Tabla 3. Nuevos primers diseñados para las regiones ITS nrDNA.

Se muestran los nombres de los

primers utilizados en la amplificación de ADN, su secuencia de nucleótidos sentido 5´-3´ y estudios de
referencia para los taxones evaluados. Las categorías se indican según el orden del mapa nuclear de genes
ARN ribosomales (small subunit SSU, 5.8S, large subunit LSU) y las regiones espaciadoras fungal
internal transcribed spacer: ITS1 (entre SSU y 5.8S) y ITS2 (entre 5.8S y LSU).
Categoría Primer Secuencia 5´- 3´ Fuente
SSU (forward) ITS1 TCCGTAGGTGAACCTGCGG White et al. (1990)
ITS1-F_KYO1 CTHGGTCATTTAGAGGAASTAA Toju et al. (2012)
ITS1-F_KYO2 TAGAGGAAGTAAAAGTCGTAA Toju et al. (2012)
ITS-u1 GGAAGKARAAGTCGTAACAAGG Cheng et al. (2016)
5.8S (reverse) ITS2 GCTGCGTTCTTCATCGATGC White et al. (1990)
ITS2_KYO1 CTRYGTTCTTCATCGDT Toju et al. (2012)
ITS2_KYO2 TTYRCTRCGTTCTTCATC Toju et al. (2012)
ITS-u2 GCGTTCAAAGAYTCGATGRTTC Cheng et al. (2016)
5.8S (forward) ITS3* GCATCGATGAAGAACGCAGC White et al. (1990)
fITS9 GAACGCAGCRAAIIGYGA Ihrmark et al. (2012)
fITS7 GTGARTCATCGAATCTTTG Ihrmark et al. (2012)
gITS7 GTGARTCATCGARTCTTTG Ihrmark et al. (2012)
ITS3_KYO1 AHCGATGAAGAACRYAG Toju et al. (2012)
ITS3_KYO2 GATGAAGAACGYAGYRAA Toju et al. (2012)
ITS-u3 CAWCGATGAAGAACGYAGC Cheng et al. (2016)
ITS-p3 YGACTCTCGGCAACGATA Cheng et al. (2016)
UniPlantF TGTGAATTGCARRATYCMG Moorhouse-Gann et al. (2018)
LSU (reverse) ITS4* TCCTCCGCTTATTGATATGC White et al. (1990)
ITS4_KYO3 CTBTTVCCKCTTCACTCG Toju et al. (2012)
ITS-u4 RGTTTCTTTTCCTCCGCTTA Cheng et al. (2016)
ITS-p4 CCGCTTAKTGATATGCTTAAA Cheng et al. (2016)
UniPlantR CCCGHYTGAYYTGRGGTCDC Moorhouse-Gann et al. (2018)

