Universidad de Santiago de Compostela

Facultad de Medicina y Odontología

Departamento de Medicina

Hospital Clínico Universitario de Santiago de Compostela

Instituto de Investigación Sanitaria de Santiago

Laboratorio de Investigación 10

FACTORES GENÉTICOS ASOCIADOS

CON PREDISPOSICIÓN A LUPUS
ERITEMATOSO SISTÉMICO:
Confirmación, efecto funcional, repercusión fenotípica y
relación con la susceptibilidad a la Artritis Reumatoide

Tesis Doctoral
María de los Ángeles Suárez Gestal
2010
El Dr. Antonio González Martínez-Pedrayo, investigador principal del Laboratorio de
Investigación 10 del Instituto de Investigación Sanitaria del Complejo Hospitalario
Universitario de Santiago de Compostela, y el Dr. Juan Jesús Gómez-Reino Carnota,
Jefe del Servicio de Reumatología del Hospital Clínico Universitario de Santiago de
Compostela y Profesor Titular del Departamento de Medicina y Catedrático de la
Universidad de Santiago de Compostela,

CERTIFICAN QUE:
El presente trabajo que lleva por título: Factores genéticos asociados con
predisposición a Lupus Eritematoso Sistémico: Confirmación, efecto funcional,
repercusión fenotípica y relación con la susceptibilidad a la Artritis Reumatoide,
realizado por María de los Ángeles Suárez Gestal en el Departamento de Medicina de la
Universidad de Santiago de Compostela bajo nuestra dirección, ha sido revisado y está
en disposición de ser presentado para optar al grado de Doctora en Biología.

Fdo: Dr. Antonio González Martínez-Pedrayo Fdo: Dr. Juan J. Gómez-Reino Carnota
A mi hermana Merchi
 Agradecimientos

El camino ha sido duro y largo, con unos momentos mejores que otros,
pero todo este esfuerzo ha merecido la pena, no sólo por los objetivos
alcanzados en mi trabajo, sino también porque durante estos años he conocido a
gente maravillosa que, junto a mi familia y amigos me han apoyado desde el
principio hasta el final de mi tesis.

En primer lugar, quiero darle las gracias a mi director de tesis, el Dr.

Antonio González, por haberme dado la oportunidad de realizar este trabajo, por
haberme animado y por tener tantas ideas y proyectos. Gracias también al Dr.
Juan Gómez-Reino, mi codirector de tesis, por su apoyo y por permitirme
realizar este trabajo en colaboración con el Servicio de Reumatología del
Hospital Clínico Universitario de Santiago de Compostela.

También agradezco la cooperación de los pacientes de lupus y artritis

reumatoide, de los controles y de los médicos e investigadores que nos han
proporcionado las muestras de ADN, así como los que nos han ayudado en la
puesta a punto de los estudios funcionales.

Quiero agradecerle a mis compañeros todo ese entusiasmo y buen rollo

que transmiten, que han hecho que los días duros fuesen más llevaderos y que
estos cinco años se me hayan pasado volando. A Isa por haberme enseñado
tantas cosas, en lo profesional como en lo personal. Ha sido toda una mentora
para mí y un modelo a seguir. A Julio, por su entusiasmo, su ayuda y su
filosofía. A Servet, por su cariño desbordante. A Isabel, por su alegría y
simpatía. A Pombo, porque con sus ocurrencias nos hemos echado unas risas en
el laboratorio. A Rebe, por las conversaciones de camino a casa, su
comprensión, su alegría y sus piropos, que se echan mucho de menos. A
Manolo por toda su ayuda, que ha sido muchísima, y su disponibilidad. Por ser
un genio aún no descubierto, por sus amplios conocimientos en toda una
variedad de temas, por su orden caótico, y por haberme dejado escribirlo todo
en mi libreta. A Elisa, por su alegría y optimismo, por sus creaziones, por las
largas y buenas conversaciones que hemos mantenido y los viajes que hemos
compartido. A Cristina, porque cada día me sorprende con una cosa nueva, por
su elegancia y sus consejos, que me han ayudado tanto. A Chicha, por ser como
es, sincera, divertida, despierta. Porque sus diálogos con Rudy me han hecho
llorar de risa. A Rudy, porque con él es imposible ponerse seria. A Rocío por
saber escuchar. A Samu, por la paciencia que tuvo cuando me enseñó algunas
técnicas. A Bea (laboratorio 8), por su alegría y sus “premoniciones”, que ojalá
se cumplan. A Diego, porque con sus sustos he descargado mucha adrenalina. A
Ana (laboratorio 7), por ser una estupenda compañera de viaje y por su risa
contagiosa. A Sonia, por tantos trayectos juntos del trabajo a casa, siendo un
gran apoyo en mis primeros años. A Ezequiel, por organizar las pachangas de
futbito. A Turo, por su amistad y porque el sábado noche en Pontevedra le gusta
tanto como a mí. A Carmen, por su ayuda, su disponibilidad y su buen hacer. A
Pepe, porque ha sido un buen compañero. A Bea (laboratorio 9), Paula y Vero
por su dulzura. Y muchas gracias a todos los demás: Miguel, Javi, Anna,
Giuseppe y Morena (laboratorio 9), Ana y Patricia (laboratorio 8), Rober, Chus,
Sandra, Vane, Pamela y Manuel (laboratorio 7), Marina, Patricia y María
(laboratorio 11) y a otras personas con las que he coincidido en el laboratorio,
como Marta, Yolanda, Inés y Aida (enfermera), así como a las nuevas caras,
Aida, Ariadna, Ana y Mari, con las que espero tener tiempo de compartir
buenos momentos. También quiero agradecerle a Carmen, Fran y Oreste su
ayuda siempre que la he necesitado.

A mis compis de facultad, por su compañía, su compañerismo y porque

nos lo hemos pasado muy bien comiendo juntos los días que teníamos prácticas.
A Bruno, porque además de un buen compañero es un fiel amigo, siempre ha
estado ahí para escucharme y darme su opinión y para sacarme de fiesta con sus
amigos cuando más lo necesitaba. A Raquel, por ser tan entrañable. A Javi R,
porque sus rizos nos vuelven locas y por lo bien que encaja y devuelve los
piques. A Javi S, por tener la investigación en la sangre y por su amor por el
mar. Siempre me lo imaginaré con un neopreno y debajo del agua. Y no me
olvido de Toño, Gonzalo, Raúl y Antonio, con los que he compartido buenos
momentos y espero seguir haciéndolo. También quiero agradecerle a Jesús su
ayuda generosa con el photoshop, que me ha sacado de un apuro; y a Fátima y
Andrea, su cariño. Y a mis compañeros de los cursos de doctorado,
especialmente a Javi, Galo y Ana, les agradezco su amistad, su apoyo y la
alegría que me han transmitido.

A mis amigos de Santiago. A mi mejor amiga, Cristina, porque la

conozco desde los 4 años y jamás nos hemos enfadado, porque siempre ha
tenido unas palabras de ánimo, las necesitara o no, por lo mucho que me valora
y porque se preocupa mucho por mí. A Raquel, porque en cuanto la conocí se
convirtió en una de mis mejores amigas, porque su memoria compensaba mis
despistes en la facultad y porque me descubrió el vicio por los lacasitos. A Toni,
porque fue un buen compañero de pupitre y se ha convertido en un buen amigo.
A Iván, por los buenos momentos que hemos compartido.

A mis niñas de Pontevedra, que me acogieron desde el primer momento

como una más, la culpa de lo cual la tiene mi prima Rut. A ella le doy las
gracias por ser mi confidente y por aguantarme en los buenos y malos
momentos. A Ana, por su sonrisa y por descubrirme grupos de música indies. A
Lourdes, por su dulzura y por haberme escuchado cuando necesitaba
desahogarme. A Iria S, porque con ella es fácil pasárselo bien. A Laura, por su
cariño y sus trucos para el estrés. A Bea, porque me encanta cuando le afecta la
altitud. A Carmen, por su originalidad y curiosidad. A Nieves, por su
personalidad alegre. A Iria P, por mostrar interés cuando empiezo a hablar de
cosas raras de mi tesis. A Susana, por su tranquilidad. Y a Vicky, por su
energía.

Y siguiendo con más gente de Pontevedra, le quiero dar las gracias a Rita,
porque en poco tiempo se ha convertido en una amiga en la que se puede
confiar. A Peon y Claudio, por el buen rato que hemos pasado en las pachangas,
en el rafting, en la carrera de orientación o tomando unas cañas. Y a Toño,
porque durante un tiempo ha sido un gran apoyo para mí, hablar con él me
tranquilizaba y me daba fuerzas para seguir. Por el cariño que me transmitió,
porque los buenos momentos fueron muchos y esos son los que quedan en el
recuerdo y porque sigo disfrutando de su compañía.

Y, por último, quiero agradecerle a mi familia todo su apoyo y su cariño.

Especialmente, a mis padres, porque siempre me han animado a hacer todo lo
que me proponía. A Belén, porque además de ser mi hermana pequeña ha sido
mi amiga y con ella he vivido muchas “aventuras”. A Cris, por toda la paciencia
que ha tenido cuando sus dos hermanas pequeñas no la dejábamos estudiar,
porque me encanta ir de compras con ella y por preocuparse por mí. A Manu,
por haberme dejado jugar con él, a pesar de llevarse siempre las culpas de
bombillas y jarrones rotos, y porque sus notas me motivaron a intentar ser tan
buena estudiante como él. A Jose, por su cariño y su paciencia cuando me
pongo enferma y lo incordio con preguntas y favores. A mis sobrinos, Marcela,
Álex, Javi, Marta, Jaime y Cris por mimarme tanto, por querer jugar conmigo y
por considerarme una “tía guay”. A mis cuñados, Gaspar, Carmen e Isa, y a mi
cuasi-cuñado Eloy, por haber querido formar parte de esta gran familia. Y a mis
tíos Pepe y Pili, por su compañía en los días de fiesta y por todo su afecto y
ayuda.

A todos vosotros gracias.

 Prefacio

La presente tesis está estructurada en los apartados de introducción,

hipótesis, objetivos, procedimientos experimentales y resultados, discusión y
conclusiones. La introducción está enfocada en varios aspectos del lupus
eritematoso sistémico (LES), incluyendo los mecanismos que lo causan, sus
características clínicas, su genética y, dentro de este apartado, los factores
genéticos de susceptibilidad más destacados. Por último, se exponen las
evidencias existentes de que enfermedades autoinmunes, como son el LES y la
artritis reumatoide (AR), comparten una parte de su componente genético. Los
procedimientos experimentales y resultados se presentan en formato de
artículos: tres ya han sido publicados, así como una carta al editor, mientras que
otros tres han sido enviados a revisión. La discusión está dividida en capítulos
que se estructuran de acuerdo con los artículos, terminando con una discusión
general. Por último, se exponen las conclusiones a las que se ha llegado con este
trabajo. Como anexo, se incluye un artículo enviado a revisión, que estudia
predictores genéticos de la respuesta al tratamiento en AR.
ÍNDICE
 Índice

Índice

Abreviaturas 1
Introducción 7
1. Lupus Eritematoso Sistémico 9
1.1. Patogenia del LES 10
1.2. Clínica del LES 14
1.3. El LES como enfermedad compleja 16
2. Influencia del componente genético en la variabilidad clínica del
LES 17
3. Estudio de la genética del LES 19
3.1. Estudios de ligamiento 19
3.2. Estudios de asociación 21
3.2.1. PDCD1 23
3.3. Estudios de asociación de genoma completo 27
3.3.1. GWAS en LES 30
3.4. Factores genéticos de LES confirmados 37
3.4.1. HLA 37
3.4.2. Factores del complemento 40
3.4.3. FCGRs 42
3.4.4. TREX1 43
3.4.5. IRF5 45
3.4.6. PTPN22 46
3.4.7. STAT4 47
3.4.8. ITGAM 49
3.4.9. C8orf13-BLK 50
3.4.10. BANK1 51
Factores genéticos asociados con predisposición a LES

3.4.11. 1q25.1 y TNFSF4 52

3.4.12. KIAA1542-IRF7 53
3.4.13. PXK 53
3.4.14. MECP2-IRAK1 54
3.4.15. TNFAIP3 y región intergénica 6q23 55
3.4.16. TNIP1 57
3.4.17. PRDM1-ATG5 58
3.4.18. JAZF1 58
3.4.19. UHRF1BP1 59
3.4.20. IL10 59
3.5. Factores genéticos con asociación al LES controvertida 60
3.5.1. TYK2 60
3.5.2. LY9 61
4. Determinación de los efectos funcionales de los loci de
susceptibilidad 62
5. El problema de la heredabilidad no explicada 66
6. La hipótesis de los factores genéticos comunes a múltiples
enfermedades autoinmunes a la luz de los GWAS 70
6.1. TNFAIP3 y región intergénica 6q23 72
Hipótesis 75
Hipótesis 77
Objetivos 79
Objetivos 81
Procedimiento experimental y resultados 83
Esquema general 85
1. Factores genéticos de LES 89
Publicación 1 91
Publicación 2 105
 Índice

2. Estudio funcional de PD1.3 107

Publicación 3 109
3. Influencia del componente genético en la variabilidad
clínica del LES 117
Publicación 4 119
Publicación 5 151
4. Componente genético común a LES y AR 167
Publicación 6 169
Publicación 7 177
Discusión 199
1. Discusión 201
1.1. Confirmación de factores de susceptibilidad al LES 203
1.2. Análisis funcionales del SNP asociado a LES, PD1.3 213
1.3. Influencia del componente genético en la variabilidad
clínica del LES 217
1.4. Componente genético común a LES y AR 225
2. Sumario 231
Conclusiones 235
Conclusiones 237
Bibliografía 239
Bibliografía 241
Anexo 277
Publicación 8 279
 Abreviaturas

Abreviaturas

3’UTR Región 3’ no traducida (del inglés, 3’ untranslated region)

ACPA Anticuerpos frente a proteínas/péptidos citrulinados (del inglés,
anti-citrullinated protein/peptide antibodies)
ACR Colegio Americano de Reumatología (del inglés, American College
of Rheumatology)
ADN Ácido desoxirribonucleico
AFF3 Miembro 3 de la familia AF4/FMR2 (del inglés, AF4/FMR2 family
member 3)
ANA Anticuerpo antinuclear (del inglés, antinuclear antibody)
anti-RNP Anticuerpo anti-ribonucleoproteína
anti-Sm Anticuerpo anti-Smith
aPL Anticuerpo antifosfolípido
AR Artritis reumatoide
ARN Ácido ribonucleico
BAFF/BLyS Factor activador de células B (del inglés, B-cell activating factor/B-
lymphocyte stimulator)
BANK1 Proteína estructural de células B con repeticiones de anquirina (del
inglés, B-cell scaffold protein with ankyrin repeats)
BCR Receptor de células B (del inglés, B-cell receptor)
BLK Quinasa de linfocito B (del ingles, B-lymphocyte kinase)
C3bi Producto de activación del complemento 3
CARD15/NOD2 Caspase recruitment domain 15/nucleotide-binding oligomerization
domain containing 2
CBF Core binding factor
ChIP Inmunoprecipitación de cromatina (del inglés, chromatin
immunoprecipitation)
CNV Variación del número de copias (del inglés, copy number variation)
CPA Célula presentadora de antígeno

1
Factores genéticos asociados con predisposición a LES

CREB1 Proteína 1 de unión al elemento de respuesta al cAMP (del ingles,

cAMP responsive element binding protein 1)
CSK Tirosín-quinasa Src C-terminal (del inglés, C-terminal Src tyrosine
kinase)
CTLA4 Antígeno 4 de linfocitos T citotóxicos (del inglés, cytotoxic T
lymphocyte antigen 4)
CV Coeficiente de variación
DC Célula dendrítica (del inglés, dendritic cell)
EIRA Investigación Epidemiológica de Artritis Reumatoide (del inglés,
Epidemiological Investigation of Rheumatoid Arthritis)
EMSA Ensayo de cambio de movilidad electroforética (del inglés,
electrophoretic mobility shift assay)
FCGR Receptor de baja afinidad de la fracción constante de la
inmunoglobulina G (del inglés, Fc fragment of IgG low affinity
receptor)
GM-CSF Factor estimulador de colonias de granulocitos-macrófagos (del
inglés, granulocyte-macrophage colony-stimulating factor)
GRZB Granzima B
GWAS Estudio de asociación de genoma completo (del inglés, genome
wide association study)
HIC2-UBE2L3 Hypermethylated in cancer 2-ubiquitin-conjugating enzyme E2L 3
HLA Antígeno leucocitario humano (del inglés, human leukocyte antigen)
ICAM1 Molécula 1 de adhesión intracelular (del inglés, intracellular
adhesion molecule 1)
IFN Interferón
IFNAR Receptor de interferón α (del inglés, IFNα receptor)
Ig Inmunoglobulina
IL Interleucina
IL1R Receptor de interleucina 1 (del inglés, IL1 receptor)
IL2R Receptor de interleucina 2 (del inglés, IL2 receptor)
indel Polimorfismo del tipo inserción/delección

2
 Abreviaturas

IP3R Receptor de inositol 1,4,5-trifosfato (del inglés, inositol 1,4,5-

triphosphate receptor)
IRAK1 Quinasa 1 asociada a receptor de interleucina 1 (del inglés,
interleukin 1 receptor associated kinase 1)
IRF Factor regulador del interferón (del inglés, interferon regulatory
factor)
ITG Integrina
ITIM Immunoreceptor tyrosine-based inhibition motif
ITPR2 Receptor 2 de inositol 1,4,5-trifosfato (del inglés, inositol 1,4,5-
triphosphate receptor 2)
ITSM Immunoreceptor tyrosine-based switch motif
JAZF1 JAZF zinc finger 1
KO Knockout
KYF5A Miembro 5A de la familia de las quinesinas (del inglés, kinesin
family member 5A)
LD Desequilibrio de ligamiento (del inglés, linkage disequilibrium)
LES Lupus eritematoso sistémico
LYN Yamaguchi sarcoma viral oncogene homolog
LYP Fosfatasa de tirosina linfoide (del inglés, lymphoid-specific tyrosine
phosphatase)
MECP2 Proteína 2 de unión a CpG metilado (del inglés, methyl-CpG-
binding protein 2)
MHC Complejo mayor de histocompatibilidad (del inglés, major
histocompatibility complex)
MIP1α Proteína 1α inflamatoria de macrófagos (del inglés, Macrophage
inflammatory protein 1α)
MMEL1 Membrane metallo-endopeptidase-like 1
Mona/Gads Adaptador monocítico (del inglés, monocytic adaptor)
NARAC Consorcio Norteamericaco de Artritis Reumatoide (del inglés,
North American Rheumatoid Arthritis Consortium)

NFκB Factor nuclear κB (del ingles, nuclear factor κB)

3
Factores genéticos asociados con predisposición a LES

NK Células “asesinas naturales” (del inglés, natural killer)

NOD Ratones diabéticos no obesos (del inglés, non-obese diabetic)
nsSNP SNP no sinónimo
OLIG3 Factor de transcripción 3 de oligodendrocitos (del inglés,
oligodendrocyte transcription factor 3)
OR Odds ratio
PARP Poli-ADP-ribosa polimerasa
pDC Célula dendrítica plasmacitoide (del inglés, plasmacytoid dendritic
cell)
PDCD1 Gen de muerte celular programada 1 (del inglés, programmed cell
death 1)
PERP p53 apoptosis effector related to PMP22
PHRF1 PHD and ring finger domain-containing protein 1
PI3K Fosfatidil inositol 3 quinasa
PLC Fosfolipasa C
PRDM1-ATG5 PR domain containing 1, with ZNF domain-APG5 autophagy 5-like
PRKCQ Proteín quinasa C theta
PTPN22 Fosfatasa de tirosina tipo 22 no-receptor (del inglés, protein tyrosin
phosphatase non-receptor type 22)
PXK Quinasa de serina-treonina con dominio homólogo a Phox (del
inglés, Phox homology domain-containing serine-threonine kinase)
RUNX1 Runt-related transcription factor 1
SLEGEN Consorcio Internacional de Genética del Lupus Eritematoso
Sistémico (del inglés, Systemic Lupus Erythematosus Genetics)
SNP Polimorfismo de un sólo nucleótido (del inglés, single nucleotide
polymorphism)
SNRPC Polipéptido C de ribonucleoproteína nuclear pequeña (del ingles,
small nuclear ribonucleoprotein polypeptide C)
SS Síndrome de Sjögren
STAT Transductor de señal y activador de la transcripción (del inglés,
signal transducer and activator of transcription)

4
 Abreviaturas

SV40 Simian virus 40

T1D Diabetes tipo 1 (del inglés, type 1 diabetes)
tagSNP SNP marcador
TCR Receptor de células T (del inglés, T-cell receptor)
TDT Análisis de desequilibrio de transmisión (del inglés, transmission
disequilibrium test)
TGFβ Factor de crecimiento transformante β (del inglés, transforming
growth factor β)
Th Linfocito T colaborador (del inglés, T helper)
TLR Receptor tipo Toll (del inglés, Toll-like receptor)
TNF Factor de necrosis tumoral (del inglés, tumor necrosis factor)
TNFAIP3 Proteína 3 inducida por el factor de necrosis tumoral α (del inglés,
tumor necrosis factor α-induced protein 3)
TNFR Receptor del TNF
TNFSF4/OX40L Miembro 4 de la superfamilia de ligandos del factor de necrosis
tumoral (del inglés, tumor necrosis factor (ligand) superfamily,
member 4)
TNIP1 Proteína 1 de interacción con TNFAIP3 (del inglés, TNFAIP3-
interacting protein 1)
TRAF Factor asociado al receptor del factor de necrosis tumoral (del
inglés, tumor necrosis factor receptor-associated factor)
Treg Linfocito T regulador
TREX1 Exonucleasa 3’ reparadora 1 (del inglés, three prime repair
exonuclease 1)
TYK2 Tirosín-quinasa 2
UHRF1BP1 Proteína 1 de unión a ICBP90 (del inglés, ICBP90 binding protein 1)
VIH Virus de la inmunodeficiencia humana
λ Factor de inflación

λs Riesgo relativo entre hermanos

5
INTRODUCCIÓN
 Introducción

Introducción

1. Lupus Eritematoso Sistémico

El lupus eritematoso sistémico (LES; [MIM] 152700) es una enfermedad

autoinmune crónica de etiología compleja. Se caracteriza por una alteración del
sistema inmune innato y adquirido, que lleva a la pérdida de tolerancia frente a
antígenos propios y a la consecuente producción de autoanticuerpos y daño
tisular. El LES es considerado una enfermedad multisistémica, ya que puede
afectar a diversos órganos, como articulaciones, riñones, corazón, sistema
nervioso, pulmones, sistema hematológico o piel (Figura 1). El curso de la
enfermedad es impredecible, con periodos de crisis alternando con otros de
remisión.

Figura 1. Algunas manifestaciones clínicas características del LES. A. Eritema malar,

en forma de alas de mariposa. B. Artritis no erosiva, que se manifiesta preferentemente en las
manos. C. Vasculitis.

9
Factores genéticos asociados con predisposición a LES

El LES es una enfermedad que afecta con una frecuencia 9 veces mayor a
mujeres que a hombres, sobre todo a mujeres en edad fértil. La prevalencia en
población europea es del 0.01-0.06 %, mientras que es tres o cuatro veces más
frecuente en poblaciones asiática, africana e hispano-americana (Petri M y col.,
2002). Esta heterogeneidad étnica junto con la heterogeneidad genética pueden
contribuir a la complejidad de sus manifestaciones clínicas.

1.1 Patogenia del LES

Los mecanismos que llevan a la aparición de la enfermedad, así como su

orden temporal, no son bien conocidos. Un posible mecanismo desencadenante
de la patogenia del LES sería la elevada tasa de apoptosis de linfocitos,
monocitos y macrófagos en la circulación, la deficiente eliminación de los
restos apoptóticos y un reconocimiento anormal de autoantígenos liberados
durante este proceso. Estos autoantígenos son captados y procesados por las
células presentadoras de antígeno (CPA). Éstas son, entre otras, células
dendríticas (DC) y linfocitos B, cuya función es presentar los antígenos a otras
células del sistema inmune mediante el complejo mayor de histocompatibilidad
(MHC). En el LES, las DCs presentan autoantígenos a linfocitos T inmaduros,
llevando a su activación. Las células B presentan autoantígenos a linfocitos T
colaboradores (Th), en los que inducen la producción de citocinas. Las citocinas,
a su vez, estimulan la proliferación de las células B y la producción de
autoanticuerpos frente a los autoantígenos nucleares, citoplasmáticos y de
superficie celular. Las células T y B activadas se infiltrarían en los tejidos y,
junto con los autoanticuerpos y depósitos de complejos inmunes,
desencadenarían procesos inflamatorios (activación del complemento,
quimiotaxis) provocando daño tisular y fibrosis (Cooper GS y col., 2008)
(Figura 2).

10
 Introducción

Figura 2. Mecanismos implicados en la pérdida de autotolerancia y en el desarrollo

de autoinmunidad (Cooper GS y col., 2008).

El interferón (IFN) α (IFN de tipo I) tiene un papel importante en este

proceso inflamatorio. La activación de las células B y DCs plasmacitoides (pDC)
por la unión de los autoantígenos a los receptores tipo Toll (TLR) 7 y 9 (Figura
2), induce la producción de IFNα. El IFNα liberado activa la expresión de toda
una serie de proteínas inflamatorias. Este patrón de expresión constituye la
“firma del IFN” (Baechler EC y col., 2004), característica de los pacientes con
LES activo. Además, el IFNα provoca en las propias pDCs la liberación del
factor activador de células B (BAFF/BLyS), que ayuda a la transformación de
los linfocitos B en células plasmáticas productoras de autoanticuerpos (Stohl W
y col., 2003). Además, altos niveles de IFNα provocan también una reducción
en el número o bien una activación defectuosa (Singh RR y col., 2002; Filaci G
y col., 2001; Oishi Y y col., 2001; Yang JQ y col., 2003) de los linfocitos T
reguladores (Treg) periféricos (Yan B y col., 2008), y de las células NK o

11
Factores genéticos asociados con predisposición a LES

“asesinas naturales”. Estos dos tipos de células serían las encargadas de limitar
la expansión de las células Th y B autorreactivas, por lo que la alteración de su
función produce un defecto en la tolerancia periférica.

En los pacientes con LES también se ha observado una función alterada

de las células Th. El desequilibrio en la producción de citocinas por linfocitos
Th1/Th2 puede tener un papel importante en la patogenia del LES. Así, se ha
visto una respuesta defectuosa de las células Th1, productoras de interleucina
(IL) 12, IFNγ (IFN de tipo II) y linfotoxina (también llamado factor de necrosis
tumoral β, TNFβ), mientras que tiene lugar una proliferación incrementada de
los linfocitos Th2, productores de IL4, IL5 e IL13. De hecho, la IL4, además de
promover la diferenciación de las células Th2, inhibe la proliferación de las
células Th1. Como resultado de este desequilibrio, se produce hiperactividad de
las células B con un aumento de la producción de autoanticuerpos (Mok CC y
col., 2003). Recientemente, se ha descubierto que otra subpoblación de células
Th, las Th17 tienen un papel accesorio, pero no por ello menos importante, en
este proceso autoinmune. Su nombre se debe a que son las principales
productoras de IL17A e IL17F, citocinas importantes del sistema inmune
adquirido por su papel proinflamatorio. Estas citocinas ejercen su efecto en el
LES facilitando la infiltración y activación de células T y B (Nalbandian A y
col., 2009).

Los procesos de apoptosis o inmunidad también pueden verse alterados

por cambios epigenéticos (Zhao S y col., 2009, Ballestar E y col., 2006). La
epigenética hace referencia a los cambios estables y potencialmente heredables
en la expresión génica que no implican cambios en la secuencia del ácido
desoxirribonucleico (ADN). Las principales marcas epigenéticas son la
metilación del ADN y las modificaciones de las histonas, tales como

12
 Introducción

acetilaciones, metilaciones y fosforilaciones. Éstas modulan la arquitectura de la

cromatina haciéndola más o menos accesibles, lo que afecta a la actividad
transcripcional. La alteración de estos procesos podría tener un papel en el LES.
Por ejemplo, inhibidores de las desacetilasas de histonas reducen la expresión
de múltiples genes, como IL6, IL10, IL12 e IFNγ, previniendo el daño renal en
ratones con un modelo de lupus (Mishra N y col., 2003). Por otra parte, la
metilación de los motivos CpG del ADN produce el silenciamiento de genes
codificantes de citocinas de células Th. Este efecto puede ser importante ya que
se ha observado que pacientes con LES tienen hipometilado el ADN
(Richardson B y col., 1990) y que inhibidores de la metilación del ADN o bien
la inyección de células T demetiladas en ratones lleva a la aparición de
manifestaciones de tipo lupus (Yung RL y col., 1995, Yung R y col., 2001).
Estos resultados explicarían que sólo el ADN procedente de células apoptóticas,
y no el ADN normal o el necrótico, pueda actuar como autoantígeno induciendo
autoinmunidad, ya que el ADN apoptótico se caracteriza por presentar niveles
reducidos de metilación (Wen ZK y col., 2007). En parte, estas alteraciones
podrían venir explicadas por variantes en el gen de la proteína 2 de unión a CpG
metilado (MECP2), que se ha visto significativamente asociado con LES
(Sawalha AH y col., 2008).

Los miRNAs también pueden ejercer un papel en las enfermedades

autoinmunes mediante su acción en los linfocitos T y B. Los miRNA son
moléculas de ácido ribonucleico (ARN) no codificante de 21-24 nucleótidos que
regulan la expresión de genes diana a nivel de la traducción. La fosfatasa de
tirosina tipo 22 no-receptor (PTPN22), inhibidora de la respuesta de las células
T frente a antígenos, ve reducida su expresión por el miR-181a (Li QJ y col.,
2007). Por otra parte, miR-146 se une a la región 3’UTR de genes implicados
en la ruta del IFN, actuando como un regulador negativo. Este miRNA inhibe la

13
Factores genéticos asociados con predisposición a LES

expresión del factor asociado al receptor del factor de necrosis tumoral (TRAF)
6, de la quinasa 1 asociada al receptor de IL1 (IRAK1) (Taganov KD y col.,
2006), del transductor de señal y activador de la transcripción (STAT) 4 y del
factor regulador de IFN (IRF) 5 (Tang Y y col., 2009). En concordancia con
estas funciones, miR-146 tiene una expresión disminuida en pacientes con LES,
correlacionando negativamente con la actividad de la enfermedad y los niveles
de IFN (Tang Y y col., 2009).

1.2. Clínica del LES

Según el Colegio Americano de Reumatología (ACR), un paciente se

clasifica como LES si presenta al menos 4 de 11 criterios establecidos (Tan EM
y col., 1982; Hochberg MC y col., 1997) (Tabla 1), lo que permite una gran
heterogeneidad de fenotipos. Algunas de las manifestaciones incluidas en los
criterios de la ACR, como fotosensibilidad, úlceras orales y artritis, son
relativamente leves, mientras que otras, como alteraciones renales, convulsiones,
psicosis y anormalidades hematológicas severas caracterizan una enfermedad
más grave.

La producción de autoanticuerpos también está relacionada con la

severidad de la enfermedad. De entre los autoanticuerpos producidos en el LES,
los más característicos son los anticuerpos antinucleares (ANAs). Éstos están
presentes en el 95 % de los pacientes, por lo que se incluyen como uno de los
criterios de clasificación del LES. Los ANAs incluyen múltiples especificidades.
Entre ellos destacan los anticuerpos anti-ADN de doble cadena, anti-histonas,
anti-nucleosomas y anti-ribonucleoproteínas (anti-RNP). Algunos de estos
anticuerpos suelen estar presentes antes de que se diagnostique la enfermedad y
su acumulación progresiva puede llevar a la aparición de determinados

14
 Introducción

fenotipos clínicos (Arbuckle MR y col., 2003). Por ejemplo, los anti-ADN de

doble cadena se asociaron con la enfermedad renal y los anticuerpos anti-
Ro/SSA y anti-La/SSB están asociados con manifestaciones dermatológicas y
lupus neonatal (Boh EE, 2004). Otros anticuerpos importantes son los
anticuerpos antifosfolípido (aPL) (ej, anti-cardiolipina), que reconocen
moléculas de la membrana celular y están relacionados con el síndrome
antifosfolípido secundario en el LES, caracterizado por trombosis recurrente y
abortos de repetición (Wilson WA y col., 1999).

Tabla 1. Criterios de clasificación del LES establecidos en 1982 (Tan EM y col., 1982)
y actualizados en 1997 (Hochberg MC y col., 1997).

15
Factores genéticos asociados con predisposición a LES

A pesar de todos estos fenotipos que se asocian con los autoanticuerpos,

hasta un tercio de la población general puede presentar algún tipo de los mismos
(Teubner A y col., 2002). Pero sólo el 1 % de personas con ANAs desarrollará
LES (Petri M y col., 2002). Por tanto, la mayoría de individuos con
autoanticuerpos están protegidos frente a sus consecuencias patológicas. Esto
sugiere que la autoinmunidad contribuye al desarrollo de lesiones tisulares, pero
no es suficiente para su producción.

1.3. El LES como enfermedad compleja

Parte de la complejidad del LES radica en que es debido a la interacción

de múltiples factores, tanto ambientales y genéticos, como hormonales (Tsao
BP y col., 2003). La importancia del componente genético se ha puesto de
manifiesto por varias observaciones. En primer lugar, el LES tiende a agruparse
en familias, aunque no sigue un patrón de herencia mendeliana simple. Aún así,
tiene una heredabilidad importante, de más del 60 %. Por otra parte, el riesgo
relativo a padecer la enfermedad entre hermanos (λs) es 20-40 veces mayor que
el riesgo general de la población. Además, la enfermedad es concordante entre
gemelos que comparten el mismo ambiente en el 2-5 % de los dicigotos y en el
24-58 % de los monocigotos. Esta diferencia de 10 veces en la concordancia de
la enfermedad entre gemelos idénticos (los que comparten todos sus genes) y
gemelos-hermanos (que comparten la mitad de sus genes) sugiere que múltiples
genes con un efecto modesto, compartidos por cada par de gemelos, tienen una
influencia importante en la susceptibilidad al LES (Tsao BP y col., 2003; Moser
KL y col., 2009; Alacon-Segovia D y col., 2005). Así que todas estas
observaciones muestran la contribución de un componente genético
significativo. De todos modos, como la concordancia más alta es del 58 %,

16
 Introducción

otros factores no genéticos también tienen que estar contribuyendo a la etiología

del LES.

En cuanto al componente hormonal, se han propuesto los estrógenos

femeninos como promotores de la enfermedad. Éstos podrían ser los
responsables de la mayor prevalencia del LES en mujeres (9 mujeres por cada
hombre). Por otro lado, el componente ambiental posiblemente incluye factores
tales como agentes mutagénicos (luz ultravioleta), infecciones víricas (virus
Epstein-Bar), la dieta y el estilo de vida (obesidad, hábito de fumar). Estos
factores modularían la susceptibilidad al LES alterando los procesos de
apoptosis o inmunidad, o a través de cambios epigenéticos (Zhao S y col., 2009;
Ballestar E y col., 2006).

2. Influencia del componente genético en la variabilidad clínica del

LES

El componente genético no sólo influencia la susceptibilidad sino la

forma clínica, como se ha demostrado en estudios epidemiológicos en Estados
Unidos. Éstos han observado que el riesgo a padecer manifestaciones severas de
LES, así como la edad de inicio de la enfermedad, varían según el grupo étnico
(hispanos, afro-americanos o caucásicos). En poblaciones no caucásicas los
pacientes tienden a ser más jóvenes y a sufrir una enfermedad más grave y
activa, con afectación de sistemas como el renal o el cardiovascular y una alta
producción de autoanticuerpos. Esto sugiere que la genética podría influenciar
la prevalencia de los distintos fenotipos (Alarcón GS y col., 2002; Alarcón GS y
col., 1999).

17
Factores genéticos asociados con predisposición a LES

En el mismo sentido, se sabe que existen diferencias genéticas entre

poblaciones del mismo continente, lo que sugiere que también podría existir una
contribución de la ascendencia genética, dentro de una misma etnia, al
desarrollo de las distintas manifestaciones clínicas del LES. Así, en Europa
existe un gradiente en la variabilidad genética en dirección norte-sur, que
permite distinguir entre poblaciones noreuropeas (Reino Unido, Alemania,
Escandinavia y Europa del este) y poblaciones sureuropeas (Italia, Grecia y
España) (Novembre J y col., 2008; Seldin MF y col., 2006). Un estudio reciente
ha demostrado la asociación de estas subpoblaciones de europeos con fenotipos
específicos del LES. Concretamente, se ha observado una mayor prevalencia de
manifestaciones mucocutáneas (fotosensibilidad y eritema discoide) en los
sujetos con ascendencia del norte de Europa, mientras que en los que procedían
del sur era mayor la prevalencia de autoanticuerpos y de nefritis (Chung SA y
col., 2009; Richman IB y col., 2009).

Los pacientes con origen en Europa occidental presentaban más serositis

y producción de autoanticuerpos en comparación con los pacientes de origen
oriental. También se ha visto que los judíos askenazíes presentan menos
alteraciones neurológicas del LES. Estas diferencias sugieren que incluso
pequeñas diferencias en la ascendencia genética podrían influenciar el
desarrollo de manifestaciones específicas (Richman IB y col., 2009). Estos
estudios se realizaron con una colección de muestras caucásicas recogidas en
Estados Unidos, con un gran predominio de los pacientes con origen
noreuropeo, por lo que sería interesante abordar esta cuestión con muestras
obtenidas en Europa y con una representación más equilibrada.

18
 Introducción

3. Estudio de la genética del LES

Como las variantes genéticas están presentes desde el nacimiento y no

están afectadas por el curso de la enfermedad ni por el tratamiento, los estudios
genéticos serían capaces de identificar factores de susceptibilidad y mecanismos
fundamentales de la patogenia. Por lo tanto, estos estudios nos permitirían
entender cómo la falta de regulación de un número de procesos inmunológicos
clave predisponen al desarrollo del LES. Se ha hipotetizado que el desarrollo de
la enfermedad tendría lugar cuando el contenido acumulado de alelos de
susceptibilidad excede un umbral, y sería desencadenado por procesos no
genéticos de naturaleza poco clara, como infecciones víricas.

Los dos tipos de estudios que se utilizan para buscar factores genéticos de
susceptibilidad son los estudios de ligamiento y los estudios de asociación.

3.1. Estudios de ligamiento

Los estudios de ligamiento analizan la cosegregación de secuencias

genómicas entre individuos de familias con múltiples enfermos. Se estudian
marcadores (preferentemente microsatélites) repartidos por todo el genoma, de
modo que si un marcador está en ligamiento con un locus de susceptibilidad, los
miembros enfermos de la familia tendrán el mismo alelo del marcador. De esta
manera se observan las regiones cromosómicas que segregan con la enfermedad
y se buscan posibles genes candidatos en las mismas.

Los estudios de ligamiento son el método de elección para estudiar los

fenotipos de herencia mendeliana, porque los modelos genéticos son pocos y de
fácil análisis. También son una buena aproximación para encontrar variantes

19
Factores genéticos asociados con predisposición a LES

raras con grandes efectos, es decir, que provocan una alta probabilidad de
desarrollar la enfermedad. Sin embargo, su aplicación a los fenotipos complejos,
como el LES, es más problemática porque no existe un modelo que explique
adecuadamente el patrón de herencia y porque los factores genéticos de
susceptibilidad para estas enfermedades suelen ser muchos y tener un efecto
pequeño. De hecho, los estudios de ligamiento de genoma completo realizados
hasta el momento en diversas poblaciones (europea, hispana, afro-americana y
asiática) indican que la susceptibilidad al LES vendría dada por múltiples loci
de pequeño efecto y de magnitud similar (Cantor RM y col., 2004; Gaffney PM
y col., 1998; Gaffney PM y col., 2000; Gray-McGuire C y col., 2000; Johansson
CM y col., 2004; Koskenmies S y col., 2004; Lindqvist AK y col., 2000; Moser
KL y col., 1998; Nath SK y col., 2004; Shai R y col., 1999, Rao S y col., 2001;
Olson JM y col., 2002). Sin embargo, no hay mucha concordancia entre los
resultados. De los casi 60 loci que han demostrado evidencias de ligamiento con
LES en estudios de genoma completo, sólo 17 han sido reproducidos en, al
menos, dos estudios independientes: 1p36, 1q23-24, 2q23-33, 2q37, 4p15-13,
4q32, 5p15, 6p22-q15, 11q23, 12q24, 14q23, 16p13, 16q12-13, 17q11, 18q21,
19q13.1 y 20p13. En consecuencia, para encontrar alguna evidencia consistente
en los estudios de ligamiento realizados, se han llevado a cabo dos meta-análisis
(Lee YH y col., 2005; Forabosco P y col., 2006). Ambos confirmaron los loci
6p22-q15, 16p12-q12, 20p12-q13 y 2q31-q34, proponiéndose como genes
causantes del ligamiento de los dos primeros loci al MHC y a CARD15/NOD2
(caspase recruitment domain 15 / nucleotide-binding oligomerization domain
containing 2), respectivamente. De todos modos, el MHC no tiene un efecto tan
fuerte como en otras enfermedades autoinmunes como la artritis reumatoide
(AR).

20
 Introducción

La falta de reproducibilidad que se observó en los estudios de ligamiento

de LES puede deberse al efecto débil de los loci, a la heterogeneidad genética o
fenotípica de las colecciones, al tamaño muestral pequeño de los estudios, a
diferencias en el poder de detección del ligamiento o en el método estadístico
usado. Por otra parte, la región que identifican como ligada a la enfermedad es
muy grande, y hacen falta estudios más finos que detecten el polimorfismo
responsable de dicho ligamiento. Debido a estas limitaciones, hoy en día, los
estudios de ligamiento han sido relegados a un segundo plano por los estudios
de asociación. Éstos últimos tienen un mayor poder estadístico, permiten el uso
de conjuntos de muestras más grandes, al no basarse en familias de enfermos, y
pueden evaluar directamente los posibles factores de riesgo.

3.2. Estudios de asociación

Una vez identificadas las regiones que segregan con la enfermedad, el

siguiente paso sería identificar el polimorfismo causal en las mismas. Esto no es
fácil, ya que las regiones de ligamiento suelen ser bastante grandes (10-30 Mb)
y pueden contener de 100 a 300 genes. Para ello, se han llevado a cabo estudios
de clonaje posicional y de asociación. Los estudios de asociación incluyen tanto
diseños caso-control, como análisis de desequilibrio de transmisión basado en
familias (TDT).

En el análisis TDT se estudia si existe una transmisión preferente de un

alelo o haplotipo específico desde los padres heterocigotos a los hijos enfermos,
lo que proporcionaría evidencias de asociación del alelo o haplotipo analizado
con la susceptibilidad a la enfermedad (Tsao BP y col., 2003). Este análisis
requiere la información genotípica de tríos constituidos por el hijo afecto y sus
padres. Al menos uno de los progenitores ha de ser heterocigoto para que la

21
Factores genéticos asociados con predisposición a LES

familia sea informativa, lo cual es una limitación de estos estudios. El análisis

estadístico se basa en la χ2 de McNemar’s que evalúa la hipótesis nula de
herencia mendeliana en la que los alelos son transmitidos al 50 % de los hijos
desde los padres heterocigotos frente a la hipótesis alternativa de que un alelo se
transmite más frecuentemente a la descendencia afectada. Esta metodología
permitió reducir el intervalo de ligamiento del cromosoma 6 al segmento
cromosómico que contiene los genes MHC de clase II en un estudio de LES
(Graham RR y col., 2002).

Los estudios de asociación caso-control no se basan en familias y, por

tanto, no tienen en cuenta los patrones de herencia. Se basan en comparaciones
de individuos enfermos no relacionados con individuos sanos de la población,
también sin relación de parentesco, lo que permite obtener grandes tamaños
muestrales que aumenten la potencia estadística del estudio. El método
estadístico para esta comparación es sencillo, basándose en el análisis χ2 de
tablas de contingencia 2 x 2, construidas con las frecuencias de los dos alelos de
un polimorfismo en casos y controles. De este modo, se dice que uno de los
alelos está asociado con la enfermedad si éste tiene una frecuencia
significativamente mayor en los casos en comparación con los controles, o
viceversa. Una de las dificultades de los estudios de asociación es la elección
del grupo control, en contraposición con los estudios de ligamiento o los TDT,
que no requieren un grupo control porque estudian modelos de herencia basados
en familias. Otro problema de los estudios de asociación es la estratificación
poblacional, que puede dar lugar a falsos positivos cuando hay diferencias en la
frecuencia de la enfermedad y del marcador entre las subpoblaciones que
forman la cohorte de muestras a estudiar. Además, siguen teniendo el
inconveniente de la dificultad que supone detectar polimorfismos de

22
 Introducción

susceptibilidad con un efecto pequeño, aunque este problema va siendo menor

al utilizar cada vez mayores tamaños muestrales.

A pesar de estos inconvenientes, los estudios de asociación caso-control,

junto con los TDT, han permitido identificar, en intervalos de ligamiento, genes
candidato, implicados en procesos inmunológicos (formación de complejos
inmunes, transducción de señal o ruta del IFN). Así, el locus 1q22-24 se podría
explicar por los receptores de baja afinidad de la fracción constante de la IgG
(FCGR) FCGR2A, FCGR2B y FCGR3A y también por la molécula de adhesión
LY9 (Cunninghame Graham DS y col., 2008b). Como candidato para el
ligamiento del locus 1q41-42 se propuso la poli-ADP-ribosa polimerasa (PARP),
que media la ADP-ribosilación post-traduccional de proteínas. El ligamiento de
la región 2q23-33 podría venir explicado por STAT1-STAT4, que inducen la
expresión de genes activados por IFN (Remmers EF y col., 2007). En el
intervalo de ligamiento 16p12-q13 se descubrió la asociación con LES del gen
de la integrina α-M (ITGAM), que participa en la inflamación al regular la
adhesión y migración leucocitaria (Nath SK y col., 2008). Por último, en el
locus 2q37 se propuso al gen de muerte celular programada 1 (PDCD1), que
participa en el mantenimiento de la tolerancia periférica. Este último locus ha
sido de gran interés ya que fue el primer gen que se encontró asociado con LES
a partir de un locus de ligamiento.

3.2.1. PDCD1

El gen PDCD1 (también conocido como PD1 o CD279) codifica para un

receptor que pertenece a la familia B7/CD28 que funciona como inhibidor de la
actividad de linfocitos T y B. Tras su identificación como posible factor de
susceptibilidad al LES en estudios de ligamiento con familias multicaso

23
Factores genéticos asociados con predisposición a LES

islandesas, suecas y noruegas (Lindqvist AK y col., 2000; Magnusson V y col.,

2000), se sugirió que el polimorfismo de un sola nucleótido (SNP) PD1.3 (G/A)
sería el responsable. El alelo A mostraba una mayor frecuencia en los pacientes
con LES en comparación con los controles en un estudio de asociación caso-
control que incluía varios grupos étnicos. Además este SNP era interesante por
su posible papel funcional, ya que parecía alterar el sitio de unión para el factor
de transcripción RUNX1 (Prokunina y col., 2002). Diferentes estudios
posteriores han mostrado asociación de PDCD1 con susceptibilidad al LES o a
determinados fenotipos de la enfermedad (Nielsen C y col., 2004; Prokunina L
y col., 2004; Sanghera DK y col., 2004; Johansson M y col., 2005; Thorburn
CM y col., 2007; Velazquez-Cruz R y col., 2007) y a otras enfermedades
autoinmunes, como AR (Prokunina L y col., 2004) o diabetes tipo 1 (T1D)
(Nielsen C y col., 2003), confirmando la importancia de este gen en los
procesos de autoinmunidad. Sin embargo, se han observado discrepancias
acerca de cuál es el alelo responsable de la relación entre PDCD1 y
autoinmunidad. Así, en otro estudio de asociación en población española
realizado por nuestro grupo, el alelo de susceptibilidad a la enfermedad fue el
alelo G de PD1.3 en lugar del A (Ferreiros-Vidal I y col., 2004). Además,
utilizando una colección de muestras de distintos países europeos se observó un
gradiente geográfico de la frecuencia del alelo A de PD1.3, que aumentaba del
noreste al suroeste de Europa en los controles (Ferreiros-Vidal I y col., 2007).
La ausencia de un gradiente similar en los pacientes sería la explicación de los
resultados discordantes en los extremos del gradiente (suecos y españoles),
excluyéndose un efecto directo de este alelo en la susceptibilidad al LES. Esta
idea es reforzada por la existencia de diferentes estudios de asociación en los
que se ha visto que otros polimorfismos de PDCD1 podrían predisponer al LES
o a otras enfermedades o fenotipos autoinmunes (James ES y col., 2005; Newby
PR y col., 2007). En concordancia con estas dos conclusiones, los estudios de

24
 Introducción

asociación de genoma completo (GWAS) de LES en población europea no

mostraron ninguna señal significativa en este locus (Hom G y col., 2008;
Graham RR y col., 2008), por lo que su asociación con la enfermedad es muy
cuestionada en la actualidad.

PDCD1 se expresa en linfocitos T y B, células NK, monocitos y células

mieloides, pero sólo tras su activación (Sharpe AH y col., 2002). También se ha
observado en el timo, donde puede jugar un papel en el mantenimiento de la
tolerancia central (Blank C y col., 2003). Los ligandos de PDCD1 son también
miembros de la familia B7: PD-L1 (B7-H1 o CD274) (Freeman GF y col., 2000)
y PD-L2 (B7-DC o CD273) (Latchman Y y col., 2001). Ambos se expresan en
monocitos y DCs. PD-L1 es producido además en células T y B y en una amplia
variedad de tejidos no linfoides (Coyle AJ y col., 2001). PDCD1, al unirse con
sus ligandos, atenúa la respuesta de los linfocitos activados. La unión induce la
fosforilación de las tirosinas de los dominios inmunoinhibidor ITIM
(immunoreceptor tyrosine-based inhibition motif) y conmutador ITSM
(immunoreceptor tyrosine-based switch motif) (Leibson PJ y col., 2004). ITSM
fosforilado recluta fosfatasas de tirosina, homólogas a la fosfatasa Src2 con
dominios SH2, que defosforilan moléculas como Syk, la fosfatidil inositol 3
quinasa (PI3K), la fosfolipasa C (PLC), Vav, ZAP70, la proteín quinasa C theta
(PRKCQ) o CD3ζ (Sharpe AH y col., 2002). En los linfocitos T activados esta
defosforilación conduce a una disminución de la proliferación y producción de
citocinas como IFNγ, IL10, IL4 e IL2 (Carreno BM y col., 2002); mientras que
en los linfocitos B conduce a la inhibición de procesos relacionados con la
proliferación y diferenciación celular, como el cambio de clase de
inmunoglobulinas (Ig) (Nishimura H y col., 1998).

25
Factores genéticos asociados con predisposición a LES

La importancia de PDCD1 en la prevención de la autoinmunidad se ha

demostrado en los ratones knockout (KO). Los ratones de distintas cepas
muestran enfermedades distintas, pero todas con etiología autoinmune. Así, los
ratones de la línea BALB/c-PDCD1-/- desarrollan una cardiopatía dilatada
autoinmune, mediada por anticuerpos anti-troponina-1, que inducen la
estimulación crónica del flujo de Ca2+ en los caridiomiocitos (Okazaki T y col.,
2003). Por su parte, la línea C57BL/6-PDCD1-/- desarrolla un fenotipo más
relacionado con el LES: glomerulonefritis de tipo lupus, depósito de IgG3 y del
factor del complemento C3 en los glomérulos, artritis y esplenomegalia
(Nishimura H y col., 1999). Por último, los ratones NOD (non-obese diabetic)-
PDCD1-/- desarrollan T1D más temprana que los ratones NOD wild type, con
una penetrancia del 100 % debida a una rápida infiltración de los islotes
pancreáticos por los linfocitos Th1 (Wang J y col., 2005).

Varios estudios han demostrado que PDCD1 también es un elemento

clave en la persistencia de infecciones víricas crónicas. En enfermos de SIDA,
PDCD1 está sobreexpresado en los linfocitos T CD8+ específicos del virus de
inmunodeficiencia humana (VIH). Esta sobreexpresión provoca una acción
antivírica ineficiente. Estos linfocitos tienen una capacidad reducida de
proliferar y de producir citocinas y moléculas efectoras. Además, la expresión
aumentada de PDCD1 en los linfocitos T se correlaciona con una mayor carga
viral, un aumento de apoptosis de los linfocitos T CD8+ y una disminución en
el recuento de linfocitos T, características predictoras de la progresión de la
enfermedad. Una demostración de la importancia de PDCD1 en el SIDA se
obtuvo al observar que el bloqueo de PDCD1 restaura las funciones de los
linfocitos T CD8+. (Day CL y col., 2006; Petrovas C y col., 2006; Trautmann L,
2006). De modo similar, se ha visto un aumento de expresión de PDCD1 en
linfocitos T CD8+, T CD4+ y Treg de pacientes con infección crónica por los

26
 Introducción

virus de las hepatitis B y C. Estos niveles elevados de expresión de PDCD1 se

correlacionaban también en estas enfermedades con la carga viral, el grado de
inflamación y el daño hepático. También, en estos dos tipos de hepatitis el
bloqueo de PDCD1 da lugar a un aumento de la producción de IFNγ y de la
proliferación de los linfocitos. Además, los pacientes que responden al
tratamiento antiviral muestran una reducción en la expresión de PDCD1 (Peng
G y col., 2008; Golden-Mason L y col., 2008; Radziewicz H y col., 2009;
Kassel R y col., 2009). Por todo ello, se considera que PDCD1 tiene un papel
crítico en la persistencia de las infecciones víricas.

Así, PDCD1 tiene un papel relevante en la regulación de la respuesta

inmune, por lo que es un buen candidato a factor de susceptibilidad al LES. Sin
embargo, los estudios de asociación más recientes no muestran una asociación
clara.

3.3. Estudios de asociación de genoma completo

La mayoría de estudios de asociación que se han llevado a cabo y de los

que se ha hablado hasta el momento en esta memoria se conocen genéricamente
como estudios de asociación de gen candidato. Se centran en el análisis de uno
o varios factores genéticos con el soporte de algún indicio sobre su posible
papel en la enfermedad, ya sea por su papel funcional, como por evidencias de
ligamiento del locus en el que se encuentran. El enfoque de los GWAS es
distinto ya que se pretende evaluar la variabilidad genética a lo largo de todo el
genoma, sin el soporte de una hipótesis previa.

Actualmente se conocen más de 14 millones de SNPs presentes en el

genoma humano, pero no es necesario el análisis de toda esta variación genética

27
Factores genéticos asociados con predisposición a LES

de forma directa. El descubrimiento de que el genoma humano está

mayoritariamente incluido en bloques de desequilibrio de ligamiento (LD),
regiones del genoma con variantes fuertemente correlacionadas (Internacional
HapMap Consortium y col., 2007), permitió la posibilidad de explorar la
variabilidad del genoma utilizando un número relativamente pequeño de SNPs.
Este descubrimiento fue parejo al desarrollo de nuevas técnicas de biología
molecular que permitieron analizar un gran número de SNPs en grandes
colecciones de muestras de forma económica, de tal manera que se consigue
una buena cobertura genética a lo largo del genoma humano. Las dos compañías
que han proporcionado dichas herramientas son Affymetrix e Illumina. Ambas
han comercializado chips para analizar hasta un millón de SNPs, siendo los más
utilizados hasta el momento los de 300000 y 500000 SNPs.

Tras genotipados a gran escala como los que se realizan con estos chips,
es necesario llevar a cabo un control de calidad a tres niveles: SNPs, muestras y
genotipos. En cuanto a los SNPs, se comprueba la eficiencia de genotipado y si
la frecuencia del alelo menor se encuentra en equilibrio de Hardy-Weinberg así
como si está en concordancia con los datos de HapMap y con los duplicados
internos. Con respecto a las muestras, se comprueba también la eficiencia de
genotipado y la concordancia entre el sexo recogido y el observado. Y con los
datos de genotipo se comprueba si existe algún problema de subestructura
poblacional y si hay muestras que puedan tener una relación de parentesco
oculta, lo que puede dar lugar a falsos positivos.

Para corregir la posible presencia de estratificación poblacional, se

utilizan dos aproximaciones: el análisis de componentes principales y el control
genómico. El control genómico usa un conjunto de marcadores no asociados
con la enfermedad y elegidos al azar para estimar un factor de inflación, λ. Este

28
 Introducción

factor es una medida basada en el test χ2 que refleja si la distribución de los

genotipos se ajusta a la hipótesis nula de ausencia de estratificación poblacional
(λ = 1). Un valor mayor de 1 indica un incremento del estadístico de asociación
debido a estratificación poblacional (Tiwari HK y col., 2008). Este valor se
utiliza como factor de corrección para todos los resultados de asociación en el
estudio. Sin embargo, algunos SNPs difieren más que otros entre las distintas
poblaciones, por lo que el ajuste uniforme que aplica el control genómico puede
no ser óptimo. El segundo método para corregir la estratificación poblacional se
basa en el análisis de componentes principales. Este análisis reduce todos los
genotipos a un menor número de variables continuas no correlacionadas,
llamadas componentes principales, que reflejan la máxima variabilidad genética
posible. Si existen subpoblaciones en el estudio, los ejes de los componentes
principales suelen tener una interpretación geográfica, por lo que fenotipos y
genotipos se pueden ajustar según la variabilidad atribuida a la ascendencia,
para llevar a cabo el estudio de asociación sin interferencia de estructura
poblacional (Price AL y col., 2006).

Una de las ventajas de los GWAS es que no requieren de hipótesis a

priori. Se pueden considerar como estudios generadores de hipótesis, ya que se
analiza todo el genoma sin tener en cuenta el posible papel en la enfermedad o
la posible funcionalidad de los SNPs. Esto ha permitido de forma efectiva
descubrir genes de susceptibilidad que no se esperaba que tuviesen un papel en
la enfermedad. Sin embargo, dado al alto número de hipótesis que son
analizadas, se ha establecido un umbral de significación mucho más estricto (P
< 5 x 10-8) que el clásico de P < 0.05. Este umbral reduce la tasa de falsos
positivos lo que hace que los resultados de asociación de los GWAS sean
altamente reproducibles. Pero se necesita un tamaño muestral grande para
detectar incluso las asociaciones más fuertes (Tabla 2).

29
Factores genéticos asociados con predisposición a LES

La potencia estadística de los GWAS, la probabilidad de que el GWAS

encuentre una asociación significativa, no puede ser calculada de forma
analítica por la existencia de LD entre los SNPs. Por ello se utilizan
simulaciones. El resultado depende de los SNPs incluidos en el chip, del tamaño
del efecto a detectar y del tamaño muestral disponible. En general, los GWAS
tienen una buena potencia (> 80 %) para detectar efectos fuertes (Odds Ratio
(OR) > 1.5), pero ésta se ve muy reducida (< 70 %) en la identificación de
efectos más modestos (OR > 1.2).

Los GWAS tienen algunas limitaciones. La primera es que los SNPs

funcionales pueden no estar en LD con ninguno de los marcadores genotipados,
por lo que no serán detectados. Esto es especialmente posible para las variantes
raras (< 5 %), que no están bien recogidas en los chips utilizados. Por otra parte,
los GWAS no pueden evaluar otro tipo de variantes como los polimorfismos de
inserción/delección (indel) o las inversiones. Sin embargo, las últimas
plataformas de genotipado ya incluyen herramientas para la detección de los
polimorfismos conocidos como CNVs o variaciones en el número de copias.

3.3.1. GWAS en LES

En total, se han publicado 5 GWAS en LES, cuatro de ellos en población

europea y uno en asiáticos. Estos estudios además de identificar un gran número
de genes o loci de susceptibilidad, han confirmado de forma consistente la
asociación con LES de factores genéticos ya conocidos, como el antígeno
leucocitario humano (HLA), IRF5, FCGR2A, PTPN22 y STAT4 (Hom G y col.,
2008, SLEGEN y col., 2008, Kozyrev SV y col., 2008; Graham RR y col., 2008;
Han JW y col., 2009) (Tabla 2).

30
 Introducción

Alelo Mayor/ P GWA < P meta-

SNP Locus Chr
Alelo Menora 5x10-8 análisis
rs2476601 PTPN22 1p13 G/A -
SLEGEN y col., 2008 (N=6728) rs1801274 FCGR2A 1q23 C/T -
rs10798269 - 1q25.1 C/T 1.11x10-7
rs7574865 STAT4 2q32 G/T Sí -
rs7601754 STAT4 2q32 T/C -
rs6445975 PXK 3p14.3 A/C 7.10x10-9
rs3131379 HLA 6p21.33 G/A Sí 1.71x10-52
rs12537284 IRF5/TNPO3 7q32 G/A 3.61x10-19
rs4963128 KIAA1542 11p15.5 C/T 3.00x10-10
rs9888739 ITGAM 16p11.2 C/T 1.61x10-23
GWAS europeos

rs7574865 STAT4 2q32.3 G/T Sí 9x10-14

2008 (N=6301)
Hom G y col.,

rs2187668 HLA 6p21 G/A Sí 3x10-21

rs10488631 IRF5/TNPO3 7q32 T/C Sí 2x10-11
rs13277113 C8orf13-BLK 8p21.3 G/A 1x10-10
rs11574637 ITGAM-ITGAX 16p11.2 T/C 3x10-11
rs5029939 TNFAIP3 6q23.3 C/G Sí 2.89x10-12
(N=2586; y 740
Graham RR y

8.49x10-11
col., 2008

rs3821236 STAT4 2q32.3 G/A

tríos)

rs2618476 BLK 8p23.1 T/C 1.70x10-8

HLA 6p21 Sí -
IRF5/TNPO3 7q32 Sí -
Kozyrev SV y
col., 2008
(N=3971)

rs10516487 BANK1 4q24 G/A 3.74x10-10

rs2205960 TNFSF4 1q25.1 C/A 2.53x10-32

rs463426 HIC2-UBE2L3 22q11.21 A/G 1.48x10-16
rs13385731 RASGRP3 2p22.3 A/G 1.25x10-15
rs7574865 STAT4 2q32.3 C/A Sí 5.17x10-42
Han JW y col., 2009 (N=12454)

rs10036748 TNIP1 5q33.1 A/G 1.67x10-9

HLA 6p21 Sí -
rs548234 PRDM1-ATG5 6q21 A/G 5.18x10-12
GWAS asiáticos

rs2230926 TNFAIP3 6q23.3 A/C 1.37x10-17

rs4917014 IKZF1 7p12.2 A/C 2.75x10-23
rs1167796 Múltiples genes 7q11.23 G/A 2.12x10-8
rs4728142 IRF5 7q32.1 G/A 8.14x10-19
rs7812879 BLK 8p23.1 G/A Sí 2.09x10-24
rs1913517 LRRC18-WDFY4 10q11.22 G/A 7.22x10-12
rs4639966 Múltiples genes 11q23.3 A/G 1.25x10-16
rs6590330 ETS1 11q24.3 G/A 1.77x10-25
rs1385374 SLC15A4 12q24.32 G/A 1.77x10-11
rs7197475 Múltiples genes 16p11.2 G/A 2.77x10-8

Tabla 2. (Pie de tabla en el reverso).

31
Factores genéticos asociados con predisposición a LES

Tabla 2. Resumen de los hallazgos principales de los GWAS en LES. Para cada
estudio se detallan los SNPs asociados, el locus en el que se encuentran, la posición en el
cromosoma, los alelos, si la asociación alcanzó el nivel de significación requerido para los GWAS
y el valor de P en el análisis conjunto de todos los resultados obtenidos en el mismo estudio. a En
negrita, el alelo de riesgo.

El Consorcio Internacional de Genética del LES (SLEGEN) llevó a cabo

un estudio de 317501 SNPs en 2 colecciones de muestras que sumaban un total
de 720 mujeres con LES y 2337 controles. Los SNPs más consistentemente
asociados fueron estudiados en otros 2 conjuntos de muestras independientes
que consistían en un total de 1846 mujeres con LES y 1825 controles (SLEGEN
y col., 2008). En el análisis combinado, encontraron asociación con 3 SNPs en
ITGAM (rs9888739, rs1143678 y rs4548893), el SNP rs4963128 en KIAA1542
y rs6445975 en la quinasa de serina-treonina con dominio homólogo a Phox
(PXK). Además, el SNP rs10798269 en 1q25.1, que se encuentra lejos de
cualquier gen conocido, fue resaltado como muy probablemente asociado
(Tabla 2).

Un segundo estudio analizó 502033 SNPs en 1311 casos con LES y 3340
controles de población europeo-americana, realizando posteriormente una fase
de confirmación de los resultados más destacables en 793 casos con LES y 857
controles de población sueca (Hom G y col., 2008). Sus resultados mostraron
también la asociación significativa de polimorfismos en la región cromosómica
que contiene el gen ITGAM. Además, vieron asociación de un locus que hasta
ahora no había sido relacionado con LES: la región promotora de los genes de la
quinasa de linfocitos B (BLK) y de C8orf13, que comparten la misma región
promotora aunque se transcriben en dirección opuesta (Hom G y col., 2008)
(Figura 3).

32
 Introducción

Figura 3. Diagrama de Manhattan representando por puntos todos los SNPs

estudiados en el GWAS realizado por Hom y col (Hom G y col., 2008). El eje de abscisas
muestra la posición en los cromosomas que están identificados por diferentes colores. En el eje de
ordenadas se representa el –logaritmo del valor P correspondiente a cada SNP.

Otro de los GWAS publicados en 2008, incluyó el estudio de 311238

SNPs en 431 pacientes y 2155 controles de ascendencia europea. En este
estudio se encontró otro locus que pasaba el umbral de significación de genoma
completo: la proteína 3 inducida por TNFα (TNFAIP3). Este locus ya se había
visto asociado con AR previamente (Graham RR y col., 2008) (Figura 4).
Además, los 134 loci con menor P se analizaron también en 740 tríos y el meta-
análisis de ambas fases mostró asociación de BLK e ITGAM (Tabla 2).

33
Factores genéticos asociados con predisposición a LES

Figura 4. Diagrama de Manhattan representando los resultados del GWAS de LES

realizado por Graham y col (Graham RR y col., 2008). Dos líneas punteadas horizontales
indican los niveles de P = 10-6 y P = 5 x 10-8.

Por último, en otro estudio de todo el genoma pero de menor densidad, se

genotiparon 85042 SNPs en una cohorte sueca de 279 casos y 515 controles.
Como consecuencia de este GWAS se encontró asociación de la proteína
estructural de células B con repeticiones de anquirina (BANK1) que alcanzó el
valor de P < 5 x 10-8 cuando se estudió en 4 cohortes adicionales de población
escandinava, argentina, alemana, italiana y española (2003 pacientes y 1968
controles) (Kozyrev SV y col., 2008) (Tabla 2).

También se ha realizado un GWAS en población china (Han JW y col.,

2009) (Figura 5). En este estudio se analizaron 493955 SNPs en 1047 casos y
1205 controles y las asociaciones significativas fueron evaluadas en dos
colecciones de muestras adicionales que englobaban 3152 casos y 7050
controles. Como resultado, se identificaron 8 loci de susceptibilidad nuevos
(RASGRP3, IKZF1, ETS1, SLC15A4, 7q11.23, 10q11.22, 11q23.3 y 16p11.2).
Además, al igual que en población europea, también observaron asociación con
LES de los loci de la proteína 1 de interacción con TNFAIP3 (TNIP1) (Gateva

34
 Introducción

V y col., 2009), PRDM1-ATG5 (PR domain containing 1, with ZNF domain-

APG5 autophagy 5-like) (SLEGEN y col., 2008) e HIC2-UBE2L3
(hypermethylated in cancer 2-ubiquitin-conjugating enzyme E2L 3) (SLEGEN y
col., 2008), y confirmaron otros 5 loci ya más consolidados: el miembro 4 de la
superfamilia de ligandos del TNF (TNFSF4) (Cunninghame Graham DS y col.,
2008a), STAT4 (Hom G y col., 2008; Graham RR y col., 2008), TNFAIP3
(Graham RR y col., 2008), IRF5 (SLEGEN y col., 2008; Hom G y col., 2008;
2008; Graham RR y col., 2007a) y BLK (Hom G y col., 2008) (Tabla 2).

Figura 5. Diagrama de Manhattan representando los resultados del GWAS de LES

en chinos realizado por Han y col (Han JW y col., 2009).

Dos herramientas complementarias tras los GWAS han sido la

imputación genotípica y el meta-análisis. La imputación permite evaluar la
asociación de marcadores genéticos que no han sido directamente genotipados.
Estos genotipos se pueden asignar conociendo los patrones de LD en un

35
Factores genéticos asociados con predisposición a LES

conjunto de muestras de referencia, como son las muestras de HapMap. La

imputación también es muy útil para combinar resultados de estudios que
utilizan diferentes plataformas de genotipado. La combinación de datos de dos o
más estudios se denomina meta-análisis. Su objetivo es tratar de detectar
asociaciones que se escapan en los GWAS individuales por tener un efecto
modesto. Además, los meta-análisis también permiten comprobar la
consistencia y credibilidad de las asociaciones, sirviendo como un método de
confirmación. Con este objetivo, se ha publicado un meta-análisis que encontró
4 loci significativos según el criterio de los GWAS: IRAK1, TNFSF4, UBE2L3
y FCGR2A (Graham RR y col., 2009). Tres de estos loci ya eran conocidos por
otros estudios previos.

Otra aproximación que se ha seguido para descubrir más factores de

susceptibilidad ha sido el análisis de SNPs con alguna evidencia de asociación
en un GWAS en más muestras para ver si se confirman. Un estudio de este tipo
(Gateva V y col., 2009) intentó identificar nuevos loci de riesgo entre los 2466
que mostraban una P < 0.05 en el GWAS de Hom y col. También incluyeron en
el análisis 505 SNPs de 23 loci previamente identificados como asociados con
LES y 42 SNPs implicados en otras enfermedades autoinmunes. El genotipado
se llevó a cabo en colecciones de Estados Unidos (1129 casos y 2991 controles)
y Suecia (834 casos y 1338 controles) independientes a las utilizadas en el
GWAS. Se confirmaron las asociaciones previas de TNFAIP3, BLK, ITGAM,
KIAA1542 y TNFSF4, y además, se identificaron 5 nuevos loci de
susceptibilidad al LES con un valor de P menor al umbral de significación de
los GWAS: TNIP1, PRDM1-ATG5, JAZF1 (JAZF zinc finger 1), proteína 1 de
unión a ICBP90 (UHRF1BP1) e IL10.

