

76. Kersting M, Friedl C, Kraus A, Behn M, Pankow W and Schuermann M. Differential frequencies of
p16(INK4a) promoter hypermethylation, p53 mutation, and K-ras mutation in exfoliative material
mark the development of lung cancer in symptomatic chronic smokers; J Clin Oncol. 18: 3221-
3229, 2000.

77. Somers VA, Pietersen AM, Theunissen PH, Thunnissen FB. Detection of K-ras point mutations in
sputum from patients with adenocarcinoma of the lung by point-EXACCT; J Clin Oncol. 16: 3061-
3068, 1998.

78. Palmisano WA, Divine KK, Saccomanno G, Gilliland FD, Baylin SB, Herman JG and Belinsky SA.
Predicting lung cancer by detecting aberrant promoter methylation in sputum; Cancer Res. 60:
5954-5958, 2000.

79. Belinsky SA, Palmisano WA, Gilliland FD, Crooks LA, Divine KK, Winters SA, Grimes MJ, Harms
HJ, Tellez CS, Smith TM, Moots PP, Lechner JF, Stidley CA and Crowell RE. Aberrant promoter
methylation in bronchial epithelium and sputum from current and former smokers; Cancer Res.
62: 2370-7, 2002.

80. Phillips M, Cataneo RN, Cummin AR, Gagliardi AJ, Gleeson K, Greenberg J, Maxfield RA and Rom
WN. Detection of lung cancer with volatile markers in the breath; Chest. 123: 2115-2123, 2003.

81. Gessner C, Kuhn H, Toepfer K, Hammerschmidt S, Schauer J, Wirts H. Detection of p53 gene
mutations in exhaled breath condensate of non-small cell lung cancer patients; Lung Cancer. 43:
215-222, 2004.

82. Fiegl M, Massoner A, Haun M, Sturm W, Kaufmann H, Hack R, Krugmann J, Fritzer-Szekeres M,

Grunewald K and Gastl G. Sensitive detection of tumour cells in effusions by combining cytology
and fluorescence in situ hybridisation (FISH); Br J Cancer. 91: 558-563, 2004.

Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón 109
83. Romeo MS, Sokolova IA, Morrison LE, Zeng C, Baron AE, Hirsch FR, Miller YE, Franklin WA and
Varella-García M. Chromosomal abnormalities in non-small cell lung carcinomas and in bronchial
epithelia of high-risk smokers detected by multi-target interphase fluorescence in situ hybridization;
J Mol Diagn. 5: 103-112, 2003.
84. Zhukov TA, Johanson RA, Cantor AB, Clark RA and Tockman MS. Discovery of distinct protein
profiles specific for lung tumors and pre-malignant lung lesions by SELDI mass spectrometry; Lung
Cancer. 40: 267-279, 2003.
85. Brambilla C, Fievet F, Jeanmart M, de Fraipont F, Lantuejoul S, Frappat V, Ferretti G, Brichon PY
and Moro-Sibilot D. Early detection of lung cancer: role of biomarkers; Eur Respir J Suppl. 39: 36S-
44S, 2003.
86. Hilbe W, Dlaska M, Duba HC, Dirnhofer S, Eisterer W, Oberwasserlechner F, Mildner A, Schmid
T, Kuhr T and Woll E. Automated real-time PCR to determine K-ras codon 12 mutations in non-
small cell lung cancer: comparison with immunohistochemistry and clinico-pathological features;
Int J Oncol. 23: 1121-1126, 2003.
87. Field JK, Brambilla C, Caporaso N, Flahault A, Henschke C, Herman J, Hirsch F, Lachmann P, Lam
S, Maier S, Montuenga LM, Mulshine J, Murphy M, Pullen J, Spitz M, Tockman M, Tyndale R, Wistuba
I and Youngson J. Consensus statements from the Second International Lung Cancer Molecular
Biomarkers Workshop: a european strategy for developing lung cancer molecular diagnostics in
high risk populations; Int J Oncol. 21: 369-73, 2002.
88. Petty RD, Nicolson MC, Kerr KM, Collie-Duguid E and Murray GI. Gene expression profiling in
non-small cell lung cancer: from molecular mechanisms to clinical application; Clin Cancer Res. 10:
3237-48, 2004.

110 Cáncer de pulmón

 FACTORES PRONÓSTICOS
EN CÁNCER DE PULMÓN
Ángel López-Encuentra
Hospital Universitario 12 de Octubre
Madrid

Contenido:
Resumen de la ponencia
Bibliografía
Artículos del ponente
 Factores pronósticos en cáncer de pulmón
Ángel López Encuentra
Servicio Neumología
Hospital Universitario 12 de Octubre, Madrid

Introducción
En Cáncer de Pulmón (CP) interesan diversos pronósticos como puede ser el de supervivencia global,
el de supervivencia específica por cáncer, el de calidad de vida durante supervivencia, el de respuesta
o resistencia terapéutica. Los más estudiados son los factores pronósticos (FP) de supervivencia, global
o específica para CP.
Revisiones recientes sobre este tema han detectado que la mayoría de los estudios publicados
sobre FP en CP tienen baja potencia estadística y son marcadamente heterogéneos.

Tipos de factores pronósticos

En CP se consideran tres tipos de FP. En primer lugar los más clásicos relacionados con la extensión
anatómica tumoral y que están contenidos en la clasificación TNM ampliamente conocida.
Otra fuente de FP potenciales son los factores clínicos relacionados con el huésped del tumor,
por las propias características del paciente o por la interacción entre enfermedad y enfermo.
Finalmente, una fundada esperanza: que los posibles FP de Biología Molecular mejoren la capacidad
predictiva pronóstica de los otros dos tipos de FP referidos.

Clasificación de extensión anatómica TNM-estadios

Cada estadio en la clasificación de 1997 está compuesto de una serie de combinaciones entre los
apartados T, N y M, y cada uno de estos apartados contienen diversos componentes agrupados (tamaño,
invasión de estructuras locales concretas, etc.).
Por tanto, la unidad clasificatoria inicial es la presencia de elementos individuales, como el tamaño
tumoral, que, agrupados con otros elementos, van conformando una escala clasificatoria ascendente y
reduccionista.
La última clasificación TNM de 1997 está validada en su aspectos más groseros como son los
estadios patológicos en las fases más iniciales del CB.
Sin embargo, hay diversos problemas en la clasificación TNM. La estadificación patológica, que es
la más exacta a nivel pronóstico, exige la presencia de pieza quirúrgica del tumor extirpado. Esta situación
sólo ocurre en alrededor de un 20% de todos los CP diagnosticados. La estadificación TNM clínica (la
que no se efectúa con los datos de la pieza extirpada en toracotomía) tiene una baja certeza clasificatoria
cuando se compara con la prueba de referencia (gold standard), que es la TNM patológica.
También, la clasificación TNM de 1997, tiene algunos parámetros como es el tamaño tumoral con
baja capacidad discriminativa para pronóstico al utilizar únicamente una escala dicotómica (igual-menor,
o mayor de 3 cm), disminuyendo su capacidad para establecer un mayor abanico de pronósticos.
Se prevé que para el año 2007 se efectúe una propuesta de nueva clasificación TNM para el
CP al evaluar una base de datos de más de 50.000 pacientes.

Factores pronósticos en cáncer de pulmón 113

Factores pronósticos clínicos
Cuando se analizan las curvas de supervivencia del CP, aun en los mejores casos de estirpe no microcítica
resecados curativos y en estadios iniciales (estadio I p) se observa que la clasificación de extensión
anatómica es insuficiente como escala pronostica para predecir a los supervivientes a largo plazo.
Existen numerosos estudios que observan que diversos factores clínicos intervienen de forma
independiente en el pronóstico. Entre las determinaciones de laboratorio están los niveles de calcio, de
la hemoglobina, de la LDH, de la albúmina. Entre los datos clínicos, la pérdida de peso, el estado clínico
general (PS), el sexo, la edad o la presencia de síntomas.
Un “índice clínico”, que agrupa diferentes condiciones de la clínica o de las determinaciones
bioquímicas, no parece discriminar pronóstico cuando se analiza en la población CP no microcítica
resecados completos y en estadios iniciales. Sin embargo, un “índice de comorbilidad”, que considera
diversas enfermedades, asociadas, si parece comportarse como un factor pronóstico independiente en
todas las poblaciones de CP quirúrgico, inclusive en los tumores más pequeños de igual o menos de
2 cm de tamaño en pieza quirúrgica. Este efecto de la comorbilidad se detecta, fundamentalmente en
el grupo de edad mas joven.
Algunas enfermedades asociadas, como es la enfermedad pulmonar obstructiva crónica, sólo tienen
impacto pronóstico cuando se analiza este factor en forma de supervivencia condicional tras 2 ó 3
años vivo desde la cirugía.
Cuando se han considerado diferentes metodologías de análisis multivariable combinando factores
pronósticos de extensión anatómica TNM con factores pronósticos clínicos, el área bajo la curva ROC
para predicción de pronóstico a 3 años no es superior a 0,72. Ello implica que existe un margen, aun
importante, para la mejora predictiva del pronóstico en CP. ¿Los factores pronósticos derivados de los
estudios de genómica y proteómica pueden ayudar a esa mejora?

Factores pronósticos de biología molecular

Existen suficientes datos para afirmar que los FP de Biología Molecular (BM) pueden mejorar, y en
ocasiones sustituir, la predicción de pronóstico de supervivencia hasta ahora conocida con los parámetros
TNM y los clínicos.
Sin embargo, tras un período inicial de aparentes avances significativos, el mejor conocimiento de
la BM en CP ha demostrado su complejidad y la necesidad de disponer de cuatro tecnologías básicas:
una base clínica de datos controlados, un análisis masivo de genes o de proteínas (arrays), un conocimiento
y manejo adecuado variable por variable (análisis uni y multivariable), y una excelente organización,
gestión y coordinación de todos los aspectos multidisciplinarios y multicéntricos que estos estudios
precisan.

Conclusiones
Actualmente existe un numeroso grupo de investigadores que intentan mejorar el conocimiento de los
factores pronósticos (FP) en el cáncer de pulmón (CP).
En primer lugar, y por primera vez en la historia de la estadificación, actualmente se está manejando
la información de más de 50.000 pacientes provenientes de todo el mundo a fin de producir una nueva
clasificación TNM para esta enfermedad en 2007.
En segundo lugar, en supervivencia global, ciertos factores clínicos en una población con CP, con
una edad media cada vez más avanzada, son FP independientes como es la presencia de la comorbilidad.

114 Cáncer de pulmón

 Finalmente, todas las limitaciones aprendidas en la construcción de clasificaciones tumorales
pronósticas son lecciones útiles para manejar, de forma integrada, la nueva fuente de información
predictiva que es la Biología Molecular.
Ciertos requerimientos deben de ser cubiertos para que esa posibilidad pueda confirmarse de
forma consistente.

Bibliografía

1. Buccheri G, Ferrigno D. Prognostic factors. Hematol Oncol Clin North Am 2004; 18: 187-201.

2. Buccheri G, Ferrigno D. Prognostic factors in lung cancer: tables and comments. Eur Respir J
1994; 7: 1350-64.

3. Brundage MD, Davies D, Mackillop WJ. Prognostic factors in non-small cell lung cancer: a decade
of progress. Chest 2002; 122: 1037-57.

4. Gospodarowicz MK, Henson DE, Hutter RVP, O´Sullivan B, Sobin LH, Wittekind Ch (eds). Prognostic
Factors in Cancer. UICC. Wilwy Liss. New York. 2001.

5. Sánchez-Céspedes M. Dissecting the genetic alterations involved in lung carcinogenesis. Lung

Cancer 2003; 40: 111-21.

6. Sánchez-Céspedes M. Pronóstico biológico y farmacogenómica. Congreso Nacional SEPAR. Junio

2004. URL (disponible septiembre 2004): [Link] (Oncología / Reuniones).

7. Fong KM, Minna JD. Molecular biology of lung cancer: clinical implications. Clin Chest Med 2002;
23: 83-101

8. Driscoll B (ed). Methods in Molecular Medicine. Lung Cancer. Diagnostic and Therapeutic Methods
and Reviews. Volumen II. Humana Press. New Jersey. 2003.

9. Yanagisawa K, Shyr Y, Xu BJ, Massion PP, Larsen PH, White BC, Roberts JR, Edgerton M, Gonzalez A,
Nadaf S, Moore JH, Caprioli RM, Carbone DP. Proteomic patterns of tumour subsets in non-
small-cell lung cancer. Lancet 2003; 362: 33-9.

10. Fong KM, Sekido Y, Gazdar AF, Minna JD. Lung cancer. 9: Molecular biology of lung cancer: clinical
implications. Thorax 2003; 58: 892-900.

11. Kallioniemi OP, Wagner U, Kononen J, Sauter G. Tissue microarray technology for high-throughput
molecular profiling of cancer. Hum Mol Genet 2001; 10: 657-62

12. Petty RD, Nicolson MC, Kerr KM, Collie-Duguid E, Murray GI. Gene expression profiling in non-
small cell lung cancer: from molecular mechanisms to clinical application. Clin Cancer Res 2004;
10: 3237-48.

13. Fernando HC, Goldstraw P. The accuracy of clinical evaluative intrathoracic staging in lung cancer
as assessed by postsurgical pathologic staging. Cancer 1990; 65: ≠2503-6.

Factores pronósticos en cáncer de pulmón 115

14. López-Encuentra, A, García-Luján R, Rivas JJ, Rodríguez-Rodríguez J, Torres-Lanza J, Varela-Simo G;
and Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and
Thoracic Surgery (GCCB-S). Comparison between clinical and pathological staging in 2,994 cases
of lung cancer. Ann Thorac Surg 2004 (en prensa).

15. Lopez-Encuentra A, Bulzebruck H, Feinstein AR, Motta G, Mountain CF, Naruke T, Sanchez JM,
Tsuchiya R, Wittekind C. Tumor staging and classification in lung cancer. Lung Cancer 2000;
29: 79-83.

16. Clinical tumour size and prognosis in lung cancer. Bronchogenic Carcinoma Cooperative Group of
the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Eur Respir J 1999; 14: 812-6.

17. Lopez-Encuentra A, Duque-Medina JL, Rami-Porta R, de la Camara AG, Ferrando P; Bronchogenic

Carcinoma Co-operative Group of the Spanish Society of Pneumology and Thoracic Surgery.
Staging in lung cancer: is 3 cm a prognostic threshold in pathologic stage I non-small cell lung
cancer? A multicenter study of 1,020 patients. Chest 2002; 121: 1515-20.

18. Lopez-Encuentra A; Bronchogenic Carcinoma Co-operative Group. Comorbidity in operable lung

cancer: a multicenter descriptive study on 2992 patients. Lung Cancer 2002; 35: 263-9.

19. Tammemagi CM, Neslund-Dudas C, Simoff M, Kvale P. In lung cancer patients, age, race-ethnicity,
gender and smoking predict adverse comorbidity, which in turn predicts treatment and survival.
J Clin Epidemiol 2004; 57: 597-609.

20. Janssen-Heijnen ML, Smulders S, Lemmens VE, Smeenk FW, van Geffen HJ, Coebergh JW. Effect
of comorbidity on the treatment and prognosis of elderly patients with non-small cell lung cancer.
Thorax 2004; 59: 602-7.

21. Iizasa T, Suzuki M,Yasufuku K, Iyoda A, Otsuji M,Yoshida S, Sekine Y, Shibuya K, Saitoh Y, Hiroshima K,
Fujisawa T. Preoperative pulmonary function as a prognostic factor for stage I non-small cell lung
carcinoma. Ann Thorac Surg 2004; 77: 1896-902

22. Gomez de la Cámara A, López-Encuentra A, Ferrando P and Bronchogenic Carcinoma Cooperati-

ve Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Heterogeneity
of prognostic profiles in non-small cell lung cancer. J Clin Epidemiol 2004 (enviado para publicación)

116 Cáncer de pulmón

Staging in Lung Cancer: Is 3 cm a
Prognostic Threshold in Pathologic
Stage I Non-small Cell Lung Cancer?
A Multicenter Study of 1,020 Patients
Ángel López-Encuentra, MD, PhD; José Luis Duque-Medina, MD, PhD;
Ramón Rami-Porta, MD, PhD; Agustı́n Gómez de la Cámara, MD, PhD;
Paloma Ferrando, MSc; for the Bronchogenic Carcinoma Co-operative Group of
the Spanish Society of Pneumology and Thoracic Surgery†

Introduction: Since 1974, a tumor size of 3 cm in diameter has been regarded as the prognostic
threshold in the staging of bronchogenic carcinoma.
Objective: To study the prognostic behavior of surgical-pathologic tumor size in non-small cell
lung cancer (NSCLC) with complete resection.
Design: Four-year multi-institutional prospective study from 1993 to 1997.
Patients: Consecutive cases of NSCLC in pathologic stages IA-IB (pIA-pIB) treated surgically with
complete resection in hospitals belonging to the Bronchogenic Carcinoma Co-operative Group of
the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S).
Methods: The Schoenfeld procedure was used to identify different prognostic groups, considering
1 cm as the measurement unit.
Results: Based on the 1,020 cases evaluated, four prognostic groups were identified: 0 to 2 cm
(group A; n ⴝ 147), 2.1 to 4 cm (group B; n ⴝ 448), 4.1 to 7 cm (group C; n ⴝ 336), and > 7 cm
(group D; n ⴝ 89). At 5 years, survival was 0.63 (95% confidence interval [CI], 0.58 to 0.68), 0.56
(95% CI, 0.53 to 0.59), 0.49 (95% CI, 0.46 to 0.52), and 0.38 (95% CI, 0.32 to 0.44) for groups A,
B, C, and D, respectively. Differences between paired groups (log-rank) were significant: 0.0074
between groups A and B, 0.0048 between groups B and C, and 0.0034 between groups C and D.
Conclusions: In initial stages (pIA-pIB) of NSCLC, the 3-cm value was not found to behave
as a prognostic threshold; in this study, four surgical-pathologic tumor size groups were
identified with strong prognostic differences: from 0 to 2 cm, from 2.1 to 4 cm, from 4.1 to 7 cm,
and > 7 cm. (CHEST 2002; 121:1515–1520)

Key words: lung cancer; lung neoplasms; size; surgery

Abbreviations: CI ⫽ confidence interval; GCCB-S ⫽ Bronchogenic Carcinoma Co-operative Group of Spanish Society
of Pneumology and Thoracic Surgery; NSCLC ⫽ non-small cell lung cancer

S tumor
ince 1974, 3 cm has been regarded as the only
1

size to establish a prognostic threshold in

edly (the last update being in 1997),2 criteria for
tumor size has remained unchanged for the last 25
the staging of bronchogenic carcinoma. Even though years.
the staging classification has been updated repeat- There is a need to conduct further research on
other clinical or molecular biological prognostic fac-
*From Hospital Universitario (Dr. Duque-Medina), Valladolid;
tors in patients with lung cancer; therefore, it be-
Hospital Universitario 12 de Octubre (Drs. López-Encuentra and comes essential for the basic anatomic classification
de la Cámara, and Ms. Ferrando), Madrid; and Hospital Mutua of tumors to be founded on solid grounds. A new
de Terrassa (Dr. Rami-Porta), Barcelona, Spain.
†A complete list of GCCB-S members is given in the Appendix. prognostic factor could only be considered useful,
Partly financed by FIS grant 97/0011, FEPAR-1995 grant, and included as part of the tumor classification, if it
Fundación RESPIRA-2000 grant, and financial aid from Castilla- has the ability to modify the prediction and accuracy
León regional government and Menarini Foundation.
Manuscript received July 2, 2001; revision accepted November of the TNM anatomic classification.3
14, 2001. The TNM classification is simplified to make its
Correspondence to: Angel López-Encuentra, MD, FCCP, Pneu-
mology Service, Hospital Universitario 12 de Octubre, Ctta. use easier; however, that simplicity may lead to
Andalucı́a 5.4, 28041 Madrid, Spain; e-mail: lencuent@[Link] decreased prognostic certainty or, in other words, a

[Link] CHEST / 121 / 5 / MAY, 2002 1515

loss of prognostic discrimination. Repeatability or The surgical-pathologic size was obtained by measuring the
validation of the prognostic values for the main greatest diameter of the fresh surgical specimen.
Surgical-pathologic stage N0 was assigned when there was no
pathologic stages in a surgical population with non- lymph node involvement after systematic nodal dissection or
small cell lung cancer (NSCLC) has been demon- when sampling of at least four lymph node stations was per-
strated in the United States, Japan, Germany, and formed (stations 2, only on the right side, 4, 7, and 10 ipsilateral
Spain.4 Nonetheless, and as it was to be expected, it to the tumor).13 These criteria were similar to those proposed in
has now been acknowledged that the consideration recent recommendations,14 such as the need to obtain six hilar-
mediastinal lymph nodes, in order to define pN0. For the
of TNM descriptors was more predictive of progno- purpose of classifying the presence or absence of mediastinal
sis than the assessment of tumor stages.5 lymph node involvement, a randomized study15 demonstrated
The Bronchogenic Carcinoma Co-operative Group that sampling had a value similar to that of mediastinal lymph
of the Spanish Society of Pneumology and Thoracic node dissection. The GCCB-S operational definition for standard
Surgery (GCCB-S) has recently evaluated its experi- complete resection requires the absence of tumor involvement of
resection margins, extracapsular involvement of resected medi-
ence in the prognostic analysis of prethoracotomy astinal lymph nodes, positive biopsy finding in unresected medi-
clinical tumor size in lung cancer.6 This study was able astinal lymph nodes, and the absence of tumor pleural effusion.
to identify four different prognostic groups of tumor Internal and external audits were performed to review the ratio
size based on radiography. However, since this clinical between the number of patients undergoing surgery and the
staging was based on a population that in the end number of cases included in the GCCB-S Registry (standard
⬎ 95%), and to review the presence and validity of the data
required surgery, it involved some problems: the collected and recorded for each case (standard ⬎ 75%), including
greater the tumor size, the greater the probability to the consistency of tumor staging. The criterion for the validity of
have invaded mediastinal lymph nodes at thoracotomy, survival data was established on the existence of a known
even in cases of small NSCLC; or the higher frequency follow-up of, at least, 85% of the case-patients registered in each
of exploratory thoracotomies or incomplete resections hospital. In the hospitals that did not meet all these conditions,
the cases corresponding to the anomalous period were excluded.
in larger tumors, among other limitations.7–10 The goal Finally, correct data transmission from the paper record to the
of this study is to evaluate tumor size as a prognostic computer database was verified on two separate occasions.
factor in patients with pT1-T2N0M0 NSCLC under- These procedures were designed to control the following
going complete resection in a nonselected surgical aspects: selection bias of surgical cases, registered cases over the
population. total number of surgical cases, sample size, type of hospital,
prognostic migration due to the prolonged period of case recruit-
ment, classification with low or deficient degrees of certainty,
contamination by data from incomplete series or erroneous data,
Materials and Methods and loss of adequate long-term follow-up.

Study Subjects Analysis

All the patients included prospectively in this study had Tumor size has been analyzed in different studies16,17 using
NSCLC in initial stages (pIA-pIB) and underwent thoracotomy different methods and perspectives. Notwithstanding, it is a
with complete resection in hospitals pertaining to the GCCB-S11 known fact that compilation of observations of supposedly con-
between October 1993 and September 1997, both inclusive. tinuous variables is bound to include errors that affect both the
Similar criteria for the functional operability of patients and accuracy and validity of such estimations. The terminal digit
oncologic operability of the tumor were used in all the GCCB-S preference phenomenon and rounding up have been cited as
hospitals.12 The participating GCCB-S centers had a wide variety typical examples.18,19 The statistical reliability, the way the vari-
of activities, including a representative range of number of beds, able is distributed, and the accurate classification of the study
type of activity (university and nonuniversity, community, public, subjects can be seriously affected as a result of this phenomenon.
and private ownership), and number of interventions per year This study verified the distribution of the tumor size variable in
(range, 8 to 100 interventions). The sample was complete, as order to choose the best method of analysis by observing the
verified by the inclusion in the registry of all patients undergoing mentioned digit preference.
complete surgical resection. Patients with death due to operative A distribution of absolute and relative frequencies of patho-
mortality or patients receiving neoadjuvant therapy were ex- logic tumor size was performed, and the normality of such
cluded from the analysis. The total number of NSCLC patients distribution of data subsequently analyzed using the Shapiro-
operated on with any pathologic stage and any type of surgery was Wilks method. The Schoenfeld procedure20 was used to identify
2,300. The final number of cases included in this study was 1,020. prognostic tumor size intervals. In this procedure, the continuous
Data were collected prospectively, in real-time, over the 4-year variable of tumor size was reclassified arbitrarily into intervals
study period, using a unified single self-copying form that (centimeters in this case). A series of consecutive intervals was
included the original and a copy (the original form was filed at the generated and its correlation with survival confirmed statistically
hospital and a copy omitting affiliation data was sent to the using the Cox proportional risk procedure,21 which revealed the
GCCB-S headquarters). At the GCCB-S Registry, each classifi- magnitude of the relative risk of each stratum.
catory component for the different T categories (tumor size, Different survival outcomes at various periods of time were
pleural tumor involvement, or tumor involvement of other analyzed and 95% confidence intervals (CIs) calculated using life
endothoracic structures) was considered differently and on an tables (actuarial survival); survival curves were compared using
individual basis for each patient. The diagnostic procedure the log-rank method. Statistical significance was adjusted using
employed was marked using a previously agreed-on code and the the Bonferroni correction for paired comparisons between
procedure showing the best resolution recorded in the registry. strata.22

1516 Clinical Investigations

 Results institutional and representative of cases of NSCLC
Distribution of Tumor Size Data treated surgically in Spain, with an initial design
conceived to control the usual bias in prognostic
Figure 1 shows the histogram of pathologic tumor and/or therapeutic studies. Even though, based on
size, where those population subjects with a tumor the pathologic stage, similar survival rates are seem-
size of ⱕ 7 cm were selected, clearly showing the ingly reported in different experiences,4 those as-
discontinuity and nonnormality behavior displayed pects of the methodology are particularly important
by this variable. This is why the Schoenfeld proce- in view of the variations in survival reported by
dure was used for analysis. different series for the same prognostic TNM cate-
gories in NSCLC.23
Population Characteristics This prospective multi-institutional analysis con-
ducted by the GCCB-S between 1993 and 1997
Of the 1,020 patients that comprised this series,
included a prognosis-specific analysis of pathologic
945 patients (93%) were men. Mean (SD) age was
tumor size in 1,020 pIA-pIB NSCLC patients who
64.1 (8.85) years (range, 36 to 87 years). By histologic
underwent a complete resection. The analyses con-
typing of the surgical specimen, 607 tumors (60%)
ducted point to the existence, in this population of
were epidermoid, 180 tumors (18%) were large cell,
subjects whose initial NSCLC was treated, of four
136 tumors (13%) were adenocarcinomas, and the
different prognostic groups distributed according to
remaining 97 tumors (9%) were of an undefined type
tumor size; the 3-cm value is not a threshold of
or a mixture of the previously mentioned types.
prognostic significance. The pathologic tumor size
intervals yielded by this study (0 to 2 cm, 2.1 to 4 cm,
Prognosis According to Pathologic Tumor Size
4.1 to 7 cm, and ⬎ 7 cm) are identical to those
Mean pathologic tumor size was 4.27 cm (SD, 2.2 observed by our group6 for the analysis of clinical
cm; median, 4 cm; range, 0.4 to 15 cm). Table 1 tumor size although, evidently, with different sur-
shows the four prognostic intervals yielded by the vival values.
Schoenfeld procedure20 and the Cox procedure.21 In resected pathologic stage I NSCLC, with a
Figure 2 shows a graphic representation of the four surgical specimen of 4.1 to 7 cm, survival at 4 and 5
survival curves for each prognostic stratum according years of 0.53 and 0.49, respectively (our study), is
to the pathologic tumor size. worse than the survival specified for pathologic stage
IIA (0.61 and 0.55, respectively).16 For tumors
⬎ 7 cm, the prognosis at 2, 3, 4, and 5 years (0.51.
Discussion 0.45, 0.41, and 0.38, respectively) is identical to that
reported for descriptors pT2N1M0-pT3N0M0 (stage
This study comprised a large series collected in a IIB) [0.56, 0.46, 0.42, and 0.39, respectively].16
short and recent time period. The study was multi- Comparison between this GCCB-S series and that
published by Mountain16 in 1997 seems adequate, as
both these series refer, in terms of pathologic stag-
ing, to NSCLC cases with complete resection, and
both exclude operative mortality. In these last few
years, there has been regained interest for the early
screening and detection of lung cancer, due in part
to the availability of procedures such as low-radiation
CT for detection of small nodules.24 Besides the
controversy raised by the design of population
screening research studies, contradictory data have
been identified regarding prognosis within the
different magnitudes in T1N0M0 lung cancer
(ⱕ 3 cm). One report17 describes experiences that
do not indicate prognostic differences among tumors
of ⬍ 3 cm; however, another study25 found such
differences. Editorials26 and letters27 continue to
fuel this current controversial issue.
Ten years ago, Watanabe et al28 considered a 5-cm
Figure 1. Frequency distribution of pathologic tumor size (in diameter to be a prognostic threshold for tumor size.
centimeters). Data corresponding to tumors ⱕ 7 cm in diameter
are presented. A digit preference is detected in whole values and He then proposed that category T2 be divided into
in their halves (1 cm, 1.5 cm, 2 cm, 2.5 cm, etc.). two groups (a and b), depending on whether the

[Link] CHEST / 121 / 5 / MAY, 2002 1517

 Table 1—Risk Ratio (Death) and Survival According to Different Strata of Pathologic Tumor Size

Survival, yr
Tumor Size Risk Ratio
Groups Diameter, cm No. (95% CI) 2 3 4 5 Log Rank

A 0–2 147 1 0.90 0.83 0.76 0.63 0.0074

B 2.1–4 448 1.5 (1.1–2.2) 0.81 0.71 0.65 0.56 0.0048
C 4.1–7 336 2.1 (1.5–3.1) 0.71 0.61 0.53 0.49 0.0034
D ⬎7 89 3.5 (2.3–5.4) 0.51 0.45 0.41 0.38

tumor was above or below that diameter.28 One actual surgical specimen. A possible problem with a
study29 evaluated the risk ratio for recurrence, taking double implication could be the presence of accom-
into account the centimeters of the tumor. That risk panying atelectasis or pneumonitis. Since atelectasis
ratio was 1.2 per centimeter (95% CI, 1.1 to 1.4). or pneumonitis is more likely to appear in large
Some European series30 on surgical lung cancer of tumors, and such clinical picture is another criterion
a predominantly squamous type (57%), and with the for T2,16 the combination of these two factors could
majority of patients being male (63%), have con- worsen the prognosis. In addition, such association
ducted a prognostic analysis on various strata of could wrongly overestimate the presumed size of the
tumor size. When a size of ⱕ 2 cm was taken as tumor. In the present study, the frequency of surgi-
reference, strata of ⱕ 4 and ⬎ 4 cm were shown to cal-pathologic atelectasis or pneumonitis, as mea-
have a direct correlation with survival. Finally, other sured in the four mentioned tumor strata, was 22%,
analyses have considered the magnitude of estimated
23%, 29%, and 21% for groups A, B, C, and D (Table
tumor volume in NSCLC stages I and II.31 The
1), respectively.
death risk increases in line with tumor volume for
In a previous GCCB-S study6 on prognostic anal-
each of the stages, in a significant and independent
fashion. The Schoenfeld procedure used in our study ysis of clinical tumor size, cases with visceral pleural
affords the advantages, in this type of tumor size involvement were excluded. In this study (1,020
analysis, of examining progressive changes in the de- patients with pIA-pIB), the presence or absence of
pendent variable (survival), depending on the levels of visceral pleural involvement does not modify prog-
the independent variable (tumor size), enabling delim- nosis in the different pathologic tumor size strata.
itation of critical borderlines in which substantial For instance, survival at 3 years for tumor groups A,
changes in such dependent variable may occur. B, C, and D (Table 1) was 0.83, 0.72, 0.61, and 0.42,
Our study may have certain limitations and a respectively, if there was no visceral pleural involve-
specific reproducibility problem attached to it. The ment. If, however, there was visceral pleural involve-
pathologic tumor size was obtained by measuring the ment, survival at 3 years for the same groups was
0.93, 0.68, 0.60, and 0.51, respectively. Other
groups5,32 report similar experiences. Other classifi-
catory or definer components for T2, such as proxi-
mal bronchial involvement, do not appear to add any
prognostic value to tumor size.25
Our population may be regarded as representative
of NSCLC in stage pIA-pIB with complete resection
in Spain in view of the multi-institutional nature of
the GCCB-S, the magnitude of our sample, and
quality controls undertaken. Nonetheless, given that
the majority of our patients in our study were male
with an epidermoid type of tumor, with scarce
presentation of adenocarcinoma, and infrequent
bronchioalveolar carcinomas, extrapolating our expe-
rience to other communities (the United States or
Japan) might be somewhat problematic.
Based on our criteria, and on the data shown in the
evaluation of clinical tumor size for a surgical popu-
lation and for pathologic tumor size, the prognostic
Figure 2. Survival in NSCLC in stage pIA-B with complete
resection (n ⫽ 1,020) according to pathologic (p) tumor size. groups observed must be taken into account when
cum ⫽ cumulative. evaluating any new potential prognostic factor (bio-

1518 Clinical Investigations

logical, clinical, molecular, etc.) or when designing 2 Sobin LH, Wittekind Ch. TNM classification of malignant
stratification criteria in clinical trials in which pa- tumors. UICC International Union Against Cancer. 5th ed.
New York, NY: Wiley-Liss, 1997
tients with initial tumor stages take part. In some
3 Gospodarowicz MK, Henson DE, Hutter RVP, et al. Prog-
studies on new prognostic factors, multivariate anal- nostic factors in cancer, 2nd ed. New York, NY: Wiley-Liss,
ysis only looks at tumor size as either ⬎ 3 cm or ⬍ 3 2001
cm,33 or as T1-T2.34 New assessments that take the 4 López-Encuentra A, Bülzebruck H, Feinstein AR, et al.
new prognostic spectrum of tumor size into account Tumor staging and classification in lung cancer. Lung Cancer
may or may not confirm the independent value of 2000; 29:79 – 83
5 Buccheri G, Ferrigno D. Prognostic value of stage grouping
these new factors. and TNM descriptors in lung cancer. Chest 2000; 117:1247–
As previously discussed, prognostic accuracy im- 1255
proves when a more discriminative staging is per- 6 Bronchogenic Carcinoma Cooperative Group of the Spanish
formed using TNM descriptors instead of stages.5 This Society of Pneumology and Thoracic Surgery (GCCB-S).
improvement in prognostic discrimination also occurs, Clinical tumor size and prognosis in lung cancer. Eur Respir
J 1999; 14:812– 816
as shown in our study, when a classificatory component 7 Riquet M, Manach D, Le Pimpec-Barthes F, et al. Prognostic
(such as tumor size) is examined in greater detail. value of T and N in non-small cell lung cancer three
In conclusion, this multi-institutional study, con- centimeters or less in diameter. Eur J Cardiothorac Surg
ducted by the GCCB-S on NSCLC cases with 1997; 11:440 – 443
complete resection, did not find the 3-cm value to be 8 Watanabe Y, Murakami S, Oda M, et al. Tumor size and
extension of lymph node metastases in N2 lung cancer. Ann
a prognostic threshold. The study did, however, Ital Chir 1999; 70:889 – 892
identify four prognostic groups with different tumor 9 Graham AN, Chan KJ, Pastorino U, et al. Systematic nodal
sizes within initial pIA-IB stages. dissection in the intrathoracic staging of patients with non-
small cell lung cancer. Thorac Cardiovasc Surg 1999; 117:
246 –251
10 Saito M, Nakamura H, Hiyoshi T, et al. Lymph node status of
Appendix: the GCCB-S
small lung cancers 2.0 cm or less in size [abstract]. Lung
Coordinators: José Luis Duque, MD (Hospital Universitario, Cancer 2000; 29(suppl 2):141
Valladolid); Angel López-Encuentra, MD (Hospital Universitario 11 Grupo Cooperativo de Carcinoma Broncogénico de SEPAR
12 de Octubre, Madrid); Ramón Rami-Porta, MD (Hospital (GCCB-S): cirugı́a del carcinoma broncogénico en España;
Mutua de Terrassa, Barcelona). estudio descriptivo. Arch Bronconeumol 1995; 31:303–309
Local representatives: Julio Astudillo, MD (Hospital Germans 12 López Encuentra A. Criteria of functional and oncological
Trias i Pujol, Barcelona); Emilio Canalı́s, MD; José Belda, MD operability in surgery for lung cancer: a multicenter study.
(Hospital Clinic, Barcelona); Antonio Cantó, MD; Antonio Ar- The Bronchogenic Carcinoma Cooperative Group of the
nau, MD (Hospital Clı́nico, Valencia); Juan Casanova, MD; Spanish Society of Pneumology and Thoracic Surgery
Manuel Mariñan, MD (Hospital de Cruces, Bilbao); Jorge (GCCB-S). Lung Cancer 1998; 20:161–168
Cerezal, MD; José Marı́a Matilla, MD (Hospital Universitario, 13 American Thoracic Society. Clinical staging of primary lung
Valladolid); Antonio Fernández de Rota, MD; Ricardo Arrabal, cancer. Am Rev Respir Dis 1983; 127:659 – 664
MD (Hospital Carlos Haya, Málaga); Federico González Ara- 14 Wittekind CH, Henson DE, Hutter RVP, et al. UICC TNM
goneses, MD; Nicolás Moreno, MD (Hospital Gregorio Mara- supplement: a commentary on uniform use. 2nd ed. New
ñón, Madrid); Jorge Freixinet, MD; Pedro Rodrı́guez, MD York, NY: Wiley-Liss, 2001
(Hospital Nuestra Señora del Pino, Las Palmas); Nicolás Llobre- 15 Izbicki JR, Passlick B, Karg O, et al. Impact of radical
gat, MD, (Hospital Universitario del Aire, Madrid); Nuria Mañes, systematic mediastinal lymphadenectomy on tumor staging in
MD (Fundación Jiménez Dı́az, Madrid); Miguel Mateu, MD; lung cancer. Ann Thorac Surg 1995; 59:209 –214
Guadalupe González Pont, MD (Hospital Mutua de Terrassa, 16 Mountain CF. Revisions in the international system for
Barcelona); José Luis Martı́n de Nicolás, MD (Hospital Univer- staging lung cancer. Chest 1997; 111:1710 –1717
sitario 12 de Octubre, Madrid); Nuria Novoa, MD (Complejo 17 Patz EF, Rossi S, Harpole DH, et al. Correlation of tumor
Hospitalario, Salamanca); Jesús Rodrı́guez, MD (Complejo Hos- size and survival in patients with stage IA non-small cell lung
pitalario, Oviedo); Antonio José Torres Garcı́a, MD (Hospital cancer. Chest 2000; 117:1568 –1571
Universitario San Carlos, Madrid); Mercedes de la Torre, MD 18 Hessel P. Terminal digit preference in blood pressure mea-
(Hospital Juan Canalejo, La Coruña); Abel Sánchez-Palencia, surements: effects on epidemiological associations. Int J
MD; Ruı́z Zafra, MD (Hospital Virgen de las Nieves, Granada); Epidemiol 1986; 15:122–125
Andrés Varela de Ugarte, MD; Pablo Gamez, MD (Clı́nica 19 Bennett S. Blood pressure measurement error: its effects on
Puerta de Hierro, Madrid); Yat Wah Pun, MD (Hospital de la cross-sectional and trend analyses. J Clin Epidemiol 1994;
Princesa, Madrid). 47:293–301
Data analysis: Agustı́n Gómez de la Cámara, MD; Francisco 20 Schoenfeld DA. Analysis of categorical data: logistic model.
Pozo Rodrı́guez, MD; Paloma Ferrando, MSc (Hospital Univer- In: Mike V, Stanley KE, eds. Statistics in medical research.
sitario 12 de Octubre, Madrid). New York, NY: Wiley, 1982; 443– 454
21 Cox DR. Regression models and life table. J R Stat Soc 1972;
34:187–220
22 Hastings RP. Supplementary library user’s guide. Cary, NC:
References SAS Institute, 1986; 437– 466
1 Mountain CF, Carr DT, Anderson WA. A system for the 23 Nesbitt JC, Putnam JB, Walsh GL, et al. Survival in early-
clinical staging of lung cancer. AJR Am J Roentgenol Radium stage non-small cell lung cancer. Ann Thorac Surg 1995;
Ther Nucl Med 1974; 120:130 –138 60:466 – 472

[Link] CHEST / 121 / 5 / MAY, 2002 1519

24 Patz EF, Goodman PC, Bepler G. Screening for lung cancer. 30 Bouchardy CH, Fioretta G, De Perrot M, et al. Determinants
N Engl J Med 2000; 343:1627–1633 of long term survival after surgery for cancer of the lung: a
25 Padilla J, Calvo V, Peñalver JC, et al. Surgical results and population-based study. Cancer 1999; 86:2229 –2237
prognostic factors in early non-small cell lung cancer. Ann 31 Jefferson MF, Pendleton N, Faragher EB, et al. “Tumor
Thorac Surg 1997; 63:324 –326 volume” as a predictor of survival after resection of non-small-
26 Black WC. Unexpected observations on tumor size and survival cell lung cancer. Br J Cancer 1996; 74:456 – 459
in stage IA non-small cell lung cancer. Chest 2000; 117:1532– 32 Deslauriers J, Grégoire J. Surgical therapy of early non-small
1534 cell lung cancer. Chest 2000; 117:104S–109S
27 Reich J. Hazards of lung cancer screening. Chest 2001; 33 Ahuja V, Coleman RE, Hendon J, et al. The prognostic
119:659 – 660
significance of fluorodeoxyglucose positron emission tomog-
28 Watanabe Y, Shimizu J, Oda M, et al. Proposals regarding some
deficiencies in the new international staging system for non- raphy imaging for patients with non-small cell lung carci-
small cell lung cancer. Jpn J Clin Oncol 1991; 21:160–168 noma. Cancer 1998; 83:918 –924
29 Lacasse Y, Bucher HC, Wong E, et al. “Incomplete resection” in 34 Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity
non-small cell lung cancer: need for a new definition. Canadian as a prognostic indicator in stage I non-small cell lung cancer.
Lung Oncology Group. Ann Thorac Surg 1998; 65:220–226 Clin Cancer Res 1999; 5:2077–2081

1520 Clinical Investigations

 Copyright # ERS Journals Ltd 1999
Eur Respir J 1999; 14: 812–816 European Respiratory Journal
Printed in UK – all rights reserved ISSN 0903-1936

Clinical tumour size and prognosis in lung cancer

Bronchogenic Carcinoma Cooperative Group of the Spanish Society of

Pneumology and Thoracic Surgery (GCCB-S)

Clinical tumour size and prognosis in lung cancer. Bronchogenic Carcinoma Cooperative Correspondence: A. López-Encuentra
Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). #ERS Pneumology Service
Journals Ltd 1999. Hospital Universitario 12 de Octubre
Ctra. de Andalucá, km 5,4
ABSTRACT: In the staging of lung cancer (LC), tumour size is a variable that can be E-28041 Madrid
used to separate primary tumour, regional nodes, metastasis (TNM), stages T1 and T2 Spain
(<3 or >3 cm). The objective of this study was to evaluate the prognostic value of Fax: 34 913908358
tumour size before thoracotomy and to determine whether tumour size can be used to
classify LC as T3. Keywords: Cohort study
This multi-institutional cooperative longitudinal prospective study in Spanish lung neoplasm
hospitals located throughout the country, with a broad range of activity levels, registry
included all consecutive cases of LC treated surgically from October 1993 to staging
September 1996 (n=2,361). TNM classification
tumour size
Four prognostic groups, characterized by tumour size, were identified according to
the Schoenfeld procedure: a) 0–2 cm (n=173); b) 2.1–4 cm (n=542); c) 4.1–7 cm (n= Received: January 19 1999
413); and d) >7 cm (n=77). The 2-yr survival rates by group were a=0.78 (95% confi- Accepted after revision May 15 1999
dence interval (CI) 0.71–0.84); b=0.67 (95% CI 0.62–0.71); c=0.58 (95% CI 0.53–0.63);
d=0.41 (95% CI 0.29–0.52). The log-rank comparisons of the survival curves were This work was partly financed by FIS
significant for the four groups (a versus b=0.0008, b versus c=0.003, c versus d=0.016). grant (97/0011), FEPAR-PENSA 1995
The clinical tumour size of lung cancer defined four prognostic groups (0–2 cm, 2.1– grant, and financial aid from the Castilla-
4 cm, 4.1–7 cm; and >7 cm). Lung cancer with a diameter >7 cm had a prognosis León government and Menarini Foun-
dation.
similar to that of stage T3 or stage IIB.
Eur Respir J 1999; 14: 812–816.