En los códigos de barras de ADN vegetal, el ensamblaje de bibliotecas de

referencia de especies conocidas ha sido uno de los objetivos más importantes (Chase &
Fay 2009; Hollingsworth et al. 2011). Aunque hasta la fecha se han codificado un total
de 71.780 especies de plantas según Barcode of Life Data Systems (BOLD), la cobertura
de especies es todavía muy pequeña (aproximadamente el 23 % del total de especies de
plantas) (Ratnasingham & Hebert 2007). Las mejoras en el desarrollo de primers
nuevos más específicos y diseñados para contribuir a la construcción de bibliotecas de
referencia más completas y reguladas (Chen et al. 2010, Ihrmark et al. 2012,
Moorhouse-Gann et al. 2018, Cheng et al. 2016, Toju et al. 2012). En Tabla 3 se
muestran nuevos primers diseñados para las regiones ITS nrDNA que pueden ser de
interés para diferenciar plantas de hongos y resultar en mayor cobertura en plantas
versus hongos, basidiomicetos versus ascomicetos, (Chen et al. 2010, Ihrmark et al.
2012, Moorhouse-Gann et al. 2018, Cheng et al. 2016, Toju et al. 2012), y dentro de
diferentes familias de plantas como las que posean un mayor contenido de hongos
micorrízicos que puedan contaminar la amplificación del taxón principal de la evidencia
vegetal. Además, los genes nucleares (como la región ITS2) son indispensables para las
inferencias evolutivas y los códigos de barras de ADN, ya que los marcadores
mitocondriales o de cloroplasto heredados uniparentalmente solo pueden revelar la
evolución de uno de los padres (Cheng et al 2016). La existencia de la región
conservadora 5.8S entre ITS1 e ITS2 hace que el uso de ambos o de toda la región ITS
sea muy flexible y potente incluso para moldes de ADN altamente degradados (Young
& Coleman 2004).
Como sustitutos del clásico conjunto de primers ITS1/ITS2 específico para
hongos [White et al 1990], los cebadores ITS1-F_KYO1 e ITS1-F_KYO2 (Tabla 3) se
diseñaron para la amplificación más selectiva de secuencias fúngicas y obtuvieron una
identificación con éxito del 98% de cobertura, mayor en comparación a los primers más
comunes que mostraron una identificación con un éxito de cobertura del 90% [Toju et
al. 2012]. ITS1-F_KYO1 se puede utilizar de forma específica para hongos, a expensas
de la universalidad, mientras que ITS1-F_KYO2 es un cebador de mayor cobertura que
puede amplificar también con plantas superiores u otras evidencias vegetales. Los
primers reverse para 5.8S: ITS2_KYO1 y ITS2_KYO2 (Tabla 3), mostraron más del
98% de éxito en la identificación, en condiciones de un solo mismatch de error,
superando al primer ITS2 más comúnmente utilizado (94% de cobertura). Igualmente,
los primers forward para 5.8S: ITS3_KYO1 y ITS3_KYO2 (Tabla 3) también
mostraron más del 98% de éxito, bajo condiciones de 1 mismatch. El primer reverse
ITS4_KYO1 (Tabla 3), de la subunidad ribosomal grande LSU (28S), mostró un valor
alto de éxito de identificación con la misma equiparación que mostró el primer ITS4,
comúnmente utilizado en la amplificación de la región ITS2. Hay que tener en cuenta
que en el estudio de Toju et al. (2012) se intentaban identificar en su totalidad las
especies del reino fungi, analizando muestras provenientes de cualquier ambiente,
incluido del suelo, no siendo tal dimensión necesaria en el laboratorio clínico.
 Ihrmark et al. (2012)24 diseñaron los primers forward fITS7, gITS7 y fITS9 a
partir de varios sitios diana del gen codificante 5.8S para generar amplicones más cortos
que mejoren la eficiencia de reacción PCR. El primer fITS9 (f de fungi) se superpone
parcialmente con la región diana del primer ITS3 [White et al. 1990] y amplifica
favorablemente hongos, aunque también otras evidencias vegetales; el fITS7 se
degeneró en una posición para obtener mayor especificidad para hongos, mejorando la
identificación de especie en comparación con fITS9. El primer gITS7 también amplifica
plantas superiores, pudiéndose utilizar en muestras que puedan contener mezcla de otros
componentes. Estos primers son muy útiles al tratar con muestras problemáticas,
degradadas, escasas (cuyo producto de reacción sea menor de 200 bp) o con presencia
de inhibidores, evitando también obtener quimeras de PCR (más de un amplicón por
fragmento diana de PCR deseado) que causen problemas en la identificación [Irhmark et
al 2012]
Los primers presentados por Cheng et al. 2016 (ITS-u1, ITS-u2, ITS-u3, ITS-u4)
se diseñaron con el objetivo de usarse universalmente para todas las plantas. Son
especialmente útiles para identificar secuencias mezcla con técnicas de secuenciación de
nueva generación (NGS). Por el contrario, Cheng et al. 2016 también diseñaron primers
específicos para plantas (ITS-p3, ITS-p4) utilizando regiones diana que difieren
significantemente entre hongos y plantas. Por último, los primers UniPlantF y
UniplantR diseñados por Moorhouse et al. 2018 han demostrado ser de gran utilidad en
muestras degradadas recogidas de excremento y contenido gástrico. La investigación
con nuevos primers diseñados, como los propuestos en Tabla 3, sería ayuda para poder
discernir taxones de ambos reinos (Fungi y Plantae), (Chen et al. 2010, Ihrmark et al.
2012, Moorhouse-Gann et al. 2018, Cheng et al. 2016, Toju et al. 2012, Han et al. 2013,
Li et al. 2015, Timpano et al. 2020), incluso en muestras de interés forense siendo tipo
mezcla o degradadas.

En conclusión, la región ITS2 nrDNA posee un poder diferenciador muy alto que
permite identificar a nivel de especie para la mayoría de las evidencias forenses, incluso
degradadas, tanto en plantas terrestres como en hongos (macromicetos)de casuística y
muestras-control, y se propone como herramienta de rutina en los casos con evidencia
vegetal.
 5. Bibliografía.