36
 Introducción

A pesar de la gran cantidad de factores genéticos de susceptibilidad al

LES identificados en los GWAS, hay que tener precaución en su interpretación
ya que, debido al alto número de análisis que implican estos estudios, la
probabilidad de encontrar falsos positivos es alta. Este inconveniente ya se
intenta corregir estableciendo un estricto umbral de significación, pero además
es necesario que estos resultados sean confirmados en conjuntos de muestras
independientes y por laboratorios independientes, sobre todo por la dificultad de
encontrar verdaderas asociaciones para las enfermedades complejas,
especialmente cuando los efectos son modestos. Así, los distintos factores
genéticos detectados no tienen el mismo grado de certidumbre. Hay
asociaciones definitivas y consistentes, debido a que ya han sido identificadas
en 2 o más estudios independientes y en los GWAS (como las de HLA, IRF5,
ITGAM, STAT4, C8orf13-BLK y TNFAIP3). Otras asociaciones han sido
identificadas sólo en uno de estos GWAS por lo que constituyen señales sólidas
(como BANK1, PXK, KIAA1542 y 1q25.1). Por otra parte, asociaciones no
detectadas en GWAS pero sí en grandes estudios de asociación de genes
candidato pueden considerarse como probables (como MECP2 y LY9), mientras
que otras pueden ser controvertidas porque los estudios muestran resultados
diferentes (como la tirosín-quinasa 2, TYK2). Así que, la replicación de estos
resultados es necesaria e importante porque proporciona una evidencia de la
reproducibilidad de la asociación de un polimorfismo con la enfermedad.

3.4. Factores genéticos de LES confirmados

3.4.1. HLA

Los primeros genes que fueron descubiertos como factores de riesgo para
el LES fueron los que codifican para el HLA. Las moléculas del HLA están

37
Factores genéticos asociados con predisposición a LES

implicadas en el reconocimiento y la respuesta inmune, de ahí que muchos

estudios genéticos de enfermedades autoinmunes se centren en ellos. El
problema que presenta su estudio es que la región en la que se encuentran es de
gran complejidad genética y con un alto LD, lo que dificulta la identificación de
las variantes causales y también la identificación de otros posibles genes de
susceptibilidad al LES.

El estudio que más contribuyó a definir la asociación del MHC con LES
incluyó unos 50 microsatélites analizados en 334 familias multicaso. En este
análisis quedó clara la importancia de los haplotipos que incluyen HLA-DRB1 y
DQB1, concretamente los correspondientes al HLA-DR2 (DRB1*1501-
DQB1*0602), HLA-DR3 (DRB1*0301-DQB1*0201) y, con una menor
importancia, al HLA-DR8 (DRB1*0801-DQB1*0402) (Graham RR y col.,
2002). Este estudio delimitó una región de 1 Mb, que engloba la región del
MHC de clase II y III, pero no fue posible precisar más debido al alto LD de la
zona. Los haplotipos portadores del HLA-DR3 confieren mayor riesgo que los
portadores del HLA-DR2 y los individuos homocigotos para DR3 o
heterocigotos DR3/DR2 muestran el riesgo más alto. Además, estos haplotipos
se han asociado con la producción de autoanticuerpos característicos del LES
(Graham RR y col., 2007b; Sebastiani GD y col., 2009). Concretamente, el
haplotipo DR2 se asocia con la producción de anti-Sm y anti-ADN de doble
cadena, mientras que DR3 está relacionado con mayores niveles de anti-Ro y
anti-La. Los GWAS publicados recientemente (SLEGEN y col., 2008; Hom G y
col., 2008; Graham RR y col., 2008) han confirmado que los marcadores
localizados en la región del HLA de clase II son los más fuertemente asociados
con la enfermedad, aunque su contribución al LES no es mucho mayor que la de
otros factores genéticos encontrados (Figura 6), por lo que el efecto del HLA
no es comparable con el observado en otras enfermedades autoinmunes como

38
 Introducción

AR o T1D (Fernando MM y col., 2008). Tampoco está clara la asociación del

HLA con LES en grupos étnicos no caucásicos (Graham RR y col., 2007b;
Fernando MM y col., 2007). Por ejemplo, en población latinoamericana ha sido
un factor de susceptibilidad inconsistente, aunque es posible que esta
inconsistencia sea debida a la heterogeneidad genética y el pequeño tamaño
muestral de los estudios. De hecho, en un meta-análisis, con mayor potencia
estadística, los alelos HLA-DR2 y -DR3, así como el haplotipo DRB1*0301-
DQB1*0201 conferían un aumento significativo del riesgo de LES en esta
población (Castaño-Rodríguez N y col., 2008).

Los genes HLA-DR y HLA-DQ tienen un papel muy importante en los

procesos inmunes ya que las proteínas que codifican se expresan en CPAs y su
función es presentar péptidos extraños a los receptores de células T (TCR) de
las células Th CD4+. Estas células estimuladas inducen la producción por las
células B de anticuerpos específicos frente al péptido, iniciando la respuesta
inmune adquirida. Sin embargo, no se conoce cuál es la participación específica
de los alelos HLA en la susceptibilidad al LES.

39
Factores genéticos asociados con predisposición a LES

11

10

6
OR

K
A, q

ST 5
FC AM

TN 22

AA 4
FC IP3
B
C2

IR 4

1
BA 1
TN A

IT B

3A

PT 2A

K
42

P2
FC K1
F

AK

KI S F
C4 C1

AT

or 25.
BL
PX
3
C4

HL

IR

PN

15
R

EC
N
G
FA

3-
G

C8 1q
f1

M
Figura 6. Comparación del efecto de los genes asociados al LES. Como medida del
tamaño del efecto se usaron las ORs (Moser KL y col., 2009).

3.4.2. Factores del Complemento

Las deficiencias en los componentes del complemento C2, C4A y C4B,

cuyos genes están localizados en la región del HLA de clase III, y C1q, con el
gen localizado en 1p34.1-1p36.3, muestran una asociación muy fuerte con LES
(Figura 6) (Sullivan KE y col., 1994; Fielder AH y col., 1983; Reveille JD y
col., 1985; Botto M y col., 2002). En concreto, la deficiencia del factor C4, bien
C4A o C4B, es una de las CNVs asociadas con LES mejor definida. La
deficiencia completa del gen (cuatro alelos nulos) es muy rara pero está
fuertemente asociada con el LES, ya que el 75 % de individuos con esta

40
 Introducción

deficiencia sufren la enfermedad (Manderson AP y col., 2004). El alelo nulo de

C4A está asociado en casi todas las poblaciones estudiadas. Sin embargo, esta
deficiencia se encuentra en el mismo haplotipo del HLA-DR3, también asociado
a LES, por lo que todavía no está claro si la asociación con LES de estos dos
factores genéticos es o no independiente (Kelly JA y col., 2002). Por otra parte,
la deficiencia de C2, que es la más frecuente en la población general, se asocia
con LES en el 33 % de los individuos (Kelly JA y col., 2002). Mientras que la
deficiencia del complemento que causa una mayor incidencia de LES es la de
C1q (Figura 6). Más del 92 % de los sujetos deficientes en C1q desarrollan
LES, normalmente con un fenotipo severo (Kelly JA y col., 2002). A pesar de la
fuerte penetrancia de las deficiencias de los factores del complemento, éstas son
variantes raras, por lo que la fracción de la susceptibilidad al LES atribuible a
estos factores es muy pequeña. Por esta razón, los factores del complemento no
son analizados en los pacientes con LES de forma sistemática.

Los componentes del complemento son fundamentales en la respuesta

inmunitaria y en la defensa frente a agentes extraños. Están implicados en una
cascada bioquímica cuyas funciones son potenciar la respuesta inflamatoria,
facilitar la fagocitosis y dirigir la lisis de células infectadas. Concretamente,
C1q sería el responsable de iniciar la cascada al unirse a la fracción Fc de
complejos inmunes polimerizados, causando la proteolisis de los factores C2 y
C4 en sus subunidades A y B. C4A favorece la degranulación de células
cebadas, liberando histamina, que provoca inflamación. Mientras que C4B
forma un complejo con C2A que continúa la cascada para la activación del resto
de componentes del complemento. Este sistema también es importante en el
LES por su papel en el aclaramiento de restos apoptóticos mediante
opsonización. Por tanto, la falta de estos componentes podría llevar a una
defectuosa opsonización, transporte de complejos inmunes y eliminación de

41
Factores genéticos asociados con predisposición a LES

dichos restos celulares, causando inflamación y daño tisular (Kelly JA y col.,

2002).

3.4.3. FCGRs

Los estudios de ligamiento proporcionaron evidencias de la relación con

LES del locus del cromosoma 1 donde se encuentran los genes que codifican
para los receptores Fcγ de baja afinidad (Cantor RM y col., 2004). Múltiples
miembros de esta familia de inmunoglobulinas se han asociado con LES,
aunque muchas de las publicaciones han obtenido resultados inconsistentes. La
evidencia más clara corresponde al polimorfismo no sinónimo de FCGR2A
(rs1801274, H131R), que altera la afinidad del receptor por subclases
específicas de IgG, afectando al procesamiento de complejos inmunes (van der
Pol W y col., 1998). Se han publicado más de 20 estudios de este SNP en
distintos grupos étnicos, con resultados inconsistentes, aunque un meta-análisis
ha mostrado un efecto moderado de susceptibilidad (Karassa FB y col., 2003).
Además, el GWAS del SLEGEN mostró asociación de este SNP con P = 6.8 x
10-7 (SLEGEN y col., 2008). El polimorfismo no sinónimo de FCGR3A (F176V)
que también modifica la afinidad del receptor (van der Pol W y col., 1998) ha
mostrado igualmente asociación a LES en algunos estudios. Un meta-análisis
mostró que está asociado pero sólo en los pacientes con nefritis lúpica (Karassa
FB y col., 2003). Estos dos genes, FCGR2A y FCGR3A, están separados por tan
sólo 35 kb, pero las dos asociaciones parecen independientes. FCGR3A se
expresa en células NK, macrófagos y algunos monocitos, mientras que
FCGR2A se expresa más ampliamente en las células hematopoyéticas. Se
piensa que la baja afinidad de los alelos de riesgo por los complejos inmunes
provoca una deficiencia en su eliminación, aumentando la probabilidad de una
respuesta autoinmune persistente que contribuiría al desarrollo de LES.

42
 Introducción

FCGR3B, que se expresa mayoritariamente en neutrófilos, es otro gen de

la familia de receptores Fcγ de baja afinidad que está implicado en la
susceptibilidad al LES. Este gen presenta un polimorfismo de tipo CNV,
observándose que el bajo número de copias está asociado con riesgo de LES
(Fanciulli M y col., 2007; Willcocks LC y col., 2008). Además, el número de
copias se ha correlacionado con la expresión del gen que, cuando es baja,
implica deficiencias en la adherencia e incorporación de los complejos inmunes
por los neutrófilos. Este comportamiento es característico del LES (Willcocks
LC y col., 2008). FCGR2B es otro gen de la familia de receptores que ha
mostrado asociación con LES en algún estudio (Su K y col., 2004).

La función de los FcγRs consiste en unirse a complejos anticuerpo-

antígeno, por la región Fc del anticuerpo, de modo que las células que expresan
estos receptores pueden identificar en el LES los complejos autoinmunes para
su eliminación mediante fagocitosis. Por tanto, la participación de los FCGRs
así como del sistema del complemento en la susceptibilidad al LES indica la
importancia que tiene la deficiente eliminación de complejos inmunes en el
desarrollo del LES.

3.4.4. TREX1

Mediante secuenciación de la exonucleasa 3’ reparadora 1 (TREX1), se

han encontrado tres tipos de variantes raras en 9 de 417 pacientes caucásicos
con LES, que están ausentes en 1712 controles (Lee-Kirsch MA y col., 2007).
Estas variantes consisten en 2 polimorfismos que provocan un cambio en la
pauta de lectura del gen, generando proteínas truncadas, SNPs no sinónimos
(nsSNPs), que modifican la secuencia aminoacídica aunque no afectan al
dominio catalítico, y una variante en la región no traducida 3’ (3’UTR) del gen.

43
Factores genéticos asociados con predisposición a LES

Mediante análisis funcionales, se observó que las proteínas truncadas veían

alterada su localización celular, por lo que probablemente TREX1 no podría
llevar a cabo su función.

El interés por estudiar TREX1 en el LES se debe a varias observaciones

que podrían recordar a características de esta enfermedad. Así, ya se habían
identificado mutaciones en este gen relacionadas con una encefalopatía
caracterizada por niveles altos de IFNα en el fluido cerebroespinal. Este
fenotipo es similar al que ocurre en una forma poco frecuente del LES,
denominada lupus sabañón. Además, tanto los pacientes que padecen la
encefalopatía como los que presentan esta variante de LES producen ANAs. En
ratones también se observó un posible papel de TREX1 en autoinmunidad, ya
que la deficiencia de este gen provoca miocarditis inflamatoria autoinmune no
infecciosa (Lee-Kirsch MA y col., 2007).

TREX1 codifica para una exonucleasa 3’ que metaboliza ADN de cadena

sencilla. TREX1 forma parte del complejo SET, que se localiza en el retículo
endoplasmático. Este complejo es traslocado al núcleo en respuesta a estrés
oxidativo inducido por grancima A. El estrés oxidativo produce apoptosis
independiente de caspasas, durante la cual TREX1 degrada rápidamente ADN
dañado de cadena sencilla (Chowdhury D y col., 2006). TREX1 también
degrada ADN de cadena sencilla derivado de virus y de retroelementos
endógenos. Esta función produce una regulación negativa de la respuesta de
IFN tipo I que inducirían estos ácidos nucleicos (Stetson DB y col., 2008). Las
infecciones víricas se han considerado factores ambientales que podrían
desencadenar el desarrollo del LES por medio de la activación de la respuesta
de IFN tipo I. Por lo tanto, la posible función de TREX1 en el reconocimiento y
degradación de ADN viral de cadena sencilla en el citoplasma, hacen de este

44
 Introducción

gen un buen candidato para tener un papel en dicha respuesta característica del
LES.

3.4.5. IRF5

IRF5 codifica para un factor de transcripción que regula la expresión de

genes de respuesta a IFN de tipo I. Este gen ha sido uno de los factores
asociados de forma más consistente con el LES, con OR ≥ 1.5 (Figura 6)
(Sigurdsson S y col., 2005; Graham RR y col., 2007a; Cunninghame Graham
DS y col., 2007b; Kozyrev SV y col., 2007; Ferreiro-Neira I y col., 2007;
Sigurdsson S y col., 2008a; SLEGEN y col., 2008). En población europea, se
han identificado múltiples polimorfismos de susceptibilidad, incluyendo: un
SNP que crea un sitio de splicing en el exón 1B (rs2004640); un SNP que crea
un sitio de poliadenilación en 3’UTR (rs10954213), resultando en una variante
transcripcional más corta y de mayor estabilidad; un indel de 30 pares de bases
en el exón 6, que afecta a un dominio de interacción de la proteína; y un indel
de 5 pb en el promotor, que modifica un sitio de unión al factor de transcripción
SP1. La asociación de estos SNPs es compleja, observándose un efecto
protector y otro de susceptibilidad, causados por polimorfismos independientes
y observándose también un posible efecto epistático entre polimorfismos
funcionales (Ferreiro-Neira I y col., 2007). También se ha confirmado la
asociación de IRF5 con LES en otros grupos étnicos (Shin HD y col., 2008;
Kawasaki A y col., 2008b; Han JW y col., 2009; Kelly JA y col., 2008), aunque
no está claro si las señales son similares a las identificadas en caucásicos.

Se ha sugerido que IRF5 induciría la producción de IFN de tipo I en

pDCs además de regular la expresión de genes de respuesta a IFN. Así, se ha
observado que pacientes con LES portadores de haplotipos de riesgo de IRF5

45
Factores genéticos asociados con predisposición a LES

tienen niveles más altos de IFNα (Niewold TB y col., 2008). A su vez, la

producción de IRF5 es inducida por IFNα, por lo que un bucle de
retroalimentación positiva puede ser parte del mecanismo que predispone al
LES.

3.4.6. PTPN22

Alteraciones en la señalización del TCR pueden incrementar el riesgo de

autoinmunidad. A este nivel actúa la fosfatasa de tirosina linfoide (LYP),
codificada por el gen PTPN22. Su función es inhibir la cascada de señalización
del TCR. El polimorfismo R620W (rs2476601) en el exón 14 de este gen está
implicado en múltiples enfermedades autoinmunes (Chung SA y col., 2007):
T1D, AR, LES y enfermedad tiroidea autoinmune entre otras. Su efecto en LES
parece más fuerte en los casos familiares que en los esporádicos (Kaufman KM
y col., 2006). El alelo de riesgo 620W impide la interacción de LYP con la
tirosín-quinasa CSK (C-terminal Src tyrosine kinase), que es una supresora de
las quinasas que median la activación del TCR. Esta evidencia llevó a sugerir
que el alelo de riesgo implicaría una pérdida de función de LYP. Por lo tanto,
este alelo llevaría a una disminución en la regulación negativa de los linfocitos
T y su respuesta exagerada facilitaría la autoinmunidad. Sin embargo,
experimentalmente se ha observado lo opuesto. El alelo de riesgo implica una
ganancia de función de LYP, resultando en una mayor inhibición de la
señalización del TCR (Vang T y col., 2005). Se sugiere que esta
hiposensibilidad linfocitaria produce fallos en la eliminación de células T
autorreactivas en el timo, causando enfermedades autoinmunes (Rieck M y col.,
2007). Un trabajo reciente ha identificado otro polimorfismo de PTPN22
asociado al LES, R263Q, que también afectaría a la función fosfatasa. El alelo
menor confiere protección frente a LES y provoca una reducción de la actividad

46
 Introducción

fosfatasa de LYP. De esta forma, se refuerza la hipótesis de que la inhibición de

la actividad de LYP es un objetivo terapéutico importante (Orrú V y col., 2009).

3.4.7. STAT4

STAT4 se localiza en la región de ligamiento 2q descrita tanto en LES

(Cantor RM y col., 2004) como en AR (Jawaheer D y col., 2003). Estudios en
población europeo-americana, identificaron este factor genético como
responsable de dicha señal en las dos enfermedades (Remmers EF y col., 2007;
Taylor KE y col., 2008). El SNP más asociado, rs7574865, tiene un efecto
mayor en LES que en AR, con OR de 1.55 y 1.27, respectivamente. Varios
estudios han confirmado esta asociación con el LES (SLEGEN y col., 2008;
Graham RR y col., 2008; Palomino-Morales RJ y col., 2008; Kobayashi S y col.,
2008; Kawasaki A y col., 2008a; Yang W y col., 2009; Han JW y col., 2009). La
combinación de la mayoría de estos estudios en un meta-análisis mostró la
solidez de esta asociación (Ji JD y col., 2010). Además de esta señal localizada
en el intrón 3, se ha sugerido la existencia de una asociación independiente en el
intrón 16, siendo el SNP más asociado el rs3821236 (Abelson AK y col., 2009).
Una señal independiente del intrón 3 también se vio en un estudio de casi 10000
pacientes con LES procedentes de múltiples grupos étnicos (afro-americanos,
hispano-americanos, asiáticos y europeo-americanos). Dicha señal estaba
representada por un haplotipo de riesgo que va del exón 4 al 14 y que está
relacionada con la asociación del rs3821236 (Namjou B y col., 2009). Por lo
tanto, la contribución de STAT4 al LES es importante en diferentes grupos
étnicos y muestra por lo menos dos señales independientes. Sin embargo,
todavía no se ha descrito ningún polimorfismo causal. Sólo se ha observado que
los SNPs rs7574865 y rs3821236 se correlacionan con los niveles de expresión
de STAT4, pero se desconoce cuál es el mecanismo de esta regulación (Abelson
AK y col., 2009).

47
Factores genéticos asociados con predisposición a LES

Se ha comunicado la asociación de algunas manifestaciones clínicas de

LES con los alelos de riesgo de STAT4. En algunos estudios se encontró que el
alelo de riesgo de rs7574865 estaba más fuertemente asociado en pacientes con
nefritis, anti-ADN de doble cadena, edad temprana de aparición de la
enfermedad, desorden hematológico, isquemia cerebrovascular, anticuerpos aPL,
y anticuerpos anti-Ro (Taylor KE y col., 2008; Kawasaki A y col., 2008a;
Sigurdsson S y col., 2008b; Yang W y col., 2009; Svenungsson E y col., 2009;
Namjou B y col., 2009). Sin embargo, las asociaciones no fueron concordantes
en todos los estudios y el fenotipo asociado está todavía por definir totalmente.

STAT4 codifica para un factor de transcripción que se expresa en

linfocitos, macrófagos y DCs, estando implicado en la diferenciación celular,
proliferación y apoptosis. STAT4 es inducido por IFN de tipo I, IL23 y, sobre
todo, por IL12. Recientemente, se ha visto que la variante de riesgo de
rs7574865 confería una mayor sensibilidad a la señalización por IFNα en
células mononucleares de sangre periférica de pacientes con LES (Kariuki SN y
col., 2009). STAT4 se encuentra de forma latente en el citosol, pero tras su
activación por citocinas, se fosforila y forma homodímeros que se traslocan al
núcleo. En el núcleo, STAT4 estimula la transcripción de genes específicos
incluyendo INFγ, un factor clave en la diferenciación de las células Th1,
(Watford WT y col., 2004). Probablemente, STAT4 sea también necesario para
el desarrollo de las células Th17 y la producción por éstas de IL17. En modelos
animales, se observó que la deficiencia de STAT4 favorecía la resistencia a
padecer enfermedades autoinmunes (Finnegan A y col., 2002). Además, la
inhibición de STAT4 a través de oligodeoxinucleótidos o oligonucleotidos
antisentido es beneficiosa en modelos animales de artritis (Klinman DM y col.,
2005; Hildner KM y col., 2007).

48
 Introducción

3.4.8. ITGAM

El gen ITGAM, que se encuentra en un locus ligado a LES (16p11) (Lee

YH y col., 2005; Forabosco P y col., 2006), ha mostrado asociación en estudios
específicos y GWAS (SLEGEN y col., 2008; Hom G y col., 2008; Nath SK y
col., 2008; Graham RR y col., 2008). El SNP más fuertemente asociado es un
SNP no sinónimo del exón 3 de ITGAM (rs1143679), que presenta una OR de
1.74 en un meta-análisis de dos cohortes de origen europeo (3818 muestras) y
africano (1560 muestras) (Nath SK y col., 2008). El alelo de riesgo codifica
para una histidina, en lugar de una arginina, en la posición 77 de la proteína. El
papel funcional de este cambio todavía se desconoce, aunque se ha sugerido que
podría afectar a la conformación de la proteína y, consecuentemente, alterar la
interacción de ITGAM con sus ligandos. Otros SNPs de la región mostraron
también una fuerte asociación. La mayoría se encontraban en LD con rs1143679
(r2 = 0.5-0.85) (SLEGEN y col., 2008; Hom G y col., 2008), mientras que
rs11150610 mostraba una señal independiente (Graham. RR y col., 2008). La
asociación de ITGAM ha sido fuertemente confirmada en un meta-análisis de
nueve cohortes independientes (8211 muestras) de poblaciones europeas e
hispanas. Sin embargo, estos polimorfismos son prácticamente monomórficos
en asiáticos, constituyendo un claro ejemplo de riesgo de LES específico de
población (Han S y col., 2009).

ITGAM codifica para la integrina α-M que dimeriza con la integrina β-2
(ITGB2 o CD18), formando el receptor del complemento 3 (también conocido
como CD11b o Mac-1). Este complejo se expresa en la superficie celular de
macrófagos, monocitos, DCs y neutrófilos. Las funciones de ITGAM son muy
variadas e incluyen su participación en la adhesión y transmigración de los
leucocitos a través del endotelio (Dunne JL y col., 2003), la activación de

49
Factores genéticos asociados con predisposición a LES

neutrófilos y monocitos (Shappell SB y col., 1990), la apoptosis de neutrófilos

(Coxon A y col., 1996) y la eliminación de complejos inmunes mediante
fagocitosis. Estas funciones las lleva a cabo a través de su interacción con un
amplio rango de ligandos, que incluyen el producto de activación del
complemento 3 (C3bi), el fibrinógeno y la molécula 1 de adhesión intracelular
(ICAM1). Como los pacientes con LES presentan un defecto en la eliminación
de complejos inmunes, se ha sugerido que el polimorfismo de ITGAM podría
ser un factor contribuyente. También se ha observado que la unión de C3bi a
ITGAM induce la producción del factor de crecimiento transformante β (TGFβ)
e IL10, que son esenciales para el mantenimiento de la tolerancia, mecanismo
igualmente alterado en el LES (Sohn JH y col., 2003).

3.4.9. C8orf13-BLK

Uno de los polimorfismos asociados con LES en el estudio GWA de Hom

y col., fue un SNP de la región promotora compartida por los genes BLK y
C8orf13 (FAM167A) (rs13277113, OR = 1.39) (Hom y col., 2008). Otros 2
GWAS (SLEGEN y col., 2008; Graham RR y col., 2008) encontraron otros 2
SNPs con menor efecto (rs2248932, OR = 1.22; rs2618476, OR = 1.29) en el
gen BLK. El alelo de riesgo del SNP rs13277113 está asociado con expresión
reducida de BLK e incrementada de C8orf13. No obstante, ni este SNP, ni
ningún otro polimorfismo en LD (r2 > 0.5) con él, afectan al sitio de unión de un
factor de transcripción ni a otras secuencias nucleicas con función predecible.

C8orf13 es un gen que se expresa de forma ubicua pero que no tiene

función conocida. De BLK se sabe que codifica una quinasa de tirosina de la
familia Src, pero su función todavía no ha sido bien definida. En ratones se ha
visto que se expresa en células pro-B tardías y durante su desarrollo a células

50
 Introducción

plasmáticas (Wasserman R y col., 1995). Por ello, se ha sugerido que estaría

implicada en la transición de células pro-B a pre-B (Tretter T y col., 2003). No
obstante, ratones deficientes en BLK no muestran defectos en las células B, por
lo que su función no está clara (Texido G y col., 2000). En humanos, se ha
sugerido que BLK podría actuar en la señalización del receptor de células B
(BCR) y de NFκB, influenciando el desarrollo de células B y los mecanismos
de tolerancia y autoinmunidad (Gourh P y col., 2010).

3.4.10. BANK1

BANK1 se identificó como un potencial candidato a partir de un estudio

GWA de baja densidad (Kozyrev SV y col., 2008). Se identificaron 3 posibles
polimorfismos funcionales, que no son independientes. El que mostró una
evidencia de asociación más fuerte fue rs17266594 (OR = 0.70), que es un
polimorfismo branch point antes del exón 2. Este SNP altera el splicing de la
proteína, dando lugar a una isoforma corta sin exón 2, que podría afectar a su
unión con otras proteínas. El segundo polimorfismo asociado (rs10516487, OR
= 0.72) es un SNP no sinónimo, localizado a 153 pb del rs17266594 y en LD
con él (r2 = 0.9). El tercer SNP de susceptibilidad (rs3733197, OR = 0.81) se
localiza en el exón 7, correspondiente al dominio anquirina de la proteína, pero
no mostró LD con ninguno de los otros 2 SNPs (r2 < 0.4). La asociación de
BANK1 fue replicada también en un estudio en población china, donde los SNPs
rs17266594 y rs3733197 mostraban asociaciones independientes (Chang YK y
col., 2009). Se ha sugerido la posible asociación de diversos SNPs de BANK1
con variables clínicas específicas: daño hematológico, inmunológico y renal y
producción de anti-RNP A y anti-Sm (Guo L y col., 2009). Sin embargo, estas
asociaciones con la clínica del LES son dudosas, ya que el análisis se hizo
comparando los casos positivos para cada criterio con los controles.

51
Factores genéticos asociados con predisposición a LES

BANK1 es una proteína de anclaje que se expresa en células B. Esta

proteína media la interacción entre la quinasa de tirosina LYN (Yamaguchi
sarcoma viral oncogene homolog) y el canal de calcio IP3R (inositol 1,4,5-
triphosphate receptor), facilitando la liberación de calcio intracelular, proceso
que es importante en la activación de células B (Yokoyama K y col., 2002).
Esta función sugiriere que las variantes asociadas con LES podrían aumentar el
riesgo a sufrir la enfermedad al alterar el umbral de activación de las células B.
Sin embargo, BANK1 también parece tener un papel inhibidor de la respuesta
de células B, ya que ratones deficientes en esta proteína muestran una
producción elevada de anticuerpos (Aiba Y y col., 2006).

3.4.11. 1q25.1 y TNFSF4

Uno de los SNPs asociados significativamente en el GWAS del SLEGEN

fue rs10798269, localizado en el locus 1q25.1 (SLEGEN y col., 2008), donde
no se ha descrito ningún gen. Sólo a unas 133 kb se encuentra un posible gen
candidato, TNFSF4 (también conocido como OX40L). Otros tres estudios han
mostrado asociación de LES con TNSF4, dos de los cuales pasaban el umbral de
significación de los GWAS (Delgado-Vega AM y col., 2009; Gateva V y col.,
2009; Graham RR y col., 2009). Resultados similares se obtuvieron en el
GWAS realizado con chinos (Chang YK y col., 2009). Este gen se expresa en
CPAs y células endoteliales y parece tener un papel en la estimulación de
células T CD4+. Además, se han observado dos haplotipos en la región
upstream del gen, uno protector y otro de riesgo, asociados con LES, en un
estudio en el que también se encontró que el haplotipo de riesgo correlacionaba
con un incremento en la expresión de TNFSF4 (Cunninghame Graham DS y
col., 2008a). Se sugirió que altos niveles de este ligando llevarían a una elevada
estimulación de las células T CD4+, desestabilizando la tolerancia periférica.

52
 Introducción

3.4.12. KIAA1542-IRF7

El SNP de KIAA1542 asociado con LES (rs4963128) se ubica en una

región donde se ha descrito un polimorfismo de tipo indel (Redon R y col.,
2006). El gen, también llamado PHRF1 (PHD and ring finger domain-
containing protein 1), se encuentra en un locus homólogo al gen codificante de
un factor de elongación. Sin embargo, se desconoce la función de la proteína
que codifica y se ha sugerido que el efecto de susceptibilidad observado en este
locus puede deberse a la proximidad del gen IRF7 (a ~ 20 Kb), que ejerce una
función importante en la señalización del IFN de tipo I. De hecho, un SNP de
este gen (rs709266) muestra un alto LD (r2 = 0.94) con el rs4963128 (SLEGEN
y col., 2008; Gateva V y col., 2009).

3.4.13. PXK

PXK codifica para una quinasa de serina-treonina con dominio homólogo

a Phox, de la que se conocen 5 variantes de splicing, 3 de las cuales (PXK_v1,
PXK_v2 y PXK_v4) se expresan en una amplia variedad de tejidos y una cuarta
(PXK_v3) que sólo lo hace en leucocitos de sangre periférica. Los dominios
homólogos a Phox tienen la función de dirigir proteínas hacia la membrana
celular, al unirse de forma específica a dominios de fosfoinositol, por lo que son
cruciales para diversas funciones celulares (Zou X y col., 2005). El SNP
asociado con LES (rs6445975) se localiza en el intrón 5 de este gen, pero se
desconoce la posible función del polimorfismo y de la proteína en la
susceptibilidad al LES.

53
Factores genéticos asociados con predisposición a LES

3.4.14. MECP2- IRAK1

MECP2 e IRAK1 se encuentran en un mismo bloque haplotípico de Xq28.

Estudios independientes mostraron de forma convincente asociación con
MECP2 o con IRAK1, pero ninguno de ellos ha analizado los dos genes. Por lo
tanto, no es posible saber si la asociación se debe a uno u a otro. En el estudio
que identificó MECP2, el SNP rs17435, en el intrón 2, fue el más fuertemente
asociado tanto en población europeo-americana (n = 1080, OR = 1.29) como en
coreana (n = 628, OR = 1.58) (Sawalha AH y col., 2008). Otros 3 SNPs
(rs1734791, rs1734792, rs1734787) entre los que hay un fuerte LD mostraron
también una fuerte asociación. Este bloque define un haplotipo de riesgo y otro
de protección. Los mismos haplotipos se encontraron en una colección
independiente de 3230 muestras europeo-americanas, donde se confirmó la
asociación de MECP2 con LES (Webb R y col., 2009). El estudio centrado en
IRAK1 se basó en un análisis TDT de 9412 SNPs llevado a cabo en LES infantil,
incluyendo 251 familias con la estructura de tríos (Jacob CO y col., 2007). Esta
asociación fue confirmada (OR > 1.5) tanto en LES infantil como en adultos, al
genotipar 13 SNPs de la región en unas 10000 muestras de 4 grupos étnicos
diferentes (europeos, asiáticos, africanos e hispanos) (Jacob CO y col., 2009).
Los SNPs más asociados (OR > 1.5) están en un bloque de LD que también
define un haplotipo de riesgo y otro de protección. Por tanto, es posible que
estos estudios estén describiendo la misma asociación. Además, se sugirió que
la dosis de IRAK1 y MECP2 podría contribuir a la mayor prevalencia del LES
en mujeres, debido a su localización en el cromosoma X (Jacob CO y col., 2009;
Sawalha AH y col., 2008).

Tanto MECP2 como IRAK1 son buenos genes candidatos. El producto de

MECP2 es una proteína que se une a citosinas metiladas y recluta deacetilasas

54
 Introducción

de histonas que dan lugar a una conformación de la cromatina inaccesible a la

maquinaria transcripcional (Jones PL y col., 1998). Pero se ha sugerido que
MECP2 no sólo ejerce una función represora de la transcripción sino que
también puede ejercer un efecto opuesto, induciendo la activación de la
transcripción, al reclutar al factor de transcripción CREB1 (cAMP responsive
element binding protein 1) (Chahrour M y col., 2008). Se ha estudiado si el
haplotipo de riesgo de MECP2 afecta a la expresión de sus genes diana. Se
observó que estaba correlacionado con expresión diferencial de genes sensibles
a metilación en células B, la mayoría sufriendo sobreexpresión y estando
algunos de ellos regulados por IFN. Esto último llevó a sugerir que MECP2
contribuiría a la “firma del IFN” característica del LES (Webb R y col., 2009).

IRAK1 codifica una quinasa de serina-treonina, que está implicada en la

transmisión de las señales de receptores de la familia TLR/IL1R. IRAK1 une
varios receptores a la proteína activadora/adaptadora TRAF6 que, una vez
activada, regula diversas rutas tanto en la respuesta inmune innata como
adquirida. Se ha visto en modelos murinos de LES que IRAK1 podría tener un
papel en la inducción de INFα/γ, en la regulación del factor nuclear κB (NFκB)
de células T y en la activación de los TLRs.

3.4.15. TNFAIP3 y región intergénica 6q23

El gen TNFAIP3 y la región intergénica 6q23 son dos loci vecinos que se
encuentran en bloques haplotípicos distintos y que están asociados a varias
enfermedades autoinmunes incluyendo AR (Wellcome Trust Case Control
Consortium, 2007; Thomson W y col., 2007; Dieguez-Gonzalez R y col., 2009)
y LES (Graham RR y col., 2008; Musone SL y col., 2008). Sin embargo, los
detalles de la asociación no coinciden. El SNP de riesgo que mostraba una

55
Factores genéticos asociados con predisposición a LES

asociación más fuerte con AR (rs6920220) está en la región intergénica 6q23 y

sólo mostró una asociación modesta con LES en el estudio de Graham y col.,
mientras que no estaba asociado en el de Musone y col. De forma similar, el
SNP protector para AR en la región intergénica (rs10499194) se vio asociado
con LES en el estudio de Musone y col. Por el contrario, las asociaciones en
TNFAIP3 han sido mucho más claras en los estudios de LES que en los de AR.
Los dos estudios de LES expusieron la asociación de un haplotipo de riesgo
definido por los alelos menores de una serie de SNPs de baja frecuencia
altamente correlacionados (r2 > 0.98) que incluyen rs104999197, rs5029939,
rs2230926 y rs7749323 (Graham RR y col., 2008; Musone SL y col., 2008). El
meta-análisis de ambos estudios y resultados de imputación permitieron definir
un haplotipo de riesgo que abarca 109 kb, en el que es difícil determinar si el
alelo funcional es el nsSNP rs2230926 u otro de los 14 SNPs que constituyen el
haplotipo. Sin embargo, este estudio no consiguió replicar la asociación de la
región intergénica 6q23, debido a los resultados dispares de los dos estudios
(Bates JS y col., 2009).

Además, el estudio de Musone y col., encontró asociación con un SNP en

la región promotora de un gen implicado en apoptosis, PERP (p53 apoptosis
effector related to PMP22), que se encuentra a unas 200 kb 3’ de TNFAIP3. Sin
embargo, esta asociación no ha sido descrita en ningún estudio adicional.

El bloque de LD de 6q23 abarca unas 60 kb en las que no hay ningún gen

conocido, sino sólo el pseudogén PTPN11. Este locus está flanqueado por los
genes del factor de transcripción 3 de oligodendrocitos (OLIG3,
oligodendrocyte transcription factor 3) y TNFAIP3. OLIG3 parece estar
implicado en el desarrollo y diferenciación de células neuronales, no siendo un
gen candidato para las enfermedades autoinmunes. En contraste, TNFAIP3

56
 Introducción

regula de forma negativa al factor de transcripción NFκB, que sí está implicado

en la respuesta inmune, pudiendo tener un papel importante en la enfermedad
(Boone DL y col., 2004; Wertz IE y col., 2004).

El gen TNFAIP3 codifica la proteína A20, un enzima que ubiquitina

proteínas de la ruta pro-inflamatoria de NFκB, desencadenada por TLRs, el
receptor de IL1 (IL1R), el receptor de TNF (TNFR) y NOD2 (Boone DL y col.,
2004; Wertz IE y col., 2004). Las proteínas diana de A20 incluyen las proteínas
adaptadoras TRAF6, RIP1, RIP2 e IKKγ/NEMO, que tras ser ubiquitinadas
sufren degradación proteosómica (Wertz IE y col., 2004). De este modo, A20
juega un papel importante en la modulación de funciones celulares como la
activación celular, la señalización de citocinas y la apoptosis, actuando como
molécula anti-inflamatoria (Beyaert R y col., 2000). La importancia de estas
funciones de TNFAIP3 se ha demostrado en ratones deficientes, que desarrollan
inflamación multiorgánica severa y caquexia letales (Lee EG y col., 2000). El
único polimorfismo asociado que puede tener un papel funcional es rs2230926,
que da lugar a un cambio de fenilalanina (alelo mayor) por cisteína (alelo menor)
en el residuo 127 de A20. Se observó que este cambio no alteraba la estabilidad
de la proteína, pero reducía de forma modesta la inhibición de NFκB, lo que
podría llevar a una respuesta inflamatoria exagerada (Musone y col., 2008).

3.4.16. TNIP1

TNIP1 mostró asociación significativa con LES en el GWAS de Gateva y

col. El SNP asociado, rs7708392, se localiza en un intrón del gen. Otras
variantes a unas 21 kb de este gen ya habían mostrado su contribución al riesgo
de psoriasis (Nair RP y col., 2009), pero las señales en estas dos enfermedades
autoinmunes son independientes (r2 = 0.001). Se sabe que TNIP1 interacciona

57
Factores genéticos asociados con predisposición a LES

con TNFAIP3 (Heyninck y col., 2003), aunque su papel en la regulación de esta

proteína se desconoce. Sin embargo, ambos genes presentan señales de
susceptibilidad en distintas enfermedades autoinmunes, por lo que se ha
hipotetizado que esta ruta tiene un importante papel en la regulación de la
autoinmunidad.

3.4.17. PRDM1-ATG5

Dos estudios han observado señales de asociación con LES en el locus

PRDM1-ATG5. Una de ellas se encuentra en la región intergénica (rs6568431)
mientras que la segunda se localiza en ATG5 (rs2245214, rs573775) (SLEGEN
y col., 2008; Gateva V y col., 2009). El bajo LD (r2 < 0.1) y los análisis
condicionales sugieren que son señales independientes. ATG5 está implicado en
la autofagia celular, proceso catabólico por el cual el citoplasma y los orgánulos
en exceso o deteriorados son secuestrados en lisosomas o vacuolas para su
descomposición. Sin embargo, su papel en el LES podría estar relacionado con
su participación en la apoptosis dependiente de caspasas, como sugieren los
modelos KO del gen. Por otra parte, PRDM1 también podría tener un papel en
el sistema inmune, ya que es un regulador transcripcional de la diferenciación
de células T y B (Crotty S y col., 2010).

3.4.18. JAZF1

La región promotora del gen JAZF1 mostró asociación con LES, con P <
5 x 10-8 (Gateva V y col., 2009). La misma variante de susceptibilidad
(rs849142) se observó previamente en diabetes tipo 2 (T2D) (Zeggini E y col.,
2008). Otro SNP independiente (rs10486567), cercano al gen, también mostró
asociación con susceptibilidad al cáncer de próstata (Thomas G y col., 2008),

58
 Introducción

pero no se asoció a LES (Gateva V y col., 2009). JAZF1 codifica para un factor
de transcripción que regula la expresión de numerosos genes, por lo que se
desconoce cuál podría ser su función específica en el LES.

3.4.19. UHRF1BP1

Un nsSNP (rs11755393) del gen UHRF1BP1 es uno de los nuevos loci de

susceptibilidad al LES identificados en el estudio de Gateva y col. (Gateva y
col., 2009). Este cambio aminoacídico se localiza en un posible dominio de
unión a UHRF1, un factor de transcripción y metilación ligado a múltiples rutas
(Arita K y col., 2008). UHRF1BP1 se encuentra en una región con alto LD que
incluye otros genes, como SNRPC (small nuclear ribonucleoprotein polypeptide
C), que codifica para un polipéptido que forma parte del complejo de
procesamiento del ARN. Por tanto, aún está por definir qué gen sería el
responsable causal de la asociación en este locus.

3.4.20. IL10

La IL10 es una importante citocina anti-inflamatoria (Diveu C y col.,

2008), por lo que el gen que la codifica es un buen candidato a participar en la
susceptibilidad al LES. Los resultados de asociación han sido inconsistentes en
los estudios realizados hace unos años. Sin embargo, los últimos estudios que
son mucho más sólidos parecen confirmar la asociación con este locus (Nath SK
y col., 2005; Gateva V y col., 2009). Además, uno de los polimorfismos
asociados con LES también contribuye al riesgo de colitis ulcerosa (Franke A y
col., 2008) y T1D (Barrett JC y col., 2009), sugiriendo la posibilidad de que el
papel de la ruta de IL10 sea similar en estas tres enfermedades.

59
Factores genéticos asociados con predisposición a LES

3.5. Factores genéticos con asociación al LES controvertida

Hay muchos genes que han sido asociados con LES en algún estudio pero
que no han sido confirmados con posterioridad. Aquí sólo se tratarán dos que
por la solidez de los estudios que los apoyan pueden ser genuinos factores de
riesgo aunque no hayan sido todavía replicados de forma definitiva.

3.5.1. TYK2

TYK2 es un gen implicado en varias rutas de señalización, entre ellas, la

del IFNα. Su relación con la susceptibilidad al LES es controvertida
(Sigurdsson S y col., 2005; Cunninghame Graham DS y col., 2007a; SLEGEN y
col., 2008). La asociación de este gen se describió a la vez que la de IRF5 en un
estudio en población escandinava, que analizaba genes de la ruta del IFN
(Sigurdsson S y col., 2005). El SNP más asociado fue rs2304256 (OR = 0.63),
localizado en el exón 8 del gen. Éste es un nsSNP que codifica para un cambio
de valina por fenilalanina en el dominio homólogo Janus 4, pero su posible
efecto funcional aún no ha sido identificado. En este estudio había un segundo
SNP asociado, rs12720356, pero ni éste ni otros 3 SNPs de TYK2 (rs280500,
rs6511696, rs280519) mostraron asociación en ninguno de los GWAS
(SLEGEN y col., 2008). Además, la asociación del nsSNP (rs2304256) sólo ha
sido confirmada en un pequeño estudio en finlandeses (Hellquist A y col., 2009),
mientras que no fue replicada en un estudio TDT con familias inglesas
(Cunninghame Graham DS y col., 2007a). En este último se encontró otro SNP
asociado (rs12720270), que también estaba asociado en el estudio finlandés
(Hellquist A y col., 2009), pero que no había resultado significativo en las
familias escandinavas (Sigurdsson S y col., 2005).

60
 Introducción

TYK2 es miembro de la familia de quinasas Janus y forma parte de la

ruta JAK-STAT, desencadenada por los receptores de IFNα, IL6, IL10 o IL12.
En las células mononucleares de sangre periférica, TYK2 es activada, junto con
JAK1, por el receptor de IFNα (IFNAR), tras unión de su ligando. Esta
activación da lugar al reclutamiento y activación de otras señales de
transducción, como son las STATs, que tras dimerizar se traslocan al núcleo
donde estimulan la expresión de genes de la “firma del IFN” (Kotenko SV y
col., 2000; Baechler EC y col., 2003).

3.5.2. LY9

LY9 (también conocido como CD229) se encuentra en el intervalo de

ligamiento al LES en 1q23 (Cantor RM y col., 2004). Este gen fue el que
mostraba asociación más fuerte de entre los estudiados en dicha región en un
estudio TDT de 660 familias inglesas y 271 familias canadienses (Cunninghame
Graham DS y col., 2008b). Hasta el momento, ningún otro estudio ha
confirmado este factor genético. LY9 se expresa en la superficie de monocitos,
células NK y linfocitos T periféricos. Participa en la adhesión entre células T y
CPAs, aunque se conoce poco acerca de su función. El SNP con P más
significativa (0.002), rs509749, es un nsSNP del exón 8 que codifica para un
cambio de valina por metionina en el aminoácido 602 del dominio
citoplasmático. Esta región es el sitio de unión de SAP/SH2D1a, una proteína
adaptadora implicada en la señalización en células T al reclutar quinasas Src,
por lo que podría interferir con esta misma (Cunninghame Graham DS y col.,
2008b).

61
Factores genéticos asociados con predisposición a LES

4. Determinación de los efectos funcionales de los loci de

susceptibilidad

Como se ha comentado anteriormente, en los últimos dos años se han

identificado más de 25 loci que predisponen al LES, reflejando el éxito que han
tenido los GWAS en esta enfermedad (Moser KL y col., 2009). Estos resultados
han permitido una mayor comprensión de las alteraciones inmunológicas
responsables del LES, ya que muchos de los genes asociados tienen papeles
importantes en el sistema inmune. Sin embargo, otros no tienen una función
conocida o son loci localizados en regiones del ADN sin ninguna función
identificable (Figura 7). Además, incluso en los genes con función conocida no
se sabe todavía cuál es el polimorfismo causal y cuáles son sus consecuencias
específicas que motivan la susceptibilidad al LES. Esta ignorancia es una de las
dificultades en la aplicabilidad de los descubrimientos genéticos.

Para tratar de avanzar en estos aspectos es necesario descubrir los

polimorfismos causales e identificar sus efectos. Éstos pueden ser desde
cambios en la estructura, función o estabilidad de las proteínas a alteraciones en
las secuencias reguladoras, ya sean sitios de unión de factores de transcripción o
de miRNAs, o sitios afectados por cambios epigenéticos. Un ejemplo de un
posible polimorfismo causal y de su posible efecto es el de PD1.3 en el gen
PDCD1, que fue considerado muy convincente aunque en la actualidad está en
duda.

62
 Introducción

Figura 7. Genes asociados con LES y su función en el sistema inmune (Moser KL y

col., 2009).

PD1.3 fue el SNP más fuertemente asociado en un gran estudio de LES

anterior a los GWAS. Éste sería un ejemplo de SNP que puede afectar al sitio de
unión de un factor de transcripción. La sustitución del alelo G por el alelo A de
PD1.3 afecta al cuarto nucleótido del sitio de unión consenso (TGT/cGGT) para
el factor de transcripción RUNX1 (runt-related transcription factor 1) (Figura
8). Este SNP se localiza en el cuarto intrón de PDCD1 en una secuencia que
muestra cuatro repeticiones en tandem de 40 nucleótidos cada una. Se propuso
que estas repeticiones podrían actuar como enhancer y, por tanto, tener un papel
importante en la regulación transcripcional de PDCD1 (Prokunina L y col.,
2002). Los enhancer son elementos reguladores que potencian la transcripción y
que son capaces de actuar a grandes distancias del gen e independientemente de
su posición y orientación con respecto al gen. La hipótesis de que el intrón 4 de
PDCD1 funcione como enhancer se basa en la predicción informática de

63
Factores genéticos asociados con predisposición a LES

múltiples sitios de unión a diferentes factores de transcripción implicados en la

diferenciación hematopoyética e inflamación: RUNX1, NFκB1 (o p50) y
factores de unión al E-box (Figura 8).

Figura 8. Parte de la secuencia del enhancer hipotético en el intrón 4 de PDCD1

(Prokunina L y col., 2002)

Sólo se ha publicado un experimento que apoyaba el papel funcional de

PD1.3. Se trata de un ensayo de cambio de movilidad electroforética (EMSA)
en el que se observó unión específica de RUNX1 a un oligonucleótido sintético
con el alelo G de PD1.3, y desaparición de la unión al oligonucleótido cuando
llevaba el alelo A (Prokunina L y col., 2002). Por tanto, se sugirió que el SNP
tendría un efecto regulador de PDCD1, probablemente disminuyendo su
expresión. En el mismo estudio también se observaron diferencias en la
expresión del ARN mensajero de PDCD1 en células mononucleares de sangre
periférica activadas entre los pacientes AA y GA y los GG. Sin embargo, estos
resultados no fueron concluyentes debido a grandes variaciones
interindividuales (Prokunina L y col., 2002). Por tanto, el papel funcional de

64
 Introducción

este SNP todavía no está claro y su posible papel en la regulación de la

expresión de PDCD1 requiere ser confirmada.

El factor de transcripción RUNX1, que se uniría a PD1.3, pertenece a una

familia de factores de transcripción nucleares, CBF (core binding factor), que
realizan funciones importantes en el desarrollo normal y en enfermedades.
Concretamente, RUNX1 regula la expresión de genes implicados en la
hematopoyesis y en la diferenciación de células mieloides y linfoides. La
secuencia consenso de unión de RUNX1 fue descrita a partir de la selección de
oligonucleótidos sintéticos que presentaban afinidad por el factor de
transcripción (Meyers S y col., 1993). Esta secuencia, TGT/cGGT, pertenece a
un grupo de secuencias identificadas previamente como elementos críticos para
la actividad de los enhancers del poliomavirus, del virus SV40 (simian virus 40)
y del retrovirus murino SL3-3 (Thornell A y col., 1988; Kamachi Y y col.,
1990). Pero además, es funcional en múltiples enhancers y promotores celulares
de genes implicados en la hematopoyesis y en la función del sistema inmune,
como en enhancers del TCR (Hernandez-Munain C y col., 1995; Bruhn L y col.,
1997) y en los promotores de los genes IL3 (Uchida H y col., 1997), factor
estimulador de colonias de granulocitos-macrófagos (GM-CSF) (Frank R y col.,
1995), CD3ε (Hallberg B y col., 1992), adaptador monocítico (Mona/Gads)
(Guyot B y col., 2003), granzima B (GRZB) (Wargnier A y col., 1995), proteína
1α inflamatoria de macrófagos (MIP1α) (Bristow CA y col., 2003), IL2 e INFγ
(Ono M y col., 2007). Así, el papel de RUNX1 en todas estas regiones
reguladoras apoya la hipótesis de que la secuencia donde se encuentra PD1.3
pueda actuar como un enhancer, pero todavía no ha sido comprobado.

65
Factores genéticos asociados con predisposición a LES

5. El problema de la heredabilidad no explicada

Los GWAS han sido una potente herramienta para la investigación del
componente genético de las enfermedades complejas, identificando gran
cantidad de variantes genéticas de susceptibilidad. La mayoría de asociaciones
encontradas hasta ahora muestran ORs ≤ 1.5 (Figura 6). Este pequeño efecto y
el gran número de genes de susceptibilidad que se están encontrando indica que
en el LES participan múltiples factores genéticos ya que cada uno de ellos
confiere un pequeño aumento en el riesgo a padecer la enfermedad. Sin
embargo, a pesar de ser numerosos explican sólo una parte pequeña de la
heredabilidad (proporción del fenotipo atribuible a factores genéticos). Así, en
el estudio GWA del SLEGEN se estimó que PXK, HLA, IRF5, KIAA1542 e
ITGAM explican tan sólo un 15 % de la heredabilidad (SLEGEN y col., 2008).
Estos resultados llevan a preguntarse dónde puede residir la heredabilidad
todavía no identificada.

Varias han sido las sugerencias sobre las distintas razones que podrían
explicar la falta de detección de una proporción considerable de la heredabilidad.
En primer lugar, es posible que aún no se hayan identificado muchas de las
variantes comunes de pequeño efecto. Otra posibilidad es que las variantes
causales por descubrir sean variantes de baja frecuencia (1-5 %) o variantes
raras (frecuencia < 0.5 %), que no están bien cubiertas por los GWAS actuales.
Además, es posible que estas variantes poco frecuentes tengan un efecto más
notable. Sin embargo, su efecto no puede ser muy fuerte ya que no han sido
detectadas por los estudios de ligamiento (Manolio TA y col., 2009). Un
ejemplo de variantes de este tipo son las variantes raras en TREX1 (Lee-Kirsch
MA y col., 2007) que ya han sido comentadas. Otra posible fuente de
heredabilidad no explicada son las variantes estructurales, como las CNVs.

66
 Introducción

Hasta hace poco, estas variaciones no se evaluaban de forma explícita ni

estaban bien cubiertas en los GWAS. Sólo recientemente se han desarrollado
varias aproximaciones para integrar el análisis de las CNVs en los GWAS, lo
que ha llevado al descubrimiento de su efecto en desórdenes neurosiquiátricos,
enfermedad de Crohn y obesidad. En el LES todavía no se han utilizado estas
nuevas herramientas pero estudios previos ya habían detectado fuertes
asociación con dos CNVs. Una en el factor del complemento C4 (Manderson
AP y col., 2004) y otra en FCGR3B (Willcocks LC y col., 2008). Por último,
otros posibles contribuyentes a la heredabilidad no explicada, que los GWAS
tienen poca potencia para detectar, son las interacciones gen-ambiente o gen-
gen, fenómenos conocidos como epistasis (Manolio TA y col., 2009) y que se
desarrollará a continuación.

La epistasis se puede analizar desde dos perspectivas diferentes, biológica

y estadística. En la perspectiva biológica, la espistasis es el resultado de la
interacción entre moléculas que participan en una misma ruta, de modo que el
efecto de un gen en un fenotipo depende de otro u otros genes o de algún factor
ambiental. En contraste, la epistasis estadística se define como una desviación
de la aditividad en un modelo matemático que relaciona múltiples genotipos y/o
variables ambientales con un fenotipo. Por lo tanto, no existe una relación
directa entre estas dos formas de considerar la epistasis. Es posible que la
demostración de epistasis por análisis estadísticos no se correlacione con una
relación biológica clara, y también que algunas epistasis biológicas no den lugar
a epistasis desde el punto de vista estadístico. Dada la herencia poligénica del
LES y el pequeño efecto de los polimorfismos asociados, el desafío está en
demostrar si existen interacciones que pudieran explicar el riesgo de LES más
allá de la acumulación de los riesgos individuales definidos por cada uno de los
polimorfismos de susceptibilidad.

67
Factores genéticos asociados con predisposición a LES

Como parte del estudio GWA llevado a cabo por el consorcio SLEGEN,
se exploró si había evidencias de epistasis entre los genes asociados, pero no las
encontraron (SLEGEN y col., 2008). Otros estudios analizaron la interacción
entre genes que forman parte de la misma ruta funcional. Así, STAT4 e IRF5
son miembros de la ruta de IFN de tipo I, por lo que sus polimorfismos de
susceptibilidad serían candidatos a interaccionar. Lo que se observó en un
estudio de 500 pacientes y 500 controles suecos fue que con cada alelo de riesgo
del rs7582694 de STAT4 (que define el haplotipo de riesgo y tiene r2 = 1 con el
rs7574865) y de dos SNPs (indel del promotor y rs10488631) de IRF5 la OR se
incrementaba en 1.82 (Sigurdsson S y col., 2008b). Un efecto incrementado al
combinar estos dos factores genéticos se describió en otro estudio de LES con
muestras europeas e hispanas (Abelson AK y col., 2009), así como en pacientes
con síndrome de Sjögren (SS) (Nordmark G y col., 2009) y en pacientes con
esclerosis sistémica cutánea difusa (Dieudé P y col., 2009). Sin embargo, los
aumentos de riesgo observados en estos estudios no han detectado desviación de
la suma de susceptibilidad que confiere cada alelo por sí mismo, por lo que no
hay evidencias de interacción epistática entre estos dos factores.

Otro factor que participa en la ruta del IFN es TYK2, por lo que también
se ha hipotetizado su posible interacción con IRF5. De hecho, un estudio
encontró epistasis significativa (P = 0.014) entre los SNPs rs10954213 de IRF5
y rs2304256 de TYK2. La combinación genotípica que más contribuyó a la
interacción era la de los homocigotos para los alelos de riesgo de ambos SNPs
(OR = 2.73) (Hellquist A y col., 2009). Aún así, el tamaño muestral de este
estudio no es muy grande (300 pacientes y 300 controles), por lo que sería
necesaria la confirmación de este resultado por estudios independientes de
mayor tamaño.

68
 Introducción

Por último, en un estudio aún sin publicar, se ha examinado también la

interacción entre moléculas que participan en la señalización de las células B.
Concretamente, se buscaron interacciones genéticas entre BANK1 y ~100000
SNPs de un GWAS. BANK1 mostró interacción estadísticamente significativa
con 29 genes, entre los que se incluían BLK y el receptor 2 de inositol 1,4,5-
trifosfato (ITPR2). Además, se confirmó la interacción física entre BANK1 y
BLK y que el alelo de riesgo del SNP rs17266594 de BANK1, que da lugar a
una variante de splicing sin dominio de unión, reduce su interacción con BLK
(Castillejo-Lopez C y col., 2009).

Por tanto, las evidencias de epistasis entre factores de susceptibilidad al

LES son pocas por el momento. La de TYK2 e IRF5 es débil, posiblemente por
el pequeño tamaño muestral empleado, mientras que la de BANK1, BLK e
ITPR2 parece más prometedora ya que ha sido confirmada en dos cohortes de
gran tamaño. Además, la interacción de BANK1 y BLK se ha explicado
biológicamente al observar como estas dos proteínas también interaccionan
físicamente y que la interacción se relaciona con una variante de splicing
(Castillejo-Lopez C y col., 2009).

Un campo inexplorado es el de las epistasis entre polimorfismos que no

están asociados con LES así como el de las interacciones con el ambiente. Por
todo ello, todavía es posible que existan muchos más ejemplos de epistasis y
que tengan una contribución significativa a la heredabilidad del LES.

69
Factores genéticos asociados con predisposición a LES

6. La hipótesis de los factores genéticos comunes a múltiples

enfermedades autoinmunes a la luz de los GWAS

Las enfermedades autoinmunes se caracterizan porque se inician por la

pérdida de tolerancia a autoantígenos. Algunos de los mecanismos implicados
en los procesos patogénicos son específicos de cada una de ellas, pero también
comparten otros. Entre estos últimos destacan los mecanismos de desregulación
de la activación de linfocitos T y B y las rutas que llevan a la inflamación. Un
ejemplo clásico de los efectos de estos mecanismos compartidos es el de los
ratones NOD, un modelo de T1D, que además presentan susceptibilidad a
diferentes enfermedades autoinmunes o a desarrollar anticuerpos característicos
de dichas enfermedades (Johansson AC y col., 2003). Así mismo, en humanos
se ha observado que algunas enfermedades autoinmunes concurren en un mismo
individuo o en una misma familia más frecuentemente que lo esperado
(Baranzini SE y col., 2009). Esto ha llevado a sugerir que, al igual que
comparten mecanismos patogénicos, podrían compartir parte de su etiología, en
concreto los factores genéticos que predisponen a la autoinmunidad.

Los estudios de ligamiento han mostrado regiones que influencian la

susceptibilidad a varias enfermedades autoinmunes. El ejemplo más claro es el
del HLA, que es el factor que mayor influencia tiene en la susceptibilidad a
autoinmunidad. Además, hay otros genes que han mostrado asociación
convincente con diferentes desórdenes autoinmunes. Tres ejemplos notables son
el antígeno 4 de linfocitos T citotóxicos (CTLA4), PTPN22 y STAT4. Estos
genes están implicados en mecanismos inmunogenéticos comunes y, por lo
tanto, tienen un efecto pleiotrópico en los fenotipos autoinmunes (Serrano NC y
col., 2006). En los últimos años se han llevado a cabo más de 30 GWAS en más
de 7 enfermedades autoinmunes, que han identificado genes asociados con más

70
 Introducción

de una enfermedad. Entre los nuevos asociados se pueden destacar el receptor α

de IL2 (IL2RA), asociado con esclerosis múltiple y T1D, IL12B, asociado con
psoriasis y enfermedad de Crohn y TNFAIP3, asociado con AR y LES
(Baranzini SE y col., 2009).

En el ámbito de las enfermedades reumáticas, existen algunas evidencias

de que el LES y la AR pueden compartir parte del componente genético. Así, el
riesgo a padecer AR de los hermanos de pacientes con LES estuvo aumentado
unas 3-5 veces con respecto al riesgo de la población general en un estudio
(Alarcón-Segovia D y col., 2005). También estas dos enfermedades se solapan
en algunos pacientes raros, dándosele a esta condición el nombre de “rhupus”
(Panush RS y col., 1988).

La AR es una enfermedad compleja en la que el componente genético

juega un papel destacable (Aho K y col., 1986; Silman AJ y col., 1993). El
factor genético más fuerte está en el HLA (Seldin MF y col., 1999).
Concretamente, esta asociación se debe a la tercera región hipervariable de la
cadena DRβ1, especialmente los aminoácidos 70-74, que forman parte del lugar
de unión al péptido (Nepom GT y col., 1989). El segundo factor genético más
importante en población caucásica es el polimorfismo R620W de PTPN22, que
aumenta el riesgo en un 40-80 % (Hinks A y col., 2006). Otros loci de
susceptibilidad destacados son la región 6q23, STAT4, TRAF1/C5, IL2RB,
PRKCQ, el miembro 5A de la familia de las quinesinas (KIF5A), el miembro 3
de la familia AF4/FMR2 (AFF3), CD40, CTLA4, IL2-IL21 y MMEL1
(membrane metallo-endopeptidase-like 1) (Barton A y col., 2009). Muchos de
estos genes son importantes en la regulación del sistema inmune, estando
implicados en la regulación de las células T y de las rutas de señalización o en
la apoptosis (Barton A y col., 2008). Por lo tanto, el HLA, PTPN22, 6q23 y

71
Factores genéticos asociados con predisposición a LES

STAT4, son factores genéticos compartidos por la AR y el LES (Zhernakova A

y col., 2009; Barton A y col., 2009) y existe la posibilidad de que no sean los
únicos. A continuación se aborda con más detalle la asociación con AR de uno
de estos factores que comparten ambas enfermedades.

6.1. TNFAIP3 y región intergénica 6q23

La región intergénica 6q23 se observó asociada con AR en dos GWAS

llevados a cabo en población inglesa y europeo-americana (Wellcome Trust
Case Control Consortium, 2007; Plenge RM y col., 2007b). Esta asociación se
debía a dos señales independientes, una de riesgo (rs6920220) y la otra de
protección (rs10499194, rs13207033). Este nuevo locus de susceptibilidad a AR
se confirmó en cohortes de muestras independientes (Thomson W y col., 2007;
Plenge RM y col., 2007a; Dieguez-Gonzalez R y col., 2009; Orozco G y col.,
2009b). Es de resaltar que la señal protectora solamente ha sido observada en
pacientes positivos para anticuerpos frente a péptidos citrulinados (ACPA).
Además, también se han visto evidencias de asociación con AR en el gen
vecino TNFAIP3, siendo estas señales estadísticamente independientes a las de
la región 6q23 (Dieguez-Gonzalez R y col., 2009; Orozco G y col., 2009b).
Estos resultados sumados a la falta de LD entre la región intergénica y
TNFAIP3 proporcionan evidencias que soportan el efecto independiente de
estas dos regiones.

Estudios en soriasis (Nair RP y col., 2009), enfermedad de Crohn

(Wellcome Trust Case Control Consortium, 2007), T1D (Fung EY y col., 2009)
y LES (Musone SL y col., 2008; Graham RR y col., 2008) sugieren que
TNFAIP3 también juega un papel en estas enfermedades autoinmunes y apoyan
la hipótesis de la existencia de una base genética compartida. Sin embargo,

72
 Introducción

algunas de estas señales no están bien recogidas en nuestro estudio previo. Las
más interesantes son las asociaciones encontradas en LES debido a su fuerte
efecto y a que una se corresponde con un nsSNP que podría tener un papel
causal en la susceptibilidad a la enfermedad.

En resumen, en los últimos años se han publicado una gran cantidad de

estudios de asociación de gran tamaño que han permitido la identificación de un
gran número de factores de susceptibilidad a LES. Estos nuevos loci necesitan
ser confirmados por estudios independientes. Además, para determinar la
importancia de estos factores en el LES es preciso identificar los posibles
polimorfismos causales y determinar su papel funcional. Así, se ha sugerido a
PD1.3 como posible polimorfismo causal en el gen PDCD1, aunque este papel
sólo había sido explorado mediante un EMSA. Por tanto, es necesario realizar
otros estudios funcionales que puedan confirmar esta hipótesis. Por otra parte, el
componente genético no sólo influencia la susceptibilidad al LES, sino que
también puede influenciar la variabilidad fenotípica de la enfermedad. La
exploración de este efecto permitirá una mayor comprensión de la patogenia del
LES. Por último, los estudios de asociación de LES y AR mostraron que una
parte de los factores de susceptibilidad están asociados con ambas enfermedades
autoinmunes. Así pues, los nuevos loci de susceptibilidad al LES deberían
considerarse como candidatos en los estudios de asociación de AR.

73
HIPÓTESIS
 Hipótesis

Hipótesis

1. El LES es una enfermedad compleja con un importante componente

genético. Los estudios de asociación caso-control son una
herramienta útil para la identificación de dichos factores genéticos
pero los resultados que obtienen necesitan ser confirmados en
colecciones de muestras independientes y por distintos laboratorios.

2. Uno de los factores de susceptibilidad a LES se encuentra en el gen

PDCD1. En este gen se propone que el SNP de susceptibilidad,
PD1.3, tiene un papel funcional en la expresión de PDCD1 debido a
su localización en una región con estructura de enhancer y a que
altera el sitio de unión al factor de transcripción RUNX1.

3. Algunas de las diferencias en las manifestaciones clínicas de los

pacientes con LES pueden explicarse por influencia del componente
genético.

4. El LES comparte mecanismos patogénicos con otras enfermedades

autoinmunes. Por lo tanto se propone que parte de sus factores
genéticos serán también factores de susceptibilidad a la AR.

77
OBJETIVOS
 Objetivos

Objetivos

1. Confirmar hallazgos significativos de asociación con susceptibilidad

a LES en una gran cohorte independiente de muestras europeas,
mediante un estudio de asociación caso-control.

2. Demostrar mediante estudios funcionales que PD1.3 es un

polimorfismo causal en PDCD1.

3. Explorar la influencia del componente genético en la variabilidad

clínica del LES, desde dos puntos de vista: el de los factores de
susceptibilidad al LES y el del fondo genético diferenciado de las dos
grandes subpoblaciones de europeos, la del norte y la del sur.

4. Comprobar si los nuevos factores de susceptibilidad al LES se

asocian con susceptibilidad a la AR.

81
PROCEDIMIENTO EXPERIMENTAL Y
RESULTADOS
 Procedimiento experimental y resultados

Procedimiento experimental y resultados

Esquema general

1. Factores genéticos de LES

Publicación 1:

• Suarez-Gestal M, Calaza M, Endreffy E, Pullmann R, Ordi-Ros J,

Sebastiani GD, Ruzickova S, Santos MJ, Papasteriades C, Marchini M,
Skopouli FN, Suarez A, Blanco FJ, D'Alfonso S, Bijl M, Carreira P, Witte
T, Migliaresi S, Gomez-Reino JJ, Gonzalez A and the European
Consortium of SLE DNA Collections. Replication of recently identified
systemic lupus erythematosus genetic associations: a case-control study.
Arthritis Res Ther 2009, 11: R69.

Publicación 2:

• Suarez-Gestal M, Calaza M, Gonzalez A. Lack of interaction between

systemic lupus erythematosus-associated polymorphisms in TYK2 and IRF5.
J Rheumatol. 2010; 37: 676-677.

85
Factores genéticos asociados con predisposición a LES

2. Estudio funcional de PD1.3

Publicación 3:

• Suarez-Gestal M, Ferreiros-Vidal I, Ortiz JA, Gomez-Reino JJ,

Gonzalez A. Analysis of the functional relevance of a putative regulatory
SNP of PDCD1, PD1.3, associated with systemic lupus erythematosus.
Genes Immun. 2008; 9: 309-315.

3. Influencia del componente genético en la variabilidad clínica del LES

Publicación 4:

• Suarez-Gestal M, Calaza M, Liz M, Ordi-Ros J, Balada E, Bijl M,

Kallenberg CG, Papasteriades C, Kappou-Rigatou I, Carreira P, Skopouli FN,
Mavromati M, Schmidt RE, Witte T, Endreffy E, Kovacs A, Marchini M,
Scorza R, Migliaresi S, Sebastiani GD, Santos MJ, Vinagre F, Suarez A,
Gutierrez C, Rego I, Blanco FJ, Barizzone N, D’Alfonso S, Pullmann Jr R,
Pullmann R, Ruzickova S, Dostal C, Gomez-Reino JJ and Gonzalez A. Weak
association of systemic lupus erythematosus clinical features with
susceptibility alleles: a case-only study.

Publicación 5:

• Suarez-Gestal M, Calaza M, Witte T, Papasteriades C, Marchini M,

Migliaresi S, Kovacs A, Ordi-Ros J, Bijl M, Santos MJ, Ruzickova S,
Pullmann R, Carreira P, Skopouli FN, D’Alfonso S, Sebastiani GD, Suarez
A, Blanco FJ, Gomez-Reino JJ, Gonzalez A and the European Consortium

86
 Procedimiento experimental y resultados

of SLE DNA Collections. Differences of systemic lupus erythematosus

clinical features between two large European population subgroups.

4. Componente genético común a LES y AR

Publicación 6:

• Suarez-Gestal M, Calaza M, Dieguez-Gonzalez R, Perez-Pampin E,

Pablos JL, Navarro F, Narváez J, Marenco JL, Herrero-Beaumont G,
Fernandez-Gutierrez B, Lamas JR, Rodriguez de la Serna A, Ortiz AM,
Carreño L, Cañete JD, Caliz R, Blanco FJ, Balsa A, Gomez-Reino JJ and
Gonzalez A. Rheumatoid arthritis does not share most of the newly
identified systemic lupus erythematosus genetic factors. Arthritis Rheum.
2009. 60 (9): 2558-2564

Publicación 7:

• Suarez-Gestal M, Calaza M, Herrero-Beaumont G, Cañete JD, Ortiz AM,

Marenco JL, Caliz R, Fernandez-Gutierrez B, Narváez J, Rodriguez de la
Serna A, Dieguez-Gonzalez R, Carreño L, Balsa A, Blanco FJ, Perez-Pampin
E, Pablos JL, Navarro F, Gomez-Reino JJ and Gonzalez A. Follow-up case-
control study of the TNFAIP3 association with rheumatoid arthritis: posible
role of antinuclear antibody status and differences with other diseases.