In Spain, the incidence and mortality of lung cancer analysis confirms the prognostic value of molecular fac-
(LC) have increased in recent decades [1]. tors, separately or associated, but not the prognostic value
In the initial stages (stages I–II) of non-small-cell lung of the surgical-pathologicaltumour size classification [9].
cancer (NSCLC), the therapy of choice is surgery if the One source of discrepancies in the prognostic value of
patient can tolerate lung resection. However even in these molecular factors may be the inconsistency of measure-
stages, surgery is not a guaranteed cure. Only 63.5% of ments of the fundamental prognostic factors [3], which
patients with stage I LC treated surgically survive $5 yrs are included in the classification of anatomic extension
[2]. Moreover, the results obtained for the same prog- (TNM classification stages) [10, 11].
nostic groups vary widely from one series to another; for Assuming that studies of multiple prognostic factors in
instance, reported 5-yr survival rates for primary tumour, LC are a necessary step toward improving our capability
regional nodes, metastasis (TNM) classification, T1N0M0 for predicting prognosis, each factor used to classify ana-
tumours range 68.5–83% [3]. tomic extension should be analysed independently. The
These findings suggest the need for other factors, per- most frequent category is T2, defined as a tumour >3 cm in
haps of a molecular type, to improve the accuracy of diameter (with no upper limit), with or without other
prognostic predictions and to establish the most suitable circumstances (proximity to a main bronchus, visceral
adjuvant therapies [4]. However, in spite of the initially pleural invasion, atelectasis or pneumonitis involving less
promising results that have been obtained in initial LC than a whole lung). The validation or correction, if nec-
with factors other than the TNM classification, subseq- essary, of the data that sustain anatomic classifications is
uent studies have failed to confirm the reproducibility of the first goal in the construction of multifactorial prog-
these factors as prognostic markers [5]. In recent studies nostic indexes [12]. As noted by a consensus group of the
of resected NSCLC, certain molecular markers and tumour International Association for the Study of Lung Cancer
size have shown a similar prognostic value in multivariate (IASLC), the construction of prognostic scales in LC
analysis [6, 7]. In other studies of stage IIIA tumours with using data collected before 1980 may yield questionable
complete resection, univariate analysis shows that tumour results [12]. Therefore, the IASLC has appointed a
size is not an independent prognostic factor for survival staging group to consider, among other questions, "con-
when using a cut-off value of 4 cm, but variables such as firmation of the prognostic independence of size in T2 (3
angiogenesis are [8]. In patients with NSCLC undergoing cm versus 4 cm versus 5 cm, etc) in cases of resectable
surgery with intent to cure (stages I–IIIA), univariate NSCLC" [12].
 TUMOUR SIZE AND PROGNOSIS IN LUNG CANCER 813

The goal of this study was to evaluate the prognostic Table 2. – Initial total number of patients and exclusions
value of clinical tumour size. It was determined whether for each study year
various cut-off values for tumour diameter, in the absence 1993–94 1994–95 1995–96 Total
of either visceral pleural involvement or other anatomic
factors justifying a higher T classification, or metastases to Patients registered 718 822 821 2361
lymph nodes or at a distance, could be an independent Surgical mortality 51 62 75 188
prognostic factor for classifying tumours as higher tumour Induction treatment 42 31 38 111
(T) (T3) or stage classification in the clinical phase before Loss of follow-up 13 94 96 203
thoracotomy. Final population 610 634 611 1859

Material and methods conditions were met by 1,205 cases, which included in-
complete resections and exploratory thoracotomies bec-
Study subjects ause these particular conditions were not known at the
time of the "clinical phase" analysis before thoracotomy.
All the patients included in the study had lung cancer
in initial stages and underwent thoracotomy with intent Methods
to cure in hospitals pertaining to the Bronchogenic Car-
cinoma Cooperative Group of the Spanish Society of In accordance with the initial design, the period of case
Pneumology and Thoracic Surgery (GCCB-S) [13]. The recruitment was short. The same criteria for the functional
population characteristics are described in table 1. In operability of patients and oncological operability of the
summary, the authors prospectively included all patients tumour were used in all the GCCB-S hospitals [15].
treated surgically from October 1993 to September 1996 Each variable recorded in the registry was accompanied
in hospitals participating in the GCCB-S who presented by the diagnostic procedure used for its classification.
the clinical picture that defined the initial population When several procedures were used, the procedure with
(table 1) [13]. The annual cumulative number of cases the best resolution was chosen. Depending on the charac-
was close to 50% of total cases occurring in Spain. The teristics of the tumour, clinical tumour size was established
participating GCCB-S centres had a wide variety of acti- using a chest radiograph or computerized axial tomogra-
vities, including a representative range of number of phy (CAT); for instance, in vertical diameters, a radiograph
beds, teaching or research activities (university and non- may, in some patients, prove to be more reliable than CAT.
university hospitals), public and private ownership, and For other characteristics, for example, the classification of
number of interventions per year (8–100 interventions clinical N2 involvement, CAT or mediastinoscopy was
were performed in participating centres for this disease). used and the procedure was recorded in the registry. The
The sample was complete, as verified by the inclusion in degree of certainty of the TNM-stages classification de-
the registry of all patients undergoing surgery, including pends on the diagnostic methods used. According to some
incomplete resections and exploratory thoracotomy. international organizations, postmortem study yields the
Table 2 shows the initial total number of patients and maximum certainty factor and the clinical findings yield
exclusions for each study year. Death due to operative the minimum certainty factor [10].
mortality has been excluded. The final number of cases The clinical classification of isolated involvement of the
included in the study of prognostic factors was 1,859. visceral pleura is considered certain only if it is verified by
For the study of clinical tumour size as a prognostic a validated procedure (thoracoscopy). The classification of
factor, the cases classified as T1 or T2 without involvement clinical N0 requires, as a minimum, the absence of lymph
of the visceral pleura, regional lymph nodes (with classi- node involvement of >1 cm in diameter in areas 4, 7, and
ficatory certainty) (see Methods section), or metastases at a 10 in CAT or magnetic resonance imaging (MRI), or the
distance were considered. Within the T2 criteria, proximity presence of negative mediastinoscopy in these zones [16].
to the main bronchus was not considered to be an exclusion For the clinical N1 classification, cytohistological cert-
factor in this study because of its low probability of mo- ainty is based on transbronchial fine needle aspiration
difying the prognosis [14]. Although a correct multivariate biopsy (FNAB) or hilioscopy, and none of the patients in
analysis of all the cases should control the prognostic these series underwent these tests. To confirm the pre-
value of tumour size using other T or nodal (N) factors, it sence of clinical N2, cytohistological certainty obtained
was considered more appropriate to avoid contaminating by transbronchial,transthoracic or transesophagealFNAB,
the results with data from more advanced tumours. These by mediastinoscopy-mediastinotomy,or by thoracoscopy
is required.
Table 1. – Population characteristics Surgical-pathological N0 is classified by radical me-
diastinal lymph node dissection or sampling of at least four
Clinical situation index
Bronchogenic carcinoma
lymph node areas (2 (only in right LC), 4, 7, and 10 on the
Initial stages same side as the tumour) [16]. For the purpose of clas-
Thoracotomy sifying the presence or absence of mediastinal lymph
Sample attributes node involvement, a randomized study has demonstrated
Representativity that sampling has a value similar to that of radical
Completeness mediastinal lymph node dissection [17].
Exclusion criteria Internal and external audits were made firstly to review
Operative mortality the ratio between the number of patients undergoing sur-
Neoadjuvant treatment with surgery gery and the number of cases included in the registry
Unknown evolution since surgery (standard over 95%) and secondly, to review the validity
814 GCCB-S

of the data recorded for each case (standard >70%), in- 1

cluding the consistency of tumoural staging. The criterion
for the validity of the survival data was established as the
existence of a known follow-up for $85% of the cases
registered in each hospital [18]. In the hospitals that did
not meet all these conditions, the cases corresponding to

Survival
the period of problems were excluded. Finally, correct 0.5
data transmission by a single central office from the paper
record to the computer database was verified.
These procedures were designed to control the follow-
ing aspects: selection bias of surgical cases; registered
cases out of the total number of surgical cases; sample size;
type of hospital; prognostic migration due to the prolonged 0
period of case recruitment; classification with low or 0 12 24 36
deficient degrees of certainty; contamination by data from Months after treatment
incomplete series or erroneous data, and loss of long-term
Fig. 1. – Cumulative probability of survival after treatment according to
follow-up. clinical tumour size; : 0–2 cm in diameter; – – – : 2.1–4 cm; - - - : 4.1–7
cm; – - – - : >7 cm. Operative deaths are excluded.
Analysis
The Schoenfeld procedure [19] was used to identify Clinical tumour size
intervals of tumour size related with specific survival
outcomes. In this procedure, the continuous variable of Mean tumour size before thoracotomy in the 1,205 clas-
tumour size was reclassified arbitrarily into intervals or sified cases was 4.24 cm (SD 1.97; median 2.4 cm; range
unit segments (centimetres in this case) with suspected 0.5–15 cm). In these 1,205 cases categorized as T1–T2
clinical significance. A series of consecutive and over- without visceral pleural involvement, N0 metastasis (M0),
lapping segments was generated and its correlation with 12-month survival was 0.78 (95% CI 0.76–0.80) and 24-
survival was confirmed statistically using the Cox pro- month survival was 0.63 (95% CI 0.60–0.66).
portional risk procedure [20], which revealed the mag- Using the Schoenfeld procedure [19], the Cox method
nitude of the relative risk for each stratum. [20] several cut-off values of tumour size were deter-
The 2-yr and 3 yr survival of the resulting prognostic mined and selected on the basis of survival. Four tumour
groups was anaysed and 95% confidence intervals (CI) size intervals, generally 2–7 cm (table 3) were found.
were calculated using life tables (actuarial survival) and Each interval increased the risk of death by 50.8%, with
log-rank comparisons of survival curves. Statistical sig- respect to the previous stratum; the different intervals
nificance was adjusted using the Bonferroni correction for showed increases of the same magnitude in the 2-yr and
paired comparisons between strata [21]. 3-yr survival analysis. In this study, 3 cm was not a cut-
off value for tumour size between prognostic categories.
Results The tumour-size groups had short-term survivals (1–2
Population characteristics yrs after surgery), showing statistically significant differ-
ences (table 3). At 3 yrs the statistical differences between
The mean age of the studied population for the purpose the four groups were maintained (log-rank =0.0002,
of examining clinical tumour size in relation to prognosis 0.009, 0.002, respectively) (fig. 1).
was 63.4±11 yrs (SD). The clinical tumour type was
epidermoid in 526 patients (44%), adenocarcinoma in 306 Discussion
(25%), large cell carcinoma in 185 (15%), unclassified
carcinoma (non-small cell) in 180 (15%), and small-cell in The goal of the study was to analyse the prognostic
8 patients (1%). Tumour size in small-cell lung cancer value of clinical tumour size (as determined by radiology)
ranged 1.5–4 cm. Ninety per cent of the patients were of LC, independently of other factors, in initial clinical
male. Exploratory thoracotomy was performed in 161 (c)T1–T2 stages without invasion of local structures
patients (13%), lobectomy or bilobectomy in 744 patients (visceral pleura), involvement of regional lymph nodes,
(62%), pneumoectomy in 270 (22%), and segmentectomy, or distant metastases. Apart from being helpful in other
atypical resection, or a combination of procedures in the areas, such information is perceived to be a valuable tool
rest of the patients in quantifying the magnitude of benefit of the surgical

Table 3. – Prognostic groups and survival defined by clinical tumour size in relation to risk of death*
Group Size n Risk ratio 2 yrs S1 S2 Log-rank
diameter in cm 95% CI 95% CI 95% CI

a 0–2 173 1 0.90 (0.86–0.95) 0.78 (0.71–0.84) 0.0008

b 2.1–4 542 1.9 (1.3–2.7) 0.82 (0.79–0.86) 0.67 (0.62–0.71) 0.003
c 4.1–7 413 2.6 (1.8–3.7) 0.72 (0.68–0.76) 0.58 (0.53–0.63) 0.016
d >7 77 3.9 (2.5–6.2) 0.62 (0.51–0.73) 0.41 (0.29–0.52)
Data are presented as absolute number with 95% confidence intervals in parentheses. *: according to the procedure of SCHOENFELD [19].
The risk ratio was calculatedaccording to the Cox method [20]; S1: cumulative probabilityof survival at 1 yr; S2: cumulative probabilityof survival
at 2 yrs.
 TUMOUR SIZE AND PROGNOSIS IN LUNG CANCER 815

treatment with regard to risk. The study comprised a large technology. The prognostic value of tumour size has been
series of recent cases collected over a short time period. studied for many years [23–25]. In 1974, the first TNM
The study was multi-institutional and representative of classification was described after an evaluation of more
cases of LC treated surgically in Spain, with an initial than 300 curves and survival tables for 2,155 patients
design conceived to control the usual bias in prognostic treated in the previous 4 yrs [26], which has conserved its
and/or therapeutic studies. These aspects of the methodol- basic structure until the present. One criterion that has not
ogy are particularly important in view of the variations in changed is the tumour size used to differentiate the T1
survival reported by different series for the same prog- and T2 categories, which has a cut-off value of 3 cm. In
nostic categories of LC [3]. fact, T3, as described in 1974, has undergone more
The analysis found four groups of clinical tumour sizes modifications as a result of the prognostic stratification of
related to risk of death: 0–2 cm; 2.1–4 cm; 4.1–7 cm; and its internal variables. However, T2 has not changed sub-
>7 cm. The 3 cm value was not confirmed as a prognostic stantially other than to incorporate visceral pleural in-
separator in staging by the current study. The short-term volvement. In a recent publication of prognostic data,
survival (1–2 yrs) after surgery in the group of patients which largely sustains the new tumoural classification of
with tumours >7 cm in diameter is similar to that of TNM anatomic extension of 1997 [22], ~7,000 cases were
anatomic classifications and/or stages superior to T2/IB evaluated, of which >5,000 cases were collected after
(table 4). For LC >7 cm in diameter, the 2-yr probability 1975 and almost 4000 cases were evaluated before CAT
of survival is closer to that of cT3N0M0 or cT2N1M0, or was introduced in 1982.
stage cIIB [22], than to the survival of the category in As shown in table 4, the prognostic significance of
which it theoretically belongs, cT2N0M0 (2-yr survival tumours >7 cm is similar to that of TNM groups or more
probability: 0.54) [22]. advanced clinical stages. Compared with other recent
When evaluating these results, the univariate nature of experiences (2,382 resected NSCLC), the probability of
the study, which excluded other LC groups from analysis, survival at 2 yrs calculated by the GCCB-S for tumours
should be emphasized. These other LC groups, might, in >7 cm in diameter was similar to that of stage IIIA (T.
multivariate analysis, demonstrate the independent prog- Naruke, National Cancer Centre, Tokyo, Japan; personal
nostic value of tumour size, even in the presence of more communication, 1997). Some groups have recommended,
advanced tumour classification conditions. in the light of survival data, that LC >5 cm in diameter be
The comparison of the present data with a recently classified as a higher category of T2 (stage IB) or by
published study of survival using the TNM-staging classi- creating a new category, T2bN0M0, within stage II [24].
fication [22] is appropriate because its prognostic data In recent literature, cases of LC treated by surgical
was used for the elaboration of the new 1997 classifica- resection in Spain show significant prognostic differences
for small variations in tumour size: for example, between
tion [11], (data is reported in clinical and/or surgical-
two groups of tumours <3 cm (0–2 cm versus 2–3 cm)
pathological categories on a yearly basis for 5 yrs), and
found in a population of 154 T1N0M0 patients had signi-
also because it includes small-cell LC in cT1-2N0M0
ficantly different 5- and 10-yr prognoses after surgery [14].
(3.8% in their series [22]) and excludes cases of surgical
In initial stages of LC in functionally inoperable patients
mortality that occurred in the first 30 days after surgery. who were treated by irradiation, different survival levels
However, it is not clear if thoracotomy with incomplete (considering only LC-specific mortality) have been det-
resection and exploratory thoracotomy are included in the ected for different tumour-size cut-off values. The 3-yr
data relative to the clinical phase and the surgical- survival rate was 30% for tumours >3 cm, 17% for 3–6 cm,
pathological classification. and 0% for tumours >6 cm (only 9 cases) [27].
Each prognostic category of the TNM classification (T1, Prognostic results vary for initial lung cancer stages
T2, N2, etc) contains distinct internal components (tumour when the variable tumour size is controlled, even when
size, atelectasis, invasion of specific neighbouring struc- restricted to T1-2N0M0 groups. This may be due to the
tures). In theory, each component should be analysed in- presence of other variables contained within T1 or T2 [10],
dependently so that, after a correct classification has been to biological-molecular factors [4], or to association with
made, their prognostic value in relation to different sur- other diseases [28]. With regard to comorbidity, a large
vival times can be determined. percentage of patients with initial stages of LC die from
Of the components making up each prognostic category, associated disease [27, 28].
the first factor evaluated by the GCCB-S was tumour size. This study has certain limitations, the first of which is
This variable has a high level of classificatory certainty that the absence of internal validation. The study population is
is attainable with simple, universally available methods described herein, but not the validation population, which
(chest radiograph or thoracic CAT); no prognostic mig- has not yet been evaluated because it was recruited in the
ration is expected as a result of advances in diagnostic final year (1996–1997). Another limitation is that the data
correspond to a short follow-up period (2 yrs), although
Table 4. – Prognostic equivalence between some clinical ideally the final analysis time in LC should be 10 yrs.
tumour sizes and the new tumour classification (1997) However, values obtained at 1, 2 and 3 yrs and the survival
First author [Ref] Category n 2-yr curves are fundamental for responsible decision-making by
survival the physician and patient [29].
Given the current possibilities for obtaining homogene-
Present author T >7 cm, N0, M0 77 0.41 ous populations and using homogeneous study methods,
MOUNTAIN [22] T3, N0, M0 107 0.37 and the current ease of information exchange, a process of
MOUNTAIN [22] T2, N1, M0 250 0.42 convergence among databases throughoutthe world should
MOUNTAIN [22] IIB 357 0.41
be started and their compatibility studied. This would lead
816 GCCB-S

to larger and more representative sample sizes; which ted late stage lung carcinoma (stage IIIA-N2). Cancer
would probably improve prediction and prognostic accu- 1996; 78: 409–415.
racy. This measure is considered necessary and is defended 9. Dosake-Akita H, Hu SX, Fujimo M, et al. Altered
as a major research challenge in lung cancer by the In- retinoblastoma protein expression in non-small cell lung
ternational Association for the Study of Lung Cancer [12], cancer. Cancer 1997; 79: 1329–1337.
which proposes to "collect and review existing databases 10. Sobin LH, Wittekind Ch. UICC International Union
of cooperative groups and other institutions in order to Against Cancer, TNM Classification of malignant tumors.
validate clinical primary tumour, regional nodes, metas- Fifth edition. New York, Wiley-Liss, 1997.
tasis" in non-small-cell lung cancer. 11. American Thoracic Society/European Respiratory Soc-
iety. Pretreatment evaluation of non-small-cell lung can-
cer. Am J Respir Crit Care Med 1997; 156: 320–332.
Bronchogenic carcinoma cooperative group of the Spa- 12. Ginsberg R, Cox J, Green M, et al. Staging Classification
nish society of pneumology and thoracic surgery Committee Consensus report. Lung Cancer 1997; 17:
Coordinators: J. Luis Duque (Hospital Universitario, Vallado- Suppl. 1, 11–13.
lid); A. López Encuentra (Hospital Universitario 12 de Octubre, 13. Grupo Cooperativo de Carcinoma Broncogénico de
Madrid); R. Rami Porta (Hospital Mutua de Terrassa, Barcelona). SEPAR (GCCB-S). Cirugá del carcinoma broncogénico
Local representatives: J. Astudillo (Hospital Germans Trias i en España. Estudio [Link] Bronconeumol1995;
Pujol, Barcelona); E. Canalś, J. Belda (Hospital Clinic, Barce- 31: 303–309.
lona); A. Cantó, A. Arnau (Hospital Clńico, Valencia); J. Casan- 14. Padilla J, Calvo V, Peñalver JC, Sales G, Morcillo A.
ova, M. Mariñan (Hospital de Cruces, Bilbao); J. Cerezal, F. Surgical results and prognostic factors in early non-small
Heras (Hospital Universitario, Valladolid); A. Fernández de Rota, cell lung cancer. Ann Thorac Surg 1997; 63: 324–326.
R. Arrabal (Hospital Carlos Haya, Málaga); F. González Arago- 15. López Encuentra A and the Bronchogenic Carcinoma
neses, N. Moreno (Hospital Gregorio Marañón, Madrid); J. Cooperative Group of the Spanish Society of Pneumo-
Freixinet, P. Rodrǵuez Suarez (Hospital Nuestra Señora del Pino, logy and Thoracic Society (GCCB-S). Criteria of functio-
Las Palmas); N. Llobregat, J. Antonio Garrido (Hospital Uni- nal and oncologicaloperability in surgery for lung cancer.
versitario del Aire, Madrid); N. Mañes, J.M. Garcá Prim (Fun- A multicenter study. Lung Cancer 1998; 20: 161–168.
dación Jiménez Dáz, Madrid); M. Mateu, E. Barbeta Sanchez 16. American Thoracic Society. Clinical staging primary lung
(Hospital Mutua de Terrassa, Barcelona); J. Luis Martń de cancer. Am Rev Respir Dis 1983; 127: 1–6.
Nicolás, C. Marrón (Hospital Universitario 12 de Octubre, Ma- 17. Izbicki JR, Passlick B, Karg O, et al. Impact of radical
drid); N. Novoa (Complejo Hospitalario, Salamanca); J. Rod- systematic mediastinal lymphadenectomy on tumor stag-
rǵuez, F.A. de Linera (Complejo Hospitalario, Oviedo); A. José ing in lung cancer. Ann Thorac Surg 1995; 59: 209–214.
Torres Garcá, A. Gómez (Hospital Universitario San Carlos, 18. Grupo Cooperativo de Carcinoma Broncogénico de
Madrid); J. José Rivas, M. de la Torre (Hospital Juan Canalejo, La SEPAR (GCCB-S). Control de calidad en un registro
Coruña); A. Sanchez-Palencia, F. Javier Ruiz Zafra (Hospital multiinstitucional de carcinoma broncogénico. Arch
Virgen de las Nieves, Granada); A. Varela Ugarte, P. Gamez Bronconeumol 1996; 32: Suppl. 2, 70.
(Clńica Puerta de Hierro, Madrid); Y. Wah Pun (Hospital de la 19. Schoenfeld DA. Analysis of categorical data: logistic
Princesa, Madrid). Data analysis: P. Ferrando, A. Goméz de la model. In: Mike and Stanley KE, eds. Statistics in Me-
Cámara (Unidad de Epidemiologá Clńica, Hospital Universitario dical Research. New York, Wiley, 1982; pp. 433–454.
12 de Octubre, Madrid). 20. Cox DR. Regression models and life table. J R Stat Soc
1972; 34: 187–220.
21. Hastings RP. Supplementary library user’s guide. Cary,
References NC, USA, SAS Institute, 1986; 437–466.
1. Izarzugaza Lizarraga I. El cáncer de pulmón en España. 22. Mountain CF. Revisions in the International System for
Revisión epidemiológica. Arch Bronconeumol 1992; 28: staging lung cancer. Chest 1997; 111: 1710–1717.
311–319. 23. Soorae AS, Abbey-Smith R. Tumor size as a prognostic
2. Mountain CF. A new internationalstaging system for lung factor after resection of lung carcinoma. Thorax 1977; 32:
cancer. Chest 1986; 89: Suppl. 4, 225–233. 19–25.
3. Nesbitt JC, Putnam JB, Walsh GL, Roth JA, Mountain 24. Watanabe Y, Shimizu J, Oda M, et al. Proposals regarding
CF. Survival in early-stage non-small cell lung cancer. some deficiencies in the new international staging system
Ann Thorac Surg 1995; 60: 466–472. for non-small cell lung cancer. Jpn J Clin Oncol 1991; 21:
4. Hermanek P, Gospodarowicz MK, Henson DE, Hutter 160–168.
RVP, Sobin LH. Prognostic factors in cancer, 1st Edn. 25. Strauss GM. Prognostic markers in resectable non-small
Berlin, Springer-Verlag, 1995. cell lung cancer. Hemat Oncol Clin North Am 1997; 11:
5. Pastorino U, Andreola S, Tagliabue E, et al. Immuno- 409–434.
cytochemical markers in stage I lung cancer: relevance to 26. Mountain CF, Carr DT, Anderson WAD. A system for the
prognosis. J Clin Oncol 1997; 15: 2858–2865. clinical staging of lung cancer. Am J Roentg Rad Ther
6. Fontanini G, Lucchi M, Vignati S, et al. Angiogenesis as Nucl Med 1974; 120: 130–138.
a prognostic indicator of survival in non-small-cell lung 27. Sandler HM, Curran WJ, Turrisi III AT. The influence of
carcinoma: a prospective study. J Natl Cancer Inst 1997; tumor size and pre-treatment staging on outcome follow-
89: 881–886. ing radiation therapy alone for stage I non-small cell lung
7. Apolinario RM, Van-der-Valk P, de Jong JS, et al. Prog- cancer. Int J Radiat Oncol Biol Phys 1990; 19: 9–13.
nostic value of the expression of p53, bc1–2, and bax 28. Pastorino U, Valente M, Bedini U, et al. Effect of chronic
oncoproteins, and neovascularization in patients with ra- cardiopulmonary disease on survival after resection for
dically resected non-small-cell lung cancer. J Clin Oncol stage Ia lung cancer. Thorax 1982; 37: 680–683.
1997; 15: 2456–2466. 29. Mazur DJ, Hickam DH. Five-year survival curves: How
8. Angeletti CA, Lucchi M, Fontanini G, et al. Prognostic much data are enough for patient-physiciandecision mak-
significance of tumoral angiogenesis in completely resec- ing in general surgery? Eur J Surg 1996; 162: 101–104.
 APLICACIÓN DE LAS MATRICES
DE TEJIDO (“TISSUE MICROARRAYS”)
AL ESTUDIO DE LOS CARCINOMAS
DE PULMÓN NO MICROCÍTICOS
Fernando López-Ríos
Hospital Universitario 12 de Octubre
Madrid

Contenido:
Resumen de la ponencia
Bibliografía
 Aplicación de las matrices de tejido
(“tissue microarrays”) al estudio de los carcinomas
de pulmón no microcíticos
Fernando López-Ríos
Departamento de Anatomía Patológica
Hospital Universitario 12 de Octubre, Madrid

Introducción
A pesar del extendido concepto de que los carcinomas pulmonares son relativamente homogéneos
desde el punto de vista histológico, la realidad es bien distinta. En la recientemente publicada clasificación
de tumores pulmonares de la Organización Mundial de la Salud se llega a considerar que hasta el 50%
de estos tumores presentan varios tipos histológicos, lo que evidentemente dificulta su diagnóstico
anatomopatológico y, por extensión, su estudio clínico y biológico. Por tanto, la división histológica se
basa en muchas ocasiones en porcentajes, presencia de un determinado rasgo microscópico, etc., hechos
que no reflejan de forma precisa las características clínico-biológicas del tumor. Como ejemplos de esta
relativa imprecisión me gustaría referirme a los siguientes:
– Falta de consenso en los criterios del adenocarcinoma bronquioloalveolar.
– Llamativa heterogeneidad histológica en los carcinomas epidermoides, no siendo infrecuentes
los carcinomas epidermoides típicos que presentan áreas de enorme atipia y pleomorfismo.
– Utilización excesiva del diagnóstico genérico de “carcinoma de pulmón de células grandes”, al
ser éste un diagnóstico de exclusión.
Por todo lo anteriormente descrito no sorprende demasiado que el carcinoma de pulmón sea,
comparándolo con otras neoplasias y considerando su elevada frecuencia y mortalidad (más de 1 millón
de muertes anuales, supervivencia a los 5 años de un 10%), relativamente desconocido desde el punto
de vista anatomopatológico y biológico.

Las matrices de tejido (“tissue microarrays”)(1-7)

La idea de estudiar muchos tejidos simultáneamente en una sola sección no es nueva y data de
los años 80. Sin embargo, la técnica de las matrices de tejido (“tissue microarrays”), descrita con detalle
en 1998, permite estudiar y localizar de manera rápida y precisa muchos cilindros de tejido en una sola
sección histológica. El primer paso en la construcción de una matriz de tejido es seleccionar las áreas
de interés en los sucesivos bloques de parafina (“bloques donantes”). De las zonas marcadas se obtendrán
cilindros de tejido (mediante un aparato de precisión previsto de sondas metálicas), que se insertarán
ordenadamente en forma de matriz en un bloque vacío de parafina (“bloque receptor”). Como es
evidente el paso previo a la inserción consiste en la realización de un agujero en el bloque receptor,
que permitirá albergar el cilindro procedente del bloque donante. Las sondas utilizadas para estas
operaciones son de diámetros variables, aunque posiblemente las más usadas sean de 0,6 mm. Una vez
finalizada la matriz, el bloque de parafina puede ser utilizado con múltiples fines, principalmente estudios
inmunohistoquímicos, produciendo al menos 100 secciones. Es todavía objeto de cierto debate qué se
puede considerar representativo de una sección completa (número de cilindros del mismo caso y su

Aplicación de las matrices de tejido (“tissue microarrays”) 131

al estudio de los carcinomas de pulmón no microcíticos
diámetro). La heterogeneidad intratumoral no parece ser un obstáculo para el uso de matrices de
tejido; como regla general cada tumor debe ser incluído al menos en duplicado, y es fundamental una
selección muy cuidadosa de las áreas que van a ser muestreadas.
Probablemente la mayor utilidad actual de las matrices de tejido es su uso en la validación de
la información generada mediante el estudio de los perfiles de expresión génica, demostrando en la
mayoría de las ocasiones que los niveles elevados de mRNA se correlacionan con niveles elevados de
proteína, estudiada mediante inmunohistoquímica. El que esta validación, que idealmente debe de ser
realizada en una serie independiente de casos, pueda ser realizada mediante una técnica muy estandarizada
y difundida como es la inmunohistoquímica, está permitiendo explorar de forma más rápida y reproducible
las hipótesis generadas mediante el estudio de los perfiles de expresión génica.

Utilización de las matrices tisulares para el estudio del carcinoma

de pulmón no microcítico

Validación conjunta de marcadores publicados previamente de forma individual.

Esta es la aplicación más inmediata de las matrices de tejido. Por un lado, podemos en una sola sección
estudiar tumores de muy diferente histología; por otro, se pueden analizar de forma conjunta docenas
de proteínas. En este sentido, son interesantes los trabajos recientes de Au et al.(8) y de Ullmann et
al.(9) en donde analizan múltiples proteínas usando matrices de tejido, que contenían más de 100
carcinomas de pulmón no microcíticos.

Validación de la información obtenida mediante el uso de matrices de DNA.

Yang et al.(10) y Meyerson et al.(11) revisan recientemente los estudios de perfiles de expresión génica
en cáncer de pulmón. La información de algunos de ellos es pública y gratuita. Los genes identificados
pueden eventualmente ser validados mediante matrices de tejido, si ésto no ha sido ya realizado.
Cualquiera que sea el abordaje que utilicemos para seleccionar los genes de interés (y sus
correspondientes proteínas y anticuerpos de inmunohistoquímica), éstas serían algunas de las principales
aplicaciones(12-23):
– Correlación con los datos clínicos (principalmente con la supervivencia global) con el fin de
identificar marcadores con valor pronóstico.
– Diagnóstico diferencial entre subtipos histológicos o identificación de nuevas categorías dentro
de los mismos.
– Diagnóstico diferencial con otras neoplasias.
– Diagnóstico diferencial entre la neoplasia y su correspondiente parénquima no tumoral.
– Correlación con datos moleculares o citogenéticos.

132 Cáncer de pulmón

Bibliografía
1. Kononen J, Bubendorf L, Kallioniemi A, Bärlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ,
Sauter G, Kallioniemi OP. Tissue microarrays for high-throughput molecular profiling of tumor
specimens. Nat Med 1998, 4 (7): 844-847.
Descripción por vez primera de una matriz de tejido.
2. [Link]
La compañía más prestigiosa que produce matrices de tejido proporciona información útil de esta
técnica.
3. [Link]
Ejemplo de un laboratorio de referencia de matrices de tejido, en este caso el de la Universidad de
Yale.
4. Liu CL, Prapong W, Natkunam Y, Alizadeh A, Montgomery K, Gilks CB, van de Rijn M. Software
tools for high-throughput analysis and archiving of immunohistochemistry staining data obtained
with tissue microarrays. Am J Pathol 2002, 161: 1557-1565.
5. Van de Rijn M, Gilks CB. Applications of microarrays to histopathology. Review. Histopathology
2004, 44: 97-108.
6. Lakhani SR, Ashworth A. Microarray and histopathological analysis of tumours: the future and the
past? Nat Rev Cancer 2001, 1: 151-157.
7. Packeisen J, Korsching E, Herbst H, Boecker W, Buerger H. Demystified…Tissue microarray
technology. J Clin Pathol: Mol Pathol 2003; 56: 198-204.
Tres artículos generales sobre la técnica de las matrices de tejido; el primero de ellos tiene una
orientación muy anatomopatológica y explica muy bien las matrices de cDNA y su relación con las
matrices de tejido.
8. Au NHC, Cheang M, Huntsman DG, Yorida E, Coldman A, Elliott WM, Bebb G, Flint J, English J,
Gilks CB, Grimes HL. Evaluation of immunohistochemical markers in non-small cell lung cancer
by unsupervised hierarchical clustering analysis: a tissue microarray study of 284 cases and 18
markers. J Pathol 2004; 204: 101-109.
9. Ullmann R, Morbini P, Halbwedl I, et al. Protein expression profiles in adenocarcinomas and
squamous cell carcinomas of the lung generated using tissue microarrays. J Pathol 2004; 203: 798-
807.
Dos grandes series de carcinomas de pulmón no microcíticos estudiados mediante matrices de tejido.
10. Yang P, Sun Z, Aubry MC, Kosari F, Bamlet W, Endo C, Molina JR, Vasmatzis G. Study design
considerations in clinical outcome research of lung cancer using microarray analysis. Lung cancer
2004, 46: 215-226.
11. Meyerson M, Franklin WA, Kelley MJ. Molecular classification and molecular genetics of human
lung cancers. Sem Oncol 2004; 31 : 4-19.
Resumenes útiles de los principales estudios de los perfiles de expresión génica en cáncer de pulmón.
12. Sugita M, Geraci M, Gao B, et al. Combined use of oligonucleotide and tissue microarrays identifies
cancer/testis antigens as biomarkers in lung carcinoma. Cancer Res 2002, 62: 3971-3979.
13. Wikman H, Kettunen E, Seppänen JK, et al. Identification of differentially expressed genes in
pulmonary adenocarcinoma by using cDNA array. Oncogene 2002; 21: 5804-5813.