[1] M.G. Simpson, Plant Anatomy and Physiology, Plant Systematics, Elsevier
Academic Press, 2005, pp. Capítulo 10.

[2] P.A. Keddy, Plants and Vegetation, Cambridge: Cambridge University Press. 2007.

[3] Y. Liu, C. Xu, W. Dong, X. Yang, S. Zhou, Determination of a criminal suspect

using environmental plant DNA metabarcoding technology, Forensic Sci.Int. 324
(2021) 110828.

[4] H. Miller Coyle, C. Ladd, T. Palmbach, H.C. Lee, The Green Revolution: botanical
contributions to forensics and drug enforcement, Croat.Med.J. 42 (2001) 340-345.

[5] Tuukka Mäkelä, Jaana Wallin, Rebecca Bucht, Sami Huhtala, Environmental
forensics a questionaire to ENFSI Laboratories: Handling of environmental crime cases
in forensic laboratories. EAFS 2022 Stockholm European Perspective. (2022).

[6] H. Miller Coyle, C. Lee, W. Lin, H.C. Lee, T.M. Palmbach, Forensic botany: using
plant evidence to aid in forensic death investigation, Croat.Med.J. 46 (2005) 606-612.

[7] R.E. Gaensslen Dr., H. Harris, H.C. Lee, Introduction to Forensic Science and
Criminalistics, McGraw-Hill Education 2008.

[8] Wildlife Forensic Science, E. Dormontt, A. Lowe, B. Degen, Standards and

guidelines for forensic botany identification. 2023 (2013).

[9] ENFSI, Best Practice Manual for the Application of Molecular Methods for the
Forensic Examination of Non-Human Biological Traces. ENFSI-BPM-APS-01 Versión
1, 2015.

[10] H.M. Coyle, P. Massey, P. Valentin, Forensic Botany, Forensic Ecology

Handbook, 2012, pp. 169-181.

[11] V. Hofstetter, B. Buyck, G. Eyssartier, S. Schnee, K. Gindro, The unbearable

lightness of sequenced-based identification, Fungal Diversity. 96 (2019) 243-284.

[12] L. Hawksworth David, Lücking Robert, Fungal Diversity Revisited: 2.2 to 3.8
Million Species, Microbiology Spectrum. 5 (2017) 5.4.10.
[13] E.C. Vellinga, T.W. Kuyper, J. Ammirati, D.E. Desjardin, R.E. Halling, A. Justo,
et al., Six simple guidelines for introducing new genera of fungi, IMA Fungus. 6 (2015)
A65-A68.

[14] L. Wilson-Wilde, Combating wildlife crime, Forensic Science, Medicine, and

Pathology. 6 (2010) 149-150.

[15] N. Hanley, K.M. Mikac, Wildlife crime in Croatia, Forensic.Sci.Med.Pathol. 16

(2020) 702-704.

[16] S. Gouda, R.G. Kerry, A. Das, N.S. Chauhan, Wildlife forensics: A boon for
species identification and conservation implications, Forensic Sci.Int. 317 (2020)
110530.

[17] C.M. Bertea, P. Luciano, S. Bossi, F. Leoni, C. Baiocchi, C. Medana, et al., PCR
and PCR–RFLP of the 5S-rRNA-NTS region and salvinorin A analyses for the rapid
and unequivocal determination of Salvia divinorum, Phytochemistry. 67 (2006) 371-
378.

[18] M.L. Warner, N.C. Kaufman, O. Grundmann, The pharmacology and toxicology of
kratom: from traditional herb to drug of abuse, Int.J.Legal Med. 130 (2016) 127-138.

[19] G. Guzman, M.L. Castro, Observations on some known species of Psilocybe

(Basidiomycotina, Agaricales, Strophariaceae) from Spain and description of a new
species, 27. (2003) 181-187.

[20] T. Maruyama, M. Kawamura, R. Kikura-Hanajiri, H. Takayama, Y. Goda, The

botanical origin of kratom (Mitragyna speciosa; Rubiaceae) available as abused drugs in
the Japanese markets, Journal of Natural Medicines. 63 (2009) 340-344.

[21] R. Houston, M. Birck, S. Hughes-Stamm, D. Gangitano, Evaluation of a 13-loci

STR multiplex system for Cannabis sativa genetic identification, Int.J.Legal Med. 130
(2016) 635-647.