87
1. Factores genéticos de LES
 Procedimiento experimental y resultados

Available online http://arthritis-research.com/content/11/3/R69

Research article Open Access

Vol 11 No 3

Replication of recently identified systemic lupus erythematosus

genetic associations: a case–control study
Marian Suarez-Gestal1, Manuel Calaza1, Emöke Endreffy2, Rudolf Pullmann3, Josep Ordi-Ros4,
Gian Domenico Sebastiani5, Sarka Ruzickova6, Maria Jose Santos7,8, Chryssa Papasteriades9,
Maurizio Marchini10, Fotini N Skopouli11, Ana Suarez12, Francisco J Blanco13, Sandra D'Alfonso14,
Marc Bijl15, Patricia Carreira16, Torsten Witte17, Sergio Migliaresi18, Juan J Gomez-Reino1,19,
Antonio Gonzalez1 for the European Consortium of SLE DNA Collections

1Laboratorio de Investigacion 10 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela 15706, Spain
2Paediatrics Department, Albert Szent-Györgyi Medical and Pharmaceutical Centre, University of Szeged, Szeged 6721, Hungary
3Instituteof Clinical Biochemistry, Martin Faculty Hospital, Jessenius Medical Faculty, Kollárova 2, 036 59 Martin, Slovakia
4Internal Medicine, Research Laboratory in Autoimmune Diseases, Hospital Vall d'Hebron, 08035 Barcelona, Spain
5Ospedale S Camillo-Forlanini, U O Complessa di Reumatologia, 00151 Roma, Italy
6Molecular Biology and Immunogenetics Department, Institute of Rheumatology, 128 50 Prague 2, Czech Republic
7Rheumatology Department, Hospital Garcia de Orta, Almada, Portugal
8Rheumatology Research Unit, Instituto Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa, Portugal
9Department of Histocompatibility and Immunology, Evangelismos Hospital, 10676 Athens, Greece
10Clinical Immunology, University of Milan and Fondazione IRCCS Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, 20122 Milan, Italy
11Pathophysiology Department, Athens University Medical School, Athens 115 27, Greece
12Department of Functional Biology, Hospital Universitario Central de Asturias, Universidad de Oviedo, Oviedo 33006, Spain
13INIBIC-CH Universitario A Coruña, 15006 A Coruña, Spain
14Dept Medical Sciences and IRCAD, Eastern Piedmont University, 28100 Novara, Italy
15Department of Rheumatology and Clinical Immunology, University Medical Center Groningen, 9713 Groningen, The Netherlands
16Rheumatology Unit Hospital 12 de Octubre, 28041 Madrid, Spain
17Division of Clinical Immunology, Department of Internal Medicine of the Hannover Medical School, D-30625 Hannover, Germany
18Rheumatology Unit, Second University of Naples, 81100 Naples, Italy
19Department of Medicine, University of Santiago de Compostela, Santiago de Compostela, 15706, Spain

Corresponding author: Antonio Gonzalez, [email protected]

Received: 24 Mar 2009 Revisions requested: 29 Apr 2009 Revisions received: 8 May 2009 Accepted: 14 May 2009 Published: 14 May 2009

Arthritis Research & Therapy 2009, 11:R69 (doi:10.1186/ar2698)

This article is online at: http://arthritis-research.com/content/11/3/R69
© 2009 Suarez-Gestel et al.; licensee BioMed Central Ltd.
This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract
Introduction We aimed to replicate association of newly 10-5), as well as association with the X chromosome MECP2
identified systemic lupus erythematosus (SLE) loci. gene (OR = 1.26, P = 0.00085 in women), which had only been
reported in a single study, and association with four other loci,
Methods We selected the most associated SNP in 10 SLE loci. 1q25.1 (OR = 0.81, P = 0.0001), PXK (OR = 1.19, P =
These 10 SNPs were analysed in 1,579 patients with SLE and 0.0038), BANK1 (OR = 0.83, P = 0.006) and KIAA1542 (OR
1,726 controls of European origin by single-base extension. = 0.84, P = 0.001), which have been identified in a genome-
Comparison of allele frequencies between cases and controls wide association study, but not found in any other study. All
was done with the Mantel–Haenszel approach to account for these replications showed the same disease-associated allele
heterogeneity between sample collections. as originally reported. No association was found with the LY9
SNP, which had been reported in a single study.
Results A previously controversial association with a SNP in the Conclusions Our results confirm nine SLE loci. For six of them,
TYK2 gene was replicated (odds ratio (OR) = 0.79, P = 2.5 × TYK2, MECP2, 1q25.1, PXK, BANK1 and KIAA1542, this

BANK1: B-cell scaffold protein with ankyrin repeats 1; BLK: B-lymphoid tyrosine kinase; GWA: genome-wide association; IL: interleukin; ITGAM:
integrin alpha M; LY9: lymphocyte antigen 9; MECP2: methyl CpG binding protein 2; OR: odds ratio; PXK: PX domain containing serine/threonine
kinase; SLE: systemic lupus erythematosus; SLEGEN: International Consortium for Systemic Lupus Erythematosus Genetics; SNP: single nucleotide
polymorphism; STAT4: signal transducer and activator of transcription; TYK2: tyrosine kinase 2.

Page 1 of 9
(page number not for citation purposes)

91
 Factores genéticos asociados con predisposición a LES

Arthritis Research & Therapy Vol 11 No 3 Suarez-Gestal et al.

replication is important. The other three loci, ITGAM, STAT4 and bias of SLE, contrary to what has been proposed. In addition,
C8orf13-BLK, were already clearly confirmed. Our results also none of the other associations seems important in this respect.
suggest that MECP2 association has no influence in the sex

Introduction pean countries (see Table S1 in Additional data file 1). Most of
Systemic lupus erythematosus (SLE) is a complex autoim- these samples have already been described [17]. Two new
mune disease of wide variability in its manifestations and clini- sample collections were from Asturias, Spain and Almada,
cal evolution that characteristically involves multiple Portugal. Each recruiting centre was asked for about 100 SLE
autoantibodies against ubiquitous nuclear antigens. Its patients and 100 ethnically matched controls. A total of 1,579
genetic component is very significant, as shown by a sibling cases and 1,726 controls were obtained in this way. All SLE
recurrence risk ratio of 20 and a 10-fold excess in SLE con- patients met the revised American College of Rheumatology
cordance between monozygotic twins over dizygotic twins classification criteria [18]. Clinical characteristics of the
[1,2]. patients are provided in Table S2 in Additional data file 1.
Patients and controls gave written informed consent. Sample
Linkage studies have indicated that this genetic component is collection was approved by the respective ethical committees.
due to multiple low-penetrance common genetic factors [1].
Only a few factors had consistently been demonstrated until Genotyping
2008: the class II HLA alleles, low-affinity receptors for the We selected a SNP for each of the 10 associated loci that we
constant fraction of IgG, and the PTPN22 and IRF5 genes. intended to replicate (Table 1). The SNPs were selected
This scenario has been dramatically improved by new technol- because they were strongly associated with SLE or because
ogies and genome resources [2]. Four genome-wide associa- they were described as probable causal polymorphisms.
tion (GWA) studies were published in 2008 [3-6] that, These 10 SNPs were amplified in a single PCR with the Qia-
together with other large-scale studies, have greatly enlarged gen Multiplex PCR kit (Qiagen, Chatsworth, CA, USA) with 20
the number of convincing SLE-associated loci. Not all of the ng genomic DNA and 0.2 PM of each primer (for primers and
newly described findings, however, have attained the same probes, see Table S3 in Additional data file 1). The PCR prod-
degree of confirmation [2]. Some of them are already defini- ucts were purified by digestion with Exonuclease I (Epicentre,
tively confirmed by replication in different sample collections Madison, WI, USA) and shrimp alkaline phosphatase (GE
by the same authors and also by independent authors in sep- Healthcare, Barcelona, Spain). Purified PCR products were
arate studies (Table 1). In this group are the SLE associations genotyped by single-base extension with the SNaPshot Multi-
with the ITGAM [3,4,6,7], STAT4 [3,4,6,8-12] and C8orf13- plex Kit (Applied Biosystems, Foster City, CA, USA) and spe-
BLK regions [3,4,6]. Other findings are very solid but they still cific probes. After a second purification with shrimp alkaline
require confirmation by independent studies. In this group are phosphatase (GE Healthcare), samples were analysed in the
the associated loci that were only reported in a single GWA Abi Prism 3130xl Genetic Analyzer (Applied Biosystems) and
study but not in the other studies, such as BANK1 [5], PXK genotypes assigned by the GeneMapper software. All geno-
[3], KIAA1542 [3] and 1q25.1 [3], or those that were reported type calls were manually reviewed and conflicting results were
in a single large study but not in any of the four GWA studies, liberally re-assayed or re-genotyped by sequencing with the
such as MECP2 [13] and LY9 [14]. Finally, the TYK2 associ- Big Dye Ready Reaction Kit v 3.1 (Applied Biosystems).
ation is more controversial because it was found in a large Sequence reactions followed the kit manufacturer protocol
study with Scandinavian families [15], partially replicated in a and were also analysed in the Abi Prism 3130xl Genetic Ana-
large study of UK families [16], and excluded in one of the lyzer.
GWA studies [3].
Statistical analysis
In the present paper, therefore, we have analysed SLE associ- Some of the sample collections in our study have already been
ation to each of these loci in more than 1,500 SLE patients used for the analysis of specific associations included in this
and 1,700 controls – and all of them except LY9 have been project. They have been excluded from the relevant analyses
clearly replicated. In addition, we have found that many of to avoid data duplication; this circumstance is detailed in Table
these loci are also important for SLE in men where data from S4 in Additional data file 1, where raw genotype data from
previous reports is almost completely absent. each sample collection are reported. Hardy-Weinberg equilib-
rium tests in control samples were performed with Haploview
Materials and methods with a threshold of 0.05 uncorrected for multiple tests [19].
Sample collection Other statistical analyses were carried out in a customized ver-
We used DNA samples from SLE patients and ethnically sion of the Statistica 7.0 program (StatSoft, Tulsa, OK, USA).
matched healthy controls of 16 collections from nine Euro-

Page 2 of 9
(page number not for citation purposes)

92
 Procedimiento experimental y resultados

Available online http://arthritis-research.com/content/11/3/R69

Table 1

Newly systemic lupus erythematosus-associated loci that were examined with previous evidence of association

Locus Chr. Location SNP Allelesa OR (95% CI) Associated Sample size Population Reference

ITGAM 16 Exon 3 rs1143679 G/A 1.78 (1.6 to 2.0) Yes 3,818 European American [7]
1.55 (1.2 to 2.0) Yes 1,289 African American [7]
2.07 (1.3 to 3.4) Yes 271 Gullah [7]
Other SNPs Yes [3,4,6]
STAT4 2 Intron 3 rs7574865 G/T 1.5 (1.2 to 1.8) Yes 3,057 European [3]
1.50 (1.4 to 1.7) Yes 4,651 European American [4]
1.55 (1.3 to 1.8) Yes 2,287 European American [8]
1.61 (1.4 to 1.9) Yes 2,495 Japanese [9]
1.62 (1.2 to 2.2) Yes 565 Colombians [10]
1.56 (1.4 to 1.7) Yes 3,958 European [12]
Other SNPs Yes [6,11]
C8orf13-BLK 8 Intergenic rs13277113 G/A 1.39 (1.3 to 1.5) Yes 6,301 European American [4]
Other SNPs Yes [3,6]
TYK2 19 Exon 8 rs2304256 C/A 0.625 (0.5 to 0.8) Yes 966 Swedish/Finnish [15]
105:127b No 380c European/Indo- [16]
Pakistani
Other SNPs No [3]
MECP2 X Intron 2 rs17435 A/T 1.58 (1.3 to 1.9) Yes 1,364 Korean [13]
1.29 (1.1 to 1.5) Yes 2,160 European [13]
1q25.1 1 Intergenic rs10798269 G/A 0.82 (0.8 to 0.9) Yes 6,728 European [3]
BANK1 4 Intron 1 rs17266594 T/C 0.74 (0.6 to 0.9) Yes 927 Scandinavian [5]
0.70 (0.5 to 0.9) Yes 576 German [5]
0.63 (0.5 to 0.8) Yes 450 Italian [5]
0.78 (0.6 to 0.9) Yes 1,136 Spanish [5]
0.58 (0.4 to 0.8) Yes 620 Argentinian [5]
KIAA1542 11 Intron 4 rs4963128 G/A 0.78 (0.7 to 0.9) Yes 6,728 European [3]
PXK 3 Intron 5 rs6445975 T/G 1.25 (1.2 to 1.4) Yes 6,728 European [3]
LY9 1 Exon 8 rs509749 A/G 377:403d Yes 510c UK Caucasian [14]
237:251d No 270c Canadian [14]

Loci ordered as presented in Table 2. The SNPs selected for replication are detailed. Chr, chromosome; CI, confidence interval; OR, odds ratio.
aMajor/minor alleles. bTransmitted:untransmitted. cNumber of families. dObserved:expected.

Comparison of cases and controls was carried out with the with the Breslow–Day test, is excluded. Significant heteroge-
Mantel–Haenszel approach because allele frequency differ- neity of effects is therefore excluded by the Breslow–Day test
ences are probable between sample collections even if spe- and allele frequency heterogeneity is accounted for with the
cific effects on the phenotype are constant. Spurious false Mantel–Haenszel approach. These analyses were also con-
positive or false negative results therefore become likely if the ducted after stratifying the samples by gender. Univariate
allele differences are not accounted for. To avoid this, the Man- logistic regression models were used to test the fit to the data
tel–Haenszel approach combines effect sizes taken as the of additive, recessive and dominant genetic models. Statistical
odds ratio (OR) in each stratum allowing for heterogeneity in power was estimated with the Power and sample size calcula-
allele frequencies. This approach provides an accurate com- tions software [20].
bined statistic if the heterogeneity of effect sizes, evaluated

Page 3 of 9
(page number not for citation purposes)

93
 Factores genéticos asociados con predisposición a LES

Arthritis Research & Therapy Vol 11 No 3 Suarez-Gestal et al.

Results with an effect size equivalent to OR > 1.15 with P < 0.05 (or
A total of 1,579 SLE patients and 1,726 controls from 16 OR > 1.23 for P < 0.001).
European collections were available for study (Tables S1 and
S2 in Additional data file 1). The genotyping call rate was In addition to these important results for replication, we found
99.9% and the genotypes in controls were in Hardy-Weinberg association with the three loci that have already been repli-
equilibrium. Individual collection data for each SNP is shown cated in GWA studies: rs1143679 in ITGAM (OR = 1.70, P
in Tables S4 and S5 in Additional data file 1. Combined anal- = 1.1 × 10-16), rs7574865 in STAT4 (OR = 1.62, P = 2.4 ×
ysis of the SNP effects across our sample collections was per- 10-12) and rs13277113 in C8orf13-BLK (OR = 1.34, P = 5.1
formed with the Mantel–Haenszel approach, which is a × 10-7). The effect sizes of these three association signals
method correcting for variability in allele frequencies between (that is, their ORs) were larger than for all the other signals,
collections provided that the effect sizes (that is, ORs) are not perhaps explaining the more consistent replication of their
significantly divergent. This condition was fulfilled because no association. Genotype comparisons for the different SNPs
significant heterogeneity in OR was detected for any of the were concordant with an additive genetic model and yielded
SNPs (Table 2, final column). very similar results to the allele frequency analyses (data not
shown).
The combined data showed significant differences between
SLE cases and controls for eight of the nine SNPs located in Combined analysis was also conducted in women (Table 3).
autosomal chromosomes (Table 2). All of the significant differ- This was particularly necessary for the MECP2 SNP rs17435,
ences between cases and controls were in the same direction located in the X chromosome. This SNP showed a significant
as originally reported (Tables 1 and 2). We found association difference between SLE women and control women and with
of the four SNPs that have been reported in a single GWA and the same disease-associated allele as previously reported (OR
not yet replicated by independent studies: rs10798269 in = 1.26, P = 0.00085). The SNPs placed in the autosomes
1q25.1 (OR = 0.81, P = 0.00013), rs6445975 in PXK (OR = showed similar results to those obtained in the unstratified
1.19, P = 0.0038), rs17266594 in BANK1 (OR = 0.83, P = analysis. There were only less significant P values due to the
0.0062) and rs4963128 in KIAA1542 (OR = 0.84, P = smaller sample size, but the effect sizes (expressed as ORs)
0.0011). There was also significant association of two of the remained largely unchanged. The BANK1 SNP was not asso-
three SNPs that were described in large studies but that were ciated in women, but this was the SNP with fewer available
not observed in any of the GWA studies: rs2304256 in TYK2 samples because we have excluded from this analysis the
(OR = 0.79, P = 2.5 × 10-5) and rs17435 in MECP2 (analysis sample collections that have previously been reported (power
of this SNP was performed separately in women and men was 0.68 for P = 0.05 and OR = 0.78, which was previously
because this gene is in chromosome X; see below). Only reported in Spanish samples) [5].
rs509749 in LY9 was similar in cases and controls. Our study
had sufficient power (80%) to detect association at this SNP No previous detailed information of men with SLE has been
published for any of these associated loci, although in a report

Table 2

Combined analysis of allele frequency differences between SLE cases and controls for nine autosomal loci

Minor allele frequency (%)a Mantel – Haenszel analysis Breslow – Day test

SNP (locus) SLE cases Controls OR (95% CI) P value P value

rs1143679 (ITGAM) 23.2 (730/3,152) 15.1 (521/3,448) 1.70 (1.5 to 1.9) 1.1 × 10-16 0.5
rs7574865 (STAT4) 32.8 (709/2,162) 23.2 (485/2,092) 1.62 (1.4 to 1.9) 2.4 × 10-12 1.0
rs13277113 (C8orf13-BLK) 30.9 (874/2,824) 25.7 (776/3,024) 1.34 (1.2 to 1.5) 5.1 × 10-7 1.0
rs2304256 (TYK2) 23.3 (733/3,152) 27.8 (960/3,450) 0.79 (0.7 to 0.9) 2.5 × 10-5 0.6
rs10798269 (1q25.1) 27.3 (861/3,158) 31.8 (1,098/3,452) 0.81 (0.7 to 0.9) 0.00013 0.2
rs17266594 (BANK1) 24 (526/2,192) 27.6 (624/2,260) 0.83 (0.7 to 0.9) 0.0062 0.4
rs4963128 (KIAA1542) 30.3 (955/3,150) 34.0 (1,173/3,448) 0.84 (0.8 to 0.9) 0.0011 0.2
rs6445975 (PXK) 27.3 (772/2,824) 24.2 (734/3,034) 1.19 (1.1 to 1.3) 0.0038 0.7
rs509749 (LY9) 43.1 (1,359/3,154) 43.8 (1,513/3,452) 0.97 (0.9 to 1.1) 0.5 0.4

Loci ordered by decreasing effect size (odds ratio (OR)). All results refer to the minor allele of each SNP, which is indicated in Table 1. CI,
confidence interval; SLE, systemic lupus erythematosus. aData presented as percentage (number of minor alleles/total number of alleles).

Page 4 of 9
(page number not for citation purposes)

94
 Procedimiento experimental y resultados

Available online http://arthritis-research.com/content/11/3/R69

Table 3

Combined analysis of allele frequency differences between SLE women and control women

Minor allele frequency (%)a Mantel – Haenszel analysis Breslow – Day test

SNP (locus) SLE cases Controls OR (95% CI) P value P value

rs1143679 (ITGAM) 22.3 (621/2,782) 15.1 (329/2,182) 1.67 (1.4 to 2.0) 2.0 × 10-11 0.6
rs7574865 (STAT4) 33.1 (636/1,920) 24.0 (317/1,322) 1.60 (1.4 to 1.9) 8.4 × 10-9 0.8
rs13277113 (C8orf13-BLK) 30.9 (777/2,514) 25.7 (475/1,848) 1.33 (1.2 to 1.5) 5.4 × 10-5 0.9
rs2304256 (TYK2) 22.9 (638/2,782) 27.2 (592/2,180) 0.81 (0.7 to 0.9) 0.0022 0.2
rs17435 (MECP2) 26.7 (744/2,784) 22.8 (498/2,186) 1.26 (1.1 to 1.4) 0.00085 0.7
rs10798269 (1q25.1) 27.1 (754/2,786) 32.3 (705/2,182) 0.77 (0.7 to 0.9) 6.2 × 10-5 0.4
rs17266594 (BANK1) 23.9 (464/1,938) 26.9 (386/1,436) 0.87 (0.7 to 1.0) 0.077 0.4
rs4963128 (KIAA1542) 30.4 (845/2,778) 33.9 (741/2,182) 0.85 (0.8 to 1.0) 0.011 0.2
rs6445975 (PXK) 26.7 (670/2,514) 23.5 (436/1,854) 1.22 (1.1 to 1.4) 0.0067 0.9
rs509749 (LY9) 43.3 (1,206/2,784) 44.0 (962/2,184) 0.98 (0.9 to 1.1) 0.7 0.5

Loci ordered as presented in Table 2. All results refer to the minor allele of each SNP, which is indicated in Table 1. CI, confidence interval; OR,
odds ratio; SLE, systemic lupus erythematosus. aData presented as percentage (number of minor alleles/total number of alleles).

describing association of the ITGAM gene it was indicated 0.03). Some SNPs were not associated in men (in the TYK2,
that results were not different between women and men [7]. 1q25.1, BANK1 and LY9 loci), but statistical power of this
This lack of information is probably due to the rarity of men suf- subgroup analysis was low, ranging from 0.19 for
fering from SLE. In our analysis, we have considered all male rs17266594 in BANK1 to 0.25 for rs2304256 in TYK2
data together without stratifying for sample collection due to among the nonassociated SNPs (power was estimated for P
the low number of men in each collection (Table 4). Results in = 0.05 and OR = 1.2).
men were similar to results in women, with the possible excep-
tion of the rs1143679 in ITGAM (OR = 2.08 versus 1.67; P =

Table 4

Comparison of SNP allele frequencies between SLE men and control men

Minor allele frequency (%)a Mantel – Haenszel analysis

SNP (locus) SLE cases Controls OR (95% CI) P value

rs1143679 (ITGAM) 27.9 (83/298) 15.7 (181/1,154) 2.08 (1.5 to 2.8) 1.2 × 10-6
rs7574865 (STAT4) 31.7 (64/202) 21.5 (159/740) 1.69 (1.2 to 2.4) 0.0025
rs13277113 (C8orf13-BLK) 31.0 (88/284) 25.1 (267/1,064) 1.34 (1.0 to 1.8) 0.045
rs2304256 (TYK2) 26.8 (80/298) 28.8 (334/1,158) 0.91 (0.7 to 1.2) 0.5
rs17435 (MECP2)b 29.2 (42/144) 18.5 (105/568) 1.82 (1.2 to 2.8) 0.0046
rs10798269 (1q25.1) 28.0 (84/300) 30.7 (355/1,158) 0.88 (0.7 to 1.2) 0.4
rs17266594 (BANK1) 26.2 (56/214) 28.4 (227/798) 0.89 (0.6 to 1.3) 0.5
rs4963128 (KIAA1542) 28.0 (84/300) 34.9 (403/1,156) 0.73 (0.6 to 1.0) 0.025
rs6445975 (PXK) 32.1 (86/268) 24.8 (265/1,068) 1.43 (1.1 to 1.9) 0.016
rs509749 (LY9) 40.6 (121/298) 42.9 (496/1,156) 0.91 (0.7 to 1.2) 0.5

Loci ordered as presented in Table 2. All results refer to the minor allele of each SNP, which is indicated in Table 1. No stratified analysis by
sample collection was done due to the small number of patients with systemic lupus erythematosus (SLE) in each collection. CI, confidence
interval; OR, odds ratio. aData presented as percentage (number of minor alleles/total number of alleles). bThese results are of carrier analysis
because MECP2 is in the X chromosome and there is a single allele in each man.

Page 5 of 9
(page number not for citation purposes)

95
 Factores genéticos asociados con predisposición a LES

Arthritis Research & Therapy Vol 11 No 3 Suarez-Gestal et al.

Discussion in SLE [13]. MECP2 could be involved in both phenomena

Our aim has been to contribute to the definition of consistent because this gene is in the X chromosome and participates in
SLE genetic factors derived from recent sound studies: four of DNA methylation. Sawalha and colleagues found association
the associations have been described in a GWA study, but not with several SNPs in women from two ethnic groups, Korean
in a second GWA study or any other study; another two asso- and European (OR for rs17435 = 1.58 and 1.29, respectively)
ciations were identified in large studies, but not in any of the [13]. The association we have found in women (OR = 1.26) is
GWA studies; and one association is more controversial very similar to that reported in their European sample, provid-
(Table 1). Our results are highly reassuring because all of the ing strong confirmatory evidence. This replication is important
associations, except one from the group not found in any for the status of MECP2 due to the lack of association signals
GWA study, were replicated with clarity and showed the same in the SLE GWA studies.
disease-associated allele as originally reported. This high
degree of reproducibility is a fundamental change that large In addition, we have found that the MECP2 SNP is also asso-
studies have brought to genetic research of SLE and other ciated with SLE in men (OR = 1.82, P = 0.0046), which was
complex diseases [2,21]. This change allows a bright future not previously known. This result seriously undermines the
for the investigation of the genetic component of SLE. hypothesized role of MECP2 in SLE gender bias. In retro-
spect, lack of sex specificity is congruent with experiments
The most remarkable result from the present study has proba- that showed MECP2 is not expressed in the inactivated X
bly been the association signal observed with the rs2304256 chromosome of women [23], which implies expression levels
nonsynonymous SNP of TYK2 (OR = 0.79) because this has in men and women should be equivalent. Future research
been a controversial SLE genetic factor. The rs2304256 SNP should aim to establish whether any of the SLE-associated
introduces a valine to phenylalanine change in the Janus SNPs in MECP2 has a functional effect and to find evidence
homology domain 4 of TYK2 whose functional relevance has of the hypothesized relationship between altered methylation
not yet been tested. This nonsynonymous SNP showed the of T-cell genes in SLE and MECP2. In addition, it is even
strongest association among the 11 TYK2 SNPs studied in unclear whether the causal polymorphism affects MECP2
Scandinavian families [15], but was not associated in a study because SLE association has also been reported with genetic
of UK families [16]. This latter study, however, found associa- variants in a neighbour gene, IRAK1, which is a key mediator
tion with another TYK2 SNP (rs12720270) that was not asso- in the signalling pathways of Toll-like receptors/IL-1R [24].
ciated in the Scandinavian study. Finally, the International
Consortium for Systemic Lupus Erythematosus Genetics The rs10798269 SNP in the 1q25.1 locus, the rs4963128
(SLEGEN) GWA study excluded association with the SNP in the KIAA1542 gene and the rs6445975 SNP in the
rs12720270 SNP (the rs2304256 SNP was not included in PXK gene were reported in the SLEGEN GWA study [3] with
the GWA panels) [3]. Our results are important in this context P values below 2 × 10-7, but they were not reported in Hom
because they show a significant association that confirms the and colleagues' GWA study [4] and none of them has yet
role of the rs2304256 nonsynonymous SNP. In addition, com- been replicated in any other study. The three SNPs were asso-
bined analysis of all available data show a clear SLE associa- ciated with SLE in our study, with effect sizes that are similar
tion (P = 2.10 × 10-11) that is stronger than the required for to those reported (OR = 0.81 versus 0.82 for the 1q25.1
genome-wide significance. SNP, 0.84 versus 0.78 for the KIAA1542 SNP, and 1.19 ver-
sus 1.25 for the PXK SNP). None of these three SNPs has any
Tyk2 is a Janus-family tyrosine kinase that is bound to cytokine predictable functional effect. In addition, the rs10798269
receptors and becomes activated after ligand binding. Defi- SNP in the 1q25.1 locus is far from any known transcript and
ciency of TYK2 leads to defects of multiple cytokine pathways, the PXK and KIAA1542 genes are of unknown function. The
including type I interferon, IL-6, IL-10, IL-12, and IL-23, and to KIAA1542 gene, however, is about 20 kb away from the IRF7
impaired T-helper type 1 differentiation and accelerated T- gene and in linkage disequilibrium with it, raising the possibility
helper type 2 differentiation [22]. Only future research will indi- that this association could be related with IRF7 function [3].
cate which of these pathways is critically affected by the TYK2 Our replication of these associations increases the need for
risk allele. research aimed to the identification of their functional effects.

Following in importance is the association of MECP2 because We have also found a significant association with the
our results provide replication and indicate that a previous rs17266594 in the BANK1 gene. This SLE genetic factor has
assumption about the role of this genetic factor in contributing been identified in a low-resolution GWA study in a Swedish
to the sex bias in SLE is questionable. Sawalha and col- sample and replicated in other European sample collections in
leagues considered the X-chromosome methyl CpG binding the same study [5], but it was not found in any of the high-res-
protein 2 coding gene (MECP2) as a possible SLE genetic olution GWA studies and has not yet been replicated by other
factor based on two features: SLE predominance in women groups. Our results provide this independent replication,
and abnormal regulation of methylation-sensitive T-cell genes although with a more modest effect (OR = 0.83 in our study

Page 6 of 9
(page number not for citation purposes)

96
 Procedimiento experimental y resultados

Available online http://arthritis-research.com/content/11/3/R69

versus 0.70 in Kozyrev and colleagues [5]). The causal poly- In addition, we have found that most examined SLE-associ-
morphism can be the rs17266594 SNP itself, which seems to ated SNPs seem to be shared between women and men.
alter splicing efficiency of BANK1, or two BANK1 nonsynon- Results are not definitive given the small number of men in the
ymous SNPs of possible damaging effect. Linkage disequilib- patient group. This lack of differential association is important
rium between these three SNPs has prevented dissection of because we do not know definitively the causes of the female
their relationship to SLE susceptibility [5]. BANK1 codes for a preference of SLE. Lack of detailed gender analysis in previ-
B-cell scaffold protein with ankyrin repeats that is implicated in ous genetic reports is regrettable because only aggregation of
B-cell receptor-mediated signalling. data from multiple studies will allow us to know whether
genetic factors contribute to this sex bias.
The rs509749 SNP of LY9 is the only SNP that was not repli-
cated in our study. We selected this SNP because it seems to Conclusions
explain the 1q23 SLE-linked locus according to a large family- In summary, our study has provided independent replication of
based study [14]. 1q23 is one of the most consistently nine SLE-associated loci, six of them of confirmatory impor-
described SLE loci in linkage studies (and its syntenic region tance because they have not yet been independently repli-
in the mouse lupus models) [1]. Examination of SNPs all along cated by other groups (1q25.1, MECP2, KIAA1542, PXK and
this locus showed stronger association with the rs509749 BANK1) or because their association was controversial
SNP [14]. This SNP has a predictable impact in protein func- (TYK2). These results bring the number of strongly confirmed
tion and is associated with changes in the proportion of spe- associated loci to 13. Replication in independent studies is
cific T-cell subsets [14]. All this evidence made the rs509749 indispensable for considering a genetic factor in this category,
SNP a good candidate for replication in our view, even if the although the common use of multiple case–control sets inside
level of significance of the SLE association was notably lower the same study or of large sample collections has increased
than the reported for the other nine SNPs studied here (P = the chances of replication [2]. Some other promising associa-
0.002). Lack of replication of this SNP in contrast with replica- tions have been discovered [6,25], or await sufficient inde-
tion of the other nine SNPs provides support for the direct rela- pendent replication [2], but it is already certain that the genetic
tionship between very low P values obtained in sound studies component of SLE is especially rich in genetic factors with
and the reproducibility of genetic association findings [21]. effects above the detectable level with current studies (OR =
1.15 to 1.25). We are therefore now in a phase of exciting dis-
The most associated SNPs in our samples were the three that coveries in this field. There still remain formidable challenges,
were already confirmed previous to our study. These three however, because it is necessary to transform the information
SNPs were associated with SLE in at least three large studies. we obtain into useful knowledge and, as has been discussed
The largest effect was observed with a nonsynonymous SNP above, we have very few clues regarding the meaning of the
in the third exon of the ITGAM gene (rs1143679, OR = 1.70) identified SLE associations. Future studies should try to iden-
[3,4,6,7]. This nonsynonymous SNP was the most associated tify the causal variants and to determine their effect at molec-
in one of the previous studies (with very similar effect, OR = ular, cellular and disease levels, including the assessment of
1.74) [7], and has been hypothesized to disturb ITGAM inter- their role in the different SLE phenotypes and the probable
action with its ligands, but still no functional evidence is avail- similar effect in women and men.
able. Another clearly established association [3,4,6,8-12] was
the second strongest in our study: SNP rs7574865 in the Competing interests
third intron of the STAT4 gene (OR = 1.62). This association The authors declare that they have no competing interests.
seems stronger in patients with a severe phenotype [12]; how-
ever, no functional polymorphism has been identified in this Authors' contributions
locus. The next strongest association (OR = 1.34) was with MS-G participated in design of the study, in genotyping the
the rs13277113 SNP, which has been reported in the GWA samples, in interpretation of the results and in writing the man-
study of Hom and colleagues [4], with a similar effect (OR = uscript. MC participated in the statistical analysis and in the
1.39). This SNP is located between C8orf13 (of unknown interpretation of results. EE, RP, JO-R, GDS, SR, MJS, CP,
function) and BLK (B-lymphoid tyrosine kinase), two genes MM, FNS, AS, FJB, SD'A, MB, PC, TW and SM participated
that are transcribed in opposite directions. No functional vari- in the acquisition of clinical data and collection of samples and
ant has been identified in this locus, but the risk allele of this in the analysis and interpretation of results. JJG-R coordinated
SNP correlates with low mRNA levels of BLK and high levels the acquisition of clinical data and collection of samples and
of C8orf13, raising the possibility that either of these two participated in the analysis and interpretation of results. AG
effects could be related with SLE. Graham and colleagues participated in the design of the study and in the coordination
found association with a strongly linked SNP in the BLK gene of acquisition of clinical data and collection of samples, and
[6], while the SLEGEN GWA study found association with an supervised genotyping, statistical analysis, interpretation of
unlinked SNP in this locus, suggesting the possibility of two results and writing of the manuscript. All authors read and
independent genetic factors [3]. approved the final manuscript.

Page 7 of 9
(page number not for citation purposes)

97
 Factores genéticos asociados con predisposición a LES

Arthritis Research & Therapy Vol 11 No 3 Suarez-Gestal et al.

Authors' information References

Other contributors to the European Consortium of SLE DNA 1. Kelly JA, Moser KL, Harley JB: The genetics of systemic lupus
erythematosus: putting the pieces together. Genes Immun
Collections: Attila Kovacs (Albert Szent-Györgyi Medical and 2002, 3(Suppl 1):S71-S85.
Pharmaceutical Centre, University of Szeged, Hungary); 2. Rhodes B, Vyse TJ: The genetics of SLE: an update in the light
Rudolf Pullmann Jr (Gerontology Research Center, National of genome-wide association studies. Rheumatology (Oxford)
2008, 47:1603-1611.
Institute on Aging, Baltimore, MD, USA); Eva Balada (Hospital 3. International Consortium for Systemic Lupus Erythematosus
Vall d'Hebron, Barcelona, Spain); Ctibor Dostal (Institute of Genetics (SLEGEN), Harley JB, Alarcón-Riquelme ME, Criswell
Rheumatology, Prague, Czech Republic); Filipe Vinagre (Hos- LA, Jacob CO, Kimberly RP, Moser KL, Tsao BP, Vyse TJ,
Langefeld CD, Nath SK, Guthridge JM, Cobb BL, Mirel DB, Marion
pital Garcia de Orta, Almada, Portugal and Instituto Medicina MC, Williams AH, Divers J, Wang W, Frank SG, Namjou B, Gabriel
Molecular, Faculdade de Medicina da Universidade de Lisboa, SB, Lee AT, Gregersen PK, Behrens TW, Taylor KE, Fernando M,
Zidovetzki R, Gaffney PM, Edberg JC, Rioux JD, et al.: Genome-
Portugal); Iris Kappou-Rigatou (Evangelismos Hospital, Ath- wide association scan in women with systemic lupus ery-
ens, Greece); Raffaella Scorza (University of Milan and Fon- thematosus identifies susceptibility variants in ITGAM, PXK,
dazione IRCCS Ospedale Maggiore Policlinico, Mangiagalli e KIAA1542 and other loci. Nat Genet 2008, 40:204-210.
4. Hom G, Graham RR, Modrek B, Taylor KE, Ortmann W, Garnier S,
Regina Elena, Milan, Italy); Maria Mavromati (Athens University Lee AT, Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R,
Medical School, Athens, Greece); Carmen Gutierrez (Hospital Demirci FY, Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson
Universitario Central de Asturias, Universidad de Oviedo, AA, Rantapää-Dahlqvist S, Petri M, Manzi S, Seldin MF, Rönnblom
L, Syvänen AC, Criswell LA, Gregersen PK, Behrens TW: Associ-
Spain); Ignacio Rego (INIBIC-CH Universitario A Coruña, ation of systemic lupus erythematosus with C8orf13-BLK and
Spain); Nadia Barizzone (Eastern Piedmont University, ITGAM-ITGAX. N Engl J Med 2008, 358:900-909.
5. Kozyrev SV, Abelson AK, Wojcik J, Zaghlool A, Linga Reddy MV,
Novara, Italy); Cees G Kallenberg (University Medical Center Sanchez E, Gunnarsson I, Svenungsson E, Sturfelt G, Jönsen A,
Groningen, The Netherlands); and Reinhold E Schmidt (Han- Truedsson L, Pons-Estel BA, Witte T, D'Alfonso S, Barizzone N,
nover Medical School, Hannover, Germany). Danieli MG, Gutierrez C, Suarez A, Junker P, Laustrup H,
González-Escribano MF, Martin J, Abderrahim H, Alarcón-
Riquelme ME: Functional variants in the B-cell gene BANK1 are
Note associated with systemic lupus erythematosus. Nat Genet
2008, 40:211-216.
A report published in Arthritis & Rheumatism after publication 6. Graham RR, Cotsapas C, Davies L, Hackett R, Lessard CJ, Leon
of this manuscript provided further confirmation of the associ- JM, Burtt NP, Guiducci C, Parkin M, Gates C, Plenge RM, Behrens
ation of MECP2 with SLE [26]. TW, Wither JE, Rioux JD, Fortin PR, Graham DC, Wong AK, Vyse
TJ, Daly MJ, Altshuler D, Moser KL, Gaffney PM: Genetic variants
near TNFAIP3 on 6q23 are associated with systemic lupus ery-
Additional files thematosus. Nat Genet 2008, 40:1059-1061.
7. Nath SK, Han S, Kim-Howard X, Kelly JA, Viswanathan P, Gilkeson
GS, Chen W, Zhu C, McEver RP, Kimberly RP, Alarcón-Riquelme
ME, Vyse TJ, Li QZ, Wakeland EK, Merrill JT, James JA, Kaufman
The following Additional files are available online: KM, Guthridge JM, Harley JB: A nonsynonymous functional var-
iant in integrin-alpha(M) (encoded by ITGAM) is associated
Additional file 1 with systemic lupus erythematosus. Nat Genet 2008,
40:152-154.
A Word file containing Table S1 that lists the origin and 8. Remmers EF, Plenge RM, Lee AT, Graham RR, Hom G, Behrens
female percentage of the DNA sample collections, Table TW, de Bakker PI, Le JM, Lee HS, Batliwalla F, Li W, Masters SL,
S2 that lists the clinical characteristics of the patients Booty MG, Carulli JP, Padyukov L, Alfredsson L, Klareskog L, Chen
WV, Amos CI, Criswell LA, Seldin MF, Kastner DL, Gregersen PK:
with SLE, Table S3 that lists the primers and probes STAT4 and the risk of rheumatoid arthritis and systemic lupus
used for genotyping the 10 SNPs, Table S4 that lists the erythematosus. N Engl J Med 2007, 357:977-986.
9. Kobayashi S, Ikari K, Kaneko H, Kochi Y, Yamamoto K, Shimane K,
genotype counts for each of the 10 SNPs detailed for Nakamura Y, Toyama Y, Mochizuki T, Tsukahara S, Kawaguchi Y,
each of the sample collections, and Table S5 that lists Terai C, Hara M, Tomatsu T, Yamanaka H, Horiuchi T, Tao K, Yas-
the minor allele percentages for each of the 10 SNPs for utomo K, Hamada D, Yasui N, Inoue H, Itakura M, Okamoto H,
Kamatani N, Momohara S: Association of STAT4 with suscepti-
each of the sample collections. bility to rheumatoid arthritis and systemic lupus erythemato-
See http://www.biomedcentral.com/content/ sus in the Japanese population. Arthritis Rheum 2008,
58:1940-1946.
supplementary/ar2698-S1.doc 10. Palomino-Morales RJ, Rojas-Villarraga A, González CI, Ramírez G,
Anaya JM, Martín J: STAT4 but not TRAF1/C5 variants influence
the risk of developing rheumatoid arthritis and systemic lupus
erythematosus in Colombians. Genes Immun 2008,
9:379-382.
Acknowledgements 11. Sigurdsson S, Nordmark G, Garnier S, Grundberg E, Kwan T, Nils-
The authors thank Carmen Pena-Pena for providing outstanding techni- son O, Eloranta ML, Gunnarsson I, Svenungsson E, Sturfelt G,
cal assistance. MS-G is the recipient of a FPU predoctoral bursary of the Bengtsson AA, Jönsen A, Truedsson L, Rantapää-Dahlqvist S,
Eriksson C, Alm G, Göring HH, Pastinen T, Syvänen AC, Rönnb-
Spanish Ministry of Education. The present work was supported by lom L: A risk haplotype of STAT4 for systemic lupus erythema-
Fondo de Investigacion Sanitaria of the Instituto de Salud Carlos III tosus is over-expressed, correlates with anti-dsDNA and
(Spain), grants 04/1651 and 06/0620 that are partially financed by the shows additive effects with two risk alleles of IRF5. Hum Mol
Fondo Europeo de Desarrollo Regional program of the European Union, Genet 2008, 17:2868-2876.
12. Taylor KE, Remmers EF, Lee AT, Ortmann WA, Plenge RM, Tian C,
by grants from the Xunta de Galicia, and by BMBF KN Rheuma grant Chung SA, Nititham J, Hom G, Kao AH, Demirci FY, Kamboh MI,
C2.12 (to TW). Petri M, Manzi S, Kastner DL, Seldin MF, Gregersen PK, Behrens
TW, Criswell LA: Specificity of the STAT4 genetic association

Page 8 of 9
(page number not for citation purposes)

98
 Procedimiento experimental y resultados

Available online http://arthritis-research.com/content/11/3/R69

for severe disease manifestations of systemic lupus ery-

thematosus. PLoS Genet 2008, 4:e1000084.
13. Sawalha AH, Webb R, Han S, Kelly JA, Kaufman KM, Kimberly RP,
Alarcón-Riquelme ME, James JA, Vyse TJ, Gilkeson GS, Choi CB,
Scofield RH, Bae SC, Nath SK, Harley JB: Common variants
within MECP2 confer risk of systemic lupus erythematosus.
PLoS ONE 2008, 3:e1727.
14. Cunninghame Graham DS, Vyse TJ, Fortin PR, Montpetit A, Cai
YC, Lim S, McKenzie T, Farwell L, Rhodes B, Chad L, Hudson TJ,
Sharpe A, Terhorst C, Greenwood CM, Wither J, Rioux JD,
CaNIOS GenES Investigators: Association of LY9 in UK and
Canadian SLE families. Genes Immun 2008, 9:93-102.
15. Sigurdsson S, Nordmark G, Göring HH, Lindroos K, Wiman AC,
Sturfelt G, Jönsen A, Rantapää-Dahlqvist S, Möller B, Kere J,
Koskenmies S, Widén E, Eloranta ML, Julkunen H, Kristjansdottir
H, Steinsson K, Alm G, Rönnblom L, Syvänen AC: Polymor-
phisms in the tyrosine kinase 2 and interferon regulatory fac-
tor 5 genes are associated with systemic lupus
erythematosus. Am J Hum Genet 2005, 76:528-537.
16. Cunninghame Graham DS, Akil M, Vyse TJ: Association of poly-
morphisms across the tyrosine kinase gene, TYK2 in UK SLE
families. Rheumatology (Oxford) 2007, 46:927-930.
17. Ferreiro-Neira I, Calaza M, Alonso-Perez E, Marchini M, Scorza R,
Sebastiani GD, Blanco FJ, Rego I, Pullmann R Jr, Pullmann R,
Kallenberg CG, Bijl M, Skopouli FN, Mavromati M, Migliaresi S,
Barizzone N, Ruzickova S, Dostal C, Schmidt RE, Witte T, Papas-
teriades C, Kappou-Rigatou I, Endreffy E, Kovacs A, Ordi-Ros J,
Balada E, Carreira P, Gomez-Reino JJ, Gonzalez A: Opposed
independent effects and epistasis in the complex association
of IRF5 to SLE. Genes Immun 2007, 8:429-438.
18. Hochberg MC: Updating the American College of Rheumatol-
ogy revised criteria for the classification of systemic lupus ery-
thematosus. Arthritis Rheum 1997, 40:1725.
19. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and vis-
ualization of LD and haplotype maps. Bioinformatics 2005,
21:263-265.
20. Dupont WD, Plummer WJ Jr: Power and sample size calcula-
tions. A review and computer program. Control Clin Trials
1990, 11:116-128.
21. Todd JA: Statistical false positive or true disease pathway?
Nat Genet 2006, 38:731-733.
22. Minegishi Y, Saito M, Morio T, Watanabe K, Agematsu K, Tsuchiya
S, Takada H, Hara T, Kawamura N, Ariga T, Kaneko H, Kondo N,
Tsuge I, Yachie A, Sakiyama Y, Iwata T, Bessho F, Ohishi T, Joh K,
Imai K, Kogawa K, Shinohara M, Fujieda M, Wakiguchi H, Pasic S,
Abinun M, Ochs HD, Renner ED, Jansson A, Belohradsky BH, et
al.: Human tyrosine kinase 2 deficiency reveals its requisite
roles in multiple cytokine signals involved in innate and
acquired immunity. Immunity 2006, 25:745-755.
23. D'Esposito M, Quaderi NA, Ciccodicola A, Bruni P, Esposito T,
D'Urso M, Brown SD: Isolation, physical mapping, and northern
analysis of the X-linked human gene encoding methyl CpG-
binding protein, MECP2. Mamm Genome 1996, 7:533-535.
24. Jacob CO, Zhu J, Armstrong DL, Yan M, Han J, Zhou XJ, Thomas
JA, Reiff A, Myones BL, Ojwang JO, Kaufman KM, Klein-Gitelman
M, McCurdy D, Wagner-Weiner L, Silverman E, Ziegler J, Kelly JA,
Merrill JT, Harley JB, Ramsey-Goldman R, Vila LM, Bae SC, Vyse
TJ, Gilkeson GS, Gaffney PM, Moser KL, Langefeld CD, Zidovetzki
R, Mohan C: Identification of IRAK1 as a risk gene with critical
role in the pathogenesis of systemic lupus erythematosus.
Proc Natl Acad Sci USA 2009, 106:6256-6261.
25. Musone SL, Taylor KE, Lu TT, Nititham J, Ferreira RC, Ortmann W,
Shifrin N, Petri MA, Kamboh MI, Manzi S, Seldin MF, Gregersen
PK, Behrens TW, Ma A, Kwok PY, Criswell LA: Multiple polymor-
phisms in the TNFAIP3 region are independently associated
with systemic lupus erythematosus. Nat Genet 2008,
40:1062-1064.
26. Webb R, Wren JD, Jeffries M, Kelly JA, Kaufman KM, Tang Y, Frank
MB, Merrill J, Kimberly RP, Edberg JC, Ramsey-Goldman R, Petri
M, Reveille JD, Alarcón GS, Vilá LM, Alarcón-Riquelme ME, James
JA, Vyse TJ, Moser KL, Gaffney PM, Gilkeson GS, Harley JB,
Sawalha AH: Variants within MECP2, a key transcription regu-
lator, are associated with increased susceptibility to lupus and
differential gene expression in patients with systemic lupus
erythematosus. Arthritis Rheum 2009, 60:1076-84.

Page 9 of 9
(page number not for citation purposes)

99
100
Supplementary Table 1
Origin and female percentage of the DNA sample collections used for replication of SLE associated SNPs.

DNA samples Female %

Collections Control SLE Control SLE
a
Czech Republica 99 101 32.3 85.1 Institute of Rheumatology, Prague
b b
Germany 92 82 25 90.2 Hannover Medical School
c
Greece 1c 99 97 66.7 86.6 Evangelismos Hospital. Athens
d
Greece 2d 88 94 93.2 91.5 Athens University Medical School
e
Hungarye 95 95 48.8 88.4 Albert Szent-Györgyi Medical and Pharmaceutical Centre. Szeged
f
University of Milan and Fondazione IRCCS Ospedale Maggiore
Italy, Milanf 106 128 42.5 86.7 Policlinico
g
Italy, Naplesg 108 81 100 79 Second University of Naples
h
Ospedale S. Camillo – Forlanini.
h
Italy, Rome 102 84 55.9 83.3 Rome
i
The Netherlandsi 180 104 58.9 86.5 University Medical Center Groningen
j j
Portugal 95 94 89.5 85.1 Hospital Garcia de Orta. Almada
k
Slovakiak 93 94 93.5 91.5 Martin Faculty Hospital. Martin
l
Spain, Asturiasl 200 147 69 91.8 Hospital Universitario Central de Asturias
Factores genéticos asociados con predisposición a LES

m
Spain, Barcelonam 96 89 52.1 91 Hospital Val d’Hebron. Barcelona
n n
Spain, Coruña 81 88 71.6 92 CH Universitario Juan Canalejo. Coruña
o
Spain, Madrido 98 92 64.3 91.3 Hospital 12 de Octubre. Madrid
p
Spain, Santiagop 95 109 48.4 89 Hospital Clinico Universitario de Santiago
Total 1726 1579 63.2 88.2
 Procedimiento experimental y resultados

Supplementary Table 2
Clinical characteristics of the patients with SLE included in the study

Clinical characteristic (scale) Value

Age of disease onset (median, IQR) 28 (21-39)
Malar rash (%) 53.5
Discoid rash (%) 18.1
Photo-sensitivity (%) 53.5
Oral ulcers (%) 28.2
Arthritis (%) 80.7
Serosistis (%) 35.8
Renal disorder (%) 41.0
Neurologic disorder (%) 14.6
Hematologic disorder (%) 74.3
Immunologic disorder (%) 77.7
ANA (%) 93.0

101
102
Supplementary Table 3
Primers and probes in 5’ to 3’ direction used for genotyping the 10 SNPs by the SNaPshot technique

PCR primers
Locus SNP Forward Primer Reverse Primer Minisequencing Probe

C8orf13-BLK rs13277113
TTACCTATGATTGATCGTGGTGATATCCGtctgacgcaggcc
cattaggtaacctgtgcttttcct ccagtccaagattcacctcag
atttttaagattaaacacttatcagatcatt $

ITGAM rs1143679 ccacagggtggtggttggagc cccaccacagatccccaggac tacagcacagtctcatgcgagcccatcc

KIAA1542
TGATTGATCGTGGTGATATCCGcctgcctccccgagtgtgtc
rs4963128 ccgagatcttgactccgtccg ggaggacaggaaggcaccaag
c $

PXK rs6445975 gctaggatgtacctgccatttcc gctgtccctagagccccagtc actcacacttactgtaagttaacaaatggagca

1q25.1 rs10798269
AGAAGTATATTAATGAGCAGTGCAGttgaggtcgaccaatct
cactaaggatggaccatttgagg aggccatggctggggaga
ctcctccttttctccttacaaatcta $

BANK rs17266594
TCGTGGTGATATCCGtgcctagtgagcatattaaaatttttg
gcaaattaatatattgcctagtgagc acaggatggcttcccttttc
agaaataataatttaacctgc $

MECP2 rs17435
ATCCGtgtagtcttcagccctatctggattcttctctttgtt
gcccagtgagccagcccag cggagagaatttgcacgctg
ctaagaactgtgttgg $
Factores genéticos asociados con predisposición a LES

LY9 rs509749
ACCTTCGCGGCAGATATAATtccatatgtcacggaagttgag
tcactcaggagggcgctgg tgcccgtatgcccctagtc
tctgtggttggagagaacacc $

STAT4 rs7574865
catgagtgtgtatgcagtaaaagtatgaaaagttggtgagca
tggtgtggatggaggtaagg aatcccctgaaattccactga
aaatgt

TYK2 rs2304256 ccctagcccagcccctac aggaggtataaacgggcattg ccagcctgtttgggaagaaggccaaggctcacaaggca

Primers selected with Primer3 and Oligos softwares. They were checked to avoid formation of dimers between the primers included in the reaction.
$ These oligonucleotides were extended with a 5' tail that has no homology with human sequences (these tails are in capital letters)
 Supplementary Table 4
Genotype counts for each of the ten SNPs and each of the sample collections
Data from sample collections that have been included in other publications were excluded (empty cells)
Data for the rs17266594 SNP from the Barcelona collection were excluded due to inconsistencies in regenotyping

Sample rs2304256 (TYK2) rs7574865 (STAT4) rs6445975 (PXK) rs17435 (MECP2) rs509749 (LY9) rs4963128 (KIAA1542) rs1143679 (ITGAM) rs13277113 (C8orf13-BLK rs17266594 (BANK1) rs10798269 (1q25.1)
collections CC CA AA GG GT TT TT TG GG AA AT TT AA AG GG GG GA AA GG GA AA GG GA AA TT TC CC GG GA AA
SLE 57 32 5 44 35 15 40 42 12 56 30 7 27 44 23 46 30 18 52 36 6 50 40 4 57 36 1 47 41 6
Portugal Controls 46 36 13 52 40 3 51 36 8 61 32 2 29 42 24 51 35 9 61 31 3 56 36 3 42 45 8 38 46 11
SLE 66 23 3 39 46 7 55 30 7 56 34 2 34 44 14 57 26 9 57 29 6 47 34 11 53 36 3 63 25 4
Madrid Controls 50 44 4 63 29 6 58 37 3 70 19 8 25 50 23 46 43 9 72 25 1 59 32 7 53 42 3 40 50 8
SLE 66 39 4 57 42 10 62 37 10 64 40 5 35 51 23 56 39 14 49 52 7 60 42 7 58 49 2 58 41 10
Santiago Controls 52 36 7 59 32 4 49 40 6 76 11 8 30 50 15 37 47 11 72 20 3 58 31 6 53 33 9 49 38 8
SLE 77 64 6 80 60 7 96 44 7 40 70 37 67 64 16 82 56 9 81 50 16 78 62 7
Asturias Controls 112 75 13 134 61 5 138 43 18 50 104 45 85 83 32 138 57 5 123 67 10 86 86 28
SLE 47 35 6 47 33 8 48 38 2 43 34 10 24 46 18 52 30 6 54 27 7 42 40 6 55 29 4 52 34 2
Coruña Controls 42 32 7 51 27 4 46 31 5 54 22 5 28 34 19 46 31 5 60 18 1 53 23 3 50 29 3 40 38 3
SLE 47 36 6 42 37 10 53 29 6 49 32 8 26 48 15 44 35 10 44 35 9 43 39 7 47 38 4
Barcelona Controls 58 27 11 52 38 6 57 30 9 63 25 8 29 48 19 53 33 10 66 25 5 55 38 3 47 41 8
SLE 46 35 3 44 26 14 28 45 11 32 38 14 49 29 6 45 33 6
Rome Controls 59 35 8 63 20 19 34 51 17 43 41 18 70 27 5 61 28 13
SLE 66 54 7 59 54 15 67 55 6 71 44 11 38 70 20 61 59 7 76 43 8 69 45 13 72 50 6 64 57 7
Milan Controls 56 40 10 64 36 6 71 30 5 76 18 12 38 51 17 43 41 22 70 32 4 60 40 6 58 39 9 53 41 12
SLE 47 27 7 40 30 11 31 41 9 38 30 13 40 35 6 47 28 6
Naples Controls 45 55 7 55 45 8 36 48 24 43 52 13 77 30 1 49 49 10
The SLE 61 36 5 47 41 16 64 26 13 37 45 20 55 39 10 63 38 3 30 58 15 58 40 6 49 45 10
Netherland Controls 94 71 15 92 73 15 127 29 21 65 88 27 90 78 12 130 48 2 63 95 22 98 68 14 74 82 24
SLE 57 35 3 48 39 8 46 39 10 47 38 10 32 51 12 52 33 10 64 30 1 45 38 12 46 38 11 48 44 3
Hungary Controls 50 41 4 58 35 2 46 46 3 67 17 10 28 38 29 37 45 13 77 17 1 55 35 5 48 39 8 42 42 11
SLE 69 25 3 38 48 11 58 36 3 49 31 17 28 54 15 44 40 13 52 40 5 47 39 11 53 38 6 47 39 11
Greece 1 Controls 47 43 9 50 43 6 60 36 2 63 25 9 37 42 20 31 54 14 62 34 2 54 38 6 43 47 9 50 39 10
SLE 59 27 8 36 43 15 50 39 5 40 40 14 19 56 19 51 33 10 47 43 4 40 39 15 63 27 4 51 37 6
Greece 2 Controls 54 27 6 54 29 5 59 25 4 44 37 5 30 34 24 29 45 12 58 28 2 37 41 9 42 40 6 36 43 8
SLE 58 28 8 41 41 12 39 47 8 57 26 11 35 45 14 46 39 9 73 20 1 43 46 5 52 32 10 55 31 8
Slovakia Controls 47 38 8 58 30 5 42 41 10 55 26 12 32 51 10 41 42 10 75 16 2 57 33 3 46 39 8 51 32 10
Czech SLE 62 32 7 43 47 11 54 40 7 55 34 12 38 37 26 53 39 9 75 25 1 45 48 8 60 37 4 49 37 15
Republic Controls 46 45 8 52 42 5 59 31 9 72 11 16 36 50 13 43 40 15 77 22 0 54 40 4 58 33 8 47 44 8
SLE 45 31 6 44 33 4 47 30 3 29 46 7 41 31 7 53 24 5 38 32 12 32 41 9
Germany Controls 45 39 8 51 33 8 66 22 4 32 40 20 49 31 11 75 17 0 49 33 10 45 39 8
SLE 930 559 87 494 465 122 743 566 103 878 539 155 501 793 283 795 605 175 930 562 84 680 590 142 627 412 57 832 633 114
Total Controls 903 684 138 613 381 52 875 550 92 1150 402 165 559 821 346 767 741 216 1240 447 37 833 582 97 591 454 85 808 738 180

103
Procedimiento experimental y resultados
 Supplementary Table 5

104
Minor allele frequencies for each of the ten SNPs and each of the sample collections
Data from sample collections that have been included in other publications were excluded (empty cells)
Data for the rs17266594 SNP from the Barcelona collection were excluded due to inconsistencies in regenotyping

rs2304256 rs7574865 rs6445975 rs17435 rs509749 rs4963128 rs1143679 rs13277113 rs17266594 rs10798269
(TYK2) (STAT4) (PXK) (MECP2) (LY9) (KIAA1542) (ITGAM) (C8orf13-BLK) (BANK1) (1q25.1)
Sample collections A T G T G A A A C A
SLE 0.223 0.346 0.351 0.237 0.479 0.351 0.255 0.255 0.202 0.282
Portugal Controls 0.326 0.242 0.274 0.189 0.474 0.279 0.195 0.221 0.321 0.358
SLE 0.158 0.326 0.239 0.207 0.391 0.239 0.223 0.304 0.228 0.179
Madrid Controls 0.265 0.209 0.219 0.180 0.490 0.311 0.138 0.235 0.245 0.337
SLE 0.216 0.284 0.261 0.229 0.445 0.307 0.306 0.257 0.243 0.280
Santiago Controls 0.263 0.211 0.274 0.142 0.421 0.363 0.137 0.226 0.268 0.284
SLE 0.259 0.252 0.197 0.490 0.327 0.252 0.279 0.259
Asturias Controls 0.253 0.178 0.198 0.487 0.368 0.168 0.218 0.355
SLE 0.267 0.278 0.239 0.310 0.466 0.239 0.233 0.295 0.210 0.216
Coruña Controls 0.284 0.213 0.250 0.198 0.444 0.250 0.127 0.184 0.213 0.272
SLE 0.270 0.320 0.233 0.270 0.438 0.309 0.301 0.298 0.258
Barcelona Controls 0.255 0.260 0.250 0.214 0.448 0.276 0.182 0.229 0.297
SLE 0.244 0.321 0.399 0.393 0.244 0.268
Rome Controls 0.250 0.284 0.417 0.377 0.181 0.265
SLE 0.268 0.328 0.262 0.262 0.430 0.287 0.232 0.280 0.242 0.277
Milan Controls 0.283 0.226 0.189 0.198 0.401 0.401 0.189 0.245 0.269 0.307
SLE 0.253 0.321 0.364 0.346 0.290 0.247
Naples Controls 0.322 0.282 0.444 0.361 0.148 0.319
SLE 0.225 0.351 0.252 0.417 0.284 0.212 0.427 0.250 0.313
The Netherlands Controls 0.281 0.286 0.201 0.394 0.283 0.144 0.386 0.267 0.361
Factores genéticos asociados con predisposición a LES

SLE 0.216 0.289 0.311 0.305 0.395 0.279 0.168 0.326 0.316 0.263
Hungary Controls 0.258 0.205 0.274 0.197 0.505 0.374 0.100 0.237 0.289 0.337
SLE 0.160 0.361 0.216 0.335 0.433 0.340 0.258 0.314 0.258 0.314
Greece 1 Controls 0.308 0.278 0.204 0.222 0.414 0.414 0.194 0.255 0.328 0.298
SLE 0.229 0.388 0.261 0.362 0.500 0.282 0.271 0.367 0.186 0.261
Greece 2 Controls 0.224 0.222 0.188 0.273 0.466 0.401 0.182 0.339 0.295 0.339
SLE 0.234 0.346 0.335 0.255 0.388 0.303 0.117 0.298 0.277 0.250
Slovakia Controls 0.290 0.215 0.328 0.269 0.382 0.333 0.108 0.210 0.296 0.280
SLE 0.228 0.342 0.267 0.287 0.441 0.282 0.134 0.317 0.223 0.332
Czech Republic Controls 0.308 0.263 0.247 0.217 0.384 0.357 0.111 0.245 0.247 0.303
SLE 0.262 0.253 0.225 0.366 0.285 0.207 0.341 0.360
Germany Controls 0.299 0.266 0.163 0.435 0.291 0.092 0.288 0.299
 Procedimiento experimental y resultados

Lack of Interaction Between Systemic Lupus by its proxy, rs2070197) and rs729302. The first SNP showed the strongest
Erythematosus-associated Polymorphisms in TYK2 and IRF5 association (p = 4.8 × 10–20) with SLE in our study8 and others10 and
accounts for association of many other SNP in the gene, including
To the Editor: rs109542138,10. The second, rs729302, is an SNP in the promoter region of
These are exciting times for the genetic investigation of systemic lupus IRF5 that was independently associated to SLE in our samples (p = 1.6 ×
erythematosus (SLE), characterized by the discovery of many reproducibly 10–9). Neither of the 2 SNP showed evidence of interaction with the
associated loci1. Further progress will require research in many different rs2304256 SNP of TYK2, either with an analysis as done by Hellquist, et
directions, including investigation of how the effects of each locus inte- al2 or with LRASSOC (Table 1). These comparisons are more powerful
grate between them and with environmental exposures to cause SLE. We than models with rs10954213 because the 2 IRF5 SNP are much more
read with interest the report by Hellquist, et al2 that showed evidence of strongly associated to SLE susceptibility and because we have data for
significant epistatic interaction between 2 SLE-associated loci, IRF5 and 3-fold more samples: 1223 cases and 1300 controls.
TYK2. The first is a definitively confirmed SLE susceptibility locus with Our results did not show any statistical evidence of interaction between
one of the strongest, albeit complex, effects. The latter has been more con- SLE-associated SNP in TYK2 and IRF5. As a consequence, we should con-
tentious, but its association with SLE is becoming clearer2,3. Epistasis tinue to consider that these 2 SLE genetic factors can contribute to disease
means that risk in subjects with susceptibility alleles at the 2 loci signifi- susceptibility by independent pathways, unless other genetic studies repli-
cantly exceeds the sum of the risks at each locus. This was rightly inter- cate the epistatic interaction or functional studies support the interaction.
preted to mean that the 2 loci impinge in the type 1 interferon pathway2, Similar interaction analysis for other genetic factors and in other sample
which is an important insight because TYK2 codes for a Janus kinase that collections will unravel the influence of epistatic interaction in SLE sus-
is involved in multiple cytokine signaling pathways in addition to this one4. ceptibility, but current evidence does not support an important contribu-
Also, demonstration of epistasis between 2 SLE loci is of importance tion5 (Suarez-Gestal, et al, unpublished data).
because its absence has been the rule for SLE genetic factors5 and for most
genetic factors of other complex diseases6,7. What is common is the con- MARIAN SUAREZ-GESTAL, MSc; MANUEL CALAZA, MMath;
tribution to total risk of the different disease alleles in a purely additive ANTONIO GONZALEZ, MD, PhD; European Consortium of SLE DNA
way, without any interaction. Therefore, we were interested in replicating Collections, Laboratorio de Investigacion 10 and Rheumatology Unit,
the epistatic interaction described by Hellquist, et al2 with the SLE data Hospital Clinico Universitario de Santiago, Santiago de Compostela,
available to us. Spain. Address correspondence to Dr. Gonzalez;
We had already genotyped the relevant single-nucleotide polymor- E-mail: [email protected]
phisms (SNP), rs2304256 in TYK23 and rs10954213 in IRF58, in a large
collection of patients with SLE and controls. These 2 SNP were associated REFERENCES
with SLE in our studies (p = 2.5 × 10–5 and 0.015, respectively) with risk 1. Rhodes B, Vyse TJ. The genetics of SLE: an update in the light of
alleles that were coincident to those found by Hellquist, et al (who report- genome-wide association studies. Rheumatology 2008;47:1603-11.
ed p = 10–4 and p = 0.004, respectively). We have data for the 2 SNP in 419 2. Hellquist A, Järvinen TM, Koskenmies S, Zucchelli M,
SLE subjects and 454 controls. The same type of analysis done by Orsmark-Pietras C, Berglind L, et al. Evidence for genetic
Hellquist, et al2, that is, a comparison between the fit to the data of logis- association and interaction between the TYK2 and IRF5 genes in
tic regression models with and without an interaction term, showed no dif- systemic lupus erythematosus. J Rheumatol 2009;36:1631-8.
ferences (Table 1). As a more exhaustive and sensitive test, we also con- 3. Suarez-Gestal M, Calaza M, Endreffy E, Pullmann R, Ordi-Ros
ducted analysis with the LRASSOC software9. This approach compares a J, Domenico Sebastiani G, et al. Replication of recently identified
range of specific genetic models with and without interaction and does not systemic lupus erythematosus genetic associations: a case-control
require statistical significance to discriminate between models, but only study. Arthritis Res Ther 2009;11:R69.
differences according to the less stringent Akaike’s Information Criterion 4. Minegishi Y, Saito M, Morio T, Watanabe K, Agematsu K, Tsuchiya
(AIC). The best model has the lowest AIC value, which means that it has S, et al. Human tyrosine kinase 2 deficiency reveals its requisite
the best fit to the case-control genotypes with the highest combination of roles in multiple cytokine signals involved in innate and acquired
likelihood and parsimony. These analyses indicated that the best model immunity. Immunity 2006;25:745-55.
included the independent contribution of the 2 loci without any interaction, 5. International Consortium for Systemic Lupus Erythematosus
although models with interaction terms were not much worse (Table 1). Genetics (SLEGEN), Harley JB, Alarcón-Riquelme ME, Criswell
Therefore, we did not confirm the epistatic interaction that Hellquist and LA, Jacob CO, Kimberly RP, Moser KL, et al. Genome-wide
colleagues have described. association scan in women with systemic lupus erythematosus
As a complementary analysis, we checked whether there was statistical identifies susceptibility variants in ITGAM, PXK, KIAA1542 and
evidence of interaction between TYK2 and IRF5 using other SNP in IRF5. other loci. Nat Genet 2008;40:204-10.
These SNP were rs10488631 (which in some studies10 has been replaced 6. Wellcome Trust Case Control Consortium. Genome-wide

Table 1. Lack of epistatic interaction between the SLE-associated SNP in TYK2 and IRF5.

SNP No. of Subjects Models with or without Interaction* LRASSOC Models **

TYK2 IRF5 SLE Controls Best Model p Best Model AIC to Interaction

Hellquist2 rs2304256 rs10954213 277 356 With interaction 0.014 — —

Our data3,8 rs2304256 rs10954213 419 454 No difference 0.68 Additive† 1.83
rs2304256 rs10488631 1223 1300 No difference 0.3 Additive 1.98
rs2304256 rs729302 1223 1300 No difference 0.88 Additive 0.94

* Multivariate logistic regression models with and without an interaction term were compared as in Hellquist, et al2. The models did not specify any mode
of inheritance. P values were obtained with the likelihood ratio test. ** Comparison of the specific inheritance models included in LRASSOC9. Akaike’s
Information Criterion (AIC) was used to classify the models. A value of AIC > 2 indicates a meaningful difference. † Additive: model with additive effects
of each SNP, without dominance or interactive components. SNP: single-nucleotide polymorphisms.