Aplicación de las matrices de tejido (“tissue microarrays”) 133

al estudio de los carcinomas de pulmón no microcíticos
14. Parmigiani G, Garrett-Mayer ES, Anbazhagan R, Gabrielson E. A cross-study comparison of gene
expression studies for the molecular classification of lung cancer. Clin Cancer Res 2004; 10: 2922-
2927.
15. Giordano TJ, Shedden KA, Schwartz DR, et al. Organ-specific molecular classification of primary
lung, colon and ovarian adenocarcinomas using gene expression profiles. Am J Pathol 2001;159:
1231-1238.
16. Bhattacharjee A, Richards WG, Staunton J, et al. Classification of human lung carcinomas by mRNA
expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Sci 2001; 98:
13790-13795.
17. Beer DG, Kardia SLR, Huang CC, et al. Gene-expression profiles predict survival of patients with
lung adenocarcinoma. Nat Med 2002; 8: 816-824.
18. Wigle DA, Jurisica I, Radulovich N, et al. Molecular profiling on non-small cell lung cancer and
correlation with disease-free survival. Cancer Res 2002; 62: 3005-3008.
19. Garber ME, Troyanskaya OG, Schluens K, et al. Diversity of gene expression in adenocarcinoma
of the lung. Proc Natl Acad Sci 2001; 98: 13784-13789.
20. Jones MH, Virtanen C, Honjoh D, et al. Two prognostically significant subtypes of high-grade lung
neuroendocrine tumours independent of small-cell and large-cell neuroendocrine carcinomas
identified by gene expression profiles. Lancet 2004; 363: 775-781.
21. Kikuchi T, Daigo Y, Katagiri T, et al. Expression profiles of non-small cell lung cancers on cDNA
microarrays: Identification of genes for prediction of lymph-node metastasis and sensitivity to anti-
cancer drugs. Oncogene 2003; 22: 2192-2205.
22. Borczuk AC, Gorenstein L, Walter KL, et al. Non-small-cell lung cancer molecular signatures
recapitulate lung developmental pathways. Am J Pathol 2003; 163: 1949-1960.
23. Wikman H, Seppänen JK, Sarhadi VK, et al. Caveolins as tumour markers in lung cancer detected
by combined use of cDNA and tissue microarrays. J Pathol 2004; 203: 584-593.
Principales estudios de los perfiles de expresión génica en carcinoma de pulmón.

134 Cáncer de pulmón

 METILACIÓN
Y CÁNCER DE PULMÓN
Manel Esteller
Centro Nacional de Investigaciones Oncológicas (CNIO)
Madrid

Contenido:
Ponencia en power point
Metilación y cáncer de pulmón 137
138 Cáncer de pulmón
Metilación y cáncer de pulmón 139
140 Cáncer de pulmón
Metilación y cáncer de pulmón 141
142 Cáncer de pulmón
Metilación y cáncer de pulmón 143
144 Cáncer de pulmón
Metilación y cáncer de pulmón 145
146 Cáncer de pulmón
Metilación y cáncer de pulmón 147
148 Cáncer de pulmón
Metilación y cáncer de pulmón 149
150 Cáncer de pulmón
Metilación y cáncer de pulmón 151
152 Cáncer de pulmón
Metilación y cáncer de pulmón 153
 Sesión III
PERSPECTIVAS DE LAS NUEVAS TERAPIAS
EN CÁNCER DE PULMÓN

Moderadora: Montserrat Sánchez-Céspedes

 DIANAS MOLECULARES
Y NUEVAS TERAPIAS
Rafael Rosell
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona

Contenido:
Resumen de la ponencia
Artículos del ponente
 Molecular Targets and Novel Therapies
Rafael Rosell
Servicio de oncología médica
Institut Català d’Oncologia
Hospital Germans Trias i Pujol, Barcelona

tandard cancer management consists in the empirical approach of randomized trials without taking
S into consideration the predicting role of multiple genetic cancer abnormalities, including gene mutations,
overexpression of anti-apoptotic genes, mutations in pro-apoptotic genes, loss of transcription by promoter
gene hypermethylation. We will focus on our recent findings and the clinical implications of EGFR tyrosine
kinase mutations in lung cancer and the pattern of serum DNA methylation in the promoter of the
14-3-3s gene.
Recently, it has been discovered that mutations on the EGFR tyrosine kinase domain confer
enhanced response to EGFR drug inhibitors, but increased resistance to chemotherapy. The potential
relevance of EGFR mutations to NSCLC treatment has recently been identified. In the present study,
laser capture microdissection was performed for the accurate procurement of tumor cells. EGFR exons
18, 19 and 21 and flanking intron sequences were amplified from genomic DNA by means of PCR,
and the samples were then subjected to bidirectional automatic sequencing. So far, 34 gefitinib-treated
patients have been screened, 18 from Japan and 16 from Spain, in addition to 1 cetuximab-treated
Spanish patient and 1 untreated patient. Most of the female patients and non-smokers were Japanese,
while there were more males and more smokers among the Spanish patients. The median number of
prior chemotherapy regimens was 3 in the Spanish and 2 in the Japanese group (P = 0.02). EGFR
mutations were observed in 12.5% of the Spanish patients and in 41% of the Japanese patients
(P = 0.17). 7/9 Japanese gefitinib responders harbored EGFR mutations: 3 missense mutations at exon
18, and 4 in-frame deletions removing amino acids 746 through 750 (ELREA), one of which was a
heterozygous in-frame deletion (747-751) and insertion of phenylalaline residue. The only Spanish gefitinib
responder also harbored a heterozygous in-frame deletion (746-751) and insertion of alanine residue.
Some of the other mutations were homozygous. Although no mutations were found in non-responders,
one was found in a Spanish patient with stable disease who had two primary lung cancers. The mutation
was found in the resected specimen of lung adenocarcinoma but not in the second relapsing primary
squamous cell carcinoma. Missense mutations were also found in the untreated patient and in the
cetuximab-treated responder (L861R). In Japanese patients, mutations were more frequently observed
in patients < 60 years (P = 0.05) and in non-smokers (P = 0.05). Median survival for Japanese patients
with EGFR mutations was 15.6 months from the start of gefitinib treatment, while for the remaining
Japanese patients with wild-type EGFR, it was 2.3 months (P = 0.04). Sequencing analysis is being
performed in additional Spanish, German and Chinese gefitinib-treated patients and in the gefitinib-
sensitive human NSCLC cell line PC9. Since median survival of Spanish patients with stable disease was
14 months, other genetic alterations are being examined in these patients. EGFR mutations are present
more frequently in Japanese, non-smokers, and patients < 60 years, and can be used as a predictive
marker for EGFR inhibition. In the meaningful number of non-Japanese patients with stable disease, other
markers may predict the relatively good response to EGFR inhibition. Final data will be presented.
Survival in advanced non-small-cell lung cancer patients treated with platinum-based doublets is
rather variable. Methylation-dependent transcriptional silencing of 14-3-3s, a major G2/M checkpoint

Dianas moleculares y nuevas terapias 159

control gene, detected in patient pre-treatment sera, could predict better survival. A sensitive methylation-
specific polymerase chain reaction assay was used to evaluate 14-3-3s methylation status in pre-treatment
serum DNA obtained from 115 cisplatin-plus-gemcitabine-treated non-small-cell lung cancer patients.
14-3-3s methylation was observed in all histologic types in 39 patients (34%). After a median follow-
up of 9.8 months, median survival was significantly greater in the methylation-positive group (15.1 versus
9.8 months; P = 0.004 by the log-rank test). Median survival for 22 methylation-positive responders has
not been reached, while it was 11.3 months for 29 methylation-negative responders (P = 0.001). The
risk of death for methylation-negative responders was almost five times greater than that of methylation-
positive responders (P = 0.001). Methylation of 14-3-3s can be detected in the pre-treatment sera of
non-small-cell lung cancer patients, obviating the need for tumor tissue and offering a novel method to
predict survival after treatment with platinum-based doublets.

160 Cáncer de pulmón

 Overexpression of ERCC1

may play a role in

cisplatin resistance in

non–small-cell lung cancer.

Gary Ernest Smith. Old Road, New Road. Oil on canvas, 40″ × 60″. Courtesy of Raymond E. Johnson's
Overland Gallery of Fine Art, Scottsdale, Arizona.

Nucleotide Excision Repair Pathways

Involved in Cisplatin Resistance in
Non–Small-Cell Lung Cancer
Rafael Rosell, MD, Miquel Taron, PhD, Agusti Barnadas, MD,
Giorgio Scagliotti, MD, Carme Sarries, PhD, and Barbara Roig, PhD

Background: In spite of the growing list of genetic abnormalities identified as being involved in DNA repair
pathways that alter chemosensitivity in non–small-cell lung cancer (NSCLC) patients, translational assays have
not yet been developed for use in individualized chemotherapy.
Methods: In metastatic NSCLC, no single cisplatin-based chemotherapy regimen has been shown to be superior
to any other. Although these studies show a small survival tail at 3 years, the majority of patients had a
median survival of 8 to 10 months. We review the principal mechanisms of cisplatin resistance, particularly
those involved in the nucleotide excision repair (NER) pathways (transcription-coupled repair and global
genomic repair).
Results: ERCC1 is a single-stranded DNA endonuclease that forms a tight heterodimer with xeroderma
pigmentosum complementation group F. It incises DNA on the 5′ side of a lesion such as cisplatin-DNA adduct.
Therefore, overexpression of ERCC1 and other NER enzymes during ovarian cancer chemotherapy with
cisplatin appears to be implicated in the formation of cellular and clinical drug resistance. Recently, baseline
ERCC1 mRNA overexpression has been related to poor response and survival in cisplatin-treated NSCLC
patients.
Conclusions: The level of evidence for many assays is limited, and only ERCC1 mRNA levels have been
analyzed extensively. The impact of ERCC1 should be fully validated in prospective clinical trials.

From the Medical Oncology Service, Hospital Germans Trias i Service, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916
Pujol, Badalona (Barcelona), Spain (RR, MT, AB, CS, BR), and the Badalona (Barcelona), Spain. E-mail: rrosell@[Link]
Thoracic Oncology Unit, Department of Clinical and Biological Dr. Scagliotti receives honoraria from Eli Lilly and Co, Aventis
Sciences, University of Torino, Torino, Italy (GS). Pharmaceuticals Inc, and AstraZeneca Pharmaceuticals LP. The other
Submitted August 5, 2002; accepted September 30, 2002. authors report no significant relationship with the companies/orga-
Address reprint requests to Rafael Rosell, MD, Medical Oncology nizations whose products or services are referenced in this article.

July/August 2003, Vol. 10, No.4 Cancer Control 297

Introduction In the landmark four-arm Eastern Cooperative
Oncology Group (ECOG) trial in advanced NSCLC, all
Cisplatin has long been the foundation of four platinum-based combination chemotherapy regi-
chemotherapy in lung cancer, and the role of noncis- mens attained the same pattern of response, median
platin combinations has not yet been fully demonstrat- survival, and 1- and 2-year survival rates. In the control
ed. Cisplatin is the platinum agent of choice in the arm (cisplatin 75 mg/m2 plus paclitaxel 135 mg/m2 by
treatment of germ-cell tumors. On the other hand, 24-hour infusion), the response rate was 21%, median
oxaliplatin is effective in colorectal cancer, unlike cis- survival was 7.8 months, 1-year survival was 31%, and 2-
platin, and shows higher activity in vitro in cancer cell year survival was 10%. Similar results were observed in
lines with an impaired DNA mismatch repair (MMR) patients treated with cisplatin plus gemcitabine, cis-
system.1 The mechanisms of resistance to cisplatin platin plus docetaxel, and carboplatin plus paclitaxel5
have recently been reviewed in depth, illustrating how (Table 1).
multiple proteins and several pathways intervene in
this resistance.1 In the three-arm Italian Lung Cancer Project trial,
patients were randomized to receive gemcitabine plus
Although cisplatin or carboplatin are the essential cisplatin or paclitaxel plus carboplatin or vinorelbine
partners in combination chemotherapy in non–small- plus cisplatin. Again, no differences in response rate
cell lung cancer (NSCLC), there are still many para- (30%), time to progression (4.6 months), or median sur-
doxical findings. In a European study, more than 400 vival (9.8 months) were observed.6 However, in the
patients with stage IIIB (30%) or IV (70%) NSCLC were first trial comparing cisplatin plus paclitaxel vs carbo-
randomized to receive cisplatin 100 mg/m2 or a com- platin plus paclitaxel, differences in time to progression
bination of paclitaxel 175 mg/m2 by 3-hour infusion (4.2 vs 3 months; P=.03) and median survival (9.8 vs
plus cisplatin 80 mg/m2 every 3 weeks. Although dif- 8.2 months; P=.01) were observed in favor of the cis-
ferences in response were observed in favor of the platin arm7 (Table 1).
combination, there were no differences in median sur-
vival (8.6 months in the cisplatin arm and 8.1 months These results can be interpreted as a reflection of
in the combination arm).2 These results are open to the failure of chemotherapy in advanced NSCLC, which
various explanations, ranging from the low paclitaxel seems unable to progress beyond the frontier of 8-
dose to the differences in the cisplatin dose between month median survival. However, the ECOG trial5 has
the two arms. Similarly, the Cancer and Leukemia ushered in a new era in cancer management that will
Group B (CALGB) has reported its trial of paclitaxel include not only the concepts of new therapeutic tar-
250 mg/m2 by 3-hour infusion plus carboplatin at a gets, chemoprevention, and spiral computed tomogra-
dose based on the area under the concentration-time phy screening,8 but also the genetic bases of chemore-
curve (AUC) of 6 compared with paclitaxel alone at sistance, which can pave the way for tailored
the same dose. The same phenomena were observed: chemotherapy. Cisplatin damages DNA, inducing the
significant differences in response and median sur- formation of chemically stable DNA adducts. The
vival3 in favor of the combination regimen but similar absence of measurable cisplatin DNA adducts, deter-
1-year survival in the two arms.4 mined by enzyme-linked immunosorbent assay (ELISA),

Table 1. — Outcomes in Selected Non–Small-Cell Lung Cancer Trials

Response Rate Survival Median Time

Median (mos) 1 Year to Progression (mos)
Schiller et al5
Pac/cis 21% 7.8 31% 3.4*
Gem/cis 22% 8.1 36% 4.2*
Docetaxel/cis 17% 7.4 31% 3.7
Pac/carbo 17% 8.1 34% 3.1
Scagliotti et al6
Vrb/cis 30% 9.5 37% 4.6
Gem/cis 30% 9.8 37% 5.3
Pac/carbo 32% 10.0 43% 5.5
Pac/cis = paclitaxel/cisplatin
Gem/cis = gemcitabine/cisplatin
Pac/carbo = paclitaxel/carboplatin
Vrb/cis = vinorelbine/cisplatin
* Significant difference in time to progression between the paclitaxel/cisplatin control arm and the gemcitabine/cisplatin arm (P=.001).

298 Cancer Control July/August 2003, Vol. 10, No.4

is associated with poor outcome. In one study, multiple the DNA. A growing number of reports identify DNA
tissues, including ovarian tumor, were obtained at autop- damage with the regulation of DNA repair gene tran-
sy from 8 patients who had received either cisplatin or scription and the control of cell cycle progression and
carboplatin chemotherapy. Cisplatin DNA adducts were apoptosis via DNA damage checkpoints. Different
detected in most of the tissues examined, and DNA pathways of DNA repair are polymorphic and vary
adduct levels were similar in the majority of tissues from interindividually and with age. These features influence
the same subject, whether taken from the bone marrow, the chemosensitivity of tumor cells toward DNA-reac-
liver, brain, or peripheral nerve.9 The assessment of tive cytotoxic drugs.
DNA adduct levels could become one predictive assay
for cisplatin and/or radiotherapy. Schaake-Koning et al10 DNA repair is a counteragent in carcinogenesis and
observed an improvement in survival in patients with an accomplice in cancer therapy resistance.12 There are
locally advanced NSCLC who were treated with daily several major DNA repair pathways. Excision repair,
radiotherapy plus daily cisplatin 6 mg/m2 approximate- including nucleotide excision repair (NER), has been
ly 1 hour before irradiation (20 administrations for a strongly linked to cisplatin resistance. Base excision
total of 120 mg/m2), compared with radiotherapy alone. repair (BER) also plays an important role in chemother-
Three-year survival was 16% for concomitant cisplatin- apy resistance. The mRNA levels of the excision repair
radiotherapy vs 2% for radiotherapy alone. cross-complementing (ERCC1) gene, involved in the
NER pathway, have recently been found to be closely
Differences in survival according to cisplatin DNA correlated with levels of 8-oxoguanine DNA glycosylase
adduct levels have been observed in patients treated (OGG1), involved in the BER pathway. The repair of
with concomitant cisplatin and radiotherapy. Dutch double-strand breaks, induced by cytotoxic agents,
investigators studied 27 patients treated with daily cis- radiotherapy, and reactive oxygen species, is carried out
platin and radiotherapy.11 To assess cisplatin DNA by homologous recombination and nonhomologous
adduct levels, buccal cells were collected by wiping the DNA end joining. Other pathways are MMR and one-
inner cheek with a cotton swab before cisplatin treat- step repair (OSR), meaning the direct reversal of DNA
ment and 1 hour after the fifth course of cisplatin. The damage. The repair protein O6-alkylguanine-DNA alkyl-
immunohistochemical method used for cytospins transferase, also known as O6-methylguanine-DNA
enabled cisplatin DNA adducts to be visualized in methyltransferase (MGMT), intervenes in OSR through
nuclei of the buccal cells. Nuclear signal intensity (arbi- removal of an alkyl group from the O6-atom of guanine
trary units) ranged from 0.4 to 2.8. Striking differences in the DNA of cells exposed to alkylating agents. With
in survival were observed according to DNA adduct lev- increasing size of the alkyl group, the relative contribu-
els. Thirteen patients with low DNA adduct levels tion of MGMT to the repair of O6-alkylguanines in DNA
(≤1.16) had a median survival of 5.2 months compared decreases and excision repair becomes more relevant.12
to 14 patients with high levels (>1.16), who had a medi- As an example of OSR, treatment with chloroethylni-
an survival of 30.2 months (P<.0001). If these data are trosourea (BCNU) correlates with MGMT activity; in the
validated in a large-scale study, cisplatin DNA adduct process of cytotoxic interstrand cross-links in target cell
levels could be used to identify the nearly 50% of DNA, BCNU initially alkylates the O6-atom of guanine.
patients who could obtain the greatest benefit from a Intriguingly, MGMT levels vary greatly among tumors,
concomitant cisplatin-radiotherapy approach and which has been used in pharmacogenomic interpreta-
enable us to look for a different therapy for the 50% tion. Hypermethylation of MGMT (abrogating OSR) was
who would not benefit from such an approach. observed in 40% of brain tumors treated with BCNU and
was related to significantly better survival.13 Interest-
Several molecular assays can be used to tailor ingly, the activity of temozolomide has been linked to
chemotherapy in the care of lung cancer patients. tumor MGMT. However, when temozolomide was com-
Accumulated evidence indicates that several genetic bined with CPT-11, this mechanism of resistance was
markers are related to cisplatin resistance, and current circumvented in tumor cells that were either MGMT
research is providing hints that predictive markers may proficient or MMR deficient.14
also affect resistance to gemcitabine and/or micro-
tubule-interacting drugs. The possibility of individualizing DNA repair pro-
files is becoming a central issue in the search for
improved chemotherapy results. Current bioinformat-
DNA Repair ics tools for microarray data have correlated gene
expression profiles in cell lines with response to
Cell repair capacity is stored in the linear sequence chemotherapy, leading to the identification of genes
of approximately 3 × 109 copies of the four bases — that may be important for drug sensitivities. However,
guanine, cytosine, adenine and thymine — aligned in profiling with microarray requires relatively large

July/August 2003, Vol. 10, No.4 Cancer Control 299

quantities of RNA, making the process inappropriate In an experimental model, elevated DRC was asso-
for certain applications. Cancer cells accumulate mul- ciated with resistance to cisplatin in lung cancer cell
tiple genetic abnormalities in signal transduction path- lines.19 In this case, the overall DRC was estimated
ways during carcinogenesis and cancer progression. based on the ability of cells to reactivate the pRSV-CAT
NER deficiencies are related to lung oncogenesis yet (chloramphenicol acetyltransferase) plasmid damaged
simultaneously confer a chemotherapy advantage. by cisplatin. The pRSV-CAT plasmid contains the bac-
Like many DNA alkylators, cisplatin acts as a cross-link- terial gene for CAT under the control of the RSV long-
er, inhibiting DNA replication, which is the critical tar- terminal repeat promoter. Platination of the pRSV-CAT
get in cancer chemotherapy. Cross-links between gua- plasmid will diminish or abolish CAT gene expression
nine bases are induced by cisplatin, carboplatin, and as a consequence of DNA damage after transfection
oxaliplatin. Cisplatin and carboplatin form an identical into cells. Repair of these lesions will restore CAT gene
cross-link, while the oxaliplatin cross-link is structural- expression and provide information about the overall
ly different due to the bulky 1,2-diaminocyclohexane repair capacity of a given cell population. NSCLC cells
group in the adduct.15 The mechanisms of DNA repair were found to be significantly more resistant to cis-
have been investigated in depth, primarily the nuclear platin than small-cell cancer cell lines isolated from
DNA repair pathways involving BER, recombination, untreated patients.19
MMR, NER, and OSR. Mitochondrial DNA repair path-
ways can also play an important role and are reviewed The epidemiology of DRC and its effect on cancer
elsewhere.16 In this review, we focus primarily on the susceptibility has been fully developed. In 1998, 64
NER pathway. reports addressed the association of cancer susceptibil-
ity with defects in DRC.20 Several assays of DRC have
been used. With the host-cell reactivation assay,DRC has
DNA Repair Capacity, Lung Cancer been measured in peripheral blood lymphocytes with
Risk, and Chemoresistance the host-cell reactivation assay and calculated as the per-
centage of residual CAT gene expression after the repair
Many cancer chemotherapeutic agents, including of ultraviolet radiation- or cisplatin-damaged plasmid
cisplatin, cause interstrand cross-links, which DNA divided by that in undamaged plasmid DNA. The
accounts for their therapeutic cytotoxic properties. host-cell reactivation assay measuring the activity of the
Similarly, many carcinogens are bifunctional, causing CAT gene has been used in cells transfected with BPDE-
both monoadducts and intrastrand or interstrand treated plasmid. Because a single unrepaired DNA
cross-links in DNA. DNA repair capacity (DRC) is adduct can effectively block CAT transcription, any CAT
genetically determined; it modulates lung cancer sus- activity will reflect the ability of the transfected cells to
ceptibility and treatment response.17 Carcinogen- remove BPDE-induced adducts from the plasmids. The
induced DNA damage induces breaks in the sugar- most susceptible subgroup of cigarette smokers on the
phosphate DNA backbone, either in one or both of basis of their low DRC were case patients who were
the two strands of the double helix. Covalent binding young (<60 years if age), female, or light smokers, or
of the carcinogen results in the formation of a chemi- who reported a family history of cancer. In contrast, in
cally altered base in DNA that is called an adduct. A a study comparing 316 newly diagnosed lung cancer
nucleotide adduct is a fragment consisting of carcino- patients and 316 cancer-free control subjects, heavy
gen-base-deoxyribose-phosphate, a nucleoside adduct smokers among both case patients and control subjects
consists of carcinogen-base-deoxyribose, and a base tended to have more proficient DRC than lighter smok-
adduct is the carcinogen-modified base only. DRC has ers, suggesting that cigarette smoking may stimulate
been assessed in peripheral blood lymphocytes by the DRC in response to the DNA damage caused by tobac-
host-cell reactivation assay, which measured cellular co carcinogens.20 Similarly, women smokers with the
reactivation of a reporter gene damaged by exposure GSTM1 null genotype, which results in diminished glu-
to 75 µm benzo[a]pyrene diol epoxide (BPDE).18 tathione S-transferase (GST) activity, had the greatest
With this functional assay, the mean level of DRC was lung cancer risk compared with other groups of women
significantly lower in patients with lung cancer than and men with different GSTM1 genotypes. The absence
in controls. Younger cases (<65 years of age) and of detoxifying GST activity may result in an excess of
smokers were more likely than controls to have internal exposure to tobacco carcinogens, leading to a
reduced DRC.18 BPDE-induced DNA adducts are higher level of DNA damage or adduct formation.21
repaired by the NER pathway, in which ERCC1 plays a
pivotal role, raising the hypothesis that lung cancer In short, defective DRC is one of the major factors
patients with lower ERCC1 levels — and thus lower responsible for carcinogenesis, and at the same time, it
DRC — may have enhanced response and survival can confer a favorable cytotoxic effect. Preliminary
with cisplatin-based chemotherapy. hints as to the therapeutic benefit of deficient DRC

300 Cancer Control July/August 2003, Vol. 10, No.4

stem from molecular epidemiology studies assessing Functional ERCC1 is important in the repair of cis-
the DRC by the host-cell reactivation assay in lympho- platin DNA adducts and in cisplatin sensitivity in intact
cytes, which measures the NER capacity.22 As stated cells.23 ERCC1 mRNA levels, measured by quantitative
above, one determinant of the level of cisplatin DNA polymerase chain reaction (PCR), were examined in
adducts in host tissues (cancer patients) treated with gastric cancer patients treated with cisplatin/fluor-
cisplatin-based chemotherapy is the rate of DNA repair. ouracil (FU). Before chemotherapy, cDNA was
Subjects vary considerably in their capacity to remove obtained from primary gastric tumors, and ERCC1
DNA adducts.18 It is thought that NER is the primary mRNA levels were expressed as the ratio of the PCR
mechanism for repairing cisplatin DNA adducts. The product of the ERCC1 gene and the β-actin housekeep-
relationship between DRC and survival in patients with ing gene. The median ERCC1 mRNA level for the 17
NSCLC treated with cisplatin-based chemotherapy was responders was 4.9, while the median ERCC1 mRNA
recently examined.22 In this study, patients who had level for the 16 resistant patients was 8. The difference
received chemotherapy were divided into quartiles between responders and nonresponders was statisti-
according to their DRC. Patients in the top quartile cally significant.23 The median survival for patients
(DRC >9.2%) had a risk of death that was more than with ERCC1 mRNA levels <5.8 was not reached at the
two times the risk of death for patients in the bottom time the report was published, while the median sur-
quartile (DRC <5.8%; P=.01). Median survival was 8.9 vival for those with levels >5.8 was only 5.4 months.
months for patients in the top quartile compared with The difference was highly significant, disclosing for the
15.8 months for those in the bottom quartile (P=.04). first time that intratumoral levels of ERCC1 mRNA
Intriguingly, among the 36 chemonaive patients who influence the outcome of gastric cancer patients treat-
underwent curative surgical resection, there was a ed with cisplatin/FU.23 This study gave no conclusive
slight survival advantage associated with increased results on whether ERCC1 mRNA levels could be an
DRC. This finding could be relevant when interpreting independent predictive marker for cisplatin benefit.
the results of neoadjuvant chemotherapy trials in early Originally, ERCC1 mRNA levels were assessed in ovari-
NSCLC. The assessment of DRC, either by measuring an cancer tissue harvested from 28 patients before
cisplatin DNA adducts, the host-cell reactivation assay, treatment with carboplatin- or cisplatin-based chemo-
or the overexpression of ERCC1 gene transcript, is war- therapy. RT-PCR–based assay was used to determine
ranted in such trials to identify the subgroup of patients the level of expression of ERCC1 and β-actin, as well as
with low DRC, who could have lower survival when human xeroderma pigmentosum group A correcting
treated with surgery alone and at the same time could (XPAC) gene. Numerical values for the expression of
benefit from neoadjuvant or adjuvant chemotherapy. In the ERCC1 and XPAC genes in the ovarian tumor tissue
contrast, patients with high DRC could have better sur- samples were obtained using the densitometric read-
vival when treated with surgery alone and could be out of the autoradiographic signal generated by the
refractory to neoadjuvant or adjuvant approaches. 32 P-labeled ERCC1 or XPAC probe divided by the
densitometric reading for β-actin. In this case, the
numerical values were different from those reported
NER Capacity and Cisplatin Effect in the literature using quantitative PCR. Thirteen non-
responders showed greater levels of ERCC1 mRNA
It is a common belief that cisplatin exerts its cyto- than 15 responders.24
toxic effect by disrupting the DNA macromolecule,
mainly through the formation of intrastrand adducts The cisplatin effect on ERCC1 mRNA expression
and interstrand cross-links that are repaired through has been examined in vitro. In response to a 1-hour
the NER pathway. It is also postulated that tumors that cisplatin exposure, human ovarian cancer cells
are defective in MMR become more resistant to cis- showed a two- to six-fold increase in steady-state levels
platin than their MMR-proficient counterparts. The of ERCC1 mRNA over basal expression levels.25,26 A
NER pathway consists of several steps: damage recog- positive association has also been demonstrated
nition, dual incision/excision, repair synthesis, and liga- between the level of ERCC1 mRNA expression and the
tion. Approximately 30 proteins participate in this amount of cisplatin-DNA adduct repair in ovarian
repair process; above all, ERCC1 has a crucial role in tumor cells in vitro.26
the incision process, which is the rate-limiting step of
the pathway. ERCC1 is a 15-kb repair gene located on Intriguingly, ERCC1 antisense RNA abrogates the
human chromosome 19. ERCC1 forms a heterodimer gemcitabine-mediated cytotoxic synergism with cis-
with XPF, and the ERCC1/XPF complex is responsible platin in human colon tumor cells that were proficient
for the incision to cleave the damaged strand at the in NER. Experimental results indicate that stable
phosphodiester bonds between 22 and 24 nucleotides expression of ERCC1 antisense mRNA downregulates
5′ to the lesion. the level of mRNA and repair activity. The downregula-

July/August 2003, Vol. 10, No.4 Cancer Control 301

tion of the repair activity significantly correlates with removed by NER, which is split into subpathways: tran-
the reduction of the cytotoxic synergism between gem- scription-coupled repair (TCR) and global genomic
citabine and cisplatin.27 repair (GGR). Importantly, TCR repairs transcription-
blocking lesions in transcribed DNA strands of active
Along the same lines, ERCC1 mRNA levels have genes, whereas GGR repairs the lesions in the nontran-
been correlated with oxaliplatin resistance in colorec- scribed strand of active genes and nontranscribing
tal cancer patients. Median survival for patients with genome.32 When transcribing RNA polymerase II
ERCC1 expression <4.9 was 10 months, while for encounters the lesion, two TCR-specific factors, CSA
patients with ERCC1 expression >4.9, it was 1.9 and CSB, are implicated for the activation of the com-
months.28 These findings indicate that intratumoral mon NER molecular pathway.32 The clinical implica-
ERCC1 mRNA may be an independent predictive mark- tions of TCR lie in the fact that cisplatin-resistant
er for oxaliplatin combination chemotherapy. Both this tumors show an intact TCR system, while tumors are
study and the original study in gastric cancer23 were sensitive to cisplatin when the TCR subpathway is defi-
conducted by investigators from the University of cient. For GGR, the xeroderma pigmentosum group C
Southern California (USC)/Norris Comprehensive (XPC) complex is activated. Along with the basal tran-
Cancer Center and Response Genetics. ERCC1 mRNA scription factor (TFIIH), an XPG binds to the DNA
levels have not been correlated with noncisplatin around the lesion. TFIIH contains two helicases, XPB
chemotherapy response. When the correlation and XPD, which open approximately a 30-base-long
between the expression of eight genes involved in NER DNA segment around the damage. This open interme-
and DRC was examined, only ERCC1 and XPD mRNA diate is stabilized by replication protein A and XPA. The
levels were highly correlated both with each other and DNA strand that contains the damaged base(s) is
with DRC.29 ERCC1 and XPD (also known as ERCC2) excised by the two NER endonucleases, XPG and
are closely linked on chromosome 19q13.2-13.3. More XPF/ERCC1. XPG cleaves the damaged DNA strand 3′
recently, the same investigators observed a strong cor- from the lesion, and XPF/ERCC1 cleaves the damaged
relation between ERCC1 and OGG1 mRNA levels in strand 5′ from the DNA lesion. Finally, the resulting gap
peripheral lymphocytes. OGG1 encodes the 8-oxogua- is filled in by DNA polymerases in the presence of repli-
nine-DNA glycosylase, which removes 8-oxoguanine cation factors. Molecular deficiencies (in both GGR
from DNA as part of the BER pathway.30 XPD poly- and TCR subpathways) in primary fibroblasts confer
morphism has been related to lower DRC.31 Approxi- marked hypersensitivity to cisplatin compared to nor-
mately half of the population examined had the geno- mal primary fibroblasts. These results demonstrate that
type Lys751Lys and also had Asp312Asp. These patients any one deficiency in XPA, XPD, XPF, or XPG confers
had a good DRC and therefore are presumably resistant marked hypersensitivity to cisplatin.32
to cisplatin. In an epidemiological study matching 341
lung cancer cases with 360 smoker control subjects, a
host-cell reactivation assay measuring the activity of the ERCC1 Expression
CAT gene was used in cells transfected with plasmids
treated with BPDE. DRC was lower in the lung cancer We have analyzed the role of ERCC1 expression in
patients than in the controls. The variants Gln751Gln metastatic NSCLC patients treated with gemcitabine/
and Asn312Asn had suboptimal DRC, with a significant cisplatin. mRNA was isolated from paraffin-embedded
increase in the hazard ratio, in contrast with the wild- primary tumor specimens obtained by bronchoscopy
type genotypes both in cases and controls, which biopsy. The median ERCC1 expression in 56 patients
exhibited the most proficient DRC.31 The frequency of analyzed relative to the expression of the control β-
homozygous variants was 10% for either codon. In an actin was 6.7. Patients with ERCC1 expression above
intermediate group with heterozygous polymorphisms, 6.7 had a median survival of 5 months, while those with
the frequency was 40% at either codon. lower levels had a median survival of 15 months. This
difference was statistically significant, and importantly,
The clinical interest of these findings lies in their in a Cox multivariable analysis, ERCC1 levels surfaced
potential usefulness in identifying in constitutional as an independent predictive variable. The fact that the
DNA from lymphocytes the polymorphisms associated cutoff was higher than previously described indicates
with suboptimal DRC and their potential role in identi- that a certain level of ERCC1 is required for synergism
fying patients with better response to cisplatin between gemcitabine and cisplatin.33
chemotherapy.
The potential role of the 5′-untranslated region (5′-
UV light, BPDE DNA adducts, and cisplatin DNA UTR) in ERCC1 mRNA expression has also been exam-
adducts are effective blocks to RNA polymerase II and ined. RT-PCR was carried out with primers targeting
thus block transcription. These DNA lesions are the 5′-UTR to amplify a fragment containing exon I

302 Cancer Control July/August 2003, Vol. 10, No.4

(UTR) and exon II (containing the initiation codon) of enhanced in some cisplatin-resistant cell lines.40 Mul-
the ERCC1 gene in 121 ovarian cancer samples. Inter- tidrug resistance protein 2 (MRP2) is also a putative cis-
estingly, two PCR amplimers from the same sample for platin efflux pump.41 Other mechanisms involve cis-
the target segment within the UTR appeared in some platin detoxification by glutathione/glutathione acetyl-
samples. The prevalence of the two amplimers S-transferases (GSH/GST). The four major GST-related
occurred in the group of patients with high ERCC1 genes (GSTP1, GSTT1, GSTM1, and GSTZ1) attach
mRNA levels (48%). In contrast, only 5% of patients reduced glutathione to electrophilic groups in a wide
with a single amplimer showed high ERCC1 mRNA lev- variety of toxic compounds, including chemotherapeu-
els. Direct DNA sequencing of the cDNA from each of tic agents, and GSTP1 overexpression has been corre-
the 121 ovarian cancer tumor samples confirmed that lated with increased cisplatin resistance.42 Recently,
tumors with two amplimers contained two distinct the GSTP1 Ile105 Val polymorphism has been associat-
sequences. The longer sequences included the com- ed with increased survival in patients with advanced
plete target sequence, 261-bp (wild type), and the colorectal cancer receiving FU/oxaliplatin chemothera-
shorter sequences demonstrated a 42-bp deletion.34 py.43 This polymorphism has been related to substan-
This 42-bp deletion seems to be associated with high tially diminished GSTP1 enzyme activity, reducing the
ERCC1 mRNA levels. detoxification pathway mediated by GSTP1.44

Overall, ERCC1 stands out as a potential predictive Metallothioneins are also involved in low cisplatin-
marker for cisplatin-based chemotherapy and it could adduct formation. Metallothioneins are metal binding
be the basis for customized chemotherapy. proteins of low molecular weight; they are cysteine
rich and have an important role in the homeostasis of
trace metals and in the detoxification of metals such as
Other Genetic Markers Conferring Cd2+ and Hg2+. Metallothioneins are transcriptionally
Cisplatin Resistance induced by these metals through metal-responsive ele-
ments located in the 5′-regulatory regions of human
Defects in DNA MMR may result from mutation or methallothionein genes. Overexpression of methal-
methylation-mediated silencing of three mismatch lothionein has been correlated with cisplatin-resis-
repair genes: hMLH-1, hMSH-2, or hPMS-2. These tance, and transfection of the gene encoding for methal-
defects have been shown to be a mechanism of resis- lothionein increases cisplatin resistance.45
tance to cisplatin but not to oxaliplatin both in vivo and
in vitro.35 It is thought that an MMR complex recog- BRCA1 plays an important role in DNA damage
nizes cisplatin-DNA adducts but not oxaliplatin-DNA repair mediated-cisplatin sensitivity.46 Increased levels
adducts, and that MMR proteins are involved in mediat- of BRCA1 have been observed in cisplatin-resistant
ed response to DNA damage.35,36 This has been demon- breast and ovarian carcinoma cell lines derived from
strated in experiments using MMR-proficient and MMR- MCF7 and SKOV3. Furthermore, antisense inhibition of
deficient cells, where different DNA repair pathways BRCA1 in SKOV3 cisplatin-resistant cell lines resulted in
have been linked to cisplatin but not to oxaliplatin.37,38 increased sensitivity to cisplatin, decreased DRC, and
increased apoptosis. BRCA1 and Rad5116 co-localize
In addition to members of the MMR family, other and interact in the S-phase of the cell cycle.47
proteins also interact with cisplatin DNA adducts,
including numerous nuclear proteins binding to cis-
platin DNA adducts, such as linker histones H1, high Conclusions
mobility group 1 (HMG1) box-containing proteins, and
many different transcription factors. HMG1 is a nonhi- Preclinical data indicate that TCR is involved in cis-
stone chromosomal protein that appears to be involved platin resistance. However, clinical findings, with a
in DNA replication and repair. HMG1 was overex- level of evidence of 2 (positive phase II studies), have
pressed in three cisplatin-resistant cell lines. The focused on ERCC1, which is involved in GGR. Further
expression of HMG1 is increased at the transcriptional research is required to validate ERCC1 mRNA levels in
level, which may be due to enhanced activity of the randomized trials, and customized chemotherapy trials
CCAAT-binding transcription factor/nuclear factor 1 including ERCC1 assessment are ongoing. However, an
(CTF/NF-1).39 important limitation is the availability of tumor sam-
ples. Stage IV NSCLC is often diagnosed through cytol-
Other mechanisms of cisplatin resistance involve ogy, which can impede ERCC1 assessment. In addition,
decreased net intracellular accumulation of cisplatin. in some instances, the amount of tumor tissue in
ATP-dependent pathways activate outward efflux of bronchial biopsies is scarce. Another test to assess the
cisplatin through the plasma membrane, which is GGR pathway is the host-cell reactivation assay, which