[22] P. Martínez Fernández, Botánica Forense, Manual de Criminalística y

Criminología, Tébar Flores S.L., 2020, pp. 235-264.
[23] J. Frigerio, G. Agostinetto, V. Mezzasalma, F. De Mattia, M. Labra, A. Bruno,
DNA-Based Herbal Teas' Authentication: An ITS2 and psbA-trnH Multi-Marker DNA
Metabarcoding Approach, Plants (Basel). 10 (2021) 2120. doi:
10.3390/plants10102120.

[24] S. Epis, C. Matinato, G. Gentili, F. Varotto, C. Bandi, D. Sassera, Molecular

detection of poisonous mushrooms in different matrices, Mycologia. 102 (2010) 747-754.

[25] P.D.N. Hebert, A. Cywinska, S.L. Ball, J.R. deWaard, Biological identifications
through DNA barcodes, Proceedings of the Royal Society of London.Series B:
Biological Sciences. 270 (2003) 313-321.

[26] CBOL Plant Working Group, P.M. Hollingsworth, L.L. Forrest, J.L. Spouge, M.
Hajibabaei, S. Ratnasingham, et al., A DNA barcode for land plants, Proceedings of the
National Academy of Sciences. 106 (2009) 12794-12797.

[27] S. Sharma, J.K. Jossan, R. Singh, DNA Barcoding in Forensic Mycology:

Concepts, Limitations, and Future Prospects, in: Shrivastava P., Dash H.R., Lorente
J.A., Imam J. (Eds.), Forensic DNA Typing: Principles, Applications and
Advancements, Springer Singapore, Singapore, 2020, pp. 431-448.

[28] X. Li, Y. Yang, R.J. Henry, M. Rossetto, Y. Wang, S. Chen, Plant DNA barcoding:
from gene to genome, Biol.Rev.Camb.Philos.Soc. 90 (2015) 157-166.

[29] J. Sokołowska, H. Fuchs, K. Celiński, Assessment of ITS2 Region Relevance for

Taxa Discrimination and Phylogenetic Inference among Pinaceae, Plants (Basel). 11
(2022) 1078. doi: 10.3390/plants11081078.

[30] S. Chen, H. Yao, J. Han, C. Liu, J. Song, L. Shi, et al., Validation of the ITS2
Region as a Novel DNA Barcode for Identifying Medicinal Plant Species, PLOS ONE.
5 (2010) e8613.

[31] R. Vilgalys, D. Gonzalez, Organization of ribosomal DNA in the basidiomycete

Thanatephorus praticola, Curr.Genet. 18 (1990) 277-280.

[32] J. Han, Y. Zhu, X. Chen, B. Liao, H. Yao, J. Song, et al., The Short ITS2 Sequence
Serves as an Efficient Taxonomic Sequence Tag in Comparison with the Full-Length
ITS, BioMed Research International. 2013 (2013) 741476.
[33] T.J. White, T. Bruns, S. Lee, J. Taylor, 38 – Amplification and Direct Sequencing
of Fungal Ribosomal RNA Genes for Phylogenetics, in: Innis M.A., Gelfand D.H.,
Sninsky J.J., White T.J. (Eds.), PCR Protocols, Academic Press, San Diego, 1990, pp.
315-322.

[34] E.K. Timpano, M.K.R. Scheible, K.A. Meiklejohn, Optimization of the second
internal transcribed spacer (ITS2) for characterizing land plants from soil, PLoS One.
15 (2020) e0231436.

[35] K. Ihrmark, I.T.M. Bödeker, K. Cruz-Martinez, H. Friberg, A. Kubartova, J.

Schenck, et al., New primers to amplify the fungal ITS2 region--evaluation by 454-
sequencing of artificial and natural communities, FEMS Microbiol.Ecol. 82 (2012) 666-
677.

[36] H. Toju, A.S. Tanabe, S. Yamamoto, H. Sato, High-coverage ITS primers for the
DNA-based identification of ascomycetes and basidiomycetes in environmental
samples, PLoS One. 7 (2012) e40863.

[37] T. Cheng, C. Xu, L. Lei, C. Li, Y. Zhang, S. Zhou, Barcoding the kingdom Plantae:
new PCR primers for ITS regions of plants with improved universality and specificity,
Mol Ecol Resour. 16 (2016) 138-149.

[38] R. Moorhouse-Gann, J.C. Dunn, N. de Vere, M. Goder, N. Cole, H. Hipperson, et

al., New universal ITS2 primers for high-resolution herbivory analyses using DNA
metabarcoding in both tropical and temperate zones, Scientific Reports. 8 (2018) 8542.