676 The Journal of Rheumatology 2010; 37:3

105
 Factores genéticos asociados con predisposición a LES

association study of 14,000 cases of seven common diseases and 9. North BV, Curtis D, Sham PC. Application of logistic regression to
3,000 shared controls. Nature 2007;447:661-78. case-control association studies involving two causative loci. Hum
7. Nair RP, Duffin KC, Helms C, Ding J, Stuart PE, Goldgar D, et al. Hered 2005;59:79-87.
Genome-wide scan reveals association of psoriasis with IL-23 and 10. Kozyrev SV, Lewén S, Reddy PM, Pons-Estel B, Argentine
NF-kappa-B pathways. Nat Genet 2009;41:199-204. Collaborative Group, Witte T, et al. Structural insertion/deletion
8. Ferreiro-Neira I, Calaza M, Alonso-Perez E, Marchini M, Scorza R, variation in IRF5 is associated with a risk haplotype and defines the
Sebastiani GD, et al. Opposed independent effects and epistasis in precise IRF5 isoforms expressed in systemic lupus erythematosus.
the complex association of IRF5 to SLE. Genes Immun Arthritis Rheum 2007;56:1234-41.
2007;8:429-38.
J Rheumatol 2010;37:3; doi:10.3899/jrheum.090823

Correspondence 677

106
2. Estudio funcional de PD1.3
 Procedimiento experimental y resultados

Genes and Immunity (2008), 1–7

& 2008 Nature Publishing Group All rights reserved 1466-4879/08 $30.00
www.nature.com/gene

ORIGINAL ARTICLE
Analysis of the functional relevance of a putative
regulatory SNP of PDCD1, PD1.3, associated
with systemic lupus erythematosus
M Suarez-Gestal1,4, I Ferreiros-Vidal1,4, JA Ortiz2, JJ Gomez-Reino1,3 and A Gonzalez1
1
Laboratorio de Investigacion 2 and Rheumatology Unit, Hospital Clinico Universitario de Santiago, Santiago de Compostela, Spain;
2
Instituto Bernabeu, Departamento de Biologı́a Molecular, Alicante, Spain and 3Department of Medicine, University of Santiago de
Compostela, Santiago de Compostela, Spain

This study aimed to test the functional effects of the PD1.3 single nucleotide polymorphism (SNP) (rs11568821), which were
proposed based on its association to systemic lupus erythematosus (SLE) susceptibility and in electrophoretic mobility shift
assays (EMSA) results. We analysed transcriptional effects of the PD1.3 locus by enhancer reporter assays. Results were
against the hypothesis that the PD1.3 locus acts as enhancer in transcriptional regulation of PDCD1. In addition, they excluded
a differential effect of the PD1.3 alleles. EMSA results confirmed that oligonucleotides with the PD1.3 G allele bind RUNX1 but
not those with the A allele. However, binding to PD1.3 G oligonucleotides was much lower than binding to positive control
oligonucleotides. Criss-cross experiments showed that this was due to flanking nucleotides in the PD1.3 sequence that
negatively affect RUNX1 binding. These results cast doubts on the functional relevance of the PD1.3 SNP and, together with
the lack of association in several studies, put into question its role as an SLE susceptibility factor. Investigation of other PDCD1
polymorphisms is needed to uncover the possible effect of this gene on SLE susceptibility.
Genes and Immunity advance online publication, 10 April 2008; doi:10.1038/gene.2008.19

Keywords: systemic lupus erythematosus; functional polymorphism; transcriptional regulation; transcription factor
binding site

Introduction PDCD1 gene3,6–8 or with the opposite allele of the PD1.3

single nucleotide polymorphism (SNP).9 These contra-
Investigation of the genetic component of complex dictory results could be related to an allele frequency
diseases involves both genetic epidemiology studies cline in PD1.3, which introduces a bias in association
and functional tests. Reports with convincing epidemio- studies depending on the population explored.5
logical and functional evidence are regarded as espe- As a consequence of the discordant results, it is still
cially robust. One such report by Prokunina et al.1 has unclear if genetic variation in PDCD1, either PD1.3 or
identified a regulatory polymorphism in PDCD1 intron another polymorphism, plays any role in SLE suscept-
4, called PD1.3, as a susceptibility factor for systemic ibility. This is very relevant because SLE has a clear
lupus erythematosus (SLE; [MIM] 152700). The finding genetic component, recurrence sibling ratio of 20–40, and
was supported by association in a large number of few genetic factors identified.10,11 In addition, PDCD1 is a
samples from different ethnic groups and by differential critical regulator of acquired immunity, and relevant
allele binding of AML1/RUNX1 transcription factor in genetic variants could have repercussion in other
electrophoretic mobility shift assays (EMSA). diseases.12 It has two characteristic tyrosine domains in
Association of PD1.3 with SLE has been replicated in the cytoplasmic tail: an immunoreceptor tyrosine-based
some studies.2,3 However, most posterior studies have inhibition motif and an immunoreceptor tyrosine-based
failed to replicate the PD1.3-SLE genetic association. In switch motif (ITSM). Interaction of PDCD1 with its
some studies, there was not association,4,5 in others widely expressed ligands (PD-L1 and PD-L2) leads to
association was only with specific subsets of SLE patients, tyrosine-phosphorylation of immunoreceptor tyrosine-
or association was with other polymorphisms in the based inhibition motif (ITIM) and immunoreceptor
tyrosine-based switch motif domains producing down-
Correspondence: Dr A Gonzalez, Laboratorio de Investigacion 2, regulation of B- and T-cell responses. Experimental
Hospital Clinico Universitario de Santiago, Travesia de Choupana animal models have established that PDCD1 is required
sn., Santiago de Compostela 15706, Spain. for the avoidance of autoimmunity, deficient animals
E-mails: [email protected] or showing exacerbated autoimmunity. In addition, PDCD1
[email protected]
4
These authors contributed equally to this work. signals are the cause of persistent viral infections by
Received 28 December 2007; revised 28 February 2008; accepted 28 downregulating T CD8 reactivity, these signals can also
February 2008 be involved in inefficient immune responses against

109
 Factores genéticos asociados con predisposición a LES

Functional analysis of PD1.3 PDCD1 SNP

M Suarez-Gestal et al
2
tumours and have been found to modulate atherogenesis (New Englands Biolabs, Ipswich, MA, USA) cut vector
in the LDLR knockout model.13 The involvement of was treated with Taq DNA polymerase (Roche, Sant
PDCD1 in chronic viral infections has already been Cugat del Vallés, Spain) in the presence of 2 mM of dTTP
confirmed in human diseases of great impact such as and PCR buffer to add thymine to its 30 ends. TA cloning
AIDS14 and chronic viral hepatitis.15 Therefore, if genetic was done in a 10 ml reaction containing 50 mg of the 30
variation of PDCD1 is associated with changes in PDCD1 T-vector, 25 mg of PD1.3 PCR product, 1 ml of T4 DNA
function, it could have repercussions in human health ligase (New England Biolabs) and 1  ligase buffer at
well beyond SLE. 16 1C overnight. Cloned PD1.3 fragments were subcloned
A point that has not been explored after the Prokunina into the KpnI/SmaI (upstream) or BamHI/SalI (down-
et al.1 report is the proposed regulatory role of the PD1.3 stream) sites of a fos-pGL3-basic vector. This vector
SNP. This SNP is in a region of PDCD1 intron 4 that was contains the minimal fos promoter upstream of the Firefly
described as enhancer-like due to the presence of four luciferase reporter gene. We generated eight reporter
tandem repeats that contain multiple putative binding vectors, four with each PD1.3 allele, two upstream and
sequences of transcription factors. The A allele of PD1.3 two downstream of the luciferase gene, and one of each
destroys a putative binding site of RUNX1. RUNX1 pair in a different orientation: sense and antisense
consensus binding site, TG[T/c]GGT, was described by (Figures 2 and 3). Sequence and orientation of each
Meyers et al.,16 who analysed random oligonucleotides insert was verified by sequencing.
selected for affinity to RUNX1. This binding site is
functional in multiple cellular enhancers and promoters Reporter assays
of genes implicated in hematopoiesis and immune We transfected 106 Jurkat cells in 0.8 ml of OptiMEN
system function, such as TCR, IL-3, GM-CSF, CD3e, medium (Invitrogen) with 0.8 mg of fos-pGL3luc vectors,
myeloperoxidase 1a, IL-2 and INFg.17 either without insert or with any of the eight ‘enhancer’
Herein, we aimed to fully explore the function of the inserts, and 0.2 mg of pRL-TK Renilla luciferase vector
PD1.3 SNP. As a first test we evaluated in enhancer (Promega, Madison, WI, USA) by using 2 ml of Lipofec-
reporter assays the repetitive structure in PDCD1 intron 4 tamine (Invitrogen) and 3 ml of Plus reagent (Invitrogen).
and whether there was any differential effect of the two Some wells were stimulated the following day with
PD1.3 alleles in regulating gene expression. The negative 500 ng ml1 of ionomycin and 10 ng ml1 of phorbol
results in these experiments led us to replicate EMSA. We 12-myristate 13-acetate (PMA). After 4 h, cells were
observed that RUNX1 binding to the PD1.3 G allele harvested and luciferase activity was measured using
sequence was stronger than to the A allele, but much the Firefly Luciferase Assay System and the Renilla
weaker than to positive control binding sites. These results Luciferase Assay System (both of Promega). Results of
put into question the functional relevance of this SNP. Firefly luciferase were expressed as relative luciferase
units after correction by Renilla luciferase activity to
adjust for transfection efficiency. Comparison of expres-
Materials and methods sion levels was done with the Wilcoxon matched pairs
test.
Analysis of tandem repeats and orthologuous sequences
The tandem repeats finder program integrated in the Nuclear extracts
USCS genome browser18 was used to localize repeats in For preparation of nuclear extracts, 107 Jurkat or MOLT-4
PDCD1 intron.19 The Ensembl release 46 from August cells were washed in 1 ml of 1  phosphate-buffered
200720 and the USCS genome browser were used for the saline and lysed at 4 1C for 15 min in 200 ml of a buffer
analysis of PDCD1 orthologous sequences. The Phast- containing 10 mM 4-(2-hydroxyethyl)-1-piperazineetha-
Cons program of the USCS browser was used to obtain nesulfonic acid pH 7.9, 1 mM ethylenediaminetetra acetic
an estimate of overall conservation across vertebrates acid (EDTA), 1 mM ethylene glycol bis(b-aminoethy-
and placental mammalians.21 In Ensembl, only placental lether)-N,N,N’,N’,-tetraacetic acid, 10 mM KCl, 1 mM
mammalian sequences were analysed. Sequences of the dithiothreitol, 1 mM phenylmethylsulfonyl fluoride,
region surrounding PD1.3 SNP from all species with 10 mg ml1 aprotinin and 10 mg ml1 leupeptin (all from
orthologous genes were extracted and aligned. Sigma-Aldrich, Madrid, Spain). Nuclei were incubated at
4 1C for 10 min with 0.1% of Triton-X100 and collected by
Enhancer luciferase reporter vectors centrifugation at 800  g and 4 1C for 15 min. Nuclei were
Genomic DNA from a PD1.3 heterozygous subject was lysed at 4 1C for 30 min with rotation in 200 ml of the same
used to generate 514 bp PCR fragments containing the buffer used to lyse cells plus 20% glycerol and 0.4 M KCl.
enhancer-like structure of intron 4 of PDCD1 gene with Insoluble material was precipitated by centrifugation at
the two alleles. PCR was done in 10 ml containing 30 ng 13 000 r.p.m. at 4 1C for 15 min and proteins were
of DNA, 0.1 mM of each primer (forward primer quantified by Bradford’s method.
50 -TGGAAGGACAGGCTGGGACC-30 and reverse pri-
mer 50 -AGTACCGGCACCGAACCTGG-30 ), 1.5 mM of Electrophoretic mobility shift assays
MgSO4, 200 nM of dNTPs, 1 U of Easy-A PCR cloning Double-stranded biotin-labelled oligonucleotides with
enzyme (Stratagene, La Jolla, CA, USA) and 1  reaction the PDCD1 sequence of PD1.3 and with two other
buffer (PCR Enhancer System, Invitrogen, Paisley, UK). sequences with consensus binding sites for AML1/
PCR conditions were: denaturation at 95 1C for 3 min RUNX1 (Table 1) were synthesized by Sigma-Genosys
followed by 35 cycles of denaturation at 95 1C for 15 s, (Cambridge, UK). Each double-stranded oligonucleotide
annealing at 56 1C for 15 s and extension at 72 1C for 15 s. was annealed at 37 1C for 1 h, and 0.5 nM were incubated
Amplified fragments were cloned into the EcoRV site of with Jurkat or MOLT-4 cell nuclear extracts in 20 ml of
pBluescript (pBK SK) vector by TA cloning. The EcoRV binding buffer (10 mM Tris-HCl pH 7.5, 90 mM KCl,

Genes and Immunity

110
 Procedimiento experimental y resultados

Functional analysis of PD1.3 PDCD1 SNP

M Suarez-Gestal et al
3
1.4 mM dithiothreitol, 50 ng ml1 poly(dI  dC), 0.1 mM including multiple transcription factor binding sites
EDTA y 1 mM MgCl2) for 20 min at room temperature. (TFBS).1 Analysis with the tandem repeats finder
We also tested other binding conditions1,16 to check if the program19 integrated in the UCSC genome browser
weak signals we obtained with PDCD1 oligonucleotides showed two alternative and overlapping tandem repeat
were protocol-dependent. For competition experiments, structures (Figure 1): one with four repeats of 40 bp with
unlabelled oligonucleotides were added to the nuclear an 83% identity and without insertion/deletions that
extracts at a 200-fold molar excess (0.1 mM) before the included PD1.3 in its most telomeric repeat, and a second
addition of the biotin-labelled probe. For supershift structure of two repeats of 80 bp with 90% identity and
experiments, nuclear extracts were incubated with 2 mg absence of insertion/deletions. These 80 bp repeats did
of polyclonal antiserum against the N-terminal region of not overlap completely with the four repeats of 40 bp and
AML-1 (sc-8563, Santa Cruz Biotechnology, Santa Cruz, the most telomeric of them finished just before the PD1.3
CA, USA) at room temperature for 20 min before the SNP.
addition of oligonucleotides. DNA-protein complexes As functional elements are more conserved between
were analysed by electrophoresis at 11 V cm1 and 4 1C in species than non-functional sequence regions, we tested
5% polyacrylamide gels and 0.5  TBE. Complexes were if the area containing the repeat sequences was evolu-
transferred to a nylon membrane at 12 V for 45 min, and tionary conserved. First we looked for the overall
crosslinked to the membrane at 7.2 J cm2 using a conservation of 400 bp surrounding PD1.3 and including
transilluminator. Migration of the biotinylated oligonu- the tandem repeats among vertebrates in the UCSC
cleotides and their complexes was detected by chemilu- genome browser.21 The PhastCons program provided no
minescence using the LightShift Chemiluminescence evidence of conservation across 28 vertebrate species or
Detection Module (Pierce, Rockford, IL, USA) followed across 17 placental mammalians.
by exposure of the membrane to X-ray films. In addition, we searched for PDCD1 orthologous
genes in the Ensembl genome database20 and found that
they were present in six other species of placental
Results mammalians. The PDCD1 sequence in Macaca mulatta
showed a large sequence gap including the whole 4th
Lack of conservation of the putative enhancer in PDCD1 intron and was excluded of further analysis. The other
intron 4 five genomic sequences included orthologous regions
The putative enhancer in the 4th PDCD1 intron has been both upstream and downstream of the region of interest.
proposed based on a four tandem repeat structure However, alignment of the region surrounding PD1.3
was poor or impossible for Canis familiaris and Bos torus.
Table 1 Oligonucleotides used in EMSA Of the three sequences remaining, those from Mus
musculus and Rattus norvegicus showed important lack
Symbol Gene Sequencesa of alignment in relation with the human sequence
(Figure 1). Only the genomic sequence from Pan
P12 PDCD1_PD1.3G ACCTGCGGTCTC troglodytes showed a good alignment to the PD1.3
Pm
12 AttTGCGGTtaC neighbouring sequences (T allele at the PD1.3 SNP).
P18G PDCD1_PD1.3G CCCACCTGCGGTCTCCGG
P18A PDCD1_PD1.3A CCCACCTGCAGTCTCCGG
These alignments showed that humans and chimpanzees
C1 Consensus GGATATTTGCGGTTAGCA share exactly one of the two 80 bp repeats, the most
C1m GGATAccTGCGGTctGCA telomeric, whereas the other is absent in chimpanzees.
C2 Consensus AATTCGAGTATTGTGGTTAATACG This suggests that the 80 bp repeat is the element that has
GCTCATAACACCAATTATGCTTAA been duplicated in the human genome from an original
single copy present in a primate ancestor. Therefore, the
Abbreviations: EMSA, electrophoretic mobility shift assays; SNP, putative enhancer in these repeats is a specific human
single nucleotide polymorphism. feature with a single copy antecedent in chimpanzees.
Double-stranded oligonucleotides were used with exactly comple-
mentary sequences except for C2 where the two complementary
oligonucleotides are shown. Sense and antisense oligonucleotides Gene reporter assays exploring the enhancer effect
were biotin-labelled at their 50 end. Enhancers have been defined by their effect increasing
a
Consensus hexanucleotide binding site is underlined; SNP gene transcription in a manner that is largely position-
nucleotide is in bold; modified nucleotides are in lower case. and orientation-independent. To test the function of the

Figure 1 Alignment of the tandem repeat structure near the PD1.3 SNP (encased) in PDCD1 intron 4 with ortologue mammalian genome
sequences. The plus strand is presented although the PDCD1 gene is transcribed in the minus strand (G and A alleles in place of the C and T
presented here). Spaces are adjusted to highlight tandem repeat structure: two 80 bp repeats and partly overlapping four 40 bp repeats. The
latter are indicated by alternating lower and upper case and separated by spaces. Some potential transcription factor binding sites in the
minus strand of PDCD1 have been signalled.

Genes and Immunity

111
 Factores genéticos asociados con predisposición a LES

Functional analysis of PD1.3 PDCD1 SNP

M Suarez-Gestal et al
4
putative enhancer in the repetitive sequence of PDCD1 Lack of evidence of PD1.3 allele effect on reporter gene
intron 4, we transiently transfected Jurkat T-cell lines transcription
with luciferase reporter gene constructs containing this We used the same enhancer reporter gene system to
structure. The fragment of the 4th intron that was compare the effect on gene expression of inserts contain-
cloned contained the two 80 bp repeat sequences, ing either the major G allele or the minor A allele of the
including the G allele of PD1.3 (the common allele PD1.3 SNP. Results from five experiments showed that
consistent with the RUNX1 consensus binding site) and luciferase expression was equivalent with the two PD1.3
386 nucleotides centromeric and 127 nucleotides telo- alleles, both in basal (Figure 3a) and in stimulated cells
meric to it (514 bp in total). This fragment was inserted in (Figure 3b) and with independence of the upstream or
a vector containing the Firefly luciferase gene under the downstream position of the insert in relation with the
control of a fos minimal promoter. Cloning sites were reporter gene or of its orientation.
selected to introduce the 4th intron fragment both 50 and
30 to the reporter gene and in sense and antisense Inefficient binding of RUNX1 to the PD1.3 site
orientations (Figure 2). In this way we expected to Given the lack of differential effect of the PD1.3 alleles in
detect enhancer effects and to be able to differ- reporter gene assays, we decided to replicate the EMSA
entiate them from potential artefacts. Five independent that supported the functional relevance of the PD1.3 SNP.
experiments were performed. They showed lack of An oligonucleotide of the same length as reported,1 18
increase in luciferase expression in cells transfected with nucleotides, and containing the PD1.3 G allele in a centre
any of the 4th intron containing constructs in relation position, P18G (Table 1), gave very weak signals in EMSA
with the empty fos-luc vector (Figure 2a for basal with Jurkat or MOLT-4 nuclear extracts. By increasing the
conditions and Figure 2b for post-stimulation). amount of nuclear extracts and extending exposure
There was a trend to lower expression in the cells times, we were able to replicate the specific binding
transfected with the constructs placed upstream of with the PD1.3 G allele oligonucleotide, P18G, and lack of
the fos promoter, especially after PMA þ ionomycin binding with the A allele oligonucleotide, P18A (Figure 4).
stimulation where it became significant (P ¼ 0.043). This Bound transcription factor was AML1/RUNX1 as shown
restricted downmodulation suggested a positional effect by supershift with specific antibodies (Figure 5). How-
(Figure 2b). ever, the weak signal obtained with the G allele

C fos
fos luc
luc
*

fos
G fos luc
luc
*

fos
fos luc
luc C

fos
fos luc
luc G

fos
fos luc
luc

0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14 16
RLU RLU

Figure 2 Luciferase enhancer reporter assays exploring the tandem repeat region of PDCD1 intron 4 containing the PD1.3 SNP. Vectors
containing this region in the forward or reverse orientation and upstream or downstream of a Firefly Luciferase gene (luc) under control of
a minimal fos promoter, were compared with the activity of a vector without it in Jurkat cells (a) in basal conditions or (b) after phorbol
12-myristate 13-acetate and ionomycin stimulation. These graphs represent the mean and s.e. of five independent experiments. *Po0.05.

@ fos
fos luc

@ fos luc

fos
fos luc @

fos
fos luc @
@

0.6 0.8 1.0 1.2 1.4 1.6 1.8 2.0 2.2 2.4 0.4 0.7 1.0 1.3 1.6 1.9 2.2 2.5 2.8

Ratio allele A / allele G Ratio allele A / allele G

Figure 3 Lack of difference between the G and A allele at the PD1.3 SNP of PDCD1 in luciferase enhancer reporter assays. The two PD1.3
alleles were compared in transiently transfected Jurkat cells: (a) in basal conditions and (b) after phorbol 12-myristate 13-acetate and
ionomycin stimulation. Vectors were as in Figure 2 but either with the G or with the A allele at PD1.3 (their position represented by @).
Results are geometric means and 95% confidence interval of the ratio between luciferase signal in cells transfected with the A allele and cells
transfected with the G allele in homologous vectors. Five independent experiments were analysed.

Genes and Immunity

112
 Procedimiento experimental y resultados

Functional analysis of PD1.3 PDCD1 SNP

M Suarez-Gestal et al
5

Figure 4 Specific but weak binding of Jukat nuclear extracts to an

18 bp oligonucleotide containing the PD1.3 G allele, P18G (lanes 3–6).
No binding was observed with the PD1.3 A allele oligonucleotide Figure 6 Effect of nucleotides flanking the RUNX1 consensus
P18A (lanes 7–10). Specificity of P18G binding was shown by binding hexanucleotide. Electrophoretic mobility shift assays
competition with unlabelled P18G (lane 6). A control 18 bp comparing binding of unmodified control oligonucleotide C1 to
oligonucleotide, C1, with the same RUNX1 consensus binding binding to a C1 modified oligonucleotide, Cm 1 that contains the four

hexanucleotide showed much stronger binding at the same nuclear nucleotides, two on each side, flanking the central hexanucleotide
extract concentration (lane 1 versus 3). The need to use large from the PD1.3 site. It also compares binding to a PD1.3
amounts of nuclear extracts and long exposure times to visualize oligonucleotide, P12, and its modified version, Pm 12 containing the

P18G binding led to increased background and unspecific bands, and four flanking nucleotides from C1. Binding was much lower to Cm 1

to saturation of the stronger bands that prevented quantitative (lane 4) than to C1 (lane 1), and much stronger to Pm
12 (lane 8) than P12

comparisons. (lane 7) showing the important role of flanking nucleotides. DNA-

protein complexes were specific, as shown by competition with
unlabelled oligonucleotides (lanes 2, 5 and 9), and the protein was
identified as RUNX1 by supershift with a specific antibody (lanes 3,
6 and 10).

(TGTGGT).16 The two control oligonucleotides produced

much stronger signals than the P18G sequence (results of
C2 binding are not shown). This difference was observed
with Jurkat and MOLT-4 nuclear extracts and both with
extracts obtained in basal conditions or after stimulation
with PMA þ ionomycin (not shown). The low binding of
the P18G oligonucleotide was independent of the techni-
que, as was observed with three different binding
protocols (not shown). We quantified the difference in
signal by serial dilution of nuclear extracts and densito-
metry reading (Figure 5). Direct comparison between
P18G and C1 oligonucleotides showed, in different
experiments, a 300- to 4000-fold lower intensity of
DNA complexes with the P18G oligonucleotide.
These results provoked us to review the reports
Figure 5 Comparison of RUNX1 binding to the intron 4 PDCD1 defining the AML1/RUNX1 binding site. It was appar-
oligonucleotide P18G with binding to the control oligonucleotide C1. ent that nucleotides flanking the central hexanucleotide
These two oligonucleotides share the same RUNX1 consensus could be important. We tested this hypothesis by
hexanucleotide. Competition with unlabelled oligonucleotides (lanes designing modified oligonucleotides exchanging the four
4 and 9) showed the specificity of binding and supershift with
anti-AML1 antibody identified the bound factor (lanes 5 and 10).
flanking nucleotides, two at each side of the hexanucleo-
Differences in binding signals varied between 300- and 4000-fold. tide, between the RUNX1 binding site in C1 and the
putative site around PD1.3 (Table 1). According to our
hypothesis, the modified control, C1m oligonucleotide,
showed much weaker RUNX1 binding than the original
C1 oligonucleotide (Figure 6). On the contrary, the
oligonucleotide P18G prompted us to compare this signal modified PD1.3 oligonucleotide, Pm 12 showed a clear
to the obtained with sequences known to be functional binding signal, whereas no binding was ever detected
RUNX1 binding sites. We selected two (Table 1), C1 with with the P12 oligonucleotide (Figure 6). Binding to C1, Cm
1
the same hexanucleotide sequence in the consensus and Pm12 were shown to be due to RUNX1 by supershift
binding site (TGCGGT) as PD1.3 allele G and also of 18 after antibody incubation (Figure 6). Therefore, the
nucleotides.22 A second oligonucleotide, C2, defined in PDCD1 sequence surrounding PD1.3 bound RUNX1
the study of the RUNX1 consensus binding site, includes very inefficiently due to the nucleotides flanking the
an hexanucleotide sequence that differs in the third base described hexanucleotide consensus site.

Genes and Immunity

113
 Factores genéticos asociados con predisposición a LES

Functional analysis of PD1.3 PDCD1 SNP

M Suarez-Gestal et al
6
Discussion intron 4th inserted upstream to the reporter gene. This
could be caused by unspecific interference with the
Identification of genetic variation in regulatory elements minimal promoter but not to an enhancer effect because
of the PDCD1 gene is of great interest given the critical enhancers are largely independent of position and
role of this immunoregulatory receptor in multiple orientation. More important for the hypothesis being
diseases.1,12,14,15 In some of them, PDCD1 downregula- tested was the lack of difference in reporter gene
tion of immune reactions is defective, as in autoimmu- expression when the two PD1.3 alleles were compared.
nity and, possibly, in atherosclerosis,13 whereas in others These negative results prompted us to re-evaluate the
it is inappropriately strong, as in chronic viral infections. differential binding of the PD1.3 alleles to RUNX1 in
The hypothesis of an enhancer in the 4th intron of the EMSA. We replicated the preferential binding of the G
gene that bears a regulatory polymorphism deserves, allele but it was of much lower intensity than positive
therefore, to be tested. control oligonucleotides. This difference was explained
Analysis of the sequence by bioinformatic means can by the lack of optimal flanking nucleotides in the PDCD1
only provide suggestive information. The enrichment in sequence as demonstrated by criss-cross experiments.
several TFBS related with immune function has been Inefficient binding of RUNX1 to the PD1.3 sequence
taken as supportive of the proposed enhancer.1 However, was overlooked by the TFBS searching softwares that
bioinformatic identification of TFBS has low predictive only consider the central hexanucleotide TG[T/c]GGT.
value. This is due to the lack of knowledge of the factors However, Thornell et al.30 had already seen evidence that
in the DNA sequence that influence TF binding to DNA other nucleotides around the consensus sequence could
and to the effect of chromatin modifications independent interfere in RUNX1 binding to DNA. They suggested a
from the DNA sequence (as DNA methylation, nucleo- decamer TTTGCGGTTA/T as the consensus binding site.
some position and histone modifications). In addition, This is the same sequence present in the two oligonu-
TFBS are predicted on the basis of studies of very few cleotides with which we observed higher binding in our
validated sequences and the defined consensus oligonu- assays.
cleotides and nucleotide matrices often are very short, Our findings are of special relevance in the analysis of
that is, hexanucleotides, and allow for substitutions at the role of genetic variation of PDCD1 in human disease.
more than one place. These characteristics determine a The PD1.3 SNP has had a dominant role in the genetic
low specificity in the identification of TFBS.23 For epidemiology studies of PDCD1 because it was found
example, we searched for binding sites for RUNX1 over associated to SLE in a very impressive association study
the PDCD1 gene in TRANSFAC Professional/Match and because it was supposed to be functional.1 However,
(Biobase Biological Databases) and found 70, only 11 in most subsequent reports have not found the reported
the 4th intron. genetic association and an explanation of these dis-
Tanscription factor binding site prediction will im- cordant results, at least among Europeans, has been
prove in the next few years thanks to more complex proposed5 (Asian populations are not polymorphic at
bioinformatic tools and to a better knowledge of this SNP31). Now, the proposed functional effects of
functional TFBS.24 For example, whole genome studies PD1.3 are also questioned by our results. It is still
with chromatin immunoprecipitation have allowed a possible that this SNP could be functional in ways that
better definition of consensus binding sites that have a we have not explored, but available information does not
much stronger predictive value.25,26 Often these consen- allow predicting any such effect. A recent presentation in
sus sequences are much larger than the previously a meeting showed correlation between PD1.3 alleles and
described or include influence from neighbouring PDCD1 expression in peripheral blood cells.32 However,
nucleotides. Unfortunately, there are only a few of these this study was done in samples from Iceland and
studies and they do not include RUNX1. Sweden, population showing the clearest association
The presence of tandem repeats of several decenes of between the SNP and SLE susceptibility. This could
nucleotides has been observed as part of some complex reflect a specific pattern of linkage disequilibrium more
regulatory units, including several enhancers.27–29 Some than a specific effect of the SNP.
of them are polymorphic and affect transcriptional In conclusion, our results question the proposed
regulation, but in all the described examples the regulatory function of the PD1.3 SNP and should be an
functional polymorphism affects the number of copies incentive to search for other PDCD1 polymorphisms that
of the repeat. It is less likely that an SNP affecting a single could affect disease susceptibility. This is an important
TFBS in a repeated structure will have functional aim as PDCD1 seems to be involved in many different
consequences, as it will be compensated by the same diseases and there are several pieces of evidence that
TF bound to the other repeats. indicate that genetic variation in PDCD1 is associated
Another factor that is possible to analyse is sequence with susceptibility to some of them.
conservation. Functional sequences are conserved
through evolution more often than neutral sequences.21
Neither the tandem repeats nor the PD1.3 sequence were
found to be conserved even among mammals. However, Acknowledgements
this does not contradict functional relevance as only a
fraction of the functional elements are conserved. We thank Samuel Seoane-Ruzo (University of Santiago)
Experimental testing of PDCD1 intron 4th structures in for help with luciferase assays and Miguel A Iñiguez-
a classical enhancer reporter assay showed no evidence Peña (Centro de Biologia Molecular, Madrid) for provid-
of an enhancer effect on the expression of the luciferase ing us with a working protocol for Jurkat cell transfec-
gene. There was only a slight but significant decrease in tion. This work was supported by two Grants, PI04/1615
expression after stimulation in the constructs with the and PI06/0620, from the Instituto de Salud Carlos III

Genes and Immunity

114
 Procedimiento experimental y resultados

Functional analysis of PD1.3 PDCD1 SNP

M Suarez-Gestal et al
7
(ISCIII, Spanish Health Ministry), which included funds associated with T-cell exhaustion and disease progression.
from the FEDER programme of the European Union. Nature 2006; 443: 350–354.
MAS-G is the recipient of a pre-doctoral bursary from the 15 Urbani S, Amadei B, Tola D, Massari M, Schivazappa S,
Spanish Ministry of Education and Culture. IF-V is the Missale G et al. PD-1 expression in acute hepatitis C virus
recipient of an ISCIII pre-doctoral bursary. AG has been (HCV) infection is associated with HCV-specific CD8 exhaus-
the recipient of a Research contract from the ISCIII. tion. J Virol 2006; 80: 11398–11403.
16 Meyers S, Downing JR, Hiebert SW. Identification of AML-1
and the (8;21) translocation protein (AML-1/ETO) as se-
quence-specific DNA-binding proteins: the runt homology
References domain is required for DNA binding and protein-protein
interactions. Mol Cell Biol 1993; 13: 6336–6345.
1 Prokunina L, Castillejo-Lopez C, Oberg F, Gunnarsson I, Berg 17 Otto F, Lubbert M, Stock M. Upstream and downstream
L, Magnusson V et al. A regulatory polymorphism in PDCD1 targets of RUNX proteins. J Cell Biochem 2003; 89: 9–18.
is associated with susceptibility to systemic lupus erythema- 18 Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH,
tosus in humans. Nat Genet 2002; 32: 666–669. Zahler AM et al. The human genome browser at UCSC.
2 Velazquez-Cruz R, Orozco L, Espinosa-Rosales F, Carreno- Genome Res 2002; 12: 996–1006.
Manjarrez R, Solis-Vallejo E, Lopez-Lara ND et al. Association 19 Benson G. Tandem repeats finder: a program to analyze DNA
of PDCD1 polymorphisms with childhood-onset systemic sequences. Nucleic Acids Res 1999; 27: 573–580.
lupus erythematosus. Eur J Hum Genet 2007; 15: 336–341. 20 Hubbard TJ, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y
3 Thorburn CM, Prokunina-Olsson L, Sterba KA, Lum RF, et al. Ensembl 2007. Nucleic Acids Res 2007; 35: D610–D617.
Seldin MF, Alarcon-Riquelme ME et al. Association of PDCD1 21 Miller W, Rosenbloom K, Hardison RC, Hou M, Taylor J,
genetic variation with risk and clinical manifestations of Raney B et al. 28-Way vertebrate alignment and conservation
systemic lupus erythematosus in a multiethnic cohort. Genes track in the UCSC Genome Browser. Genome Res 2007; 17:
Immun 2007; 8: 279–287. 1797–1808.
4 Sigurdsson S, Nordmark G, Goring HH, Lindroos K, Wiman 22 Puig-Kroger A, Lopez-Rodriguez C, Relloso M, Sanchez-
AC, Sturfelt G et al. Polymorphisms in the tyrosine kinase 2 and Elsner T, Nueda A, Munoz E et al. Polyomavirus enhancer-
interferon regulatory factor 5 genes are associated with systemic binding protein 2/core binding factor/acute myeloid
lupus erythematosus. Am J Hum Genet 2005; 76: 528–537. leukemia factors contribute to the cell type-specific activity
5 Ferreiros-Vidal I, D’Alfonso S, Papasteriades C, Skopouli FN, of the CD11a integrin gene promoter. J Biol Chem 2000; 275:
Marchini M, Scorza R et al. Bias in association studies of 28507–28512.
systemic lupus erythematosus susceptibility due to geogra- 23 Rahmann S, Muller T, Vingron M. On the power of profiles for
phical variation in the frequency of a programmed cell death 1 transcription factor binding site detection. Stat Appl Genet Mol
polymorphism across Europe. Genes Immun 2007; 8: 138–146. Biol 2003; 2: Article7.
6 Nielsen C, Laustrup H, Voss A, Junker P, Husby S, Lillevang 24 Collas P, Dahl JA. Chop it, ChIP it, check it: the current
ST et al. A putative regulatory polymorphism in PD-1 is status of chromatin immunoprecipitation. Front Biosci 2008; 13:
associated with nephropathy in a population-based cohort 929–943.
of systemic lupus erythematosus patients. Lupus 2004; 13: 25 Hollenhorst PC, Shah AA, Hopkins C, Graves BJ. Genome-
510–516. wide analyses reveal properties of redundant and specific
7 Sanghera DK, Manzi S, Bontempo F, Nestlerode C, Kamboh promoter occupancy within the ETS gene family. Genes Dev
MI. Role of an intronic polymorphism in the PDCD1 gene 2007; 21: 1882–1894.
with the risk of sporadic systemic lupus erythematosus and 26 Yochum GS, McWeeney S, Rajaraman V, Cleland R, Peters S,
the occurrence of antiphospholipid antibodies. Hum Genet Goodman RH et al. Serial analysis of chromatin occupancy
2004; 115: 393–398. identifies beta-catenin target genes in colorectal carcinoma
8 Johansson M, Arlestig L, Moller B, Rantapaa-Dahlqvist S. cells. Proc Natl Acad Sci USA 2007; 104: 3324–3329.
Association of a PDCD1 polymorphism with renal manifesta- 27 MacKenzie A, Quinn J. A serotonin transporter gene intron 2
tions in systemic lupus erythematosus. Arthritis Rheum 2005; polymorphic region, correlated with affective disorders, has
52: 1665–1669. allele-dependent differential enhancer-like properties in the
9 Ferreiros-Vidal I, Gomez-Reino JJ, Barros F, Carracedo A, mouse embryo. Proc Natl Acad Sci USA 1999; 96: 15251–15255.
Carreira P, Gonzalez-Escribano F et al. Association of PDCD1 28 Giambra V, Fruscalzo A, Giufre’ M, Martinez-Labarga C,
with susceptibility to systemic lupus erythematosus: evidence Favaro M, Rocchi M et al. Evolution of human IgH30 EC
of population-specific effects. Arthritis Rheum 2004; 50: duplicated structures: both enhancers HS1,2 are polymorphic
2590–2597. with variation of transcription factor’s consensus sites. Gene
10 Ferreiro-Neira I, Calaza M, Alonso-Perez E, Marchini M, 2005; 346: 105–114.
Scorza R, Sebastiani GD et al. Opposed independent effects 29 Bellizzi D, Rose G, Cavalcante P, Covello G, Dato S, De Rango
and epistasis in the complex association of IRF5 to SLE. Genes F et al. A novel VNTR enhancer within the SIRT3 gene, a
Immun 2007; 8: 429–439. human homologue of SIR2, is associated with survival at
11 Nath SK, Kilpatrick J, Harley JB. Genetics of human systemic oldest ages. Genomics 2005; 85: 258–263.
lupus erythematosus: the emerging picture. Curr Opin 30 Thornell A, Hallberg B, Grundstrom T. Binding of SL3-3
Immunol 2004; 16: 794–800. enhancer factor 1 transcriptional activators to viral and
12 Keir ME, Francisco LM, Sharpe AH. PD-1 and its ligands in chromosomal enhancer sequences. J Virol 1991; 65: 42–50.
T-cell immunity. Curr Opin Immunol 2007; 19: 309–314. 31 Mori M, Yamada R, Kobayashi K, Kawaida R, Yamamoto K.
13 Gotsman I, Grabie N, Dacosta R, Sukhova G, Sharpe A, Ethnic differences in allele frequency of autoimmune-disease-
Lichtman AH et al. Proatherogenic immune responses are associated SNPs. J Hum Genet 2005; 50: 264–266.
regulated by the PD-1/PD-L pathway in mice. J Clin Invest 32 Kristjansdottir H, Steinsson K, Gunnarsson I, Thorsteinsdottir
2007; 117: 2974–2982. T, Alarcon-Riquelme ME. Lower Expression Levels of the PD1
14 Day CL, Kaufmann DE, Kiepiela P, Brown JA, Moodley ES, Immunoreceptor in SLE Patients and Lower Frequency of
Reddy S et al. PD-1 expression on HIV-specific T cells is CD25+ CD4 T-cells. Arthritis Rheum 2007; 56: S746 (Abs. 1952).

Genes and Immunity

115
3. Influencia del componente genético en la
variabilidad clínica del LES
 Procedimiento experimental y resultados

Weak association of Systemic Lupus Erythematosus clinical features

with susceptibility alleles: a case-only study

Marian Suarez-Gestal1, Manuel Calaza1, Myriam Liz1, Josep Ordi-Ros2, Eva Balada2,
Marc Bijl3, Cees G Kallenberg3, Chryssa Papasteriades4, Iris Kappou-Rigatou4, Patricia
Carreira5, Fotini N. Skopouli6, Maria Mavromati6, Reinhold E. Schmidt7, Torsten
Witte7, Emöke Endreffy8, Attila Kovacs9, Maurizio Marchini10, Raffaella Scorza10,
Sergio Migliaresi11, Gian Domenico Sebastiani12, Maria Jose Santos13, Filipe Vinagre13,
Ana Suarez14, Carmen Gutierrez14, Ignacio Rego15, Francisco J Blanco15, Nadia
Barizzone16, Sandra D’Alfonso16, Rudolf Pullmann Jr17, Rudolf Pullmann18, Sarka
Ruzickova19, Ctibor Dostal20, Juan J Gomez-Reino1,21 and Antonio Gonzalez1

1
Laboratorio de Investigacion 10 and Rheumatology Unit, Instituto de Investigacion
Sanitaria - Hospital Clinico Universitario de Santiago, Santiago de Compostela, 15706
Spain. [email protected]; [email protected]; [email protected]
2
Internal Medicine, Research Laboratory in Autoimmune Diseases, Hospital Vall
d'Hebron, 08035 Barcelona, Spain. [email protected]; [email protected]
3
Department of Rheumatology and Clinical Immunology, University Medical Center
Groningen, 9713 Groningen, The Netherlands. [email protected];
[email protected]
4
Department of Histocompatibility and Immunology, Evangelismos Hospital, 10676
Athens, Greece. [email protected]; [email protected]
5
Rheumatology Department, Hospital 12 de Octubre, 28041 Madrid, Spain.
[email protected]
6
Pathophysiology Department, Athens University Medical School, Athens 115 27,
Greece. [email protected]; [email protected]
7
Division of Clinical Immunology, Department of Internal Medicine of the Hannover
Medical School, D-30625 Hannover, Germany. [email protected];
[email protected]
8
Paediatrics Department, Albert Szent-Györgyi Medical and Pharmaceutical Centre,
University of Szeged, 6721 Hungary. [email protected]
9
Department of Rheumatology, Hospital of Hungarian Railways, H-5000 Szolnok,
Hungary. [email protected]

119
Factores genéticos asociados con predisposición a LES

10
Clinical Immunology, University of Milan and Fondazione IRCCS Ospedale
Maggiore Policlinico, Mangiagalli e Regina Elena, 20122 Milan, Italy.
[email protected]; [email protected]
11
Rheumatology Unit, Second University of Naples, 81100 Naples, Italy.
[email protected]
12
UOC Reumatologia, Azienda Ospedaliera San Camillo-Forlanini, Roma, Italy.
[email protected]
13
Rheumatology Department, Hospital Garcia de Orta and Rheumatology Research
Unit, Instituto Medicina Molecular, Lisboa, Portugal. [email protected];
[email protected]
14
Department of Functional Biology, Hospital Universitario Central de Asturias,
Universidad de Oviedo, Oviedo 33006, Spain. [email protected]; [email protected]
15
INIBIC-CH Universitario A Coruña, 15006 A Coruña, Spain. [email protected];
[email protected]
16
Dept Medical Sciences and IRCAD , Eastern Piedmont University, 28100 Novara,
Italy. [email protected]; [email protected]
17
GBMC Hospital, Department of Medicine, Baltimore, MD 21209, USA.
[email protected]
18
Institute of Clinical Biochemistry, Martin Faculty Hospital, Jessenius Medical
Faculty, Kollárova 2, 036 59 Martin, Slovakia. [email protected]
19
Institute of Biotechnology, Academy of Sciences of the Czech Republic, Prague,
Czech Republic. [email protected]
20
Molecular Biology and Immunogenetics Dept, Institute of Rheumatology, 128 50
Prague 2, Czech Republic. [email protected]
21
Department of Medicine, University of Santiago de Compostela, Santiago de
Compostela, 15706 Spain. [email protected]

Corresponding author:
Antonio Gonzalez
Laboratorio de Investigacion 10
Hospital Clinico Universitario de Santiago
Travesia de Choupana sn.
15706-Santiago de Compostela
Spain

120
 Procedimiento experimental y resultados

Tfn: 34 981 950 903

Fax: 34 981 951 068
[email protected]
[email protected]

121
Factores genéticos asociados con predisposición a LES

ABSTRACT
Introduction: To analyze if nine newly identified SLE susceptibility loci were

influencing the presence of some of the best defined SLE clinical features.

Methods: We compared the genotypes of a representative SNP in each of nine SLE-

associated loci, in ITGAM, STAT4, C8orf13-BLK, IRAK1-MECP2, BANK1, TYK2,

KIAA1542, PXK and 1q25.1, between patients with and without each of 11 clinical

features: ten of the ACR classification criteria (except ANAs) and age of disease onset.

Data of 1561 patients were used.

Results: The most consistent and significant result was the association of the rare allele

of rs13277113 in the C8orf13-BLK locus with increased risk of nephritis (O.R. = 1.35, P

= 0.00026). The reported association of STAT4 with early age of disease onset was

replicated. Not so the other described associations of this locus, but joint analysis of a

previous report with our data lent further support to association of STAT4 with oral

ulcers and immunologic disorder. Combined analysis of ITGAM data from a recent

report and our study showed more doubtful association of this locus with immunologic

disorder, nephritis and discoid rash, although our study, separately, did not replicate

these associations. Some other results were suggestive of the presence of additional

phenotype-genotype associations, but they were not significant after correction for the

number of tests.

Conclusions: Our results together with previous studies indicate that clinical variability

of SLE is influenced by the SLE susceptibility alleles. However, the effects are weak

and difficult to reproduce indicating the need of phenotype-specific genetic studies.

122
 Procedimiento experimental y resultados

INTRODUCTION

Systemic Lupus Erythematosus (SLE; OMIM 152700) is a complex disease with

heterogeneous clinical manifestations and a genetic component that begins to be

understood [1]. Clinical heterogeneity complicates its diagnosis, treatment and research

[2]. We do not have yet clear clues about the causes of this variability, but likely

contributing elements are stochastic factors and differences in the environmental

exposures or in the genetic constitution. Understanding the relationships between these

factors and the SLE features will help elucidate disease mechanisms and could provide

the basis for a classification of patients in more homogeneous subgroups.

Many associations between genetic polymorphisms and the presence of specific

SLE clinical features have been reported, but they have not yet reached a high degree of

confidence [3-6]. This is similar to what had happened in relation to SLE susceptibility

until 2008: although there were many reports of association there were few genetic

factors that had been consistently demonstrated. The advent of Genome Wide

Association (GWA) studies in 2008 and other large studies, with their increased sample

sizes and stricter standards, changed dramatically this panorama. Now, there are more

than ten new loci that are consistently associated with SLE susceptibility [7-8]. These

loci are prime candidates for having a predisposing effect for specific SLE clinical

features. The first analyses seem to indicate that this is the case for some of them [9-11].

Herein, we have analyzed the association of nine of these consistent SLE susceptibility

loci (ITGAM, STAT4, C8orf13-BLK, IRAK1-MECP2, BANK1, TYK2, KIAA1542, PXK

and 1q25.1) with some clinical features in more than 1500 patients. Some significant

associations were found and some of the previously described received some additional

support, but the observed effects were weak and will need further confirmation.

123
Factores genéticos asociados con predisposición a LES

MATERIAL AND METHODS

Sample and data collection: Recruiting of DNA samples from SLE patients has been

already described [12]. Briefly, 16 recruiting centres from 9 European countries were

asked for about 100 SLE patients and controls of uniform Caucasian ethnicity. A total

of 1561 patients were obtained (18 patients included in a previous study[12] were

excluded after reviewing their clinical data). All SLE patients met the revised American

College of Rheumatology classification criteria [13], and gave written informed

consent. Sample collection was approved by the respective ethical committees. Clinical

characteristics of the patients were obtained at the same time. They included the ACR

classification criteria, gender, age of disease onset, and time of follow-up.

Genotypes: Genotypes for the SLE-associated SNPs in ITGAM, STAT4, C8orf13-BLK,

IRAK1-MECP2, BANK1, TYK2, KIAA1542, PXK and 1q25.1 loci have been already

described [12].

Association analysis: We compared SNP allele frequencies between cases positive and

negative for each of the ACR classification criteria (except presence of ANA given that

they were almost constant) and age of disease onset by logistic regression following a

genetic additive model with codes 2 for aa genotypes, 1 for aA genotypes and 0 for the

AA genotypes. Patient gender was included as covariate. Age of disease onset was

included in these analysis after separating patients in two groups < or ≥ 30 years old at

disease onset. Results at this stage with P < 0.05 were analyzed in patients stratified by

gender. Bonferroni correction for multiple tests was done considering the number of

analyzed clinical features. Statistical analyses were done in a customized version of the

Statistica 7.0 program (StatSoft, Tulsa, OK, USA). Power to detect association was

estimated with the “Power and sample size” software [14]. Combination of the current

124
 Procedimiento experimental y resultados

results with previous studies was done with fixed-effect and with random-effect

metaanalyses as implemented in the R project (http://www.r-project.org/).

RESULTS

Characteristics of the patient collection

The genotypes of strongly associated SNPs in 9 confirmed SLE susceptibility

loci were available for 1561 European patients with SLE and for 1728 healthy controls

(Table 1). Information about ACR classification criteria, gender, age of disease onset,

and time of follow-up was also available for most of these patients (Table 2).

Case-only analysis of the association with SLE clinical features

Seven associations between genotypes and clinical features were detected below

P = 0.05 in the comparison between positive and negative patients (Table 3). Only two

of them were below P = 0.01. The two involved nephritis that was associated with the

SLE risk allele at the C8orf13-BLK locus and with the IRAK1-MECP2 risk allele. The

other five associations were just below the 0.05 threshold. One of the weak associations

replicates a previous finding: the association of the risk allele of the STAT4 SNP with

younger disease onset [9]. However, we did not replicate the described associations of

the STAT4 SNP with nephritis, immunologic disorder or oral ulcers (although there was

a trend in the same direction for the latter) [9-10]. Other weak association was observed

between the ITGAM risk allele and a younger age of disease onset, but we did not

replicate other reported associations with this SLE risk allele [11]. We also found weak

association of renal disorder with the risk allele in BANK1 and of oral ulcers with this

same allele and the risk PXK allele (Table 3). However, only the association of nephritis

with the C8orf13-BLK SNP remained significant after correcting by the number of tests.

125
Factores genéticos asociados con predisposición a LES

Analyses of patients stratified by gender was done only for the SNPs showing P

< 0.05 in global analyses (Table 4). The smallest stratum included the 151 men with

SLE in our collection, what allowed for a very limited statistical power. This limitation

was considered for interpretation by focusing in effect sizes more than in P values. In

contrast, the largest stratum was made of 1393 women with SLE, and therefore similar

to the global study sample. The effect size of five of the associations was similar or

stronger in males than in females and concordant in direction. These associations

included the two stronger, renal disorder with the risk alleles of C8orf13-BLK and of

IRAK1-MECP2. The other two significant associations in the global analysis, renal

disorder with BANK1 and oral ulcers with PXK, were restricted to women in the

stratified analysis (Table 3).

Joint analysis with previous data

We combined our results with the available in previous reports. There were few

articles and only in three of them data were reported as to permit case-only analyses,

comparing patients with and without the clinical feature. Each of these three articles

provided data on one of the loci included in our analyses, C8orf13-BLK, STAT4 and

ITGAM [9, 11, 15]. There was an additional study analyzing SLE clinical features in

relation with the ITGAM locus but with a different SNP [15]. The other published

studies did not provide enough information to combine effect sizes, as a second one

about STAT4 [10], or the studies on BANK1 [16], and TYK2 [17]; or there was not any

report, as for the remaining loci.

The clearest association in our study, that of rs13277113 in C8orf13-BLK with

renal disorder, was opposed to the results of a GWAS that included clinical data on 781

patients [15]. The marked contrast between the two studies leaves this association as

uncertain at this time (Table 5). On the contrary, the results for the STAT4 locus were

126
 Procedimiento experimental y resultados

quite similar between the two available studies. The associations between young age of

disease onset, oral ulcers or immunologic disorder and rs7574865 were concordant and,

consequently, they became reinforced in the combined analysis with about 2700

patients (Table 5). Only the association that was previously observed between

rs7574865 and renal disorder did not receive any additional support, and it became non-

significant (P = 0.14) in the combined analysis. Finally, less conclusive results were

obtained with the joint analysis on the ITGAM locus. The direction of change for the

three analyzed criteria was the same in the two studies, but results from Kim-Howard et

al. showed stronger differences than ours. The differences in effects for renal disorder

and discoid rash were such as to cause conflicting results between the fixed-effects and

random-effects metaanalyses. There were significant associations with the fixed-effects

analysis and lack of them with the more conservative random-effects approach.

Immunologic disorder was associated with P = 0.04 with both approaches.

DISCUSSION

There are several obstacles for the identification of loci preferentially associated

with particular SLE phenotypes that make their investigation more difficult than the

study of disease susceptibility. Firstly, the statistical power of the available collections

becomes greatly reduced in subgroup analyses. Lack of power will lead to false negative

results. In addition, the performance of many comparisons increases the risk of false

positives and the subsequent lack of reproducibility. A solution to this problem will be

to require stringent significant thresholds for claiming association, but this measure will

lead to even more false negative results. Another limitation is the variability of the

clinical data, because sample collections show marked differences in the prevalence of

the different SLE manifestations [9, 15, 18-23]. These differences have many possible

127
Factores genéticos asociados con predisposición a LES

causes, but if they are due to biases unrelated with the disease process they will be a

source of spurious associations [24]. Consideration of these obstacles and the

recommendations for subgroup analysis in clinical trials [25-27], have determined the

design of our study. We have followed a fixed sequence approach, which requires a

significant difference in the more general group before starting analysis in a subgroup;

we have also corrected for the number of tests done, took into consideration previous

reports concerning the same comparisons, and take into account the power of the

analyses for interpretation.

According to the fixed sequence approach, we selected nine loci that are

convincingly associated to SLE susceptibility and that have shown association in our

collection of samples [7-8, 12]. This procedure does not exclude that some gene variants

could predispose to a particular SLE clinical phenotype without increasing appreciably

susceptibility to SLE overall. This has been already reported for the FCGR3A V158F

SNP that is associated with lupus nephritis, but not convincingly with SLE

susceptibility in patients without nephritis [5].

The clearest associations in our study were with renal disorder. Association

between lupus nephritis and the SLE risk allele of the rs13277113 SNP in the C8orf13-

BLK locus remained significant after correcting for the number of tests, and was

consistently observed in women and men. The same SNP has already been analyzed for

association with SLE classification criteria in a previous GWAS [15], but no association

with renal disorder was found in any of the two series of patients analyzed in that study.

In addition, the direction of change in one of the series, which was reported in more

detail, was opposed to the observed by us (Table 5). Prevalence of renal disorder in that

study was lower (28.0 %) than in our collection of samples (41.0 %) and this difference

(P = 2.0 x 10-12) could contribute to the discordant results. The C8orf13-BLK locus is

10

128
 Procedimiento experimental y resultados

reproducibly associated with SLE susceptibility [12, 15, 28], and probably with RA [29-

30], and Systemic Sclerosis [31]. The SNP that we have analyzed is the most studied

and seems to be the most associated with SLE susceptibility. It correlates with changes

in expression of the two flanking genes, C8orf13 and BLK, with an increase of C8orf13

and a decrease of BLK [15]. BLK is the best understood of the two, and it is a good

candidate because it codes for a B-cell specific tyrosine kinase that is involved in

maturation of B cells and in BCR signalling [32-33]. A second association of lupus

nephritis in our study was less clear. The SLE risk allele of rs17435 in the IRAK1-

MECP2 locus was associated with increased risk of nephritis both in women and men.

However, the association did not remain significant after correction by the number of

tests done. Therefore, we consider these two associations of renal disorder as unproven

until other studies provide additional evidence.

The rs7574865 SNP in STAT4 has been associated with a severe SLE phenotype

defined by nephritis, age at diagnosis < 30 years old, immunologic disorder (and,

specifically, double-stranded DNA autoantibodies) and absence of oral ulcers [9]. The

association with immunologic disorder (and anti-dsDNA) and a modest increase in

nephritis prevalence was also reported in other study with 695 patients [10]. However,

no effect on age of disease onset or oral ulcers was detected in this second study. Our

results showed only a weak association with younger disease onset that was consistent

in women and men. We also found a trend to decreased prevalence of oral ulcers, but it

was only observed in women (data not shown). No association with nephritis or

immunologic disorder was present in our data. Overall, the results confirm that

rs7574865 SNP in the STAT4 locus is associated with a particular SLE phenotype

whose details are still incompletely defined, but that very likely include immunologic

disorder (same trend in the three studies), specially the presence of anti-dsDNA

11

129
Factores genéticos asociados con predisposición a LES

antibodies, which was a clear association in the two previous studies and was not

available to us; a younger age of disease onset, for which there was weak association in

two studies and a non-significant trend in the third [10]. It is also probable that this

phenotype will include also renal disorder and lack of oral ulcers because two of the

three studies were concordant for these two associations.

We also found association of rs1143679, which is a likely causal non-

synonymous SNP in ITGAM, with a younger age of disease onset. This characteristic of

SLE has not been analyzed in previous studies [11, 15], and the association did not

remain significant after correction by the number of tests, which make this association

of uncertain relevance. Something similar happens with other recently reported clinical

associations with this locus [11]. Joint analysis with our data show only weak

association with immunologic disorder (P = 0.04) and inconclusive results regarding

renal disorder and discoid rash due to the differences in effect size between the two

studies. In addition, the other available report shows no association with any of these

three clinical features in any of the two series of patients considered [15], albeit the

analyzed SNP in that report, rs11574637, is only partially correlated with rs1143679.

Of the remaining loci studied here, only TYK2 and BANK1 have previously been

examined for association with SLE clinical features [16-17]. No specific association

was found in the previous studies and we did not find any in ours, in spite of relative

good power. In the interpretation of these negative results, it is important to consider the

power of the each comparison. All the SNPs analyzed here have similar power because

this is determined by the minor allele frequencies that are similar. However, the clinical

features show a gradation of power in function of the rarity of the phenotype with

lowest frequency (Table 2). Larger power is available for clinical features showing a

prevalence approaching 50%, like age of disease onset < 30, photosensitivity or malar

12

130
 Procedimiento experimental y resultados

rash, whereas a lower power corresponds to clinical features with low prevalence, like

neurologic disorder, or with very high prevalence, like arthritis or female gender. None

of the latter was associated in our study or has been reported as associated in previous

studies.

Our results and previous reports on the same loci [9-10, 15-17] and in other SLE

susceptibility loci [17, 34-41] do not show a clear and consistent association with

specific clinical features or subphenotypes. Association of the STAT4 locus with some

SLE features is at present the only significant exception to this trend. This conclusion is

not contradicted by some studies that have found differences in SLE susceptibility loci

between patients with a clinical feature and healthy controls, but not differences

between patients with and without the clinical manifestation [16, 39, 41]. Other

confirmed SLE susceptibility loci that have not shown association with specific clinical

manifestations include IRF5 [17, 36-38], PTPN22 [34-35, 39-40] and TNFAIP3 [41].

The same can be affirmed for the MHC, except that in this case, convincing associations

with particular autoantibodies have been reported [42-45]. The available evidence does

not exclude, however, that future studies will find modest or weak associations that

have escaped detection due to lack of power of the current SLE patient collections.

In retrospect, a weak phenotype specificity of the SLE susceptibility loci is

coherent with the fact that they have been identified in studies involving all types of

patients with SLE. It is likely that large phenotype-specific GWAs will uncover genetic

variants with a more clear effect on phenotypes, even if they have less impact in SLE

overall. This type of studies should be actively promoted in the hope that will allow

identifying more uniform subgroups of patients with SLE, which could be very useful to

improve disease management. Also, it is possible that complex interactions between loci

or with environmental exposures play a more significant role in the phenotypic

13

131
Factores genéticos asociados con predisposición a LES

heterogeneity of SLE. In any case, a contribution of genetic variation to SLE

phenotypes is supported by ethnic [46-47], ancestry [48] and family studies [49-51], and

it should be expected that future research will be able to identify the phenotype-specific

loci.

CONCLUSIONS

The paucity of sound associations with specific clinical features in our study,

together with other reports on the same loci [9-10, 15-17], or on other confirmed SLE

susceptibility loci [17, 34-41] shows that clinical variability of SLE does not correlate in

a consistent and clear way with SLE susceptibility alleles. The best of the already

known associations is with the STAT4 locus, and it is still incompletely defined. Other

associations that are only tentative at present will be confirmed in new studies, but it is

likely that only phenotype-specific GWAS will lead to the discovery of a significant

fraction of their genetic component.

ABBREVIATIONS

SLE: Systemic Lupus Erythemtosus

GWA: Genome Wide Association study

anti-dsDNA: Double-stranded DNA autoantibodies

MAF: Minor allele frequency

CI: Confidence Interval

OR: Odds ratio

COMPETING INTEREST

The authors declare that they have no competing interests.

14

132
 Procedimiento experimental y resultados

AUTHORS’ CONTRIBUTIONS

MS-G participated in design of the study, genotyped the samples, participated in the

interpretation of the results and in writing the manuscript. MC participated in the

statistical analysis and in the interpretation of results. ML, JO-R, EB, MB, C-GK, CP,

IK-R, PC, F-NS, MM, R-ES, TW, EE, AK, MM, RS, SM, GD-S, M-JS, FV, AS, CG,

IR, F-JB, NB, SD, RP Jr, RP, SR, CD, and JJG-R participated in the acquisition of

clinical data, collection of samples and in the analysis and interpretation of results. AG

participated in the design of the study, coordinated acquisition of clinical data and

collection of samples, supervised genotyping, statistical analysis, interpretation of

results and writing of the manuscript. All authors read and approved the final

manuscript.

ACKNOWLEDGEMENTS

MS-G is the recipient of a FPU pre-doctoral bursary of the Spanish Ministry of

Education. The present work was supported by Fondo de Investigacion Sanitaria of the

Instituto de Salud Carlos III (Spain), grants 06/0620, 08/0744 and RD08/0075/0019 that

are partially financed by the Fondo Europeo de Desarrollo Regional program of the

European Union, by grants from the Xunta de Galicia, and by BMBF KN Rheuma grant

C2.12 (to TW)

REFERENCES
1. Wallace DJ, Hahn B, Dubois EL: Dubois' lupus erythematosus, 7th edn.

Philadelphia: Lippincott Williams & Wilkin; 2007.

15

133
Factores genéticos asociados con predisposición a LES

2. Eisenberg R: Why can't we find a new treatment for SLE? J Autoimmun

2009, 32(3-4):223-230.

3. Tsao BP: Update on human systemic lupus erythematosus genetics. Curr

Opin Rheumatol 2004, 16(5):513-521.

4. Lauwerys BR, Wakeland EK: Genetics of lupus nephritis. Lupus 2005,

14(1):2-12.

5. Karassa FB, Trikalinos TA, Ioannidis JP: The Fc gamma RIIIA-F158 allele is

a risk factor for the development of lupus nephritis: a meta-analysis. Kidney

Int 2003, 63(4):1475-1482.

6. Sestak AL, Nath SK, Sawalha AH, Harley JB: Current status of lupus

genetics. Arthritis Res Ther 2007, 9(3):210.

7. Moser KL, Kelly JA, Lessard CJ, Harley JB: Recent insights into the genetic

basis of systemic lupus erythematosus. Genes Immun 2009, 10(5):373-379.

8. Rhodes B, Vyse TJ: The genetics of SLE: an update in the light of genome-

wide association studies. Rheumatology (Oxford) 2008, 47(11):1603-1611.

9. Taylor KE, Remmers EF, Lee AT, Ortmann WA, Plenge RM, Tian C, Chung

SA, Nititham J, Hom G, Kao AH, Demirci FY, Kamboh MI, Petri M, Manzi S,

Kastner DL, Seldin MF, Gregersen PK, Behrens TW, Criswell LA: Specificity

of the STAT4 genetic association for severe disease manifestations of

systemic lupus erythematosus. PLoS Genet 2008, 4(5):e1000084.

10. Sigurdsson S, Nordmark G, Garnier S, Grundberg E, Kwan T, Nilsson O,

Eloranta ML, Gunnarsson I, Svenungsson E, Sturfelt G, Bengtsson AA, Jonsen

A, Truedsson L, Rantapaa-Dahlqvist S, Eriksson C, Alm G, Goring HH,

Pastinen T, Syvanen AC, Ronnblom L: A risk haplotype of STAT4 for

systemic lupus erythematosus is over-expressed, correlates with anti-

16

134
 Procedimiento experimental y resultados

dsDNA and shows additive effects with two risk alleles of IRF5. Hum Mol

Genet 2008, 17(18):2868-2876.

11. Kim-Howard X, Maiti AK, Anaya JM, Bruner GR, Brown E, Merrill JT, Edberg

JC, Petri MA, Reveille JD, Ramsey-Goldman R, Alarcon GS, Vyse TJ, Gilkeson

G, Kimberly RP, James JA, Guthridge JM, Harley JB, Nath SK: ITGAM

coding variant (rs1143679) influences the risk of renal disease, discoid rash,

and immunologic manifestations in lupus patients with European ancestry.

Ann Rheum Dis 2009.

12. Suarez-Gestal M, Calaza M, Endreffy E, Pullmann R, Ordi-Ros J, Domenico

Sebastiani G, Ruzickova S, Jose Santos M, Papasteriades C, Marchini M,

Skopouli FN, Suarez A, Blanco FJ, D'Alfonso S, Bijl M, Carreira P, Witte T,

Migliaresi S, Gomez-Reino JJ, Gonzalez A: Replication of recently identified

systemic lupus erythematosus genetic associations: a case-control study.

Arthritis Res Ther 2009, 11(3):R69.

13. Hochberg MC: Updating the American College of Rheumatology revised

criteria for the classification of systemic lupus erythematosus. Arthritis

Rheum 1997, 40(9):1725.

14. Dupont WD, Plummer WD, Jr.: Power and sample size calculations. A review

and computer program. Control Clin Trials 1990, 11(2):116-128.

15. Hom G, Graham RR, Modrek B, Taylor KE, Ortmann W, Garnier S, Lee AT,

Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY,

Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson AA, Rantapaa-

Dahlqvist S, Petri M, Manzi S, Seldin MF, Ronnblom L, Syvanen AC, Criswell

LA, Gregersen PK, Behrens TW: Association of systemic lupus

17

135
Factores genéticos asociados con predisposición a LES

erythematosus with C8orf13-BLK and ITGAM-ITGAX. N Engl J Med 2008,

358(9):900-909.

16. Guo L, Deshmukh H, Lu R, Vidal GS, Kelly JA, Kaufman KM, Dominguez N,

Klein W, Kim-Howard X, Bruner GR, Scofield RH, Moser KL, Gaffney PM,

Dozmorov IM, Gilkeson GS, Wakeland EK, Li QZ, Langefeld CD, Marion MC,

Williams AH, Divers J, Alarcon GS, Brown EE, Kimberly RP, Edberg JC,

Ramsey-Goldman R, Reveille JD, McGwin G, Jr., Vila LM, Petri MA et al:

Replication of the BANK1 genetic association with systemic lupus

erythematosus in a European-derived population. Genes Immun 2009,

10(5):531-538.

17. Sigurdsson S, Nordmark G, Goring HH, Lindroos K, Wiman AC, Sturfelt G,

Jonsen A, Rantapaa-Dahlqvist S, Moller B, Kere J, Koskenmies S, Widen E,

Eloranta ML, Julkunen H, Kristjansdottir H, Steinsson K, Alm G, Ronnblom L,

Syvanen AC: Polymorphisms in the tyrosine kinase 2 and interferon

regulatory factor 5 genes are associated with systemic lupus erythematosus.

Am J Hum Genet 2005, 76(3):528-537.

18. Cervera R, Abarca-Costalago M, Abramovicz D, Allegri F, Annunziata P,

Aydintug AO, Bacarelli MR, Bellisai F, Bernardino I, Biernat-Kaluza E,

Blockmans D, Boki K, Bracci L, Campanella V, Camps MT, Carcassi C,

Cattaneo R, Cauli A, Chwalinska-Sadowska H, Contu L, Cosyns JP, Danieli

MG, D DC, Depresseux G, Direskeneli H, Domenech I, Espinosa G, Fernandez-

Nebro A, Ferrara GB, Font J et al: Systemic lupus erythematosus in Europe at

the change of the millennium: lessons from the "Euro-Lupus Project".

Autoimmun Rev 2006, 5(3):180-186.

18

136
 Procedimiento experimental y resultados

19. Pons-Estel BA, Catoggio LJ, Cardiel MH, Soriano ER, Gentiletti S, Villa AR,

Abadi I, Caeiro F, Alvarellos A, Alarcon-Segovia D: The GLADEL

multinational Latin American prospective inception cohort of 1,214 patients

with systemic lupus erythematosus: ethnic and disease heterogeneity among

"Hispanics". Medicine (Baltimore) 2004, 83(1):1-17.

20. Alarcon GS, McGwin G, Jr., Petri M, Reveille JD, Ramsey-Goldman R,

Kimberly RP: Baseline characteristics of a multiethnic lupus cohort:

PROFILE. Lupus 2002, 11(2):95-101.

21. Petri M: The effect of race on the presentation and course of SLE in the

United States. Arthritis and Rheumatism 1997, 40(9):785-785.

22. Wang F, Wang CL, Tan CT, Manivasagar M: Systemic lupus erythematosus

in Malaysia: a study of 539 patients and comparison of prevalence and

disease expression in different racial and gender groups. Lupus 1997,

6(3):248-253.

23. Al Arfaj AS, Khalil N: Clinical and immunological manifestations in 624

SLE patients in Saudi Arabia. Lupus 2009, 18(5):465-473.

24. Hulley SB: Designing clinical research, 3rd edn. Philadelphia, PA: Lippincott

Williams & Wilkins; 2007.

25. Guillemin F: Primer: the fallacy of subgroup analysis. Nat Clin Pract

Rheumatol 2007, 3(7):407-413.

26. Brookes ST, Whitley E, Peters TJ, Mulheran PA, Egger M, Davey Smith G:

Subgroup analyses in randomised controlled trials: quantifying the risks of

false-positives and false-negatives. Health Technol Assess 2001, 5(33):1-56.

27. Moyé LA: Multiple analyses in clinical trials: fundamentals for

investigators. New York: Springer; 2003.

19

137
Factores genéticos asociados con predisposición a LES

28. Harley JB, Alarcon-Riquelme ME, Criswell LA, Jacob CO, Kimberly RP,

Moser KL, Tsao BP, Vyse TJ, Langefeld CD, Nath SK, Guthridge JM, Cobb

BL, Mirel DB, Marion MC, Williams AH, Divers J, Wang W, Frank SG,

Namjou B, Gabriel SB, Lee AT, Gregersen PK, Behrens TW, Taylor KE,

Fernando M, Zidovetzki R, Gaffney PM, Edberg JC, Rioux JD, Ojwang JO et

al: Genome-wide association scan in women with systemic lupus

erythematosus identifies susceptibility variants in ITGAM, PXK,

KIAA1542 and other loci. Nat Genet 2008, 40(2):204-210.

29. Suarez-Gestal M, Calaza M, Dieguez-Gonzalez R, Perez-Pampin E, Pablos JL,

Navarro F, Narvaez J, Marenco JL, Herrero-Beaumont G, Fernandez-Gutierrez

B, Lamas JR, de la Serna AR, Ortiz AM, Carreno L, Canete JD, Caliz R, Blanco

FJ, Balsa A, Gomez-Reino JJ, Gonzalez A: Rheumatoid arthritis does not

share most of the newly identified systemic lupus erythematosus genetic

factors. Arthritis Rheum 2009, 60(9):2558-2564.

30. Gregersen PK, Amos CI, Lee AT, Lu Y, Remmers EF, Kastner DL, Seldin MF,

Criswell LA, Plenge RM, Holers VM, Mikuls TR, Sokka T, Moreland LW,

Bridges SL, Jr., Xie G, Begovich AB, Siminovitch KA: REL, encoding a

member of the NF-kappaB family of transcription factors, is a newly

defined risk locus for rheumatoid arthritis. Nat Genet 2009, 41(7):820-823.

31. Gourh P, Agarwal SK, Martin E, Divecha D, Rueda B, Bunting H, Assassi S,

Paz G, Shete S, McNearney T, Draeger H, Reveille JD, Radstake TR, Simeon

CP, Rodriguez L, Vicente E, Gonzalez-Gay MA, Mayes MD, Tan FK, Martin J,

Arnett FC: Association of the C8orf13-BLK region with systemic sclerosis in

North-American and European populations. J Autoimmun 2009.

20

138
 Procedimiento experimental y resultados

32. Dymecki SM, Niederhuber JE, Desiderio SV: Specific expression of a tyrosine

kinase gene, blk, in B lymphoid cells. Science 1990, 247(4940):332-336.

33. Saijo K, Schmedt C, Su IH, Karasuyama H, Lowell CA, Reth M, Adachi T,

Patke A, Santana A, Tarakhovsky A: Essential role of Src-family protein

tyrosine kinases in NF-kappaB activation during B cell development. Nat

Immunol 2003, 4(3):274-279.