July/August 2003, Vol. 10, No.4 Cancer Control 303

 Table 2. — Predictive Tests Considered for Use in 3. Lilenbaum RC, Herndon J, List M, et al. Single-agent (SA) ver-
Cisplatin-Based Customized Chemotherapy Trials sus combination chemotherapy (CC) in advanced non-small cell lung
cancer (NSCLC): a CALGB randomized trial of efficacy, quality life
Marker Assay Level of (QOL), and cost-effectiveness. Proc Annu Meet Am Soc Clin Oncol.
Evidence 2002;21:2. Abstract.
4. Garfield D. Two drugs better than one for NSCLC. Lancet
ERCC1 cDNA quantitation 2 Oncol. 2002;3:389.
Damaged CAT reporter genes Host-cell reactivation 2 5. Schiller JH, Harrington D, Belani CP, et al. Comparison of four
repaired in test lymphocytes chemotherapy regimens for advanced non-small-cell lung cancer. N
transfected with BPDE- Engl J Med. 2002;346:92-98.
treated plasmids 6. Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III random-
ized trial comparing three platinum-based doublets in advanced non-
Cisplatin-DNA adducts Immunohistochemistry 2 small cell lung cancer. J Clin Oncol. 2002;20:4285-4291.
Ap endonuclease Immunohistochemistry 3 7. Rosell R, Gatzemeier U, Betticher DC, et al. Phase III ran-
domised trial comparing paclitaxel/carboplatin with paclitaxel/cis-
XPD polymorphisms Genotyping 2/3 platin in patients with advanced non-small cell lung cancer: a coop-
erative multinational trial. Ann Oncol. 2002;13:1539-1549.
8. Carney DN. Lung cancer: time to move on from chemother-
apy. N Engl J Med. 2002;346:126-128.
examines the ability to repair BPDE-induced DNA 9. Poirier MC, Reed E, Litterst CL, et al. Persistence of platinum-
adducts in peripheral lymphocytes. Like the assess- ammine-DNA adducts in gonads and kidneys of rats and multiple tis-
ment of ERCC1, this test has a level of evidence of 2. A sues from cancer patients. Cancer Res. 1992;52:149-153.
10. Schaake-Koning C, van den Bogaert W, Dalesio O, et al. Effects
third test is the measurement of cisplatin-DNA adducts of concomitant cisplatin and radiotherapy on inoperable non-small-
in nuclei of buccal cells, which also has a level of evi- cell lung cancer. N Engl J Med. 1992;326:524-530.
dence of 2. The only limitation for this method is that 11. van de Vaart PJ, Belderbos J, de Jong D, et al. DNA-adduct lev-
els as a predictor of outcome for NSCLC patients receiving daily cis-
it requires at least the prior administration of one cycle platin and radiotherapy. Int J Cancer. 2000;89:160-166.
of cisplatin-based chemotherapy. Cisplatin-DNA 12. Rajewsky MF, Müller R. DNA repair and the cell cycle as tar-
adducts can be detected a few days after the first cycle, gets in cancer therapy. In: Alison M, ed. The Cancer Handbook. Lon-
don: Nature Publishing Group; 2002:1507-1519.
and the results can be used by the medical oncologist 13. Esteller M, Garcia-Foncillas J, Andion E, et al. Inactivation of
when deciding whether to continue with cisplatin or the DNA-repair gene MGMT and the clinical response of gliomas to
switch to a noncisplatin regimen in those cases with alkylating agents. N Engl J Med. 2000;343:1350-1354.
14. Houghton PJ, Stewart CF, Cheshire PJ, et al. Antitumor activity
poor nuclear signal intensity (Table 2). of temozolomide combined with irinotecan is partly independent of
O6-methylguanine-DNA methyltransferase and mismatch repair phe-
The role of adjuvant chemotherapy has not yet notypes in xenograft models. Clin Cancer Res. 2000;6:4110-4118.
15. Siddik ZH. Mechanisms of action of cancer chemotherapeu-
been demonstrated in NSCLC, and there are some hints tic agents: DNA-interactive alkylating agents and antitumour plat-
that patients with proficient GGR can have better inum-based drugs. In: Alison M, ed. The Cancer Handbook. London:
prognosis — though paradoxically, proficient GGR can Nature Publishing Group; 2002:1295-1313.
16. Kohn KW, Bohr VA. Genomic instability and DNA repair. In:
cause resistance to cisplatin-based adjuvant chemo-
Alison M, ed. The Cancer Handbook. London: Nature Publishing
therapy. The assessment of ERCC1 in surgical samples Group; 2002:87-106.
could be used to select patients with low ERCC1 17. Phillips DH. The formation of DNA adducts. In: Alison M, ed.
levels who could most benefit from adjuvant chemo- The Cancer Handbook. London: Nature Publishing Group; 2002:
293-307.
therapy. Along the same lines, apurinic/apyrimidinic 18. Wei Q, Cheng L, Hong WK, et al. Reduced DNA repair capac-
endonuclease (Ap endo) is a key DNA repair enzyme ity in lung cancer patients. Cancer Res. 1996;56:4103-4107.
that confers resistance to radiotherapy and alkylating 19. Zeng-Rong N, Paterson J,Alpert L, et al. Elevated DNA repair
capacity is associated with intrinsic resistance of lung cancer to
drugs. Ap endo is crucial in the BER pathway. High chemotherapy. Cancer Res. 1995;55:4760-4764.
nuclear Ap endo expression correlated with better 20. Wei Q, Cheng L,Amos CI, et al. Repair of tobacco carcinogen-
survival in surgically resected NSCLC patients.48 At the induced DNA adducts and lung cancer risk: a molecular epidemio-
logic study. J Natl Cancer Inst. 2000;92:1764-1772.
same time, it is reported to be a mechanism of resis- 21. Berwick M,Vineis P. Markers of DNA repair and susceptibili-
tance to alkylating agents.49 Finally, XPD polymor- ty to cancer in humans: an epidemiologic review. J Natl Cancer Inst.
phisms can be examined in constitutional DNA, and for 2000;92:874-897.
22. Bosken CH,Wei Q,Amos CI, et al. An analysis of DNA repair
this reason, lymphocytes from peripheral blood are a as a determinant of survival in patients with non-small-cell lung can-
practical source of DNA. The level of evidence for this cer. J Natl Cancer Inst. 2002;94:1091-1099.
test is 2/3 (ie, little clinical evidence). 23. Metzger R, Leichman CG, Danenberg KD, et al. ERCC1 mRNA
levels complement thymidylate synthase mRNA levels in predicting
response and survival for gastric cancer patients receiving combina-
References tion cisplatin and fluorouracil chemotherapy. J Clin Oncol. 1998;16:
309-316.
1. Guminski AD, Harnett PR, deFazio A. Scientists and clinicians 24. Dabholkar M, Vionnet J, Bostick-Bruton F, et al. Messenger
test their metal-back to the future with platinum compounds. Lancet RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate
Oncol. 2002;3:312-318. with response to platinum-based chemotherapy. J Clin Invest.
2. Gatzemeier U, von Pawel J, Gottfried M, et al. Phase III com- 1994;94:703-708.
parative study of high-dose cisplatin versus a combination of pacli- 25. Li Q, Gardner K, Zhang L, et al. Cisplatin induction of ERCC-
taxel and cisplatin in patients with advanced non-small-cell lung can- 1 mRNA expression in A2780/CP70 human ovarian cancer cells. J
cer. J Clin Oncol. 2000;18:3390-3399. Biol Chem. 1998;273:23419-23425.

304 Cancer Control July/August 2003, Vol. 10, No.4

 26. Li Q,Yu JJ, Mu C, et al. Association between the level of ERCC- 48. Kakolyris S, Giatromanolaki A, Koukourakis M, et al. Nuclear
1 expression and the repair of cisplatin-induced DNA damage in localization of human AP endonuclease 1 (HAP1/Ref-1) associates
human ovarian cancer cells. Anticancer Res. 2000;20:645-652. with prognosis in early operable non-small-cell lung cancer (NSCLC).
27. Yang LY, Li L, Jiang H, et al. Expression of ERCC1 antisense J Pathol. 1999;189:351-357.
RNA abrogates gemcitabine-mediated cytotoxic synergism with cis- 49. Bobola MS, Blank A, Berger MS, et al. Apurinic/apyrimidinic
platin in human colon tumor cells defective in mismatch repair but endonuclease activity is elevated in human adult gliomas. Clin Can-
proficient in nucleotide excision repair. Clin Cancer Res. cer Res. 2001;7:3510-3518.
2000;6:773-781.
28. Shirota Y, Stoehlmacher J, Brabender J, et al. ERCC1 and
thymidylate synthase mRNA levels predict survival for colorectal can-
cer patients receiving combination oxaliplatin and fluorouracil
chemotherapy. J Clin Oncol. 2001;19:4298-4304.
29. Vogel U, Dybdahl M, Frentz G, et al. DNA repair capacity:
inconsistency between effect of over-expression of five NER genes
and the correlation to mRNA levels in primary lymphocytes. Mutat
Res. 2000;461:197-210.
30. Vogel U, Moller P, Dragsted L, et al. Inter-individual variation,
seasonal variation and close correlation of OGG1 and ERCC1 mRNA
levels in full blood from healthy volunteers. Carcinogenesis.
2002;23:1505-1509.
31. Spitz MR,Wu X,Wang Y, et al. Modulation of nucleotide exci-
sion repair capacity by XPD polymorphisms in lung cancer patients.
Cancer Res. 2001;61:1354-1357.
32. Furuta T, Ueda T, Aune G, et al. Transcription-coupled
nucleotide excision repair as a determinant of cisplatin sensitivity of
human cells. Cancer Res. 2002;62:4899-4902.
33. Lord RV, Brabender J, Gandara D, et al. Low ERCC1 expression
correlates with prolonged survival after cisplatin plus gemcitabine
chemotherapy in non-small cell lung cancer. Clin Cancer Res.
2002;8:2286-2291.
34. Yu JJ, Thornton K, Guo Y, et al. An ERCC1 splicing variant
involving the 5′-UTR of the mRNA may have a transcriptional modu-
latory function. Oncogene. 2001;20:7694-7698.
35. Fink D, Zheng H, Nebel S, et al. In vitro and in vivo resistance
to cisplatin in cells that have lost DNA mismatch repair. Cancer Res.
1997;57:1841-1845.
36. Fink D, Aebi S, Howell SB. The role of DNA mismatch repair
in drug resistance. Clin Cancer Res. 1998;4:1-6.
37. Nehme A, Baskaran R, Nebel S, et al. Induction of JNK and
cAbl signalling by cisplatin and oxaliplatin in mismatch repair-profi-
cient and -deficient cells. Br J Cancer. 1999;79:1104-1110.
38. Vaisman A, Varchenko M, Umar A, et al. The role of hMLH1,
hMSH3 and hMSH6 defects in cisplatin and oxaliplatin resistance:
correlation with replicative bypass of platinum-DNA adducts. Cancer
Res. 1998;58:3579-3585.
39. Nagatani G, Nomoto M, Takano H, et al. Transcriptional acti-
vation of the human HMG1 gene in cisplatin-resistant human cancer
cells. Cancer Res. 2001;61:1592-1597.
40. Fujii R, Mutoh M, Sumizawa T, et al. Adenosine triphosphate-
dependent transport of leukotriene C4 by membrane vesicles pre-
pared from cisplatin-resistant human epidermoid carcinoma tumor
cells. J Natl Cancer Inst. 1994;86:1781-1784.
41. Taniguchi K, Wada M, Kohno K, et al. A human canalicular
multispecific organic anion transporter (cMOAT) gene is overex-
pressed in cisplatin-resistant human cancer cell lines with decreased
drug accumulation. Cancer Res. 1996;56:4124-4129.
42. Ban N, Takahashi Y, Takayama T, et al. Transfection of glu-
tathione S-transferase (GST)-pi antisense complementary DNA
increases the sensitivity of a colon cancer cell line to adriamycin, cis-
platin, melphalan, and etoposide. Cancer Res. 1996;56:3577-3582.
43. Stoehlmacher J, Park DJ, Zhang W, et al. Association between
glutathione S-transferases P1, T1 and M1 genetic polymorphism and
survival of patients with metastatic colorectal cancer. J Natl Cancer
Inst. 2002;94:936-942.
44. Watson MA, Stewart RK, Smith GB, et al. Human glutathione
S-transferase P1 polymorphisms. Carcinogenesis. 1998;19:275-280.
45. Vandier D, Calvez V, Massade L, et al. Transactivation of metal-
lothionein promoter in cisplatin-resistant cancer cells: a specific
gene therapy strategy. J Natl Cancer Inst. 2000;92:642-647.
46. Husain A, He G,Venkatraman ES, et al. BCRA1 up-regulation is
associated with repair-mediated resistance to cis-diamminedichloro-
platinum (II). Cancer Res. 1998;58:1120-1123.
47. Scully R, Livingston DM. In search of the tumor-suppressor
functions of BRCA1 and BCRA2. Nature. 2000;408:429-432.

July/August 2003, Vol. 10, No.4 Cancer Control 305

 Human Molecular Genetics, 2004, Vol. 13, No. 20 2443–2449
doi:10.1093/hmg/ddh260
Advance Access published on August 18, 2004

BRCA1 mRNA expression levels as an indicator

of chemoresistance in lung cancer
Miquel Taron1, Rafael Rosell1,*, Enriqueta Felip2, Pedro Mendez1, John Souglakos5,
Maria Sanchez Ronco6, Cristina Queralt1, Joaquim Majo3, Jose Miguel Sanchez1,
Jose Javier Sanchez6 and Jose Maestre4
1
Medical Oncology Service, Institut Catala d’Oncologia, Hospital Germans Trias i Pujol, Badalona, Barcelona, Spain,
2
Medical Oncology Service, 3Pathology Department and 4Department of Thoracic Surgery, Hospital Vall d’Hebron,
Barcelona, Spain, 5Department of Medical Oncology, General Hospital of Heraklion, Crete, Greece and 6Autonomous
University of Madrid, Madrid, Spain

Received April 27, 2004; Revised July 15, 2004; Accepted August 4, 2004

Lung cancer is the most common cancer, with dismal outcome. Treatment approaches, including cisplatin-
based chemotherapy and surgery, are currently based on the clinical classification of the tumor, without
genetic assessment for predicting differential chemosensitivity. BRCA1 plays a central role in DNA repair,
and decreased BRCA1 mRNA expression in the human breast cancer HCC1937 cell line caused cisplatin
hypersensitivity, but the relation between BRCA1 and survival in lung cancer patients has never been examined.
We used real-time quantitative polymerase chain reaction to determine BRCA1 mRNA levels in 55 surgically
resected tumors of non-small-cell lung cancer patients who had received neoadjuvant gemcitabine/cisplatin
chemotherapy, and divided the gene expression values into quartiles. When results were correlated with out-
come, two cut-offs were observed; patients with levels <0.61 had better outcome, and those >2.45 had poorer
outcome. Median survival was not reached for the 15 patients in the bottom quartile, whereas for the 28 in the
two middle quartiles, it was 37.8 months (95% CI, 10.6 – 65), and for the 12 patients in the top quartile, it was
12.7 months (95% CI, 0.28 – 28.8) (P 5 0.01). Moreover, when patients were stratified by pathologic stage,
those in the bottom quartile had a decreased risk of death (HR 5 0.206; 95% CI, 0.05 – 0.83; P 5 0.026) com-
pared with those in the top quartile, and those in the two middle quartiles also had a decreased risk of
death (HR 5 0.294; 95% CI, 0.10 – 0.83; P 5 0.020) compared with those in the top quartile. BRCA1 expression
is potentially an important tool for use in cancer management and should be assessed for predicting differ-
ential chemosensitivity and tailoring chemotherapy in lung cancer.

INTRODUCTION radioresistance (3). BRCA1 is also involved in homologous

recombination repair (HRR) and non-homologous end
Breast cancer 1 (BRCA1) plays a crucial role in DNA repair, joining, in response to DNA damage (4). In addition, it is a
and decreased BRCA1 mRNA expression has been observed component of a large DNA repair complex termed the
in both sporadic and hereditary breast cancers (1); however, BRCA1-associated genome surveillance complex, which con-
its potential effect in lung cancer has never been examined. tains a number of mismatch repair proteins, indicating a poten-
BRCA1 is implicated in transcription-coupled nucleotide exci- tial role for BRCA1 in mismatch repair (1,4). BRCA1 may also
sion repair (TC-NER), and modulation of its expression leads be a regulator of mitotic spindle assembly, as BRCA1 and
to modification of TC-NER and hence to radio- and chemore- b-tubulin colocalize to the microtubules of the mitotic
sistance. Upregulation of BRCA1 expression led to increased spindle and to the centrosomes (5). Finally, enhanced
cisplatin resistance in the SKOV-3 human ovarian cancer BRCA1 expression has been linked to apoptosis through the
cell line (2), and restoration of BRCA1 in the BRCA1- c-Jun N-terminal kinase pathway (6), which is activated by
negative HCC1937 human breast cancer cell line restored cisplatin-induced DNA damage; inhibition of this pathway

*To whom correspondence should be addressed at: Medical Oncology Service, Catalan Institute of Oncology, Hospital Germans Trias i Pujol, Ctra
Canyet, s/n, 08916 Badalona, Barcelona, Spain. Tel: þ34 934978925; Fax: þ34 934978950; Email: rrosell@[Link]

Human Molecular Genetics, Vol. 13, No. 20 # Oxford University Press 2004; all rights reserved
2444 Human Molecular Genetics, 2004, Vol. 13, No. 20

increased cisplatin sensitivity in cell lines (7). Decreased IIIB NSCLC patients treated with neoadjuvant gemcitabine/
BRCA1 mRNA expression in a breast cancer cell line, as cisplatin followed by surgery.
determined by real-time quantitative polymerase chain reac-
tion (RT-QPCR), led to greater sensitivity to cisplatin and
etoposide, but to greater resistance to the microtubule-interfer- RESULTS
ing agents paclitaxel and vincristine (8). Recently, furthermore,
Median survival was 37.8 months (95% CI, 27 – 48.5 months)
reconstitution of wild-type BRCA1 into the BRCA1-negative
for all patients, 51.9 months (95% CI, 31.6 –72.4 months) for
HCC1937 breast cancer cell line (9) resulted in a 20-fold
patients who underwent lobectomy and 25.8 months (95%
increase in cisplatin resistance and, in contrast, in a 1000 –
CI, 12.7– 38.8 months) for those who underwent pneumo-
10 000-fold increase in sensitivity to antimicrotubule drugs
nectomy. BRCA1 was detected in all tumors, although there
(paclitaxel and vinorelbine) (4,10). Mouse models carrying
was considerable variation in its level of expression, with
conditional disruption of BRCA1 were highly sensitive to
values relative to the b-actin internal control ranging 37-
doxorubicin and gamma irradiation but resistant to tamoxifen,
fold, from 0.28 to 10.43. Amplification plots obtained for
providing additional evidence for differential chemosensitivity
the genes BRCA1 and b-actin are shown in Figure 1. Values
linked to BRCA1 expression (11). When BRCA1 expression
ranged from 0.28 to 0.61 [interpatient coefficient of variation
was examined by semi-quantitative PCR in women with
(ICV), 30.7%] for the 15 patients in the bottom quartile,
sporadic breast cancer, low BRCA1 mRNA levels (bottom
from 0.65 to 1.20 (ICV, 17.4%) for the 14 patients in the
quartile) were associated with a higher frequency of distant
second quartile, from 1.23 to 2.37 (ICV, 17.7%) for the 14
metastases (12).
patients in the third quartile, and from 2.45 to 10.43 (ICV,
Despite the wealth of data in cell lines and mouse models,
54.7%) for the 12 patients in the top quartile. Owing to the
only one small study has examined the correlation of BRCA1
similar values and ICVs observed in the second and third quar-
and BRCA2 mRNA expression with response to chemotherapy
tiles, these two groups were merged for statistical analyses.
in the clinical setting. Among 25 women with docetaxel-treated
No differences in clinical characteristics were observed
locally advanced or metastatic breast cancer (13), only BRCA2
according to quartiles of BRCA1 mRNA expression levels
mRNA levels were significantly lower in responders than in
(Table 1). However, for patients in the bottom quartile, radio-
non-responders, though a slight difference was also observed
graphic response tended to be higher than for those in the
for BRCA1. Non-small-cell lung cancer (NSCLC) accounts
middle or top quartiles (66.7, 57.1 and 58.3%, respectively),
for 80% of all lung cancers, with 1.2 million new cases world-
complete resection was attained more often (93.3, 78.6 and
wide each year. NSCLC resulted in more than 1 million deaths
83.3%, respectively), and a lobectomy was performed more
worldwide in 2001, and is the leading cause of cancer-related
often [73.3, 32.1 (P ¼ 0.005) and 58.3% (P ¼ 0.2), respect-
mortality in both men and women (31 and 25%, respectively)
ively] (Table 1). Median survival was not reached for the 15
(14). The overall 5-year survival of patients with NSCLC has
patients in the bottom quartile, whereas for the 28 patients
remained at ,15% for the past 20 years. Stage grouping of
in the two middle quartiles, it was 37.8 months (95% CI,
TNM subsets (T, primary tumor; N, regional lymph nodes; M,
10.6 – 65), and for the 12 patients in the top quartile, it was
distant metastases) permits the identification of patient groups
12.7 months (95% CI, 0.28– 28.8) (P ¼ 0.01) (Fig. 2). Five
with similar prognosis and treatment options. Five-year survi-
patients who attained a complete pathologic response
val is around 25% for pathologic stage IIB (T1-2N1M0,
(T0N0) were all in the bottom quartile of BRCA1 levels
T3N0M0), 13% for stage IIIA (T3N1M0, T1-2-3N2M0) and
(Table 2). Conversely, in the majority of patients with high
a low 7% for stage IIIB (T4N0-1-2M0) (15). Small randomized
BRCA1 levels, no clinical or pathologic downstaging was
studies of cisplatin-based chemotherapy followed by surgery in
observed following chemotherapy and surgery (Table 3).
clinical stage IIIA (16) or stage IIB –IIIB (17) showed remark-
When patients were stratified by pathologic stage, those in
able improvement in survival over patients treated either with
the bottom quartile had a decreased risk of death
surgery alone or with surgery followed by radiotherapy.
(HR ¼ 0.206; 95% CI, 0.05 –0.83; P ¼ 0.026) compared
Event-free survival was similar in the two studies (12.7 (16)
with those in the top quartile, and those in the two middle
and 20 (17) months in the neoadjuvant chemotherapy arm
quartiles also had a decreased risk of death (HR ¼ 0.294;
and 5.8 (16) and 5 (17) months in the surgery arm). In
95% CI, 0.10 – 0.83; P ¼ 0.020) compared with those in the
general, neoadjuvant chemotherapy induces tumor shrinkage
top quartile. When patients were stratified by clinical stage,
and sterilizes metastatic lymph nodes, leading to pathologic
a similar pattern was observed. Those in the bottom quartile
downstaging in 33% and complete pathologic remission in
had a decreased risk of death (HR ¼ 0.220; 95% CI, 0.06 –
up to 14% of patients (18). Although a wealth of data indicates
0.77; P ¼ 0.018) compared with those in the top quartile,
that changes in the level of several gene transcripts can modu-
and those in the two middle quartiles also had a decreased
late differential chemosensitivity between patients with the
risk of death (HR ¼ 0.430; 95% CI, 0.17 – 1.1; P ¼ 0.078)
same TNM subset, at present no predictive genetic markers
compared with those in the top quartile.
of chemotherapy response are used for tailoring treatment.
On the basis of the evidence for the role of BRCA1 in breast
and ovarian cancers, we reasoned that BRCA1 mRNA
expression could also play an important role in predicting
DISCUSSION
differential chemotherapy sensitivity in NSCLC. We exam- Resistance to cytotoxic drugs is the major impediment to the
ined the potential predictive value of BRCA1 mRNA successful treatment of many tumor types, especially in lung
expression in resected specimens from stage IIB, IIIA and cancer. The elucidation of the mechanisms of this resistance
 Human Molecular Genetics, 2004, Vol. 13, No. 20 2445

Figure 1. Example of the amplification plots (DRn versus cycle number) of (A) b-actin and (B) BRCA1 cDNAs. Both figures correspond to serial dilutions of
cDNA obtained from one of the samples. (C) and (D) Examples of the validation curves for relative quantification. Different primers and probe concentrations
were assayed for b-actin and BRCA1 gene expression analysis to obtain the optimal PCR efficiency. In order for the relative quantification to be valid, the ampli-
fication efficiency of the target (BRCA1 ) and the reference (b-actin ) amplification must be approximately equal. A sensitive method for assessing whether two
amplicons have the same amplification efficiency is to see how DCt varies when using a serial dilution of a control cDNA. We performed two validations: one
using control cDNA, another using cDNA from paraffin-embedded samples. (C) Several runs with serial dilutions were performed to confirm that the slope ,0.1
in the plot DCt value versus log10 input amount cDNA, defined as Ct BRCA1 in each dilution minus Ct b-actin in the same dilution. (D) For primers and probe
sets, the slope of the plot Ct versus log10 input amount cDNA needed to be between 23.25 and 23.45, since a slope of 23.33 represents 100% efficiency. The
slopes in our assays were 23.36 for b-actin and 23.32 for BRCA1, with a correlation coefficient (R 2) .0.98.

is crucial for improving treatment outcome and for selecting resected lung cancer patients and demonstrated that BRCA1
and customizing chemotherapy. Upregulation of DNA repair expression can be accurately assessed. BRCA1 gene
genes has been related to resistance to cisplatin and radiother- expression was detectable in all 55 samples analyzed in this
apy. The repair of cisplatin DNA damage occurs via study. Patients in the bottom quartile of BRCA1 mRNA
the activity of the nucleotide excision repair endonuclease levels (,0.61) obtained the maximum benefit of neoadjuvant
(ERCC1/XPF) and Rad51-related HRR proteins (19,20). We gemcitabine/cisplatin chemotherapy, whereas those in the top
had previously used RT-QPCR to assess mRNA levels of quartile (.2.45) had the poorest outcome. These findings
ERCC1 and RRM1, genes related to global genome NER but support the hypothesis that BRCA1 mRNA expression levels
not directly to TC-NER (20), and found that overexpression could be an indicator of differential cisplatin sensitivity in
of either of these genes influenced survival in gemcitabine/cis- NSCLC, which is consistent with findings in pre-clinical
platin-treated stage IV NSCLC patients (21 – 23). However, models in breast cancer (2 – 4,8,10,11). The HCC1937 cell
unlike ERCC1, BRCA1 is involved in TC-NER (3,24), and line (9), from a primary breast carcinoma with a germline
may thus be a better predictive marker of cisplatin response. BRCA1 mutation, was transfected with either wild-type
The availability of fresh tumor tissue in the clinical setting BRCA1 or an empty vector to test response to antimicrotubule
is not yet common, and the recovery of mRNA from paraffin- drugs (paclitaxel and vinorelbine) and DNA-damaging drugs
embedded tissue has therefore become very important. mRNA (cisplatin, bleomycin and etoposide). Reconstitution of wild-
real-time assays permit quantitative and accurate measurement type BRCA1 function into HCC1937 resulted in a 1000-fold
of gene expression (25). In the present study, we used RT- increase in sensitivity to paclitaxel and a 10 000-fold increase
QPCR to quantitatively analyze BRCA1 mRNA expression in sensitivity to vinorelbine. Conversely, it resulted in a 2-fold
in processed formalin-fixed, paraffin-embedded tissues from increase in resistance to bleomycin, a 20-fold increase in
2446 Human Molecular Genetics, 2004, Vol. 13, No. 20

Table 1. Patient characteristics according to BRCA1 mRNA expression levels (bottom quartile versus two middle quartiles versus top quartile)

Bottom quartile of BRCA1 Middle quartiles of BRCA1 Top quartile of BRCA1

levels (0.28–0.61) N levels (0.65– 2.37) N levels (2.45–10.43) N

Sex
Female 3 (20%) 3 (10.7%) 0
Male 12 (80%) 25 (89.3%) 12 (100%)
Age
Median, range 60 (49–74%) 65 (51–76%) 61 (45–71%)
Histology
Squamous cell carcinoma 5 (33.3%) 16 (57.1%) 5 (41.7%)
Adenocarcinoma 7 (46.7%) 11 (39.3%) 2 (16.7%)
Large cell carcinoma 3 (20%) 1 (3.6%) 5 (41.7%)
Initial staging
IIB
T3N0 2 (13.3%) 3 (10.7%) 1 (8.3%)
IIIA
T3N1 0 1 (3.6%) 3 (25%)
T1N2 0 0 0
T2N2 1 (6.7%) 6 (21.4%) 1 (8.3%)
T3N2 3 (20%) 7 (25%) 2 (16.7%)
IIIB
T4N0 6 (40%) 8 (28.6%) 3 (25%)
T4N1 1 (6.7%) 2 (7.1%) 1 (8.3%)
T4N2 2 (13.3%) 1 (3.6%) 1 (8.3%)
Chemotherapy regimen
Gemcitabine/cisplatin 15 (100%) 26 (92.9%) 10 (83.3%)
Gemcitabine/carboplatin 0 2 (7.1%) 2 (16.7%)
Radiographic response
Partial response 10 (66.7%) 16 (57.1%) 7 (58.3%)
Stable disease 5 (33.3%) 10 (35.7%) 4 (33.3%)
Progressive disease 0 2 (7.1%) 1 (8.3%)
Surgical results
Complete resection 14 (93.3%) 22 (78.6%) 10 (83.3%)
Incomplete resection 1 (6.7%) 5 (17.9%) 2 (16.7%)
Unresectable 0 1 (3.6%) 0
Surgical procedures
Lobectomy 11 (73.3%) 9 (32.1%) 7 (58.3%)
Pneumonectomy 4 (26.7%) 14 (50%) 5 (41.7%)
Bilobectomy 0 4 (14.3%) 0
Unresectable 0 1 (3.6%) 0

resistance to cisplatin and a .100-fold increase in resistance Among heavy smokers, both lung cancer patients and controls
to etoposide (10). Interestingly, BRCA1 failed to modulate have more proficient DNA repair capacity (measured by host-
resistance or sensitivity to the antimetabolite 5-fluorouracil, cell reactivation assay) in lymphocytes than non- or light
perhaps reflecting the distinct mode of action of antimetabo- smokers (30). Elevated DNA repair capacity has been associ-
lites (10). ated with cisplatin resistance both in NSCLC cell lines (31)
BRCA1 mRNA is reduced in sporadic breast cancer cells and in lung cancer patients (32). The expression levels of
despite a lack of mutations. Aberrant cytosine methylation DNA repair genes, including BRCA1, can be expected to be
of the BRCA1 CpG island promoter may be a partial mechan- elevated in lung cancer patients, particularly those who are
ism of BRCA1 repression in sporadic breast cancer (26,27). heavy smokers.
Along the same lines, it has been shown that the Fanconi Several cisplatin-based doublets demonstrated similar survi-
anemia (FANC)-BRCA pathway (28) regulates cisplatin sensi- val in a randomized study of more than 1000 metastatic
tivity, with the clinical finding that methylation of FANCF NSCLC patients (33); furthermore, other studies have found
confers increased cisplatin sensitivity in ovarian cancer (29). no survival differences between cisplatin alone and cisplatin/
FANC genes interact with those involved in DNA repair path- paclitaxel (34), or between docetaxel alone and docetaxel/
ways, including BRCA1, Rad-51, ATM and NBS1 (28). cisplatin (35). On the basis of our results and of pre-clinical
Cigarette smoking remains the principal cause of lung data (10), we can speculate that patients with low BRCA1
cancer, with 85– 90% of all lung cancer patients having mRNA levels can benefit from single-agent cisplatin,
smoked cigarettes at some time. The profound role of cigarette whereas those with high levels would benefit from single-
smoking in lung cancer development and DNA damage could agent docetaxel or paclitaxel. In contrast, high BRCA1 levels
also contribute to the dismal outcome and the limited effect of may diminish the synergism between taxanes and cisplatin
chemotherapy as DNA repair capacity is stimulated in or carboplatin. Although sensitivity to antimetabolites, such
response to DNA damage caused by tobacco carcinogens. as gemcitabine, may not be affected by BRCA1 levels,
 Human Molecular Genetics, 2004, Vol. 13, No. 20 2447

Figure 2. Median survival according to quartiles of BRCA1 mRNA expression levels. Median survival was not reached for those in the bottom quartile, whereas
it was 37.8 months for those in the middle quartiles, and 12.7 months for those in the top quartile.

Table 2. BRCA1 mRNA levels and clinical stage in patients who attained complete pathologic response after neoadjuvant chemotherapy followed by surgery

Patient BRCA1 mRNA levels Pre-treatment clinical stage Post-treatment clinical stage Pathologic stage

1 0.31 T3N2 T2N0 T0N0

2 0.28 T2N2 T1N0 T0N0
3 0.30 T4N2 T2N1 T0N0
4 0.33 T4N2 T2N0 T0N0
5 0.34 T4N1 T4N1 T0N0

gemcitabine/cisplatin synergism may be partially abrogated in BRCA1 gene expression analysis by RT-QPCR
tumors with high BRCA1 mRNA levels; on the other hand,
these tumors may benefit from the synergism observed We examined BRCA1 gene expression in formalin-fixed,
between taxanes and gemcitabine. To date, no other clinical paraffin-embedded surgical resected specimens from the
study has assessed BRCA1 mRNA expression as a predictive 55 patients as previously described (36,37). After standard
marker of chemotherapy response in lung cancer. If further tissue sample deparaffinization using xylene and alcohols,
research validates our findings, BRCA1 mRNA assessment samples were lyzed in a Tris – chloride, EDTA, sodium
will provide an important tool for customizing NSCLC chemo- dodecyl sulfate (SDS) and proteinase K containing buffer.
therapy in order to improve survival in this very common and RNA was then extracted with phenol – chloroform– isoamyl
fatal disease. alcohol followed by precipitation with isopropanol in the pre-
sence of glycogen and sodium acetate. RNA was resuspended
in RNA storage solution (Ambion Inc., Austin TX, USA) and
treated with DNase I to avoid DNA contamination. cDNA was
MATERIALS AND METHODS synthesized using M-MLV retrotranscriptase enzyme. Tem-
plate cDNA was added to TaqMan Universal Master Mix
Patients (AB; Applied Biosystems, Foster City, CA, USA) in a
In all patients, neoadjuvant chemotherapy was indicated after 12.5ml reaction with specific primers and probe for each
evaluation by a thoracic surgeon, a radiologist, a medical gene. The primer and probe sets were designed using Primer
oncologist and a radiation oncologist. Patients received three Express 2.0 Software (AB). Quantification of gene expression
cycles of neoadjuvant chemotherapy; 51 received cisplatin was performed using the ABI Prism 7900HT Sequence Detec-
100 mg/m2 day 1 plus gemcitabine 1250 mg/m2 days 1 and tion System (AB). Primers and probe for BRCA1 mRNA
8 every 21 days, and four received carboplatin AUC ¼ 5 expression analysis were designed according to the Ref
day 1 plus gemcitabine 1000 mg/m2 days 1 and 8 every 21 Seq NM_007294 ([Link]
days. A thoracotomy was performed within 4– 5 weeks after Forward primer is located in exon 8 (position 4292 –
the last chemotherapy cycle; the surgical procedure was 4317 bp), reverse primer in exon 9 (position 4336 – 4360 bp)
based on the extent of tumor at the time of the initial and probe in the exon 8/9 junction (position 4313 bp –
presentation. 4333 bp). The PCR product size generated with these
2448 Human Molecular Genetics, 2004, Vol. 13, No. 20

Table 3. Correlation of clinical and pathologic stage in patients in the top Investigación Cooperativa de Centros de Cáncer (CO-010)
quartile of BRCA1 mRNA expression and through Ayuda Carlos III (RCESP 03/09) and by
funding from La Fundació Badalona Contra El Càncer.
Patient mRNA BRCA1 Pre-treatment Post-treatment Pathologic
levels clinical stage clinical stage stage