[39] M. Kowalczyk, A. Sekuła, P. Mleczko, Z. Olszowy, A. Kujawa, S. Zubek, et al.,

Practical aspects of genetic identification of hallucinogenic and other poisonous
mushrooms for clinical and forensic purposes, Croat.Med.J. 56 (2015) 32-40.

[40] K.G. Nugent, B.J. Saville, Forensic analysis of hallucinogenic fungi: a DNA-based
approach, Forensic Sci.Int. 140 (2004) 147-157.

[41] T.A. Hall, BioEdit: A User-Friendly Biological Sequence Alignment Editor and
Analysis Program for Windows 95/98/NT, Nucleic Acids Symposium Series. 41 (1999)
95-98.
[42] M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H.
McWilliam, et al., Clustal W and Clustal X version 2.0, Bioinformatics. 23 (2007)
2947-2948.

[43] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994)
4673-4680.

[44] R.H. Nilsson, Five simple guidelines for establishing basic authenticity and
reliability of newly generated fungal ITS sequences, MycoKeys. 4 (2012) 37-63.

[45] H.A. Raja, A.N. Miller, C.J. Pearce, N.H. Oberlies, Fungal Identification Using
Molecular Tools: A Primer for the Natural Products Research Community, J.Nat.Prod.
80 (2017) 756-770.

[46] P. Martínez Fernández, O. Quintela, E. del Valle, B. Pérez-Gómez, Genetic

identification and subsequent LC-QTOF MS analysis of plant remains (Oenanthe spp.)
could prove the cause of an undetermined sudden death, Int.J.Legal Med. 135 (2021)
1407-1411.

[47] China Plant BOL Group, D. Li, L. Gao, H. Li, H. Wang, X. Ge, et al., Comparative
analysis of a large dataset indicates that internal transcribed spacer (ITS) should be
incorporated into the core barcode for seed plants, Proc.Natl.Acad.Sci.U.S.A. 108
(2011) 19641-19646.

[48] S. Govorushko, R. Rezaee, J. Dumanov, A. Tsatsakis, Poisoning associated with

the use of mushrooms: A review of the global pattern and main characteristics, Food
Chem.Toxicol. 128 (2019) 267-279.

[49] S.P. Elliott, A case of fatal poisoning with the aconite plant: quantitative analysis in
biological fluid, Sci.Justice. 42 (2002) 111-115.

[50] M. Ellenhorn, D. Barceloux, Medical Toxicology—Diagnosis and Treatment of

Human Poisoning. Elsevier Science Publishing Co. (1988).

[51] U. Mengs, R. Torsten Pohl, T. Mitchell, Legalon® SIL: The Antidote of Choice in
Patients with Acute Hepatotoxicity from Amatoxin Poisoning, Curr.Pharm.Biotechnol.
13 (2012) 1964-1970.
[52] M. W. Beug, M. Shaw, K. W. Cochran, Thirty plus Years of Mushroom
Poisoning:
Summary of the Approximately 2,000 Reports in the NAMA Case Registry ,
McIlvainea. 2 (2006).

[53] P. Martínez Fernández, ENFSI - APST 2023, Food-poisoning judicial cases from
some edible macrofungi (Pleurotus, Lactarius, Boletus sp., Basidiomycota) like the
controversial morels (Morchella spp., Ascomycota), (2023).

[54] E. Lagrange, J. Vernoux, Correction: Lagrange, E.; Vernoux, J.-P. Warning on

False or True Morels and Button Mushrooms with Potential Toxicity Linked to
Hydrazinic Toxins: An Update. Toxins 2020, 12, 482, Toxins (Basel). 14 (2022) 345.
doi: 10.3390/toxins14050345.

[55] J. Piqueras-Carrasco, Intoxicaciones por setas, una actualización, Revista Española

de Medicina Legal. 40 (2014) 19-29.

[56] F. Krause, Toxicity of morels and lorchels (fungi), Apoth. Ztg. 33 (1918).

[57] J. Piqueras-Carrasco, La toxicidad de las colmenillas (Morchella sp.) Lactarius 12

(2003) 83-87.

[58] M.F. Gabriel, P. González-Delgado, I. Postigo, J. Fernández, V. Soriano, B.

Cueva, et al., From respiratory sensitization to food allergy: Anaphylactic reaction after
ingestion of mushrooms (Agaricus bisporus), Med.Mycol.Case Rep. 8 (2015) 14-16.

[59] A. Bresinsky, H. Besl, A Colour Atlas of Poisonous Fungi, Wolfe Publishing Ltd.
1990.