34. Orozco G, Sanchez E, Gonzalez-Gay MA, Lopez-Nevot MA, Torres B, Caliz R,

Ortego-Centeno N, Jimenez-Alonso J, Pascual-Salcedo D, Balsa A, de Pablo R,

Nunez-Roldan A, Gonzalez-Escribano MF, Martin J: Association of a

functional single-nucleotide polymorphism of PTPN22, encoding lymphoid

protein phosphatase, with rheumatoid arthritis and systemic lupus

erythematosus. Arthritis Rheum 2005, 52(1):219-224.

35. Kyogoku C, Langefeld CD, Ortmann WA, Lee A, Selby S, Carlton VE, Chang

M, Ramos P, Baechler EC, Batliwalla FM, Novitzke J, Williams AH, Gillett C,

Rodine P, Graham RR, Ardlie KG, Gaffney PM, Moser KL, Petri M, Begovich

AB, Gregersen PK, Behrens TW: Genetic association of the R620W

polymorphism of protein tyrosine phosphatase PTPN22 with human SLE.

Am J Hum Genet 2004, 75(3):504-507.

36. Cunninghame Graham DS, Manku H, Wagner S, Reid J, Timms K, Gutin A,

Lanchbury JS, Vyse TJ: Association of IRF5 in UK SLE families identifies a

variant involved in polyadenylation. Hum Mol Genet 2007, 16(6):579-591.

37. Sigurdsson S, Goring HH, Kristjansdottir G, Milani L, Nordmark G, Sandling

JK, Eloranta ML, Feng D, Sangster-Guity N, Gunnarsson I, Svenungsson E,

Sturfelt G, Jonsen A, Truedsson L, Barnes BJ, Alm G, Ronnblom L, Syvanen

AC: Comprehensive evaluation of the genetic variants of interferon

21

139
Factores genéticos asociados con predisposición a LES

regulatory factor 5 (IRF5) reveals a novel 5 bp length polymorphism as

strong risk factor for systemic lupus erythematosus. Hum Mol Genet 2008,

17(6):872-881.

38. Ferreiro-Neira I, Calaza M, Alonso-Perez E, Marchini M, Scorza R, Sebastiani

GD, Blanco FJ, Rego I, Pullmann R, Jr., Pullmann R, Kallenberg CG, Bijl M,

Skopouli FN, Mavromati M, Migliaresi S, Barizzone N, Ruzickova S, Dostal C,

Schmidt RE, Witte T, Papasteriades C, Kappou-Rigatou I, Endreffy E, Kovacs

A, Ordi-Ros J, Balada E, Carreira P, Gomez-Reino JJ, Gonzalez A: Opposed

independent effects and epistasis in the complex association of IRF5 to SLE.

Genes Immun 2007, 8(5):429-438.

39. Reddy MV, Johansson M, Sturfelt G, Jonsen A, Gunnarsson I, Svenungsson E,

Rantapaa-Dahlqvist S, Alarcon-Riquelme ME: The R620W C/T

polymorphism of the gene PTPN22 is associated with SLE independently of

the association of PDCD1. Genes Immun 2005, 6(8):658-662.

40. Balada E, Villarreal-Tolchinsky J, Ordi-Ros J, Labrador M, Serrano-Acedo S,

Martinez-Lostao L, Vilardell-Tarres M: Multiplex family-based study in

systemic lupus erythematosus: association between the R620W

polymorphism of PTPN22 and the FcgammaRIIa (CD32A) R131 allele.

Tissue Antigens 2006, 68(5):432-438.

41. Bates JS, Lessard CJ, Leon JM, Nguyen T, Battiest LJ, Rodgers J, Kaufman

KM, James JA, Gilkeson GS, Kelly JA, Humphrey MB, Harley JB, Gray-

McGuire C, Moser KL, Gaffney PM: Meta-analysis and imputation identifies

a 109 kb risk haplotype spanning TNFAIP3 associated with lupus nephritis

and hematologic manifestations. Genes Immun 2009, 10(5):470-477.

22

140
 Procedimiento experimental y resultados

42. Galeazzi M, Sebastiani GD, Morozzi G, Carcassi C, Ferrara GB, Scorza R,

Cervera R, de Ramon Garrido E, Fernandez-Nebro A, Houssiau F, Jedryka-

Goral A, Passiu G, Papasteriades C, Piette JC, Smolen J, Porciello G,

Marcolongo R: HLA class II DNA typing in a large series of European

patients with systemic lupus erythematosus: correlations with clinical and

autoantibody subsets. Medicine (Baltimore) 2002, 81(3):169-178.

43. Galeazzi M, Sebastiani GD, Tincani A, Piette JC, Allegri F, Morozzi G, Bellisai

F, Scorza R, Ferrara GB, Carcassi C, Font J, Passiu G, Smolen J, Papasteriades

C, Houssiau F, Nebro AF, Ramon Garrido ED, Jedryka-Goral A, Marcolongo R:

HLA class II alleles associations of anticardiolipin and anti-beta2GPI

antibodies in a large series of European patients with systemic lupus

erythematosus. Lupus 2000, 9(1):47-55.

44. Vasconcelos C, Carvalho C, Leal B, Pereira C, Bettencourt A, Costa PP,

Marinho A, Barbosa P, Almeida I, Farinha F, Mendonca T, Correia JA,

Mendonca D, Martins B: HLA in Portuguese systemic lupus erythematosus

patients and their relation to clinical features. Ann N Y Acad Sci 2009,

1173:575-580.

45. Fernando MM, Stevens CR, Walsh EC, De Jager PL, Goyette P, Plenge RM,

Vyse TJ, Rioux JD: Defining the role of the MHC in autoimmunity: a review

and pooled analysis. PLoS Genet 2008, 4(4):e1000024.

46. Uribe AG, McGwin G, Jr., Reveille JD, Alarcon GS: What have we learned

from a 10-year experience with the LUMINA (Lupus in Minorities; Nature

vs. nurture) cohort? Where are we heading? Autoimmun Rev 2004, 3(4):321-

329.

23

141
Factores genéticos asociados con predisposición a LES

47. Peschken CA, Katz SJ, Silverman E, Pope JE, Fortin PR, Pineau C, Smith CD,

Arbillaga HO, Gladman DD, Urowitz M, Zummer M, Clarke A, Bernatsky S,

Hudson M: The 1000 Canadian faces of lupus: determinants of disease

outcome in a large multiethnic cohort. J Rheumatol 2009, 36(6):1200-1208.

48. Chung SA, Tian C, Taylor KE, Lee AT, Ortmann WA, Hom G, Graham RR,

Nititham J, Kelly JA, Morrisey J, Wu H, Yin H, Alarcon-Riquelme ME, Tsao

BP, Harley JB, Gaffney PM, Moser KL, Manzi S, Petri M, Gregersen PK,

Langefeld CD, Behrens TW, Seldin MF, Criswell LA: European population

substructure is associated with mucocutaneous manifestations and

autoantibody production in systemic lupus erythematosus. Arthritis Rheum

2009, 60(8):2448-2456.

49. Ramos PS, Kelly JA, Gray-McGuire C, Bruner GR, Leiran AN, Meyer CM,

Namjou B, Espe KJ, Ortmann WA, Reichlin M, Langefeld CD, James JA,

Gaffney PM, Behrens TW, Harley JB, Moser KL: Familial aggregation and

linkage analysis of autoantibody traits in pedigrees multiplex for systemic

lupus erythematosus. Genes Immun 2006, 7(5):417-432.

50. Scofield RH, Bruner GR, Kelly JA, Kilpatrick J, Bacino D, Nath SK, Harley JB:

Thrombocytopenia identifies a severe familial phenotype of systemic lupus

erythematosus and reveals genetic linkages at 1q22 and 11p13. Blood 2003,

101(3):992-997.

51. Tsao BP, Grossman JM, Riemekasten G, Strong N, Kalsi J, Wallace DJ, Chen

CJ, Lau CS, Ginzler EM, Goldstein R, Kalunian KC, Harley JB, Arnett FC,

Hahn BH, Cantor RM: Familiality and co-occurrence of clinical features of

systemic lupus erythematosus. Arthritis Rheum 2002, 46(10):2678-2685.

24

142
Procedimiento experimental y resultados

25

143
Factores genéticos asociados con predisposición a LES

Table 1: SLE susceptibility loci included in the study with the representative SNPs,
their Minor Allele Frequencies (MAF) in patients and controls, O.R. and P valuesa

b
MAF % (n/N)
c
Locus SNP SLE patients Controls O.R. (95% C.I.) P-value
-15
ITGAM rs1143679 23.0 (718/3116) 15.1 (521/3448) 1.71 (1.5-2.0) 8.1 x 10
-13
STAT4 rs7574865 32.6 (1015/3118) 23.4 (808/3456) 1.53 (1.4-1.7) 6.0 x 10
-6
C8orf13-BLK rs13277113 30.9 (963/3116) 25.2 (868/3444) 1.32 (1.2-1.5) 2.0 x 10
-5
IRAK1-MECP2 rs17435 27.0 (841/3120) 21.5 (743/3456) 1.27 (1.1-1.4) 2.5 x 10

1q25.1 rs10798269 27.1 (846/3122) 31.8 (1098/3452) 0.81 (0.7-0.9) 0.00019

PXK rs6445975 26.7 (834/3118) 23.5 (813/3454) 1.24 (1.1-1.4) 0.00037

TYK2 rs2304256 23.3 (727/3116) 27.8 (960/3450) 0.82 (0.7-0.9) 0.00076

BANK1 rs17266594 25.0 (779/3122) 29.0 (1003/3456) 0.83 (0.7-0.9) 0.0017

KIAA1542 rs4963128 30.2 (939/3114) 34.0 (1173/3448) 0.84 (0.8-0.9) 0.0011

a
These analyses were reported in detail in Suarez-Gestal et al (22)
b
n = number of minor alleles, N = total number of alleles
c
Comparisons were done with logistic regression following a genetic additive model and including
gender as covariate except for IRAK1-MECP2, which is in the X chromosome

26

144
 Procedimiento experimental y resultados

Table 2: Clinical characteristics of the patients with SLE included in the study and the
number of subjects with available information for each of them
Number of
Characteristic Value subjects
Women (%) 90.2 1544
a
Age of disease onset (median, IQR ) 29 (21-40) 1340
Age of disease onset < 30 (%) 52.0 1340
b
Time of follow-up (median, IQR) 10 (6-17) 1159
b
Malar rash (%) 56.6 1296
Discoid rash (%) 18.1 1379
Photosensitivity (%) 53.6 1388
Oral ulcers (%) 28.1 1390
Arthritis (%) 80.6 1398
Serositis (%) 35.8 1392
Renal disorder (%) 41.0 1387
Neurologic disorder (%) 14.5 1305
Hematologic disorder (%) 74.2 1348
Immunologic disorder (%) 77.6 1383
b
Antinuclear Antibody (%) 98.5 1129

a
IQR = Inter-quartile range
b
Data from specific recruitment centres were excluded because the feature was underreported: the Czech
Republic and Madrid for time of follow-up; Hungary for malar rash; and the Evangelismos Hospital in
Greece and the Milan collections for ANA

27

145
Factores genéticos asociados con predisposición a LES

Table 3: Comparison of the allele frequencies at nine SNP from SLE susceptibility loci
between patients positive and negative for 11 clinical features. Only significant
differences and results corresponding to previously reported associations are shown.
MAF % (n/N) a
O.R.
Locus Feature Positive patients Negative patients P Pcorr
(95% C.I.)

C8orf13- 34.8 28.0 1.37

Renal disorder 0.00017 0.0019
BLK (395/1136) (457/1632) (1.2-1.6)

IRAK1- 29.9 25.2 1.25

Renal disorder 0.0063 0.06
MECP2 (320/1072) (392/1556) (1.1-1.5)

34.9 31.1 1.18 b

STAT4 Age of onset <30 0.04 n.s.
(486/1394) (399/1282) (1.0-1.4)
30.1 33.7 0.85
Oral ulcers 0.07 n.s.
(235/780) (672/1996) (0.7-1.0)
32.9 32.7 1.01
Renal disorder n.s. n.s.
(374/1136) (535/1634) (0.9-1.2)
33.3 30.7 1.13
Immunologic d. n.s. n.s.
(715/2144) (190/618) (0.9-1.4)

21.5 26.1 0.78

BANK1 Oral ulcers 0.01 n.s.
(168/780) (521/2000) (0.6-1.0)
22.7 26.2 0.82
Renal disorder 0.03 n.s.
(258/1136) (429/1638) (0.7-1.0)

23.7 27.9 0.82

PXK Oral ulcers 0.04 n.s.
(184/776) (557/2000) (0.7-1.0)

24.7 21.2 1.22

ITGAM Age of onset <30 0.03 n.s.
(344/1392) (272/1282) (1.0-1.5)
23.9 22.6 1.08
Discoid rash n.s. n.s.
(119/498) (509/2254) (0.9-1.4)
23.7 22.2 1.09
Renal disorder n.s. n.s.
(269/1134) (363/1634) (0.9-1.3)
23.3 21.5 1.11
Immunologic d. n.s. n.s.
(498/2140) (133/620) (0.9-1.4)

a
MAF = Minor Allele Frequency, n = number of minor alleles, N = total number of alleles
b
n.s. = not significant

28

146
 Procedimiento experimental y resultados

Table 4: Stratification of the significant associations from Table 3 by gender

Women Men
O.R. O.R.
Locus Feature P P
(95% C.I.) (95% C.I.)

1.32 1.84
C8orf13-BLK Renal disorder 0.0014 0.023
(1.1-1.6) (1.1-3.1)

1.22 2.15
IRAK1-MECP2 Renal disorder 0.029 0.05
(1.0-1.5) (1.0-4.6)

1.15 1.62
STAT4 Age of onset <30 0.075 0.097
(1.0-1.3) (0.9-2.9)

0.78 0.79
BANK1 Oral ulcers 0.018 0.5
(0.6-1.0) (0.4-1.6)
0.79 1.03
Renal disorder 0.018 0.9
(0.7-1.0) (0.6-1.8)

0.79 1.13
PXK Oral ulcers 0.024 0.71
(0.6-1.0) (0.6-2.2)

1.22 1.19
ITGAM Age of onset <30 0.04 0.55
(1.0-1.5) (0.7-2.1)

29

147
Factores genéticos asociados con predisposición a LES

Table 5. Combined analysis of data from current and previous studies. Only
associations significant in any of the studies and allowing for case-only analysis were
considered.
b
OR this OR previous O.R.comb. b c
Locus Feature a Pcomb. Pheter. N
study study (95% C.I.)

1.37 0.73
C8orf13-BLK Renal disorder - - 0.0018 2165
(1.2-1.6) (0.5-1.1)

1.18 1.22 1.20

STAT4 Age of onset <30 0.0017 0.78 2696
(1.0-1.4) (1.0-1.4) (1.1-1.3)
0.85 0.80 0.82
Oral ulcers 0.0009 0.6 2783
(0.7-1.0) (0.7-0.9) (0.7-0.9)
1.13 1.24 1.19
Immunologic d. 0.011 0.51 2777
(0.9-1.4) (1.0-1.5) (1.0-1.4)
1.01 1.23 1.07
Renal disorder 0.14 0.061 2780
(0.9-1.2) (1.0-1.5) (1.0-1.2)

1.09 1.39 1.23 d

ITGAM Renal disorder 0.0013 0.058 3098
(0.9-1.3) (1.2-1.7) (1.1-1.4)
1.08 1.27 1.16 d
Discoid rash 0.029 0.24 2858
(0.9-1.4) (1.0-1.6) (1.0-1.3)
1.11 1.30 1.18
Immunologic d. 0.04 0.35 3068
(0.9-1.4) (1.0-1.7) (1.0-1.4)

a
Previous studies were [15] for C8orf13-BLK, [9] for STAT4 and [11] for ITGAM
b
Fixed-effect metaanalysis odds ratio (95 % confidence interval) and P value
c
Pheter = heterogeneity P value; N = total number of patients in the combined analysis
d
Random-effect metaanalysis gave non-significant results

30

148
 Procedimiento experimental y resultados

Additional files provided with this submission:

Additional file 1: competinginterests 1392903058347436.doc, 44K

http://arthritis-research.com/imedia/7827810763522699/supp1.doc

149
 Procedimiento experimental y resultados

Differences of Systemic Lupus Erythematosus

Clinical Features between two Large European

Population Subgroups

Marian Suarez-Gestal1, Manuel Calaza1, Torsten Witte2, Chryssa Papasteriades3, Maurizio

Marchini4, Sergio Migliaresi5, Attila Kovacs6, Josep Ordi Ros7, Marc Bijl8, Maria Jose Santos9,

Sarka Ruzickova10, Rudolf Pullmann11, Patricia Carreira12, Fotini N. Skopouli13, Sandra

D’Alfonso14, Gian Domenico Sebastiani15, Ana Suarez16, Francisco J Blanco17, Juan J Gomez-

Reino1,18, Antonio Gonzalez1, and the European Consortium of SLE DNA Collections

ACADEMIC DEGREES:

M Suarez-Gestal, MSc; M Calaza, MSc; T Witte, MD; C Papasteriades, MD; M Marchini, MD; S

Migliaresi, MD; A Kovacs, MD; J Ordi Ros, MD; M Bijl, MD; MJ Santos, MD; S Ruzickova, MD;

R Pullmann, MD; P Carreira, MD; FN Skopouli, MD; S D’Alfonso, MD; GD Sebastiani, MD; A

Suarez, MD; FJ Blanco, MD; JJ Gomez-Reino, MD; A Gonzalez, MD.

AFFILIATIONS:
1
Laboratorio de Investigacion 10 and Rheumatology Unit, Instituto de Investigacion Sanitaria -

Hospital Clinico Universitario de Santiago, 15706-Santiago de Compostela, Spain

2
Division of Clinical Immunology, Department of Internal Medicine of the Hannover Medical

School, D-30625 Hannover, Germany

3
Department of Histocompatibility and Immunology, Evangelismos Hospital, 10675-Athens,

Greece

151
Factores genéticos asociados con predisposición a LES

4
Clinical Immunology, University of Milan and Fondazione IRCCS Ospedale Maggiore

Policlinico, Mangiagalli e Regina Elena, 20122- Milan, Italy

5
Rheumatology Unit, Second University of Naples, 81100-Naples, Italy
6
Department of Rheumatology, Hospital of Hungarian Railways, H-5000 Szolnok, Hungary
7
Internal Medicine, Research Laboratory in Autoimmune Diseases. Hospital Vall d'Hebron. 08035-

Barcelona. Spain
8
Department of Rheumatology and Clinical Immunology, University Medical Center Groningen,

9713-Groningen, The Netherlands

9
Rheumatology Department, Hospital Garcia de Orta and Rheumatology Reseach Unit, Instituto de

Medicina Molecular. Lisboa, Portugal

10
Institute of Biotechnology, Academy of Sciences of the Czech Republic, 128 50 Prague 2, Czech

Republic
11
Institute of Clinical Biochemistry, Martin Faculty Hospital, Jessenius Medical Faculty, Kollárova

2, 036 59 Martin, Slovakia

12
Rheumatology Department. Hospital 12 de Octubre. 28041-Madrid. Spain; [email protected]
13
Pathophysiology Department, Athens University Medical School, Athens – 115 27, Greece
14
Dept. Medical Sciences and IRCAD , Eastern Piedmont University, 28100-Novara, Italy
15
Ospedale S. Camillo - Forlanini, U.O. Complessa di Reumatologia, 00151-Roma, Italy
16
Department of Functional Biology, Hospital Universitario Central de Asturias, Universidad de

Oviedo, Oviedo 33006, Spain

17
Laboratorio de Investigación Osteoarticular y del Envejecimiento. Servicio de Reumatología. CH

Universitario A Coruña. 15006-A Coruña. Spain

18
Department of Medicine, University of Santiago de Compostela, Spain

Corresponding author:

Antonio Gonzalez

152
 Procedimiento experimental y resultados

Laboratorio de Investigacion 10

Hospital Clinico Universitario de Santiago

Travesia de Choupana sn.

15706-Santiago de Compostela

Spain

Tfn: 34 981 950 903

Fax: 34 981 951 068

[email protected]

[email protected]

Running title: European subgroups in SLE

FUNDING

MS-G is the recipient of a FPU pre-doctoral bursary of the Spanish Ministry of Education. This

work was supported by Fondo de Investigacion Sanitaria of the Instituto de Salud Carlos III

(Spain), grants [06/0620, 08/0744 and by RETICS Program, RD08/0075 (RIER)] that are partially

financed by the Fondo Europeo de Desarrollo Regional program of the European Union, and by

grants from the Xunta de Galicia and by BMBF KN Rheuma grant [C2.12 to TW].

CONFLICT OF INTERESTS

No conflict of interest has been declared by the authors.

ABBREVIATIONS

SLE: Systemic Lupus Erythematosus

ACR: American College of Rheumatology

CV: Coefficient of variation

153
Factores genéticos asociados con predisposición a LES

154
 Procedimiento experimental y resultados

ABSTRACT

We aimed to determine if Systemic Lupus Erythematosus (SLE) phenotypes differ between the two

subgroups of Europeans identified in large genetic studies. Prevalence of ACR SLE classification

criteria and mean age of disease onset were compared between 475 patients with SLE from the

Northern subgroup and 1080 patients from the Southern subgroup. Arthritis was more prevalent in

the Southern subgroup (P = 1.7 x 10-6). Photosensitivity was more prevalent in the Northern group

(P = 0.0006). These differences were concordant with a previous study that analyzed European

ancestry percentages in American patients with SLE, confirming a new level of phenotype

heterogeneity of SLE inside one of the continental ethnic groups and suggesting the need of new

levels of stratification in genetic and population studies.

155
Factores genéticos asociados con predisposición a LES

INTRODUCTION

SLE clinical heterogeneity poses many challenges to clinical diagnosis, treatment and

research 11. Genetic, environmental and socioeconomic factors seem to have a role, but our

understanding of their effects is still very incomplete. Variation on severity and clinical phenotype

between ethnic groups has been shown in multiple studies 1, 4, 6, 8, 11-12. Part of this variation is

attributed to differences in the genetic component. A very interesting addition that strengthens the

link between genetic factors and SLE clinical heterogeneity and extends the distinction to

differences within a single ethnic group has been a recent report by Chung et al.3. In this study,

distinction between Northern and Southern European ancestries, which are the 2 major European

subgroups according to genome wide studies 7, correlated with the prevalence of specific SLE

features. Replication of these findings is necessary given the high variability of SLE clinical data

between patient collections that makes this type of studies prone to irreproducibility 1-2, 5-6, 10, 12. It is

also necessary given the important consequences for SLE research in Europeans that will need to

consider separately the 2 subpopulations. Here, we have replicated 2 of the associations described

by Chung et al: arthritis was more frequent in patients from the South of Europe and

photosensitivity was more frequent in patients from the North.

METHODS

Patient data: Data from 1555 European SLE patients recruited at 16 centres from 9 different

countries were analyzed 9. They included the American College of Rheumatology (ACR)

classification criteria, age of onset, time of follow-up and gender. All patients and controls gave

their written informed consent and the study was approved by the relevant ethic committees.

Statistical analysis: Patients were divided in Northern and Southern subgroups according with their

place of origin. We excluded from analysis the variables showing large variability within the 2

subgroups (Coefficient of variation (CV) ≥ 30 % between the centres in the Northern or Southern

subpopulations). Comparison of the 2 subpopulations was done with logistic regression

156
 Procedimiento experimental y resultados

incorporating patient gender and time of follow-up as covariates.

Founding sources: This work was supported by Fondo de Investigacion Sanitaria of the Instituto

de Salud Carlos III, the Fondo Europeo de Desarrollo Regional program of the European Union,

grants from the Xunta de Galicia and by BMBF KN Rheuma grant. This founding bodies had no

contribution in designing the study, collecting, analyzing and interpreting the data and approving

the final manuscript.

RESULTS

The Northern European subgroup was made of 475 patients with SLE from Germany, The

Netherlands, Hungary, the Czech Republic and Slovakia. The Southern Europeans subgroup was

made of 1080 patients from Spain, Italy, Greece and Portugal.

The first step in the analysis was to determine the variability of SLE clinical data within

each of the 2 subgroups. This analysis was done separately for the centres corresponding to

Southern and Northern European subpopulations (Table 1). Discoid rash, oral ulcers, renal disorder

and neurologic disorder showed CV that were larger than 30 % in the Southern and Northern

subgroups and were excluded from further analysis. Serositis, immunologic disorder, malar rash and

photosensitivity showed CV of 20-25 %, whereas arthritis, hematologic disorder and antinuclear

antibodies CV were below 20 % (Table 1). Variability in patient gender and age of disease onset

was low. Time of follow-up was more variable in the Southern subgroup and significantly different

between the 2 subgroups (Table 2). However, this difference in time of follow-up had not

appreciable effect in the results except for serositis, which was less prevalent in the patients with

shorter follow-up (not shown).

Only arthritis, photosensitivity and serositis were different between the patients from the

Southern and Northern European subpopulations (Table 2). The differences in prevalence of

arthritis and photosensitivity remained clearly significant after accounting for the number of test

157
Factores genéticos asociados con predisposición a LES

performed (Pcorr = 0.000017 and 0.0056, respectively), but not the difference in serositis (Pcorr =

0.054). In addition, the association with serositis disappeared when the difference in follow-up

between the Northern and Southern subpopulations was taken into account (P = 0.6).

Notably, the differences in arthritis and photosensitivity were in the same direction

previously reported in the European Americans 3, with a prevalence in excess of 10.7 % in arthritis

among the patients from the South and of 9.4 % in photosensitivity among the subjects from the

Northern group.

DISCUSSION

Differences in the SLE phenotype between continental ethnic populations are widely

acknowledged 1, 4, 6, 8, 11-12. However, there is only a report indicating that there are also differences

between patients of European origin depending on their Northern or Southern ancestry 3. Here, we

have addressed this question and found 2 clear differences, in arthritis and photosensitivity, that are

concordant with the study of Chung et al. 3. This concordance is very striking because design of the

2 studies has been very different. The Chung et al. study included almost exclusively European

Americans (98.0 %) whose ancestry was ascertained by analysis of ancestry informative

polymorphisms. In contrast, we have used data from European patients living in Europe and their

ancestry has been ascertained by their place of origin. This difference is important because each

collection of patients is affected by environmental exposures and other local factors that could

confound analysis, but these factors will be very different in the 2 studies. Therefore, we find very

reassuring that the arthritis and photosensitivity results of the 2 studies were concordant.

The differences we have found could be indicative of underlying mechanisms whose

elucidation will help understand SLE clinical heterogeneity. For example, photosensitivity excess in

the Northern subpopulation could be related with a lighter skin colour 3, 8, which is genetically

determined.

Other associations of the Chung et al. study were not replicated in our analysis 3. We did not

158
 Procedimiento experimental y resultados

found any difference between the 2 subgroups of Europeans in the prevalence of immunologic

disorder and we did not compare discoid rash or renal disorder because these 2 features showed

large variability within each of the subgroups in our data. High variability in the prevalence clinical

features of SLE is very common between different collections of patients 1-2, 5-6, 10, 12. When it is

present it is best to avoid comparisons because results are unreliable.

In summary, our study replicates the association of the Northern European subpopulation

with more photosensitivity and less arthritis than the observed in the Southern subpopulation.

Concordance between our study and Chung et al. 3 identify SLE clinical features under genetic

influence, advance in our understanding of SLE clinical heterogeneity, and call our attention to the

need to account for European subpopulations in SLE studies.

ACKNOWLEDGMENTS:

Other contributors to the European Consortium of SLE DNA Collections: Myriam Liz,

Laboratorio de Investigacion 10 and Rheumatology Unit, Instituto de Investigacion Sanitaria –

Hospital Clinico Universitario de Santiago, 15706-Santiago de Compostela, Spain; Reinhold E

Schmidt, Division of Clinical Immunology, Department of Internal Medicine of the Hannover

Medical School, D-30625 Hannover, Germany; Iris Kappou-Rigatou, Department of

Histocompatibility and Immunology, Evangelismos Hospital, 10676 Athens, Greece; Raffaella

Scorza, Clinical Immunology, University of Milan and Fondazione IRCCS Ospedale Maggiore

Policlinico, Mangiagalli e Regina Elena, 20122 Milan, Italy; Emöke Endereffy, Department of

Paediatrics, Albert Szent-Györgyi Clinical Centre, University of Szeged, 6720 Hungary; Eva

Balada, Internal Medicine, Research Laboratory in Autoimmune Diseases Hospital Vall d’Hebron,

08035 Barcelona, Spain; Cees G Kallenberg, Department of Rheumatology and Clinical

Immunology, University Medical Center Groningen, 9713 Groningen, The Netherlands; Filipe

Vinagre, Rheumatology Department, Hospital Garcia de Orta, Almada, (Portugal) and

Rheumatology Research Unit, Instituto Medicina Molecular, Faculdade de Medicina da

159
Factores genéticos asociados con predisposición a LES

Universidade de Lisboa, Portugal; Ctibor Dostal, Molecular Biology and Immunogenetics Dept,

Institute of Rheumatology, 128 50 Prague 2, Czech Republic; Rudolf Pullmann Jr, Gerontology

Research Center, National Institute on Aging, 5600 Nathan Shock Drive, Baltimore, Maryland

21224, USA; Maria Mavromati, Pathophysiology Department, Athens University Medical School,

Athens 115 27, Greece; Nadia Barizzone, Dept Medical Sciences and IRCAD , Eastern Piedmont

University, 28100 Novara, Italy; Carmen Gutierrez, Department of Functional Biology, Hospital

Universitario Central de Asturias, Universidad de Oviedo, Oviedo 33006, Spain; Ignacio Rego,

Laboratorio de Investigación Osteoarticular y del Envejecimiento. Servicio de Reumatología. CH

Universitario A Coruña. 15006-A Coruña. Spain.

10

160
 Procedimiento experimental y resultados

REFERENCES

1. Alarcon GS, McGwin G, Jr., Petri M, Reveille JD, Ramsey-Goldman R, Kimberly RP.

Baseline characteristics of a multiethnic lupus cohort: PROFILE. Lupus 2002;11: 95-101.

2. Cervera R, Abarca-Costalago M, Abramovicz D, Allegri F, Annunziata P, Aydintug AO,

Bacarelli MR, Bellisai F, Bernardino I, Biernat-Kaluza E, Blockmans D, Boki K, Bracci L,

Campanella V, Camps MT, Carcassi C, Cattaneo R, Cauli A, Chwalinska-Sadowska H, Contu L,

Cosyns JP, Danieli MG, D DC, Depresseux G, Direskeneli H, Domenech I, Espinosa G, Fernandez-

Nebro A, Ferrara GB, Font J, Frutos MA, Galeazzi M, Garcia-Carrasco M, Garcia Iglesias MF,

Garcia-Tobaruela A, George J, Gil A, Gonzalez-Santos P, Grana M, Gul A, Haga HJ, de Haro-Liger

M, Houssiau F, Hughes GR, Ingelmo M, Jedryka-Goral A, Khamashta MA, Lavilla P, Levi Y,

Lopez-Dulpa M, Lopez-Soto A, Maldykowa H, Marcolongo R, Mathieu A, Morozzi G,

Nicolopoulou N, Papasteriades C, Passiu G, Perello I, Petera P, Petrovic R, Piette JC, Pintado V, de

Pita O, Popovic R, Pucci G, Puddu P, de Ramon E, Ramos-Casals M, Rodriguez-Andreu J, Ruiz-

Irastorza G, Sanchez-Lora J, Sanna G, Scorza R, Sebastiani GD, Sherer Y, Shoenfeld Y, Simpatico

A, Sinico RA, Smolen J, Tincani A, Tokgoz G, Urbano-Marquez A, Vasconcelos C, Vazquez JJ,

Veronesi J, Vianna J, Vivancos J. Systemic lupus erythematosus in Europe at the change of the

millennium: lessons from the "Euro-Lupus Project". Autoimmun Rev 2006;5: 180-6.

3. Chung SA, Tian C, Taylor KE, Lee AT, Ortmann WA, Hom G, Graham RR, Nititham J,

Kelly JA, Morrisey J, Wu H, Yin H, Alarcon-Riquelme ME, Tsao BP, Harley JB, Gaffney PM,

Moser KL, Manzi S, Petri M, Gregersen PK, Langefeld CD, Behrens TW, Seldin MF, Criswell LA.

European population substructure is associated with mucocutaneous manifestations and

autoantibody production in systemic lupus erythematosus. Arthritis Rheum 2009;60: 2448-56.

4. Fernandez M, Alarcon GS, Calvo-Alen J, Andrade R, McGwin G, Jr., Vila LM, Reveille JD.

A multiethnic, multicenter cohort of patients with systemic lupus erythematosus (SLE) as a model

for the study of ethnic disparities in SLE. Arthritis Rheum 2007;57: 576-84.

5. Hom G, Graham RR, Modrek B, Taylor KE, Ortmann W, Garnier S, Lee AT, Chung SA,

11

161
Factores genéticos asociados con predisposición a LES

Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY, Kamboh MI, Kao AH, Tian C,

Gunnarsson I, Bengtsson AA, Rantapaa-Dahlqvist S, Petri M, Manzi S, Seldin MF, Ronnblom L,

Syvanen AC, Criswell LA, Gregersen PK, Behrens TW. Association of systemic lupus

erythematosus with C8orf13-BLK and ITGAM-ITGAX. N Engl J Med 2008;358: 900-9.

6. Petri M. The effect of race on the presentation and course of SLE in the United States.

Arthritis and Rheumatism 1997;40: 785-785.

7. Seldin MF, Shigeta R, Villoslada P, Selmi C, Tuomilehto J, Silva G, Belmont JW, Klareskog

L, Gregersen PK. European population substructure: clustering of northern and southern

populations. PLoS Genet 2006;2: e143.

8. Sestak AL, Nath SK, Kelly JA, Bruner GR, James JA, Harley JB. Patients with familial and

sporadic onset SLE have similar clinical profiles but vary profoundly by race. Lupus 2008;17:

1004-9.

9. Suarez-Gestal M, Calaza M, Endreffy E, Pullmann R, Ordi-Ros J, Domenico Sebastiani G,

Ruzickova S, Jose Santos M, Papasteriades C, Marchini M, Skopouli FN, Suarez A, Blanco FJ,

D'Alfonso S, Bijl M, Carreira P, Witte T, Migliaresi S, Gomez-Reino JJ, Gonzalez A. Replication of

recently identified systemic lupus erythematosus genetic associations: a case-control study. Arthritis

Res Ther 2009;11: R69.

10. Taylor KE, Remmers EF, Lee AT, Ortmann WA, Plenge RM, Tian C, Chung SA, Nititham J,

Hom G, Kao AH, Demirci FY, Kamboh MI, Petri M, Manzi S, Kastner DL, Seldin MF, Gregersen

PK, Behrens TW, Criswell LA. Specificity of the STAT4 genetic association for severe disease

manifestations of systemic lupus erythematosus. PLoS Genet 2008;4: e1000084.

11. Wallace DJ, Hahn B, Dubois EL. Dubois' lupus erythematosus. 7th edn. Philadelphia:

Lippincott Williams & Wilkin, 2007.

12. Wang F, Wang CL, Tan CT, Manivasagar M. Systemic lupus erythematosus in Malaysia: a

study of 539 patients and comparison of prevalence and disease expression in different racial and

gender groups. Lupus 1997;6: 248-53.

12

162
 Procedimiento experimental y resultados

Table 1: Clinical features of SLE patients and variability of their values within the European
Northern and Southern subgroups.

CV (%)
Value N* Northern † Southern †
Women (%) 90.3 1543 3.1 3.3
age of onset (mean, years) 31.1 1349 6.3 10.6
time of follow-up (mean, years) 11.9 1168 12.6 22.8
Malar rash (%) ‡ 56.5 1305 24.8 19.8
Discoid rash (%) 18.1 1388 48.8 59.2
Photosensitivity (%) 53.4 1397 17.6 23.0
Oral ulcers (%) 28.2 1399 56.0 63.1
Arthritis (%) 80.7 1407 15.8 10.4
Serositis (%) 35.8 1401 9.9 26.2
Renal disorder (%) 41.0 1396 32.5 38.9
Neurologic disorder (%) 14.6 1314 66.4 38.4
Hematologic disorder (%) 74.3 1356 15.0 18.8
Immunologic disorder (%) 77.7 1392 22.1 23.0
Antinuclear antibody (%) ‡ 98.7 1138 1.8 2.1
*
Number of patients used for each analysis
†
Northern subgroup: Germany, the Netherlands, Hungary, the Czech Republic and Slovakia. Southern subgroup: Spain,
Italy, Greece and Portugal.
‡
Some data from all patients of specific recruitment centres were excluded because the feature was underreported:
Hungary for malar rash; and the Evangelismos Hospital in Greece and the Milan collections for antinuclear antibody

13

163
Factores genéticos asociados con predisposición a LES

14

164
 Procedimiento experimental y resultados

Table 2: Comparison of clinical features between the Northern and Southern subpopulations of
European patients with SLE

Value
Northern Southern P-value * O.R. (95 % C.I.) †
Women (%) 88.6 91.0 0.14
age of onset (mean, years) 31.9 30.8 0.18
time of follow-up (mean, years) 14.2 10.7 5.3 x 10-14
Malar rash (%) 56.3 55.6 0.17 1.01 (0.9-1.2)
Photosensitivity (%) 59.7 50.3 0.00056 1.49 (1.2-1.9)
Arthritis (%) 73.6 84.3 0.0000017 0.51 (0.4-0.7)
Serositis (%) 39.5 33.8 0.0055 ‡ 1.29 (1.1-1.7)
Hematologic disorder (%) 75.5 73.7 0.12 1.11 (0.9-1.4)
Immunologic disorder (%) 77.2 77.9 0.68 0.95 (0.7-1.2)
Antinuclear antibody (%) 98.6 98.5 0.92 1.06 (0.3-3.3)
*
Comparison done with logistic regression including patient gender as covariate
†
Odds ratios and their 95 % confidence intervals were calculated taking as reference the Southern subpopulation of
patients
‡
This difference did not persist after considering differences in follow-up

15

165
4. Componente genético común a LES y AR
 Procedimiento experimental y resultados

ARTHRITIS & RHEUMATISM

Vol. 60, No. 9, September 2009, pp 2558–2564
DOI 10.1002/art.24748
© 2009, American College of Rheumatology

Rheumatoid Arthritis Does Not Share Most of the Newly

Identified Systemic Lupus Erythematosus Genetic Factors

Marian Suarez-Gestal,1 Manuel Calaza,1 Rebeca Dieguez-Gonzalez,1 Eva Perez-Pampin,1

Jose Luis Pablos,2 Federico Navarro,3 Javier Narvaez,4 Jose Luis Marenco,5
Gabriel Herrero-Beaumont,6 Benjamin Fernandez-Gutierrez,7 Jose Ramon Lamas,7
Arturo Rodriguez de la Serna,8 Ana Maria Ortiz,9 Luis Carreño,10
Juan D. Cañete,11 Rafael Caliz,12 Francisco J. Blanco,13Alejandro Balsa,14
Juan J. Gomez-Reino,15 and Antonio Gonzalez1

Objective. Rheumatoid arthritis (RA) and sys- aim of this study was to determine whether 9 other SLE
temic lupus erythematosus (SLE) share some genetic genetic factors are also implicated in RA susceptibility.
factors such as HLA, PTPN22, STAT4, and 6q23. The Methods. A characteristic single-nucleotide poly-
morphism (SNP) in each of 9 genetic factors, ITGAM
(rs1143679), C8orf13–BLK (rs13277113), TYK2
Supported by the Instituto de Salud Carlos III of the Spanish (rs2304256), 1q25.1 (rs10798269), PXK (rs6445975),
Health Ministry (grants PI06/0620 and PI08/0744) and the Xunta de
Galicia (grant 07PXIB918091PR). The Instituto de Salud Carlos III
KIAA1542 (rs4963128), MECP2 (rs17435), BANK1
Research Network provided support for many of the collaborating (rs17266594), and LY9 (rs509749), was studied in 1,635
research teams (grant RD08/0075). patients with RA and 1,906 control subjects from Spain.
1
Marian Suarez-Gestal, MSc, Manuel Calaza, MSc, Rebeca
Dieguez-Gonzalez, PhD, Eva Perez-Pampin, MD, Antonio Gonzalez, The rs7574865 SNP in STAT4 was also included. Anal-
MD, PhD: Hospital Clinico Universitario de Santiago, Santiago de yses were conducted globally and after stratification by
Compostela, Spain; 2Jose Luis Pablos, MD: Hospital 12 de Octubre, sex and clinical features (anti–cyclic citrullinated pep-
Madrid, Spain; 3Federico Navarro, MD: Hospital Universitario Virgen
Macarena, Seville, Spain; 4Javier Narvaez, MD, PhD: Hospital Uni- tide and rheumatoid factor, shared epitope, rheumatoid
versitario de Bellvitge, Barcelona, Spain; 5Jose Luis Marenco, MD: nodules, radiographic changes, sicca syndrome, and
Hospital Universitario de Valme, Seville, Spain; 6Gabriel Herrero-
Beaumont, MD: Fundacion Jimenez Diaz, Madrid, Spain; 7Benjamin
pneumonitis).
Fernandez-Gutierrez, MD, PhD, José Ramón Lamas, PhD: Hospital Results. No association was observed between RA
Clinico San Carlos, Madrid, Spain; 8Arturo Rodriguez de la Serna, and any of the 9 newly identified SLE genetic factors. A
MD: Hospital Santa Creu i Sant Pau, Barcelona, Spain; 9Ana Maria
Ortiz, MD, PhD: Hospital Universitario de la Princesa, Madrid, Spain; meta-analysis using previous data was consistent with
10
Luis Carreño, MD: Hospital Universitario Gregorio Marañon, Ma- these results. In addition, there were no significant
drid, Spain; 11Juan D. Cañete, MD, PhD: Hospital Clinicico and differences between individuals with and those without
Institut d’Investigacions Biomèdiques August Pi I Sunyer, Barcelona,
Spain; 12Rafael Caliz, MD: Hospital Universitario Virgen de las each of the clinical features analyzed, except the fre-
Nieves, Granada, Spain; 13Francisco J. Blanco, MD: Hospital Univer- quency of the minor allele in the C8orf13–BLK locus that
sitario Juan Canalejo, Coruña, Spain; 14Alejandro Balsa, MD: Hospi- was decreased in patients with sicca syndrome (14.6%
tal La Paz, Madrid, Spain; 15Juan J. Gomez-Reino, MD, PhD: Hospital
Clinico Universitario de Santiago and Universitario de Santiago de versus 22.4% in controls; P ⴝ 0.003).
Compostela, Santiago de Compostela, Spain. Conclusion. None of the 9 recently identified SLE
Dr. Fernandez-Gutierrez has received speaking fees from
Bristol-Myers Squibb (less than $10,000). Dr. Balsa has received
risk factors showed association with RA. Therefore,
consulting fees, speaking fees, and/or honoraria from Abbott (less than common genetic factors affecting the pathogenesis of
$10,000). these 2 disorders seem to be limited, revealing that the
Address correspondence and reprint requests to Antonio
Gonzalez, MD, PhD, Laboratorio de Investigacion 10, Hospital genetic component contributes to the different expres-
Clinico Universitario de Santiago, Travesia de Choupana s/n, 15706 sion of these diseases.
Santiago de Compostela, Spain. E-mail: Antonio.Gonzalez.Martinez.
[email protected].
Submitted for publication March 9, 2009; accepted in revised Rheumatoid arthritis (RA) and systemic lupus
form May 17, 2009. erythematosus (SLE) share a complex etiology encom-
2558

169
 Factores genéticos asociados con predisposición a LES

RA GENETIC INDEPENDENCE FROM SLE 2559

passing genetic, environmental, and stochastic compo- Table 1. Clinical characteristics of the 1,635 patients with rheuma-
nents (1,2). Loss of tolerance to self antigens, which toid arthritis*
leads to stimulation of lymphocytes and other immune Female sex 75.0
cells, release of cytokines, activation of complement, and Age at disease onset, median (interquartile range) years 48 (37–57)
Morning stiffness 96.1
the production of autoantibodies, contributes to the Arthritis in ⱖ3 joint areas 99.7
pathogenesis of both RA and SLE (3,4). RA and SLE Arthritis in hand joints 99.0
also share genetic factors such as those in the HLA, Symmetric arthritis 99.3
Rheumatoid nodules (n ⫽ 1,291) 20.1
PTPN22, STAT4, and 6q23 loci (5–8); however, their Rheumatoid factor (n ⫽ 1,504) 72.7
respective clinical phenotypes are clearly different. RA Erosions (n ⫽ 1,502) 70.4
is characterized by symmetric erosive arthritis of the Sicca syndrome (n ⫽ 903) 14.8
Interstitial pneumonitis (n ⫽ 1,520) 2.8
peripheral joints with pannus formation that is chronic Shared epitope carrier (n ⫽ 594) 54.7
and progressive, which causes a characteristic pattern of Anti–citrullinated protein antibody positive (n ⫽ 655) 66.1
pain, rigidity, and deformities. In contrast, arthritis is * Except where indicated otherwise, values are the percent. When data
only one among the diverse array of clinical manifesta- were not available for all patients, the number of patients for whom
tions of SLE and typically is not erosive, does not have data were available is shown.
a progressive course, and most often is not symmetric
(9). Malar rash, photosensitivity, serositis, nephritis,
peripheral and central nerve system disease, and cyto- larger than the number of such factors in RA. Therefore,
penia are indicative of SLE but not RA. The 2 clinical we examined the role in RA of a representative SNP for
syndromes overlap only in some exceptional patients (a each of 10 recently identified SLE genetic factors:
clinical situation that is referred to as rhupus by many STAT4 (which is already known to be shared by SLE and
investigators). Therefore, the 2 diseases should have RA), ITGAM, C8orf13–BLK, PXK, TYK2, KIAA1542,
differential etiologic factors. Such etiologic factors could 1q25.1, BANK1, MECP2, and LY9 (6). All except LY9
be genetic, with some being specific for SLE and others have consistently been associated with SLE (19). How-
being specific for RA. Alternatively, the differential ever, only the SNP in STAT4 was associated with RA in
factors could be environmental or stochastic. our current comparison of more than 1,600 patients and
A common genetic component of RA, SLE, and 1,900 healthy control subjects. A meta-analysis including
other autoimmune diseases has been hypothesized previous data led to similar results. Therefore, it seems
(10,11). This hypothesis was triggered by the observation that RA does not share most of the new SLE genetic
of an increased concurrence of several autoimmune factors, indicating that the genetic component is a
diseases in members of the same family (12,13) and was significant contributor to the different expression of
strongly reinforced by the discovery of the role of HLA these 2 diseases.
alleles in most autoimmune diseases (14) and, later, by
genetics studies in families showing that linkage to
different autoimmune diseases clustered in overlapping PATIENTS AND METHODS
loci (15). Similar findings were also observed in animal Sample collection. We used DNA samples from 1,635
models of autoimmune diseases (16). More recently, patients with RA and 1,906 healthy control subjects of Spanish
some genetic factors with a shared effect in many of ancestry (281 of the control subjects were previously described
by our group in a study of SLE susceptibility [19]). All patients
these diseases have been identified. The most generally with RA met the 1987 revised American College of Rheuma-
shared is PTPN22, but other examples include STAT4, tology (formerly, the American Rheumatism Association) clas-
the 6q23 locus, and possibly CTLA4 and IRF5 (5– sification criteria (20). The clinical characteristics of the pa-
8,17,18). Now, thanks to genome-wide association stud- tients are shown in Table 1. Patients and control subjects gave
ies, we are beginning to have more comprehensive written informed consent to participate in the study. Sample
collection was approved by the respective ethics committees.
knowledge of the genetic component of these diseases. SNP genotyping. A strongly SLE-associated SNP for
The identification of more genetic factors will allow us to each of 10 recently identified SLE genetic factors was selected
determine whether those that are shared by several (Table 2). The 10 SNPs were amplified in a single polymerase
diseases are the rule or the exception. As a consequence, chain reaction (PCR) (Qiagen Multiplex PCR Kit; Qiagen,
we will make advances in the identification of differen- Chatsworth, CA) with 20 ng of genomic DNA and 0.2 ␮M of
each primer. PCR products were purified by digestion with
tial disease factors. exonuclease I (Epicentre Technologies, Madison, WI) and
At the time when this study was planned, the shrimp alkaline phosphatase (SAP; GE Healthcare, Barcelona,
number of recently identified genetic factors in SLE was Spain). Purified PCR products were included in a single-base

170
 Procedimiento experimental y resultados

2560 SUAREZ-GESTAL ET AL

Table 2. Allele frequencies for the 10 SNPs identifying SLE genetic factors*
Minor allele frequency, no. (%)

SNP (locus) RA patients Control subjects OR (95% CI)

rs7574865 (STAT4) 665/2,768 (24.0) 784/3,612 (21.7) 1.14 (1.0–1.3)†
rs1143679 (ITGAM) 561/3,264 (17.2) 608/3,808 (16.0) 1.09 (1.0–1.2)
rs13277113 (C8orf13–BLK) 757/3,268 (23.2) 852/3,810 (22.4) 1.05 (0.9–1.2)
rs2304256 (TYK2) 842/3,262 (25.8) 1,025/3,804 (26.9) 0.94 (0.8–1.0)
rs10798269 (1q25.1) 1,042/3,268 (31.9) 1,285/3,812 (33.7) 0.92 (0.8–1.0)
rs4963128 (KIAA1542) 1,013/3,264 (31.0) 1,214/3,812 (31.8) 0.96 (0.9–1.1)
rs6445975 (PXK) 790/3,270 (24.2) 851/3,814 (22.3) 1.11 (1.0–1.2)
rs17266594 (BANK1) 773/2,768 (27.9) 987/3,612 (27.3) 1.03 (0.9–1.2)
rs509749 (LY9) 1,530/3,270 (46.8) 1,777/3,810 (46.6) 1.03 (0.9–1.2)
rs17435 (MECP2)‡
Women 461/2,252 (20.5) 445/2,224 (20.0) 1.05 (0.9–1.2)
Men 71/372 (19.1) 100/622 (16.1) 1.23 (0.9–1.7)

* SLE ⫽ systemic lupus erythematosus; RA ⫽ rheumatoid arthritis; OR ⫽ odds ratio; 95% CI ⫽ 95%
confidence interval.
† P ⫽ 0.028.
‡ This single-nucleotide polymorphism (SNP), which is in chromosome X, was assessed by analysis of
allelic frequencies in women and by carrier analysis in men.

extension reaction with the SNaPshot Multiplex Kit (Applied 99.9%, and genotypes in the control subjects were in
Biosystems, Foster City, CA) and specific probes. After a Hardy-Weinberg equilibrium.
second purification with SAP (GE Healthcare), samples were
analyzed in the ABI Prism 3130xl Genetic Analyzer (Applied
We observed association of the STAT4 SNP
Biosystems), and genotypes were assigned using GeneMapper rs7574865 with RA (odds ratio [OR] 1.14, 95% confi-
software (Applied Biosystems). (Primer and oligonucleotide dence interval CI 1.0–1.3, P ⫽ 0.028) but no significant
sequences are available from the corresponding author.) differences between patients with RA and control sub-
Statistical analysis. Tests for Hardy-Weinberg equili- jects for the other 8 autosomal SNPs or for the MECP2
brium in control samples were done with Haploview (21), using
a threshold of 0.05, without correction for multiple testing. SNP, which is located in the X chromosome and was
Other statistical analyses were done using a customized version analyzed separately in female and male individuals
of the Statistica 7.0 program (StatSoft, Tulsa, OK). Compari- (Table 2). All genotype comparisons were concordant
son of cases and controls was done with allele frequency data with an additive genetic model and gave results similar
using chi-square tests on 2 ⫻ 2 contingency tables. These to the allele comparisons (results not shown). The power
analyses were also conducted after stratifying the samples by
sex and available clinical data. Results from the stratified of these analyses was enough to detect genetic factors
analyses were subjected to Bonferroni correction. Univariate showing an OR between 1.20 for the ITGAM SNP and
logistic regression models were used to test the fit to the data 1.15 for the LY9 SNP (␣ ⫽ 0.05 and 1 – ␤ ⫽ 0.80), which
of additive, recessive, and dominant genetic models. Statistical were the SNPs with minimum and maximum power,
power was estimated using “power and sample size calcula- respectively.
tions” software (22). Meta-analysis was done with our data and
data from previous reports, using a fixed-effects model with R Analysis was also done after stratification of
software (http://www.r-project.org/). Heterogeneity of the ef- samples according to sex and clinical data, which in-
fect size between studies was assessed with the I2 statistic for cluded anti–cyclic citrullinated peptide antibodies, rheu-
inconsistency and Cochran’s Q statistic. Samples from Hospital matoid factor, the shared epitope, rheumatoid nodules,
Universitario La Paz and Hospital Clinico San Carlos have radiographic changes, sicca symptoms, and interstitial
already been used for the analysis of 2 genetic factors included
in this project: BANK1 and STAT4. To avoid data duplication, pneumonitis. Most of these comparisons showed similar
we excluded these samples from the relevant analysis. results across strata (detailed data are available from the
corresponding author). The most remarkable difference
was the decreased frequency of the minor allele of
RESULTS
rs13277113 in the C8orf13–BLK locus among patients
A total of 1,635 patients with RA and 1,906 with RA and sicca symptoms (14.6% versus 24.2% in
control subjects of Spanish ancestry were available for patients without these symptoms [P ⫽ 0.0005] and versus
study. The genotyping call rate across the 10 SNPs was 22.4% in controls [P ⫽ 0.003]) (Table 3). These differ-

171
 Factores genéticos asociados con predisposición a LES

RA GENETIC INDEPENDENCE FROM SLE 2561

Table 3. Significant differences in stratified analyses of patients with RA, according to sex and clinical features*
Comparisons between patient strata Comparisons with controls

SNP (locus) MAF, no. (%) OR (95% CI) P Pcorr† OR (95% CI) P Pcorr
rs6445975 (PXK)
Women 541/2,252 (24.0) 1.10 (0.9–1.3) NS NS 1.19 (1.0–1.4) 0.015 NS
Men 168/752 (22.3) 0.87 (0.7–1.1) NS NS
rs13277113 (C8orf13–BLK)
Sicca syndrome 39/268 (14.6) 0.53 (0.4–0.8) 0.0005 0.008 0.59 (0.4–0.8) 0.003 0.04
No sicca syndrome 356/1472 (24.2) 1.11 (1.0–1.3) 0.16 NS
rs509749 (LY9)
Shared epitope 330/650 (50.8) 1.41 (1.1–1.8) 0.003 0.05 1.18 (1.0–1.4) 0.05 NS
No shared epitope 227/538 (42.2) 0.84 (0.7–1.0) 0.05 NS
rs10798269 (1q25.1)
RF positive 673/2,184 (30.8) 0.85 (0.7–1.0) 0.06 NS 0.88 (0.8–1.0) 0.02 NS
RF negative 283/822 (34.4) 1.03 (0.9–1.2) NS NS
rs2304256 (TYK2)
Erosions 565/2,108 (26.8) 1.19 (1.0–1.4) 0.06 NS 0.99 (0.9–1.1) NS NS
No erosions 209/888 (23.5) 0.83 (0.7–1.0) 0.04 NS
* The presence of erosions was defined radiographically. RA ⫽ rheumatoid arthritis; SNP ⫽ single-nucleotide polymorphism; MAF ⫽ minor allele
frequency; OR ⫽ odds ratio; 95% CI ⫽ 95% confidence interval; NS ⫽ not significant; RF ⫽ rheumatoid factor.
† Bonferroni correction.

ences remained significant after correction for the num- SNP rs1143679, for which no previous information was
ber of tests performed (Table 3). However, this result found. The meta-analysis confirmed the results observed
should be taken with caution given the small number of in our sample collection: the one SNP that is clearly
patients in this group (n ⫽ 134) and association with a associated with RA is the STAT4 SNP (Table 4), for
different allele than that in patients with SLE. There which ⬎35,000 subjects have already been studied. Re-
were other differences between strata (Table 3), but they sults for this SNP showed significant heterogeneity of
were significant in the analyses only previous to Bonfer- effects between studies (I2 ⫽ 53.0%, P for Cochran’s Q
roni correction. statistic [PQ] ⫽ 0.007) that was not attributable to the
Finally, we combined our results with previous inclusion of our results (I2 ⫽ 53.2%, PQ ⫽ 0.008). This
data including data available only as supplementary heterogeneity prevents a sound estimate of the summary
information and data imputed from the available geno- effect size, but it does not question association of the
types but not directly tested in previous studies. These STAT4 SNP with RA, because all studies showed an OR
analyses included, at least, an additional data set for all of ⬎1.0 for this SNP. Two other SNPs showed border-
of the SNPs except MECP2 SNP rs17435 and ITGAM line association with RA: the SNP in the C8orf13–BLK

Table 4. Combined analysis of allele frequency differences for SLE-associated SNPs obtained in the current and previous studies (including
imputed genotypes) comparing patients with RA and controls*
SNP (locus) No. of RA patients No. of controls OR (95% CI) P Ref.
rs7574865 (STAT4)† 17,565 18,315 1.25 (1.2–1.3) 1.1 ⫻ 10⫺34 31,38–46‡
rs7574865 (STAT4)§ 16,181 16,509 1.26 (1.2–1.3) 2.9 ⫻ 10⫺34 31,38–46‡
rs13277113 (C8orf13–BLK) 3,494 4,562 1.09 (1.0–1.2) 0.03 31
rs2304256 (TYK2) 3,161 2,763 0.94 (0.9–1.0) NS 18
rs10798269 (1q25.1) 5,006 6,694 0.97 (0.9–1.0) NS 31,46
rs4963128 (KIAA1542) 5,014 6,694 1.01 (1.0–1.1) NS 31,46
rs6445975 (PXK) 5,017 6,695 1.06 (1.0–1.1) 0.04 31,46
rs17266594 (BANK1) 3,550 3,960 0.97 (0.9–1.0) NS 37
rs509749 (LY9) 5,014 6,691 1.04 (1.0–1.1) NS 31,46

* SLE ⫽ systemic lupus erythematosus; SNPs ⫽ single-nucleotide polymorphisms; RA ⫽ rheumatoid arthritis; OR ⫽ odds ratio; 95% CI ⫽ 95%
confidence interval; NS ⫽ not significant.
† Analysis of heterogeneity between studies was possible only for STAT4, for which significant heterogeneity was observed (I2 ⫽ 53.0%, P for
Cochran’s Q statistic [PQ] ⫽ 0.007).
‡ Data from refs. 39 and 46 overlap, and only the largest set from ref. 39 was used here.
§ I2 ⫽ 53.2%, PQ ⫽ 0.008, not including data from the present study.

172
 Procedimiento experimental y resultados

2562 SUAREZ-GESTAL ET AL

locus for which ⬃8,000 subjects have been analyzed (P ⫽ factors have been independently confirmed [19,35]).
0.03) and the SNP in PXK, with data from ⬎11,000 Therefore, our specific analysis together with the meta-
subjects (P ⫽ 0.04). analysis including previous data allow for a more con-
clusive assessment that reinforces the SLE specificity of
these genetic factors in relation to RA.
DISCUSSION
Our study has enough power to detect effect sizes
During the last decades, evidence supporting a corresponding to an OR between 1.15 and 1.20 for the
common genetic component for a diversity of auto- SNPs in autosomes and 1.24 for the MECP2 SNP in
immune diseases has been continuously investigated chromosome X. This is in the range of the weakest
(10,11,15,16,23). The genetic factors that were associ- detectable effects by analysis of the largest RA sample
ated with a certain disease were considered good candi- collections, such as the North American Rheumatoid
dates for the other diseases in the group, and they were Arthritis Consortium family collection and the Epidemi-
systematically examined. This practice could have intro- ological Investigation of Rheumatoid Arthritis (36).
duced a bias supporting the commonality hypothesis, Combining our results with those from previous studies
because extensive investigation of the same factors in (including imputed data) increased the power. Two
multiple diseases could have led to some associations weak association signals with ORs of 1.09 and 1.06 were
just by chance. This is likely in the context of the lack of detected in the C8orf13–BLK and PXK loci, respectively.
reproducibility that until recently characterized genetics It is therefore possible that SNP effects below these sizes
studies of complex diseases (24). Accordingly, conflict- could have escaped our detection. In this case, the
ing results have been the rule. Nowadays, genetics eventual RA-associated SNPs would be of lower signif-
studies have achieved a high degree of reproducibility icance for RA than for SLE disease, in which the
due to a significant increase in sample size and to more reported ORs for these SNPs have been larger than 1.19,
strict thresholds for claiming association (25). In addi- with the exception of single reports that did not replicate
tion, association across the genome has been analyzed in the LY9 and TYK2 associations (19,35). It is also possible
an unbiased manner (25). These developments gave us that different polymorphisms in the same gene are
the opportunity to address the question of genetic involved in different diseases, as indicated by a recent
commonality between RA and SLE with a new set of report of association of BANK1 SNPs with RA in a study
solidly established genetic factors. that did not show association with the rs17266594 SNP
The results provide evidence against widespread that we examined here (37).
sharing of genetic factors between RA and SLE. Of the Another possibility we have addressed is that the
9 newly examined SLE genetic factors, none was found sharing of genetic factors is restricted to specific sub-
to be associated with RA. This lack of association groups of patients with RA, perhaps with more similarity
persisted after a meta-analysis including previous data, with SLE. This is what happens with polymorphisms in
which makes it unlikely that any of the 9 representative IRF5 that are associated with SLE and with a not-fully-
SNPs have an effect in RA similar to that observed in defined subgroup of patients with RA (17,18). However,
SLE. our analysis did not identify any clear association of this
In retrospect, it could be contended that our type. There were some association signals in the strati-
findings were expected, given the identification of these fied analyses, but only differences in the C8orf13–BLK
genetic factors in the SLE genome-wide association SNP in patients with sicca syndrome remained signifi-
study (26–28) and not in the RA genome-wide associa- cant after correction. Unfortunately, no stratified data
tion study (29–31). However, the lack of significant were available in previous reports that would allow us to
association in a genome-wide association study does not draw more sound conclusions by increasing statistical
mean the lack of any association, because genome-wide power through meta-analysis.
association studies apply strict thresholds for signifi- In summary, the genetic factors in the HLA,
cance, and coverage of the different SLE and RA PTPN22, 6q23, IRF5, and STAT4 loci are shared by SLE,
genome-wide association studies was not identical (i.e., RA, and other immune-mediated diseases (5,6). How-
only 1 of the 10 SNPs studied here was included in the ever, none of the other 9 recently identified SLE genetic
largest RA genome-wide association study [31]). In factors examined here showed association with RA.
addition, 3 SLE genetic factors explored here, TYK2 These results indicate that the genetic component of
(32), MECP2 (33), and LY9 (34), were not found in the each of these 2 diseases contributes significantly to the
SLE genome-wide association study (although the first 2 different disease phenotypes. This is an idea that is not

173
 Factores genéticos asociados con predisposición a LES

RA GENETIC INDEPENDENCE FROM SLE 2563

new but that lacked experimental support (10). The 11. Becker KG. The common variants/multiple disease hypothesis of
common complex genetic disorders. Med Hypotheses 2004;62:
magnitude of the differential component cannot be 309–17.
estimated yet, because a large fraction of the heritability 12. Lin JP, Cash JM, Doyle SZ, Peden S, Kanik K, Amos CI, et al.
of RA and SLE has not been defined. More precise Familial clustering of rheumatoid arthritis with other autoimmune
estimates will be possible once the causal variants of diseases. Hum Genet 1998;103:475–82.
13. Payami H, Joe S, Thomson G. Autoimmune thyroid disease in
each of the genetic factors are identified. It is reasonable type I diabetic families. Genet Epidemiol 1989;6:137–41.
to expect that further genetic research will provide a 14. Fernando MM, Stevens CR, Walsh EC, De Jager PL, Goyette P,
clearer definition of what molecules and pathways are Plenge RM, et al. Defining the role of the MHC in autoimmunity:
a review and pooled analysis. PLoS Genet 2008;4:e1000024.
shared or specific in the pathogenesis of RA and SLE, 15. Becker KG, Simon RM, Bailey-Wilson JE, Freidlin B, Biddison
allowing for better management of these 2 rheumatic WE, McFarland HF, et al. Clustering of non-major histocompat-
diseases. ibility complex susceptibility candidate loci in human autoimmune
diseases. Proc Natl Acad Sci U S A 1998;95:9979–84.
16. Griffiths MM, Encinas JA, Remmers EF, Kuchroo VK, Wilder
RL. Mapping autoimmunity genes. Curr Opin Immunol 1999;11:
ACKNOWLEDGMENT 689–700.
We thank the sample donors for their generous collab- 17. Dieguez-Gonzalez R, Calaza M, Perez-Pampin E, de la Serna AR,
Fernandez-Gutierrez B, Castaneda S, et al. Association of inter-
oration.
feron regulatory factor 5 haplotypes, similar to that found in
systemic lupus erythematosus, in a large subgroup of patients with
rheumatoid arthritis. Arthritis Rheum 2008;58:1264–74.
AUTHOR CONTRIBUTIONS
18. Sigurdsson S, Padyukov L, Kurreeman FA, Liljedahl U, Wiman
All authors were involved in drafting the article or revising it AC, Alfredsson L, et al. Association of a haplotype in the
critically for important intellectual content, and all authors approved promoter region of the interferon regulatory factor 5 gene with
the final version to be published. Dr. Gonzalez had full access to all of rheumatoid arthritis. Arthritis Rheum 2007;56:2202–10.
the data in the study and takes responsibility for the integrity of the 19. Suarez-Gestal M, Calaza M, Endreffy E, Pullmann R, Ordi-Ros J,
data and the accuracy of the data analysis. Domenico Sebastiani G, et al. Replication of recently identified
Study conception and design. Suarez-Gestal, Gonzalez. systemic lupus erythematosus genetic associations: a case control
Acquisition of data. Dieguez-Gonzalez, Perez-Pampin, Pablos, Na- study. Arthritis Res Ther 2009;11:R69.
varro, Narvaez, Marenco, Herrero-Beaumont, Fernandez-Gutierrez, 20. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Lamas, Rodriguez de la Serna, Ortiz, Carreño, Cañete, Caliz, Blanco, Cooper NS, et al. The American Rheumatism Association 1987
Balsa, Gomez-Reino, Gonzalez. revised criteria for the classification of rheumatoid arthritis.
Analysis and interpretation of data. Suarez-Gestal, Calaza, Gomez- Arthritis Rheum 1988;31:315–24.
Reino, Gonzalez. 21. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and
visualization of LD and haplotype maps. Bioinformatics 2005;21:
263–5.
REFERENCES 22. Dupont WD, Plummer WD Jr. Power and sample size calcula-
tions: a review and computer program. Control Clin Trials 1990;
1. Gregersen PK. Genetics of rheumatoid arthritis: confronting 11:116–28.
complexity. Arthritis Res 1999;1:37–44. 23. Raman K, Mohan C. Genetic underpinnings of autoimmunity:
2. Nath SK, Kilpatrick J, Harley JB. Genetics of human systemic lessons from studies in arthritis, diabetes, lupus and multiple
lupus erythematosus: the emerging picture. Curr Opin Immunol sclerosis. Curr Opin Immunol 2003;15:651–9.
2004;16:794–800. 24. Ioannidis JP, Ntzani EE, Trikalinos TA, Contopoulos-Ioannidis
3. Ronnblom L, Pascual V. The innate immune system in SLE: type
DG. Replication validity of genetic association studies. Nat Genet
I interferons and dendritic cells. Lupus 2008;17:394–9.
2001;29:306–9.
4. Malmstrom V, Trollmo C, Klareskog L. The additive role of innate
25. Todd JA. Statistical false positive or true disease pathway? Nat
and adaptive immunity in the development of arthritis. Am J Med
Genet 2006;38:731–3.
Sci 2004;327:196–201.
5. Bowes J, Barton A. Recent advances in the genetics of RA 26. International Consortium for Systemic Lupus Erythematosus Ge-
susceptibility. Rheumatology (Oxford) 2008;47:399–402. netics (SLEGEN), Harley JB, Alarcon-Riquelme ME, Criswell
6. Rhodes B, Vyse TJ. The genetics of SLE: an update in the light of LA, Jacob CO, Kimberly RP, et al. Genome-wide association scan
genome-wide association studies. Rheumatology (Oxford) 2008; in women with systemic lupus erythematosus identifies suscepti-
47:1603–11. bility variants in ITGAM, PXK, KIAA1542 and other loci. Nat
7. Graham RR, Cotsapas C, Davies L, Hackett R, Lessard CJ, Leon Genet 2008;40:204–10.
JM, et al. Genetic variants near TNFAIP3 on 6q23 are associated 27. Kozyrev SV, Abelson AK, Wojcik J, Zaghlool A, Linga Reddy
with systemic lupus erythematosus. Nat Genet 2008;40:1059–61. MV, Sanchez E, et al. Functional variants in the B-cell gene
8. Musone SL, Taylor KE, Lu TT, Nititham J, Ferreira RC, Ortmann BANK1 are associated with systemic lupus erythematosus. Nat
W, et al. Multiple polymorphisms in the TNFAIP3 region are Genet 2008;40:211–6.
independently associated with systemic lupus erythematosus. Nat 28. Hom G, Graham RR, Modrek B, Taylor KE, Ortmann W, Garnier
Genet 2008;40:1062–4. S, et al. Association of systemic lupus erythematosus with C8orf13-
9. Fernandez A, Quintana G, Rondon F, Restrepo JF, Sanchez A, BLK and ITGAM-ITGAX. N Engl J Med 2008;358:900–9.
Matteson EL, et al. Lupus arthropathy: a case series of patients 29. Raychaudhuri S, Remmers EF, Lee AT, Hackett R, Guiducci C,
with rhupus. Clin Rheumatol 2006;25:164–7. Burtt NP, et al. Common variants at CD40 and other loci confer
10. Gregersen PK, Behrens TW. Genetics of autoimmune diseases: risk of rheumatoid arthritis. Nat Genet 2008;40:1216–23.
disorders of immune homeostasis. Nat Rev Genet 2006;7:917–28. 30. Plenge RM, Cotsapas C, Davies L, Price AL, de Bakker PI, Maller

174
 Procedimiento experimental y resultados

2564 SUAREZ-GESTAL ET AL

J, et al. Two independent alleles at 6q23 associated with risk of TW, et al. STAT4 and the risk of rheumatoid arthritis and systemic
rheumatoid arthritis. Nat Genet 2007;39:1477–82. lupus erythematosus. N Engl J Med 2007;357:977–86.
31. Wellcome Trust Case Control Consortium. Genome-wide associ- 40. Barton A, Thomson W, Ke X, Eyre S, Hinks A, Bowes J, et al.
ation study of 14,000 cases of seven common diseases and 3,000 Re-evaluation of putative rheumatoid arthritis susceptibility genes
shared controls. Nature 2007;447:661–78. in the post-genome wide association study era and hypothesis of a
32. Sigurdsson S, Nordmark G, Goring HH, Lindroos K, Wiman AC, key pathway underlying susceptibility. Hum Mol Genet 2008;17:
Sturfelt G, et al. Polymorphisms in the tyrosine kinase 2 and 2274–9.
interferon regulatory factor 5 genes are associated with systemic 41. Kobayashi S, Ikari K, Kaneko H, Kochi Y, Yamamoto K, Shimane
lupus erythematosus. Am J Hum Genet 2005;76:528–37. K, et al. Association of STAT4 with susceptibility to rheumatoid
33. Sawalha AH, Webb R, Han S, Kelly JA, Kaufman KM, Kimberly arthritis and systemic lupus erythematosus in the Japanese popu-
RP, et al. Common variants within MECP2 confer risk of systemic lation. Arthritis Rheum 2008;58:1940–6.
42. Orozco G, Alizadeh BZ, Delgado-Vega AM, Gonzalez-Gay MA,
lupus erythematosus. PLoS ONE 2008;3:e1727.
Balsa A, Pascual-Salcedo D, et al. Association of STAT4 with
34. Cunninghame Graham DS, Vyse TJ, Fortin PR, Montpetit A, Cai
rheumatoid arthritis: a replication study in three European popu-
YC, Lim S, et al. Association of LY9 in UK and Canadian SLE
lations. Arthritis Rheum 2008;58:1974–80.
families. Genes Immun 2008;9:93–102.
43. Martinez A, Varade J, Marquez A, Cenit MC, Espino L, Per-
35. Cunninghame Graham DS, Akil M, Vyse TJ. Association of digones N, et al. Association of the STAT4 gene with increased
polymorphisms across the tyrosine kinase gene, TYK2 in UK SLE susceptibility for some immune-mediated diseases. Arthritis
families. Rheumatology (Oxford) 2007;46:927–30. Rheum 2008;58:2598–602.
36. Plenge RM, Padyukov L, Remmers EF, Purcell S, Lee AT, 44. Zervou MI, Sidiropoulos P, Petraki E, Vazgiourakis V, Kra-
Karlson EW, et al. Replication of putative candidate-gene associ- soudaki E, Raptopoulou A, et al. Association of a TRAF1 and a
ations with rheumatoid arthritis in ⬎4,000 samples from North STAT4 gene polymorphism with increased risk for rheumatoid
America and Sweden: association of susceptibility with PTPN22, arthritis in a genetically homogeneous population. Hum Immunol
CTLA4, and PADI4. Am J Hum Genet 2005;77:1044–60. 2008;69:567–71.
37. Orozco G, Abelson AK, Gonzalez-Gay MA, Balsa A, Pascual- 45. Palomino-Morales RJ, Rojas-Villarraga A, Gonzalez CI, Ramirez
Salcedo D, Garcia A, et al. Study of functional variants of the G, Anaya JM, Martin J. STAT4 but not TRAF1/C5 variants
BANK1 gene in rheumatoid arthritis. Arthritis Rheum 2009;60: influence the risk of developing rheumatoid arthritis and systemic
372–9. lupus erythematosus in Colombians. Genes Immun 2008;9:
38. Lee HS, Remmers EF, Le JM, Kastner DL, Bae SC, Gregersen 379–82.
PK. Association of STAT4 with rheumatoid arthritis in the Korean 46. Plenge RM, Seielstad M, Padyukov L, Lee AT, Remmers EF,
population. Mol Med 2007;13:455–60. Ding B, et al. TRAF1-C5 as a risk locus for rheumatoid arthritis:
39. Remmers EF, Plenge RM, Lee AT, Graham RR, Hom G, Behrens a genomewide study. N Engl J Med 2007;357:1199–209.

175
 Procedimiento experimental y resultados

Follow-up case-control study of the TNFAIP3 association

with Rheumatoid Arthritis: possible role of anti-nuclear
antibody status and differences with other diseases

Marian Suarez-Gestal1, Manuel Calaza1, Rebeca Dieguez-Gonzalez1, Gabriel Herrero-

Beaumont2, Juan D Cañete3, Ana María Ortiz4, Jose Luis Marenco5, Rafael Caliz6,
Benjamin Fernandez-Gutierrez7, Javier Narvaez8, Arturo R de la Serna9, Luis Carreño10,
Alejandro Balsa11, Francisco J Blanco12, Eva Perez-Pampin1, Beatriz Joven13, Federico
Navarro14, Juan J Gomez-Reino1,15 and Antonio Gonzalez1

1 Laboratorio de Investigacion 10 and Rheumatology Unit. Instituto Investigacion

Sanitaria-Hospital Clinico Universitario de Santiago. Xantiago de Compostela. Spain.
[email protected]; [email protected]; [email protected];
[email protected]
2 Rheumatology Unit. Fundacion Jimenez Diaz. Madrid. Spain. [email protected]
3 Rheumatology Unit Hospital Clinic. Barcelona. Spain. [email protected]
4 Rheumatology Unit. Hospital Universitario de la Princesa. Madrid. Spain.
[email protected]
5 Rheumatology Unit. Hospital Universitario de Valme. Sevilla. Spain.
[email protected]
6 Rheumatology Unit. Hospital Universitario Virgen de las Nieves. Granada. Spain.
[email protected]
7 Rheumatology Unit. Hospital Clinico San Carlos. Madrid. Spain.
[email protected]
8 Rheumatology Unit. Hospital Universitario de Bellvitge. Barcelona. Spain.
[email protected]
9 Rheumatology Unit. Hospital Santa Creu e San Pau. Barcelona. Spain.
[email protected]
10 Rheumatology Unit. Hospital Universitario Gregorio Marañon. Madrid. Spain.
[email protected]
11 Rheumatology Unit. Hospital La Paz . Madrid. Spain. [email protected]
12 Laboratorio de Investigación Osteoarticular y del Envejecimiento. INIBIC-Complejo
Hospitalario Universitario A Coruña. Spain. [email protected]
13 Rheumatology Unit. Hospital 12 de Octubre. Madrid. Spain.
[email protected]
14 Rheumatology Unit. Hospital Universitario Virgen Macarena. Sevilla. Spain.
[email protected]
15 Department of Medicine. University of Santiago. Santiago de Compostela. Spain.
[email protected]

Corresponding author:
Antonio Gonzalez
Laboratorio de Investigacion 10
Hospital Clinico Universitario de Santiago

177
Factores genéticos asociados con predisposición a LES

Travesia de Choupana sn.

15706-Santiago de Compostela
Spain
Tfn: 34 981 950 903
Fax: 34 981 951 068
[email protected]
[email protected]

178
 Procedimiento experimental y resultados

ABSTRACT

Introduction: Recent studies have shown that TNFAIP3 is associated with several

autoimmune diseases and pointed to a nsSNP, rs2230926, as the causal polymorphism

in SLE, but not in psoriasis. We aimed to complete analysis of this gene in RA.

Methods: Five TNFAIP3 SNPs, including the nsSNP associated with SLE and the SNP

associated with psoriasis, rs610604, and a PERP SLE-associated SNP were analyzed in

1657 patients with RA and 1638 controls of Spanish ancestry. Data were complemented

with genotypes for other SNPs previously studied in the same samples. Stratification of

patients by gender, ACPA, RF, ANA status and by HLA-DRB1 genotypes was done.

Results: Association was observed with rs610604, but not with SLE associated SNPs or

haplotypes. However, association with rs610604 differed from the previously reported

in psoriasis in direction of change. Haplotype analysis and genetic models of association

indicated that the rs610604 SNP reflects best the association between RA and

TNFAIP3. ANA status identified differential association of SNPs in the 6q23 region

better than ACPA status, although both were correlated and the associations reinforced

in these stratified analyses were unrelated with the described in SLE.

Conclusions: The association of TNFAIP3 with RA was different from the observed in

SLE and in psoriasis. Identification of the involved mechanisms will unravel the

relationships between these autoimmune diseases. In addition, ANA status was the best

discriminator of differential associations in the 6q23 region. Therefore, ANA status

could be useful to understand the known genetic heterogeneity of RA patients.

179
Factores genéticos asociados con predisposición a LES

INTRODUCTION

Recent research has uncovered several rheumatoid arthritis (RA) genetic factors that are

consistently replicated in successive studies [1]. This reproducibility allows for

experiments aimed to discover molecular mechanisms and therapeutic and clinical

implications. One of these confirmed RA susceptibility factors is particularly intriguing

because it has been identified in a region of chromosome 6q23 devoid of genes and

because it includes variants showing two independent effects [2-4]. These two effects

are identified by the rs6920220 SNP, which minor allele is associated with increased

RA susceptibility, and by the rs10499194 SNP (or the rs13207033 SNP), which minor

allele is associated with RA protection. In addition to these clearly confirmed

associations, we and others have found evidence for a combined effect of these two

SNPs in the intergenic locus with SNPs in the tumour necrosis factor-Į-induced protein

3 (TNFAIP3) gene, which is 185 kb downstream [5-6]. TNFAIP3 is an important

protein in the regulation of immune reactions through inhibition of NFkappaB signals at

multiple levels and, therefore, a good candidate for an important role in RA. In addition,

association with the polymorphisms in the 6q23 intergenic region, in TNFAIP3 or in

both has been also observed in systemic lupus erythematosus (SLE) [7-9], psoriasis

[10], celiac disease [11], type 1 diabetes [12] and juvenile idiopatic arthritis [13-14],

indicating that genetic variation in this broad 6q23 region influences susceptibility to

multiple immune-mediated diseases.

We aimed to clarify the complex genetics of RA in this region by adding to our

previous analysis [5], which was done with tagSNPs, the most informative SNPs from

new reports in other diseases and by analysing specific subphenotypes that could be

shared between them. The SLE studies have been the most exhaustive and rewarding

because they have found strong association with SNPs at the two loci, the intergenic

180
 Procedimiento experimental y resultados

region and the TNFAIP3 gene, and with a third locus: the PERP gene that is further 207

Kb downstream from TNFAIP3 [7-9]. In addition, these SLE studies showed strong

association with a TNFAIP3 nsSNP (rs2230926 or its proxy in our samples, rs5029939)

[7-9] that was shown to hinder the inhibitory effect of TNFAIP3 on NFkappaB [8].

These results make of this nsSNP the most likely TNFAIP3 causal variant in SLE

susceptibility and suggests a potential mechanism of action. In addition, our new study

has included other SNPs because psoriasis shows no association with any of the SNPs

that are associated with SLE in the intergenic region or in the TNFAIP3 locus, but with

an unlinked intronic SNP, rs610604 [10]. Consequently, we have included in this

follow-up study of RA the most associated SNP in PERP, rs6922466, and five

TNFAIP3 SNPs: the nsSNP rs2230926 and two other SNPs strongly associated to SLE

rs7749323 and rs5029939, the rs610604 SNP associated to psoriasis and a tagSNP,

rs644340, to cover more completely the locus. In addition, we have explored if

stratification of patients with RA according to the presence of anti-nuclear antibodies

(ANA), and SLE-associated HLA-DRB1 alleles allowed to identify subgroups of

patients with differential association to any of these SNPs. The six SNPs were analyzed

in 1657 patients with RA and 1638 controls. Results showed association with the

psoriasis susceptibility SNP in TNFAIP3, but the direction of change was the opposite.

In addition, there was no association with SLE susceptibility SNPs in TNFAIP3 or in

PERP. Presence of ANA identified subgroups of patients with differential associations

in this region, but these associations did not match with the described in SLE. These

results suggest the possibility that the causal variants in this locus may be different in

RA, psoriasis and SLE.

MATERIAL AND METHODS

181
Factores genéticos asociados con predisposición a LES

DNA samples: Samples used in this study (1657 patients with RA and 1638 controls)

have already been described [5]. All patients met the revised American College of

Rheumatology 1987 classification criteria [15]. Participants gave their written informed

consent and the respective ethical committees approved the study.

Genotyping: Six SNPs were genotyped in multiplex PCR and single-base extension

reactions as described [5]. PCR primers and hybridization probes are detailed in

supplementary table 1. HLA-DRB1 was studied by Sequence Based Typing (SBT)

using the AlleleSEQR HLA-DRB1 Typing kit (Abbott, Germany), which includes a

single PCR amplification for all the alleles of the second exon of DRB1 and

bidirectional sequencing. Samples with ambiguous genotypes due to the impossible

discrimination between combinations of different pairs of alleles were additionally

sequenced with group-specific primers (AlleleSEQR HLA-DRB1 GSSP, Abbott,

Germany). Some samples required additional disambiguation based on a large excess in

the frequency of one of the allele combinations over the alternative in our Spanish

sample.

Statistical analysis: Quality control, comparison of allele and genotype frequency data,

conditional logistic regression, haplotype analysis and statistical power estimation were

carried out as described [5]. Data from our previous study on this region was included

in the conditional and haplotype analyses.

RESULTS

The five TNFAIP3 SNPs and one PERP SNP were genotyped with a 99.9 % call rate

and were in accordance with Hardy-Weinberg equilibrium in controls. Comparison of

allele frequencies between the 1657 patients with RA and the 1638 controls showed

weak significant differences only in two SNPs: rs610604 and rs644340 (O.R. = 0.89

182
 Procedimiento experimental y resultados

and 0.90, respectively; Table 1) that are, respectively, the SNP associated with psoriasis

and the tagSNP included to complete coverage of the locus. Both showed a modest

protective effect of their minor allele. No association was observed with any of the other

three TNFAIP3 SNPs that are the most associated in SLE studies (Table 1). As these

three SLE susceptibility SNPs have minor allele frequencies below 5 %, the power of

these analyses could be a matter of concern. However, it was possible to exclude with

great confidence a similar effect than the reported in SLE (power > 99.9 % to detect an

effect of O.R. = 2.0 with p < 0.001). This is consequence of the large size of our study

and the considerable magnitude of the effects reported in SLE (O.R. • 2.0)[7-9]. In

addition, the PERP rs6922466 SNP did not show allele differences between patients

with RA and controls in our study. Again, power of our study was enough (> 90 % for p

< 0.001) to detect an effect as large as the reported in SLE (O.R. = 0.77)[8]. Genotype

analyses yielded similar results (not shown).

Integration of these and our previous results showed that rs610604 was the TNFAIP3

SNP most strongly associated with RA. However, it was in tight LD with other two

associated SNPs, rs582757 and rs644340, and their individual effects were redundant by

conditional logistic regression analysis (not shown). That is, association with any of the

three SNPs disappeared when any of the other two was included in a multilocus model.

These results suggest that there is a single causal polymorphism in TNFAIP3 for the RA

association.

Analysis of TNFAIP3 haplotypes with the ten SNPs (five from our previous report, and

five from this study) showed no difference between cases and controls (Table 2). In

contrast, the SLE associated haplotype defined by the rare allele of rs7749323 was not

associated with RA. We also combined the enlarged data from the TNFAIP3 locus with

our results from the 6q23 intergenic locus [5]. As could be expected by the redundancy

183
Factores genéticos asociados con predisposición a LES

between rs582757, rs610604 and rs644340, any of these three SNPs was present in the

best regression logistic models together with SNPs of the intergenic locus (not shown).

These models showed association with RA in both the 6q23 intergenic region and in the

TNFAIP3 locus through epistasis or interdependence of their effects. No contribution

from the newly studied SNPs in TNFAIP3 or in PERP was found. Therefore, none of

the analyses performed, single SNP, haplotype or multilocus, have provided new

independent associations or new interactions over the already described.

Given the discrepant associations between SLE and RA in the TNFAIP3 locus we were

specially interested in analyzing RA subphenotypes, with particular interest in patients

with SLE-like characteristics (clinical features are shown in supplementary table 2). In

our previous analyses we stratified by gender, ACPA and RF status and we detected

associations between women and ACPA positive patients and SNPs of the intergenic

locus, but none with SNPs of the TNFAIP3 locus. Similarly, none of the new SNPs was

differentially associated when stratified by these three clinical variables (not shown). In

addition, we have analyzed all the SNPs after stratification by the presence of ANA, the

shared epitope and SLE-associated HLA-DRB1 alleles (*0301, *1501 and *0801).

Stratification by ANA status identified markedly different subgroups of patients

regarding association with the intergenic and the TNFAIP3 loci. There were 5 SNPs

with different frequencies between ANA positive and ANA negative patients (Table 3).

In addition, 4 SNPs were different between ANA positive patients and controls, and 2

between ANA negative patients and controls. Surprisingly, none of the three TNFAIP3

SNPs associated with SLE, rs2230926, rs7749323 and rs5029939, were significantly

influenced by stratification according to ANA status. Conditional analysis showed that

the 4 SNPs different in ANA positive patients were explained by rs13207033, which

showed the most marked difference with controls. This SNP was associated only with

184
 Procedimiento experimental y resultados

the RA patients that were ANA positive in our collection of samples (Table 3). On the

other side, the two SNPs that were specially associated with the ANA negative

subgroup of patients were redundant, although rs610604 explained better the association

in conditional analysis than rs11970361 (not shown). This SNP, which explained all

association in the TNFAIP3 locus, was only associated in the ANA negative subgroup,

with no difference between the ANA positive patients and the controls (Table 3). None

of the stratifications on HLA alleles identified any differential association in the two

loci (not shown).

The marked effect of ANA status motivated us to test if the ANA positive patients were

different from the ANA negative ones in the presence of ACPA, RF, SE alleles and SLE

associated HLA-DRB1 alleles (Table 4). The comparisons showed that ANA positive

patients were similar to the ANA negative patients in all these features except in the

presence of RF that was more common among the ANA positive subjects. Therefore,

there was not any indication to suspect of the classification as RA of the ANA positive

patients.

Our previous analyses have showed that association of rs13207033 was restricted to

ACPA positive patients. Therefore, we checked how the two subgroups of antibody

positive patients were related. Most ANA positive patients were also ACPA positive

(66.2 %, Table 4), but association was not different in the ANA positive patients that

were ACPA negative and in the positive for the two autoantibodies (O.R. = 0.67 vs

0.74, respectively). Therefore, the ANA status had a more marked effect in association

with this SNP than the ACPA status and was able to explain it entirely.

DISCUSION

Our follow-up study has not identified any new independent association with RA in the

TNFAIP3 locus or in the PERP gene. This indicates that although association in this

185
Factores genéticos asociados con predisposición a LES

region of chromosome 6q23 is complex, it could be tractable. In addition, our study has

helped to clarify it by showing that the pattern of association with RA in TNFAIP3 does

not resemble SLE or psoriasis. The most associated SNP was rs610604, as described in

psoriasis, but the risk alleles were the opposite. The rare allele has been described as

associated with increased risk in psoriasis, but it was associated with protection in RA.

In addition, the SLE susceptibility SNPs were not associated with RA. This lack of

association of the SLE SNPs was observed in spite of a very good power for a similar

effect. Also psoriasis has been found to lack association with the SLE SNPs in

TNFAIP3. This pattern is important because suggests that association of the TNFAIP3

locus with several diseases cannot be assumed to be due to the same polymorphism and

mechanisms. However, these results require replication in independent studies given the

weak association in the locus we have found and lack of concordance with the results of

two recent studies that showed association of RA with the SLE-associated rs2230926,

weak in a UK study (P = 0.03, O.R. = 1.21)[6] and stronger in the Japanese (P = 2.6 x

10-5, O.R. = 1.35)[16] .

The type of comparative analysis between different autoimmune diseases is important

because these diseases share multiple characteristics, but they also have distinctive

features and their identification can be very useful to understand the possibilities and

limitations of transferring knowledge and treatments. The commonality of genetic

factors between autoimmune diseases is supported by multiple shared associations. In

the case of RA and SLE, there is clear evidence of a set of loci that are shared. They

include PTPN22, STAT4, the 6q23 intergenic locus, C8orf13–BLK and PXK, and,

probably, IRF5 and CTLA4 [17-18]. Other associations seem to be specific either of

SLE, as the ITGAM or IRAK1-MECP2 loci, or of RA, as the C5-TRAF1 locus.

Association with HLA-DRB1 is peculiar as it involves different alleles in RA and in

10

186
 Procedimiento experimental y resultados

SLE. As mentioned, our results suggest that association with TNFAIP3 will be of this

type too, present in the two diseases but with different alleles. The genetic relationship

between RA and psoriasis is less clear. They do not share any of the clearly

demonstrated susceptibility loci, not even PTPN22. An apparent exception could have

been association with the TNFAIP3 locus (psoriasis does not show association with

SNPs in the 6q23 intergenic locus) [10], but the same variant showed opposed effects in

our RA patients than the described in psoriasis.

Heterogeneity in the association with the 6q23 region has also been observed within the

patients with RA since the first reports [2-6, 16]. It seems that one of the two

independent associations in the intergenic 6q23 locus, identified by rs13207033 or

rs10499194, is predominant in patients with ACPA [3, 5, 16]. Now, we have found that

it was also more marked in patients with ANA. In fact, the presence of ANA was able to

account for the effect of ACPA status in this association in spite of identifying a much

smaller fraction of the patients. In addition, ANA status was differentially associated

with SNPs in the TNFAIP3 locus, but not with the SLE-associated SNPs in this locus, as

could have been expected. These results are intriguing because they suggest that the

presence of ANA is a possible marker of as subgroup of RA patients and because they

add to the evidence of heterogeneous effects of genetic variation in the 6q23 region.

However, these resutls should be interpreted with caution because not all reports are

concordant in the relationship between ACPA subphenotypes and SNPs in the region

[6], and because there were limitations in our stratification on ANA. These limitations

include the performance of multiple comparisons between subgroups of patients, lack of

ANA data for a fraction of the patients and assessment of ANA status at different times

in the evolution of RA. Specifically, some of the ANA data were obtained after

treatment with TNF antagonists, which is known to induce production of these

11

187
Factores genéticos asociados con predisposición a LES

autoantibodies [19]. On the contrary, we do not find reasons to doubt of the

classification of the ANA positive patients as genuine RA: apart from being classified

as RA on clinical grounds their frequencies of ACPA, RF and SE were typical of RA.

CONCLUSIONS

In summary, this follow-up study indicates that only three association signals in the

6q23 region contribute to RA susceptibility: two in the intergenic locus and one in

TNFAIP3, as previously reported [6, 17]. Participation of the SLE-associated SNP in

PERP was excluded. Results also suggest that the association in TNFAIP3 is different

from the described in SLE and in psoriasis, although this result will require

confirmation. Our study also highlights the possibility that ANA status could be useful

in stratifying RA patients because it identified differential patterns of association in the

two 6q23 loci.

ABBREVIATIONS

TNFAIP3: tumour necrosis factor-Į-induced protein 3

RA: rheumatoid arthritis

SLE: systemic lupus erythematosus

OR: odds ratio

CI: confidence interval

MAF: minor allele frequency

COMPETING INTEREST

The author(s) declare that they have no competing interests.

12

188
 Procedimiento experimental y resultados

AUTHORS’ CONTRIBUTION

MS-G participated in design of the study, genotyped the samples, participated in the

interpretation of the results and in writing the manuscript. MC participated in the

statistical analysis and in the interpretation of results. RD-G performed HLA-DRB1

genotyping. GH-B, J-DC, A-MO, J-LM, RC, BF-G, JN, AR-S, LC, AB, F-JB, EP-P, J-

LP and FN participated in the acquisition of clinical data and collection of samples and

in the analysis and interpretation of results. JJG-R coordinated the acquisition of clinical

data and collection of samples and participated in the analysis and interpretation of

results. AG participated in the design of the study and in the coordination of acquisition

of clinical data and collection of samples, supervised genotyping, statistical analysis,

interpretation of results and writing of the manuscript. All authors read and approved

the final manuscript.

ACKNOWLEDGMENTS

We thank Carmen Pena-Pena for her excellent technical assistance. M.S-G is the

recipient of a FPU pre-doctoral bursary of the Spanish Ministry of Education; M.C. is

the recipient of an “Isabel Barreto” bursary of the Government of Galicia. This project

was supported by grants PI080744 and by RETICS Program, RD08/0075 (RIER) from

the Instituto de Salud Carlos III (Spain) with participation of funds from FEDER

(European Union).

REFERENCES

1. Bowes J, Barton A: Recent advances in the genetics of RA susceptibility.

Rheumatology (Oxford) 2008, 47(4):399-402.
2. Genome-wide association study of 14,000 cases of seven common diseases
and 3,000 shared controls. Nature 2007, 447(7145):661-678.
3. Plenge RM, Cotsapas C, Davies L, Price AL, de Bakker PI, Maller J, Pe'er I,
Burtt NP, Blumenstiel B, DeFelice M, Parkin M, Barry R, Winslow W, Healy C,

13

189
Factores genéticos asociados con predisposición a LES

Graham RR, Neale BM, Izmailova E, Roubenoff R, Parker AN, Glass R,

Karlson EW, Maher N, Hafler DA, Lee DM, Seldin MF, Remmers EF, Lee AT,
Padyukov L, Alfredsson L, Coblyn J et al: Two independent alleles at 6q23
associated with risk of rheumatoid arthritis. Nat Genet 2007, 39(12):1477-
1482.
4. Thomson W, Barton A, Ke X, Eyre S, Hinks A, Bowes J, Donn R, Symmons D,
Hider S, Bruce IN, Wilson AG, Marinou I, Morgan A, Emery P, Carter A, Steer
S, Hocking L, Reid DM, Wordsworth P, Harrison P, Strachan D, Worthington J:
Rheumatoid arthritis association at 6q23. Nat Genet 2007, 39(12):1431-1433.
5. Dieguez-Gonzalez R, Calaza M, Perez-Pampin E, Balsa A, Blanco FJ, Canete
JD, Caliz R, Carreno L, de la Serna AR, Fernandez-Gutierrez B, Ortiz AM,
Herrero-Beaumont G, Pablos JL, Narvaez J, Navarro F, Marenco JL, Gomez-
Reino JJ, Gonzalez A: Analysis of TNFAIP3, a feedback inhibitor of nuclear
factor-kappaB and the neighbor intergenic 6q23 region in rheumatoid
arthritis susceptibility. Arthritis Res Ther 2009, 11(2):R42.
6. Orozco G, Hinks A, Eyre S, Ke X, Gibbons LJ, Bowes J, Flynn E, Martin P,
Wilson AG, Bax DE, Morgan AW, Emery P, Steer S, Hocking L, Reid DM,
Wordsworth P, Harrison P, Thomson W, Barton A, Worthington J: Combined
effects of three independent SNPs greatly increase the risk estimate for RA
at 6q23. Hum Mol Genet 2009, 18(14):2693-2699.
7. Graham RR, Cotsapas C, Davies L, Hackett R, Lessard CJ, Leon JM, Burtt NP,
Guiducci C, Parkin M, Gates C, Plenge RM, Behrens TW, Wither JE, Rioux JD,
Fortin PR, Graham DC, Wong AK, Vyse TJ, Daly MJ, Altshuler D, Moser KL,
Gaffney PM: Genetic variants near TNFAIP3 on 6q23 are associated with
systemic lupus erythematosus. Nat Genet 2008, 40(9):1059-1061.
8. Musone SL, Taylor KE, Lu TT, Nititham J, Ferreira RC, Ortmann W, Shifrin N,
Petri MA, Kamboh MI, Manzi S, Seldin MF, Gregersen PK, Behrens TW, Ma
A, Kwok PY, Criswell LA: Multiple polymorphisms in the TNFAIP3 region
are independently associated with systemic lupus erythematosus. Nat Genet
2008, 40(9):1062-1064.
9. Bates JS, Lessard CJ, Leon JM, Nguyen T, Battiest LJ, Rodgers J, Kaufman
KM, James JA, Gilkeson GS, Kelly JA, Humphrey MB, Harley JB, Gray-
McGuire C, Moser KL, Gaffney PM: Meta-analysis and imputation identifies
a 109 kb risk haplotype spanning TNFAIP3 associated with lupus nephritis
and hematologic manifestations. Genes Immun 2009, 10(5):470-477.
10. Nair RP, Duffin KC, Helms C, Ding J, Stuart PE, Goldgar D, Gudjonsson JE, Li
Y, Tejasvi T, Feng BJ, Ruether A, Schreiber S, Weichenthal M, Gladman D,
Rahman P, Schrodi SJ, Prahalad S, Guthery SL, Fischer J, Liao W, Kwok PY,
Menter A, Lathrop GM, Wise CA, Begovich AB, Voorhees JJ, Elder JT,
Krueger GG, Bowcock AM, Abecasis GR: Genome-wide scan reveals
association of psoriasis with IL-23 and NF-kappaB pathways. Nat Genet
2009, 41(2):199-204.
11. Trynka G, Zhernakova A, Romanos J, Franke L, Hunt KA, Turner G,
Bruinenberg M, Heap GA, Platteel M, Ryan AW, de Kovel C, Holmes GK,
Howdle PD, Walters JR, Sanders DS, Mulder CJ, Mearin ML, Verbeek WH,
Trimble V, Stevens FM, Kelleher D, Barisani D, Bardella MT, McManus R, van
Heel DA, Wijmenga C: Coeliac disease-associated risk variants in TNFAIP3
and REL implicate altered NF-kappaB signalling. Gut 2009, 58(8):1078-
1083.

14

190
 Procedimiento experimental y resultados

12. Fung EY, Smyth DJ, Howson JM, Cooper JD, Walker NM, Stevens H, Wicker
LS, Todd JA: Analysis of 17 autoimmune disease-associated variants in type
1 diabetes identifies 6q23/TNFAIP3 as a susceptibility locus. Genes Immun
2009, 10(2):188-191.
13. Prahalad S, Hansen S, Whiting A, Guthery SL, Clifford B, McNally B, Zeft AS,
Bohnsack JF, Jorde LB: Variants in TNFAIP3, STAT4, and C12orf30 loci
associated with multiple autoimmune diseases are also associated with
juvenile idiopathic arthritis. Arthritis Rheum 2009, 60(7):2124-2130.
14. Hinks A, Eyre S, Ke X, Barton A, Martin P, Flynn E, Packham J, Worthington J,
Thomson W: Overlap of disease susceptibility loci for rheumatoid arthritis
(RA) and juvenile idiopathic arthritis (JIA). Ann Rheum Dis 2009.
15. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, Healey
LA, Kaplan SR, Liang MH, Luthra HS, et al.: The American Rheumatism
Association 1987 revised criteria for the classification of rheumatoid
arthritis. Arthritis Rheum 1988, 31(3):315-324.
16. Shimane K, Kochi Y, Horita T, Ikari K, Amano H, Hirakata M, Okamoto A,
Yamada R, Myouzen K, Suzuki A, Kubo M, Atsumi T, Koike T, Takasaki Y,
Momohara S, Yamanaka H, Nakamura Y, Yamamoto K: The association of a
nonsynonymous single-nucleotide polymorphism in TNFAIP3 with systemic
lupus erythematosus and rheumatoid arthritis in the Japanese population.
Arthritis Rheum 2010, 62(2):574-579.
17. Suarez-Gestal M, Calaza M, Dieguez-Gonzalez R, Perez-Pampin E, Pablos JL,
Navarro F, Narvaez J, Marenco JL, Herrero-Beaumont G, Fernandez-Gutierrez
B, Lamas JR, de la Serna AR, Ortiz AM, Carreno L, Canete JD, Caliz R, Blanco
FJ, Balsa A, Gomez-Reino JJ, Gonzalez A: Rheumatoid arthritis does not
share most of the newly identified systemic lupus erythematosus genetic
factors. Arthritis Rheum 2009, 60(9):2558-2564.
18. Gregersen PK, Amos CI, Lee AT, Lu Y, Remmers EF, Kastner DL, Seldin MF,
Criswell LA, Plenge RM, Holers VM, Mikuls TR, Sokka T, Moreland LW,
Bridges SL, Jr., Xie G, Begovich AB, Siminovitch KA: REL, encoding a
member of the NF-kappaB family of transcription factors, is a newly
defined risk locus for rheumatoid arthritis. Nat Genet 2009, 41(7):820-823.
19. Charles PJ, Smeenk RJ, De Jong J, Feldmann M, Maini RN: Assessment of
antibodies to double-stranded DNA induced in rheumatoid arthritis
patients following treatment with infliximab, a monoclonal antibody to
tumor necrosis factor alpha: findings in open-label and randomized
placebo-controlled trials. Arthritis Rheum 2000, 43(11):2383-2390.

15

191
Factores genéticos asociados con predisposición a LES

Table 1. Comparison of the minor allele frequencies of the five TNAFIP3 and the PERP

SNPs between RA cases and controls

a
MAF % (n/N)
SNP RA patients Controls O.R. (95% C.I.) b P

TNFAIP3

rs2230926 4.9 (161/3312) 4.5 (147/3274) 1.09 (0.9-1.4) ns c

rs5029939 4.8 (158/3308) 4.5 (147/3274) 1.07 (0.8-1.3) ns

rs610604 31.6 (1045/3308) 34.3 (1122/3272) 0.89 (0.8-1.0) 0.020

rs644340 35.7 (1184/3314) 38.3 (1253/3272) 0.90 (0.8-1.0) 0.031

rs7749323 2.7 (89/3314) 2.4 (77/3274) 1.15 (0.8-1.6) ns

PERP

rs6922466 26.3 (871/3310) 27.7 (906/3274) 0.93 (0.8-1.0) ns

a
MAF = Minor Allele Frequency, n = number of minor alleles, N = total number of alleles
b
O.R. = Odds Ratio, C.I. = Confidence Interval
c
ns = not significant

16

192
 Procedimiento experimental y resultados

Table 2. Comparison of the TNFAIP3 haplotype frequencies between patients with RA

and controls

Alleles at each SNP

Controls RA patients
1 2 3 4 5 6 7 8 9 10
N (%) N (%)
T C G C T T A A G G 1150 (35.1%) 1250 (37.7%)
C C G C T T A A G G 843 (25.7%) 837 (25.3%)
T C G C T C G G G G 453 (13.8%) 417 (12.6%)
T C G C T C G G A G 421 (12.9%) 391 (11.8%)
T T C C T T G G G G 178 ( 5.4%) 166 ( 5.0%)
T C C G G T A G G A 72 ( 2.2%) 88 ( 2.7%)
T C C G G T G G G G 46 ( 1.4%) 41 ( 1.2%)
T C C G G T A G G G 23 ( 0.7%) 29 ( 0.9%)
Other haplotypes 90 (2.7%) 95 (2.9%)
Total 3276 (100%) 3314 (100%)

a
Corresponding SNPs: 1: rs600144; 2: rs11970361; 3: rs11970411; 4: rs5029939; 5: rs2230926; 6:

rs582757 ; 7: rs610604 ; 8: rs644340 ; 9: rs17780429; 10: rs7749323

17

193
194
Table 3. Analysis of the allele frequencies in the 6q23 intergenic and TNFAIP3 loci after stratification of patients with RA by ANA status

a + -
MAF % (n/N) ANA vs. controls ANA vs. controls
+ - b + -
SNP ANA ANA Controls O.R. (95% C.I.) P O.R. (95% C.I.) P P ANA vs ANA
rs13207033 23.0 (100/434) 28.2 (305/1082) 29.7 (914/3082) 0.71 (0.6-0.9) 0.0044 0.93 (0.8-1.1) 0.36 0.041
rs6920220 24.4 (110/450) 21.2 (240/1134) 20.1 (639/3184) 1.29 (1.0-1.6) 0.032 1.07 (0.9-1.3) 0.43 0.16
rs694069 33.4 (149/446) 38.7 (436/1126) 40.0 (1276/3188) 0.75 (0.6-0.9) 0.0073 0.95 (0.8-1.1) 0.44 0.05
rs600144 20.9 (95/454) 27.7 (329/1188) 26.8 (857/3202) 0.72 (0.6-0.9) 0.008 1.05 (0.9-1.2) 0.54 0.0051
rs11970361 8.3 (38/458) 4.3 (51/1192) 6.0 (194/3242) 1.42 (1.0-2.0) 0.056 0.70 (0.5-1.0) 0.028 0.0012
rs610604 35.8 (164/458) 30.3 (361/1190) 34.3 (1122/3272) 1.07 (0.9-1.3) 0.52 0.83 (0.7-1.0) 0.013 0.033
Factores genéticos asociados con predisposición a LES

a
MAF = Minor Allele Frequency, n = number of minor alleles, N = total number of alleles
b
O.R. = Odds Ratio, C.I. = Confidence Interval
 Procedimiento experimental y resultados

Table 4. Comparison of the frequency of RA or SLE distinctive characteristics between

ANA positive and negative patients

a
ANA % (n/N)

positive negative P

ACPA + 66.2 (151/228) 59.5 (353/593) 0.08

RF + 78.7 (166/211) 63.0 (349/554) 0.00003

SE + 44.4 (40/90) 54.2 (212/391) 0.09

HLA-DRB1 *0301.*1501.*0801 27.0 (24/89) 26.8 (110/410) 0.9

a
n = number of subjects with the characteristic; N = total number of available subjects with complete
information

Additional files provided with this submission:

Additional file 1: Supplementary Tables.doc, 44K

http://arthritis-research.com/imedia/1742438513355044/supp1.doc

195
196
Supplementary Table 1. Primers and probes used for genotyping the TNFAIP3 and PERP SNPs represented in the 5’ to 3’ direction

PCR primers
Locus SNP Forward Primer Reverse Primer Minisequencing Probe
TNFAIP3 rs5029939 ccctgtgtgctcctccttag tgaatgacaccaactgcaaag TTACCTATGAacaccaactgcaaaggagccatgggaccttggttctagcttaa $
TNFAIP3 rs2230926 ttgctgggtcttacatgcag cccgtttcaacaaattcctg
aggacacagacttggtactgaggaaggcgctgt
TNFAIP3 rs610604 tggatggaccaagattgatt tgtggattatggcaagaattgta TTACCTATGATTGATCGTGGTGATATCCGattgtagaaccattcactgaaatgcaggcctgtgatgaagagct
$
TNFAIP3 rs644340 tagctggaattacaggcgctc aggaggctgaggtgcgcag TTACCTATGATTGATgaggctgaggtgcgcagatcacttaaggccaagagtcaaaaac $
TNFAIP3 rs7749323 gtctgagccttgtccctgag tgggtctcctctcttgtgct ggtagaccatggaatccacattaagaca
PERP rs6922466 gtctgttccgccaccattac acagctgaattcaaaagtgga ttaattgtatcattcagttttgtctggggaagtttttgggttttgttt

Primers were selected with Primer3 and Oligos. They were checked to avoid formation of dimers between the primers included in the reaction.
Factores genéticos asociados con predisposición a LES

$ These oligonucleotides were extended with a 5' tail that has not homology with human sequences (these tails are in capital letters)
 Procedimiento experimental y resultados

Table 2. Clinical characteristics of the patients with RA included in the study

Clinical characteristic (scale) Value Available data

Female (%) 75.0 1509
Age of disease onset (median, IQR) 48, 38-58 1460
Morning stiffness (%) 96.0 1441
Arthritis of 3 or more joint areas (%) 99.7 1441
Arthritis of hand joints (%) 99.3 1441
Symmetric arthritis (%) 99.0 1441
Rheumatoid nodules (%) 20.2 1301
Rheumatoid factor (%) 72.7 1546
Erosions (%) 70.3 1530
S. Sicca (%) 8.8 1533
Interstitial pneumonitis (%) 2.8 1533
Shared epitope (carrier %) 54.3 610
ACPA (%) 66.3 671
ANA (%) 27.8 825
*0301/*0501/*0801 (carrier %) 27.1 546

197
DISCUSIÓN
 Discusión

1. Discusión

El LES es una enfermedad de etiología compleja en la que el componente

genético juega un papel importante, como se ha visto en estudios de agregación
familiar y de gemelos (Lawrence JS y col., 1987; Wandstrat A y col., 2001;
Deapen D y col., 1992). El HLA fue uno de los primeros factores genéticos de
susceptibilidad al LES confirmados. Sin embargo, su contribución es menor que
en otras enfermedades autoinmunes, como la AR. También se ha demostrado la
asociación con LES de IRF5, aunque la complejidad de los efectos descubiertos
no ha permitido todavía esclarecer su papel en la enfermedad. Otras variantes de
susceptibilidad al LES conocidas desde hace años son los factores del
complemento C1q, C2 y C4, los receptores de baja afinidad para la IgG y el
inmunomodulador PTPN22. En los últimos años, los avances en la tecnología
de genotipado han permitido analizar una gran cantidad de SNPs en un gran
número de muestras. En 2008 se han publicado 4 GWAS en LES que han dado
a conocer un número considerable de nuevas variantes de susceptibilidad (Hom
G y col., 2008, SLEGEN y col., 2008, Kozyrev SV y col., 2008 y Graham RR y
col., 2008): ITGAM, KIAA1542, PXK, 1q25.1, C8orf13-BLK, TNFAIP3 y
BANK1. A la vez, estudios de asociación de genes candidato han sugerido la
implicación en el LES de otros genes, como TNFSF4 (Cunninghame Graham
DS y col., 2008a), MECP2-IRAK1 (Jacob CO y col., 2009; Sawalha AH y col.,
2008) y LY9 (Cunninghame Graham DS y col., 2008b). La consolidación de
estas asociaciones necesita de estudios de replicación. Así, uno de los objetivos
de este trabajo ha sido confirmar las nuevas señales de asociación en una
cohorte independiente de muestras de LES. Se seleccionaron para ello 10 SNPs
representativos de 10 factores genéticos (ITGAM, KIAA1542, PXK, 1q25.1,
C8orf13-BLK, STAT4, TYK2, LY9, MECP2 y BANK1). Los resultados obtenidos

201
Factores genéticos asociados con predisposición a LES

confirmaron la asociación con el LES de todos estos factores genéticos, excepto

LY9. Para 6 de ellos (PXK, 1q25.1, C8orf13-BLK, TYK2, MECP2 y BANK1)
esta confirmación fue importante ya que sólo se habían visto asociados en un
único estudio o mostraban una asociación inconsistente.

También se trató de confirmar la existencia de una interacción epistática

entre IRF5 y TYK2 (Hellquist A y col., 2009), ya que se ha sugerido que parte
de la heredabilidad no explicada podría deberse a la interacción entre factores
genéticos. Para ello se utilizó la comparación de los modelos de regresión
logística con y sin el término de interacción y el análisis con el software
LRASSOC, que también compara modelos con y sin interacción. Los resultados
obtenidos no confirmaron la epistasis entre estos dos factores genéticos,
indicando su contribución independiente a la susceptibilidad al LES.

PDCD1 fue el primer factor de susceptibilidad al LES identificado a

partir de estudios de ligamiento. Sin embargo, las publicaciones posteriores han
presentado resultados controvertidos. El polimorfismo más estudiado ha sido el
SNP PD1.3, debido a su localización en una región con posible función de
enhancer (Prokunina L y col., 2002). Con el objetivo de explorar la
funcionalidad de PD1.3 se llevaron a cabo ensayos EMSA y de gen reporter.
Los resultados obtenidos no indicaron un papel funcional para este SNP.

También se buscó una explicación a la heterogeneidad clínica del LES

desde dos perspectivas que tienen en cuenta el componente genético. Por un
lado, se evaluó la influencia de los SNPs confirmados de susceptibilidad al LES
en la prevalencia de 11 variables clínicas: 10 fenotipos definidos por los
criterios de clasificación de la ACR (excepto los ANAs) y la edad de inicio de
la enfermedad. Se encontraron asociaciones de alelos de susceptibilidad con

202
 Discusión

variables clínicas, aunque éstas fueron débiles. Por otra parte, se trató de buscar
si existía una correlación entre las manifestaciones clínicas y la ascendencia
noreuropea o sureuropea de los pacientes. Los resultados confirmaron una
mayor frecuencia de fotosensibilidad en el norte y de artritis en el sur,
sugiriendo una influencia modesta del fondo genético de estas dos
subpoblaciones de europeos en la variabilidad clínica del LES.

Finalmente, se evaluó, mediante un estudio de asociación caso-control, si

los nuevos loci de susceptibilidad al LES se encontraban asociados con AR,
debido a que diversas observaciones sugieren que estas dos enfermedades
comparten una fracción de su componente genético. Los resultados mostraron
que STAT4 es el único factor claramente compartido por ambas enfermedades,
aunque la combinación de datos con estudios previos también sugerían un
efecto modesto de los SNPs de C8orf13-BLK y PXK. Por otra parte, la región
6q23 también se había identificado en AR y LES (Wellcome Trust Case Control
Consortium, 2007; Plenge RM y col., 2007b; Dieguez-Gonzalez R y col., 2009;
Musone SL y col., 2008; Graham RR y col., 2008), aunque las señales de
asociación no coincidían exactamente. Un nuevo estudio del locus TNFAIP3 en
AR mostró que las señales de asociación no coincidían con las publicadas en
LES.

1.1. Confirmación de factores de susceptibilidad al LES

Cuando un gen se encuentra por primera vez asociado a una enfermedad

o su asociación no está clara debido a resultados inconsistentes, son necesarios
los estudios de replicación. De esta forma es posible descartar asociaciones
debidas al azar o a factores subyacentes no detectados. En este sentido, nuestro
objetivo ha sido el de contribuir a la definición de los factores genéticos de

203
Factores genéticos asociados con predisposición a LES

susceptibilidad al LES. Así, se estudiaron los 10 loci siguientes: ITGAM, STAT4,

C8orf13-BLK, BANK1, PXK, KIAA1542, 1q25.1, MECP2, LY9 y TYK2. La
selección de un SNP en cada uno de estos loci se hizo en función de su fuerte
asociación con LES o su posible papel funcional.

Los resultados de este análisis fueron importantes ya que confirmaron de

forma clara la asociación de 9 de los 10 SNPs estudiados, mostrando el mismo
alelo de susceptibilidad que el publicado con anterioridad. Los resultados más
destacables fueron la confirmación de la asociación de TYK2, que hasta el
momento ha sido controvertida; la asociación de MECP2, del que sólo había un
estudio publicado en ese momento; y la asociación de 1q25.1, PXK, BANK1 y
KIAA1542, que sólo habían sido identificados en un GWAS. Sin embargo, no se
confirmó la asociación de LY9 con LES, a pesar de que el estudio tenía potencia
estadística suficiente para replicar esta señal. Tampoco los GWAS observaron
una señal en este locus. Los otros tres genes de susceptibilidad estudiados
(ITGAM, STAT4 y C8orf13-BLK) también fueron replicados y mostraron las
ORs más fuertes. Esto explicaría que estas señales hayan sido confirmadas de
forma más consistente.

El análisis de estos SNPs se llevó a cabo mediante la aproximación de

Mantel-Haenszel, ya que las colecciones de muestras utilizadas proceden de
distintos centros europeos. Esta aproximación combina los efectos del SNP en
las distintas colecciones de casos y controles, permitiendo que exista
heterogeneidad en frecuencias alélicas. La heterogeneidad de efectos entre las
colecciones de muestras se evalúa con el análisis de Breslow-Day. Una P <
0.05 en este test indicaría que alguna colección tiene un efecto extremo, por lo
que tendríamos que excluirla del análisis global. Los resultados obtenidos no

204
 Discusión

mostraron problemas de heterogeneidad para ninguno de los SNPs, por lo que la

agrupación de las distintas colecciones resultó apropiada.

El nsSNP rs2304256 de TYK2 se localiza en el exón 8 del gen, donde

introduce un cambio de valina por fenilalanina en el dominio JH4. Este dominio
es crucial no sólo para la interacción de TYK2 con el receptor de IFNα,
IFNAR1 (Richter MF y col., 1998), sino también para la expresión de IFNAR1
en las membranas celulares (Ragimbeau J y col., 2003). Sin embargo, todavía
no se ha evaluado el posible efecto del nsSNP en estas funciones de TYK2. Este
SNP fue el más asociado en un estudio de ligamiento y de asociación caso-
control de familias escandinavas (Sigurdsson S y col., 2005), pero no se
encontró asociado en otro estudio con familias inglesas (Cunninghame Graham
DSy col., 2007a). Sin embargo, en este segundo estudio se encontró asociación
con un SNP del intrón 7 de TYK2 (rs12720270) que, a su vez, no estaba
asociado en el estudio de las familias escandinavas (Sigurdsson S y col., 2005).
A pesar de que en estos estudios específicos se observan señales de asociación
en TYK2, éstas no aparecen en los GWAS. Así, el GWAS del SLEGEN excluyó
la asociación de rs12720270 (SLEGEN y col., 2008). En este contexto en que se
observan discrepancias en las señales de susceptibilidad y ausencia de
asociación en los GWAS, es donde la importancia de nuestros resultados se
pone de manifiesto al confirmar la asociación del nsSNP. Además, combinando
los resultados de los distintos estudios se observó una asociación clara de
rs2304256 con LES que pasa el umbral de significación de los GWAS (P = 2.1
x 10-11). Con posterioridad a nuestro trabajo, rs2304256 y rs12720270 también
mostraron asociación con LES en un pequeño estudio en finlandeses (Hellquist
A y col., 2009) contribuyendo a la confirmación de TYK2 como factor de
susceptibilidad.

205
Factores genéticos asociados con predisposición a LES

La función de la proteína TYK2 está relacionada con las rutas de

señalización celular. Así, TYK2 es una quinasa de tirosina de la familia Janus
que se encuentra unida al dominio citoplasmático de receptores de citocinas,
mediando la activación de éstos por sus ligandos. Una vez activada, TYK2
fosforila el receptor al que está unida creando sitios de unión para STATs, que
desencadenan la expresión de genes de varias rutas (Yamaoka K y col., 2004).
Las rutas en las que se ha visto implicado TYK2 son la del IFN tipo I, IL6, IL10,
IL12 e IL23. De modo que la deficiencia de TYK2 en ratones lleva a la
alteración de estas rutas y, en consecuencia, a una diferenciación defectuosa de
las células Th1 y acelerada de las Th2 (Minegishi Y y col., 2006).
Investigaciones futuras indicarán cuál de estas rutas es la responsable de que el
alelo de riesgo de TYK2 aumente la susceptibilidad a LES.

La asociación de TYK2 fue descubierta en un estudio de genes que

participan en la ruta del IFN de tipo I, en el que también se descubrió la
asociación de IRF5 con el LES (Sigursson S y col., 2005). Una publicación
reciente observó evidencias de interacción epistática entre TYK2 e IRF5
(Hellquist A y col., 2009). Sin embargo, con nuestros datos no se replicó esta
interacción entre SNPs de TYK2 (rs2304256) e IRF5 (rs10954213, rs10488631,
rs729302) asociados al LES. Por tanto, mientras que otros estudios genéticos o
funcionales no apoyen la epistasis, no está claro si estos dos factores
interaccionan en la misma ruta para conferir una mayor susceptibilidad al LES o
si su aportación a la susceptibilidad es por rutas independientes.

Otra contribución importante del presente estudio fue la confirmación de

la asociación de MECP2. Por una parte, la asociación encontrada en mujeres
(OR = 1.26) es muy similar a la publicada también en mujeres de población
europeo-americana por Sawalha y col. (OR = 1.29) (Sawalha AH y col., 2008).

206
 Discusión

Este resultado proporciona una confirmación necesaria ya que no hay señales de

asociación con este gen en los GWAS. Otro estudio posterior también ayudó a
reforzar este resultado positivo (Webb R y col., 2009). Las dos razones por las
que Sawalha y col. consideraron este gen como posible factor de susceptibilidad
al LES fueron su localización en el cromosoma X y su participación en la
metilación del ADN (Sawalha AH y col., 2008). Esta función podría tener un
papel en el LES porque los genes sensibles a metilación sufren una regulación
anormal en pacientes con esta enfermedad y la proteína que codifica MECP2 se
une de forma específica a secuencias metiladas del ADN reprimiendo la
expresión de los genes que regulan (Klose RJ y col., 2006). Sin embargo,
MECP2 también se une a regiones no metiladas y está asociado con genes que
se transcriben de forma activa (Chahrour M y col., 2008). Por tanto, su papel no
sería específicamente de silenciamiento génico sino, más bien, de regulación de
la transcripción. Por otro lado, Sawalha y col. propusieron que la localización
de MECP2 en el cromosoma X podría explicar el predominio del LES en
mujeres (Sawalha AH y col., 2008). No obstante, MECP2 también está asociado
a LES en hombres, como muestran nuestros resultados. La OR es incluso más
fuerte en hombres (1.82) que en mujeres (1.26), lo que cuestiona la hipótesis de
que este gen contribuye a una mayor prevalencia de LES en mujeres. Esto no
sería sorprendente considerando que MECP2 no se expresa en el cromosoma X
inactivado de las mujeres (D’Esposito M y col., 1996), lo que implicaría que los
niveles de expresión en ambos sexos serían equivalentes.

No se ha determinado ningún papel funcional para los SNPs asociados en

MECP2 y no está claro si el polimorfismo causal afecta a MECP2 o a un gen
cercano y en LD, llamado IRAK1. Este segundo gen podría ser un buen
candidato ya que codifica para un mediador clave en las rutas de señalización de
los receptores TLR/IL1R. Además, SNPs en IRAK1 han mostrado asociación

207
Factores genéticos asociados con predisposición a LES

más fuerte que los de MECP2 (OR > 1.5) (Gateva V y col., 2009; Jacob CO y
col., 2009). Así pues, es importante que estudios futuros traten de determinar
cuál de estos dos genes es el responsable del efecto causal. Después de esto,
todavía quedaría identificar el SNP funcional.

Los SNPs rs10798269 en el locus 1q25.1, rs4963128 en KIAA1542 y

rs6445975 en PXK habían sido hallados en un solo GWAS con valores de P por
debajo de 2 x 10-7 (SLEGEN y col., 2008) y no fueron confirmados en ningún
otro artículo. De ahí la importancia de la confirmación observada en nuestro
estudio con efectos similares a los publicados (OR = 0.81 vs 0.82, 0.84 vs 0.78
y 1.19 vs 1.25, respectivamente). Cabe destacar que ninguno de estos 3
polimorfismos se puede relacionar de forma clara con un posible efecto en la
patogenia del LES. El locus 1q25.1 se localiza en un intervalo ligado al LES,
aunque está lejos de cualquier transcrito conocido. Una relación interesante
existe entre el SNP asociado, rs10798269, y otro gen asociado en un estudio
previo, TNFSF4, ya que sólo se encuentra a 130 kb (Graham DS y col., 2008).
De forma que es posible que la señal identificada como correspondiente a
1q25.1 se deba a este último gen. Una situación similar ocurre con KIAA1542,
que está a unas 20 kb del gen IRF7 y en LD con él. La asociación del primero
puede estar relacionada con la función del segundo como regulador de la
expresión de genes de IFN tipo I (SLEGEN y col., 2008) De hecho,
recientemente, se ha observado que variantes genéticas de la región KIAA1542-
IRF7, en combinación con autoanticuerpos característicos del LES, están
asociadas con altos niveles de IFNα en suero (Salloum R y col., 2010). Por
último, el SNP rs6445975 se localiza en el intrón 5 de PXK. Este gen se expresa
en una amplia variedad de tejidos, pero poco se sabe de su función. Sólo se
conoce que el dominio homólogo a phox se une de manera específica a
fosfatidilinositol 3-fosfato, induciendo la internalización de proteínas en los

208
 Discusión

endosomas para su degradación (Takeuchi H y col., 2010). Por tanto, la

replicación de estas 3 asociaciones aumenta la necesidad de identificar el
polimorfismo causal de cada uno de ellos e investigar sus efectos funcionales.

El SNP rs17266594 en BANK1 fue otro polimorfismo que se encontró

asociado significativamente y que sólo había sido identificado previamente en
un único GWAS (Kozyrev SV y col., 2008). El GWAS en el que se descubrió
era de baja resolución e incluyó la replicación en una segunda colección de
muestras europeas. El SNP rs17266594 fue el más asociado, aunque hay otros 2
posibles SNPs funcionales que también estaban asociados. Nuestros resultados
proporcionaron una replicación independiente de dicho SNP, aunque con un
efecto ligeramente más modesto (OR = 0.83 vs 0.70). Este SNP podría ser por sí
mismo el polimorfismo causal, ya que parece alterar la eficiencia del splicing de
BANK1. Las isoformas alternativas se caracterizan por la pérdida del exón 2 que
codifica para el dominio de unión a IP3R. Pero no ha sido posible discernir entre
los 3 SNPs funcionales asociados porque están en fuerte LD.

BANK1 codifica para una proteína estructural de células B con

repeticiones de anquirina. Esta proteína estaría implicada en la señalización
mediada por el BCR, pero no está claro si ejerce un papel estimulador o
inhibidor de la activación de las células B (Yokoyama K y col., 2002; Aiba Y y
col., 2006). Puede que su efecto dependa de la interacción con otras proteínas de
forma que sean estas interacciones las que determinen el papel o la eficacia de
BANK1 en la ruta de señalización. Una de estas interacciones está detrás de uno
de los ejemplos más claros de epistasis identificados en enfermedades
complejas y consiste en la interacción epistática entre BANK1 y BLK
(Castillejo-Lopez C y col., 2009). Además, esta epistasis está apoyada por

209
Factores genéticos asociados con predisposición a LES

evidencias de interacción física (co-immunoprecipitación y co-localización en

un modelo celular in vitro) entre las dos proteínas y también con IP3R.

El único SNP cuya asociación no se confirmó en nuestro estudio fue

rs509749 en LY9. Este gen se encuentra en 1q23, uno de los locus descritos de
forma más consistente en los estudios de ligamiento de LES (y su región
sinténica en los estudios de ratones) (Kelly JA y col., 2002). La función de LY9
en el sistema inmune consiste en mediar la adhesión entre células T, en cuya
membrana se expresa, y CPAs. En un estudio basado en familias inglesas y
canadienses, el SNP rs509749 mostró la asociación más fuerte de la región 1q23,
pudiendo explicar el ligamiento de ésta con el LES (Cunninghame Graham DS
y col., 2008b). Este SNP es no sinónimo y tiene un impacto predecible en la
función de la proteína al alterar su dominio de unión a SAP/SH2D1a, implicada
en rutas de señalización de células T. Esta evidencia funcional hacía de este
polimorfismo un buen candidato para incluir en nuestro estudio de replicación, a
pesar de que el nivel de significación era notablemente más bajo que el
encontrado para los otros 9 SNPs estudiados (P = 0.002). Esto muestra la
dificultad de replicar asociaciones genéticas con valores de P altos.

Los tres factores genéticos restantes (ITGAM, STAT4 y C8orf13-BLK)

son los que tenían asociaciones más sólidas y que además ya habían sido
confirmadas en uno o más estudios previos. El más asociado fue ITGAM (OR =
1.70), que se había observado previamente en tres estudios (SLEGEN y col.,
2008; Hom G y col., 2008; Nath SK y col., 2008). El SNP que se seleccionó
(rs1143679) fue el de menor P en uno de dichos estudios (donde presentó un
efecto muy similar al observado aquí, OR = 1.74) (Nath SK y col., 2008). Éste
es un nsSNP y se ha hipotetizado que podría alterar la interacción de ITGAM
con sus ligandos, aunque aún no existe ninguna evidencia de ello. ITGAM

210
 Discusión

codifica para una integrina que se une a una amplia variedad de ligandos (Ehlers
MR y col., 2000). Esta molécula media la adhesión leucocitaria, la
trasmigración a través del endotelio y la fagocitosis de moléculas opsonizadas
con C3bi. Esta última función es importante para la eliminación de células
apoptóticas por los macrófagos (Mevorach D y col., 1998), proceso defectuoso
en pacientes con LES (Ren Y y col., 2003) que, por tanto, podría contribuir a la
patogenia de la enfermedad (Casciola-Rosen LA y col., 1994).

El SNP rs7574865, en el tercer intrón de STAT4, mostró la segunda

asociación más fuerte con LES (OR = 1.62). Además, es uno de los SNPs de
susceptibilidad más claramente establecidos por estudios previos (SLEGEN y
col., 2008; Hom G y col., 2008; Remmers EF y col., 2007; Kobayshi S y col.,
2008; Palomino-Morales RJ y col., 2008; Sigurdsson S y col., 2008b; Taylor KE
y col., 2008). Este SNP es sólo uno entre varios SNPs altamente
correlacionados, que forman un haplotipo asociado con LES (Remmers EF y
col., 2008; Sigurdsson S y col., 2008b; Taylor KE y col., 2008). Sin embargo, no
se ha identificado ningún polimorfismo funcional en este locus. Sólo se observó
la relación de rs7574865 con una mayor expresión de STAT4 en osteoblastos
(Sigurdsson S y col., 2008b). Por otra parte, se ha mostrado asociación de los
mismos SNPs con otras enfermedades autoinmunes, incluyendo AR (Hom G y
col., 2008; Remmers EF y col., 2007; Kobayshi S y col., 2008; Lee HS y col.,
2007; Martinez A y col., 2008; Orozco G y col., 2008), SS (Korman BD y col.,
2008), T1D (Martinez A y col., 2008; Korman BD y col., 2008; Zervou MI y
col., 2008a) y enfermedad inflamatoria intestinal (Martinez A y col., 2008). La
relación de STAT4 con enfermedades autoinmunes también se observó en
ratones KO, que son resistentes a múltiples enfermedades autoinmunes,
incluyendo AR. Por el contrario, los modelos de LES sufren una enfermedad
más grave (Jacob CO y col., 2003; Singh RR y col., 2003). Esta repercusión

211
Factores genéticos asociados con predisposición a LES

opuesta en modelos de distintas enfermedades autoinmunes, podría estar

relacionada con la diferenciación de las células T en Th1 o Th2. STAT4 es
esencial para la diferenciación de las Th1 (Nishikomori R y col., 2002). Por
tanto, este factor de transcripción tendría un impacto diferente en la artritis,
enfermedad en la que predominan los efectos de tipo Th1, que en el LES donde
podrían predominar los efectos de tipo Th2. Pero esta interpretación necesita
revisarse debido al descubrimiento del papel fundamental de los linfocitos Th17
en muchas enfermedades autoinmunes y a la asociación de los mismos alelos de
STAT4 con AR y LES.

Por último, el SNP rs13277113 (OR = 1.34) está localizado entre dos
genes que se transcriben en direcciones opuestas, C8orf13 y BLK. Este
polimorfismo se había descrito en el GWAS de Hom y col., con un efecto
similar al encontrado (OR = 1.39) (Hom G y col., 2008). Otros dos estudios
encontraron asociaciones significativas en este locus, uno de ellos con un SNP
en BLK fuertemente ligado a rs13277113 (Graham RR y col., 2008), y el otro
con un SNP independiente (SLEGEN y col., 2008). Estos resultados sugieren la
posibilidad de la existencia de dos efectos genéticos independientes en la región.
El locus también se ha visto asociado recientemente con AR (Gregersen PK y
col., 2009) y esclerosis sistémica (Gourh P y col., 2010). No se ha identificado
ningún polimorfismo que tuviese un efecto funcional. Aún así, se observó que
el alelo de riesgo de rs13277113 se correlaciona con niveles bajos de mRNA de
BLK y altos de C8orf13. Por lo tanto, cualquiera de estos dos efectos podría
tener un papel en el LES. Sin embargo, mientras que C8orf13 es un gen de
función desconocida, BLK es un buen candidato en el LES porque está
implicado en la ruta de señalización del BCR y en la diferenciación de células
pro-B a pre-B (Tretter T y col., 2003). Además, como se comentó anteriormente,
existen evidencias de que BLK interacciona con otro factor de susceptibilidad al

212
 Discusión

LES, BANK1, que interviene igualmente en la ruta de señalización del BCR

(Castillejo-Lopez C y col., 2009). Esta interacción se observó tanto desde el
punto de vista estadístico como físico, detectando la co-localización y co-
inmunoprecipitación entre estas dos moléculas y de ellas con el receptor IP3R,
importante en las rutas de señalización. Por último, se ha observado que el
haplotipo de riesgo de rs13277113 y de otro SNP de la región estaría
relacionado con un defecto en la señalización del BCR y de la ruta NFĸB
(Gourh P y col., 2010). Por lo tanto, parece muy posible que el efecto de esta
asociación esté relacionado con BLK y no con C8orf13.

1.2. Análisis funcionales del SNP asociado a LES, PD1.3

Uno de los factores genéticos de mayor interés en el LES hasta hace poco
fue PDCD1, dado su papel crítico como inmunoregulador en múltiples
enfermedades y su localización en un locus de ligamiento (Prokunina L y col.,
2002; Keir ME y col., 2007; Day CL y col., 2006; Urbani S y col., 2006). El
SNP PD1.3, localizado en el cuarto intrón de este gen, fue propuesto como el
polimorfismo causal responsable de la asociación con LES (Prokunina L y col.,
2002). Esto se debe a que se encuentra en una región con características
compatibles con un enhancer. La región presenta múltiples sitios de unión a
factores de transcripción relacionados con funciones inmunes y 4 repeticiones
en tandem de unos 40 nucleótidos. La única evidencia experimental de que
PD1.3 puede repercutir funcionalmente sobre el gen PDCD1 era un EMSA. En
este ensayo se veía alterada la unión del factor de transcripción RUNX1,
relacionado con la diferenciación hematopoyética (Prokunina L y col., 2002).

Para estudiar el hipotético papel funcional del SNP PD1.3 y el posible

papel de la región como enhancer se realizaron estudios de gen reporter en los

213
Factores genéticos asociados con predisposición a LES

que se analizaron los efectos transcripcionales de construcciones plasmídicas

que incluían el intrón 4 de PDCD1. Se utilizaron 4 construcciones para cada
uno de los alelos, con el intrón 4 en las dos orientaciones, tanto en posición 5’
como 3’ del gen reporter, ya que los enhancer son independientes de su
posición y orientación. Los resultados no mostraron evidencias de que el intrón
4 funcione como enhancer. Además, tampoco se observó un efecto diferencial
de los dos alelos de PD1.3.

Estos resultados negativos pusieron en duda la importancia de la unión de

RUNX1 a PD1.3. Así pues, se repitió el EMSA para comprobar la unión entre
RUNX1 y oligonucleótidos sintéticos con las dos variantes alélicas de PD1.3.
Los resultados confirmaron la unión preferencial del alelo G. Sin embargo, al
comparar esta unión con la de las secuencias control, se pudo ver que es una
unión ineficiente, a pesar de presentar la misma secuencia consenso. Esto llevó
a sospechar que los nucleótidos vecinos a la secuencia consenso podían tener un
papel en la afinidad de RUNX1 por el oligonucleótido. Por ello, se observaron
las secuencias sintéticas que se habían unido a RUNX1 en un ensayo de
afinidad y a partir de las cuales Meyers y col. describieron el sitio consenso de
este factor de transcripción (TGT/cGGT) (Meyers S y col., 1993). Se comprobó
que las bases adenina y timina son más frecuentes que las bases guanina y
citosina, que son las que se encuentran en torno a PD1.3. Esta hipótesis fue
confirmada mediante EMSA, al modificar las sondas originales en dichas
posiciones. Otros autores ya habían evidenciado que los nucleótidos que limitan
la secuencia consenso podían intervenir en la unión de RUNX1 al ADN, lo que
apoyaba nuestros resultados. Así, sugirieron que la secuencia que mejor unía
RUNX1 era el decanucleótido TTTGCGGTTA/T (Thornell A y col., 1991).
Ésta es la misma secuencia que está presente en dos de los oligonucleótidos con

214
 Discusión

los que se observó una mejor afinidad de unión en nuestros experimentos: el

control C1 y el oligonucleótido de PDCD1 modificado, P12m.

Estos resultados muestran las limitaciones de la identificación

bioinformática de los lugares de unión a factores de transcripción. Ésta se basa
en secuencias consenso (Roulet E y col., 1998) o bien en matrices de peso
posicional que recogen la frecuencia de cada nucleótido en cada posición
(Stormo GD y col., 2000). Sin embargo, carecen de información cuantitativa de
la afinidad de unión del factor de transcripción por dicha secuencia. Además, la
especificidad de los sitios de unión puede ser pequeña, ya que la mayoría de
factores de transcripción son miembros de familias cuyos integrantes reconocen
secuencias similares (Rahmann S y col., 2003). En consecuencia, softwares
como TRANSFAC® Professional/Match™ (Biobase Biological Databases)
(Kel AE y col., 2003) predicen un número elevado de posibles lugares de unión,
de los que son funcionales sólo unos pocos (Li Q y col., 2001). De hecho, al
hacer una búsqueda en TRANSFAC® Professional/Match™ de lugares de
unión para RUNX1, se encontraron 70 secuencias que podrían unir este factor
de transcripción a lo largo del gen PDCD1, de las cuales 11 estaban en el intrón
4.

Otra razón para la falta de especificidad de los lugares de unión predichos

es que, en muchos casos, las secuencias de unión a factores de transcripción son
identificadas a partir de ensayos in vitro, como EMSAs. Estos ensayos, al no
estar dentro del contexto celular, tienen una utilidad limitada. Esto se debe a que
no tienen en cuenta otra serie de variables que pueden determinar la unión del
factor de transcripción y, por tanto, la funcionalidad de la región. Tales
variables pueden ser interacciones proteína-proteína o modificaciones de la
cromatina independientes de la secuencia (como metilaciones, posición de los

215
Factores genéticos asociados con predisposición a LES

nucleosomas o modificaciones de histonas). Por todo ello, la identificación de

las dianas funcionales de los factores de transcripción es todavía un reto sin
resolver (Li CC y col., 2006). Un avance en la identificación de estas dianas
consenso, que permite su evaluación in vivo, se ha obtenido con los estudios de
genoma completo que combinan inmunoprecipitación de cromatina (ChIP) con
la hibridación en microarrays (ChIP-on-chip) o con secuenciación (Hollenhorst
PC y col., 2007; Yochum GS y col., 2007). Estos estudios detectan lugares de
unión más grandes que los hexanucleótidos que se solían describir con las
técnicas in vitro. Además, tienen en cuenta la influencia de nucleótidos vecinos,
lo que permite una mayor especificidad de las secuencias identificadas.
Desafortunadamente, los estudios de este tipo realizados hasta el momento no
incluyen RUNX1.

Por otra lado, PD1.3 se encuentra en una región con repeticiones en

tandem, característica que se ha observado en algunos enhancer y que podría
apoyar un posible papel funcional para este polimorfismo (MacKenzie A y col.,
1999; Giambra V y col., 2005; Bellizi D y col., 2005). Sin embargo, los
polimorfismos que alteran la regulación transcripcional llevada a cabo por estas
secuencias son frecuentemente variaciones en el número de copias de dichas
repeticiones en tandem. Es menos probable que un SNP que altere uno de los
sitios de unión de un factor de transcripción en una estructura repetitiva tenga
consecuencias funcionales, ya que sería compensado por la unión de los mismos
factores de transcripción a las otras repeticiones. Desde otro punto de vista, si la
secuencia donde se encuentra PD1.3 fuese un elemento de regulación de
PDCD1, habría sido sometida a selección positiva por su relevancia biológica.
Por tanto, sería una secuencia conservada a lo largo de la evolución de las
especies (Miller W y col., 2007). Éste no es el caso del intrón 4 de PDCD1,
donde no hemos visto ninguna homología con genomas de mamíferos. Aún así,

216
 Discusión

esto no excluiría una posible relevancia funcional, ya que una fracción de los
elementos funcionales no se han conservado. Otra característica de los enhancer
típicos es que se encuentran en posición 5’ ó 3’ al gen o en el primer intrón del
mismo, no habiéndose descrito en otros intrones. Así pues, estas observaciones
junto con los resultados obtenidos en los ensayos de gen reporter y en los
EMSAs cuestionan la relevancia funcional de este sitio en la regulación de la
expresión de PDCD1 y en la susceptibilidad al LES. Al excluirse PD1.3, queda
abierta la posibilidad de que otro polimorfismo de PDCD1 fuese el responsable
de la susceptibilidad. Sin embargo, no hay ningún candidato claro y los GWAS
de LES publicados recientemente no mostraron ninguna señal de asociación en
este locus, por lo que en la actualidad no está confirmado que PDCD1 sea un
factor de susceptibilidad al LES.

1.3. Influencia del componente genético en la variabilidad clínica del

LES

El LES es una enfermedad que muestra una gran heterogeneidad clínica

por razones desconocidas. Sin embargo, parece que el componente genético
contribuye a la variedad de fenotipos (Wallace DJ y col., 2007; Tsao BP y col.,
2004; Sestak AI y col., 2007; Chung SA y col., 2009; Tsao BP y col., 2002;
Scofield RH y col., 2003; Uribe AG y col., 2004; Ramos PS y col., 2006;
Peschken CA y col., 2009). Este efecto no se puede demostrar en los estudios de
asociación caso-control, en los que se tiene en cuenta al conjunto de los
pacientes. De ahí el interés del análisis genético estratificando por las variables
clínicas. Por otro lado, se han identificado dos subpoblaciones europeas bien
diferenciadas desde el punto de vista de los polimorfismos genéticos,
correspondientes a los países del norte y a los del sur (Seldin MF y col., 2006;

217
Factores genéticos asociados con predisposición a LES

Novembre J y col., 2008; Tian C y col., 2008). Esta distinción entre

subpoblaciones europeas puede influenciar a la variabilidad fenotípica del LES.

En primer lugar, los 9 loci asociados con LES que se han estudiado
(ITGAM, KIAA1542, PXK, 1q25.1, C8orf13-BLK, STAT4, TYK2, MECP2 y
BANK1) se analizaron estratificando por las manifestaciones clínicas (10
fenotipos definidos por los criterios de clasificación de la ACR y edad de
aparición de la enfermedad). Las asociaciones observadas fueron débiles y poco
consistentes. La asociación más clara fue la del alelo menor del SNP
rs13277113 de C8orf13-BLK con mayor riesgo de nefritis. Por otra parte,
STAT4 es el factor genético que ha mostrado asociaciones más sólidas con
variables clínicas en varios estudios. Sin embargo, el alelo menor del SNP
rs7574865 de STAT4 sólo mostró asociación con edad temprana de la
enfermedad y una tendencia de asociación con menor susceptibilidad a úlceras
orales. La escasez de asociaciones consistentes se debe, en parte, a las
limitaciones de este tipo de análisis.

Una de las limitaciones de estos análisis de subgrupos consiste en la

reducción del tamaño muestral, que disminuye la probabilidad de encontrar
asociaciones significativas (Guillemin F, 2007; Brookes ST y col., 2001; Moyé
LA, 2003). Otra limitación es el elevado número de comparaciones, que
favorece la aparición de asociaciones debidas al azar. Además, la recogida
retrospectiva de los datos y la variación existente entre las características
clínicas de distintas colecciones de muestras (Taylor KE y col., 2008; Hom G y
col., 2008; Cervera R y col., 2006; Pons-Estel BA y col., 2004; Alarcón GS y
col., 2002; Petri M y col., 1997; Wang F y col., 1997; Al Arfaj AS y col., 2009)
pueden generar asociaciones falsas (Hulley SB, 2007). A pesar de todos estos
inconvenientes hay motivos para el optimismo, pues hay publicaciones con

218
 Discusión

resultados prometedores que asocian factores de susceptibilidad al LES con

algún aspecto especifico de su clínica (Taylor KE y col., 2008; Sigurdsson S y
col., 2008b; Tsao BP y col., 2004; Lauwerys BR y col., 2005; Karassa FB y col.,
2003; Sestak AL y col., 2007).

Los problemas derivados del análisis de subgrupos se trataron de evitar

siguiendo las recomendaciones realizadas en el campo de los ensayos clínicos
(Guillemin F, 2007; Brookes ST y col., 2001; Moyé LA, 2003). Estas
recomendaciones intentan obtener un equilibrio adecuado entre la tasa de falsos
positivos y falsos negativos. Para obtenerlo, se utiliza una aproximación
secuencial; se considera la consistencia y el poder estadístico de los análisis
para la interpretación de los resultados; y se realizan correcciones por el número
de comparaciones. La aproximación secuencial supone que sólo se estudia un
subgrupo de factores de un grupo que ya mostró asociación. Por ello, se decidió
evaluar los 9 SNPs que están asociados con LES en nuestras muestras y que no
habían sido analizadas en relación con la clínica en nuestros estudios previos
(ITGAM, KIAA1542, PXK, 1q25.1, C8orf13-BLK, STAT4, TYK2, MECP2 y
BANK1). Esta es una aproximación práctica, pero no se puede excluir que un
factor genético pueda estar asociado con un fenotipo y no con la enfermedad en
su conjunto. Esto ocurre, por ejemplo, con el polimorfismo no sinónimo
FCGR3A V158F y la nefritis lúpica (Karassa FB y col., 2003). Sin embargo,
estas asociaciones podrán descubrirse más fácilmente en el contexto de GWAS
o estudios de genes candidato en los que se analice de forma específica un
fenotipo particular. Por otra parte, la consistencia de las asociaciones se evaluó
mediante comprobación de su presencia en nuevos subgrupos de pacientes
realizados de forma independiente. Estos subgrupos se pueden realizar de forma
aleatoria, pero se prefirió utilizar una variable como el sexo, que puede estar
relacionada con sesgos y que es un criterio comúnmente utilizado para dividir

219
Factores genéticos asociados con predisposición a LES

pacientes con LES. Los resultados también se interpretaron teniendo en cuenta

la potencia estadística de cada comparación SNP-fenotipo por separado. Esta
potencia depende de la frecuencia alélica del SNP y de la frecuencia de la
variable clínica. Los 9 SNPs tienen frecuencias alélicas similares (15-35 %), por
lo que su efecto en la potencia estadística fue similar. Sin embargo, los criterios
clínicos determinan una gradación de la potencia estadística. Ésta es mayor para
los criterios con frecuencia entorno al 50 %, ya que permiten dividir a los casos
en dos grupos de tamaño similar. Entre ellos se encuentran la edad de aparición
de la enfermedad, la fotosensibilidad o el eritema malar. Sin embargo, los
criterios con frecuencias alélicas más extremas son los que determinan
potencias estadísticas menores. Entre estos criterios, se encuentran el desorden
neurológico (de baja frecuencia), la artritis y el sexo femenino (ambas de alta
frecuencia).

La asociación más clara y consistente, como ya se comentó, fue la del

SNP rs13277113 en C8orf13-BLK con nefritis lúpica, ya que persistió tras
corregir por el número de comparaciones y en los subgrupos de hombres y
mujeres. El mismo SNP también se había evaluado en relación con la clínica en
un GWAS. En dicho estudio, no se encontró ninguna asociación significativa, y
además el efecto tendía a ser opuesto al encontrado aquí en relación con la
nefritis (Hom G y col., 2008). Este resultado discordante puede estar
relacionado con la notable diferencia en la prevalencia de la nefritis entre los
dos estudios. En el GWAS, la prevalencia era significativamente menor (28 %)
que en nuestra colección de muestras (41 %) (P = 2 x 10-12). Por lo tanto, la
asociación de este SNP en C8orf13-BLK con nefritis necesita de estudios
adicionales antes de considerarla como firme.

220
 Discusión

Una segunda asociación, aunque menos clara, fue la del SNP rs17435 de
IRAK1-MECP2 con nefritis. Se observó tanto en el análisis global, como de
forma consistente en mujeres y hombres. Sin embargo, esta asociación no
persistió tras realizar la corrección por múltiples tests. Por lo tanto, es necesario
confirmarla en estudios futuros.

El rs7574865 de STAT4 es el SNP que ha mostrado asociación más clara

con la clínica, en concreto, con un fenotipo de LES severo. En un estudio se
observó la asociación de STAT4 con mayor riesgo de nefritis, aparición de la
enfermedad en menores de 30 años, presencia de desorden inmunológico, en
concreto, anti-ADN de doble cadena, y con ausencia de úlceras orales (Taylor
KE y col., 2008). Otro estudio confirmó la asociación con presencia de daño
inmunológico y anti-ADN de doble cadena y, de forma modesta, con riesgo de
nefritis (Sigurdsson S y col., 2008b). Nuestros resultados no confirmaron de
forma clara ninguno de los datos anteriores. Sólo mostraron una débil
asociación con aparición temprana de la enfermedad, que se mantenía en los
subconjuntos de hombres y mujeres. También se observó una tendencia de
asociación con ausencia de úlceras orales, que sólo era significativa en mujeres.
Los análisis de STAT4 con nefritis y daño inmunológico tenían una buena
potencia estadística, pero no confirmaron los resultados previos. La
combinación de estos datos con los de Taylor y col. reforzó la asociación de
STAT4 con daño inmunológico y con la ausencia de úlceras orales. Por
consiguiente, este factor genético parece estar asociado con un fenotipo de LES
particular. Éste podría incluir la presencia de daño inmunológico y,
específicamente, anti-ADN de doble cadena, con los que está asociado en los
dos estudios previos (Taylor KE y col., 2008; Sigurdsson S y col., 2008b).
También incluiría la aparición temprana de la enfermedad, con la cual se

221
Factores genéticos asociados con predisposición a LES

observan asociaciones débiles en nuestro estudio y el de Taylor y col. y una

tendencia no significativa en un tercero (Sigurdsson S y col., 2008b).

Otro de los SNPs más fuertemente asociados con LES, el nsSNP

rs1143679 de ITGAM, mostró una débil asociación con la edad temprana de
aparición de la enfermedad. Sin embargo, al corregir por el número de
comparaciones la asociación deja de ser significativa y, estratificando por sexo,
sólo se encuentra asociado en mujeres. Además, esta asociación no se observó
en estudios previos, por lo que es de dudosa relevancia. Al combinar nuestros
datos con los de las variables que están asociadas con ITGAM en el estudio de
Kim-Howard y col. aparece una diferencia débilmente significativa de ITGAM
con daño inmunológico y, menos concluyente, con nefritis y eritema discoide.
Un tercer trabajo que analizó ITGAM en relación con los criterios clínicos no
encontró ninguna asociación significativa (Hom G y col., 2008). En este estudio
se analizó un SNP que está sólo parcialmente relacionado con el rs1143679, por
lo que no se pudieron utilizar sus datos para el análisis combinado.

Del resto de loci estudiados, sólo TYK2 y BANK1 fueron previamente

analizados en relación con la clínica, sin ningún resultado de asociación
significativa (Sigurdsson S y col., 2005; Guo L y col., 2009). Nuestros
resultados son concordantes ya que no se encontró ninguna asociación para
estos dos factores genéticos, a pesar de tener una buena potencia estadística.

En conclusión, se muestra una escasez de resultados sólidos de asociación

de factores de susceptibilidad con fenotipos específicos. Esto se observa con los
loci estudiados (Taylor KE y col., 2008; Sigurdsson S y col., 2008b; Hom G y
col., 2009; Guo L y col., 2009; Sigurdsson S y col., 2004) y también con otros
loci confirmados en LES, como IRF5 (Sigurdsson S y col., 2005; Cunninghame

222
 Discusión

Graham DS y col., 2007b; Sigurdsson S y col., 2008a; Ferreiro-Neira I y col.,

2007), PTPN22 (Reddy MV y col., 2005; Kyogoku C y col., 2004; Orozco G y
col., 2005; Balada E y col., 2006) o TNFAIP3 (Bates JS y col., 2009). El HLA
únicamente se ha relacionado con la producción de anticuerpos específicos
(Galeazzi M y col., 2002; Galeazzi M y col., 2000; Vasconcelos C y col., 2009;
Fernando MM y col., 2007). Por tanto, parece no haber una correlación
consistente entre los alelos de susceptibilidad en su conjunto y las variables
clínicas del LES. El factor que muestra una evidencia más clara de asociación
con la clínica es STAT4, aunque aún hay discrepancias que no permiten definir
con exactitud el subgrupo de pacientes con LES asociado con polimorfismos en
este gen. De ahí la necesidad de llevar a cabo estudios más grandes que
permitan analizar un mayor número de pacientes con y sin cada una de las
variables clínicas. Estos estudios aumentarán la probabilidad de encontrar
asociaciones modestas o débiles que no se han detectado en los estudios
actuales. Además, permitirán identificar subgrupos de pacientes más uniformes,
lo que podría resultar útil a la hora de mejorar el tratamiento de la enfermedad.

Otra aproximación para explicar la variabilidad clínica del LES consiste

en evaluar la influencia del componente genético de las subpoblaciones dentro
del grupo étnico estudiado. Un trabajo previo mostró, con esta aproximación
original, que parte de la heterogeneidad clínica en caucásicos depende de
factores genéticos relacionados con la ascendencia nor- o sureuropea (Chung
SA y col., 2009). Nuestros resultados confirmaron la mayor prevalencia de
fotosensibilidad y menor prevalencia de artritis en el norte de Europa. Además,
proporcionaron información complementaria a la aportada por Chung y col.
debido al diferente diseño de los dos estudios. En el estudio de Chung y col. las
muestras, de origen europeo, fueron recogidas en Estados Unidos, mientras que
nuestras muestras han sido recogidas en Europa. En el estudio de Chung y col.

223
Factores genéticos asociados con predisposición a LES

se utilizaron marcadores genéticos informativos de ascendencia (Seldin MF y

col., 2006; Tian C y col., 2008). Mientras que en nuestro estudio se utilizó el
país de origen como indicador de ascendencia, según estudios previos que
observaron que la estructura genética europea refleja la distribución geográfica
de los países de origen (Novembre J y col., 2008). Además, los marcadores de
ascendencia europea se identificaron a partir de muestras de distintos países
recogidos de un modo similar al de nuestro estudio (Seldin MF y col., 2006;
Tian C y col., 2008). Otra discrepancia es que en el estudio de Chung y col.
predominaban las muestras con ascendencia noreuropea, mientras que nuestro
estudio presenta un número relativamente mayor de muestras del sur.

La diferencia, señalada en el párrafo anterior, en cuanto al lugar de

recogida de las muestras es importante porque cada colección de pacientes
puede estar afectada por factores locales, de tipo ambiental y socioeconómico,
muy diferentes en Europa y Estados Unidos. La distinta recogida y recuperación
de los datos clínicos o el tipo de pacientes que acuden a los centros sanitarios
también podrían tener un efecto en la gran variabilidad clínica entre las distintas
colecciones o estudios (Alarcón GS y col., 2002; Cervera R y col., 2006; Petri
M, 1997; Wang F y col., 1997; Hom G y col., 2008; Taylor KE y col., 2008).
Esta variabilidad disminuye la reproducibilidad de los estudios de asociación
con factores genéticos. Para intentar evitar este problema sólo se analizaron
aquellas características clínicas con menor variabilidad entre las colecciones de
muestras del norte y entre las colecciones de muestras del sur. Específicamente,
con un coeficiente de variación (CV) menor del 30 %. Éste es el menor CV
observado para las variables clínicas de LES entre grupos étnicos diferentes
(Alarcón GS y col., 2002; Cervera R y col., 2006; Petri M, 1997; Wang F y col.,
1997), por lo que dentro de un mismo grupo étnico se debería esperar una
menor variabilidad, aunque no mucho menor. A pesar de las diferencias entre

224
 Discusión

los estudios, la replicación de dos de las asociaciones observadas por Chung y

col., como se comentó anteriormente, da fiabilidad a los resultados.

El interés de estos resultados reside en poder encontrar los mecanismos

subyacentes que expliquen la heterogeneidad clínica del LES. Así, Chung y col.
dieron como posible explicación de la mayor prevalencia de fotosensibilidad en
el norte de Europa, el color de piel más claro, característico de estas poblaciones
y que viene determinado genéticamente (Chung SA y col., 2009; Sestak AL y
col., 2008). Además, esta explicación estaría en concordancia con una menor
prevalencia de fotosensibilidad en los pacientes con LES afro-americanos
(Sestak AL y col., 2008).

Aparte de analizar la influencia del componente genético en la

variabilidad de los criterios de clasificación de la ACR, sería interesante realizar
un estudio similar con otros datos clínicos de la enfermedad, como los índices
de daño o actividad del LES. El problema para realizar estos análisis está en la
dificultad que supone disponer de colecciones de muestras bien caracterizadas
para todas estas variables. Este tipo de estudios requieren de un gran esfuerzo
por parte de los centros que coleccionan las muestras, como se ha intentado
hacer en el Proyecto Euro-Lupus, que ha recogido datos clínicos de una gran
cantidad de pacientes europeos de forma prospectiva (Cervera R y col., 2006).

1.4. Componente genético común a LES y AR

En las últimas décadas, se han identificado una serie de genes que

confieren susceptibilidad a varias enfermedades autoinmunes. La asociación del
HLA es la más consistentemente establecida en estas enfermedades. PTPN22,
confirmado como un factor de riesgo para AR (Begovich AB y col., 2004),

225
Factores genéticos asociados con predisposición a LES

también confiere susceptibilidad a otras enfermedades autoinmunes (Gregersen

PK y col., 2006b) como T1D (Bottini N y col., 2004; Onengut-Gumuscu S y col.,
2004), enfermedad tiroidea autoinmune (Velaga MR y col., 2004), algunas
formas de artritis juvenil (Hinks A y col., 2005, Viken MK y col., 2005) y LES
(Kyogoku C y col., 2004; Reddy MV y col., 2005; Wu H y col., 2005; Kaufman
KM y col., 2006). STAT4 también se observó asociado con AR y LES de forma
reproducible (Remmers EF y col., 2007), mientras que su asociación con SS
(Korman BD y col., 2008), T1D (Martinez A y col., 2008; Zervou MI y col.,
2008a) y enfermedad inflamatoria intestinal (Martinez A y col., 2008) necesita
ser confirmada. La asociación de IRF5 con AR y LES también ha sido
corroborada en los últimos años (Sigurdsson S y col., 2005; Dieguez-Gonzalez
R y col., 2008). Más recientemente se ha observado que la región 6q23 sería
otro locus de susceptibilidad implicado en estas dos complejas enfermedades
autoinmunes y en psoriasis (Wellcome Trust Case Control Consortium, 2007;
Plenge RM y col., 2007a; Plenge RM y col., 2007b; Thomson W y col., 2007;
Dieguez-Gonzalez R y col., 2009; Orozco G y col., 2009 b; Musone SL y col.,
2008; Graham RR y col., 2008; Nair RP y col., 2009). Todas estas
observaciones sugieren la existencia de un componente genético común a
múltiples enfermedades autoinmunes y, por tanto, que dichas enfermedades
compartan rutas patogénicas (Gregersen PK y col., 2006a; Becker KG y col.,
2004; Becker KG y col., 1998; Griffiths MM y col., 1999; Raman K y col.,
2003). De ahí que los factores genéticos que se encuentran asociados con una
enfermedad sean considerados como candidatos para otras enfermedades del
mismo tipo. El inconveniente de esta estrategia es que se puede introducir un
sesgo, ya que el estudio del mismo factor genético en múltiples enfermedades
puede dar lugar a alguna asociación por azar.

226
 Discusión

De los 9 loci asociados con LES que se han estudiado (STAT4, ITGAM,
C8orf13-BLK, TYK2, 1q.25.1, PXK, KIAA1542, MECP2 y BANK1), sólo STAT4
había sido ampliamente analizado y claramente asociado con AR (Wellcome
Trust Case Control Consortium, 2007; Lee HS y col., 2007; Remmers EF y col.,
2007; Barton A y col., 2008; Kobayashi S y col., 2008; Orozco G y col., 2008;
Martinez A y col., 2008; Zervou MI y col., 2008b; Palomino-Morales RJ y col.,
2008). También se confirmó este resultado en nuestra colección de muestras de
AR. Sin embargo, no se encontró ninguna asociación significativa para los otros
8 factores genéticos, a pesar de que el poder estadístico de este estudio era
suficiente para detectar efectos con OR de 1.15-1.20 de SNPs en cromosomas
autosómicos y 1.24 del SNP de MECP2, en el cromosoma X. Además, estos
efectos serían similares a las OR más débiles encontradas en las dos grandes
colecciones de muestras de AR, NARAC (North American Rheumatoid
Arthritis Consortium) y EIRA (Swedish Epidemiological Investigation of
Rheumatoid Arthritis) (Plenge RM y col., 2005).

La disponibilidad de otros estudios de asociación con AR de los SNPs

analizados, excepto para los de ITGAM y MECP2, permitió realizar un meta-
análisis con mayor poder estadístico. En el mismo, se confirmó la asociación de
STAT4. Además, se encontraron dos asociaciones de pequeño efecto en los loci
C8orf13-BLK (OR = 1.09) y PXK (OR = 1.06), que no habían sido detectadas
en los estudios previos. Recientemente, otro grupo también ha observado
asociación de C8orf13-BLK con AR (Gregersen PK y col., 2009). Por tanto, los
SNPs de este grupo asociados con AR parecen tener un efecto mucho menor
que en LES, en donde mostraban ORs superiores a 1.19 (salvo TYK2 y LY9, que
no mostraron asociación en algún estudio previo (Cunningham Graham DS y
col., 2007a) o en nuestro estudio caso-control de LES). Incluso el efecto de
STAT4 es menor en AR que el que tiene en LES (OR = 1.14-1.32 vs 1.55-1.62).

227
Factores genéticos asociados con predisposición a LES

Así pues, parece poco probable que estos SNPs tengan una importancia similar
en ambas enfermedades.

En parte, los resultados de los 9 loci de susceptibilidad a LES eran de

esperar, ya que la mayoría fueron encontradas en los GWAS de LES (SLEGEN
y col., 2008; Kozyrev SV y col., 2008; Hom G y col., 2008; Graham RR y col.,
2008), pero no en los de AR (Raychaudhuri S y col., 2008; Plenge RM y col.,
2007b; Wellcome Trust Case Control Consortium, 2007). Otra posible causa de
la falta de una asociación clara de estos SNPs con AR es que distintos
polimorfismos del mismo gen estén implicados en enfermedades distintas,
como podría ocurrir con BANK1. Un estudio reciente de este gen ha encontrado
asociación con AR, pero no con el SNP de LES estudiado aquí (rs17266594)
(Orozco G y col., 2009a).

Algo similar parece ocurrir con TNFAIP3. Por un lado, los SNPs de baja
frecuencia, rs5029939, rs2230926 y rs7749323, fuertemente asociados con LES
(OR ≥ 2, P ≤ 10-4) (Musone SL y col., 2008; Graham RR y col., 2008), no
mostraron asociación con AR. Por otro lado, el SNP rs610604 presentó una
asociación con AR cuyo efecto era opuesto al observado en psoriasis (Nair RP y
col., 2009). Sin embargo, dicho SNP junto con el rs644340 mostraban un efecto
protector similar al del SNP que ya se había estudiado con anterioridad
(rs582757) (Dieguez-Gonzalez R y col., 2009) y con la que tienen cierta
relación. Por tanto, se confirmó dicha señal protectora en el gen TNFAIP3.
Como ya se había mostrado previamente, ésta contribuye a la susceptibilidad a
AR de forma conjunta con las señales protectora (rs13207033, rs10499194) y
de riesgo (rs6920220) localizadas en la región intergénica de 6q23. Así pues, el
patrón de asociación con AR en TNFAIP3 parece distinto al de LES o psoriasis.
Sin embargo, estos resultados en AR necesitan ser confirmados en estudios

228
 Discusión

independientes debido a que las señales de asociación en TNFAIP3 son débiles

y no concuerdan con los resultados de otros dos estudios recientes. Éstos
muestran una asociación débil del nsSNP de LES rs2230926 tanto en población
caucásica (P = 0.03, OR = 1.21) (Orozco G y col., 2009b) como japonesa
(Shimane K y col., 2010).

En cuanto a la otra señal de susceptibilidad al LES, localizada a ~200 kb

3’ de TNFAIP3, en la región 5’ del gen PERP (rs6922466) (Musone SL y col.,
2008), los resultados obtenidos tampoco mostraron asociación con AR, a pesar
de que el poder estadístico del estudio era suficiente para detectar los efectos
observados en LES.

Una posibilidad de que en el análisis global de casos con AR vs controles

no se detecte la asociación de la mayoría de factores de LES o de que haya
discrepancias en las señales es que la asociación en AR tenga lugar en
subgrupos de pacientes con características fenotípicas más parecidas al LES.
Esto parece ocurrir en IRF5, cuya asociación con LES ha sido fuertemente
confirmada (Sigurdsson S y col., 2005; Graham RR y col., 2007a; Cunninghame
Graham DS y col., 2007b; Kozyrev SV y col., 2007; Ferreiro-Neira I y col.,
2007; Sigurdsson S y col., 2008a), mientras que en AR está restringida a un
subgrupo de pacientes que no está totalmente definido (Dieguez-Gonzalez R y
col., 2008; Sigurdsson S y col., 2007). Sin embargo, el análisis de los 9 factores
genéticos de LES estratificando por algunas variables clínicas de la AR sólo
muestra una asociación consistente tras la corrección por tests múltiples. Esta
asociación se corresponde con el locus C8orf13-BLK en relación con el SS. El
alelo menor parece conferir protección frente a este fenotipo. Sin embargo, el
mismo alelo también mostró mayor riesgo de AR en el análisis combinado con
datos publicados, siendo este efecto opuesto de difícil explicación.

229
Factores genéticos asociados con predisposición a LES

En relación con el locus 6q23, ya se había observado que la señal de

protección en la región intergénica, marcada por el SNP rs13207033 (o su
tagSNP rs10499194), estaba preferentemente asociada en los pacientes ACPA+
(Plenge RM y col., 2007a; Dieguez-Gonzalez R y col., 2009). Sin embargo, en
otro estudio se detectó una asociación con pacientes ACPA- (Orozco G y col.,
2009b). Al analizar variables clínicas más características del LES en estos
pacientes con AR, se observó además que la asociación de este SNP es más
marcada con pacientes ANA+. Sin embargo, el SNP rs610604 de TNFAIP3
tenía una asociación más marcada con pacientes ANA-. Mientras que los SNPs
de baja frecuencia característicos del LES seguían sin mostrar asociación tras
esta estratificación. Estos resultados sugieren la posibilidad de que los pacientes
con AR muestren un patrón de asociación particular en relación con la presencia
de ANAs. Sin embargo, este patrón no parece relacionado con el observado en
LES. Aún así, hay que tener en cuenta las limitaciones de estos análisis. Por una
parte, no disponemos de los datos de ANAs para todos los pacientes con AR.
Además, éstos fueron medidos mediante técnicas distintas y a tiempos
diferentes en la evolución de la AR, pudiendo estar influenciados por el
tratamiento con antagonistas del TNF, que se sabe que inducen la producción de
estos autoanticuerpos (Charles PJ y col., 2000). En segundo lugar, el análisis de
subfenotipos, como se comentó en el apartado anterior, implica una reducción
del número de muestras, disminuyendo el poder estadístico del análisis. Por
último, el alto número de comparaciones aumenta la probabilidad de aparición
de falsos positivos. Una estrategia que permitiría aumentar la potencia
estadística de los estudios genotipo-fenotipo, sería combinar datos similares de
estudios independientes en un meta-análisis, pero de momento otros estudios no
han presentado resultados de este tipo.

230
 Discusión

En conclusión, de los factores de susceptibilidad al LES estudiados, sólo

STAT4 es claramente compartido por la AR, mostrando la misma señal de
riesgo asociada. TNFAIP3 también sería un locus de susceptibilidad para estas
dos enfermedades, aunque hemos observado que esta asociación no se debe a
los mismos polimorfismos, por lo que posiblemente no estén implicados los
mismos mecanismos. Además, los factores de susceptibilidad a LES C8orf13-
BLK y PXK también han mostrado evidencias de estar asociados con AR. No
obstante estos últimos resultados necesitan ser confirmados. Esta dificultad para
obtener señales significativas en AR podría deberse en parte a que el efecto de
los polimorfismos es, en general, más débil en AR que en LES. Aún así, otros
estudios han mostrado más factores compartidos por LES y AR, como PTPN22,
IRF5, CTLA4 y BANK1. Por tanto, estas dos enfermedades comparten varios
factores genéticos de susceptibilidad, aunque también existen factores
específicos para cada una de ellas.

2. Sumario

En este trabajo se ha abordado la confirmación de factores genéticos de

susceptibilidad al LES. Además, se ha realizado el análisis funcional de PD1.3,
el posible SNP causal del gen PDCD1. También se ha evaluado la influencia del
componente genético sobre los subfenotipos del LES. Y, por último, se ha
explorado si los nuevos factores genéticos identificados en LES son
compartidos por AR, en busca de mecanismos patogénicos comunes a estas dos
enfermedades autoinmunes.

El estudio de nuevos factores de susceptibilidad al LES proporcionó la

replicación independiente de la asociación de 9 loci con esta enfermedad. Como
consecuencia de estos resultados, 5 de los loci fueron confirmados por primera

231
Factores genéticos asociados con predisposición a LES

vez de modo independiente (1q25.1, MECP2, KIAA1542, PXK y BANK1). Un

sexto fue replicado, aunque su asociación sigue siendo controvertida (TYK2).
De este modo, ya hay un número considerablemente alto de loci asociados de
forma consistente con LES. Este alto grado de reproducibilidad es una mejora
fundamental en la investigación de la genética del LES y otras enfermedades
complejas y es consecuencia de los grandes estudios que se están llevando a
cabo. Por lo tanto, estamos en una fase de descubrimientos interesantes en este
campo. Sin embargo, la identificación de los factores genéticos es sólo un
primer paso. Es necesario transformar la información que obtenemos en
conocimiento útil y, de momento, tenemos pocas claves sobre el significado
biológico de las asociaciones con LES detectadas. Estudios futuros deberán
tratar de identificar las variantes causales y, mediante ensayos funcionales,
determinar sus efectos a los niveles molecular, celular y de la enfermedad, como
se ha intentado hacer con PD1.3.

Sin embargo, los resultados sobre PD1.3 cuestionan su propuesto papel

funcional. Puede que este SNP sea relevante en algún sentido que no se haya
explorado todavía, pero la información disponible no permite predecir ningún
efecto. Además, su asociación con el LES también ha sido cuestionada, al
menos en población europea, y en los GWAS no se ha observado ninguna señal
significativa en PDCD1. Por lo tanto, se pone en duda el papel de este gen en la
susceptibilidad al LES en caucásicos.

También se ha examinado el papel que los nuevos factores de

susceptibilidad al LES tienen en los diferentes fenotipos de la enfermedad. Los
resultados muestran una escasez de asociaciones destacables con características
clínicas específicas. Las asociaciones más claras se observaron con STAT4, pero
con un subfenotipo todavía no muy bien definido. Por tanto, la variabilidad

232
 Discusión

fenotípica no se correlaciona de modo consistente con los alelos de

susceptibilidad al LES. Así, se hace necesario aumentar la potencia estadística
de los estudios encaminados a descubrir polimorfismos con influencia en el
fenotipo, para poder encontrar las posibles asociaciones débiles o modestas.
Una posible aproximación sería el realizar GWAS o estudios de genes
candidato en subgrupos de pacientes con un fenotipo concreto. También es
posible que la falta de correlación con los alelos de susceptibilidad se deba a su
intervención en interacciones más complejas, entre factores genéticos o de éstos
con el ambiente. Una prueba adicional de que el componente genético influye
en los fenotipos del LES se obtuvo al comparar pacientes con distinto fondo
genético característico de las subpoblaciones de ascendencia nor- o sureuropea.
Así, confirmamos una mayor prevalencia de fotosensibilidad y menor
prevalencia de artritis en el norte que en el sur. Además, estas diferencias
muestran la necesidad de tener en cuenta la ascendencia en los estudios
epidemiológicos del LES.

Por último, observamos que una buena parte de los nuevos factores
genéticos de LES eran específicos de LES, ya que no estaban asociados con AR.
Así, el único factor de susceptibilidad de los 9 analizados que está claramente
compartido por ambas enfermedades es STAT4. C8orf13-BLK y PXK mostraron
una débil asociación con AR, pero sólo al combinar nuestros datos con los de
otros estudios. En cuanto a TNFAIP3, nuestros resultados muestran señales de
asociación distintas en las dos enfermedades. En resumen, los factores genéticos
que son compartidos por el LES y la AR son PTPN22, STAT4, la región
intergénica de 6q23 y puede que IRF5, CTLA4, C8orf13-BLK, PXK y BANK1.
Sin embargo, el componente genético de ambas enfermedades difiere en
muchos otros factores de susceptibilidad, como TNFAIP3, KIAA1542, 1q25.1,
MECP2 y TYK2. Estos resultados indican que, aunque comparten una fracción

233
Factores genéticos asociados con predisposición a LES

del componente genético, el resto del componente genético tiene un efecto

específico de cada enfermedad. Si bien ésta no es una idea nueva, carecía de
apoyo experimental. Sin embargo, todavía no se puede estimar la magnitud del
componente diferencial ya que no se ha definido una gran parte de la
heredabilidad de estas dos enfermedades. Esto será posible una vez que se
hayan identificado las variantes causales de cada factor genético.

Concluyendo, nuestro trabajo ha contribuido al conocimiento del

componente genético del LES, así como a diferenciarlo del de la AR. De esta
forma, se ha contribuido al conocimiento de los mecanismos patogénicos que
son importantes en estas enfermedades autoinmunes.

234
CONCLUSIONES
 Conclusiones

Conclusiones

1. Se han replicado de forma independiente nueve loci asociados a LES

(ITGAM, STAT4, C8orf13-BLK, 1q25.1, MECP2, KIAA1542, PXK,
BANK1 y TYK2). Seis de estas replicaciones tuvieron importancia
confirmatoria, ya que fueron las primeras independientes (1q25.1,
MECP2, KIAA1542, PXK y BANK1) o, en el caso de TYK2, porque su
asociación era controvertida. Estos resultados muestran la
reproducibilidad de los estudios genéticos en LES recientes, por lo
que su futuro es prometedor.

2. La unión ineficiente a RUNX1, la ausencia de efecto enhancer y la

falta de regulación transcripcional alelo-diferencial cuestionan el
papel del SNP PD1.3 como polimorfismo causal de la asociación de
PDCD1 con LES.

3. Los efectos de los factores de susceptibilidad en la variabilidad

clínica del LES son débiles y difíciles de reproducir. STAT4 es el que
está más claramente asociado, aunque el fenotipo todavía no está
completamente definido.

4. Se confirma la mayor prevalencia de fotosensibilidad y la menor

prevalencia de artritis en los pacientes con ascendencia del norte de
Europa en relación con los de ascendencia del sur. Estos resultados
corroboran la influencia del fondo genético en la heterogeneidad
clínica del LES.

237
Factores genéticos asociados con predisposición a LES

5. Ninguno de los loci asociados recientemente con LES, excepto

STAT4, ha mostrado asociación clara con AR. Así mismo, las
asociaciones con LES observadas en el gen TNFAIP3 no coinciden
con las observadas en AR. Por tanto, aunque AR y LES comparten
una fracción de su componente genético, también existen factores de
susceptibilidad específicos de cada enfermedad.

238
BIBLIOGRAFÍA
 Bibliografía

Bibliografía

• Abelson AK, Delgado-Vega AM, Kozyrev SV, Sanchez E, Velazquez-Cruz R,

Eriksson N et al. STAT4 associates with SLE through two independent effects
that correlate with gene expression and act additively with IRF5 to increase
risk. Ann Rheum Dis. 2009; 68: 1746-1753.
• Aho K, Koskenvuo M, Tuominen J, Kaprio J. Occurrence of rheumatoid
arthritis in a nation wide series of twins. J Rheumatol. 1986; 13: 899-902.
• Aiba Y, Yamazaki T, Okada T, Gotoh K, Sanjo H, Ogata M et al. BANK
negatively regulates Akt activation and subsequent B cell responses. Immunity.
2006; 24: 259-268.
• Al Arfaj AS, Khalil N. Clinical and immunological manifestations in 624 SLE
patients in Saudi Arabia. Lupus. 2009; 18: 465-473.
• Alarcón GS, Friedman AW, Straaton KV, Moulds JM, Lisse J, Bastian HM et
al. Systemic lupus erythematosus in three ethnic groups: III. A comparison of
characteristics early in the natural history of the LUMINA cohort. LUpus in
MInority populations: NAture vs. Nurture. Lupus. 1999; 8: 197-209.
• Alarcon GS, McGwin G Jr, Petri M, Reveille JD, Ramsey-Goldman R,
Kimberly RP. Baseline characteristics of a multiethnic lupus cohort: PROFILE.
Lupus. 2002; 11: 95-101.
• Alarcón-Segovia D, Alarcón-Riquelme ME, Cardiel MH, Caeiro F, Massardo
L, Villa AR et al. Familiar aggregation of systemic lupus erythematosus,
rheumatoid arthritis, and other autoimmune diseases in 1,177 lupus patients
from the GLADEL cohort. Arthritis Rheum. 2005; 52: 1138-1147.
• Arbuckle MR,McClain MT,Rubertone MV,Scofield RH,Dennis GJ,James JA
et al. Development of autoantibodies before the clinical onset of systemic lupus
erythematosus. N Engl J Med. 2003. 349: 1526-1533.

241
Factores genéticos asociados con predisposición a LES

• Arita K, Ariyoshi M, Tochio H, Nakamura Y, Shirakawa M. Recognition of

hemi-methylated DNA by the SRA protein UHRF1 by a base-flipping
mechanism. Nature. 2008; 455: 818-821.
• Baechler EC, Gregersen PK, Behrens TW. The emerging role of interferon in
human systemic lupus erythematosus. Curr Opin Immunol. 2004; 16: 801-807.
• Balada E, Villarreal-Tolchinsky J, Ordi-Ros J, Labrador M, Serrano-Acedo S,
Martinez-Lostao L et al. Multiplex family-based study in systemic lupus
erythematosus: association between the R620W polymorphism of PTPN22 and
the FcgammaRIIa (CD32A) R131 allele. Tissue Antigens. 2006; 68: 432-438.
• Ballestar E, Esteller M, Richardson BC. The epigenetic face of systemic lupus
erythematosus. J Immunol. 2006; 176: 7143-7147.
• Baranzini SE. The genetics of autoinmune diseases: a networked perspective.
Curr Opin Immunol. 2009; 21: 596-605.
• Barrett JC, Clayton DG, Concannon P, Akolkar B, Cooper JD, Erlich HA et
al. Genome-wide association study and meta-analysis find that over 40 loci
affect risk of type 1 diabetes. Nat Genet. 2009; 41: 703-707.
• Barton A, Thomson W, Ke X, Eyre S, Hinks A, Bowes J et al. Re-evaluation
of putative rheumatoid arthritis susceptibility genes in the post-genome wide
association study era and hypothesis of a key pathway underlying susceptibility.
Hum Mol Genet. 2008; 17: 2274-2279.
• Barton A, Worthington J. Genetic Susceptibility to Rheumatoid Arthritis: An
Emerging Picture. Arthritis Rheum. 2009; 61: 1441-1446.
• Bates JS, Lessard CJ, Leon JM, Nguyen T, Battiest LJ, Rodgers J et al. Meta-
analysis and imputation identifies a 109 kb risk haplotype spanning TNFAIP3
associated with lupus nephritis and hematologic manifestations. Genes Immun.
2009; 10: 470-477.
• Becker KG, Simon RM, Bailey-Wilson JE, Freidlin B, Biddison WE,
McFarland HF et al. Clustering of non-major histocompatibility complex

242
 Bibliografía

susceptibility candidate loci in human autoimmune diseases. Proc Natl Acad Sci
U S A. 1998; 95: 9979-9984.
• Becker KG. The common variants/multiple disease hypothesis of common
complex genetic disorders. Med Hypotheses. 2004; 62: 309-317.
• Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP,
Alexander HC et al. A missense single-nucleotide polymorphism in a gene
encoding a protein tyrosine phosphatase (PTPN22) is associated with
rheumatoid arthritis. Am J Hum Genet. 2004; 75: 330-337.
• Bellizzi D, Rose G, Cavalcante P, Covello G, Dato S, De Rango F et al. A
novel VNTR enhancer within the SIRT3 gene, a human homologue of SIR2, is
associated with survival at oldest ages. Genomics. 2005; 85: 258-263.
• Beyaert R, Heyninck K, Van Huffel S. A20 and A20-binding proteins as
cellular inhibitors of nuclear factor-kappa B-dependent gene expression and
apoptosis. Biochem Pharmacol. 2000; 60: 1143-1151.
• Blank C, Brown I, Marks R, Nishimura H, Honjo T, Gajewski TF et al.
Absence of programmed death receptor 1 alters thymic development and
enhances generation of CD4/CD8 double-negative TCR-transgenic T cells. J
Immunol. 2003; 171: 4574-4581.
• Boh EE. Neonatal lupus erythematosus. Clin Dermatol. 2004; 22: 125-128.
• Boone DL, Turer EE, Lee EG, Ahmad RC, Wheeler MT, Tsui C et al. The
ubiquitin-modifying enzyme A20 is required for termination of Toll-like
receptor responses. Nat Immunol. 2004; 5: 1052-1060.
• Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M et
al. A functional variant of lymphoid tyrosine phosphatase is associated with
type I diabetes. Nat Genet. 2004; 36: 337-338.
• Botto M, Walport MJ. C1q, autoimmunity and apoptosis. Immunobiology.
2002; 205: 395-406.

243
Factores genéticos asociados con predisposición a LES

• Bristow CA, Shore P. Transcriptional regulation of the human MIP-1alpha

promoter by RUNX1 and MOZ. Nucleic Acids Res. 2003; 31: 2735-2744.
• Brookes ST, Whitley E, Peters TJ, Mulheran PA, Egger M, Davey Smith G.
Subgroup analyses in randomised controlled trials: quantifying the risks of
false-positives and false-negatives. Health Technol Assess. 2001; 5: 1-56.
• Bruhn L, Munnerlyn A, Grosschedl R. ALY, a context-dependent coactivator
of LEF-1 and AML-1, is required for TCRalpha enhancer function. Genes Dev.
1997; 11: 640-653.
• Cantor RM, Yuan J, Napier S, Kono N, Grossman JM, Hahn BH et al.
Systemic lupus erythematosus genome scan: support for linkage at 1q23, 2q33,
16q12-13, and 17q21-23 and novel evidence at 3p24, 10q23–24, 13q32, and
18q22-23. Arthritis Rheum. 2004; 50: 3203-3210.
• Carreno BM, Collins M. The B7 family of ligands and its receptors: new
pathways for costimulation and inhibition of immune responses. Annu Rev
Immunol. 2002; 20: 29-53.
• Casciola-Rosen LA, Anhalt G, Rosen A. Autoantigens targeted in systemic
lupus erythematosus are clustered in two populations of surface structures on
apoptotic keratinocytes. J Exp Med. 1994; 179: 1317-30.
• Castaño-Rodríguez N, Diaz-Gallo LM, Pineda-Tamayo R, Rojas-Villarraga A,
Anaya JM. Meta-analysis of HLA-DRB1 and HLA-DQB1 polymorphisms in
Latin American patients with systemic lupus erythematosus. Autoimmun Rev.
2008; 7: 322-330.
• Castillejo-Lopez C, Delgado-Vega AM, Wojcik J, Kozyrev S, Egido JRL,
Sanchez E et al. Genetic Interactions Reveal a Novel B-Cell Pathway in
Systemic Lupus Erythematosus [abstract]. Arthritis Rheum. 2009; 60 Suppl 10:
1226.
• Cervera R, Abarca-Costalago M, Abramovicz D, Allegri F, Annunziata P,
Aydintug AO et al. Systemic lupus erythematosus in Europe at the change of

244
 Bibliografía

the millennium: lessons from the "Euro-Lupus Project". Autoimmun Rev. 2006;
5: 180-186.
• Chahrour M, Jung SY, Shaw C, Zhou X, Wong ST, Qin J et al. MeCP2, a key
contributor to neurological disease, activates and represses transcription.
Science. 2008; 320: 1224-1229.
• Chang YK, Yang W, Zhao M, Mok CC, Chan TM, Wong RWS et al.
Association of BANK1 and TNFSF4 with systemic lupus erythematosus in Hong
Kong Chinese. Genes Immun. 2009; 10: 414-420.
• Charles PJ, Smeenk RJ, De Jong J, Feldmann M, Maini RN. Assessment of
antibodies to double-stranded DNA induced in rheumatoid arthritis patients
following treatment with infliximab, a monoclonal antibody to tumor necrosis
factor alpha: findings in open-label and randomized placebo-controlled trials.
Arthritis Rheum. 2000; 43: 2383-2390.
• Chowdhury D, Beresford PJ, Zhu P, Zhang D, Sung JS, Demple B et al. The
exonuclease TREX1 is in the SET complex and acts in concert with NM23-H1 to
degrade DNA during granzyme A-mediated cell death. Mol Cell. 2006; 23: 133-
142.
• Chung SA, Criswell LA. PTPN22: its role in SLE and autoimmunity.
Autoimmunity. 2007; 40: 582-590.
• Chung SA, Tian C, Taylor KE, Lee AT, Ortmann WA, Hom G et al.
European population substructure is associated with mucocutaneous
manifestations and autoantibody production in systemic lupus erythematosus.
Arthritis Rheum. 2009; 60: 2448-2456.
• Cooper GS, Gilbert KM, Greidinger EL, James JA, Pfau JC, Reinlib L et al.
Recent advances and opportunities in research oln Lupus: environmental
influences and mechanisms of disease. Environ Health Perspect. 2008; 116:
695-702.

245
Factores genéticos asociados con predisposición a LES

• Coxon A, Rieu P, Barkalow FJ, Askari S, Sharpe AH, von Andrian UH et al.
A novel role for the beta 2 integrin CD11b/CD18 in neutrophil apoptosis: a
homeostatic mechanism in inflammation. Immunity. 1996; 5: 653-666.
• Coyle AJ, Gutierrez-Ramos JC. The expanding B7 superfamily: increasing
complexity in costimulatory signals regulating T cell function. Nat Immunol.
2001; 2: 203-209.
• Crotty S, Johnston RJ, Schoenberger SP. Effectors and memories: Bcl-6 and
Blimp-1 in T and B lymphocyte differentiation. Nat Immunol. 2010; 11: 114-120.
• Cunninghame Graham DS, Akil M, Vyse TJ. Association of polymorphisms
across the tyrosine kinase gene, TYK2 in UK SLE families. Rheumatology
(Oxford). 2007a; 46: 927-930.
• Cunninghame Graham DS, Graham RR, Manku H, Wong AK, Whittaker JC,
Gaffney PM et al. Polymorphism at the TNF superfamily gene TNFSF4 confers
susceptibility to systemic lupus erythematosus. Nat Genet. 2008a; 40: 83-89.
• Cunninghame Graham DS, Manku H, Wagner S, Reid J, Timms K, Gutin A
et al. Association of IRF5 in UK SLE families identifies a variant involved in
polyadenylation. Hum Mol Genet. 2007b; 16: 579-591.
• Cunninghame Graham DS, Vyse TJ, Fortin PR, Montpetit A, Cai YC, Lim S
et al. Association of LY9 in UK and Canadian SLE families. Genes Immun.
2008b; 9:93-102.
• Day CL, Kaufmann DE, Kiepiela P, Brown JA, Moodley ES, Reddy S et al.
PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion
and disease progression. Nature. 2006; 443: 350-354.
• Deapen D, Escalante A, Weinrib L, Horwitz D, Bachman B, Roy-Burman P
et al. A revised estimate of twin concordance in systemic lupus erythematosus.
Arthritis Rheum. 1992; 35: 311-318.

246
 Bibliografía

• Delgado-Vega AM, Abelson AK, Sánchez E, Witte T, D’Alfonso S, Galeazzi

M et al. Replication of the TNFSF4 (OX40L) promoter region association with
systemic lupus erythematosus. Genes Immun. 2009; 10: 248-253.
• D'Esposito M, Quaderi NA, Ciccodicola A, Bruni P, Esposito T, D'Urso M et
al. Isolation, physical mapping, and northern analysis of the X-linked human
gene encoding methyl CpG-binding protein, MECP2. Mamm Genome. 1996; 7:
533-535.
• Dieguez-Gonzalez R, Calaza M, Perez-Pampin E, Balsa A, Blanco FJ, Cañete
JD et al. Analysis of TNFAIP3, a feedback inhibitor of nuclear factor-kappa B
and the neighbor intergenic 6q23 region in rheumatoid arthritis susceptibility.
Arthritis Res Ther. 2009; 11; R42.
• Dieguez-Gonzalez R, Calaza M, Perez-Pampin E, Rodriguez de la Serna A,
Fernandez-Gutierrez B, Castañeda S et al. Association of interferon regulatory
factor 5 haplotypes, similar to that found in systemic lupus erythematosus, in a
large subgroup of patients with rheumatoid arthritis. Arthritis Rheum. 2008; 58:
1264-1274.
• Dieudé P, Wipff J, Guedj M, Ruiz B, Melchers I, Hachulla E et al. BANK1 is
a genetic risk factor for diffuse cutaneous systemic sclerosis and has additive
effects with IRF5 and STAT4. Arthritis Rheum. 2009; 60: 3447-3454.
• Diveu C, McGeachy MJ, Cua DJ. Cytokines that regulate autoimmunity. Curr
Opin. Immunol. 2008; 20: 663-668.
• Dunne JL, Collins RG, Beaudet AL, Ballantyne CM, Ley K. Mac-1, but not
LFA-1, uses intercellular adhesion molecule-1 to mediate slow leukocyte rolling
in TNF-alpha-induced inflammation. J Immunol. 2003; 171: 6105-6111.
• Ehlers MR. CR3: a general purpose adhesion-recognition receptor essential
for innate immunity. Microbes Infect. 2000; 2: 289-294.

247
Factores genéticos asociados con predisposición a LES

• Fanciulli M, Norsworthy PJ, Petretto E, Dong R, Harper L, Kamesh L et al.

FCGR3B copy number variation is associated with susceptibility to systemic,
but not organ-specific, autoimmunity. Nat Genet. 2007; 39: 721-723.
• Fernando MM, Stevens CR, Sabeti PC, Walsh EC, McWhinnie AJ, Shah A et
al. Identification of two independent risk factors for lupus within the MHC in
United Kingdom families. PLoS Genet. 2007; 3: e192.
• Fernando MM, Stevens CR, Walsh EC, De Jager PL, Goyette P, Plenge RM
et al. Defining the role of the MHC in autoimmunity: a review and pooled
analysis. PLoS Genet. 2008; 4: e1000024.
• Ferreiro-Neira I, Calaza M, Alonso-Perez E, Marchini M, Scorza R,
Sebastiani GD et al. Opposed independent effects and epistasis in the complex
association of IRF5 to SLE. Genes Immun. 2007; 8: 429-438.
• Ferreiros-Vidal I, D'Alfonso S, Papasteriades C, Skopouli FN, Marchini M,
Scorza R et al. Bias in association studies of systemic lupus erythematosus
susceptibility due to geographical variation in the frequency of a programmed
cell death 1 polymorphism across Europe. Genes Immun. 2007; 8: 138-146.
• Ferreiros-Vidal I, Gomez-Reino JJ, Barros F, Carracedo A, Carreira P,
Gonzalez-Escribano F et al. Association of PDCD1 with susceptibility to
systemic lupus erythematosus: evidence of population-specific effects. Arthritis
Rheum. 2004; 50: 2590-2597.
• Fielder AHL, Walport MJ, Batchelor JR, Rynes RI, Black CM, Dodi IA et al.
Family study of the major histocompatibility complex in patients with systemic
lupus erythematosus: importance of null alleles of C4A and C4B in determining
disease susceptibility. Br Med J. 1983; 286: 425-428.
• Filaci G, Bacilieri S, Fravega M, Monetti M, Contini P, Ghio M et al.
Impairment of CD81 T suppressor cell function in patients with active systemic
lupus erythematosus. J Immunol. 2001; 166: 6452–6457.

248
 Bibliografía

• Finnegan A, Grusby MJ, Kaplan CD, O'Neill SK, Eibel H, Koreny T et al. IL-
4 and IL-12 regulate proteoglycan-induced arthritis through Stat-dependent
mechanisms. J Immunol. 2002; 169: 3345-3352.
• Forabosco P, Gorman JD, Cleveland C, Kelly JA, Fisher SA, Ortmann WA et
al. Meta-analysis of genome-wide linkage studies of systemic lupus
erythematosus. Genes Immun. 2006; 7: 609-614.
• Frank R, Zhang J, Uchida H, Meyers S, Hiebert SW, Nimer SD et al. The
AML1/ETO fusion protein blocks transactivation of the GM-CSF promoter by
AML1B. Oncogene. 1995; 11: 2667-2674.
• Franke A, Balschun T, Karlsen TH, Sventoraityte J, Nikolaus S, Mayr G et al.
Sequence variants in IL10, ARPC2 and multiple other loci contribute to
ulcerative colitis susceptibility. Nat Genet. 2008; 40: 1319-1323.
• Freeman GJ, Long AJ, Iwai Y, Bourque K, Chernova T, Nishimura H et al.
Engagement of the PD-1 immunoinhibitory receptor by a novel B7 family
member leads to negative regulation of lymphocyte activation. J Exp Med. 2000;
192: 1027-1034.
• Fung EY, Smyth DJ, Howson JM, Cooper JD, Walker NM, Stevens H et al.
Analysis of 17 autoimmune disease-associated variants in type 1 diabetes
identifies 6q23/TNFAIP3 as a susceptibility locus. Genes Immun. 2009; 10:
188-191.
• Gaffney PM, Kearns GM, Shark KB, Ortmann WA, Selby SA, Malmgren ML
et al. A genome-wide search for susceptibility genes in human systemic lupus
erythematosus sibpair families. Proc Natl Acad Sci U S A. 1998; 95: 14875-
14879.
• Gaffney PM, Ortmann WA, Selby SA, Shark KB, Ockenden TC, Rohlf KE et
al. Genome screening in human systemic lupus erythematosus: results from a
second Minnesota cohort and combined analyses of 187 sib-pair families. Am J
Hum Genet. 2000; 66: 547-556.

249
Factores genéticos asociados con predisposición a LES

• Galeazzi M, Sebastiani GD, Morozzi G, Carcassi C, Ferrara GB, Scorza R et

al. HLA class II DNA typing in a large series of European patients with
systemic lupus erythematosus: correlations with clinical and autoantibody
subsets. Medicine (Baltimore). 2002; 81: 169-178.
• Galeazzi M, Sebastiani GD, Tincani A, Piette JC, Allegri F, Morozzi G et al.
HLA class II alleles associations of anticardiolipin and anti-beta2GPI
antibodies in a large series of European patients with systemic lupus
erythematosus. Lupus. 2000; 9: 47-55.
• Gateva V, Sandling JK, Hom G, Taylor KE, Chung SA, Sun X et al. A large-
scale replication study identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10
as risk loci for systemic lupus erythematosus. Nat Genet. 2009; 41: 1228-1233.
• Giambra V, Fruscalzo A, Giufre’ M, Martinez-Labarga C, Favaro M, Rocchi
M et al. Evolution of human IgH30EC duplicated structures: both enhancers
HS1,2 are polymorphic with variation of transcription factor’s consensus sites.
Gene. 2005; 346: 105-114.
• Golden-Mason L, Klarquist J, Wahed AS, Rosen HR. Cutting Edge:
Programmed Death-1 Expression Is Increased on Immunocytes in Chronic
Hepatitis C Virus and Predicts Failure of Response to Antiviral Therapy: Race-
Dependent Differences. J Immunol. 2008; 180: 3637-3641.
• Gourh P, Agarwal SK, Martin E, Divecha D, Rueda B, Bunting H et al.
Association of the C8orf13-BLK region with systemic sclerosis in North-
American and European populations. J Autoimmun. 2010; 34:155-62.
• Graham DS, Graham RR, Manku H, Wong AK, Whittaker JC, Gaffney PM et
al. Polymorphism at the TNF superfamily gene TNFSF4 confers susceptibility
to systemic lupus erythematosus. Nat Genet. 2008; 40: 83-89.
• Graham RR, Cotsapas C, Davies L, Hackett R, Lessard CJ, Leon JM et al.
Genetic variants near TNFAIP3 on 6q23 are associated with systemic lupus
erythematosus. Nat Genet. 2008; 40: 1059-1061.

250
 Bibliografía

• Graham RR, Hom G, Ortmann W, Behrens TW. Review of recent genome-

wide association scans in lupus. J Intern Med. 2009; 265: 680-688.
• Graham RR, Kyogoku C, Sigurdsson S, Vlasova IA, Davies LR, Baechler EC
et al. Three functional variants of IFN regulatory factor 5 (IRF5) define risk
and protective haplotypes for human lupus. Proc Natl Acad Sci U S A. 2007a;
104: 6758-6763.
• Graham RR, Ortmann W, Rodine P, Espe K, Largefeld C, Lange E et al.
Specific combinations of HLA-DR2 and DR3 clas II haplotypes contribute
graded risk for disease susceptibility and autoantibodies in human SLE. Eur J
Hum Genet. 2007b; 15: 823-830.
• Graham RR, Ortmann WA, Langefeld CD, Jawaheer D, Selby SA, Rodine PR
et al. Visualizing human leukocyte antigen class II risk haplotypes in human
systemic lupus erythematosus. Am J Hum Genet. 2002; 71: 543-553.
• Gray-McGuire C, Moser KL, Gaffney PM, Kelly J, Yu H, Olson JM et al.
Genome scan of human systemic lupus erythematosus by regression modeling:
evidence of linkage and epistasis at 4p16-15.2. Am J Hum Genet. 2000; 67:
1460-1469.
• Gregersen PK, Amos CI, Lee AT, Lu Y, Remmers EF, Kastner DL et al. REL,
encoding a member of the NF-kappaB family of transcription factors, is a newly
defined risk locus for rheumatoid arthritis. Nat Genet. 2009; 41: 820-823.
• Gregersen PK, Behrens TW. Genetics of autoimmune diseases: disorders of
immune homeostasis. Nat Rev Genet. 2006a; 7: 917-928.
• Gregersen PK, Lee HS, Batliwalla F, Begovich AB. PTPN22: setting
thresholds for autoimmunity. Semin Immunol. 2006b; 18: 214-223.
• Griffiths MM, Encinas JA, Remmers EF, Kuchroo VK, Wilder RL. Mapping
autoimmunity genes. Curr Opin Immunol. 1999; 11: 689-700.
• Guillemin F. Primer: the fallacy of subgroup analysis. Nat Clin Pract
Rheumatol. 2007; 3: 407-413.

251
Factores genéticos asociados con predisposición a LES

• Guo L, Deshmukh H, R Lu R, Vidal GS, Kelly JA, Kaufman KM et al.

Replication of the BANK1 genetic association with systemic lupus
erythematosus in a European-derived population. Genes Immun. 2009; 10: 531-
538.
• Guyot B, Mouchiroud G. Characterization of promoter elements directing
Mona/Gads molecular adapter expression in T and myelomonocytic cells:
involvement of the AML-1 transcription factor. J Leukoc Biol. 2003; 73: 263-
272.
• Hallberg B, Thornell A, Holm M, Grundstrom T. SEF1 binding is important
for T cell specific enhancers of genes for T cell receptor-CD3 subunits. Nucleic
Acids Res. 1992; 20: 6495-6499.
• Han JW, Zheng HF, Cui Y, Sun LD, Ye DQ, Hu Z et al. Genome-wide
association study in a Chinese Han population identifies nine new susceptibility
loci for systemic lupus erythematosus. Nat Genet. 2009; 41: 1234-1237.
• Han S, Kim-Howard X, Deshmukh H, Kamatani Y, Viswanathan P,
Guthridge JM et al. Evaluation of imputation-based association in and around
the integrin-alpha-M (ITGAM) gene and replication of robust association
between a non-synonymous functional variant within ITGAM and systemic
lupus erythematosus (SLE). Hum Mol Genet. 2009; 18: 1171-1180.
• Hellquist A, Järvinen TM, Koskenmies S, Zucchelli M, Orsmark-Pietras C,
Berglind L et al. Evidence for genetic association and interaction between the
TYK2 and IRF5 genes in systemic lupus erythematosus. J Rheumatol. 2009; 36:
1631-1638.
• Hernandez-Munain C, Krangel MS. c-Myb and core-binding factor/PEBP2
display functional synergy but bind independently to adjacent sites in the T-cell
receptor delta enhancer. Mol Cell Biol. 1995; 15: 3090-3099.
• Heyninck K, Kreike MM, Beyaert R. Structure-function analysis of the A20-
binding inhibitor of NF-κB activation, ABIN-1. FEBS Lett. 2003; 536: 135-140.

252
 Bibliografía

• Hildner KM, Schirmacher P, Atreya I, Dittmayer M, Bartsch B, Galle PR et al.

Targeting of the transcription factor STAT4 by antisense phosphorothioate
oligonucleotides suppresses collagen-induced arthritis. J Immunol. 2007; 178
(6): 3427-3436.
• Hinks A, Barton A, John S, Bruce I, Hawkins C, Griffiths CE et al.
Association between the PTPN22 gene and rheumatoid arthritis and juvenile
idiopathic arthritis in a UK population: further support that PTPN22 is an
autoimmunity gene. Arthritis Rheum. 2005; 52: 1694-1699.
• Hinks A, Worthington J, Thomson W. The association of PTPN22 with
rheumatoid arthritis and juvenile idiopathic arthritis. Rheumatology (Oxford).
2006; 45: 365-368.
• Hochberg MC. Updating the American College of Rheumatology revised
criteria for the classification of systemic lupus erythematosus. Arthritis Rheum.
1997; 40: 1725.
• Hollenhorst PC, Shah AA, Hopkins C, Graves BJ. Genomewide analyses
reveal properties of redundant and specific promoter occupancy within the ETS
gene family. Genes Dev. 2007; 21: 1882-1894.
• Hom G, Graham RR, Modrek B, Taylor KE, Ortmann W, Garnier S et
al.Association of systemic lupus erythematosus with C8orf13-BLK and ITGAM-
ITGAX. N Engl J Med. 2008; 358: 900-909.
• Hulley SB. Designing clinical research. 3rd ed. Philadelphia, PA: Lippincott
Williams & Wilkins; 2007.
• International HapMap Consortium, Frazer KA, Ballinger DG, Cox DR, Hinds
DA, Stuve LL et al. A second generation human haplotype map of over 3.1
million SNPs. Nature. 2007; 449: 851-861.
• Jacob CO, Reiff A, Armstrong DL, Myones BL, Silverman E, Klein-Gitelman
M et al. Identification of novel susceptibility genes in childhood-onset systemic

253
Factores genéticos asociados con predisposición a LES

lupus erythematosus using a uniquely designed candidate gene pathway

platform. Arthritis Rheum. 2007; 56: 4164-4173.
• Jacob CO, Zang S, Li L, Ciobanu V, Quismorio F, Mizutani A et al. Pivotal
role of Stat4 and Stat6 in the pathogenesis of the lupus-like disease in the New
Zealand mixed 2328 mice. J Immunol. 2003; 171: 1564-1571.
• Jacob CO, Zhu J, Armstrong DL, Yan M, Han J, Zhou XJ et al. Identification
of IRAK1 as a risk gene with critical role in the pathogenesis of systemic lupus
erythematosus. Proc Natl Acad Sci U S A. 2009; 106: 6256–6261.
• James ES, Harney S, Wordsworth BP, Cookson WO, Davis SJ, Moffatt MF et
al. PDCD1: a tissue-specific susceptibility locus for inherited inflammatory
disorders. Genes Immun. 2005; 6: 430-437.
• Jawaheer D, Seldin MF, Amos CI, Chen WV, Shigeta R, Etzel C et al.
Screening the genome for rheumatoid arthritis susceptibility genes: a
replication study and combined analysis of 512 multicase families. Arthritis
Rheum. 2003; 48: 906-916.
• Ji JD, Lee WJ, Kong KA, Woo JH, Choi SJ, Lee YH et al. Association of
STAT4 polymorphism with rheumatoid arthritis and systemic lupus
erythematosus: a meta-analysis. Mol Biol Rep. 2010; 37: 141-147.
• Johansson AC, Lindqvist AK, Johannesson M, Holmdahl R. Genetic
heterogeneity of autoimmune disorders in the nonobese diabetic mouse. Scand J
Immunol. 2003; 57: 203-213.
• Johansson CM, Zunec R, Garcia MA, Scherbarth HR, Tate GA, Paira S et al.
Chromosome 17p12-q11 harbors susceptibility loci for systemic lupus
erythematosus. Hum Genet. 2004; 115:230-238.
• Johansson M, Arlestig L, Möller B, Rantapää-Dahlqvist S. Association of a
PDCD1 polymorphism with renal manifestations in systemic lupus
erythematosus. Arthritis Rheum. 2005; 52: 1665-1669.

254
 Bibliografía

• Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N et al.
Methylated DNA and MeCP2 recruit histone deacetylase to repress
transcription. Nat Genet. 1998; 19: 187-191.
• Kamachi Y, Ogawa E, Asano M, Ishida S, Murakami Y, Satake M et al.
Purification of a mouse nuclear factor that binds to both the A and B cores of
the polyomavirus enhancer. J Virol. 1990; 64: 4808-4819.
• Karassa FB, Trikalinos TA, Ioannidis JP. The Fc gamma RIIIA-F158 allele is
a risk factor for the development of lupus nephritis: a meta-analysis. Kidney Int.
2003; 63: 1475-1482.
• Kariuki SN, Kirou KA, MacDermott EJ, Barillas-Arias L, Crow MK,
Niewold TB. Cutting edge: autoimmune disease risk variant of STAT4 confers
increased sensitivity to IFN-alpha in lupus patients in vivo. J Immunol. 2009;
182: 34-38.
• Kassel R, Cruise MW, Iezzoni JC, Taylor NA, Pruett TL, Hahn YS.
Chronically inflamed livers up-regulate expression of inhibitory B7 family
members. Hepatology. 2009; 50: 1625-1637.
• Kaufman KM, Kelly JA, Herring BJ, Adler AJ, Glenn SB, Namjou B et al.
Evaluation of the Genetic Association of the PTPN22 R620W Polymorphism in
Familial and Sporadic Systemic Lupus Erythematosus. Arthritis Rheum. 2006;
54: 2533-2540.
• Kawasaki A, Ito I, Hikami K, Ohashi J, Hayashi T, Goto D et al. Role of
STAT4 polymorphisms in systemic lupus erythematosus in a Japanese
population: a case-control association study of the STAT1-STAT4 region.
Arthritis Res Ther. 2008a; 10: R113.
• Kawasaki A, Kyogoku C, Ohashi J, Miyashita R, Hikami K, Kusaoi M et al.
Association of IRF5 polymorphisms with systemic lupus erythematosus in a
Japanese population: support for a crucial role of intron 1 polymorphisms.
Arthritis Rheum. 2008b; 58: 826-834.

255
Factores genéticos asociados con predisposición a LES

• Keir ME, Francisco LM, Sharpe AH. PD-1 and its ligands in T-cell immunity.
Curr Opin Immunol. 2007; 19: 309-314.
• Kel AE, Gossling E, Reuter I, Cheremushkin E, Kel-Margoulis OV,
Wingender E et al. MATCH: A tool for searching transcription factor binding
sites in DNA sequences. Nucleic Acids Res. 2003; 31: 3576-3579.
• Kelly JA, Kelley JM, Kaufman KM, Kilpatrick J, Bruner GR, Merrill JT et al.
Interferon regulatory factor-5 is genetically associated with systemic lupus
erythematosus in African Americans. Genes Immun. 2008; 9: 187-194.
• Kelly JA, Moser KL, Harley JB. The genetics of systemic lupus erythematosus:
putting the pieces together. Genes Immun. 2002; 3 Suppl 1:S71-S85.
• Kim-Howard X, Maiti AK, Anaya JM, Bruner GR, Brown E, Merrill JT et al.
ITGAM coding variant (rs1143679) influences the risk of renal disease, discoid
rash, and immunologic manifestations in lupus patients with European ancestry.
Ann Rheum Dis. 2009. [Epub ahead of print].
• Klinman DM, Gursel I, Klaschik S, Dong L, Currie D, Shirota H. Therapeutic
potential of oligonucleotides expressing immunosuppressive TTAGGG motifs.
Ann N Y Acad Sci. 2005; 1058: 87-95.
• Klose RJ, Bird AP. Genomic DNA methylation: the mark and its mediators.
Trends Biochem Sci. 2006; 31: 89-97.
• Kobayashi S, Ikari K, Kaneko H, Kochi Y, Yamamoto K, Shimane K et al.
Association of STAT4 with susceptibility to rheumatoid arthritis and systemic
lupus erythematosus in the Japanese population. Arthritis Rheum. 2008; 58:
1940-1946.
• Korman BD, Alba MI, Le JM, Alevizos I, Smith JA, Nikolov NP et al.
Variant form of STAT4 is associated with primary Sjogren's syndrome. Genes
Immun. 2008; 9:267-270.

256
 Bibliografía

• Koskenmies S, Lahermo P, Julkunen H, Ollikainen V, Kere J, Widen E.

Linkage mapping of systemic lupus erythematosus (SLE) in Finnish families
multiply affected by SLE. J Med Genet. 2004; 41: e2-e5.
• Kotenko SV, Pestka S. Jak-Stat signal transduction pathway through the eyes
of cytokine class II receptor complexes. Oncogene. 2000; 19: 2557-2565.
• Kozyrev SV, Abelson AK, Wojcik J, Zaghlool A, Linga Reddy MVP,
Sanchez E et al. Functional variants in the B-cell gene BANK1 are associated
with systemic lupus erythematosus. Nat Genet. 2008. 40 (2): 211-216.
• Kozyrev SV, Lewen S, Reddy PM, Pons-Estel B,Witte T, Junker P et al.
Structural insertion/deletion variation in IRF5 is associated with a risk
haplotype and defines the precise IRF5 isoforms expressed in systemic lupus
erythematosus. Arthritis Rheum. 2007; 56: 1234-1241.
• Kyogoku C, Langefeld CD, Ortmann WA, Lee A, Selby S, Carlton VE et al.
Genetic association of the R620W polymorphism of protein tyrosine
phosphatase PTPN22 with human SLE. Am J Hum Genet. 2004; 75: 504-507.
• Latchman Y, Wood CR, Chernova T, Chaudhary D, Borde M, Chernova I et
al. PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat
Immunol. 2001; 2: 261-268.
• Lauwerys BR, Wakeland EK. Genetics of lupus nephritis. Lupus. 2005; 14: 2-
12.
• Lawrence JS, Martins CL, Drake GL. A family survey of lupus erythematosus.
1. Heritability. J Rheumatol. 1987; 14: 913-921.
• Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP et al. Failure to
regulate TNF-induced NF-kappaB and cell death responses in A20-deficient
mice. Science. 2000; 289: 2350-2354.
• Lee HS, Remmers EF, Le JM, Kastner DL, Bae SC, Gregersen PK.
Association of STAT4 with rheumatoid arthritis in the Korean population. Mol
Med. 2007; 13: 455-460.

257
Factores genéticos asociados con predisposición a LES

• Lee YH, Nath SK. Systemic lupus erythematosus susceptibility loci defined by
genome scan meta-analysis. Hum Genet. 2005; 118: 434-443.
• Lee-Kirsch MA, Gong M, Chowdhury D, Senenko L, Engel K, Lee YA et al.
Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 are
associated with systemic lupus erythematosus. Nat Genet. 2007; 39: 1065-1067.
• Leibson PJ. The regulation of lymphocyte activation by inhibitory receptors.
Curr Opin Immunol. 2004; 16: 328-336.
• Li CC, Ramirez-Carrozzi VR, Smale ST. Pursuing gene regulation 'logic' via
RNA interference and chromatin immunoprecipitation. Nat Immunol. 2006; 7:
692-697.
• Li Q, Johnston SA. Are all DNA binding and transcription regulation by an
activator physiologically relevant? Mol Cell Biol. 2001; 21: 2467-2474.
• Li QJ, Chau J, Ebert PJ, Sylvester G, Min H, Liu G et al. miR-181a is an
intrinsic modulator of T cell sensitivity and selection. Cell. 2007; 129: 147-161.
• Lindqvist AK, Steinsson K, Johanneson B, Kristjansdottir H, Arnasson A,
Grondal G et al. A susceptibility locus for human systemic lupus erythematosus
(hSLE1) on chromosome 2q. J Autoimmun. 2000; 14: 169-178.
• MacKenzie A, Quinn J. A serotonin transporter gene intron 2 polymorphic
region, correlated with affective disorders, has allele-dependent differential
enhancer-like properties in the mouse embryo. Proc Natl Acad Sci U S A. 1999;
96: 15251-15255.
• Magnusson V, Lindqvist AK, Castillejo-Lopez C, Kristjansdottir H, Steinsson
K, Grondal G et al. Fine mapping of the SLEB2 locus involved in susceptibility
to systemic lupus erythematosus. Genomics. 2000; 70: 307-314.
• Manderson AP, Botto M, Walport MJ. The role of complement in the
development of systemic lupus erythematosus. Annu Rev Immunol. 2004; 22:
431-456.

258
 Bibliografía

• Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ et
al. Finding the missing heritability of complex diseases. Nature. 2009; 461:
747-753.
• Martinez A, Varade J, Marquez A, Cenit MC, Espino L, Perdigones N et al.
Association of the STAT4 gene with increased susceptibility for some immune-
mediated diseases. Arthritis Rheum. 2008; 58: 2598-2602.
• Mevorach D, Mascarenhas JO, Gershov D, Elkon KB. Complement-
dependent clearance of apoptotic cells by human macrophages. J Exp Med.
1998; 188: 2313-2320.
• Meyers S, Downing JR, Hiebert SW. Identification of AML-1 and the (8;21)
translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins:
the runt homology domain is required for DNA binding and protein-protein
interactions. Mol Cell Biol. 1993; 13: 6336-6345.
• Miller W, Rosenbloom K, Hardison RC, Hou M, Taylor J, Raney B et al. 28-
way vertebrate alignment and conservation track in the UCSC Genome
Browser. Genome Res. 2007; 17: 1797-1808.
• Minegishi Y, Saito M, Morio T, Watanabe K, Agematsu K, Tsuchiya S et al.
Human tyrosine kinase 2 deficiency reveals its requisite roles in multiple
cytokine signals involved in innate and acquired immunity. Immunity 2006; 25:
745-755.
• Mishra N, Reilly CM, Brown DR, Ruiz P, Gilkeson GS. Histone deacetylase
inhibitors modulate renal disease in the MRL- lpr/ lpr mouse. J Clin Invest.
2003; 111: 539-552.
• Mok CC, Lau CS. Pathogenesis of systemic lupus erythematosus. J Clin
Pathol. 2003; 56: 481-490.
• Moser KL, Kelly JA, Lessard CJ Harley JB. Recent insights into the genetic
basis of systemic lupus erythematosus. Genes Immun. 2009; 10: 373-379.

259
Factores genéticos asociados con predisposición a LES

• Moser KL, Neas BR, Salmon JE, Yu H, Gray-McGuire C, Asundi N et al.

Genome scan of human systemic lupus erythematosus: evidence for linkage on
chromosome 1q in African-American pedigrees. Proc Natl Acad Sci U S A.
1998; 95: 14869-14874.
• Moyé LA. Multiple analyses in clinical trials: fundamentals for investigators.
New York: Springer; 2003.
• Musone SL, Taylor KE, Lu TT, Nititham J, Ferreira RC, Ortmann W et al.
Multiple polymorphisms in the TNFAIP3 region are independently associated
with systemic lupus erythematosus. Nat Genet. 2008; 40; 1062-1064.
• Nair RP, Duffin KC, Helms C, Ding J, Stuart PE, Goldgar D et al. Genome-
wide scan reveals association of psoriasis with IL-23 and NF-κB pathwasys.
Nat Genet. 2009; 41: 199-204.
• Nalbandian A, Crispín JC, Tsokos GC. Interleukin-17 and systemic lupus
erythemathosus: current concepts. Clin Exp Immunol. 2009; 157: 209-215
• Namjou B, Sestak AL, Armstrong DL, Zidovetzki R, Kelly JA, Jacob N et al.
High-density genotyping of STAT4 reveals multiple haplotypic associations with
systemic lupus erythematosus in different racial groups. Arthritis Rheum. 2009;
60: 1085-1095.
• Nath SK, Han S, Kim-Howard X, Kelly JA, Viswanathan P, Gilkeson GS et
al. A nonsynonymous functional variant in integrin-aM (encoded by ITGAM) is
associated with systemic lupus erythematosus. Nat Genet. 2008. 40: 152-154.
• Nath SK, Harley JB, Lee YH. Polymorphisms of complement receptor 1 and
interleukin-10 genes and systemic lupus erythematosus: a meta-analysis. Hum
Genet. 2005; 118: 225-234.
• Nath SK, Quintero-Del-Rio AI, Kilpatrick J, Feo L, Ballesteros M, Harley JB.
Linkage at 12q24 with systemic lupus erythematosus (SLE) is established and
confirmed in Hispanic and European American families. Am J Hum Genet.
2004; 74: 73-82.

260
 Bibliografía

• Nepom GT, Byers P, Seyfried C, Healey LA, Wilske KR, Stage D et al. HLA
genes associated with rheumatoid arthritis: identification of susceptibility
alleles using specific oligonucleotide probes. Arthritis Rheum. 1989; 32: 15-21.
• Newby PR, Roberts-Davies EL, Brand OJ, Heward JM, Franklyn JA, Gough
SC et al. Tag SNP screening of the PDCD1 gene for association with Graves'
disease. Clin Endocrinol (Oxf). 2007; 67: 125-128.
• Nielsen C, Hansen D, Husby S, Jacobsen BB, Lillevang ST. Association of a
putative regulatory polymorphism in the PD-1 gene with susceptibility to type 1
diabetes. Tissue Antigens. 2003; 62: 492-497.
• Nielsen C, Laustrup H, Voss A, Junker P, Husby S, Lillevang ST. A putative
regulatory polymorphism in PD-1 is associated with nephropathy in a
population-based cohort of systemic lupus erythematosus patients. Lupus. 2004;
13: 510-516.
• Niewold TB, Kelly JA, Flesch MH, Espinoza LR, Harley JB and Crow MK.
Association of the IRF5 risk haplotype with high serum interferon-alpha activity
in systemic lupus erythematosus patients. Arthritis Rheum. 2008; 58 (8): 2481-
2487.
• Nishikomori R, Usui T, Wu CY, Morinobu A, O'Shea JJ, Strober W.
Activated STAT4 has an essential role in Th1 differentiation and proliferation
that is independent of its role in the maintenance of IL-12R beta 2 chain
expression and signaling. J Immunol. 2002; 169: 4388-4398.
• Nishimura H, Minato N, Nakano T, Honjo T. Immunological studies on PD-1
deficient mice: implication of PD-1 as a negative regulator for B cell responses.
Int Immunol. 1998; 10: 1563-1572.
• Nishimura H, Nose M, Hiai H, Minato N, Honjo T. Development of lupus-like
autoimmune diseases by disruption of the PD-1 gene encoding an ITIM motif-
carrying immunoreceptor. Immunity. 1999; 11: 141-151.

261
Factores genéticos asociados con predisposición a LES

• Nordmark G, Kristjansdottir G, Theander E, Eriksson P, Brun JG, Wang C et

al. Additive effects of the major risk alleles of IRF5 and STAT4 in primary
Sjögren’s syndrome. Genes Immun. 2009; 10: 68-76.
• Novembre J, Johnson T, Bryc K, Kutalik Z, Boyko AR, Auton A et al. Genes
mirror geography within Europe. Nature. 2008; 456: 98–101.
• Oishi Y, Sumida T, Sakamoto A, Kita Y, Kurasawa K, Nawata Y et al.
Selective reduction and recovery of invariant Valpha24JalphaQ T cell receptor
T cells in correlation with disease activity in patients with systemic lupus
erythematosus. J Rheumatol. 2001; 28: 275-283.
• Okazaki T, Tanaka Y, Nishio R, Mitsuiye T, Mizoguchi A, Wang J et al.
Autoantibodies against cardiac troponin I are responsible for dilated
cardiomyopathy in PD-1-deficient mice. Nat Med. 2003; 9: 1477-1483.
• Olson JM, Song Y, Dudek DM, Moser KL, Kelly JA, Bruner GR et al. A
genome screen of systemic lupus erythematosus using affected-relative-pair
linkage analysis with covariates demonstrates genetic heterogeneity. Genes
Immun. 2002; 3 Suppl 1: S5-S12.
• Onengut-Gumuscu S, Ewens KG, Spielman RS, Concannon P. A functional
polymorphism (1858C/T) in the PTPN22 gene is linked and associated with type
I diabetes in multiplex families. Genes Immun. 2004; 5: 678-80.
• Ono M, Yaguchi H, Ohkura N, Kitabayashi I, Nagamura Y, Nomura T et al.
Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1.
Nature. 2007; 446: 685-689.
• Orozco G, Abelson AK, Gonzalez-Gay MA, Balsa A, Pascual-Salcedo D,
Garcia A et al. Study of functional variants of the BANK1 gene in rheumatoid
arthritis. Arthritis Rheum. 2009a; 60: 372-379.
• Orozco G, Alizadeh BZ, Delgado-Vega AM, Gonzalez-Gay MA, Balsa A,
Pascual-Salcedo D et al. Association of STAT4 with rheumatoid arthritis: a

262
 Bibliografía

replication study in three European populations. Arthritis Rheum. 2008;

58:1974-1980.
• Orozco G, Hinks A, Eyre S, Ke X, Gibbons LJ, Bowes J et al. Combined
effects of three independent SNPs greatly increase the risk estimate for RA at
6q23. Hum Mol Genet. 2009b; 18: 2693-2699.
• Orozco G, Sanchez E, Gonzalez-Gay MA, Lopez-Nevot MA, Torres B, Caliz
R et al. Association of a functional single-nucleotide polymorphism of PTPN22,
encoding lymphoid protein phosphatase, with rheumatoid arthritis and systemic
lupus erythematosus. Arthritis Rheum. 2005; 52: 219-224.
• Orrú V, Tsai SJ, Rueda B, Fiorillo E, Stanford SM, Dasgupta J et al. A loss-
of-function variant of PTPN22 is associated with reduced risk of systemic lupus
erythematosus. Hum Mol Genet. 2009; 18: 569-579.
• Palomino-Morales RJ, Rojas-Villarraga A, Gonzalez CI, Ramírez G, Anaya
JM, Martín J. STAT4 but not TRAF1/C5 variants influence the risk of
developing rheumatoid arthritis and systemic lupus erythematosus in
Colombians. Genes Immun. 2008; 9: 379-382.
• Panush RS, Edwards LN, Longley S, Webster E. "Rhupus" syndrome. Arch
Intern Med. 1988; 148: 1633-1636.
• Peng G, Li S, Wu W, Tan X, Chenb Y, Chen Z. PD-1 upregulation is
associated with HBV-specific T cell dysfunction in chronic hepatitis B patients.
Mol Immunol. 2008; 45: 963-970.
• Peschken CA, Katz SJ, Silverman E, Pope JE, Fortin PR, Pineau C et al. The
1000 Canadian faces of lupus: determinants of disease outcome in a large
multiethnic cohort. J Rheumatol. 2009; 36: 1200-1208.
• Petri M. Epidemiology of systemic lupus erythematosus. Best Pract Res Clin
Rheumatol. 2002; 16: 547-558.
• Petri M. The effect of race on the presentation and course of SLE in the
United States. Arthritis Rheum. 1997; 40: 785-785.

263
Factores genéticos asociados con predisposición a LES

• Petrovas C, Casazza JP, Brenchley JM, Price DA, Gostick E, Adams WC et al.
PD-1 is a regulator of virus-specific CD8+ T cell survival in HIV infection. J
Exp Med. 2006; 203 (10): 2281-2292
• Plenge RM, Cotsapas C, Davies L, Price AL, de Bakker PIW, Maller J et al.
Two independent alleles at 6q23 associated with risk of rheumatoid arthritis.
Nat Genet. 2007a; 39: 1477-1482.
• Plenge RM, Padyukov L, Remmers EF, Purcell S, Lee AT, Karlson EW et al.
Replication of putative candidate-gene associations with rheumatoid arthritis in
4,000 samples from North America and Sweden: association of susceptibility
with PTPN22, CTLA4, and PADI4. Am J Hum Genet. 2005; 77: 1044-1060.
• Plenge RM, Seielstad M, Padyukov L, Lee AT, Remmers EF, Ding B et al.
TRAF1-C5 as a risk locus for rheumatoid arthritis: a genomewide study. N
Engl J Med. 2007b; 357: 1199-1209.
• Pons-Estel BA, Catoggio LJ, Cardiel MH, Soriano ER, Gentiletti S, Villa AR
et al. The GLADEL multinational Latin American prospective inception cohort
of 1,214 patients with systemic lupus erythematosus: ethnic and disease
heterogeneity among "Hispanics". Medicine (Baltimore). 2004; 83: 1-17.
• Price AL, Patterson NJ, Plenge RM, Weinblatt ME, Shadick NA, Reich D.
Principal components analysis corrects for stratification in genome-wide
association studies. Nat Genet. 2006; 38: 904-909.
• Prokunina L, Castillejo-Lopez C, Oberg F, Gunnarsson I, Berg L, Magnusson
V et al. A regulatory polymorphism in PDCD1 is associated with susceptibility
to systemic lupus erythematosus in humans. Nat Genet. 2002; 32: 666-669.
• Prokunina L, Gunnarsson I, Sturfelt G, Truedsson L, Seligman VA, Olson JL
et al. The systemic lupus erythematosus-associated PDCD1 polymorphism
PD1.3A in lupus nephritis. Arthritis Rheum. 2004; 50: 327-328.
• Radziewicz H, Dunham RM, Grakoui A. PD-1 tempers Tregs in chronic HCV
infection. J Clin Invest. 2009; 119: 450-453.

264
 Bibliografía

• Ragimbeau J, Dondi E, Alcover A, Eid P, Uze G, Pellegrini S. The tyrosine

kinase Tyk2 controls IFNAR1 cell surface expression. EMBO J. 2003; 22: 537-
547.
• Rahmann S, Muller T, Vingron M. On the power of profiles for transcription
factor binding site detection. Stat Appl Genet Mol Biol. 2003; 2: Article7.
• Raman K, Mohan C. Genetic underpinnings of autoimmunity: lessons from
studies in arthritis, diabetes, lupus and multiple sclerosis. Curr Opin Immunol.
2003; 15: 651-659.
• Ramos PS, Kelly JA, Gray-McGuire C, Bruner GR, Leiran AN, Meyer CM et
al. Familial aggregation and linkage analysis of autoantibody traits in
pedigrees multiplex for systemic lupus erythematosus. Genes Immun. 2006; 7:
417-432.
• Rao S, Olson JM, Moser KL, Gray-McGuire C, Bruner GR, Kelly J et al.
Linkage analysis of human systemic lupus erythematosus-related traits: a
principal component approach. Arthritis Rheum. 2001; 44: 2807-2818.
• Raychaudhuri S, Remmers EF, Lee AT, Hackett R, Guiducci C, Burtt NP et
al. Common variants at CD40 and other loci confer risk of rheumatoid arthritis.
Nat Genet. 2008; 40: 1216-1223.
• Reddy MV, Johansson M, Sturfelt G, Jonsen A, Gunnarsson I, Svenungsson E,
et al. The R620W C/T polymorphism of the gene PTPN22 is associated with
SLE independently of the association of PDCD1. Genes Immun. 2005; 6: 658-
662.
• Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD et al. Global
variation in copy number in the human genome. Nature. 2006; 444: 444-454.
• Remmers EF, Plenge RM, Lee AT, Graham RR, Hom G, Behrens TW et al.
STAT4 and the risk of rheumatoid arthritis and systemic lupus erythematosus. N
Engl J Med. 2007; 357: 977-986.

265
Factores genéticos asociados con predisposición a LES

• Ren Y, Tang J, Mok MY, Chan AW, Wu A, Lau CS. Increased apoptotic
neutrophils and macrophages and impaired macrophage phagocytic clearance
of apoptotic neutrophils in systemic lupus erythematosus. Arthritis Rheum.
2003; 48: 2888-2897.
• Reveille JD, Arnett FC, Wilson RW, Bias WB, McLean RH. Null alleles of
the fourth component of complement and HLA haplotypes in familial systemic
lupus erythematosus. Immunogenetics. 1985; 21: 299-311.
• Richardson B, Scheinbart L, Strahler J, Gross L, Hanash S, Johnson M.
Evidence for impaired T cell DNA methylation in systemic lupus erythematosus
and rheumatoid arthritis. Arthritis Rheum. 1990; 33: 1665-1673.
• Richman IB, Chung SA, Taylor KE, Kosoy R, Tian C, Ortmann WA et al.
European population substructure correlates with systemic lupus erythematosus
endophenotypes in North Americans of European descent. Genes Immun. 2009.
[Epub ahead of print].
• Richter MF, Dumenil G, Uze G, Fellous M, Pellegrini S. Specific contribution
of TYK2 JH regions to the binding and the expression of the interferon a/b
receptor component IFNAR1. J Biol Chem. 1998; 273: 24723-24729.
• Rieck M, Arechiga A, Onengut-Gumuscu S, Greenbaum C, Concannon P,
Buckner JH. Genetic variation in PTPN22 corresponds to altered function of T
and B lymphocytes. J Immunol. 2007; 179: 4704-4710.
• Roulet E, Fisch I, Junier T, Bucher P, Mermod N. Evaluation of computer
tools for the prediction of transcription factor binding sites on genomic DNA. In
Silico Biol. 1998; 1: 21-28.
• Salloum R, Franek BS, Kariuki SN, Rhee L, Mikolaitis RA, Jolly M et al.
Genetic variation at the IRF7/PHRF1 locus is associated with autoantibody
profile and serum interferon-alpha activity in lupus patients. Arthritis Rheum.
2010; 62: 553-561.

266
 Bibliografía

• Sanghera DK, Manzi S, Bontempo F, Nestlerode C, Kamboh MI. Role of an

intronic polymorphism in the PDCD1 gene with the risk of sporadic systemic
lupus erythematosus and the occurrence of antiphospholipid antibodies. Hum
Genet. 2004; 115: 393-398.
• Sawalha AH, Webb R, Han S, Kelly JA, Kaufman KM, Kimberly RP et al.
Common variants within MECP2 confer risk of systemic lupus erythematosus.
PLoS ONE. 2008; 3: e1727.
• Scofield RH, Bruner GR, Kelly JA, Kilpatrick J, Bacino D, Nath SK et al.
Thrombocytopenia identifies a severe familial phenotype of systemic lupus
erythematosus and reveals genetic linkages at 1q22 and 11p13. Blood. 2003;
101: 992-997.
• Sebastiani GD, Galeazzi M. Immunogenetic studies on systemic lupus
erythematosus. Lupus. 2009; 18: 878-883.
• Seldin MF, Amos CI, Ward R, Gregersen PK. The genetics revolution and the
assault on rheumatoid arthritis. Arthritis Rheum. 1999; 42: 1071-1079.
• Seldin MF, Shigeta R, Villoslada P, Selmi C, Tuomilehto J, Silva G et al.
European population substructure: Clustering of northern and southern
populations. PLoS Genet. 2006; 2: e143.
• Serrano NC, Millan P, Páez MC. Non-HLA associations with autoimmune
diseases. Autoimmun Rev. 2006; 5: 209-214.
• Sestak AL, Nath SK, Kelly JA, Bruner GR, James JA, Harley JB. Patients
with familial and sporadic onset SLE have similar clinical profiles but vary
profoundly by race. Lupus. 2008; 17: 1004-1009.
• Sestak AL, Nath SK, Sawalha AH, Harley JB. Current status of lupus
genetics. Arthritis Res Ther. 2007; 9: 210.
• Shai R, Quismorio FP Jr, Li L, Kwon OJ, Morrison J, Wallace DJ et al.
Genome-wide screen for systemic lupus erythematosus susceptibility genes in
multiplex families. Hum Mol Genet. 1999; 8: 639-644.

267
Factores genéticos asociados con predisposición a LES

• Shappell SB, Toman C, Anderson DC, Taylor AA, Entman ML, Smith CW.
Mac-1 (CD11b/CD18) mediates adherence-dependent hydrogen peroxide
production by human and canine neutrophils. J Immunol. 1990; 144: 2702-
2711.
• Sharpe AH, Freeman GJ. The B7-CD28 superfamily. Nat Rev Immunol. 2002;
2: 116-126.
• Shimane K, Kochi Y, Horita T, Ikari K, Amano H, Hirakata M et al. The
association of a nonsynonymous single-nucleotide polymorphism in TNFAIP3
with systemic lupus erythematosus and rheumatoid arthritis in the Japanese
population. Arthritis Rheum. 2010; 62: 574-579.
• Shin HD, Kim I, Choi CB, Lee SO, Lee HW, Bae SC. Different genetic
effects of interferon regulatory factor 5 (IRF5) polymorphisms on systemic
lupus erythematosus in a Korean population. J Rheumatol. 2008; 35: 2148-
2151.
• Sigurdsson S, Göring HH, Kristjansdottir G, Milani L, Nordmark G, Sandling
JK et al. Comprehensive evaluation of the genetic variants of interferon
regulatory factor 5 (IRF5) reveals a novel 5 bp length polymorphism as strong
risk factor for systemic lupus erythematosus. Hum Mol Genet. 2008a; 17: 872-
881.
• Sigurdsson S, Nordmark G, Garnier S, Grundberg E, Kwan T, Nilsson O et al.
A risk haplotype of STAT4 for systemic lupus erythematosus is over-expressed,
correlates with antidsDNA and shows additive effects with two risk alleles of
IRF5. Hum Mol Genet. 2008b; 17: 2868-2876.
• Sigurdsson S, Nordmark G, Göring HH, Lindroos K, Wiman AC, Sturfelt G,
et al. Polymorphisms in the Tyrosine Kinase 2 and Interferon Regulatory
Factor 5 Genes Are Associated with Systemic Lupus Erythematosus. Am J Hum
Genet. 2005. 76: 528-537.

268
 Bibliografía

• Sigurdsson S, Padyukov L, Kurreeman FA, Liljedahl U, Wiman AC,

Alfredsson L et al. Association of a haplotype in the promoter region of the
interferon regulatory factor 5 gene with rheumatoid arthritis. Arthritis Rheum.
2007; 56: 2202-2210.
• Silman AJ, Macgregor AJ, Thomson W, Holligan S, Carthy D, Farhan A,
Ollier WE. Twin cocncordance rates for rheumatoid arthritis: Results from a
nationwide study. Br J Rheumatol. 1993; 32: 903-907.
• Singh RR, Ebling FM, Albuquerque DA, Saxena V, Kumar V, Giannini EH et
al. Induction of autoantibody production is limited in nonautoimmune mice. J
Immunol. 2002; 169: 587-594.
• Singh RR, Saxena V, Zang S, Li L, Finkelman FD, Witte DP et al.
Differential contribution of IL-4 and STAT6 vs STAT4 to the development of
lupus nephritis. J Immunol. 2003; 170: 4818-4825.
• SLEGEN, Harley JB, Alarcón-Riquelme ME, Criswell LA, Jacob CO,
Kimberly RP et al.Genome-wide association scan in women with systemic lupus
erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and
other loci. Nat Genet. 2008; 40: 204-210.
• Sohn JH, Bora PS, Suk HJ, Molina H, Kaplan HJ, Bora NS. Tolerance is
dependent on complement C3 fragment iC3b binding to antigen-presenting cells.
Nat Med. 2003; 9: 206-212.
• Stetson DB, Ko JS, Heidmann T, Medzhitov R. Trex1 prevents cell-intrinsic
initiation of autoimmunity. Cell. 2008; 134: 587-598.
• Stohl W, Metyas S, Tan SM, Cheema GS, Oamar B, Xu D et al. B lymphocyte
stimulator overexpression in patients with systemic lupus erythematosus:
longitudinal observations. Arthritis Rheum. 2003; 48: 3475-3486.
• Stormo GD. DNA binding sites: representation and discovery. Bioinformatics.
2000; 16: 16-23.

269
Factores genéticos asociados con predisposición a LES

• Su K, Wu J, Edberg JC, Li X, Ferguson P, Cooper GS et al. A promoter

haplotype of the immunoreceptor tyrosine-based inhibitory motif-bearing
FcgammaRIIb alters receptor expression and associates with autoimmunity. I.
Regulatory FCGR2B polymorphisms and their association with systemic lupus
erythematosus. J Immunol. 2004; 172: 7186-7191.
• Sullivan KE, Petri MA, Schmeckpeper BJ, McLean RH, Winkelstein JA.
Prevalence of a mutation causing C2 deficiency in systemic lupus
erythematosus. J Rheumatol. 1994; 21: 1128-1133.
• Svenungsson E, Gustafsson J, Leonard D, Sandling J, Gunnarsson I,
Nordmark G et al. A STAT4 risk allele is associated with ischemic
cerebrovascular events and antiphospholipid antibodies in systemic lupus
erythematosus. Ann Rheum Dis. 2009. [Epub ahead of print].
• Taganov KD, Boldin MP, Chang KJ, Baltimore D. NFkB-dependent induction
of microRNA miR-146, an inhibitor targeted to signaling proteins of innate
immune responses. Proc Natl Acad Sci U S A. 2006; 103: 12481-12486.
• Takeuchi H, Takeuchi T, Gao J, Cantley LC, Hirata M. Characterization of
PXK as a protein involved in epidermal growth factor receptor trafficking. Mol
Cell Biol. 2010. [Epub ahead of print].
• Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield NF et al. The
1982 revised criteria for the classification of systemic lupus erythematosus.
Arthritis Rheum. 1982; 25:1271-1277.
• Tang Y, Luo X, Cui H, Ni X, Yuan M, Guo Y et al. MicroRNA-146a
contributes to abnormal activation of the type I interferon pathway in human
lupus by targeting the key signaling proteins. Arthritis Rheum. 2009; 60: 1065-
1075.
• Taylor KE, Remmers EF, Lee AT, Ortmann WA, Plenge RM, Tian C et al.
Specificity of the STAT4 genetic association for severe disease manifestations of
systemic lupus erythematosus. PLoS Genet. 2008; 4: e1000084.

270
 Bibliografía

• Teubner A, Tillmann HL, Schuppan D, Gericke G, Manns MP, Stölzel U.

Prevalence of circulating autoantibodies in healthy individuals. Med Klin
(Munich). 2002; 97: 645-649.
• Texido G, Su IH, Mecklenbräuker I, Saijo K, Malek SN, Desiderio S et al.
The B-cell-specific Src-family kinase Blk is dispensable for B-cell development
and activation. Mol Cell Biol. 2000; 20: 1227-1233.
• Thomas G, Jacobs KB, Yeager M, Kraft P, Wacholder S, Orr N et al. Multiple
loci identified in a genome-wide association study of prostate cancer. Nat Genet.
2008; 40: 310-315.
• Thomson W, Barton A, Ke X, Eyre S, Hinks A, Bowes J et al. Rheumatoid
arthritis association at 6q23. Nat Genet. 2007; 39: 1431-1433.
• Thorburn CM, Prokunina-Olsson L, Sterba KA, Lum RF, Seldin MF,
Alarcon-Riquelme ME et al. Association of PDCD1 genetic variation with risk
and clinical manifestations of systemic lupus erythematosus in a multiethnic
cohort. Genes Immun. 2007; 8: 279-287.
• Thornell A, Hallberg B, Grundstrom T. Binding of SL3-3 enhancer factor 1
transcriptional activators to viral and chromosomal enhancer sequences. J
Virol. 1991; 65: 42-50.
• Thornell A, Hallberg B, Grundstrom T. Differential protein binding in
lymphocytes to a sequence in the enhancer of the mouse retrovirus SL3-3. Mol
Cell Biol. 1988; 8: 1625-1637.
• Tian C, Plenge RM, Ransom M, Lee A, Villoslada P, Selmi C et al. Analysis
and application of European genetic substructure using 300 K SNP infomation.
PLoS Genet. 2008; 4: e4.
• Tiwari HK, Barnholtz-Sloan J, Wineinger N, Padilla MA, Vaughan LK,
Allison DB. Review and evaluation of methods correcting for population
stratification with a focus on underlying statistical principles. Hum Hered. 2008;
66: 67-86.

271
Factores genéticos asociados con predisposición a LES

• Trautmann L, Janbazian L, Chomont N, Said EA, Gimmig S, Bessette B et al.

Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to
reversible immune dysfunction. Nat Med. 2006; 12: 1198-1202.
• Tretter T, Ross AE, Dordai DI. Desiderio S. Mimicry of Pre–B Cell Receptor
Signaling by Activation of the Tyrosine Kinase Blk. J Exp Med. 2003; 198:
1863-1873.
• Tsao BP, Grossman JM, Riemekasten G, Strong N, Kalsi J, Wallace DJ et al.
Familiality and co-occurrence of clinical features of systemic lupus
erythematosus. Arthritis Rheum. 2002; 46: 2678-2685.
• Tsao BP. The genetics of human systemic lupus erythematosus. Trends
Immunol. 2003; 24: 595-602.
• Tsao BP. Update on human systemic lupus erythematosus genetics. Curr Opin
Rheumatol. 2004; 16: 513-521.
• Uchida H, Zhang J, Nimer SD. AML1A and AML1B can transactivate the
human IL-3 promoter. J Immunol. 1997; 158: 2251-2258.
• Urbani S, Amadei B, Tola D, Massari M, Schivazappa S, Missale G et al. PD-
1 expression in acute hepatitis C virus (HCV) infection is associated with HCV-
specific CD8 exhaustion. J Virol. 2006; 80: 11398-11403.
• Uribe AG, McGwin G Jr, Reveille JD, Alarcon GS. What have we learned
from a 10-year experience with the LUMINA (Lupus in Minorities; Nature vs.
nurture) cohort? Where are we heading? Autoimmun Rev. 2004; 3: 321-329.
• van der Pol W, van de Winkel JG. IgG receptor polymorphisms: risk factors
for disease. Immunogenetics. 1998; 48: 222-232.
• Vang T, Congia M, Macis MD, Musumeci L, Orru V, Zavattari P et al.
Autoimmune-associated lymphoid tyrosine phosphatase is a gain-of-function
variant. Nat Genet. 2005; 37: 1317-1319.

272
 Bibliografía

• Vasconcelos C, Carvalho C, Leal B, Pereira C, Bettencourt A, Costa PP et al.

HLA in Portuguese systemic lupus erythematosus patients and their relation to
clinical features. Ann N Y Acad Sci. 2009; 1173: 575-580.
• Velaga MR, Wilson V, Jennings CE, Owen CJ, Herington S, Donaldson PT et
al. The codon 620 tryptophan allele of the lymphoid tyrosine phosphatase (LYP)
gene is a major determinant of Graves' disease. J Clin Endocrinol Metab. 2004;
89: 5862-5865.
• Velázquez-Cruz R, Orozco L, Espinosa-Rosales F, Carreño-Manjarrez R,
Solís-Vallejo E, López-Lara ND et al. Association of PDCD1 polymorphisms
with childhood-onset systemic lupus erythematosus. Eur J Hum Genet. 2007; 15:
336-341.
• Viken MK, Amundsen SS, Kvien TK, Boberg KM, Gilboe IM, Lilleby V et al.
Association analysis of the 1858C>T polymorphism in the PTPN22 gene in
juvenile idiopathic arthritis and other autoimmune diseases. Genes Immun.
2005; 6: 271-273.
• Wallace DJ, Hahn B, Dubois EL. Dubois' lupus erythematosus. 7th ed.
Philadelphia: Lippincott Williams & Wilkin; 2007.
• Wandstrat A, Wakeland E. The genetics of complex autoimmune diseases:
non-MHC susceptibility genes. Nat Immunol. 2001; 2: 802-809.
• Wang F, Wang CL, Tan CT, Manivasagar M. Systemic lupus erythematosus
in Malaysia: a study of 539 patients and comparison of prevalence and disease
expression in different racial and gender groups. Lupus. 1997; 6: 248-253.
• Wang J, Yoshida T, Nakaki F, Hiai H, Okazaki T, Honjo T et al.
Establishment of NOD-Pdcd1-/- mice as an efficient animal model of type I
diabetes. Proc Natl Acad Sci U S A. 2005; 102: 11823-11828.
• Wargnier A, Legros-Maida S, Bosselut R, Bourge JF, Lafaurie C, Ghysdael
CJ et al. Identification of human granzyme B promoter regulatory elements
interacting with activated T-cell-specific proteins: implication of Ikaros and

273
Factores genéticos asociados con predisposición a LES

CBF binding sites in promoter activation. Proc Natl Acad Sci U S A. 1995; 92:
6930-6934.
• Wasserman R, Li YS, Hardy RR. Differential expression of the blk and ret
tyrosine kinases during B lineage development is dependent on Ig
rearrangement. J Immunol. 1995; 155: 644-651.
• Watford WT, Hissong BD, Bream JH, Kanno Y, Muul L, O’Shea JJ.
Signaling by IL-12 and IL-23 and the immunoregulatory roles of STAT4.
Immunol Rev. 2004; 202: 139-156.
• Webb R, Wren JD, Jeffries M, Kelly JA, Kaufman KM, Tang Y et al.
Variants within MECP2, a key transcription regulator, are associated with
increased susceptibility to lupus and differential gene expression in patients
with systemic lupus erythematosus. Arthritis Rheum. 2009; 60: 1076-1084.
• Wellcome Trust Case Control Consortium. Genome-wide association study of
14,000 cases of seven common diseases and 3,000 shared controls. Nature.
2007; 447: 661-678.
• Wen ZK, Xu W, Xu L, Cao QH, Wang Y, Chu YW et al. DNA
hypomethylation is crucial for apoptotic DNA to induce systemic lupus
erythematosus-like autoimmune disease in SLE-non-susceptible mice.
Rheumatology (Oxford). 2007; 46: 1796-1803.
• Wertz IE, O'Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S et al. De-
ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB
signalling. Nature. 2004; 430: 694-699.
• Willcocks LC, Lyons PA, Clatworthy MR, Robinson JI, Yang W, Newland
SA et al. Copy number of FCGR3B, which is associated with systemic lupus
erythematosus, correlates with protein expression and immune complex uptake.
J Exp Med. 2008; 205: 1573-1582.
• Wilson WA, Gharavi AE, Koike T, Lockshin MD, Branch DW, Piette JC et al.
International consensus statement on preliminary classification criteria for

274
 Bibliografía

definite antiphospholipid syndrome: report of an international workshop.

Arthritis Rheum. 1999; 42: 1309-1311.
• Wu H, Cantor RM, Graham DS, Lingren CM, Farwell L, Jager PL et al.
Association analysis of the R620W polymorphism of protein tyrosine
phosphatase PTPN22 in systemic lupus erythematosus families: increased T
allele frequency in systemic lupus erythematosus patients with autoimmune
thyroid disease. Arthritis Rheum. 2005; 52: 2396-2402.
• Yamaoka K, Saharinen P, Pesu M, Holt VE 3r, Silvennoinen O, O'Shea JJ.
The Janus kinases (Jaks). Genome Biol. 2004; 5: 253.
• Yan B, Ye S, Chen G, Kuang M, Shen N, Chen S. Dysfunctional CD4+
CD25+ regulatory T cells in untreated SLE, secondary to IFNα producing
antigen presenting cells. Arthritis Rheum. 2008; 58: 801-812.
• Yang JQ, Saxena V, Honglin Xu H, Kaer LV, Wang CR, Singh RR. Repeated
α-galactosylceramide administration results in expansion of NK T cells and
alleviates inflammatory dermatitis in MRL-lpr/lpr mice. J Immunol. 2003; 171:
4439-4446.
• Yang W, Ng P, Zhao M, Hirankarn N, Lau CS, Mok CC et al. Population
differences in SLE susceptibility genes: STAT4 and BLK, but not PXK, are
associated with systemic lupus erythematosus in Hong Kong Chinese. Genes
Immun. 2009; 10: 219-226.
• Yochum GS, McWeeney S, Rajaraman V, Cleland R, Peters S, Goodman RH
et al. Serial analysis of chromatin occupancy identifies beta-catenin target
genes in colorectal carcinoma cells. Proc Natl Acad Sci U S A. 2007; 104:
3324-3329.
• Yokoyama K, Su IH, Tezuka T, Yasuda T, Mikoshiba K, Tarakhovsky A et al.
BANK regulates BCR-induced calcium mobilization by promoting tyrosine
phosphorylation of IP3 receptor. EMBO J. 2002; 21: 83-92.

275
Factores genéticos asociados con predisposición a LES

• Yung R, Kaplan M, Ray D, Schneider K, Mo RR, Johnson K et al.

Autoreactive murine Th1 and Th2 cells kill syngeneic macrophages and induce
autoantibodies. Lupus. 2001; 10: 539-546.
• Yung RL, Quddus J, Chrisp CE, Johnson KJ, Richardson BC. Mechanism of
drug-induced lupus. I. Cloned Th2 cells modified with DNA methylation
inhibitors in vitro cause autoimmunity in vivo. J Immunol. 1995; 154: 3025-
3035.
• Zeggini E, Scott LJ, Saxena R, Voight BF, Marchini JL, Hu T et al. Meta-
analysis of genome-wide association data and large-scale replication identifies
additional susceptibility loci for type 2 diabetes. Nat Genet. 2008; 40: 638-645.
• Zervou MI, Mamoulakis D, Panierakis C, Boumpas DT, Goulielmos GN.
STAT4: A risk factor for type 1 diabetes? Hum Immunol. 2008a; 69: 647-650.
• Zervou MI, Sidiropoulos P, Petraki E, Vazgiourakis V, Krasoudaki E,
Raptopoulou A et al. Association of a TRAF1 and a STAT4 gene polymorphism
with increased risk for rheumatoid arthritis in a genetically homogeneous
population. Hum Immunol. 2008b; 69: 567-571.
• Zhao S, Long H, Lu Q. Epigenetic Perspectives in Systemic Lupus
Erythematosus: Pathogenesis, Biomarkers, and Therapeutic Potentials. Clin
Rev Allergy Immunol. 2009. [Epub ahead of print].
• Zhernakova A, van Diemen CC, Wijmenga C. Detecting shared pathogenesis
from the shared genetics of immune-related diseases. Nat Rev Genet. 2009; 10:
43-55.
• Zou X, Qiu G, Chen C, Wu M, Hu Y, Zheng H et al. Expression pattern and
subcellular localization of five splice isoforms of human PXK. Int J Mol Med.
2005; 16: 701-707.

276
ANEXO
 Anexo

Lack of replication of genetic predictors

for the rheumatoid arthritis response to
anti-TNF treatments: a prospective case-
only study

Marian Suarez-Gestal1*, Eva Perez-Pampin1*, Manuel Calaza1, Juan J. Gomez-Reino1,2

and Antonio Gonzalez1

1
Laboratorio Investigacion 10 and Rheumatology Unit, Hospital Clinico Universitario
de Santiago, Santiago de Compostela. Spain; [email protected],
[email protected], [email protected]
2
Department of Medicine. University of Santiago de Compostela, Santiago de
Compostela. Spain; [email protected]
* These authors contributed equally

Corresponding author:

Antonio Gonzalez

Laboratorio de Investigacion 10

Hospital Clinico Universitario de Santiago

Travesia de Choupana sn.

15706-Santiago de Compostela

Spain

Tfn: 34 981 950 903

Fax: 34 981 951 068

[email protected]

279
Factores genéticos asociados con predisposición a LES

[email protected]

Keywords: Rheumatoid arthritis, anti-TNF, Gene polymorphism, DAS28, Biomarker

280
 Anexo

ABSTRACT

Introduction: We aimed to replicate the strong associations that a recent Genome Wide

Association Study (GWAS) has found between 16 SNPs and response to anti-TNF

treatment in 89 patients with RA. This study is very important because, according with

published simulations, associations as strong as the reported will mean that these SNPs

could be used as predictors of response at the individual level.

Methods: Disease activity score (DAS28) was evaluated in 151 anti-TNF treated

patients with RA of Spanish ancestry at baseline and every 3 months thereafter.

Genotypes of the 16 putative predictor SNPs were obtained by single-base extension.

Association between the relative change in DAS28 and SNP genotypes was tested by

linear regression. In addition, logistic regression was applied to compare genotypes in

non-responders (n = 34) versus good-responders (n = 61) following the EULAR

response criteria.

Results: None of the analyses showed any significant association between the 16 SNPs

and response to anti-TNF treatments at 3 or 6 months. Results were also negative when

only patients treated with Infliximab (66.9 % of the total) were separately analyzed.

These negative results were obtained in spite of a very good statistical power to

replicate the reported strong associations.

Conclusion: We still do not have any sound evidence of genetic variants associated

with RA response to anti-TNF treatments. In addition, the possibility we had envisaged

of using the results of a recent GWAS for prediction in individual patients should be

dismissed.

281
Factores genéticos asociados con predisposición a LES

INTRODUCTION

Anti-tumor necrosis factor (TNF) therapies have revolutionized the treatment of

rheumatoid arthritis (RA)[1-2]. Three drugs of this type, Infliximab, Etanercept and

Adalimumab, have been used with success in hundreds of thousands patients with RA

around the world. New drugs targeting TNF are in development or have been recently

approved[3]. The beneficial effects of these drugs include a better quality of life, control

of inflammation, stiffness and pain, and slowing progression to joint erosions and

deformity. It seems also that they are able to decrease cardiovascular risk and overall

mortality of patients with RA[4-5]. However, there is a significant percentage of

patients that do not obtain these advantageous effects[1-3]. In some of them, this lack of

response is primary, from the start of the treatment, whereas others develop resistance to

treatment after a period of initial response. Unfortunately, there are no useful predictors

to forecast how the clinical response of a specific patient will be. This has led to an

unsatisfactory trial and error approach in the selection of drugs, which means that some

patients will miss an effective treatment at a critical window of opportunity time[6] and

a waste of resources for the health services. As a response to this challenge, multiple

lines of research are looking for predictors of response to anti-TNF therapies among

patient clinical features, synovial tissue biomarkers, blood proteins or genetic

variants[7-10]. Very promising, although preliminary, findings have been reported in

this last field. Sixteen SNPs with an important association with response to treatment

were identified in a recent Genome Wide Association (GWA) study[7]. In our view, the

most remarkable aspect of these findings was the marked effect size of each SNP, with

levels very rarely found in genetic studies of complex traits. All showed O.R. over 3.5

in the comparison between patients with good response and non-responders. Some of

them showed effect sizes over O.R. = 10. These effects together with minor allele

282
 Anexo

frequencies over 12 % mean that they will allow, if confirmed, for prediction of

response to anti-TNF treatments with great accuracy at the level of the individual

patient[11]. The limitation of this study was that only 89 patients were included and

even very significant results in a study of this size are uncertain. Our objective has been

to provide the necessary replication to these exciting findings with the expectation that,

at least, a few of them will be confirmed. This will be a first step before proceeding to

prospective clinical studies to assess their utility in clinical practice.

MATERIALS AND METHODS

Patients: A group of 151 patients with RA were followed prospectively at the

Rheumatology Unit of the “Hospital Clinico Universitario de Santiago” to study the

efficacy of anti-TNF therapy. All of them were of European (Spanish) ancestry. Only

patients that were naïve with respect to biologic treatments were included. Patients have

been systematically evaluated at the initiation of therapy and every three months

thereafter. Evaluations included painful and swollen joint counts, visual analogue scales

of pain, global health assessment by the patient and the physician, erythrocyte

sedimentation rate (ESR), C-reactive protein (CRP), Health Assessment Questionnaire

(HAQ) and DAS-28 score. Clinical characteristics are detailed in Table 1. All

participants gave their informed consent for inclusion and the study and procedures

have been approved by the Ethics Committee for Clinical Research of Galicia.

Assessment of the efficacy of the treatment: We used the same procedures described

in Liu et al. to make our results comparable[7]. Response to anti-TNF treatments was

assessed with the DAS28 score.[12] The primary outcome was the quantitative variable

relDAS28, which was calculated as follows:

Das 28baseline− Das 283 months

relDAS 28=
Das 28baseline

283
Factores genéticos asociados con predisposición a LES

A secondary outcome was the EULAR response classification in good-, moderate- or

non-responders.[13] Good-responders have a ∆DAS28 ≥ 1.2 and DAS28 at 3 months ≤

3.2; moderate-responders have ∆DAS28 ≥ 1.2 and DAS28 at 3 months > 3.2 or 0.6 <

∆DAS28 ≤ 1.2 and DAS28 at 3 months ≤ 5.1; and non-responders are those who do not

fall in any of these categories.

Genotypes: A total of 16 SNPs from Liu et al. [7] were analyzed (Table 2). Genotypes

were obtained by single-base extension with the SNaPshot Multiplex Kit (Applied

Biosystems, Foster City, CA, USA) and specific primers and probes (available as

supplementary material). Genotype call rate was 99.79 %, allele frequencies were in

Hardy-Weinberg equilibrium and concordant results for the 16 SNPs were obtained in

the 21 samples that were genotyped twice.

Statistical Analysis: Comparisons of the clinical characteristics of the patients with RA

included in the GWAS and in our study was done with the Student t test for data

available as means and standard deviation and with the Chi squared test for contingency

tables for frequency data. Analyses of the relationship between SNPs and treatment

response were done as in Liu et al. to make our results comparable also in this aspect[7].

Briefly, linear regression analysis between genotype data following a genetic additive

model and relDAS28 as the continuous dependent variable was done. A t statistic was

derived from the linear regression and used to calculate the p-value of the association.

This statistic is robust to deviations from normality of relDAS28. We also conducted

logistic regression analysis between the groups of responders and non-responders. Odds

ratios (O.R.) and their 95 % confidence intervals (C.I.) were obtained using as reference

the non-responder group. This second analysis will be less powerful because the

phenotype is transformed to a dichotomous variable and because the sample size is

reduced by exclusion of the moderate responders. Statistical analyses were performed in

284
 Anexo

a customized version of the Statistica 7.0 program (StatSoft, Tulsa, OK, USA). We also

explored visually the possibility that consideration of all the SNPs jointly will

discriminate between responder and non-responder patients. This analysis was done

with the Co-Plot algorithm implemented in the Visual Co-Plot software (D. Talby and

A. Raveh; available at http://www.cs.huji.ac.il/~davidt/vcoplot/index.html) [14].

Estimation of the statistical power for the linear regression analysis was done by

transforming the reported P values and number of samples in the corresponding

correlation coefficients (R2). The values of R2 and the number of samples in our study

were used as input in the module for the F test in omnibus comparisons by linear

regression of the G*Power v3.0.10 software[15].

RESULTS

The aim of our study was to replicate the strong association of 16 SNPs with

response to anti-TNF therapy reported in a recent GWAS[7]. Therefore, we have used

the same variables and type of analysis. Data from the 151 patients with RA are shown

in table 1. Some of the characteristics of our study population were different from the

patients analyzed in the GWAS[7]. Specifically, our patients showed a lower percentage

of RF positivity, higher positivity for anti-CCP antibodies, and higher baseline HAQ

and DAS28 levels. There were 70.2 % patients with high disease activity at baseline as

assessed by a DAS28 > 5.1. In spite of this high activity, there were 40.4 % and 43.7 %

good responders at 3 and 6 months, respectively, and only 22.5 % and 21.8 % of non-

responders at 3 and 6 months, respectively. The percentages of responders and non-

responders were similar in the two studies. In contrast, the proportion of patients treated

with each of the three anti-TNF drugs was different (Table 1). In our cohort, most

patients were treated with Infliximab (66.9 %), followed by Etanercept (23.2 %) and

285
Factores genéticos asociados con predisposición a LES

Adalimumab (9.9 %). We also checked that there was a good correlation between the

variable used as primary outcome in our analysis, redDAS28, and the EULAR response

classification (Figure 1) allowing for consistency in the analyses.

The relationship between the SNP genotypes and response to anti-TNF treatment

at 3 months was evaluated by linear regression analysis between the genotypes and the

continuous variable relDAS28, which is the relative change in DAS28 between baseline

and the time of evaluation. There was not association of any of the 16 SNPs with

relDAS28 at 3 months (Table 2). Secondary analyses showed very similar results.

Comparison of non-responders with good-responders according to the EULAR criteria

at 3 months did not show any significant association (Table 2). The most extreme O.R.

= 1.9 (95 % C.I. = 1.0-3.6) corresponded to rs437943 in the CNTDE1 locus, but it

compared poorly with the previously reported O.R. = 4.6 (95 % C.I. = 1.8-12.3). In

addition, there was not association of relDAS28 with any of the 16 SNPs at 6 months,

neither of the classification in responders and non-responders (available as

supplementary table). Finally, analysis of response to treatment with Infliximab, which

represented 66.9 % of the patients in our study, did not show any significant association

(available as supplementary table). No separate analyses of response to treatment with

Etarnercept or Adalimumab were done because of the small number of patients in these

two subgroups. We also visually explored if joint consideration of the 16 SNPs was able

to discriminate between the different groups of patients according to their response to

treatment, but patients with different responses did not show any clustering in

identifiable groups in this analysis (Figure 2).

It was critical, for interpretation of the above results, to assess if our study had

enough statistical power to replicate the previously reported associations. Power for the

weakest association in the GWAS, which corresponds to rs928655 (P = 3 x 10-5) , was

286
 Anexo

larger than 95 % for a P value of 0.002. It is important to remark that O.R. from the

GWAS are very likely heavily biased upwards as consequence of the winner’s curse

affecting any GWAS and specially those of small size [16-17]. Therefore this power

estimate is only valuable in the context of the reported O.R. taken at face value.

DISCUSSION

There is a great need of good predictors for RA response to the anti-TNF

treatments[1-3, 9]. The development and approval of new effective drugs for RA adds

to this urgency[3]. The recent GWAS from Liu et al. [7] was especially remarkable

because it showed such strong associations that, according to published simulations[11],

they could be used for prediction in individual patients. This is a characteristic that has

not been found in any of the previous studies. However, the size of the study implied

that results should be replicated before they could be taken at face value, as already

acknowledged by the authors. We have tried to provide here the needed replication in

the expectation that some of them will be confirmed and that validation in prospective

studies will soon follow.

Unfortunately, none of the associations was replicated in spite of the moderately

larger sample size of our study and the corresponding very good power to detect this

type of strong associations. These results make very unlikely that any of the 16 SNPs

could have an association as strong as suggested by the previous GWAS[7]. It is

possible that the differences between the patients with RA in the two studies could have

had an effect in the lack of replication, but these differences were not large enough to

completely explain the very divergent results. In addition, patients in the GWAS were

predominantly of European ancestry as were all the patients in our study. Therefore, it

seems more likely that the original strong associations were due to random variation of

287
Factores genéticos asociados con predisposición a LES

allele frequencies in a study including more than 300 000 SNPs and to the heavy bias

characteristic of GWAS of small sample size [16-17]. This possibility was already

considered by us before beginning this study, but we judged that some SNPs will be

replicated given that they showed low P values, 5 of them with P values below 10-6[7],

and low P values are the best indication of the reproducibility of results[18].

CONCLUSIONS

Our negative results implicate that we do not have still any strong evidence

supporting a significant role of genetic variation in the response to anti-TNF. In

addition, our results imply that none of the SNPs in our study will be useful as

individual predictors of response to anti-TNF, as we initially expected. It is still possible

that they will show association with response to anti-TNF, but of a much weaker

strength.

ABBREVATIONS

GWAS: Genome wide association study

RA: Rheumatoid arthritis

DAS28: Disease activity score

Anti-TNF: Anti-tumor necrosis factor

ESR: Erythrocyte sedimentation rate

CRP: C-reactive protein

HAQ: Health assessment questionnaire

O.R.: Odds ratio

C.I.: Confidence interval

MAF: Minor allele frequency

10

288
 Anexo

COMPETING INTERESTS

Roche Spain contributed to the funding of this project. However, the company

had no input in the design of the study or in the analysis and writing of the manuscript.

The company did not have the right to early access to results or to interfere in any other

way with the interpretation or reporting of the results. Therefore, the authors keep

exclusive and complete responsibility for the study.

AUTHORS’ CONTRIBUTION

MS-G participated in design of the study, genotyped the samples, participated in

the interpretation of the results and in writing the manuscript. EP-P participated in the

acquisition of clinical data and collection of samples and in the analysis and

interpretation of results. MC participated in the statistical analysis and in the

interpretation of results. JJG-R coordinated the acquisition of clinical data and

participated in the analysis and interpretation of results. AG participated in the design of

the study and in the coordination of acquisition of clinical data and collection of

samples, supervised genotyping, statistical analysis, interpretation of results and writing

of the manuscript. All authors read and approved the final manuscript

ACKNOWLEDGMENTS

We thank Carmen Pena-Pena for her excellent technical assistance and Yolanda

Lopez-Golan for her help in recruiting patients. M.S-G is the recipient of a FPU pre-

doctoral bursary of the Spanish Ministry of Education; M.C. is the recipient of an

“Isabel Barreto” bursary of the Government of Galicia. This project was supported by

an unrestricted grant from Roche Spain and by grants PI080744 and PI09/90744 form

11

289
Factores genéticos asociados con predisposición a LES

the Instituto de Salud Carlos III (Spain) with participation of funds from FEDER

(European Union).

REFERENCES
1. Chen YF, Jobanputra P, Barton P, Jowett S, Bryan S, Clark W, Fry-Smith A,

Burls A: A systematic review of the effectiveness of adalimumab, etanercept

and infliximab for the treatment of rheumatoid arthritis in adults and an

economic evaluation of their cost-effectiveness. Health Technol Assess 2006,

10(42):iii-iv, xi-xiii, 1-229.

2. Moreland LW, Emery P: TNF[alpha]-inhibition in the treatment of

rheumatoid arthritis. London: Martin Dunitz; 2003.

3. Rubbert-Roth A, Finckh A: Treatment options in patients with rheumatoid

arthritis failing initial TNF inhibitor therapy: a critical review. Arthritis Res

Ther 2009, 11 Suppl 1:S1.

4. Carmona L, Descalzo MA, Perez-Pampin E, Ruiz-Montesinos D, Erra A, Cobo

T, Gomez-Reino JJ: All-cause and cause-specific mortality in rheumatoid

arthritis are not greater than expected when treated with tumour necrosis

factor antagonists. Ann Rheum Dis 2007, 66(7):880-885.

5. Dixon WG, Watson KD, Lunt M, Hyrich KL, Silman AJ, Symmons DP:

Reduction in the incidence of myocardial infarction in patients with

rheumatoid arthritis who respond to anti-tumor necrosis factor alpha

therapy: results from the British Society for Rheumatology Biologics

Register. Arthritis Rheum 2007, 56(9):2905-2912.

6. Finckh A, Liang MH, van Herckenrode CM, de Pablo P: Long-term impact of

early treatment on radiographic progression in rheumatoid arthritis: A

meta-analysis. Arthritis Rheum 2006, 55(6):864-872.

12

290
 Anexo

7. Liu C, Batliwalla F, Li W, Lee A, Roubenoff R, Beckman E, Khalili H, Damle

A, Kern M, Furie R, Dupuis J, Plenge RM, Coenen MJ, Behrens TW, Carulli JP,

Gregersen PK: Genome-wide association scan identifies candidate

polymorphisms associated with differential response to anti-TNF treatment

in rheumatoid arthritis. Mol Med 2008, 14(9-10):575-581.

8. Maxwell JR, Potter C, Hyrich KL, Barton A, Worthington J, Isaacs JD, Morgan

AW, Wilson AG: Association of the tumour necrosis factor-308 variant with

differential response to anti-TNF agents in the treatment of rheumatoid

arthritis. Hum Mol Genet 2008, 17(22):3532-3538.

9. Skapenko A, Prots I, Schulze-Koops H: Prognostic factors in rheumatoid

arthritis in the era of biologic agents. Nat Rev Rheumatol 2009, 5(9):491-496.

10. Plenge RM, Criswell LA: Genetic variants that predict response to anti-

tumor necrosis factor therapy in rheumatoid arthritis: current challenges

and future directions. Curr Opin Rheumatol 2008, 20(2):145-152.

11. Janssens AC, Moonesinghe R, Yang Q, Steyerberg EW, van Duijn CM, Khoury

MJ: The impact of genotype frequencies on the clinical validity of genomic

profiling for predicting common chronic diseases. Genet Med 2007, 9(8):528-

535.

12. Prevoo ML, van 't Hof MA, Kuper HH, van Leeuwen MA, van de Putte LB, van

Riel PL: Modified disease activity scores that include twenty-eight-joint

counts. Development and validation in a prospective longitudinal study of

patients with rheumatoid arthritis. Arthritis Rheum 1995, 38(1):44-48.

13. van Gestel AM, Prevoo ML, van 't Hof MA, van Rijswijk MH, van de Putte LB,

van Riel PL: Development and validation of the European League Against

Rheumatism response criteria for rheumatoid arthritis. Comparison with

13

291
Factores genéticos asociados con predisposición a LES

the preliminary American College of Rheumatology and the World Health

Organization/International League Against Rheumatism Criteria. Arthritis

Rheum 1996, 39(1):34-40.

14. Bravata DM, Shojania KG, Olkin I, Raveh A: CoPlot: a tool for visualizing

multivariate data in medicine. Stat Med 2008, 27(12):2234-2247.

15. Faul F, Erdfelder E, Lang AG, Buchner A: G*Power 3: a flexible statistical

power analysis program for the social, behavioral, and biomedical sciences.

Behav Res Methods 2007, 39(2):175-191.

16. Ioannidis JP: Why most discovered true associations are inflated.

Epidemiology 2008, 19(5):640-648.

17. Xiao R, Boehnke M: Quantifying and correcting for the winner's curse in

genetic association studies. Genet Epidemiol 2009, 33(5):453-462.

18. Todd JA: Statistical false positive or true disease pathway? Nat Genet 2006,

38(7):731-733.

14

292
 Anexo

FIGURE LEGENDS

Figure 1: Good correlation between outcome variables, EULAR response

classification and relDAS28. Median, interquartile range, and non-outlier range are

represented as dots, box and whiskers, respectively. Empty dots represent outliers.

Figure 2: Multivariate visual analysis showing that 16 SNPs were not able to

separate RA patients classified according to their EULAR response. Responders are

represented as blue dots; moderate responders as red dots; and non-responders as green

dots. Yellow arrows represent the genotypes of each of the 16 SNPs according to an

additive model. This representation was obtained with Visual Co-Plot.;

15

293
Factores genéticos asociados con predisposición a LES

Table 1. Clinical characteristics of the patients in this study compared with the report
from Liu et al. [7]
Variable This study Data from ref. 7 P-value
Age (mean ± SD) 54.2 ± 13.1 57 ± 13.5 0.06
Age at diagnosis (mean ± SD) 46.2 ± 13.5 47 ± 15 0.3
Women (%) 84.8 75 0.06
Disease duration (mean ± SD) 7.8 ± 6.6 8±8 0.4
a
Current Smokers (%) 9.1 15 0.3
a
Ever Smokers (%) 25.0

RF+ (%) 68.9 83.8 0.01

a
CCP+ (%) 86.3 61.9 0.0001
a
SE+ (%) 58.3
a
ANAs+ (%) 29.8

HAQ at baseline (mean ± SD) 1.4 ± 0.7 1.1 ± 0.6 0.0005

DAS28 at baseline (mean ± SD) 5.6 ± 1.2 5.2 ± 0.8 0.002
DAS28 ≥ 5.1 (%) 70.2
3.2 ≤ DAS28 > 5.1 (%) 26.5
DAS28 at 12-16 wk (mean ± SD) 3.6 ± 1.4 3.7 ± 1.3 0.2
DAS28 at 6 months (mean ± SD) 3.5 ± 1.4

Good-responders at 12-16 wk (%) 40.4 34.8 0.6

Non-responders at 12-16 wk (%) 22.5 25.8 0.6
Good-responders at 6 months (%) 43.7
Non-responders at 6 months (%) 21.8

anti-TNF drug
Infliximab (n) 101 32 0.01
Etanercept (n) 35 39 0.02
Adalimumab (n) 15 18 0.05

a
Data was available for 102 patients for CCP antibodies, ANA and SE; and for 88 patients for smoking
habits.

16

294
 Anexo

Table 2. Relationship of relDAS28 and SNP genotypes, and comparison of the allele
frequencies between responders and non-responders.
Responders’
P value of Non-responders’ MAF % c P
SNP MAF % b O.R. (95% C.I.)
relDAS28 b (n/N) value
(n/N)
rs983332 0.6 25.9 (30/116) 27.9 (19/68) 1,11 (0,6-2,0) 0.8
rs928655 0.1 18.9 (23/122) 28.0 (19/68) 0.60 (0.3-1.2) 0.1
rs13393173 0.8 23.8 (29/122) 20.6 (14/68) 0,83 (0,4-1,7) 0.6
rs437943 0.05 38.5 (47/122) 25.0 (17/68) 0,53 (0,3-1,0) 0.06
rs10945919 0.7 27.9 (34/122) 23.5 (16/68) 0,79 (0,4-1,7) 0.5
rs854547 0.3 39.3 (48/122) 36.8 (25/68) 1.12 (0.6-2.1) 0.7
rs854548 0.9 23.0 (28/122) 23.5 (16/68) 1,03 (0,5-2,0) 0.9
rs854555 0.6 35.2 (43/122) 38.2 (26/68) 1,14 (0,6-2,0) 0.7
rs868856 0.6 32.8 (40/122) 36.8 (25/68) 1,19 (0,6-2,0) 0.6
rs7046653 0.5 32.0 (39/122) 36.8 (25/68) 1,23 (0,7-2,5) 0.5
rs2814707 0.8 25.4 (31/122) 29.4 (20/68) 1,22 (0,6-2,5) 0.6
rs3849942 0.4 23.0 (28/122) 29.4 (20/68) 1,41 (0,7-2,5) 0.3
rs774359 0.2 26.2 (32/122) 36.8 (25/68) 1,64 (0,8-3,3) 0.1
rs6138150 0.5 14.0 (17/122) 14.7 (10/68) 0.94 (0.4-2.2) 0.9
rs6028945 0.9 12.3 (15/122) 13.2 (9/68) 1,09 (0,5-2,5) 0.9
rs6071980 0.9 18.9 (23/122) 16.2 (11/68) 0,83 (0,4-2,0) 0.6

a
Major/Minor alleles
b
MAF = Minor Allele Frequency, n = number of minor alleles, N = total number of alleles
c
O.R. were calculated as in Liu et al [7], taking the allele associated with the non-responders as the
numerator of the non-responders odds, and the non-responders odds as the numerator of the O.R.

17

295
Factores genéticos asociados con predisposición a LES

Figure 1

296
 Anexo

Figure 2

Additional files provided with this submission:

Additional file 1: predicting response tto_v07_ART_highlighted changes.doc,

118K
http://arthritis-research.com/imedia/2026296369357146/supp1.doc

297
298
Supplementary Table 1. Primers and probes in 5’ĺ 3’ direction used for genotyping the 16 SNPs by the single-base extension approach.

PCR primers
SNP Forward Primer Reverse Primer Minisequencing Probe
rs983332 atctgtagctctgtttctgcttgg caagtactccttgctgccaaaag cagactctctataattttaatggaatcaatacacaaggtccagcgtccaacta
rs928655 gcctttcccatcacattctc ttctcagctgcctccttctt CCAGAAGTATATTAATGAGCAGTGCgtgaattctgtgatttctcaccctgcctttcagatttg $
rs13393173 tggtgttctcattgccttgaatg gaacaagatggtctctatcccagg tggaaagccctCagacagctacaatttagctaactcca
rs437943 ccagcattggtggaagtgat tggtcagtttgaaaggtctgc TTACCTATGATTGATgagcaccatatagaacttatagcaacca $
rs10945919 tcactgcagttctgcctttg tgatccactttgtgtttgga tttggaaatttactattgaaagagaaaggttcaaagctgaaacattagctgcccaaggactca
rs854547 aagtggtcctcctgcttcag ttggaccaagactagatttcctg gctgcttttcaggagtgaatcactgaag
rs854548 aacaagccttgactgggtaaac tgcaggctttgctcttttaac TTACCTATGAtgactgggtaaacctgtatcaattgtcaaagGatatatctgtcaatca $
rs854555 cccaagagatacgggctttaac tttgtccacggtctttattcag catcatatatatgatatcatcttgacatatttgtctactgctg
rs868856 cgctggtgcttcatactcac agcctttgcagagacacctg TTACCTATGAtcctagtccgtctttctctttcacttgtggttttcttcccttgtcatttaagcattctcaact $
rs7046653 tgtaggcacaatgggtagctt gagacactaggaccgtttgttg tcctggtatcctttattttctgaattaaaaaaaaaaaaggctgtatga
rs2814707 aaacgacaagagaagcacagc gcccacctcaaactaaagca aattcctgcatccagtagtgcccaaagccagtg
rs3849942 ccatgctaggcactgagacac cccactacagcccattcttc ctttcttcccacaggtctagctagtacgtatttctttt
rs774359 agtaaaggaactaacatgtaggcactc gtacccgtgggcaaggtg cacctatttcctcatctgtaaaatggcaataatagtaatagtacctaatgtgt
Factores genéticos asociados con predisposición a LES

rs6138150 caggatggaagctctgtcaag agccaagactcagggtgtgt gttggcaaattcagattccaaaagtctc

rs6028945 agctggaactgggtttgttg gactcagccttgtggtgagg tccaatgacagtagtgagtaaatgagcatgCactaaataaagaacaca
rs6071980 ctgattccttttcctgtttgc tgcagaattcaaggacacaga agcctgacaggatttttattttAtgtttggggaacagaatactaacaggtcatgttta

Primers selected with Primer3 and Oligos softwares. They were checked to avoid formation of dimers between the primers included in the reaction.
$ These oligonucleotides were extended with a 5' tail that has not homology with human sequences (these tails are in capital letters)
 Anexo

Supplementary Table 2. Analysis of the association between genotypes at the 16 SNPs

and response to treatment with Infliximab after 3 months of follow-up by linear

regression with the relative change in DAS28 (redDAS28) and by comparison of

responders and non-responders according to the EULAR criteria.

P value of Responders’ Non-responders’

SNP relDAS28 MAF % (n/N)a MAF % (n/N)a O.R. (95% C.I.) P value
rs983332 0.14 21.2 (14/66) 27.3 (12/44) 0.72 (0.3-1.7) 0.46

rs928655 0.85 20.6 (14/68) 18.2 (8/44) 1.17 (0.4-3.1) 0.75

rs13393173 0.86 22.1 (15/68) 25.0 (11/44) 0.85 (0.3-2.1) 0.72

rs437943 0.67 36.8 (25/68) 25.0 (11/44) 1.74 (0.8-4.0) 0.19

rs10945919 0.47 27.9 (19/68) 22.7 (10/44) 1.32 (0.5-3.2) 0.54

rs854547 0.70 35.3 (24/68) 36.4 (16/44) 0.95 (0.45-2.1) 0.91

rs854548 0.81 22.1 (15/68) 25.0 (11/44) 0.85 (0.3-2.1) 0.72

rs854555 0.92 30.9 (21/68) 36.4 (16/44) 0.78 (0.4-1.7) 0.55

rs868856 0.92 41.2 (28/68) 40.9 (18/44) 1.01 (0.5-2.2) 0.98

rs7046653 0.71 39.7 (27/68) 40.9 (18/44) 0.95 (0.4-2.1) 0.9

rs2814707 0.83 30.9 (21/68) 31.8 (14/44) 0.96 (0.4-2.2) 0.92

rs3849942 0.48 27.9 (19/68) 31.8 (14/44) 0.83 (0.4-1.9) 0.66

rs774359 0.17 30.9 (21/68) 43.2 (19/44) 0.59 (0.3-1.3) 0.18

rs6138150 0.78 13.2 (9/68) 18.2 (8/44) 0.69 (0.2-1.9) 0.48

rs6028945 0.39 13.2 (9/68) 9.1 (4/44) 1.53 (0.4-5.3) 0.5

rs6071980 0.48 22.1 (15/68) 13.6 (6/44) 1.79 (0.6-5.0) 0.26

a
MAF = Minor Allele Frequency, n = number of minor alleles, N = total number of alleles

299
Factores genéticos asociados con predisposición a LES

Supplementary Table 3. Analysis of the of the association between genotypes at the 16

SNPs and response to treatment with anti-TNF after 6 months of follow-up by linear
regression with the relative change in DAS28 (redDAS28) and by comparison of
responders and non-responders according to the EULAR criteria.

P value of Responders’ Non-responders’

SNP relDAS28 MAF % (n/N)a MAF % (n/N)a O.R. (95% C.I.) P value
rs983332 0.30 19.2 (23/120) 26.7 (16/60) 0.62 (0.3-1.4) 0.23

rs928655 0.23 19.4 (24/124) 25.8 (16/62) 0.68 (0.3-1.4) 0.31

rs13393173 0.45 17.7 (22/124) 27.4 (17/62) 0.61 (0.3-1.2) 0.15

rs437943 0.28 40.3 (50/124) 30.6 (19/62) 1.50 (0.8-2.9) 0.21

rs10945919 0.65 28.2 (35/124) 29.0 (18/62) 0.96 (0.5-1.9) 0.91

rs854547 0.89 35.5 (44/124) 35.5 (22/62) 1.00 (0.5-1.9) 1.00

rs854548 0.85 20.2 (25/124) 21.0 (13/62) 0.96 (0.5-1.9) 0.91

rs854555 0.61 33.9 (42/124) 37.1 (23/62) 0.87 (0.5-1.7) 0.66

rs868856 0.56 31.5 (39/124) 33.9 (21/62) 0.89 (0.5-1.7) 0.74

rs7046653 0.41 30.6 (38/124) 33.9 (21/62) 0.86 (0.4-1.7) 0.65

rs2814707 0.69 21.8 (27/124) 24.2 (15/62) 0.88 (0.4-1.8) 0.72

rs3849942 0.45 20.2 (25/124) 24.2 (15/62) 0.80 (0.4-1.6) 0.54

rs774359 0.53 24.2 (30/124) 29.0 (18/62) 0.78 (0.4-1.6) 0.48

rs6138150 0.054 16.1 (20/124) 11.3 (7/62) 1.43 (0.6-3.4) 0.42

rs6028945 0.75 12.1 (15/124) 14.5 (9/62) 0.78 (0.3-2.1) 0.62

rs6071980 0.84 18.5 (23/124) 16.1 (10/62) 1.22 (0.5-3.0) 0.66

a
MAF = Minor Allele Frequency, n = number of minor alleles, N = total number of alleles

300