1 2.8 T3N2 T3N2 T2N2 REFERENCES

2 5.5 T2N2 —a T2N0
3 10.43 T3N1 T2N0 T2N0 1. Kennedy, R.D., Quinn, J.E., Johnston, P.G. and Harkin, D.P. (2002)
4 2.45 T3N0 T3N0 T3N0 BRCA1: mechanisms of inactivation and implications for management of
5 4.12 T4N0 T1N0 T4N0 patients. Lancet, 360, 1007–1014.
6 6.93 T4N2 T3N0 T2N0 2. Husain, A., He, G., Venkatraman, E.S. and Spriggs, D.R. (1998) BRCA1
7 2.81 T4N1 T4N1 T3N1 up-regulation is associated with repair-mediated resistance to cis-
8 3.09 T3N1 T2N0 T2N0 diamminedichloroplatinum(II). Cancer Res., 58, 1120–1123.
9 5.61 T3N1 T2N0 T2N0 3. Abbott, D.W., Thompson, M.E., Robinson-Benion, C., Tomlinson, G.,
10 3.36 T3N2 T3N2 T2N2 Jensen, R.A. and Holt, J.T. (1999) BRCA1 expression restores radiation
11 2.8 T4N0 T3N0 T3N0 resistance in BRCA1-defective cancer cells through enhancement of
12 2.62 T4N0 T4N0 T2N0 transcription-coupled DNA repair. J. Biol. Chem., 274, 18808–18812.
4. Mullan, P.B., Quinn, J.E., Gilmore, P.M., McWilliams, S., Andrews, H.,
a
Gervin, C., McCabe, N., McKenna, S., White, P., Song, Y.H. et al. (2001)
Data not available. BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to
antimicrotubule agents. Oncogene, 20, 6123–6131.
5. Lotti, L.V., Ottini, L., D’Amico, C., Gradini, R., Cama, A., Belleudi, F.,
primers was 69 bp. The primers and 50 labeled fluorescent Frati, L., Torrisi, M.R. and Mariani-Costantini, R. (2002) Subcellular
reporter dye (6FAM) probe were as follows: b-actin: localization of the BRCA1 gene product in mitotic cells. Genes,
forward 50 -TGA GCG CGG CTA CAG CTT-30 , reverse Chromosomes Cancer, 35, 193–203.
6. Harkin, D.P., Bean, J.M., Miklos, D., Song, Y.H., Truong, V.B.,
50 -TCC TTA ATG TCA CGC ACG ATT T-30 , probe Englert, C., Christians, F.C., Ellisen, L.W., Maheswaran, S., Oliner, J.D.
50 -ACC ACC ACG GCC GAG CGG-30 ; BRCA1: forward et al. (1999) Induction of GADD45 and JNK/SAPK-dependent apoptosis
50 -GGC TAT CCT CTC AGA GTG ACA TTT TA-30 , following inducible expression of BRCA1. Cell, 97, 575 –586.
reverse 50 -GCT TTA TCA GGT TAT GTT GCA TGG T-30 , 7. Potapova, O., Haghighi, A., Bost, F., Liu, C., Birrer, M.J., Gjerset, R. and
Mercola, D. (1997) The Jun kinase/stress-activated protein kinase
probe 50 -CCA CTC AGC AGA GGG-30 . pathway functions to regulate DNA repair and inhibition of the pathway
Relative gene expression quantification was calculated sensitizes tumor cells to cisplatin. J. Biol. Chem., 272, 14041– 14044.
according to the comparative Ct method using b-actin as an 8. Lafarge, S., Sylvain, V., Ferrara, M. and Bignon, Y.J. (2001)Inhibition of
endogenous control and commercial RNA controls (Strata- BRCA1 leads to increased chemoresistance to microtubule-interfering
gene, La Jolla, CA) as calibrators. Final results, were deter- agents, an effect that involves the JNK pathway. Oncogene, 20,
6597–6606.
mined as follows: 22(DCt sample 2 DCt calibrator), where DCt 9. Tomlinson, G.E., Chen, T.T.L., Stastny, V.A., Virmani, A.K.,
values of the calibrator and sample are determined by subtract- Spillman, M.A., Tonk, V., Blum, J.L., Schneider, N.R., Wistuba, I.I.,
ing the Ct value of the target gene from the value of the b- Shay, J.W. et al. (1998) Characterization of a breast cancer cell line
actin gene. In all experiments, only triplicates with a SD of derived from a germ-line BRCA1 mutation carrier. Cancer Res., 58,
3237–3242.
the Ct value ,0.20 were accepted. In addition, for each 10. Quinn, J.E., Kennedy, R.D., Mullan, P.B., Gilmore, P.M., Carty, M.,
sample analyzed, a retrotranscriptase minus control was run Johnston, P.G. and Harkin, D.P. (2003) BRCA1 functions as a differential
in the same plate to assure lack of genomic DNA contami- modulator of chemotherapy-induced apoptosis. Cancer Res., 63,
nation (Fig. 1). 6221–6228.
11. Brodie, S.G., Xu, X., Qiao, W., Li, W.M., Cao, L. and Deng, C.X. (2001)
Multiple genetic changes are associated with mammary tumorigenesis in
Brca1 conditional knockout mice. Oncogene, 20, 7514–7523.
Statistical methods 12. Seery, L.T., Knowlden, J.M., Gee, J.M.W., Robertson, J.F.R., Kenny, F.S.,
Ellis, I.O. and Nicholson, R.I. (1999) BRCA1 expression levels predict
In order to provide an easily interpretable evaluation of the distant metastasis of sporadic breast cancers. Int. J. Cancer (Pred. Oncol.),
effect of BRCA1 mRNA expression, gene expression values 84, 258 –262.
were divided into quartiles. ICVs were calculated to assess 13. Egawa, C., Miyoshi, Y., Takamura, Y., Taguchi, T., Tamaki, Y. and
similarities between quartiles. Hazard ratios were calculated Noguchi, S. (2001) Decreased expression of BRCA2 mRNA predicts
favorable response to docetaxel in breast cancer. Int. J. Cancer (Pred.
with the univariate Cox model, stratifying by pathologic and Oncol.), 95, 255–259.
clinical stage, and comparison between Kaplan – Meier survi- 14. Jemal, A., Murray, T., Samuels, A., Ghafoor, A., Ward, E. and Thun, M.J.
val curves was performed with the log-rank test. All tests of (2004) Cancer statistics, 2003. CA Cancer J. Clin., 54, 8 –29.
statistical significance were two-sided, with a statistical 15. Mountain, C.F. (1997) Revisions in the international system for staging
power of 80%, and significance was set at 0.05 except in mul- lung cancer. Chest, 111, 1710–1717.
16. Pass, H.I., Pogrebniak, H.W., Steinberg, S.M., Mulshine, J. and Minna, J.
tiple comparisons, where it was set at 0.017 in accordance (1992) Randomized trial of neoadjuvant therapy for lung cancer: interim
with the Bonferroni correction. analysis. Ann. Thor. Surg., 53, 992 –998.
17. Rosell, R., Gómez-Codina, J., Camps, C., Maestre, J., Padilla, J., Cantó, A,
Mate, J.L., Li Shanrong, Roig J., Olazábal, A. et al. (1994) A randomized
trial comparing preoperative chemotherapy plus surgery with surgery alone
ACKNOWLEDGEMENTS in patients with non-small-cell lung cancer. N. Engl. J. Med., 330, 153–158.
18. Martini, N., Kris, M.G., Flehinger, B.J., Gralla, R.J., Bains, M.S., Burt, M.E.,
The authors thank Renée O’Brate for assistance with the Heelan, R., McCormack, P.M., Pisters, K.M.W., Rigas, J.R. et al. (1993)
manuscript. This study was supported by Spanish Ministry Preoperative chemotherapy for stage IIIa (N2) lung cancer: The Sloan-
of Health research grants provided through Red Temática de Kettering experience with 136 patients. Ann. Thorac. Surg., 55, 1365–1374.
 Human Molecular Genetics, 2004, Vol. 13, No. 20 2449

19. Aloyz, R., Xu, Z.Y., Bello, V., Bergeon, J., Han, F.Y., Yan, Y., 28. Hussain, S., Uit E, Huber, P.A.J., Medhurst, A.L., Ashworth, A. and
Malapetsa, A., Alaoui-Jamali, M.A., Duncan, A.M.V. and Panasci, L. Mathew, C.G. (2003). Direct interaction of the Fanconi with BRCA2/
(2002) Regulation of cisplatin resistance and homologous recombinational FANCD1. Hum. Mol. Genet., 12, 2503–2510
repair by the TFIIH subunit XPD. Cancer Res., 62, 5457–5462. 29. Taniguchi, T., Tischkowitz, M., Ameziane, N., Hodgson, S.V.,
20. Furuta, T., Ueda, T., Aune, G., Sarasin, A., Kraemer, K.H. and Pommier, Mathew, C.G., Joenje, H., Mok, S.C and D’Andrea, A.D. (2003)
Y. (2002) Transcription-coupled nucleotide excision repair as a Disruption of the Fanconi anemia–BRCA pathway in cisplatin-sensitive
determinant of cisplatin sensitivity of human cells. Cancer Res., 62, ovarian tumors. Nat. Med., 9, 568–574.
4899–4902. 30. Wei, Q., Cheng, L., Amos, C.I., Wang, L.E., Guo, Z., Hong, W.K.H and
21. Lord, R.V.N., Brabender, J., Gandara, D., Alberola, V., Camps, C., Spitz, M.R. (2000). Repair of tobacco carcinogen-induced DNA adducts
Domine, M., Cardenal, F., Sanchez, J.M., Gumerlock, P.H., Taron, M. and lung cancer risk: a molecular epidemiologic study. J. Natl Cancer
et al. (2002) Low ERCC1 expression correlates with prolonged survival Inst., 92, 1764–1772.
after cisplatin plus gemcitabine chemotherapy in non-small-cell lung 31. Zeng-Rong, N., Paterson, J., Alpert, L., Tsao, M.S., Viallet, J. and
cancer. Clin. Cancer Res., 8, 2286–2291. Alaoui-Jamali, M.A. (1995) Elevated DNA repair capacity is associated
22. Rosell, R., Scagliotti, G., Danenberg, K.D., Lord, R., Bepler, G., with intrinsic resistance of lung cancer to chemotherapy. Cancer Res.,
Novello, S., Cooc, J., Crino, L., Sancehz, J.J., Taron, M. et al. (2003) 55, 4760–4764.
Transcripts in pretreatment biopsies from a three-arm randomized 32. Bosken, C.H., Wei, Q., Amos, C.I. and Spitz, M.R. (2002) An analysis of
trial in metastatic non-small-cell lung cancer. Oncogene, 22, DNA repair as a determinant of survival in patients with non-small-cell
3548–3553. lung cancer. J. Natl Cancer Inst., 94, 1091–1099.
33. Schiller, J.H., Harrington, D., Velan, C.P., Langer, C., Sandler, A.,
23. Rosell, R., Danenberg, K.D., Alberola, V., Bepler, G., Sanchez, J.J.,
Krrok, J., Zhu, J. and Johnson, D.H. (2002) Comparison of tour
Camps, C., Provencio, M., Isla, D., Taron, M., Diz, P. et al. (2004)
chemotherapy regimens for advanced non-small-cell lung cancer.
Ribonucleotide reductase mRNA expression and survival in gemcitabine/
N. Engl. J. Med., 346, 92–98.
cisplatin-treated advanced non-small-cell lung cancer patients. Clin.
34. Gatzemeier, U., von Pawel, J., Gottfried, M., ten Velde, G.P.M.,
Cancer Res., 10, 1318–1325. Mattson, K., DeMarinis, F., Harper, P., Salvati, F., Robinet, G., Lucenti, A.
24. LePage, F., Randrianarison, V., Marot, D., Cabannes, J., Perricaudet, M., et al. (2000) Phase III comparative study of high-dose cisplatin versus a
Feunteun, J. and Sarasin, A. (2000) BRCA1 and BRCA2 are necessary for combination of paclitaxel and cisplatin in patients with advanced non-
the transcription-coupled repair of the oxidative 8-oxoguanine lesion in small-cell lung cancer. J. Clin. Oncol., 18, 3390–3399.
human cells. Cancer Res., 60, 5548–5552. 35. Georgoulias, V., Ardavanis, A., Agelidou, A., Agelidou, M.,
25. Einspahr, J.G., Krouse, R.S., Yochim, J.M., Danenberg, P.V., Chandrinos, V., Tsaroucha, E., Toumbis, M., Kouroussis, C., Syrigos, K.,
Danenberg, K.D., Bhattacharyya, A.K., Martinez, M.E. and Alberts, D.S. Polyzos, A. et al. (2004) Docetaxel versus docetaxel plus cisplatin as
(2003) Association between cyclooxygenase expression and colorectal front-line treatment of patients with advanced non-small-cell lung cancer:
adenoma characteristics. Cancer Res., 63, 3891–3893. A randomized, multicenter phase III trial. J. Clin. Oncol., 22, 2602–2609.
26. Rice, J.C., Massey-Brown, K.S. and Futscher, B.W. (1998) Aberrant 36. Specht, K., Richter, T., Müller, U., Walch, A., Werner, M. and Hofler, H.
methylation of the BRCA1CpG island promoter is associated with (2001) Quantitative gene expression analysis in microdissected archival
decreased BRCA1 mRNA in sporadic breast cancer cells. Oncogene, 17, formalin-fixed and paraffin-embedded tumor tissue. Am. J. Pathol., 158,
1807–1812. 419–429.
27. Esteller, M., Silva, J.M., Domı́nguez, G., Bonilla, F., Matias-Guiu, X., 37. Krafft, A.E., Duncan, B.W., Bijwaard, K.E., Taubenberger, J.K. and
Lerma, E., Bussaglia, Prat, J., Harkes, I.C., Repasky, E.A. et al. (2000) Lichy, J.H. (1997) Optimization of the isolation and amplification of RNA
Promoter hypermethylation and BRCA1 inactivation in sporadic breast from formalin fixed, paraffin-embedded tissue: The Armed Forces Institute
and ovarian tumors. J. Natl Cancer Inst., 92, 564– 569. of Pathology experience and literature review. Mol. Diagn., 3, 217–230.
2286 Vol. 8, 2286 –2291, July 2002 Clinical Cancer Research

Low ERCC1 Expression Correlates with Prolonged Survival after

Cisplatin plus Gemcitabine Chemotherapy in Non-Small Cell
Lung Cancer1

Reginald V. N. Lord,2 Jan Brabender,2 with advanced (stage IIIb or IV) NSCLC treated as part of
David Gandara, Vicente Alberola, Carlos Camps, a multicenter randomized trial with Gem 1250 mg/m2 days
1 and 8 plus CDDP 100 mg/m2 on day 1 every 3 weeks.
Manuel Domine, Felip Cardenal,
mRNA was isolated from paraffin-embedded pretreatment
José M. Sánchez, Paul H. Gumerlock, primary tumor specimens, and relative expression levels of
Miquel Tarón, José J. Sánchez, ERCC1/␤-actin were measured using a quantitative reverse
Kathleen D. Danenberg, Peter V. Danenberg, and transcription-PCR (Taqman) system.
Rafael Rosell3 Results: ERCC1 expression was detectable in all tu-
University of Southern California/Norris Comprehensive Cancer mors. There were no significant differences in ERCC1 levels
Center, Los Angeles, California 90033 [R. V. N. L., J. B., P. V. D.]; by gender, age, performance status, weight loss, or tumor
University of California, Davis Cancer Center, Sacramento, California stage. The overall response rate was 44.7%. There were no
95817 [D. G., P. H. G.]; Hospital Arnau de Vilanova, 46015 Valencia, significant associations between ERCC1 expression and re-
Spain [V. A.]; Hospital General de Valencia, 46014 Valencia, Spain
sponse. Median overall survival was significantly longer in
[C.C.]; Fundación Jiménez Diaz, 28005 Madrid, Spain [M. D.];
Institut Català d’Oncologia, 08907 Bellvitge, Barcelona, Spain patients with low ERCC1 expression tumors (61.6 weeks;
[F. C.]; Hospital Germans Trias i Pujol, Badalona, s/n 08916 95% confidence interval, 42.4 – 80.7 weeks) compared to
Barcelona, Spain [J. M. S., M. T., R. R.]; Free University of Madrid, patients with high expression tumors (20.4 weeks, 95% con-
28029 Madrid, Spain [J. J. S.]; and Response Genetics, Los Angeles, fidence interval, 6.9 –33.9 weeks). ERCC1 expression, East-
California 90033 [K. D. D.]
ern Cooperative Oncology Group performance status, and
presence of weight loss were significant prognostic factors
ABSTRACT for survival in a Cox proportional hazards multivariable
Purpose: Overexpression of the excision repair cross- analysis.
complementing 1 (ERCC1) gene, which is crucial in the Conclusions: These data suggest that ERCC1 expression
repair of cisplatin (CDDP)-DNA adducts, is reported to is a predictive factor for survival after CDDP/Gem therapy
negatively influence the effectiveness of CDDP-based ther- in advanced NSCLC. Although there was a trend toward
apy for gastric and ovarian cancers. Recent evidence indi- decreased response with high ERCC1 mRNA levels, this
cates that Gemcitabine (Gem) may modulate ERCC1 nucle- difference failed to reach statistical significance. This result
otide excision repair activity, and down-regulation of DNA may reflect the impact of Gem and the requirement for
repair activity by ERCC1 antisense RNA reportedly inhibits ERCC1 expression for CDDP/Gem synergism or may be
synergism of CDDP/Gem. We investigated whether ERCC1 attributable to the relatively small patient sample size in this
mRNA expression levels were associated with clinical out- study. Prospective studies of ERCC1 as a predictive marker
comes after treatment with a combination Gem/CDDP reg- for activity of CDDP-based regimens in NSCLC are war-
imen for patients with advanced stage non-small cell lung ranted.
cancer (NSCLC).
Experimental Design: Response and survival were cor- INTRODUCTION
related with the level of ERCC1 expression in 56 patients Lung cancer is the leading cause of cancer death in both
men and women in many countries, including Spain and the
United States. More than 75% of lung cancers are NSCLC.4
Except for some patients with surgically resectable disease, the
prognosis for patients with NSCLC is poor. Platinum-based
Received 12/11/01; revised 4/15/02; accepted 4/15/02.
The costs of publication of this article were defrayed in part by the chemotherapy has been shown to provide survival and quality of
payment of page charges. This article must therefore be hereby marked life benefits for patients with advanced stage, unresectable
advertisement in accordance with 18 U.S.C. Section 1734 solely to NSCLC, but overall 2-year survival rates for this group remain
indicate this fact.
1
⬍15% (1, 2).
Funded in part by NIH/National Cancer Institute Grant CA 63265 (to
D. G.), Grant CA 71716 (to P. V. D.), and Grants CM 17101 and CA
62505 to University of California, Davis Cancer Center (to D. G. and
P. H. G.), and a grant from the University of Southern California (to
4
K. D. D. and P. V. D.). The abbreviations used are: NSCLC, non-small cell lung cancer;
2
Both authors contributed equally to this work. CDDP, cisplatin, cis-diamminedichloroplatinum; Gem, Gemcitabine,
3
To whom requests for reprints should be addressed, at Hospital Ger- 2⬘,2⬘-difluorodeoxycytidine; ERCC1, excision repair cross-comple-
mans Trias i Pujol, Medical Oncology Service, Ctra de Canyet, s/n menting gene 1; XPA, xeroderma pigmentosum group A protein;
08916 Badalona, Barcelona, Spain. Phone: 3493-497-8925; Fax: 3493- ECOG, Eastern Cooperative Oncology Group; SLCG, Spanish Lung
497-8950; E-mail: rrosell@[Link]. Cancer Group; CI, confidence interval.
 Clinical Cancer Research 2287

Pharmacogenetics, the study of genes that influence drug the participating SLCG centers after review of the H&E-stained
activity and toxicity, offers the possibility of tailoring therapy to slides.
the specific genetic profile of individual patients and tumors. A RNA Isolation and cDNA Synthesis. RNA isolation
pharmacogenetic approach can thus potentially increase re- from paraffin-embedded specimens was done according to a
sponse rates and survival outcomes while decreasing toxicity proprietary procedure (US patent number 6,248,535). After
and overall treatment costs. The cytotoxic effect of the antican- RNA isolation, cDNA was prepared from each sample as de-
cer drug CDDP is principally attributable to the formation of scribed previously (17).
bulky intrastrand platinum-DNA adducts. Removal of these Reverse Transcription-PCR Quantification of mRNA
adducts from genomic DNA is mediated by the nucleotide Expression. Relative cDNA quantitation for ERCC1 and an
excision repair pathway, (3, 4), a critical element of which for internal reference gene (␤-actin) was done using a fluorescence-
this function is the ERCC1 gene (3, 5, 6). DNA repair can be based, real-time detection method (ABI PRISM 7700 Sequence
attenuated by blocking the interaction between ERCC1 protein Detection System; TaqMan; Applied Biosystems, Foster City,
and the XPA (7), and high ERCC1 expression is associated with CA), as described previously (17–19).
resistance to platinum-containing therapy in human ovarian and The primers and probe sequences used are given below. In
gastric tumor specimens (8, 9). Cytotoxic synergism has been each case, the first primer is the forward PCR primer, the second
demonstrated between Gem and CDDP, (10 –13), and a higher is the reverse PCR primer, and the third is the Taqman probe:
response rate was found for the combination of Gem plus CDDP ERCC1, GGGAATTTGGCGACGTAATTC, GCGGAGGCT-
compared with a standard CDDP plus etoposide regimen in GAGGAACAG, and 6FAM (carboxyfluorescein) 5⬘-CACAG-
GTGCTCTGGCCCAGCACATA-3⬘TAMRA (N,N,N⬘,N⬘-tetra-
patients with advanced NSCLC (14). Importantly, this Gem/
methyl-6-carboxyrhodamine); ␤-actin, TGAGCGCGGCTAC-
CDDP synergism has been shown to involve ERCC1 and the
AGCTT, TCCTTAATGTCACGCACGATTT, and 6FAM5⬘-
nucleotide excision repair pathway; expression of ERCC1 anti-
ACCACCACGGCCGAGCGG-3⬘TAMRA.
sense RNA abrogates gemcitabine-mediated cytotoxic syner-
The PCR reaction mixture consisted of 600 nM of each
gism with CDDP in vitro in human colon cancer cells defective
primer, 200 nM probe, 2.5 units of AmpliTaq Gold polymerase,
in mismatch repair but proficient in nucleotide excision repair
200 ␮M each dATP, dCTP, dGTP, 400 ␮M dUTP, 5.5 mM
(15). In this study, we investigated whether these in vitro find-
MgCl2, and 1⫻ Taqman Buffer A containing a reference dye, to
ings apply in vivo by measuring ERCC1 mRNA levels in pri-
a final volume of 25 ␮l (all reagents were from Applied Bio-
mary NSCLC tissues and correlating these with the clinical systems, Foster City, CA). Cycling conditions were 50°C for
outcomes for patients treated as part of a prospective random- 10 s, 95°C for 10 min, followed by 46 cycles at 95°C for 15 s
ized trial with a combined Gem/CDDP regimen. and 60°C for 1 min. Colon, liver, and lung RNAs (all from
Stratagene, La Jolla, CA) were used as control calibrators on
MATERIALS AND METHODS each plate. All gene expression analyses were performed in a
blinded fashion with the laboratory investigators unaware of the
Patients and Samples. Clinical data were retrieved from
clinical data.
the medical and trial database records of patients with advanced
Statistical Analysis. TaqMan analyses yield values that
NSCLC who were treated with a standardized Gem/CDDP
are expressed as ratios between two absolute measurements
regimen at various hospitals of the SLCG. All patients were
(gene of interest/internal reference gene). The Mann-Whitney t
enrolled in the Gem/CDDP arm of a prospective multicenter test was used to test for significant associations between the
three-arm randomized trial (GECP/98-02), the SLCG Phase III continuous test variable ERCC1 expression and dichotomous
trial of Gem/CDDP versus Gem/CDDP/vinorelbine versus se- variables (patient sex, age above and below the median age,
quential doublets of Gem/vinorelbine followed by ifosfamide/ presence of weight loss, presence of pleural effusion, and tumor
vinorelbine in advanced NSCLC (16). The patients were treated stage). The Kruskal-Wallis test was used to test for significant
between October 1998 and September 2000. All patients re- differences in ERCC1 expressions within multiple groups
ceived Gem 1250 mg/m2 on days 1 and 8 plus CDDP 100 (ECOG performance status and histology). Fisher’s exact test
mg/m2 on day 1 every 3 weeks. Eligibility criteria for GECP/ was used for the analysis of categorical clinicopathological
98-02 were measurable stage IV (with brain metastases eligible values including response and dichotomized ERCC1 values.
if asymptomatic) or stage IIIB (malignant pleural and/or peri- All patients were followed from first study treatment until
cardial effusion and/or supraclavicular adenopathy) NSCLC and death or until the data were censored, with the patient consid-
ECOG performance score 0 –2. ered to be alive as of April 2001. Kaplan-Meier survival curves
All patients had chest X-ray and a computed tomography and the log-rank test were used to analyze univariate distribu-
scan of the chest and upper abdomen before entry into the study tions for survival and disease-free survival. The maximal ␹2
and underwent repeat evaluations at least every 6 weeks. Tumor method of Miller and Siegmund (20) and Halpern (21) was
response was assessed according to WHO criteria as complete adapted to determine which expression value best segregated
response, partial response, stable disease, and progressive dis- patients into poor and good prognosis subgroups (in terms of
ease. Tumors were reassessed during treatment with the same likelihood of surviving), with the log-rank test as the statistic
imaging methods used to establish the baseline tumor measure- used to measure the strength of the grouping. To determine a P
ment. All patients gave signed informed consent, and the study that would be interpreted as a measure of the strength of the
was approved by the institutional ethics review boards. Archival association based on the maximal ␹2 analysis, 1000 boot-strap-
primary tumor specimens from each patient were retrieved from like simulations were used to estimate the distribution of the
2288 ERCC1 Expression and Survival in NSCLC

Table 1 Patient characteristics

n (%)
No. of patients 56 (100)
Sex
Male 48 (85.7)
Female 8 (14.3)
Age, yr
Median 60.5
Range 32–75
ECOG performance status
0 13 (23.2)
1 35 (62.5)
2 8 (14.3)
Weight loss 21 (37.5)
Stage
IIIB 16 (28.6)
IV 40 (71.4)
Pleural effusion 11 (19.6)
Histopathology
Adenocarcinoma 30 (53.6)
Squamous cell carcinoma 20 (35.7) Fig. 1 Kaplan-Meier survival curve for patients with intratumoral
Large cell carcinoma 4 (7.1) ERCC1 levels above and below the median ERCC1 level.
Unspecified 2 (3.6)
Response
Complete response 3 (5.4)
Partial response 18 (32.1)
Stable disease 8 (14.3) levels were significantly higher in squamous cell carcinomas
Progressive disease 18 (32.1) (median, 8.6) compared with adenocarcinomas (median, 5.2;
Not evaluablea 9 (16.1) P ⫽ 0.015, Mann-Whitney test).
a
Due to early death or malignant pleural effusion. Response to Chemotherapy. The tumor response fre-
quencies for the 47 patients who were evaluable for response are
shown in Table 1. The overall response rate was 44.7%. The
ERCC1 expression levels in the complete response and partial
maximal ␹2 statistics under the hypothesis of no association response, i.e., “responding” tumors (median, 4.3; range, 1.2–
(21). Cox’s proportional hazards modeling of factors that were 24.6) were not significantly different from the levels in the
significant in univariate analysis was performed to identify stable disease and progressive disease, i.e., “non-responding”
which factors might have a significant influence on survival. tumors (median, 7.85; range, 0.8 –24.3; P ⫽ 0.31, Mann-Whit-
SPSS version 10.0.5 software (SPSS, Inc., Chicago, IL) was ney test). There were also no significant differences between the
used for all statistical analyses. All Ps were two-sided. proportion of responding and nonresponding tumors with
ERCC1 values greater and less than any ERCC1 level (all
RESULTS Fisher’s exact test). The response rate in tumors with ERCC1
Patient and Tumor Characteristics. Demographic de- expression below the median value (“low” expression, 52%
tails on the 56 patients included in the study and tumor stage and responders) was higher than for tumors with ERCC1 expression
cell type details are shown in Table 1. The median number of above the median value (“high” expression, 36.4% responders;
treatment cycles received was three (range, one to six). Three of Fisher’s exact test, P ⫽ 0.38).
the 56 patients had received radiotherapy, and 5 patients had Association between Patient Overall Survival and
undergone surgical resection of the primary tumor. ERCC1 Levels. The median overall survival time was 36.6
ERCC1 Expression Levels. ERCC1 mRNA expression weeks (range, 0 –113.4 weeks), and the median time to progres-
was detectable in all 56 samples analyzed. The median ERCC1 sion was 24.4 weeks (range, 0 –102.9 weeks). Use of the log-
expression, relative to the expression of the internal control rank test and the maximal ␹2 statistic to identify ERCC1 levels
housekeeping gene ␤-actin, was 6.7 ⫻ 10⫺3 (range, 0.8 ⫻ 10⫺3 that segregated patients into poor and good prognosis subgroups
to 24.6 ⫻ 10⫺3; values shown hereafter without x 10⫺3, e.g., showed that the range of discriminatory values included the
median, 6.7). Twenty-eight (50%) patients had an ERCC1 level median value, which was therefore used as the cutoff value for
greater than the median, and 50% had a level ⬍6.7. There were the survival analysis. Fig. 1 shows the Kaplan-Meier survival
no significant associations between ERCC1 levels and any of curve for patients with intratumoral ERCC1 levels above and
the factors age (P ⫽ 0.66), sex (P ⫽ 0.18), presence of weight below the median ERCC1 level. As shown in Table 2, patients
loss in the 6 months before randomization (P ⫽ 0.74), tumor with ERCC1 levels below the median had a significantly longer
stage (IIIB versus IV; P ⫽ 0.39), or presence of pleural effusion median survival of 61.6 weeks (95% CI, 42.4 – 80.7 weeks)
(P ⫽ 0.25, all Mann-Whitney t test). There were also no compared with 20.4 weeks (95% CI, 6.9 –33.9 weeks) for pa-
significant differences between the ERCC1 levels among pa- tients with ERCC1 levels above the median. Adjusted for tumor
tients with different performance status grades (P ⫽ 0.48, stage, the log-rank statistic for the association between low or
Kruskal-Wallis test) or different tumor cell types (all four tumor high ERCC1 expression and overall survival was 3.97, and the P
types, P ⫽ 0.10, Kruskal-Wallis test), but ERCC1 expression was 0.046. The unadjusted log-rank results are shown in Table 2.
 Clinical Cancer Research 2289

Table 2 Factors associated with overall survival

Univariable analysis Multivariable analysis
Median Log-rank Hazard ratio
survival (wk) statistic P (95% CI) P
ERCC1 expression
Lowa 62 6.78 0.009 0.32 (0.14–0.71) 0.005
Higha 20
Weight loss
Absent 46 8.89 ⬍0.003 0.36 (0.17–0.75) 0.007
Present 14
ECOG performance status (0 vs. 1 or 2)
0 61 10.29 ⬍0.005 0.26 (0.09–0.76) 0.014
1 31
2 5
a
ERCC1 expression values are categorized according to whether there was less than the ERCC1 median value of 6.7 (“low expression”) or
greater than the median (“high expression”).

An ERCC1 cutoff value of 5.8 was tested because this after the trial was closed, the clinical data were collected pro-
value was shown in a previous study to be associated with spectively under the conditions of a multicenter randomized
overall survival for patients with gastric cancer (9). Overall trial, and the laboratory work was performed in a blinded
survival was significantly better for the group of NSCLC pa- fashion. Furthermore, other studies have also found an associ-
tients in this study with ERCC1 levels ⬍5.8 (median, 74.71 ation between lower intratumoral ERCC1 expressions and im-
weeks; 95% CI, 71.77–77.66 weeks) compared with those with proved clinical outcomes for patients treated with platinum-
ERCC1 levels ⬍5.8 (median, 61.0 weeks; 95% CI, 45.61–76.39 containing regimens. Metzger et al. (9) found a significant
weeks; unadjusted log-rank statistic, 6.37; P ⫽ 0.011). association between ERCC1 levels and survival after CDDP/5-
Other factors that were significantly associated with overall fluorouracil therapy for patients with gastric cancer. Metzger et
survival on univariable analysis using Kaplan Meier survival al. (9) used a cutoff ERCC1 mRNA expression value of 5.8,
curves and the log-rank test were the presence of pretreatment which also divided patients in a statistically significant way into
weight loss and the ECOG performance status (Table 2). Patient good and poor survival arms in our study, although a higher
age (P ⫽ 0.18), sex (P ⫽ 0.87), tumor stage (P ⫽ 0.99), tumor ERCC1 level was a more powerful discriminator. Dabholkar et
cell type (SCC versus adenocarcinoma P ⫽ 0.63), and presence al. (26) reported that patients with ovarian cancer who were
of pleural effusion (P ⫽ 0.71) were not significant prognostic clinically resistant to platinum-based therapy had a statistically
factors for overall survival. ERCC1 level, ECOG performance significant 2.6-fold higher expression level of ERCC1 in their
status, and weight loss remained significant prognostic factors tumor tissue than patients who responded to that therapy. A
for survival in the Cox proportional hazards regression model further study showed that both ERCC1 and XPAC (the human
multivariable analysis (Table 2). Ps for a Cox regression model excision repair gene that corrects the defect in xeroderma pig-
stratified on tumor stage were 0.038 for ERCC1, 0.017 for mentosum group A cells) were important for response to plati-
weight loss and 0.02 for ECOG performance status (perform- num-based chemotherapy in ovarian cancer tissues (8). Other
ance status 0 versus 1 or 2). studies have also reported associations between higher ERCC1
expressions and worse clinical outcomes for CDDP-based ther-
DISCUSSION apy for esophageal cancer (27, 28) and for oxaliplatin/5-fluorou-
This study found an association between lower ERCC1 racil treatment for colorectal cancer (29).
mRNA expression levels and improved survival after treatment In addition to associations with survival outcomes, several
with a combination Gem/CDDP regimen for patients with ad- of these studies found associations between ERCC1 expression
vanced stage NSCLC. Experimental studies have shown that and chemoresponse (8, 9, 26, 28, 29). These studies included
high ERCC1 levels are associated with increased removal of patients treated with CDDP but not with Gem. A significant
CDDP-induced DNA adducts and relative CDDP resistance (5), association with response was not found in our study, but this
and ERCC1-defective cells or knockout mice are highly sensi- finding was not unexpected because of the requirement for
tive to DNA cross-linking agents (22, 23). Lee et al. (24) ERCC1 for CDDP/Gem synergism (15). Despite this require-
showed that transfecting ERCC1 into a UV repair-deficient ment, ERCC1 levels remain important, as indicated by the
[ERCC1(⫺)] Chinese hamster ovary cell line conferred DNA association with survival and the trend toward a lower response
adduct repair capability and CDDP resistance. These findings rate in patients with high ERCC1 mRNA tumor levels. It is also
suggest that the likely explanation for our results is that intra- noteworthy that the 52% response rate in the low ERCC1 group
tumoral ERCC1 levels are associated with the effectiveness of is considerably higher than the 21– 40.6% response rates re-
CDDP therapy because ERCC1 expression influences ERCC1- ported in other CDDP/Gem NSCLC randomized trials (14,
mediated DNA adduct repair activity (25). 30 –32).
Confidence in our results is derived from the fact that, Cisplatin- or carboplatin-containing regimens have been
although the genetic analysis was performed retrospectively considered a standard of care in the therapy of advanced stage
2290 ERCC1 Expression and Survival in NSCLC

NSCLCs for ⬎15 years (1). Recently, randomized studies have 9. Metzger, R., Leichman, C. G., Danenberg, K. D., Danenberg, P. V.,
sought to determine whether nonplatinum combinations of Lenz, H. J., Hayashi, K., Groshen, S., Salonga, D., Cohen, H., Laine, L.,
newer agents were either more efficacious or less toxic. Results Crookes, P., Silberman, H., Baranda, J., Konda, B., and Leichman, L.
ERCC1 mRNA levels complement thymidylate synthase mRNA levels
have been inconclusive, suggesting that a therapeutic plateau for in predicting response and survival for gastric cancer patients receiving
currently available chemotherapy has been reached (33–38). combination cisplatin and fluorouracil chemotherapy. J. Clin. Oncol.,
Instead, novel therapeutic approaches will likely be required to 16: 309 –316, 1998.
optimize chemotherapy effectiveness in individual patients, and 10. van Moorsel, C. J., Pinedo, H. M., Veerman, G., Bergman, A. M.,
the use of potential molecular predictors of response and sur- Kuiper, C. M., Vermorken, J. B., van der Vijgh, W. J., and Peters, G. J.
vival in individual NSCLC patients may well become important Mechanisms of synergism between cisplatin and gemcitabine in ovarian
and non-small-cell lung cancer cell lines. Br. J. Cancer, 80: 981–990,
criteria for chemotherapy selection (39, 40). Recent studies of
1999.
NSCLC cells or tissues have identified several potentially val-
11. Bergman, A. M., Ruiz, V. H. V., Veerman, G., Kuiper, C. M., and
uable chemosensitivity markers in addition to ERCC1 (8, 39, Peters, G. J. Synergistic interaction between cisplatin and gemcitabine
41– 43), but validation of these markers is still required. Another in vitro. Clin. Cancer Res., 2: 521–530, 1996.
potential clinical consequence of our findings is that, as sug- 12. Rosell, R., Tonato, M., and Sandler, A. The activity of gemcitabine
gested by Li et al. (5), pharmacological approaches that inhibit plus cisplatin in randomized trials in untreated patients with advanced
ERCC1 expression may increase cellular sensitivity to CDDP. non-small cell lung cancer. Semin. Oncol., 25: 27–34, 1998.
UCN-01 (7-hydroxylstaurosporine) is a cell cycle checkpoint 13. Edelman, M. J., Quam, H., and Mullins, B. Interactions of gemcit-
abrogator that has been shown to inhibit nucleotide excision abine, carboplatin and paclitaxel in molecularly defined non-small-cell
lung cancer cell lines. Cancer Chemother. Pharmacol., 48: 141–144,
repair, attenuate the interaction of ERCC1 with XPA (7), and 2001.
potentiate CDDP cytotoxicity (44). In the present study, the 14. Cardenal, F., Lopez-Cabrerizo, M. P., Anton, A., Alberola, V.,
multivariate analyses confirmed the strength of the ERCC1 Massuti, B., Carrato, A., Barneto, I., Lomas, M., Garcia, M., Lianes, P.,
mRNA levels, which was even more significant than that of Montalar, J., Vadell, C., Gonzalez-Larriba, J. L., Nguyen, B., Artal, A.,
performance status. Further validation of these findings could and Rosell, R. Randomized Phase III study of gemcitabine-cisplatin
versus etoposide-cisplatin in the treatment of locally advanced or met-
lead to a dramatic change in clinical practice, avoiding unnec-
astatic non-small-cell lung cancer. J. Clin. Oncol., 17: 12–18, 1999.
essary CDDP chemotherapy in almost half of NSCLC patients.
15. Yang, L. Y., Li, L., Jiang, H., Shen, Y., and Plunkett, W. Expression
The Preliminary Genotypic International Lung Trial, a prospec- of ERCC1 antisense RNA abrogates Gemicitabine-mediated cytotoxic
tive randomized trial testing the importance of ERCC1 expres- synergism with cisplatin in human colon tumor cells defective in mis-
sion and other factors for CDDP effectiveness in NSCLC pa- match repair but proficient in nucleotide excision repair. Clin. Cancer
tients, is under way. Res., 6: 773–781, 2000.
16. Alberola, V., Camps, C., Provencia, M., Rosell, R., Vadell, C.,
Bover, I., Rui Zcasado, A., Azagra, P., Jiménez, U., González-Larriba,
REFERENCES J., Cardenal, F. A. A., Carrato, A., Morales, S., and Sánchez, J. Cispla-
1. Bunn, P. A., Jr., and Kelly, K. New chemotherapeutic agents prolong tin/Gemcitabine (CG) versus cisplatin/Gemcitabine/vinorelbine (CGV)
survival and improve quality of life in non-small cell lung cancer: a versus sequential doublets of Gemcitabine/vinorelbine followed by if-
review of the literature and future directions. Clin. Cancer Res., 4: osfamide/vinorelbine (GV/IV) in advanced NSCLC: results of a Spanish
1087–1100, 1998. Lung Cancer Group Phase III trial (GEPC/98-02). Proc. Am. Soc. Clin.
Oncol., 20: 308a, 2001.
2. Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in
non-small cell lung cancer: a meta-analysis using updated data on 17. Lord, R. V., Salonga, D., Danenberg, K. D., Peters, J. H., De-
individual patients from 52 randomised clinical trials. Br. Med. J., 311: Meester, T. R., Park, J. M., Johansson, J., Skinner, K. A., Chandrasoma,
899 –909, 1995. P., DeMeester, S. R., Bremner, C. G., Tsai, P. I., and Danenberg, P. V.
Telomerase reverse transcriptase expression is increased early in the
3. Reed, E. Platinum-DNA adduct, nucleotide excision repair and plat-
Barrett’s metaplasia, dysplasia, adenocarcinoma sequence. J. Gastroin-
inum based anti-cancer chemotherapy. Cancer Treat. Rev., 24: 331–344,
test. Surg., 4: 135–142, 2000.
1998.
18. Gibson, U. E., Heid, C. A., and Williams, P. M. A novel method for
4. Reardon, J. T., Vaisman, A., Chaney, S. G., and Sancar, A. Efficient
real time quantitative RT-PCR. Genome Res., 6: 995–1001, 1996.
nucleotide excision repair of cisplatin, oxaliplatin, and bis-aceto-
ammine-dichloro-cyclohexylamine-platinum(IV) (JM216) platinum 19. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. Real time
intrastrand DNA diadducts. Cancer Res., 59: 3968 –3971, 1999. quantitative PCR. Genome Res., 6: 986 –994, 1996.
5. Li, Q., Yu, J. J., Mu, C., Yunmbam, M. K., Slavsky, D., Cross, C. L., 20. Miller, R., and Siegmund, D. Maximally selected ␹2 statistics.
Bostick-Bruton, F., and Reed, E. Association between the level of Biometrics, 38: 1011–1016, 1982.
ERCC-1 expression and the repair of cisplatin-induced DNA damage in 21. Halpern, J. Maximally selected ␹2 statistics for small samples.
human ovarian cancer cells. Anticancer Res., 20: 645– 652, 2000. Biometrics, 38: 1017–1023, 1982.
6. Yu, J. J., Lee, K. B., Mu, C., Li, Q., Abernathy, T. V., Bostick- 22. Westerveld, A., Hoeijmakers, J. H., van Duin, M., de Wit, J., Odijk,
Bruton, F., and Reed, E. Comparison of two human ovarian carcinoma H., Pastink, A., Wood, R. D., and Bootsma, D. Molecular cloning of a
cell lines (A2780/CP70 and MCAS) that are equally resistant to plati- human DNA repair gene. Nature (Lond.), 310: 425– 429, 1984.
num, but differ at codon 118 of the ERCC1 gene. Int. J. Oncol., 16: 23. Melton, D. W., Ketchen, A. M., Nunez, F., Bonatti-Abbondandolo,
555–560, 2000. S., Abbondandolo, A., Squires, S., and Johnson, R. T. Cells from
7. Jiang, H., and Yang, L. Y. Cell cycle checkpoint abrogator UCN-01 ERCC1-deficient mice show increased genome instability and a reduced
inhibits DNA repair: association with attenuation of the interaction of frequency of S-phase-dependent illegitimate chromosome exchange but
XPA and ERCC1 nucleotide excision repair proteins. Cancer Res., 59: a normal frequency of homologous recombination. J. Cell Sci., 111:
4529 – 4534, 1999. 395– 404, 1998.
8. Dabholkar, M., Vionnet, J., Bostick-Bruton, F., Yu, J. J., and Reed, 24. Lee, K. B., Parker, R. J., Bohr, V., Cornelison, T., and Reed, E.
E. Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue Cisplatin sensitivity/resistance in UV repair-deficient Chinese hamster
correlate with response to platinum-based chemotherapy. J. Clin. Inves- ovary cells of complementation groups 1 and 3. Carcinogenesis (Lond.),
tig., 94: 703–708, 1994. 14: 2177–2180, 1993.
 Clinical Cancer Research 2291