[60] A.B. Pomilio, S. Maris Battista, Á Alonso, Parte 4: Síndromes tempranos con
síntomas complejos, Micetismos, Acta Bioquím Clín Latinoam, 2019, pp. 361-96.

[61] B. Climent-Díaz, F. Alonso-Ecenarro, X. Pérez-Hernández, A. Valverde-Valera, S.

Ventura- Sampera, M. Bernal-Morillo, Short duration sindromes. Myscetisms: Clinical
and Laboratory Diagnosis. SEQCML, Barcelona, 2022.

[62] D. Michelot, L.M. Melendez-Howell, Amanita muscaria: chemistry, biology,

toxicology, and ethnomycology, Mycol.Res. 107 (2003) 131-146.
[63] M.B.J. Moniz, I. Kaczmarska, Barcoding of diatoms: nuclear encoded ITS
revisited, Protist. 161 (2010) 7-34.

[64] H. Yao, J. Song, C. Liu, K. Luo, J. Han, Y. Li, et al., Use of ITS2 region as the
universal DNA barcode for plants and animals, PLoS One. 5 (2010) e13102. doi:
10.1371/journal.pone.0013102.

[65] D. LI, J. LIU, Z. CHEN, H. WANG, X. GE, S. ZHOU, et al., Plant DNA barcoding
in China, Journal of Systematics and Evolution. 49 (2011) 165-168.

[66] C.L. Schoch, K.A. Seifert, S. Huhndorf, V. Robert, J.L. Spouge, C.A. Levesque, et
al., Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA
barcode marker for Fungi, Proc.Natl.Acad.Sci.U.S.A. 109 (2012) 6241-6246.

[67] M.W. Chase, R.S. Cowan, P.M. Hollingsworth, C. van den Berg, S. Madriñán, G.
Petersen, et al., A proposal for a standardised protocol to barcode all land plants, Taxon.
56 (2007) 295-299.

[68] M.A. Buchheim, A. Keller, C. Koetschan, F. Förster, B. Merget, M. Wolf, Internal

transcribed spacer 2 (nu ITS2 rRNA) sequence-structure phylogenetics: towards an
automated reconstruction of the green algal tree of life, PLoS One. 6 (2011) e16931.

[69] A.W. Coleman, ITS2 is a double-edged tool for eukaryote evolutionary

comparisons, Trends Genet. 19 (2003) 370-375.

[70] B. Varadharajan, M. Parani, DMSO and betaine significantly enhance the PCR
amplification of ITS2 DNA barcodes from plants, Genome. 64 (2021) 165-171.

[71] W.J. Kress, K.J. Wurdack, E.A. Zimmer, L.A. Weigt, D.H. Janzen, Use of DNA
barcodes to identify flowering plants, Proc.Natl.Acad.Sci.U.S.A. 102 (2005) 8369-8374.

[72] C. Sass, D.P. Little, D.W. Stevenson, C.D. Specht, DNA barcoding in the
cycadales: testing the potential of proposed barcoding markers for species identification
of cycads, PLoS One. 2 (2007) e1154.

[73] G. Nieto Feliner, J.A. Rosselló, Better the devil you know? Guidelines for
insightful utilization of nrDNA ITS in species-level evolutionary studies in plants,
Mol.Phylogenet.Evol. 44 (2007) 911-919.
[74] P.M. Hollingsworth, S.W. Graham, D.P. Little, Choosing and using a plant DNA
barcode, PLoS One. 6 (2011) e19254.

[75] M. Gardes, T.D. Bruns, ITS primers with enhanced specificity for basidiomycetes--
application to the identification of mycorrhizae and rusts, Mol.Ecol. 2 (1993) 113-118.

[76] K.N. Egger, Molecular analysis of ectomycorrhizal fungal communities, Can.J.Bot.

73 (1995) 1415-1422.

[77] K.J. Martin, P.T. Rygiewicz, Fungal-specific PCR primers developed for analysis
of the ITS region of environmental DNA extracts, BMC Microbiol. 5 (2005) 28-28.

[78] M.W. Chase, M.F. Fay, Ecology. Barcoding of plants and fungi, Science. 325
(2009) 682-683.

[79] S. Ratnasingham, P.D.N. Hebert, bold: The Barcode of Life Data System.
Mol.Ecol.Notes. 7 (2007) 355-364.

[80] I. Young, A.W. Coleman, The advantages of the ITS2 region of the nuclear rDNA
cistron for analysis of phylogenetic relationships of insects: a Drosophila example,
Mol.Phylogenet.Evol. 30 (2004) 236-242.