25. Chaney, S. G., and Sancar, A. DNA repair: enzymatic mechanisms Gallo, C., De Placido, S., and Bianco, A. R. Mitomycin C plus vindesine
and relevance to drug response. J. Natl. Cancer Inst., 88: 1346 –1360, plus etoposide (MEV) versus mitomycin C plus vindesine plus cisplatin
1996. (MVP) in stage IV non-small-cell lung cancer: a Phase III multicentre
26. Dabholkar, M., Bostick-Bruton, F., Weber, C., Bohr, V. A., randomised trial. The “Gruppo Oncologico Centro-Sud-Isole”
Egwuagu, C., and Reed, E. ERCC1 and ERCC2 expression in malignant (G. O. C. S. I.). Ann. Oncol., 7: 821– 826, 1996.
tissues from ovarian cancer patients. J. Natl. Cancer Inst., 84: 1512– 35. Gatzemeier, U., Heckmayr, M., Hossfeld, D. K., Kaukel, E., Kos-
1517, 1992. chel, G., and Neuhauss, R. A randomized trial with mitomycin-C/
27. Moore-Joshi, M. H., Danenberg, K. D., Lord, R. V., Johansson, J., ifosfamide versus mitomycin-C/vindesine versus cisplatin/etoposide in
advanced non-small-cell lung cancer. Am. J. Clin. Oncol., 14: 405– 411,
Uetake, H., Danenberg, P. V., and Harpole, D. H., Jr. Low thymidylate
1991.
synthase and ERCC1 gene expressions are associated with increased
survival after neoadjuvant 5-FU/cisplatin/radiotherapy for esophageal 36. Kosmidis, P. A., Bacoyiannis, C., Mylonakis, N., et al. A random-
adenocarcinoma. Proc. Am. Soc. Clin. Oncol., 19: 244A, 2000. ized Phase III trial of paclitaxel plus carboplatin versus paclitaxel plus
gemcitabine in advanced non small cell lung cancer (NSCLC). A
28. Metzger, R., Schneider, P. M., Baldus, S. E., et al. Quantitative
preliminary analysis. Proc. Am. Soc. Clin. Oncol., 19: 488, 2000.
ERCC1 RNA expression identifies non-response to cis-platinum based
neoadjuvant radiochemotherapy for esophageal cancer. Proc. Am. Soc. 37. Yamamoto, N., Fukuoka, M., Nakagawa, K., et al. Randomized
Clin. Oncol., 20: 130a, 2001. Phase II study of docetaxel (DOC) plus cisplatin (CDDP) versus DOC
plus irinotecan in advanced non-small cell lung cancer (NSCLC): A
29. Shirota, Y., Stoehlmacher, J., Brabender, J., Xiong, Y., Uetake, H.,
West Japan Thoracic Oncology Group (WJTOG) study. Ann. Oncol., 11
Danenberg, K. D., Groshen, S., Tsao-Wei, D. D., Danenberg, P. V., and
(Suppl. 4): S107, 2000.
Lenz, H. ERCC1 and thymidylate synthase mRNA levels predict sur-
vival for colorectal cancer patients receiving combination oxaliplatin 38. Van Meerbeeck, J. P., Smit, E. F., Lianes, P., Schramel, F., Lenz,
and fluorouracil chemotherapy. J. Clin. Oncol., 19: 4298 – 4304, 2001. M., Debruyne, C., and Giaccone, G. A EORTC randomized Phase III
trial of three chemotherapy regimens in advanced non-small-cell lung
30. Sandler, A. B., Nemunaitis, J., Denham, C., von Pawel, J., Cormier,
cancer (NSCLC). Proc. Am. Soc. Clin. Oncol., 20: 308a, 2001.
Y., Gatzemeier, U., Mattson, K., Manegold, C., Palmer, M. C., Gregor,
A., Nguyen, B., Niyikiza, C., and Einhorn, L. H. Phase III trial of 39. Rosell, R., Taron, M., and O’Brate, A. Predictive molecular mark-
gemcitabine plus cisplatin versus cisplatin alone in patients with locally ers in non-small cell lung cancer. Curr. Opin. Oncol., 13: 101–109,
advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 18: 2001.
122–130, 2000. 40. Rosell, R., Green, M., and Gumerlock, P. Advances in the treatment
31. Crino, L., Scagliotti, G. V., Ricci, S., De Marinis, F., Rinaldi, M., of non-small cell lung cancer: molecular markers take the stage. Semin.
Gridelli, C., Ceribelli, A., Bianco, R., Marangolo, M., Di Costanzo, F., Oncol., 28: 28 –34, 2001.
Sassi, M., Barni, S., Ravaioli, A., Adamo, V., Portalone, L., Cruciani, 41. Young, L. C., Campling, B. G., Cole, S. P., Deeley, R. G., Gerlach,
G., Masotti, A., Ferrara, G., Gozzelino, F., and Tonato, M. Gemcitabine J. H. Multidrug resistance proteins MRP3. MRP1, and MRP2 in lung
and cisplatin versus mitomycin, ifosfamide, and cisplatin in advanced cancer: correlation of protein levels with drug response and messenger
non-small-cell lung cancer: a randomized Phase III study of the Italian RNA levels. Clin. Cancer Res., 7: 1798 –1804, 2001.
Lung Cancer Project. J. Clin. Oncol., 17: 3522–3530, 1999. 42. Mack, P. C., Gandara, D. R., Bowen, C., Edelman, M. J., Pagli-
32. Schiller, J. H., Harrington, D., Belani, C., Langer, C., Sandler, A., eroni, T., Schnier, J. B., Gelmann, E. P., and Gumerlock, P. H. RB status
Krook, J., Zhu, J., and Johnson, D. H. Comparison of four chemotherapy as a determinant of response to UCN-01 in non-small cell lung carci-
regimens for advanced non-small-cell lung cancer. N. Engl. J. Med., noma. Clin. Cancer Res., 5: 2596 –2604, 1999.
346: 92–98, 2002. 43. Monzo, M., Rosell, R., Sanchez, J. J., Lee, J. S., O’Brate, A.,
33. Georgoulias, V., Papadakis, E., Alexopoulos, A., Tsiafaki, X., Gonzalez-Larriba, J. L., Alberola, V., Lorenzo, J. C., Nunez, L., Ro,
Rapti, A., Veslemes, M., Palamidas, P., Vlachonikolis, I., and the Greek J. Y., and Martin, C. Paclitaxel resistance in non-small-cell lung cancer
Oncology Cooperative Group G. Platinum-based and non-platinum- associated with ␤-tubulin gene mutations. J. Clin. Oncol., 17: 1786 –
based chemotherapy in advanced non-small-cell lung cancer: a random- 1793, 1999.
ised multicentre trial. Lancet, 357: 1478 –1484, 2001. 44. Pollack, I. F., Kawecki, S., and Lazo, J. S. Blocking of glioma
34. Gridelli, C., Perrone, F., Palmeri, S., D’Aprile, M., Cognetti, F., proliferation in vitro and in vivo and potentiating the effects of BCNU
Rossi, A., Gebbia, V., Pepe, R., Veltri, E., Airoma, G., Russo, A., and cisplatin: UCN-01, a selective protein kinase C inhibitor. J. Neu-
Incoronato, P., Scinto, A. F., Palazzolo, G., Natali, M., Leonardi, V., rosurg., 84: 1024 –1032, 1996.
Vol. 10, 4215s– 4219s, June 15, 2004 (Suppl.) Clinical Cancer Research 4215s

Gene Expression as a Predictive Marker of Outcome in Stage

IIB-IIIA-IIIB Non-Small Cell Lung Cancer After
Induction Gemcitabine-Based Chemotherapy
Followed By Resectional Surgery

Rafael Rosell,1 Enriqueta Felip,2 Miquel Taron,1 (65% versus 54%; P ⴝ 0.24), complete resections (94%
Joaquim Majo,3 Pedro Mendez,1 versus 72%; P ⴝ 0.03), lobectomies (71% versus 34%; P ⴝ
0.004), and pathological complete responses (29% versus
Maria Sanchez-Ronco,4 Cristina Queralt,1
0%; P ⴝ 0.00001)
Jose Javier Sanchez,4 and Jose Maestre5 Conclusions: Patients with RRM1 levels in the bottom
1
Institut Catala d’Oncologia, Medical Oncology Service, Hospital quartile benefited significantly from gemcitabine/cisplatin
Germans Trias i Pujol, Barcelona; 2Medical Oncology Service,
3 neoadjuvant chemotherapy, leading us to conclude that
Pathology Department, 4Autonomous University of Madrid, Madrid,
Spain; and 5Department of Thoracic Surgery, Hospital Vall d’Hebron, RRM1 mRNA levels should be additionally validated to
Barcelona proceed with tailored chemotherapy.

ABSTRACT INTRODUCTION
Purpose: The first suggestions of a relationship between The overall 5-year survival of patients with non-small cell
gene mRNA expression and differential sensitivity to gem- lung cancer (NSCLC) has remained at ⬍15% for the past 20
citabine/cisplatin are now emerging. ERCC1, RRM1, and years. For patients with clinical stage IIB (T1–2N1M0 and
XPD are involved in the nucleotide excision repair pathways, T3N0M0), 5-year survival is ⬃25%; for those with stage IIIA
and tumor up-regulation of these genes leads to chemother- (T3N1M0 and T1–2-3N2M0), it is 13%; and for those with
apy failure. In the present study, we have examined the stage IIIB (T4N0 –1-2M0), it bottoms out at 7% (1). Small
potential correlation and predictive value of ERCC1, RRM1, randomized studies of neoadjuvant chemotherapy in stage IIIA
and XPD mRNA expression in resected specimens from 67 (2) or stage IIB-IIIB (3) showed remarkable improvement in
stage IIB, IIIA, and IIIB non-small cell lung cancer patients survival over patients treated either with surgery alone or with
treated with neoadjuvant gemcitabine/platinum followed by surgery followed by adjuvant radiotherapy. Event-free survival
surgery was similar in the two studies: 12.7 (2) and 20 (3) months in the
Experimental Design: ERCC1, RRM1, and XPD expres- neoadjuvant chemotherapy arm and 5.8 (2) and 5 (3) months in
sion was quantified using real-time quantitative reverse the surgery arm.
transcription-PCR. The efficiency of removal of cisplatin DNA adducts by the
Results: A good correlation was found between mRNA nucleotide excision repair (NER) system is assumed to be one of
expression levels of the three genes. For RRM1 levels, pa- the determinants of cisplatin resistance (4, 5). Excision repair
tients in the bottom quartile had a decreased risk of death cross-complementation group 1 (ERCC1) is a single-stranded
compared with those in the top quartile (risk ratio ⴝ 0.30; DNA endonuclease, which forms a tight heterodimer with xe-
P ⴝ 0.033). Median survival for the 17 patients in the bottom roderma pigmentosum complementation group F. Its role in
quartile was 52 months, whereas for the 15 in the top NER is to incise DNA on the 5⬘ side of lesions such as cisplatin
quartile, it was 26 months (P ⴝ 0.018). When the charac- DNA adducts. Overexpression of ERCC1 and other NER genes
teristics of these 17 patients were compared with all of the has been associated with repair of cisplatin-induced DNA dam-
other 50 patients, no differences in initial staging were ob- age and clinical resistance to cisplatin (4 – 8), and repair of
served. However, the 17 patients in the bottom quartile had cisplatin DNA adducts does not occur in the absence of func-
better outcomes, including more radiographic responses tional ERCC1 (4 – 8). Ribonucleotide reductase is responsible
for the reduction of ribonucleotides to their corresponding de-
oxyribonucleotides, providing a balanced supply of precursors
for DNA synthesis and repair. Alterations in ribonucleotide
Presented at the First International Conference on Novel Agents in the reductase levels can have significant effects on such biological
Treatment of Lung Cancer, October 17–18, 2003, Cambridge, Massa- properties of cells as tumor promotion and tumor progression
chusetts. and can potentiate metastasis. It has been reported that transcrip-
Grant support: Eli Lilly & Co., Redes Temáticas de Investigación
Cooperativa de Centros de Cáncer (CO-010), Red de Centros de Epi- tion coupled-NER-deficient cells, with underexpression of xe-
demiologı́a y Salud Pública (RCESP), and by La Fundació Badalona roderma pigmentosum group D (XPD), are hypersensitive to
Contra El Càncer. cisplatin regardless of their global genome-NER status.
Requests for reprints: Rafael Rosell, Medical Oncology Service, Sci- On the basis of these data, we have examined for the first
entific Director of Oncology Research, Institut Català d’Oncologia,
Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916 Barcelona,
time the potential correlation and predictive value of ERCC1,
Spain. Phone: 34-93-497-89-25; Fax: 34-93-497-89-50; E-mail: rrosell@ ribonucleotide reductase subunit M1 (RRM1), and XPD mRNA
[Link]. expression in resected specimens from stage IIB, IIIA, and IIIB
4216s RRM1 mRNA Expression in NSCLC

NSCLC patients treated with neoadjuvant gemcitabine/cisplatin 21 days. Clinical tumor response was evaluated after three
followed by surgery. chemotherapy cycles according to the Eastern Cooperative On-
cology Group criteria for solid-tumor response. A thoracotomy
PATIENTS AND METHODS was performed within 4 –5 weeks after the last chemotherapy
Patients. The present study composed of 67 consecutive cycle; the surgical procedure was based on the extent of tumor
stage IIB-IIIA-IIIB NSCLC patients from one single institution at the time of the initial presentation.
(Hospital Vall d’Hebron, Barcelona, Spain). Initially, surgical Laboratory Methods. Total RNA was recovered from
resection of both primary disease and hilar/mediastinal nodal formalin-fixed, paraffin-embedded surgical specimens using
disease was recommended for patients with stage IIB-IIIA proteinase K digestion and phenol-chloroform extraction as
NSCLC, and patients with potentially resectable T4 N0 lesions described previously (9). After cDNA synthesis XPD, ERCC1,
(stage IIIB) were also eligible for this study. All of the patients and RRM1 expression was analyzed with real-time quantitative
were medically fit to undergo surgical resection, and they un- PCR. Quantification of gene expression was performed using
derwent surgery between September 1998 and December 2002, the ABI Prism 7900HT Sequence Detection System (Applied
after receiving neoadjuvant gemcitabine/platinum chemother- Biosystems, Foster City, CA). The primers and 5⬘-labeled probe
apy. Baseline patient characteristics are shown in Table 1. were as follows: ␤-actin, forward 5⬘ TGA GCG CGG CTA
Patients received three cycles of neoadjuvant chemotherapy; 63 CAG CTT 3⬘, reverse 5⬘ TCC TTA ATG TCA CGC ACG ATT
received cisplatin 100 mg/m2 day 1 and gemcitabine 1250 T 3⬘, and probe 5⬘ ACC ACC ACG GCC GAG CGG 3⬘;
mg/m2 day 1 and 8 every 21 days; and 4 patients with creatinine ERCC1, forward 5⬘ GGG AAT TTG GCG ACG TAA TTC 3⬘,
clearance ⬍60 ml/min received carboplatin area under the reverse 5⬘ GCG GAG GCT GAG GAA CAG 3⬘, probe 5⬘ CAC
curve ⫽ 5 day 1 and gemcitabine 1000 mg/m2 day 1 and 8 every AGG TGC TCT GGC CCA GCA CAT A 3⬘; XPD, forward 5⬘
GCT CCC GCA AAA ACT TGT GT 3⬘, reverse 5⬘ CAT CGA
CGT CCT TCC CAA A 3⬘, probe 5⬘ ACC CTG AGG TGA
CAC CCC TGC G 3⬘; and RRM1, forward 5⬘ ACT AAG CAC
Table 1 Patient characteristics and surgical results for all patients CCT GAC TAT GCT ATC C 3⬘, reverse 5⬘ CTT CCA TCA
Characteristic No. patients % CAT CAC TGA ACA CTT T 3⬘, probe 5⬘ CAG CCA GGA
TCG CTG TCT CTA ACT TGC A 3⬘.
Sex
Female 7 10 Relative gene expression quantification was calculated ac-
Male 60 90 cording to the comparative threshold cycle method (2⫺⌬⌬Ct)
Age, years using ␤-actin as an endogenous control and commercial RNA
Median 64 controls (Stratagene, La Jolla, CA) as calibrators.
Range 45–76
Statistical Methods. Survival curves were obtained by
Histology
Squamous cell carcinoma 29 43 the Kaplan-Meier method, and the difference in survival in
Adenocarcinoma 26 39 subgroups was analyzed using either the log-rank test or Tarone-
Large-cell carcinoma 11 16 Ware test (SPSS 11.5 software). We performed survival analysis
Other 1 1 using Cox proportional hazards models. We assessed the fit of
Initial staging
IIB the hazard models by plotting the cumulative hazard of death
T3N0 6 9 against the Cox-Snell residuals. In addition, we assessed the
IIIA effect of gene mRNA expression on the relative risk (RR) of
T3N1 5 7 death using gene mRNA expression quartiles. All of the statis-
T1N2 —
tical tests were two-sided, and the level of significance was set
T2N2 10 15
T3N2 13 19 at 5%.
IIIB
T4N0 20 30
T4N1 8 12 RESULTS
T4N2 5 7 Radiographic and surgical results are summarized in Table
Chemotherapy regimen
Gemcitabine/cisplatin 63 94 1. Pathological complete response occurred in 5 patients (1
Gemcitabine/carboplatin 4 6 patient with radiographic stable disease and 4 patients with
Radiographic response radiographic partial response to chemotherapy). Median overall
Partial response 38 57 survival for all of the patients was 37.80 months [95% confi-
Stable disease 23 34
dence interval (CI), 27.04 – 48.56 months], and median event-
Progressive disease 6 9
Surgical results free survival for all of the patients was 11.84 months (95% CI,
Complete resection 52 78 5.48 –18.21 months). Thirty-day postoperative mortality was
Incomplete resection 10 15 7.5% (5 patients). This included a bronchopleural fistula result-
Unresectable 5 7 ing in death in 1 patient who underwent a bilobectomy; pneu-
Pathologic complete response 5 7
Surgical procedures monia and respiratory failure occurred in 2 patients who under-
Lobectomy 29 43 went a right pneumonectomy; a fourth patient died from
Pneumonectomy 29 43 respiratory failure after a left pneumonectomy; and the fifth
Bilobectomy 4 6 cause of death was pneumonia after the patient had undergone a
Unresectable 5 7
right upper lobectomy.
 Clinical Cancer Research 4217s

The 52 completely resected patients attained a median DISCUSSION

survival of 45.1 months (95% CI, 24.5– 65.6 months). The 10 In the present study, a good correlation has been found
patients with incomplete resection and the 5 unresectable pa- among ERCC1, RRM1, and XPD gene expression levels, indi-
tients had a significantly shorter survival [6.8 months (95% CI, cating that a single assessment of one of these genes could
5.5– 8.1 months) and 5.6 months (95% CI, 3.6 –7.5 months), provide information about all three. This confirms our previous
respectively; log-rank P ⫽ 0.0001]. Twelve of the 67 patients findings of a strong correlation between ERCC1 and RRM1. We
received postoperative radiotherapy: 5 for residual N2 disease, 3 carried out three different studies, examining individually the
for rib involvement, and the remaining 4 for unresectable dis- role of ERCC1, RRM1, and then both, mRNA expressions in
ease. Relapse occurred in 38 patients (57%). Sites of initial paraffin-embedded pretreatment bronchial biopsies from gem-
failure included only local-regional in 37% (14 of 38), only citabine/cisplatin-treated advanced NSCLC patients. In the first
systemic in 18% (7 of 38), and both local and systemic in 45%
study, median overall survival was significantly longer in pa-
(17 of 38). Of the 24 patients who relapsed at distant sites, 10
tients with low ERCC1-expressing tumors than in those with
had brain metastases.
high ERCC1-expressing tumors (15 versus 5 months; P ⫽
Gene Expression. Significant correlations were found
0.009). ERCC1 mRNA expression, performance status, and
between ERCC1 mRNA expression and XPD mRNA expres-
weight loss were significant independent prognostic factors
sion (r ⫽ 0.48; P ⬍ 0.0001) and between RRM1 mRNA
(10). Then we analyzed RRM1 expression in pretreatment bron-
expression and XPD mRNA expression (r ⫽ 0.48; P ⬍ 0.0001).
chial biopsies from a second group of gemcitabine/cisplatin-
A nearly significant correlation was found between ERCC1
treated advanced NSCLC patients. Median time to progression
mRNA expression and RRM1 mRNA expression (r ⫽ 0.22;
P ⫽ 0.07). For RRM1 mRNA levels, patients in the bottom was 7.6 months for patients with low RRM1 levels and 4.3
quartile had a decreased risk of death compared with those in the months for those with high levels (P ⫽ 0.005). Median survival
top quartile (RR ⫽ 0.30; 95% CI, 0.10 – 0.91; P ⫽ 0.033; Table was 15.5 months for patients with low RRM1 levels and 6.8
2). For XPD mRNA levels, patients in the bottom quartile months for those with high levels (P ⫽ 0.002; Ref. 11). In a
(0.08 – 0.71) had a decreased risk of death compared with those third group of patients, we studied both ERCC1 and RRM1
in the top quartile (1.71–3.78; RR ⫽ 0.40; 95% CI, 0.12–1.37; mRNA expression in pretreatment bronchial biopsies again
P ⫽ 0.145). For ERCC1 mRNA levels, patients in the bottom from gemcitabine/cisplatin-treated advanced NSCLC patients
quartile (2.73– 4.96) had a higher risk of death compared with who were part of a large randomized trial (12). There was a
those in the top quartile (7.45–12.31; RR ⫽ 1.51; 95% CI, strong correlation between ERCC1 and RRM1 mRNA expres-
0.55– 4.10; P ⫽ 0.422) sion levels (r ⫽ 0.4; P ⬍ 0.001). Patients with low RRM1
Significant differences in median survival were observed mRNA levels had significantly longer median survival than
between the 17 patients in the bottom quartile of RRM1 expres- those with high levels (13.7 versus 3.6 months; P ⫽ 0.009).
sion and the 15 in the top quartile (52 versus 26 months; P ⫽ There were no significant differences according to ERCC1
0.018). Of these 17 patients in the bottom quartile, 5 underwent mRNA levels, although there was a tendency to longer median
a pneumonectomy with a median survival of 31.12 months, and survival among patients with low ERCC1 levels. Median sur-
12 underwent a lobectomy with a median survival of 51.97 vival was significantly longer among patients with low levels of
months (P ⫽ 0.191). When the characteristics of these 17 both RRM1 and ERCC1 (not reached) than among those with
patients were examined, no differences in the initial staging high levels of both genes (6.8 months; P ⫽ 0.016; Ref. 13).
were observed in comparison with the remaining 50 patients in These observations confirm the preclinical data in which the
the other 3 quartiles. However, for patients in the bottom quar- overexpression of ribonucleotide reductase confers gemcitabine
tile, radiographic response tended to be higher (65% versus resistance in the human oropharyngeal carcinoma KB cells (14).
54%; P ⫽ 0.24), complete resection was attained more often In the present study, patients with the lowest RRM1 levels
(94% versus 72%; P ⫽ 0.03), and a lobectomy was performed attained better survival, which was also correlated with a high
more often (71% versus 34%; P ⫽ 0.004). Furthermore, path- complete resection rate, with a median survival of 52 months.
ological complete response was observed in 29% of patients in Martini et al. (15) demonstrated for the first time that complete
the bottom quartile versus 0% of the remaining patients (P ⫽ resection was essential for effective disease control and long-
0.00001). No significant differences were observed according to term survival in stage IIIA N2 disease after neoadjuvant chem-
ERCC1 or XPD mRNA levels (data not shown). otherapy. Eighty-nine patients with complete resection had a
median survival of 27 months, a 3-year survival of 41%, and a
5-year survival of 26%, whereas 47 patients with incomplete or
no resection had a median survival of 12 months and a 5%
Table 2 Univariate Cox proportional hazards model of the RRa of survival at 3 and 5 years (15). Several other studies (16 –18)
death associated with RRM1 mRNA expression levels divided have reported a 40% or more 3-year survival in patients with
into quartiles complete resection. Pathological complete remission was also
Quartile RRM1 RR (95% CI) P higher for the group of patients with the lowest RRM1 levels
1 (lowest) 0.40–0.84 0.30 (0.10–0.91) 0.033 (29%), both compared with other patients in this trial (0%) and
2 0.84–1.23 0.76 (0.30–1.90) 0.555 with the average reported in the literature (12%; Ref. 19). We
3 1.23–1.79 0.54 (0.19–1.51) 0.238 did not observe differences in median survival according to
4 (highest) 1.79–5.15 1.00 surgical procedure, although a tendency toward longer survival
a
RR, relative risk; CI, confidence interval. was observed in those patients who underwent a lobectomy.
4218s RRM1 mRNA Expression in NSCLC

Pneumonectomy has been found to be an adverse prognostic the patients never have biopsy, they have only positive cytology.
factor in multivariate analyses (20). This kind of a study should be requested even with targeted
Further prospective research is being carried out to test therapies, to have the tumor or the tissues analyzed at baseline
whether patients with low RRM1 mRNA levels (bottom quar- as a possible parameter. All these studies were analyzed in a few
tile) will obtain the maximum survival benefit from cisplatin patients because there were no means to find more tissue. Even
doublets, whereas those with high levels (top three quartiles) from the 600-patient Italian study, only 100 tumor samples were
could obtain better outcomes when treated with noncisplatin available. This is one of the major pitfalls that we have today. If
doublets. I had the opportunity to reshape the study, I would put RRM1 as
a marker, to test if gemcitabine could be valid in patients with
overexpression with RRM1 with just changing the cisplatin to
OPEN DISCUSSION an antimicrotubule drug. We are also in this study validating the
Dr. Thomas Lynch: Dr. Gandara, you have done a lot of importance of BRCA1.
work in terms of thinking about how one selects chemotherapy. Dr. Paul Bunn: What really needs to happen is to validate
What do you think is the most promising course? these assays. These quantitative PCR tests may not give you the
Dr. David Gandara: Although all of these data are very same result in two different laboratories.
interesting, Dr. Rosell and I have had practical problems in Dr. Rosell: In the study I have presented they have the
terms of how do you apply these to a patient population. The same results. But, a major caveat: this is almost impossible
problem of course is that our patients are very heterogeneous in unless there is a consensus meeting of people involved in the
regard to all of these pathways and that it really takes a large laboratory.
prospectively designed trial to validate some of these of mark- Dr. Bunn: We need to do a large randomized trial: it is
ers. SWOG is now doing a repeat of the Noda study in small cell very costly and the question is whether there are really enough
lung cancer [N. Engl. J. Med., 346:85–91, 2002]. As part of that data to put resources into that type of trial. There should first be
study we are selecting genomic DNA from all the patients to a prospective trial with a reasonable number of patients, where
look at polymorphisms for UGT1A1 and for all of the DNA you are going to give them all of the same treatment to see if this
repair genes. Among 620 patients, we will probably be able to really does predict in a large set of patients. I would submit that
sort out at least that component of the polymorphisms. The NCI trial should have two laboratories doing the laboratory tests, and
Japan has agreed to provide genomic DNA from similar patients they should be blinded. If you can show that the results are
treated there as part as a collaborative project, so we can also see reproducible and predictive, then you could go to a prospective
about interracial differences. trial. It is very difficult to get these samples.
Dr. Eric Rowinsky: Given the extremely low rates of Dr. Rosell: To avoid potential confusion, I will clarify:
polymorphism in the population in regard to any target protein, RNA isolation can be performed in any laboratory. Quantitative
do you really think any of these studies would be able to discern PCR analysis can be performed in any laboratory. It is not
if there are truly functional differences in activity in those necessary to validate. The calibration can be different, because
patients? I think the numbers required, if you really tried to do the values you are providing are completely different from
some calculations, are astounding. I don’t think that can be another laboratory. There could be consensus on the values, but
answered in clinical trials and possibly could be answered in the that is not absolutely necessary.
laboratory if we understood the polymorphisms.
Dr. Gandara: In actuality, we have put incidence into the
statistical design, and we have very good data for the incidence REFERENCES
of the UGT1A1 polymorphism. If European heritage is 13% for 1. Mountain CF. Revisions in the international system for staging lung
cancer. Chest 1997;111:1710 –7.
the 77 genotype, Hispanic 19%, African Americans 15%, and
2. Pass HI, Pogrebniak HW, Steinberg SM, Mulshine J, Minna J.
Japanese 2%, that would predict toxicity from irinotecan, so that Randomized trial of neoadjuvant therapy for lung cancer: interim anal-
could explain a lot of differences between Japan and the US. On ysis. Ann Thor Surg 1992;53:992– 8.
the basis of the incidence of the polymorphisms, we can discern 3. Rosell R, Gómez-Codina J, Camps C, et al. A randomized trial
it with a 620 patient trial. comparing preoperative chemotherapy plus surgery with surgery alone
Dr. Bruce Johnson: I believe the data to support the study in patients with non-small-cell lung cancer. N Engl J Med 1994;330:
design examining the role of ERCC1 was done mostly with 153– 8.
response to gemcitabine, is that correct? Why use docetaxel as 4. Sarries C, Haura EB, Roig B, et al. Pharmacogenomic strategies for
developing customized chemotherapy in non-small-cell lung cancer.
a control arm? Most of your results are based on about 50 Pharmacogenomics 2003;3:763– 80.
patients and with your planned multivariate analysis, I would 5. Rosell R, Lord RVN, Taron M, Reguart N. DNA repair and cisplatin
assume the logistics of doing this trial are incredibly difficult. resistance in non-small cell lung cancer. Lung Cancer 2002;38:217–27.
You have to be able to see a difference between 180 patients. 6. Rosell R, Taron M, Alberola V, Massuti B, Felip E. Genetic testing
Did you think about doing another prospective study with a for chemotherapy in non-small cell lung cancer. Lung Cancer 2003;41:
group that is homogeneously treated, rather than going straight S97–102.
to a randomized study? 7. Rosell R, Crino L, Danenberg KD, et al. Targeted therapy in com-
bination with gemcitabine in non-small cell lung cancer. Sem Oncol
Dr. Rosell: Again, we have much preclinical evidence that 2003;30:19 –25.
is used in the design of this trial. It is still relatively difficult to 8. Rosell R, Taron M, Barnadas A, Scagliotti G, Sarries C, Roig B.
organize clinical trials with mandatory biopsy and a central Nucleotide excision repair pathways involved in cisplatin resistance in
review because in stage IV, as you know, at least one subset of non-small cell lung cancer. Cancer Control 2003;10:297–305.
 Clinical Cancer Research 4219s

9. Krafft AE, Duncan BW, Bijwaard KE, Taubenberger JK, Lichy JH. 15. Martini N, Kris MG, Flehinger BJ, et al. Preoperative chemotherapy
Optimization of the Isolation and amplification of RNA from formalin- for stage IIIa (N2) lung cancer: The Sloan-Kettering experience with
fixed, paraffin-embedded tissuue: the Armed Forces Institute of Pathol- 136 patients. Ann Thorac Surg 1993;55:1365–74.
ogy experience and literatura review. Mol Diagn 1997;3:217–30. 16. Burkes RL, Ginsberg RJ, Shepherd FA, et al. Induction chemother-
10. Lord RVN, Brabender J., Gandara D, et al. Low ERCC1 expression apy with mitomycin, vindesine, and cisplatin for stage III unresectable
correlates with prolonged survival after cisplatin plus gemcitabine non-small-cell lung cancer: Results of the Toronto phase II trial. J Clin
chemotherapy in non-small-cell lung cancer Clin Cancer Res 2002;8: Oncol 1992;10:580 – 6.
2286 –91.
17. Rosell R, Lopez-Cabrerizo MP, Astudillo J. Preoperative chemo-
11. Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pre- therapy for stage IIIA non-small-cell lung cancer. Curr Opin Oncol
treatment biopsies from a three-arm randomized trial in metastatic
1997;9:149 –55.
non-small-cell lung cancer. Oncogene 2003;22:3548 –53.
18. Betticher DC, Schmitz SFH, Totsch M, et al. Mediastinal lymph
12. Alberola V, Camps C, Provencio M, et al. Cisplatin plus gemcit-
abine versus a cisplatin-based triplet versus nonplatinum sequential node clearance after docetaxel-cisplatin neoadjuvant chemotherapy
doublets in advanced non-small-cell lung cancer: A Spanish Lung is prognostic of survival in patients with stage IIIA pN2 non-small-
Cancer Group phase III randomized trial. J Clin Oncol 2003;21: cell lung cancer: A multicenter phase II trial. J Clin Oncol 2003;21:
3207–13. 1752–9.
13. Rosell R, Danenberg KD, Alberola V, et al. Ribonucleotide reduc- 19. Pisters KMW, Kris MG, Gralla RJ, Zaman MB, Heelan RT, Martini
tase messenger RNA expression and survival in gemcitabine/cisplatin- N. Pathologic complete response in advanced non-small-cell lung can-
treated advanced non-small cell lung cancer patients. Clin Cancer Res cer following preoperative chemotherapy: Implications for the design of
2004;10:1318 –25. future non-small-cell lung cancer combined modality trials. J Clin Oncol
14. Goan, Y-G, Zhou B, Hu E, Mi S, Yen Y. Overexpression of 1993;11:1757– 62.
ribonucleotide reductase as a mechanism of resistance to 2,2-difluoro- 20. Martin J, Ginsberg RJ, Venkatraman ES, et al. Long-term results of
deoxycytidine in the human KB cancer cell line. Cancer Res 1999;59: combined-modality therapy in resectable non-small-cell lung cancer.
4204 –7. J Clin Oncol 2002;20:1989 –95.
 Molecular Predictors of Response to Chemotherapy
in Lung Cancer
Rafael Rosell, Miquel Taron, Aurelio Ariza, Agusti Barnadas, Jose Luis Mate, Noemı́ Reguart, Mireia Margelı́,
Enriqueta Felip, Pedro Méndez, and Rosario Garcı́a-Campelo

Overall, chemotherapy falls short of the high expecta- the labile chloro ligands with water molecules.
tions for improved survival in surgically resected non– The charged aquated species are highly reactive,
small cell lung cancer patients and prolonged survival
in the metastatic setting. Conventional chemotherapy
but the chloro-monoaquo species is the most sig-
trials, even those including new cytotoxic drugs or nificant from the perspective of interaction with
novel targeting approaches, are hampered by a lack of DNA at physiological pH. In the case of carbopla-
genetic information. Within the global genomic-repair tin, which is a more stable bidentate cyclobutane-
pathway, overexpression of excision repair cross-com- dicarboxylate ligand, the aquation reaction is
plementing 1 (ERCC1) has been associated with poor
much slower. This reduces drug potency, which
response and survival in cisplatin-treated patients. The
lack of DNA adducts in cell nuclei indicates an efficient thereby requires a greater dose for an equivalent
global genomic repair pathway, which leads to cisplatin antitumor effect.4 As soon as the monoaquated
resistance. Several xeroderma pigmentosum (XP) species of cisplatin is formed, it reacts immediately
genes, including XPD, play an important role in deter- with a DNA base (preferentially N7 of guanine) to
mining the efficiency of the transcription-coupled re-
form a monofunctional adduct. The remaining
pair pathway. XPD polymorphism has been related to
lower DNA repair capacity and enhanced cisplatin sen- chloride ligand linked to platinum in the mono-
sitivity. Other DNA repair systems are the base exci- adduct is then hydrolyzed, and the resulting
sion repair pathway, in which apurinic/apyrimidinic en- aquated species interacts with a second nucleo-
donuclease 1 (Ape 1) plays a pivotal role, and the one- philic site to form DNA cross-links. Both 1,2- and
step repair pathway, where O6ⴚalkylguanine-DNA
1,3-intrastrand DNA cross-links are formed. 1,2-
alkyltransferase (MGMT) has a key function. MGMT
methylation can be assessed in serum DNA. By assess- interstrand cross-links between opposite guanine
ing ERCC1 mRNA, cisplatin adducts, XPD polymor- bases are formed preferentially in 5⬘G-C3⬘ se-
phism, Ape 1, and MGMT, we can obtain a complete quences of both strands. However, mounting evi-
genetic profile, which can be used in real translational dence indicates that intrastrand adducts provide
research.
the strongest basis for the cytotoxic action of cis-
Semin Oncol 31 (suppl A):000-000. © 2004 Elsevier Inc. All
rights reserved.
platin.4
In general, the genetic mechanisms of cancer
chemoresistance are difficult to understand. More-
C ISPLATIN is still the scaffolding of combi-
nation chemotherapy in non–small cell lung
cancer (NSCLC). Results tend to be similar
over, from the clinical point of view, the utility of
genetic tests is limited because of the scarcity of
whether the partner drug is paclitaxel, docetaxel, tumor tissue obtained by bronchoscopy in stage IV
or gemcitabine. Similar results are generally ob- NSCLC patients. In early stages, we can benefit
tained with carboplatin,1 although in a random- from the resected tumor specimens that provide a
ized study, median survival was 8.2 months in the considerable amount of tumor tissue for RNA ex-
paclitaxel/carboplatin arm and 9.8 months in the traction. With laser-captured microdissection, we
paclitaxel/cisplatin arm (hazard ratio, 1.22; P ⫽ can also retrospectively compare tumor cells with
.01).2 Many cytotoxic drugs induce DNA damage
similar to that caused by carcinogens. Covalent
binding of the carcinogen or cytotoxic drug results From the Medical Oncology Service, the Pathology Department,
Hospital Germans Trias i Pujol, Badalona (Barcelona), Spain; the
in the formation of a chemically altered base in
Medical Oncology Service, Hospital Vall d’Hebron, Barcelona,
DNA that is termed an adduct.3 Cisplatin has a Spain; and the Medical Oncology Service, Hospital Juan Canalejo,
rigid structure with two labile chloro and two La Coruña, Spain.
stable ammine ligands in a cis configuration. Like Address reprint requests to Rafael Rosell, MD, Medical Oncology
some alkylating agents, the neutral drug molecule Service, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, Bada-
lona (Barcelona), Spain 08916.
needs to be converted to a reactive form. This © 2004 Elsevier Inc. All rights reserved.
occurs nonenzymatically in solution, where dis- 0093-7754/04/3101-0A03$30.00/0
placement reactions result in stepwise exchange of doi:10.1053/[Link].2003.12.011

Seminars in Oncology, Vol 31, No 1, Suppl A (February), 2004: pp 000-000 1

2 ROSELL ET AL

Fig 1. DNA repair pathways. RNA Pol II, RNA polymerase II; TFIIH, basal transcription factor; ERCC1, excision repair crossing-
complimenting 1; CSA, Cockayne syndrome A; CSB, Cockayne syndrome B; XRCC1, x-ray crossing-complimenting 1; XPA-G,
xeroderma pigmentosum A-G; RPA, replication protein A; MGMT, methylguanylmethyltransferase.

cells of the surrounding stroma to analyze loss of blocks to RNA polymerase II and thus block tran-
heterozygosity. scription.5 These DNA lesions, including cisplatin
To understand the cisplatin mechanisms of re- adducts, are removed by NER. NER can be subdi-
sistance and how to select genetic tests for imme- vided into genetically separable subpathways
diate clinical application, it is mandatory to un- termed transcription-coupled repair (TCR) and
derstand the pathways of cisplatin resistance. In global genomic repair (GGR) (Fig 1).
short, the DNA repair pathways are a common Transcription-coupled repair (or TC-NER) re-
denominator for carcinogenesis and cisplatin resis- pairs transcription-blocking lesions in transcribed
tance. Needless to say, cisplatin resistance could DNA strands of active genes, whereas GGR or
be multifaceted, including decreased drug accumu- (GG-NER) repairs the lesions in the nontran-
lation, enhanced cellular detoxification by ele- scribed strand of active genes and nontranscribing
vated levels of glutathione or metallothionein, and genome.6-8 To understand the numerous acronyms
enhanced DNA repair. used in Figs 1 to 3, it is important to clarify that
our current knowledge of the NER pathway stems
MECHANISMS OF SCANNING DNA FOR
from the study of inherited genetic disorders with
LESIONS AND REPAIR FACTORIES
deficient DNA repair systems. In humans, NER is
Nucleotide Excision Repair Subpathways a major defense against the carcinogenic effects of
DNA repair is crucial for removing cisplatin ultraviolet light from the sun. The severe conse-
adducts. Nucleotide excision repair (NER) is the quences of inborn defects in this repair pathway
essential pathway to protect the host from devel- are apparent from the rare, autosomal recessive
oping lung cancer and, at the same time, to gen- disorder xeroderma pigmentosum (XP). Patients
erate cisplatin resistance. Ultraviolet light and cis- with this disease present with hypersensitivity to
platin induce DNA lesions that are effective sunlight, pigmentary alterations, and premalignant
MOLECULAR PREDICTORS OF RESPONSE 3

Fig 2. Nucleotide excision repair subpathways. RNA Pol II, RNA polymerase II; CSA, Cockayne syndrome A; CSB, Cockayne
syndrome B; XPA-G, xeroderma pigmentosum A-G; TFIIH, basal transcription factor; RPA, replication protein A; ERCC1, excision
repair crossing-complimenting 1; XRCC1, x-ray crossing-complimenting 1.

lesions in the sun-exposed area of the skin, and an defective in functions involved in the TCR sub-
extremely high incidence of skin cancer. Many pathway.9 XP and Cockayne syndrome offer model
patients show accelerated neurodegeneration.9 In systems for investigating molecular mechanisms
terminally differentiated human neurons, GGR is underlying the apoptotic response induced by ul-
markedly attenuated while proficient repair per- traviolet irradiation and cisplatin.11
sists in both strands of expressed genes, and the The left side of Fig 1 shows the TCR pathway,
expression of several genes involved in the inci- where RNA polymerase II is the sensor for cispla-
sion step of NER is upregulated. It has been pos- tin damage.8 When transcribing RNA polymerase
tulated that GGR is switched off in terminally II encounters the lesion, two transcription-coupled
differentiated cells while TCR is maintained.5 In repair-specific factors, CSA and CSB, are impli-
XP, there are at least seven NER-deficient comple- cated for the activation of the common NER mo-
mentation groups: XPA to XPG. These groups are lecular pathway.11,12 The clinical implications of
defective in both NER subpathways.9 Loss of het- TCR lie in the fact that cisplatin-resistant tumors
erozygosity has been detected in several of these show an intact TCR system, while tumors are
groups, to a large degree in ovarian cancer and to sensitive to cisplatin when the TCR subpathway is
a lesser degree in colon and lung cancer.10 deficient. Conversely, the novel cytotoxic drug
Cockayne syndrome, another photosensitive ecteinascidin 743 requires a proficient TCR sub-
disease associated with a NER defect, involves pathway.13,14 In translational clinical trials, pa-
postnatal growth failure, progressive neurologic tients could be assigned to receive cisplatin- or
dysfunction, premature aging, and sun sensitivity, non– cisplatin-based chemotherapy according to
but no cancers. Two complementation groups their TCR status.
have been identified: CSA and CSB. Both are For GGR, the XPC complex is activated. Along
4 ROSELL ET AL

Fig 3. DNA repair pathways and chemoresistance. MMR, mismatch repair; BER, base excision repair; TC-NER, transcription-
coupled nucleotide excision repair; GG-NER, global genomic nucleotide excision repair; OSR, one-step repair; RNA Pol II, RNA
polymerase II; XPD, xeroderma pigmentosum D; MGMT, methylguanylmethyltransferase; Ape 1, apurinic/apyrimidinic endonuclease
1; IHC, immunohistochemistry; ERCC1, excision repair cross-complimenting 1.

with the basal transcription factor (TFIIH), an cancer (Table 1).15-17 The main obstacle to testing
XPG binds to the DNA around the lesion. TFIIH ERCC1 is the scarcity of tumor tissue available for
contains two helicases, XPB and XPD, which open RNA isolation and quantitative polymerase chain
an approximately 30-bp DNA segment around the reaction from bronchoscopy. Conversely, XPD can
damage. This open intermediate is stabilized by be analyzed in constitutional DNA, for example,
replication protein A and XPA. The DNA strand in DNA isolated from peripheral blood lympho-
that contains the damaged base(s) is excised by cytes. In addition, XPD polymorphism has been
the two NER endonucleases, XPG and XPF/exci- related to lower DNA repair capacity in several
sion repair cross-complementing 1 (ERCC1). XPG studies.18 Approximately half of the population
cleaves the damaged DNA strand 3⬘ from the examined have the genotype Lys751Lys and also
lesion, and XPF/ERCC1 cleaves the damaged have Asp312Asp. These patients have a good
strand 5⬘ from the DNA lesion. Finally, the result- DNA repair capacity and therefore are presumably
ing gap is filled in by DNA polymerases in the resistant to cisplatin.18,19 In an epidemiologic
presence of replication factors.12 study matching 341 lung cancer cases with 360
smoker control subjects, a host-cell reactivation
XPD Polymorphism and DNA Repair Capacity assay measuring the activity of the chloramphen-
For translational research purposes, XPD is im- icol acetyltransferase gene was used in cells trans-
portant because it intervenes in both the TCR and fected with plasmids treated with benzo(a)pyrene
the GGR subpathways. Until now, translational diol epoxide. DNA repair capacity was lower in
research has focused on ERCC1 mRNA overex- the lung cancer patients than in the controls. The
pression as an element of the GGR related to variants Gln751Gln and Asn312Asn had subop-
cisplatin resistance in gastric, ovarian, and lung timal DNA repair capacity, with a significant in-
MOLECULAR PREDICTORS OF RESPONSE 5

Table 1. ERCC1 as a Predictive Marker in Gastric, Colorectal, and Non–Small Cell Lung Cancer Patients
Treated With Cisplatin or Oxaliplatin

ERCC1 Survival
Regimen Tumor Patients Cut-off (mos) P Value
2
Cis 100 mg/m on day 1 Gastric cancer15 19 ⬍5.8 NR .03
5-FU 200 mg/m2/day ⫻ 21 days (CI) 19 ⬎5.8 5.4
Oxaliplatin 130/mg/m2 every 21 days Colorectal cancer16 40 ⬍4.9 10.9 ⬍.001
5-FU 200 mg/m2/day ⫻ 21 days (CI) 10 ⬎4.9 1.9
Gem 1,250 mg/m2 on days 1 and 8 NSCLC17 28 ⬍6.7 15 .04
Cis 100 mg/m2 day 1 every 3 weeks 28 ⬎6.7 5

Abbreviations: NSCLC, non–small cell lung cancer; 5-FU, 5-fluorouracil; Gem, gemcitabine; Cis, cisplatin; NR, not reported; CI, continuous
infusion.

crease in the hazard ratio, in contrast with the warranted in such trials to identify the subgroup of
wild-type genotypes both in cases and controls, patients with low DNA repair capacity that could
which exhibited the most proficient DNA repair have lower survival when treated with surgery
capacity.18 The frequency of homozygous variants alone and at the same time could benefit from
is 10% for either codon. In an intermediate group neoadjuvant or adjuvant chemotherapy. In con-
with heterozygous polymorphisms, the frequency trast, patients with high DNA repair capacity
was 40% at either codon. This leads us to speculate could have better survival when treated with sur-
that this group could have an intermediate out- gery alone and could be refractory to neoadjuvant
come. The clinical interest of these findings lies in or adjuvant approaches (Table 2).
their potential usefulness in identifying constitu-
tional DNA from lymphocyte polymorphisms as- Cisplatin DNA Adducts
sociated with suboptimal DNA repair capacity and The absence of measurable cisplatin DNA ad-
their potential role in identifying patients with ducts, indicating a deficiency in the GGR subpath-
better response to cisplatin chemotherapy. way, has been associated with poor outcome in
The relationship between DNA repair capacity NSCLC. In one study, multiple tissues, including
and survival in NSCLC patients treated with cis- ovarian tumor, were obtained at autopsy from
platin-based chemotherapy was recently examined eight patients who had received either cisplatin or
by a host-cell reactivation assay.19 In this study, carboplatin chemotherapy. Cisplatin DNA ad-
patients who had received chemotherapy were di- ducts were detected in most of the tissues exam-
vided into quartiles according to their DNA repair ined, and DNA adduct levels were similar in the
capacity. Patients in the top quartile (DNA repair majority of tissues from the same subject, whether
capacity ⬎9.2%) had a risk of death that was more taken from the bone marrow, liver, brain, or pe-
than two times greater than that of patients in the ripheral nerve.20 The assessment of DNA adduct
bottom quartile (DNA repair capacity ⬍5.8%) levels could become a predictive assay for cisplatin
(P ⫽ .01). Median survival was 8.9 months for and/or radiotherapy. Schaake-Koning et al21 ob-
patients in the top quartile compared with 15.8 served an improvement in survival in patients
months for those in the bottom quartile (P ⫽ .04). with locally advanced NSCLC treated with daily
Intriguingly, among the 36 chemotherapy-naive radiotherapy plus daily cisplatin 6 mg/m2 approx-
patients who underwent curative surgical resec- imately 1 hour before irradiation (20 administra-
tion, there was a slight survival advantage associ- tions for a total of 120 mg/m2) compared with
ated with increased DNA repair capacity. This radiotherapy alone. Three-year survival was 16%
finding could be extremely relevant when inter- for concomitant cisplatin-radiotherapy versus 2%
preting the results of neoadjuvant chemotherapy for radiotherapy alone. Differences in survival ac-
trials in early NSCLC. The assessment of DNA cording to cisplatin DNA adduct levels have been
repair capacity, reflecting the GGR subpathway, is observed in patients treated with concomitant cis-
6 ROSELL ET AL

Table 2. Markers for Customized Cisplatin Therapy in Neoadjuvant or Adjuvant Trials

Poor Candidates Good Candidates

Marker Assay Good Prognosis CTR Poor Prognosis

ERCC1 QPCR Overexpression ⫹⫹ Low expression

Ape 1 IHC Overexpression ⫹⫹ Low expression
DRC HCRA High DRC ⫹⫹⫹ To be assessed
Cisplatin adducts IHC Absence ⫹⫹⫹ Presence

Abbreviations: CTR, chemoresistance; QPCR, quantitative polymerase chain reaction; IHC, immunohistochemistry; DRC, DNA repair
capacity; HCRA, host-cell reactivation assay.

platin-radiotherapy. Dutch investigators22 studied 1) plays an important role. Ape 1 is a multifunc-

27 patients treated with daily cisplatin and radio- tional enzyme mediating repair of ionizing radia-
therapy. For assessing cisplatin DNA adduct lev- tion and alkylating agent–induced DNA damage.
els, buccal cells were collected by wiping the inner Ape 1 acts in base excision repair to hydrolyze
cheek with a cotton swab before cisplatin treat- abasic sites arising from enzymatic removal of
ment and 1 hour after the fifth course of cisplatin. damaged purine and pyrimidine bases. It has a
The immunohistochemical method used for cyto- 3⬘-phosphodiesterase activity that excises deoxyri-
spins enabled cisplatin DNA adducts to be visual- bose fragments and phosphate groups at the 3⬘
ized in nuclei of the buccal cells. Nuclear signal terminus of DNA strand breaks caused by ionizing
intensity (arbitrary units) ranged from 0.4 to 2.8. radiation, yielding a 3⬘-OH substrate for DNA
Striking differences in survival were observed ac- repair synthesis. Nuclear Ape 1 has been related to
cording to DNA adduct levels. Thirteen patients improved survival in resected NSCLC, which can
with low DNA adduct levels (⬍1.16) had a me- be explained by the role of effective base excision
dian survival of 5.2 months, as compared with 14 repair in repairing DNA damage (Table 2).24 In-
patients with high levels (⬎1.16) who had a me- terestingly, immunostaining expression of Ape 1
dian survival of 30.2 months (P ⬍ .0001).22 has been observed in germ cell tumors from tes-
Figures 1 and 223 illustrate the pivotal role of XPD ticular cancer patients. The elevation was corre-
in cisplatin resistance. Elegant experiments show lated with resistance to chemotherapy with bleo-
that molecular deficiencies (in both GGR and TCR mycin.25
subpathways) in primary fibroblasts confer marked
hypersensitivity to cisplatin compared with normal O6-Alkylguanine-DNA Alkyltransferase and One-
primary fibroblasts. These results show that any one Step Repair
deficiency in XPA, XPD, XPF, or XPG confers Finally, serum DNA could be useful for meth-
marked hypersensitivity to cisplatin. Therefore, we ylation assays. The right upper corners of Figs 1
postulate that XPD genotypes Gln751Gln or het- and 3 show the one-step repair pathway as the first
erozygous Lys751Gln or Asn312Asn or Asp312Asn mechanism in detecting DNA damage by alkylat-
could have an enhanced sensitivity to cisplatin. ing agents. Many tumors exhibit overexpression of
the DNA repair enzyme O6⫺alkylguanine-DNA
Base Excision Repair Pathway alkyltransferase (MGMT). In addition, tumors in
Figure 3 summarizes the DNA repair pathways which MGMT is methylated respond better to
in a way that may be applied to patient treatment. BCNU (carmustine). The one-step repair pathway
In the center of the figure, we speculate that XPD (the direct reversal of DNA damage) targets
could be a determinant genetic marker, equivalent 2-chloroethylnitrosoureas, such as carmustine and
to ERCC1. Cisplatin adducts could be a good temozolomide, both of which involve alkylation of
surrogate of the function of GGR. There is also an the O6 site of guanine. One-step repair is per-
additional pathway, the base excision repair, in formed by the repair protein MGMT through di-
which apurinic/apyrimidinic endonuclease (Ape rect removal of an alkyl group from the O6 atom of
MOLECULAR PREDICTORS OF RESPONSE 7

guanine in the DNA of cells exposed to alkylating ERCC1 was overexpressed in almost half of the
agents. With increasing size of the alkyl group (ⱖ patients. Patients with high ERCC1 levels had
ethyl), the relative contribution of MGMT to the significantly better survival rates than those with
repair of O6-alkylguanines in DNA decreases, and lower levels.32 This kind of information is opening
excision repair steps in as a backup modality.23 the gates to understanding the ineffectiveness of
This O6-alkylguanine DNA lesion is highly cyto- adjuvant chemotherapy because patients with
toxic and correlates inversely with the activity of high levels of ERCC1 do not respond to cisplatin-
MGMT, which removes the monofunctional O6 based therapy, yet they have much better survival
adduct from the DNA, limiting response to these rates. We can hypothesize that only the subgroup
cytotoxic drugs. With methylation-specific poly- of patients with low levels of ERCC1, who by
merase chain reaction, 40% of brain tumors definition have a worse prognosis, will paradoxi-
showed no methylated MGMT, which correlated cally respond to cisplatin-based chemotherapy.
with better response and survival in BCNU- Further research is warranted to validate not only
treated patients. Anaplastic astrocytomas were the predictive value of ERCC1 but also that of
also included in this study, and striking differences XPD polymorphism, cisplatin adducts, Ape 1, and
in median time to progression were observed (21 MGMT methylation.
months for methylated v 8 months for unmethyl-
ated gliomas; P ⬍.001).26 Similar methylation pat- ACKNOWLEDGMENT
terns of p16, DAPK, GSTP1, and MGMT in The authors would like to express their gratitude to Drs
paired tumor and serum DNA were observed in Giorgio Scagliotti (Bologna, Italy); Alain Depierre (Besançon,
France); Karin Mattson (Helsinki, Finland); and Gerold Bepler
resected NSCLCs (Table 2).27
(Tampa, FL) for generously providing data from their studies,
and to Renée O’Brate and Lourdes Franquet for assistance with
CLINICAL IMPLICATIONS
the manuscript.
A study of adjuvant chemotherapy failed to
improve survival in comparison with the control REFERENCES
arm of surgery plus postoperative radiotherapy in 1. Schiller JH, Harrington D, Belani CP, et al: Comparison
completely resected stage II/IIIA NSCLC. Median of four chemotherapy regimens for advanced non–small-cell
lung cancer. N Engl J Med 346:92-98, 2002
survival was 39 months in the control arm and 38
2. Rosell R, Gatzemeier U, Betticher DC, et al: Phase III
months in the chemotherapy arm (P ⫽ .56).28 randomised trial comparing paclitaxel/carboplatin with pacli-
Along the same lines, an Italian study failed to taxel/cisplatin in patients with advanced non–small-cell lung
demonstrate an improvement in survival in the cancer: A cooperative multinational trial. Ann Oncol 13:1539-
chemotherapy arm (P ⫽ .58).29 No benefit was 1549, 2002
3. Phillips DH: The formation of DNA adducts, in Alison
obtained with neoadjuvant chemotherapy in a
MR (ed): The Cancer Handbook. London, Nature Publishing
study of stage I-IIIA NSCLC, where median sur- Group, 2002, pp 293-307
vival was 36 months in the chemotherapy arm and 4. Siddik ZH: Mechanisms of action of cancer chemother-
26 months in the control arm (P ⫽ .15).30 How- apeutic agents: DNA-interactive alkylating agents and antitu-
ever, some data suggest that neoadjuvant chemo- mour platinum-based drugs, in Alison MR (ed): The Cancer
Handbook. London, Nature Publishing Group, 2002, pp 1295-
therapy could improve survival. In a study of stage
1313
IIIA or selected IIIB NSCLC, Mattson et al31 5. Hanawalt PC: Controlling the efficiency of excision re-
obtained a 21-month median survival in the che- pair. Mut Res 485:3-13, 2001
motherapy arm versus 14 months in the control 6. May A, Nairn RS, Okumoto DS, et al: Repair of individ-
arm (P ⫽ .0014). In general, it is almost impossible ual DNA strands in the hamster dihydrofolate reductase gene
after treatment with ultraviolet light, alkylating agents, and
to elucidate the role of chemotherapy based on
cisplatin. J Biol Chem 268:1650-1657, 1993
conventional clinical trials. Genetic markers can 7. McKay BC, Ljungman M, Rainbow AJ: Persistent DNA
and should be used to identify the large subgroup damage induced by ultraviolet light inhibits p21waf1 and bax
of patients that can be expected to have a good expression: implications for DNA repair, UV sensitivity and
outcome because of their own efficient DNA re- the induction of apoptosis. Oncogene 17:545-555, 1998
8. Cullinane C, Mazur SJ, Essigmann JM, et al: Inhibition of
pair pathways and, moreover, that will have no
RNA polymerase II transcription in human cell extracts by
response to chemotherapy (Table 2). As an exam- cisplatin DNA damage. Biochemistry 38:6204-6212, 1999
ple, when ERCC1 was analyzed in fresh tissue from 9. Conforti G, Nardo T, D’Incalci M, et al: Proneness to
chemotherapy-naive patients with resected NSCLC, UV-induced apoptosis in human fibroblasts defective in tran-
 FACTORES DE RESISTENCIA
A QUIMIOTERAPIA
EN CÁNCER DE PULMÓN
Miquel Taron
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona

Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
 Factores de resistencia a quimioterapia
en cáncer de pulmón
Miquel Taron
Servicio de Oncología Médica
Institut Català d’Oncologia
Hospital Germans Trias i Pujol, Barcelona

l cáncer de pulmón de célula no pequeña (NSCLC) representa el 80% de los casos de cáncer de
E pulmón. Este tumor es altamente quimiorresistente, metastásico de origen y de mal pronóstico con
una supervivencia global a los 5 años inferior al 15% . Estos datos son todavía más dramáticos en el
grupo de pacientes avanzados (estadios IIIB con efusión pleural y IV), donde la mediana de supervivencia
se sitúa en torno a los 8-10 meses, y sin que exista ninguna combinación de quimioterapia que demuestre
su superioridad frente a otra.
Actualmente los estudios dirigidos a la búsqueda de marcadores genéticos como factores de
resistencia a los distintos agentes de quimioterapia y que permitan la individualización de los tratamientos
son uno de los objetivos prioritarios de la investigación aplicada al enfermo oncológico.
Existen diferentes técnicas basadas en el análisis de DNA, RNA y proteínas que pueden utilizarse
para dirigir este objetivo, aunque cabe destacar que en muchos casos el factor limitante es la baja
disponibilidad de las muestras tumorales. Por ejemplo, en cáncer de pulmón avanzado, únicamente se
dispone de material tumoral procedente de biopsia del 60% de los pacientes. Además, este material
suele obtenerse de muestras fijadas en formol e incluidas en parafina y contiene un número bajo de
células tumorales, lo que dificulta todavía más, desde el punto de vista metodológico, las estrategias
técnicas a desarrollar.
Dentro de los agentes más utilizados en el tratamiento del NSCLC cabe destacar el cisplatino
y carboplatino que son el eje vertebral del tratamiento de quimioterapia en combinación con agentes
antimicrotúbulos (taxanos y alcaloides de la vinca) o gemcitabina. Actualmente, muchos de los estudios
de marcadores de quimiorresistencia se centran en los factores genéticos y epigenéticos relacionados
con la respuesta a estos fármacos. Por ejemplo, existen diferentes vías de reparación del DNA entre
las que cabe destacar la vía Nucleotide Excision Repair (o NER) por su papel fundamental en la capacidad
reparadora del DNA (DNA repair capacity o DRC) y por tanto en la eliminación de los aductos del
platino sobre el DNA limitando su actividad. Dentro de esta vía los genes ERCC1 y XPD son cruciales
en la capacidad de reparación del DNA y también, por tanto, en la respuesta a los tratamientos basados
en agentes platinados. Así, por ejemplo, el análisis de expresión de RNA de ERCC1 por PCR Cuantitativa
(QPCR) en biopsias previas a quimioterapia de pacientes con NSCLC avanzado tratados con
gemcitabina/cisplatino demuestra que los pacientes con niveles elevados de expresión tienen una mediana
de supervivencia de 5 meses, que es significativamente menor en relación a los pacientes con niveles
bajos de expresión, con una mediana de supervivencia de 15 meses, siendo además la expresión de
este gen un factor pronóstico independiente para la supervivencia en el análisis multivariado. Estos
resultados han sido corroborados en otros dos estudios, lo que demuestra la importancia de los niveles
de expresión de este gen en el tratamiento basado en agentes platinados. En base a estos resultados
se está desarrollando un ensayo clínico en NSCLC avanzado (en el seno del Grupo Español de Cáncer
de Pulmón-GECP) donde los pacientes son tratados de forma individualizada atendiendo a los valores

Factores de resistencia a quimioterapia en cáncer de pulmón 197

de expresión de RNA de ERCC1 analizados por QPCR en tejido tumoral obtenido de la biopsia. En
la rama control los pacientes son tratados con taxotere/cisplatino, mientras que en la rama experimental
los pacientes con niveles altos de ERCC1 son tratados con gemcitabina/taxotere (es decir, tratamiento
sin cisplatino) mientras que los pacientes con niveles bajos de expresión del gen son tratados igual que
el grupo control. En la actualidad se han incluido 320 de los 360 pacientes proyectados en este ensayo,
y el análisis interino ha demostrado un beneficio clínico de este tratamiento individualizado y que se
traduce tanto en una mejora del tiempo a la progresión como en la supervivencia.
Otro gen que puede ser utilizado en un modelo de tratamiento individualizado es ribonucleótido
reductasa (RR) M1. RR codifica una enzima limitante en la síntesis de DNA y que participa igualmente
en los procesos de reparación del DNA. La subunidad M1 (RRM1) tiene un papel importante en la
especificidad del substrato, la actividad enzimática y en el metabolismo de la gemcitabina. Igual que en
el ejemplo anterior, la sobrexpresión de RRM1 analizada por QPCR en biopsias obtenidas previas al
tratamiento en pacientes con NSCLC avanzado que han recibido gemcitabina/cisplatino presentan una
supervivencia significativamente menor que aquellos pacientes con niveles de expresión bajos.
Por último, cabe también destacar el papel en cáncer de pulmón de la expresión de BRCA1, un
gen con múltiples funciones y fundamental en la reparación del DNA. El análisis de expresión de este
gen en muestras tumorales quirúrgicas de pacientes en estadios IIB-IIIA-IIIB tratados con quimioterapia
neoadyuvante basada en platino/gemcitabina revela que los pacientes con niveles bajos (cuartil inferior)
tienen una supervivencia significativamente superior a aquellos pacientes con niveles elevados de expresión.
Existen datos en la literatura que demuestran en modelos in vitro que la elevada expresión de BRCA1
hipersensibiliza las células al tratamiento con derivados antimicrotúbulos mientras que comporta resistencia
a los agentes platinados. De esta forma los pacientes con niveles de expresión de BRCA1 altos y por
tanto resistentes a cisplatino, pueden ser tratados con agentes antimiotúbulos como taxol o taxotere
y, por tanto, el análisis de expresión de este gen debe igualmente contribuir a una mejora en la selección
individualizada de los tratamientos de quimioterapia.
Tal y como se ha comentado, el principal obstáculo en el análisis de expresión a nivel de RNA
es la escasez de tejido tumoral que se dispone de muchos pacientes, y acentuado en los pacientes con
NSCLC avanzado. Otras técnicas como el análisis de polimorfismos pueden realizarse a partir de DNA
de linfocitos y permiten por tanto estudiar nuevos marcadores en todos los pacientes con independencia
de su estadio ya que la disponibilidad de muestras en este caso no es limitante. Así, el análisis de
polimorfismos (y en concreto de SNPs o single nucleotide polymorphisms) ha emergido como una nueva
realidad en la búsqueda de factores de quimiorresistencia. Existen muchos genes polimórficos que han
demostrado un importante papel en la respuesta a quimioterapia, como por ejemplo Timidilato sintasa
y respuesta a 5-Fluorouracilo, UGT1A1 y toxicidad a CPT11, e incluso que se han relacionado con
fenómenos trombóticos ([Link]. MTHFR) e incluso el Alzheimer. Además el análisis de SNPs supone
introducir nuevos marcadores de respuesta o de toxicidad desde el punto de vista de la variabilidad
genética de cada individuo.
Por ejemplo, el gen ERCC1 presenta un SNP silente en el codón 118 (C/T) que se ha relacionado
con un mayor o menor grado de expresión del gen. Así, en pacientes con NSCLC avanzado tratados
con taxotere/cisplatino ERCC1-118(C/T) ha demostrado tener un valor predictivo para la supervivencia
en el análisis multivariado: pacientes homocigotos C/C para este gen presentan una mayor supervivencia
(no se alcanza la mediana de supervivencia a los 22 meses de seguimiento) en comparación con los
pacientes C/T o T/T en esta posición (mediana de supervivencia de 9,7 meses) (P = 0.01). Además,
los resultados de un estudio farmacogenómico en 250 pacientes con NSCLC avanzado tratados con
gemcitabina/cisplatino demuestra un beneficio opuesto, donde los pacientes con genotipo T/T tienen

198 Cáncer de pulmón

en este caso mejor supervivencia que los pacientes homocigotos para el alelo ERCC1-118(C). Estos
resultados pueden tener un claro beneficio en la selección del tratamiento basado en este caso en
taxote/cisplatino o gemcitabina/cisplatino en base al análisis de ERCC1-118(C/T).
Otro gen fundamental en la vía de reparación NER es el gen XPD. Diversos estudios han
demostrado que los pacientes portadores de las variantes homocigotas Gln751XPD (aproximadamente
el 12% de la población caucásica) presentan un menor tiempo a la progresión y supervivencia en
relación a los portadores del alelo Lys751XPD cuando son tratados con dobletes basados en cisplatino.
En base a estos resultados, los pacientes homocigotos para el alelo Gln751XPD deben ser tratados
con regímenes que no contengan derivados platinados como por ejemplo gemcitabina/taxotere o
taxotere/CPT-11. Obviamente existen miles de genes polimórficos con potencial aplicación clínica como
son EGF, IL6, RRM1, Cox 2, PPAR-γ, XRCC1, XRCC3, o Ligasa IV entre otros.
Al igual que en el caso de los polimorfismos, el análisis de metilación aberrante de los genes
supresores tumorales supone una nueva aproximación al análisis de factores de resistencia a quimioterapia.
Además, estudios de la literatura y de nuestra propia experiencia han demostrado que existe una
correlación entre los patrones de metilación de múltiples genes analizados en DNA sérico y en DNA
tumoral obtenido de la biopsia o de la pieza quirúrgica del mismo paciente.
Así, por ejemplo, la metilación aberrante del gen FANCF se ha relacionado con la sensibilidad al
cisplatino en cáncer de ovario, y la metilación del gen 14-3-3σ confiere una hipersensibilidad al cisplatino y
a la adriamicina. Estudios de nuestro laboratorio en pacientes con NSCLC avanzado tratados con
gemcitabina/cisplatino demuestran que los pacientes con metilación del gen 14-3-3σ analizado en DNA
sérico presentan un mejor pronóstico en relación a los que no presentan metilación del gen. La pérdida de
expresión del gen PTEN se ha demostrado que es el resultado de la hipermetilación en más del 30% de
glioblastomas, tumores gástricos y NSCLC. La pérdida de PTTEN activa la vía de PI3K/Akt, que se ha asociado
a resistencia a distintos agentes citotóxicos, y por tanto puede ser un marcador general de quimiorresistencia.
Los primeros pasos para la individualización de los tratamientos de quimioterapia a través del
análisis de expresión de distintos genes de reparación del DNA se ha iniciado con éxito, y la
implementación del análisis de expresión de otros muchos genes será esencial para discriminar los
mecanismos genéticos relacionados con la quimiorresistencia. Estos pasos incipientes en la individualización
de los tratamientos de quimioterapia deberán obviamente verse complementados con la inclusión de
nuevos marcadores, nuevos métodos y validarse en estudios prospectivos. De forma similar, estas
estrategias deberán implementarse en el análisis de marcadores de respuesta para las nuevas terapias
dirigidas a dianas específicas o targeted therapies.

Bibliografía
1. Rosell R, Taron M, Ariza A, et al. Molecular predictors of response to chemotherapy in lung cancer.
Semin Oncol 31 (1 Suppl 1), 20-7; 2004.

2. Rosell R, Taron M, Barnadas A, Scagliotti G, Sarries C, Roig B. Nucleotide excision repair pathways
involved in cisplatin resistance in non-small cell lung cancer. Cancer Control, 10(4): 297-305; 2003.

3. Sarries C, Haura E, et al Pharmacogenomic strategies for developing customized chemotherapy

in non-small cell lung cancer. Pharmacogenomics 3(6); 763-780; 2002.

4. Lord R, Brabender J, Gandara D, et al L et al, Low ERCC1 expression correlates with prolonged
survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin. Can. Res;
8; 2286-2291; 2002.

Factores de resistencia a quimioterapia en cáncer de pulmón 199

 5. Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsies from a three-arm
randomized trial in metastatic nonsmall-cell lung cancer. Oncogene 2003; 00:1-6.

6. Rosell R, Danenberg K, Alberola V, et al. Ribonucleotide reductase messenger RNA expression

and survival in Gemcibatine/Cisplatin-Treated advanced Non-Small Cell Lung Cancer patients.
Clin. Can. Res. (10); 1318-1325; 2004.

7. Rosell R, Felip E, Taron M, et al. Gene expression as a predictive marker of outcome in stage
IIB-IIIA-IIIB non-small cell lung cancer after induction gemcitabine-based chemotherapy followed
by resectional surgery. Clin Cancer Res, Jun 15; 10(12): 4215S-9S; 2004.

8. Isla D, Sarries C, Rosell R, et al. Single nucleotide polymorphisms and outcome in docetaxel–cisplatin-
treated advanced non-small-cell lung cancer. Ann Oncol, 15; 1194-1203, 2004.

9. Taron M, Rosell R, Felip E, et al. BRCA1 mRNA Expression Levels as an Indicator of Chemoresistance
in Lung Cancer. Hum Mol Genetics, 2004 (accepted; in press Vol 13, 20).

10. Balaña C, Ramirez JL, Taron M, Roussos Y, Ariza A, Ballester R; Sarries C, Mendez P, Sanchez JJ,
Rosell R. MGMT methylation in serum and tumor DNA predicts response to BCNU but not to
temozolamide plus cisplatin in glioblastoma multiforme. Clin Cancer Res, 9:1461-1468; 2003.

11. JL Ramírez, C. Sàrries, P Lopez de Castro, et al. Methylation patterns and k-ras mutations in tumors
and paired serum of resected NSCLC patients. Cancer Letters, 193(2): 207-216; 2003.

200 Cáncer de pulmón

Factores de resistencia a quimioterapia en cáncer de pulmón 201
202 Cáncer de pulmón
Factores de resistencia a quimioterapia en cáncer de pulmón 203
204 Cáncer de pulmón
 TERAPIA GÉNICA
Noemí Regüart
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona

Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
 Gene therapy and cancer
vaccines for lung cancer
Noemí Regüart
Medical Oncology Service
Institut Català d’Oncologia
Hospital Germans Trias i Pujol, Barcelona

number of cancer vaccine and gene therapy approaches are being evaluated in patients with lung
A cancer. Much of the focus on cancer immunotherapy has been in the area of cancer vaccine
development.
Gene therapy is a strategy involving the transfer of specific genetic sequences into cells to mitigate
disease. The critical components of any cancer gene therapy are indentification of the gene of potential
interest, identification of the relevant cell for gene transfer, and finally, identification of the potential vector
system for the delivery of the genetic material. Gene transfer vectors include both viral (adenovirus,
retrovirus, vaccinia virus, etc) and non-viral (liposomal vectors) agents. Adenoviral vectors are the most
common vectors used in gene transfer since are relatively easy to manufacter and have the ability to
transduce both dividing and non-dividing cells.
The most common gene therapy approaches include “gene replacement therapy” and “gene
inhibition therapy” in an attempt to reverse a malignant phenotipe, “suicide gene therapy” to induce tumor
cell destruction, “immunogene therapy” to modify genetically either the tumor cell or a component of
the immune system to induce a tumor-specific immune response. The largest human gene therapy
experience in lung cancer is with intratumoral gene replacement therapy, predominantly with p53, but
such approaches are limited to locoregional disease control. Clinical trials of intratumoral Ad-p53 gene
transfer combined with chemotherapy or radiation in advanced NSCLC have been reported and leads
to synergistic anti-tumor effects without increasing toxicity(1, 2). Unfortunately intravenous administration
of Ad-p53 as a form of systemic therapy of disseminated NSCLC is unlikely to be a viable treatment
approach because of the immunogenicity of the adenovirus and life-threatening toxicity. A variant of the
p53 gene replacement approach is the use of genetically modified adenoviruses designed to replicate
exclusively in tumor cells with impaired p53 function. One example of such approach is ONYX-015(3).
A second approach to direct targeting for cancer cells is the suicide gene approach which consists in
adenoviral transfer of an encoding prodrug-converting enzyme that transform a systemically administered
nontoxic prodrug into a toxic compound that leads to cell death. One example is the herpes simplex
thymidine kinase (HSV-tk), that converts a nontoxic nucleoside analog in gancilovir(4, 5).
Cancer vaccines incorporate a source of tumor antigens, immunologically relevant, combined with
some type of “adjuvant” to make these tumor antigens more visible to the immune system. In lung cancer,
although a number of antigens are expressed/overexpressed in a subset of patients, the relevant immunologically
dominant antigens are unknown. Cancer vaccine strategies include GM-CSF (GVAX®) gene-modified cancer
cells(6, 7), liposomal MUC1 peptide(8), Mage-3 peptide, nonspecific Mycobacterium vaccae(9), and BEC (ganglioside
GD3 anti-idiotype), among others. Preliminary human trials have demonstrated immune responses as well
as tumor regression in late stage disease and several strategies are moving into late stage clinical development.
However, the challenge remains to develop an immune monitoring system that not only evaluate the the
sensitivity but that correlates with the relevant clinical effect-tumor shrinkage.

Terapia génica 207

Bibliografía
1. Schuler, M, Herrmann, R, De Greve, JL, et al. Adenovirus-mediated wild-type p53 gene transfer in
patients receiving chemotherapy for advanced non-small-cell lung cancer: results of a multicenter
phase II study. J Clin Oncol, 2001; 19(6): 1750-1758.
2. Nemunaitis, J, Swisher, SG, Timmons, T, et al. Adenovirus-mediated p53 gene transfer in sequence
with cisplatin to tumors of patients with non-small-cell lung cancer. J Clin Oncol, 2000; 18(3):
609-622.
3. Nemunaitis, J, Cunningham, C, Buchanan, A, et al. Intravenous infusion of a replication-selective
adenovirus (ONYX-015) in cancer patients: safety, feasibility and biological activity. Gene Ther,
2001; 8(10): 746-759.
4. Sterman, DH, Treat, J, Litzky, LA, et al. Adenovirus-mediated herpes simplex virus thymidine
kinase/ganciclovir gene therapy in patients with localized malignancy: results of a phase I clinical
trial in malignant mesothelioma. Hum Gene Ther, 1998; 9(7): 1083-1092.
5. Sterman, DH, Molnar-Kimber, K, Iyengar,T, et al. A pilot study of systemic corticosteroid administration
in conjunction with intrapleural adenoviral vector administration in patients with malignant pleural
mesothelioma. Cancer Gene Ther, 2000; 7(12): 1511-1518.
6. Nemunaitis, J, Sterman, D, Jablons, D, et al. Granulocyte-macrophage colony-stimulating factor gene-
modified autologous tumor vaccines in non-small-cell lung cancer. J Natl Cancer Inst, 2004; 96(4):
326-331.
7. Salgia, R, Lynch, T, Skarin, A, et al. Vaccination with irradiated autologous tumor cells engineered
to secrete granulocyte-macrophage colony-stimulating factor augments antitumor immunity in
some patients with metastatic non-small-cell lung carcinoma. J Clin Oncol, 2003; 21(4): 624-630.
8. Palmer, M, Parker, J, Modi, S, et al. Phase I study of the BLP25 (MUC1 peptide) liposomal vaccine
for active specific immunotherapy in stage IIIB/IV non-small-cell lung cancer. Clin Lung Cancer,
2001; 3(1): 49-57; discussion 58.
9. O'Brien, ME, Saini, A, Smith, IE, et al. A randomized phase II study of SRL172 (Mycobacterium
vaccae) combined with chemotherapy in patients with advanced inoperable non-small-cell lung
cancer and mesothelioma. Br J Cancer, 2000; 83(7): 853-857.

208 Cáncer de pulmón

Terapia génica 209
210 Cáncer de pulmón
Terapia génica 211
212 Cáncer de pulmón
 CUIDADOS DE ENFERMERÍA
EN LAS NUEVAS
MODALIDADES TERAPÉUTICAS
Ana Jiménez
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona

Contenido:
Ponencia en “PowerPoint”
Cuidados de enfermería en las nuevas modalidades terapéuticas 215
216 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 217
218 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 219
220 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 221
222 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 223
224 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 225
226 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 227
228 Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas 229
 AVANCES EN EL MANEJO
MULTIMODAL DEL CÁNCER
DE PULMÓN NO MICROCÍTICO
Pilar Garrido
Hospital Ramón y Cajal
Madrid

Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
 Avances en el tratamiento
multimodal del cáncer de pulmón
Pilar Garrido
Servicio de oncología médica
Hospital Ramón y Cajal, Madrid

ás de un tercio de los pacientes con cáncer de pulmón no microcítico (CPNM) debutan con
M enfermedad localmente avanzada. Aunque se trata de un grupo muy heterogéneo, hoy en día
sabemos que todos los subgrupos se benefician de un manejo multidisciplinario que incluya quimioterapia
(QT) y tratamiento local (cirugía, radioterapia o ambos).1-5 Tradicionalmente, se ha asociado el estadio IIIA
con un manejo de QT neoadyuvante seguido de cirugía y el estadio IIIB con un manejo de QT y
radioterapia (RT) bien secuencial bien concurrente 6-12. Sin embargo, los límites son imprecisos existiendo
datos que avalan el papel de la cirugía en subgrupos de pacientes con estadio IIIB (sobre todo en
pacientes con T4N0-1) así como del papel de la QT/RT concurrente previa a la cirugía en estadio IIIA.

Estadio IIIA
La publicación en los años 90 de dos estudios fase III que comparaban cirugía frente a quimioterapia
basada en cisplatino seguida de cirugía en pacientes con estadio III resecable supuso un cambio en la
práctica asistencial, al demostrar un beneficio en supervivencia para los pacientes sometidos al tratamiento
combinado13-14. La administración de QT preoperatoria permite, al menos desde un punto de vista
teórico, actuar simultáneamente sobre el tumor conocido (permitiendo de esa forma “testar”, además,
su quimiosensibilidad) y, además, actuar contra la enfermedad micrometastásica que pudiera existir.
Por ello, uno de los aspectos claves en los últimos años ha sido la búsqueda de las combinaciones de
QT más activas y con menor perfil de toxicidad en este contexto15-20. En general, se han testado las
mismas hipótesis que en la enfermedad avanzada (QT basada en platino o no, dobletes con nuevos
fármaco, tripletes, etc.) obteniéndose resultados muy interesantes. Así, la tasa de respuestas objetivas
esperable con un esquema de QT de dos fármacos y que incluya cisplatino está alrededor del 60-
70% y la tasa de resecabilidad supera el 50% en la mayoría de las series. En cualquier caso, siempre
debe hacerse una lectura muy detallada de las características de los pacientes incluidos en la serie
que se analice dado el peso pronóstico tan dispar de algunas de ellas.
Actualmente, también es materia de debate si debe incluirse radioterapia torácica como parte
del tratamiento preoperatorio ya que algunos estudios fase II21-24 utilizando esta estrategia obtienen una
elevada tasa de resecciones y de remisiones completas patológicas, pero a costa de una elevada toxicidad.
En este sentido, en ASCO 2004 se presentaron los datos del único estudio fase III realizado hasta ahora
en el que 558 pacientes con estadio III se aleatorizaban entre recibir cisplatino-etopósido seguido de
cirugía y luego radioterapia o cisplatino-etopósido seguido de tratamiento concurrente con
carboplatino/vindesina y radioterapia fraccionada y luego cirugía25. Las conclusiones del estudio fueron
que, con esta combinación, la asociación de RT preoperatoria no impacta en supervivencia libre de
enfermedad o supervivencia global pero sí incrementa significativamente la tasa de esofagitis severa.
La elección correcta de los pacientes que deben ser sometidos a cirugía también es muy debatida.
Algunos autores propugnan que solo deben ser intervenidos aquellos que obtengan buena respuesta
con el tratamiento de inducción mientras que otros argumentan que la tasa de respuestas radiológicas

Avances en el manejo multimodal del cáncer de pulmón no microcítico 233

no es un buen índice para valorar resecabilidad y que, en ausencia de otras estrategias curativas,
no deben ser excluidos de cirugía esos pacientes. En este sentido, un estudio fase III26 que comparaba
tratamiento de inducción con QT/RT seguido de cirugía frente a tratamiento solo con QT/RT fue
presentado el año pasado en ASCO y luego en el 10º congreso mundial de pulmón (North American
Intergroup Trial 0139). El estudio, realizado sobre 429 pacientes con estadio IIIA N2, demostró mayor
supervivencia libre de enfermedad en la rama que incluía cirugía (mediana 14 versus 11 meses, a 3
años 29% versus 19%) sin diferencia en supervivencia global o patrón de recaída y con una mayor tasa
de muertes relacionadas con el tratamiento en ese brazo (6,9% versus 1,6%). La conclusión de los
autores es que se precisa un mayor seguimiento del estudio para determinar si realmente la cirugía
prolonga la supervivencia de estos pacientes frente al tratamiento bimodal con QT/RT.

Estadio IIIB
Diversos ensayos clínicos randomizados y metaanálisis4-12 han demostrado la superioridad de la quimioterapia
basada en cisplatino asociada a radioterapia frente a la radioterapia sola en pacientes con estadio III
irresecable y buen estado general. Asimismo, las guías NCCN y ASCO recomiendan tratamiento
combinado para esos pacientes2-3. Sin embargo, la estrategia óptima está aún por definir y quedan aún
muchas preguntas por responder (la mejor secuencia de tratamiento, la elección de fármacos, el
fraccionamiento de radioterapia, etc.).
Una vez demostrada la superioridad del tratamiento combinado con QT y RT, la pregunta clave
fue si el tratamiento debía ser concurrente o secuencial. En este sentido, tres estudios fase III con diferentes
combinaciones de fármacos han sido ya comunicados. El primero de ellos, llevado a cabo en Japón
y publicado en 1999 por el West Japan Lung Cancer Group27 aleatorizó 320 pacientes a tratamiento
concurrente o secuencial junto con dos ciclos del esquema MVP (mitomicina 8 mg/m2, vindesina 3 mg/m2
y cisplatino 80 mg/m2). La radioterapia concurrente comenzaba el día 2 y se administraban 56 Gy (2
Gy por fracción, 5 fracciones semanales hasta un total de 14 fracciones seguidas de un periodo de
descanso de 10 días y luego el mismo esquema que al principio). El tratamiento con radioterapia secuencial
se realizaba al finalizar la QT. La tasa de respuestas objetivas fue 84% en el brazo concurrente y 66.4%
en el secuencial (p = 0,0002). La mediana de supervivencia (16,5 vs 13,3 meses) y la supervivencia a
largo plazo (17,9% vs 7,1%) también fueron superiores en el brazo concurrente así como la toxicidad
hematológica. Probablemente debido a la técnica de RT empleada, no hubo diferencias significativas en
la tasa de toxicidad no hematológica severa en este estudio.
Más recientemente, se han comunicado los resultados a largo plazo del estudio americano RTOG
941028-29. Seiscientos once pacientes con estadios II- III irresecables fueron aleatorizados en tres brazos.
Uno de ellos utilizaba cisplatino y vinblastina secuencial con radioterapia torácica que se iniciaba el
día 50, otro recibía el mismo esquema pero de forma concurrente y el último, recibía un esquema
concurrente con radioterapia hiperfraccionada junto a cisplatino y etopósido. La toxicidad no hematológica
aguda grado 3-4, como era de esperar, fue significativamente superior con los esquemas concurrentes
(30%, 48% y 62%, respectivamente) pero no hubo diferencias significativas en las tasas de toxicidad
tardía. Los datos de supervivencia, al igual que en el estudio japonés, fueron favorables al tratamiento
concurrente pero no al brazo con RT hiperfraccionada. Los datos fueron: medianas y supervivencia a
4 años de 14,6 meses y 12% (secuencial), 17 meses y 21% (concurrente) y 15,2 meses y 17% (concurrente
hiperfraccionada).
El tercer estudio fase III30, por el contrario, no demuestra ventaja en la supervivencia (medianas
de 13,8 versus 15,8 meses) siendo, además, la diferencia en toxicidad muy significativa (disfagia severa
0%/24% y esofagitis grado 4 0%/28%)

234 Cáncer de pulmón

 Otros estudios fase II que también analizan esquemas concurrentes con distintas asociaciones de
QT se han comunicado recientemente. Así, el estudio LAMP31 que incluía 258 pacientes y analizaba tres
grupos (tratamiento secuencial, tratamiento de inducción seguido de de tratamiento concurrente y
tratamiento concurrente seguido de tratamiento de consolidación) concluye recomendando el tratamiento
concomitante seguido de la QT adyuvante utilizando la combinación paclitaxel y carboplatino. El estudio
de Zatloukal32 recomienda la combinación de vinorelbina y cisplatino concurrente con radioterapia, tras
comparar en un estudio fase II randomizado este esquema con el mismo pero administrado secuencialmente.
El grupo SWOG33 en su estudio 9594 recomienda cisplatino/etopósido concurrente con radioterapia y
seguido de 3 ciclos de consolidación con docetaxel. Por último, el CALGB34 ha testado diferentes dobletes
(cisplatino vinorelbina, paclitaxel carboplatino y cisplatino gemcitabina) con una estrategia de inducción
previa al tratamiento concurrente que demuestra la factibilidad de esas combinaciones. En cualquier caso,
existen diferentes combinaciones posibles y, si se opta por la estrategia concurrente, es fundamental un
estricto control de la toxicidad sobre todo esofágica y pulmonar.

Conclusiones
El manejo de los pacientes con cáncer de pulmón no microcítico estadio III está en constante evolución
siendo la premisa fundamental que todos se benefician de un manejo multidisciplinario. Quimioterapia,
radioterapia y cirugía son estrategias que deben combinarse para ofrecer a cada paciente la mejor
opción. Sin embargo, la existencia de múltiples aspectos por resolver hace recomendable siempre la
inclusión de los pacientes en ensayos clínicos y, por supuesto y de manera ineludible la valoración
individual de cada uno de ellos por un comité multidisciplinario con experiencia en cáncer de pulmón.

Bibliografía
1. Paesmans M, Berghmans T, Vallot F et al. Treatment with or without chemotherapy for locally
advanced non small cell lung cancer: a systematic review by the European Lung Cancer Working
Party. Lung Cancer 2000; 9 (suppl 1): 90 (abstr 293).
2. Pfister D, Johnson D, Azzoli C et al. American Society Of Clinical [Link] of unresectable
non small cell lung cancer guideline: update 2003. J Clin Oncol 2004; 22: 330-353.
3. Ettinger DS, Cox JD, Ginsberg RJ et al. NCCN non small cell lung cancer practice guidelines.
National Comprehensive Cancer Network. Oncology 1996; 10: (suppl) 81-111.
4. Pritchard RS, Anthony SP: Chemotherapy plus radiotherapy compared with radiotherapy alone
in the treatment of locally advanced, unresectable non small cell lung cancer. A meta-analysis. Ann
Inter Med 1996; 125: 723-729.
5. Non Small Cell Lung Cancer Collaborative Group. Chemotherapy in non small cell lung cancer:
a metaanalysis using updated data on individual patients from 52 randomized clinical trials. Br
Med J 1995; 311: 899-909.
6. Dillman RO, Seagren SL, Propert KJ et al: A randomized trial of induction chemotherapy plus high
dose radiation versus radiation alone in stage III non small cell lung cancer. N Engl J Med 1990; 323:
940-945.
7. Dillman R, Don J, Seagren S et al. Improved survival in stage III non small cell lung cancer: a seven
year follow-up of CALGB 8433 trial. J Nat Cancer Inst 1996; 88: 1210-1215.

Avances en el manejo multimodal del cáncer de pulmón no microcítico 235

 8. Sause WT, Scott C, Taylor S et al: Radiation Therapy Oncology Group (RTOG) 88-08 and Eastern
Cooperative Oncology Group (ECOG) 4588: Preliminary results of a phase III trial in regionally
advanced, unresectable non small cell lung cancer. J Natl Cancer Inst 1995; 87: 198-205.

9. Sause W, Kolesar P, Taylor S et al. Final results of phase III trial in regionally advanced unresectable
non small cell lung cancer. Chest 2000; 117: 358-364.

10. Le Chevalier T, Arriagada R, Quoix E et al: Radiotherapy alone versus combined chemotherapy
and radiotherapy in non-resectable non small cell lung cancer: first analysis of a randomized trial
in 353 patients. J Natl Cancer Inst 1991; 83: 417-423.

11. Schaake-Koning C, van den Bogaert W, Dalesio O et al: Effect of concomitant cisplatin and
radiotherapy on inoperable non small cell lung cancer. N Engl J Med 1992; 326: 524-530.

12. Jeremic B, Shibamoto Y, Acimovic L et al. Hyperfractionated radiation therapy with or without
concurrent low-dose daily carboplatin/etoposide for stage III non small cell lung cancer: a randomized
study. J Clin Oncol 1996: 14: 1065-1070.

13. Rosell R, Gómez Codina J, Camps C et al. A randomized trial comparing preoperative chemotherapy
plus surgery with surgery alone in patients with non-small cell lung cancer. N Engl J Med 1994;
330: 153-158.

14. Roth J, Fosella F, Komaki R et al. A randomized trial comparing perioperative chemotherapy and
surgery with surgery alone in resectable stage IIIA non-Small Cell Lung Cancer. J Natl Cancer
Inst 1994; 86: 673-680.

15. Van Zandwijk N, Smit E, Kranmer G et al. Gemcitabine and cisplatin as induction regimen for
patients with biopsy-proven stage IIIAN2 Non-Small Cell Lung Cancer: a phase II study of the
EORTC lung Cancer Cooperative Group. J Clin Oncol 2000; 18: 2658-2664.

16. Betticher D, Schmitz S, Tötsch M et al. Mediastinal lymph node clearance after docetaxel-cisplatin
neoadjuvant chemotherapy is prognostic of survival in patients with stage IIIA pN2 Non-Small
Cell Lung Cancer: a multicenter phase II trial. J Clin Oncol 2003; 21:1752-1759.

17. Manegold C, Biesma B, Smit H et al. Docetaxel and cisplatin as induction chemotherapy in stage
IIIA N2 non-small cell lung cancer: an EORTC phase II trial (08984). Proc American Soc Clin
Oncol 2004, vol 23, 654a (#7166).

18. Gottfried M, Ramlau R, Krzakowski M et al. Vinorelbine-based triplet with ifosfamide and cisplatin
as induction chemotherapy to increase resection rate in marginally unresectable non-small cell
lung cancer patients. Proc American Soc Clin Oncol 2004, vol 23, 654a, (# 7165).

19. Cappuzzo F, De Marinis F, Nelli F et al. Phase II study of gemcitabine-cisplatin-paclitaxel triplet as

induction chemotherapy in inoperable, locally-advanced non-small cell lung cancer. Lung Cancer
2003; 42, 355-361.

20. Garrido P, Moyano A, Lago J et al. Multidisciplinary approach including surgery in stage IIIB non
small cell lung cancer. Rev Oncología 1999; 1 (suppl 2): 61-69.

21. Albain K, Rush V, Crowley J et al. Long term results after concurrent cisplatin/etoposide plus chest
radiotherapy followed by surgery in bulky stages IIIA(N2) and IIIB non small cell lung cancer: 6
year outcomes from South West Oncology Group study 8805. Proc Am Soc Clin Oncol 1999;
18: 467 a (1801).

236 Cáncer de pulmón

22. Choi N, Carey R, Daly W et al. Potential impact on survival of improved tumor downstaging and
resection rate by preoperative twice-daily radiation and concurrent chemotherapy in stage IIIA
non small cell lung cancer. J Clin Oncol 1997; 15: 712-717.

23. Eberhardt W, Wilke H, Stamatis M et al. Preoperative chemotherapy followed by concurrent

chemoradiation therapy based on hyperfractionated accelerated radiotherapy and definitive surgery
in locally advanced non small cell lung cancer: mature results of a phase II trial. J Clin Oncol 1998;
16: 622-634.

24. Thomas M, Rube C, Semik M et al. Impact of preoperative bimodality induction including twice-
daily radiation on tumor regression and survival in stage III non small cell lung cancer. J Clin Oncol
1999; 17: 1185-1193.

25. Thomas M, Macha H, Ukena D et al. Cisplatin / etoposide followed by twice-daily chemoradiation
versus cisplatin / etoposide alone before surgery in stage III non-small cell lung cancer: a randomized
stage III trial of the German Lung Cancer Cooperative Group. Proc American Soc Clin Oncol
2004, vol 23, 616a (#7004).

26. Albain K, Scout C, Rush V et al. Phase III study of concurrent chemotherapy and full course
radiotherapy versus CT/RT induction followed by surgical resection for stage IIIA (pN2) non-
small cell lung cancer: first outcome analysis of North American Intergroup trial 0139 (RTOG
93-09). Lung Cancer 2003; 41: S4.

27. Furuse K, Fukuoka M, Kawahara M et al: Phase III study of concurrent versus sequential thoracic
radiotherapy in combination with mitomycin, vindesine and cisplatin in unresectable stage III non
small cell lung cancer. J Clin Oncol 1999; 17: 2692-2699.

28. Movsas B, Scott C, Curran W et al. A Quality-adjusted time without symptoms or toxicity
(QTWiST) analysis of RTOG 9410. Proc Amer Soc Clin Oncol 2001; 20; 291a (# 1247).

29. Curran W, Scott C, Langer C, et al. Long-term benefit is observed in a phase III comparison of
sequential versus concurrent chemoradiation for patients with unresected stage III non small cell
lung cancer: Radiation Therapy Oncology Group 9410. Proc Amer Soc Clin Oncol 2003; 22;621
(#2499).

30. Pierre F, Maurice P, Gilles R et al. A randomized phase III trial of sequential chemoradiotherapy
versus concurrent chemo-radiotherapy in locally advanced non small cell lung cancer. GLOT-GFPC
NPC 9501 study. Proc Amer Soc Clin Oncol 2001; 20: abstr 1246.

31. Bonomi P, Curran W, Choy H et al. Randomized 3-arm phase II study of paclitaxel, carboplatin,
and thoracic radiation for patients with stge III NSCLC. Report of Locally Advanced Multimodality
Protocol. Lung Cancer 2003; 41 (Suppl 2), S77 (# 0-263).

32. Zatloukal P, Petruzelka L, Zemanova M et al. Concurrent versus sequential radiochemotherapy

with vinorelbine plus cisplatin in locally advanced NSCLC. A radomized phase II study. Long-term
follow-up data. Lung Cancer 2003; 41 (Suppl 2), S76 (# 0-262).

33. Gandara D, Chansky K, Albain K et al. Consolidation docetaxel after concurrent chemoradiotherapy
in stage IIIB non small cell lung cancer: phase II SWOG 9504. J Clin Oncol 2003; 21 (10): 2004-10.

34. Vokes E, Herndon JE, Crawford J et al: Randomized phase II trial of cisplatin with gemcitabine or
paclitaxel or vinorelbine as induction chemotherapy followed by concomitant chemoradiotherapy
for stage III non small cell lung cancer. J Clin Oncol 2002; 20: 4191-4198.

Avances en el manejo multimodal del cáncer de pulmón no microcítico 237

238 Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico 239
240 Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico 241
242 Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico 243
244 Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico 245
246 Cáncer de pulmón
ACTUALIZACIÓN DEL TRATAMIENTO
DE CÁNCER DE PULMÓN
José Miguel Sánchez Torres
Instituto Catalán de Oncología
Hospital Germans Trias i Pujol
Barcelona

Contenido:
Resumen de la ponencia
Bibliografía
 Actualización del tratamiento
del cáncer de pulmón
José Miguel Sánchez Torres
Servicio de oncología médica
Instituto Catalán de Oncología
Hospital Germans Trias i Pujol, Badalona (Barcelona)

l cáncer de pulmón es la neoplasia más frecuente y la principal causa de muerte por cáncer. Alrededor
E del 80% pertenecen a la variedad histológica de cáncer de pulmón no microcítico (CPNM). De
ellos un tercio son resecables en el momento del diagnóstico. La resección quirúrgica es el tratamiento
estándar en los estadios iniciales de la enfermedad. Sin embargo, sólo el 50% de ellos estará curado a
los 5 años a pesar de la resección completa de la enfermedad. La supervivencia en estos estadios
precoces disminuye en relación directa al tamaño del tumor y a la afectación ganglionar. La supervivencia
a los 5 años oscila entre el 67% en estadio IA (pT1N0) y el 39% en estadio pIIB (pT2 N1)(1).
En la actualidad se está evaluando el efecto de la quimioterapia pre y postoperatoria en los
estadios iniciales resecables de la enfermedad. La quimioterapia preoperatoria podría aumentar la
supervivencia en estadios I y II con respecto a la cirugía sola(2). El papel de la quimioterapia adyuvante
en determinados subgrupos de pacientes ha sido establecido con los resultados de los últimos estudios
completados.
El Grupo Español de Cáncer de Pulmón (GECP) tiene en marcha el ensayo NATCH en pacientes
con estadios iniciales, los cuales son aleatorizados a una de las tres ramas de tratamiento: cirugía sola,
quimioterapia preoperatoria con paclitaxel-carboplatino, o bien quimioterapia postoperatoria. Los resultados
preliminares muestran un claro efecto de la quimioterapia neoadyuvante en la reducción del tamaño
tumoral.
El metaanálisis del año 1995 concluyó que el tratamiento adyuvante con combinaciones basadas
en platinos incrementa la supervivencia a 5 años en un 5% y reduce el riesgo de muerte en un 13%
frente a la resección quirúrgica sola, aunque esta diferencia no alcanzaba la significación estadística
(HR 0,87, P = 0,08)(3).
Estos resultados han sido confirmados por el estudio del grupo IALT (International Adjuvant Lung
Cancer Trial) en pacientes con estadios I, II y III(4). La quimioterapia postoperatoria incrementó la
supervivencia a 5 años de los pacientes en un 4.1% en comparación con los pacientes tratados únicamente
con resección quirúrgica (44,5% vs 40,4%; P < 0,03).
Recientemente, dos estudios aleatorizados demuestran un beneficio estadísticamente significativo de
la quimioterapia adyuvante en estadios precoces. El estudio CALGB 9633, en pacientes con estadio IB
(T2 N0), reportó un beneficio de la quimioterapia postoperatoria con paclitaxel y carboplatino tanto
en la supervivencia global a los 4 años (71% vs 59%, P = 0.028), como en la supervivencia libre de
recaida (61% vs 50%, P = 0,035)(5). En el estudio canadiense, el tratamiento adyuvante con vinorelbina
y cisplatino supuso un incremento del 15% en la supervivencia global (69% vs 54%, P = 0,002), y del
13% en la supervivencia libre de recidiva (61% vs 48%, P = 0,012), ambas a los 5 años, en pacientes
con estadio IB y II(6).

Actualización del tratamiento de cáncer de pulmón 249

 Ahora bien, puesto que sabemos que alrededor de la mitad nunca va a recidivar, un enfoque
racional sería el tratamiento adyuvante solo a los pacientes con alto riesgo de recidiva. El análisis de
marcadores pronósticos podría definir el grupo de pacientes resecados con mayor probabilidad de
recurrencia. En estos pacientes, la identificación de marcadores predictivos genéticos podría identificar
subgrupos quimiorresistentes y quimiosensibles frente a determinados agentes.
La enfermedad localmente avanzada o estadio III supone el 20-30% de los pacientes al diagnóstico.
El estadio IIIA incluye los casos con extensión locorregional T3 N1 y T1-3 N2. A pesar de ser técnicamente
resecables, tienen una supervivencia a los 5 años del 10-15%. Los principales factores pronósticos son
la afectación ganglionar y la resección completa. La quimioterapia neoadyuvante ha demostrado incrementar
la supervivencia de estos pacientes(7, 8). El estadio IIIB incluye pacientes clásicamente considerados
irresecables, cuya supervivencia a los cinco años es del 5%. En estos pacientes la radioterapia concomitante
con quimioterapia, bien precedida de quimioterapia de inducción, o bien seguida de quimioterapia de
consolidación, es el tratamiento que consigue un mayor beneficio en la supervivencia.
El 40-50% de los pacientes tienen una enfermedad en estadio IV o metastático en el momento
del diagnóstico. Los platinos (cisplatino y carboplatino) se consideran el elemento imprescindible en el
tratamiento de estos tumores. Datos procedentes de ocho ensayos que utilizaron tratamiento con
quimioterapia basada en cisplatino mostraron un incremento del 10% en la supervivencia a 1 año y de
1.5 meses en la mediana de supervivencia(3). Después de más de dos décadas de ensayos clínicos
evaluando la eficacia de distintas combinaciones de un platino más otro agente, se ha llegado a lo que
podríamos denominar un techo terapéutico. Un ensayo llevado a cabo por el Southwest Oncology
Group concluyó que la mediana en la supervivencia con vinorelbina-cisplatino era similar a la obtenida
con paclitaxel/carboplatino: 8,1 y 8,6 meses, respectivamente(9). Más recientemente, el Eastern Cooperative
Oncology Group desarrolló un ensayo aleatorizado a cuatro ramas de tratamiento y observó una tasa
global de respuestas del 19%, una supervivencia mediana de 7.9 meses, una supervivencia a 1 año de
33%, y de 11% a los 2 años(10). No se encontraron diferencias en la eficacia de los cuatro esquemas
de quimioterapia basados en platino (cisplatino-paclitaxel, cisplatino-gemcitabina, cisplatino-docetaxel, y
carboplatino-paclitaxel). En el Italian Lung Cancer Project, los pacientes eran aleatorizados a recibir
gemcitabina/cisplatino o paclitaxel/carboplatino o vinorelbina/cisplatino. De nuevo, no se encontraron
diferencias en la tasa de respuestas (30%), tiempo hasta la progresión (4,6 meses), ni en la supervivencia
mediana (9,8 meses)(11).
En este contexto son necesarios nuevos enfoques en el tratamiento del cáncer de pulmón. Uno
sería la investigación de nuevos agentes que actúan contra determinadas dianas moleculares, realizando
su acción en pasos muy específicos del complejo proceso de proliferación y diferenciación celular. Otro
sería la identificación de marcadores genéticos predictivos de quimiorresistencia que nos puedan definir
subgrupos de pacientes que van a poder beneficiarse del tratamiento con determinadas combinaciones
de agentes quimioterápicos.
Las vías de reparación de ADN juegan una importante función en la resistencia a la quimioterapia.
El análisis de la expresión de genes que intervienen en la reparación de ADN puede ayudarnos a
individualizar la combinación óptima de agentes quimioterápicos. Los genes ERCC1 (Excision Repair
Cross-Complementing 1), RR (Ribonucleotide Reductase) y BRCA1 (Breast Cancer 1) intervienen de forma
crucial en las vías de reparación de ADN.
La sobreexpresión de ERCC1 en tejido tumoral se ha asociado con resistencia a cisplatino en
pacientes con CPNM tratados con gemcitabina y cisplatino. La mediana en la supervivencia de los
pacientes con bajo nivel de expresión de ERCC1 fue de 15 meses, mientras que en aquellos con alto
nivel de expresión fue solo de 5 meses (P = 0,009). El análisis multivariable identificó la expresión de

250 Cáncer de pulmón

este gen como factor pronóstico de supervivencia junto con la pérdida de peso y el Performance
Status(12). El GECP está finalizando el reclutamiento de pacientes en un ensayo farmacogenómico
aleatorizado en el que el esquema de quimioterapia en la rama experimental depende de la expresión
de ERCC1: docetaxel-cisplatino si la expresión es baja, y una combinación sin platino si ésta es alta,
docetaxel-gemcitabina. Los datos preliminares indican una mayor eficacia en los pacientes tratados en
la rama experimental.
RR es una enzima limitante clave en la síntesis de ADN. Además la subunidad RRM1 interviene
en el metabolismo de la gemcitabina y en la reparación de ADN. La sobreexpresión de RRM1 se ha
correlacionado con la resistencia a gemcitabina tanto in vitro como en pacientes con CPNM tratados
con cisplatino y gemcitabina.
El análisis en la expresión de RRM1 en biopsias de pacientes italianos tratados dentro de un
ensayo aleatorizado(11), reveló diferencias estadísticamente significativas en la supervivencia del grupo de
pacientes tratados con gemcitabina y cisplatino. La supervivencia mediana fue de 15,5 meses en aquellos
con un nivel bajo de RRM1 y de 6,8 meses en aquellos con un nivel alto (P = 0,0028). El tiempo a
la progresión también resultó superior en los pacientes con niveles bajos (P = 0,05)(13).
Entre 1988 y 2000 el GECP desarrolló un ensayo aleatorizado comparando gemcitabina-
cisplatino versus gemcitabina-cisplatino-vinorelbina versus gemcitabina-vinorelbina seguido de vinorelbina-
ifosfamida(14). En el grupo asignado a gemcitabina-cisplatino, la supervivencia mediana en los pacientes
con baja expresión de RRM1 era superior a la de los que tenían alta expresión en el tejido tumoral:
13,7 meses vs 3,6 meses (P = 0,009), así como el tiempo hasta la progresión: 8,4 meses vs 2,7 meses
(P = 0,020)(15).
BRCA1 es un gen que juega un papel crucial en varias de las vías de reparación del ADN. Su
expresión se ha relacionado con resistencia a quimio y radioterapia. Estudios preclínicos sugieren que
una expresión reducida de BRCA1 incrementa la sensibilidad a agentes que producen un daño en el
ADN, como cisplatino, por promover la reparación del ADN y la supervivencia celular, con inhibición
de la apoptosis. En contraste con este efecto, una expresión elevada de BRCA1 aumenta la sensibilidad
de los agentes antimicrotúbulos por inducir la apoptosis en respuesta a dichos agentes(16)
La expresión reducida de BRCA1 en una línea celular de cáncer de mama determinó una gran
sensibilidad a cisplatino y etopósido y una gran resistencia a agentes que actúan sobre los microtúbulos,
como paclitaxel y vincristina(17). La reconstitución del gen BRCA1 resultó en un incremento en la
resistencia a cisplatino y también en la sensibilidad a agentes antimicrotúbulos(18, 19).
En un grupo de 55 pacientes estadios IIB, IIIA y IIIB que fueron resecados después de recibir
quimioterapia neoadyuvante con gemcitabina y cisplatino se realizó una cuantificación de la expresión
de BRCA1 ARNm en tejido tumoral parafinado, y esta expresión génica se dividió en cuartiles. La
supervivencia no se ha alcanzado en los pacientes en el cuartil con menor expresión de BRCA1, es
de 37.8 meses en los pacientes incluidos en los dos cuartiles medios, y es de 12,7 meses en aquellos
en el cuartil superior, y esta diferencia es estadísticamente significativa (P = 0,01)(20)
Los inhibidores de la tirosín kinasa del receptor del factor de crecimiento epidérmico (EGFR)
son pequeñas moléculas que compiten con el ATP en su unión a la tirosín kinasa del EGFR, con lo cual
inhiben su autofosforilación y la posterior activación en cascada de señalizaciones que conducen a la
multiplicación celular, bloqueando el proceso de proliferación y metastatización. La presencia de mutaciones
en el dominio tirosín kinasa del EGFR se ha identificado como el mayor determinante de respuesta a
agentes inhibidores de dicha tirosín kinasa. Varios trabajos han descrito estas mutaciones y su correlación
con sensibilidad a inhibidores de EGFR. La mayoría de las mutaciones se localizan en los exones 18, 19

Actualización del tratamiento de cáncer de pulmón 251

y 21, y consisten en delecciones y en sustitución de aminoácidos. Estos estudios muestran una alta
frecuencia de mutaciones en pacientes con histología de adenocarcinoma, mujeres, no fumadores y
asiáticos. Aquellos pacientes con mutaciones tratados con un inhibidor de EGFR pueden conseguir una
inusual larga supervivencia(21, 22, 23, 24).
El GECP en su compromiso para mejorar el tratamiento y pronóstico de los pacientes con cáncer
de pulmón, tiene previsto iniciar en los próximos meses varios ensayos clínicos farmacogenómicos con
el objetivo de evaluar la expresión de RRM1 y de BRCA1 como potenciales marcadores predictivos
de quimiorresistencia, tanto en la enfermedad metastásica como en neoadyuvancia y en adyuvancia.
En esta misma línea se contempla el análisis de mutaciones en el dominio tirosín kinasa del EGFR
en el tejido tumoral de los pacientes con histología de adenocarcinoma y posterior tratamiento con
agentes inhibidores del mismo, como gefitinib o erlotinib.
La individualización del tratamiento de acuerdo a la expresión de marcadores predictivos de
respuesta a agentes quimioterápicos y a inhibidores moleculares de la proliferación celular podría mejorar
de forma significativa el pronóstico de los pacientes con cáncer de pulmón, y dará lugar a un cambio
radical en la práctica clínica habitual

Bibliografía
1. Mountain CF. Revisions in the international system for staging lung cancer. Chest 1997; 111: 1710-
1717.
2. Depierre A, Milleron B, Moro-Sibilot D, et al. Preoperative chemotherapy followed by surgery
compared with primary surgery in respectable stage I (except T1N0), II, and IIIa non-small cell
lung cancer. J Clin Oncol 2002; 20: 247-253.
3. Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in non-small cell lung cancer:
a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Br
Med J 1995; 311: 899-909.
4. The International Adjuvant Lung Cancer Trial Collaborative Group. Cisplatin-based Adjuvant
Chemotherapy In Patients With Completely Resected NSCLC, N Engl J Med 2004; 350: 351-360.
5. Strauss GM, Maddaus MA, Johnson EA, et al. Randomized clinical trial of adjuvant chemotherapy
with paclitaxel and carboplatin following resection in stage IB non-small cell lung cancer. Report
of Cancer and Leukemia Group B (CALGB) Protocol 9633. Proc Am Soc Clin Oncol 2004;
23: 7019.
6. Winton TL, Livingston R, Johnson D, et al. A prospective randomized trial of adjuvant vinorelbine
and cisplatin in completely resected stage IB and II non-small cell lung cancer (Intergroup Trial
JBR. 10). Proc Am Soc Clin Oncol 2004; 23: 7018.
7. Rosell R, Gómez Codina J, Camps C et al. A randomized trial comparing preoperative chemotherapy
plus surgery with surgery alone in patients with non-small cell lung cancer et al. N Engl J Med
1994; 330: 153-158.
8. Roth JA, Fossella F, Komaki R et al. A randomized trial comparing perioperative chemotherapy
and surgery with surgery alone in resectable stage IIIA non-small-cell lung cancer. J Natl Cancer
Inst 1994; 86: 673-680.

252 Cáncer de pulmón

 9. Kelly K, Crowley J, Bunn PA, et al. Randomized phase III trial of paclitaxel plus carboplatin versus
vinorelbine plus cisplatin in the treatment of patients with advanced non-small cell lung cancer:
a Southwest Oncology Group trial. J Clin Oncol 2001; 19: 3210-8.

10. Schiller JH, Harrington D, Belani CP, et al. Comparison of four chemotherapy regimens for advanced
non-small-cell lung cancer. N Engl J Med 2002; 346: 92-98.

11. Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III randomized trial comparing three platinum-
based doublets in advanced non-small cell lung cancer. J Clin Oncol 2002; 20: 4285-4291.

12. Lord RVN, Brabender J, Gandara D, et al. Low ERCC1 expression correlates with prolonged
survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin Cancer
Res 2002; 8: 2286-2291.

13. Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsias from a three arm
randomized trial in metastatic non-small cell lung cancer. Oncogene 2003; 22: 3548-3553.

14. Alberola V, Camps C, Provencio M, et al. Cisplatin plus gemcitabine versus a cisplatin-based triplet
versus nonplatinum sequential doublets in advanced non-small cell lung cancer: a Spanish Lung
Cancer Group Phase III randomized trial. J Clin Oncol 2003; 21: 3207-3213.

15. Rosell R, Danenberg KD, Alberola V, et al. Ribonucleotide reductase Messenger RNA expression
and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clin
Cancer Res 2004; 10: 1318-1325.

16. Kennedy RD, Quinn JE, Mullan PB, et [Link] role of BRCA1 in the celular response to chemotherapy.
J Natl Cancer Inst 2004; 96: 1659-1668.

17. Lafarge S, Sylvain V, Ferrara M, et al. Inhibition of BRCA1 leads to increased chemoresistance to
microtubule-interfering agents, an effect that involves the JNK pathway. Oncogene 2001; 20: 6597-
6606.

18. Mullan PB, Quinn JE, Gilmore PM, et al. BRCA1 and GADD45 mediated G2/M cell cycle arrest
in response to antimicrotubule agents. Oncogene 2001; 20: 6123-6131.

19. Quinn JE, Kennedy RD, Mullan PB, et al. BRCA1 functions as a differential modulator of
chemotherapy-induced apoptosis. Cancer Res 2003; 63: 6221-6228.

20. Taron M, Rosell R, Felip E, et al. BRCA1 mRNA expression levels as an indicator of chemoresistance
in lung cancer. Hum Mol Genet 2004; 13: 2443-2449.

21. Lynch TJ, Bell DW, Sordilla R, et al. Activating mutations in the epidermal groth factor receptor
underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004; 350: 2129-
2139.

22 Paez JG. Jänne PA, Lee JC, et al. EGFR mutations in lung cancer : correlation with clinical response
to gefitinib therapy. Science 2004; 304: 1497-1500.

23. Pao W, Miller V, Zukowski M, et al. EGF receptor gene mutations are common in lung cancer
from “never smokers” are associated with sensitivity of tumors to gefitinib and erlotinib. PNAS
2004; 101: 13306-13311.

24. Miguel Taron,Yukito Ichinose, Rafael Rosell, et al. Activating mutations in the tyrosine kinase domain
of the epidermal growth factor receptor are associated with gefitinib response in chemorefractary
lung adenocarcinomas. Clin Cancer Res 2005 (in press).

Actualización del tratamiento de cáncer de pulmón 253

La edición de esta publicación ha sido posible gracias a la colaboración de: