BugTracks

This may not be the most exciting read, but it will give you a little window into the sorts of problems I’m wrestling with while trying to attach names to the insects I’m studying, as my country crumbles around me. I was asked a seemingly simple question by Steve Nanz this morning, and the more I thought about it, the more it made my head hurt. Instead of writing an extremely long response in a BugGuide comment, I thought it would be useful to lay some things out in a blog post. Might as well start from the beginning…

Gracilaria quinquistrigella (Gracillariidae) was described by Kentucky lepidopterist V. T. Chambers in 1875 from a specimen caught in Texas (he misspelled the genus, which should have been Gracillaria). Its host plant was unknown. Very little has been published about this species since. Forbes (1923) included it in Lepidoptera of New York and Neighboring States, under the name Acrocercops quinquestrigella (misspelled), and quinquistrigella was still listed in that genus by Don Davis in the Hodges et al. (1983) Checklist of North American Lepidoptera. Forbes indicated that Coriscium rhombiferellum, which was described in 1876 by the German lepidopterists Frey & Boll from another specimen caught in Texas, was a synonym (based on what evidence, I don’t know), but Don listed rhombiferellum as a valid species (not having seen the type specimen, as far as I know). Based on my quick reading of the original description of rhombiferellum (in German), it doesn’t sound like the same moth, but it would be nice to see it to make sure. Frey & Boll’s specimens are mostly at the Natural History Museum in London, and today I wrote to the curator who in the past has provided me with images of such things, but I got an auto-reply saying that he is on leave. Anyway, Forbes stated that Acrocercops quinquestrigella occurs in Kentucky and Texas—neither of which are “neighboring states” of New York, last I checked—and I think this must have been an error based on the fact that Chambers lived in Kentucky. Charles Kimball’s 1965 Lepidoptera of Florida includes Acrocercops quinquestrigella based on three specimens reared from Sida rhombifolia (Malvaceae) by Carl Stegmaier (who later published a series of papers about Florida’s leaf-mining agromyzid flies), dated March 7, 1963. Charles Covell, in his 1999 checklist of the butterflies and moths of Kentucky, included A. quinquistrigella based on Forbes’ error. And that’s it.

In November 2012, Julia and I collected some leaf mines on narrow-leaved globemallow (Malvaceae: Sphaeralcea angustifolia) in Texas.

When finished feeding, the larvae exited their mines and spun cocoons. One did so at the bottom of a rearing vial, so I was able to get a look at the larva inside its cocoon through the side of the vial:

Here’s the finished cocoon viewed from above, now containing the pupa. Note the “frothy bubbles” on the surface of the cocoon at either end, which are characteristic of certain gracillariid moths.

I ended up getting only parasitoid wasps from the larvae we collected, but we also collected one cocoon along with the mines, and an adult emerged from it. Here’s the cocoon with the empty pupal skin poking out of it…

…and the adult:

I tentatively identified this as Acrocercops quinquistrigella based on Kimball’s record from Florida; at the time it was the only published record of a gracillariid reared from a mallow in North America, and the description of the adult was a good match.

Five years later, Mike Palmer collected leaf mines in Oklahoma from an unrelated plant called betonyleaf noseburn (Euphorbiaceae: Tragia betonicifolia). The only leafminer known from Tragia was Cyphacma tragiae, a weird moth that Annette Braun described in 1942, which currently is not assigned to a family or even a superfamily. Here is one of the adults that emerged from Mike’s mines:

Braun had mentioned that sometimes the cocoon of C. tragiae is decorated with a few frothy bubbles, which would be a really weird coincidence since these bubbles are otherwise unique to Gracillariidae (and C. tragiae definitely isn’t a gracillariid). I suspect that Braun observed some cocoons of this species that Mike found, didn’t have adults emerge from them, and assumed that they were made by the same species she reared from plain cocoons. But what was Mike’s moth? On October 15, 2017, I wrote to Don Davis:

I’m curious for your thoughts on the moths in the two [above] photos.  The first was reared from Sphaeralcea angustifolia in Texas a few years ago; I had thought it might be Acrocercops quinquistrigella, since this species reportedly has been reared from Sida rhombifolia (both Malvaceae).  The second emerged just yesterday from Tragia betonicifolia (Euphorbiaceae) in Oklahoma.  They look to me to be the same species, despite such distantly related hostplants.  I’m wondering what the status of A. quinquistrigella is, given that it was described from a caught specimen that may or may not still exist.  If these moths are that species, it seems that it may really belong to another genus?

Don replied:

Thanks Charley for the photos and interesting notes. Your photos closely resemble the few Acrocercops quinquistrigella in [the Smithsonian] collection (including the type) but the male genitalia should be compared. Unfortunately the few specimens that I have are mostly missing abdomens (including the type) and I have only been able to draw the female genitalia. One specimen that we have was reared from Sphaeralcea in Texas [in 1939]. . . Please collect all you can for future comparisons.

Don sent this photo of what he said was the type specimen:

On July 5, 2019, Don wrote:

Hi Charley:

Would you be interested in contributing as a co author to 2-3 MONA [Moths of North America] volumes on the North American Gracillariidae? I have completed most of the illustrations (see attached list) and have already published on some species (a few with you). Dave Wagner has asked to be included as the third author on this project. It would be good to have someone primarily responsible for the descriptions of the adults, which perhaps you and Dave could do. I would be able to describe most of the genitalic morphology, and hopefully complete any remaining illustrations. We should also include distributional maps for the species.

The first volume would treat the subfamily Gracillariinae. A few years ago I began portions of the first volume (see attached) and this needs to be updated and completed.

I still have a few other projects to complete, but hope to start working on the Gracillariinae more next year, if I can receive some help.

Please let me know if you are interested in this project.

Best wishes,

Don

I knew from previous correspondence with Don that he was aware of over 100 undescribed species in addition to the 300+ already named species of Gracillariidae in North America (which he had been studying since the 1960s, even if he said he hadn’t begun work on this monograph until “a few years ago.”). I also knew from previous discussions with Dave that Dave’s contribution would be limited to the extensive rearing that he had already done, beginning in the early 1980s; he was (and is) too busy with other things to have any time for describing or writing about Gracillariidae. So I was aware that this would be no small undertaking, but I eagerly agreed.

I began by comparing Don’s species list against the one I had made for Leafminers of North America, which followed the recent reorganization of Gracillariidae into eight subfamilies (previously there were just three, and most of the new ones were split out from what Don was referring to as Gracillariinae). Earlier that year, Greg Pohl had enlisted me to take the lead on the Gracillariidae section of the new Annotated Taxonomic Checklist of the Lepidoptera of North America, north of Mexico, so going over Don’s list complemented that effort well, and of course I invited him to be a coauthor.

When I came to the Acrocercops section, I found that almost nothing in that genus actually belonged there. Don had determined that three species belonged in the genus Cryptolectica, which hadn’t been documented as occurring in North America previously. We also transferred A. cordiella, a Cuban species that Don had found in Texas, to Dialectica and added it to the list. Three other species, A. arbutella, A. astericola, and A. pnosmodiella, are misplaced in Acrocercops but Don hadn’t determined the correct placement, so we left them there with the “Acrocercops” in quotes. In the file Don sent me, he had a note by quinquistrigella: “n. gen. [new genus] in Lithocolletinae?” Operating under the assumption that the globemallow leafminer was in fact quinquistrigella, it was clear to me from the larval biology that this species does not belong in Acrocercopinae, since one of the defining characters of that subfamily is that the larvae turn bright red when mature. Lithocolletinae also wasn’t a good fit, and the general appearance of the leaf mine and adult (as well as the frothy bubbles on the cocoon) fit well with Ornixolinae, so we moved it there. It obviously didn’t make sense to keep it in Acrocercops, and we also couldn’t revert it to the genus Gracillaria, since that is in the subfamily Gracillariinae, so we just listed it under “unknown genus.” This left just A. rhombiferellum (discussed above) and the oak leafminer A. albinatella under Acrocercops, without quotation marks—and whether A. rhombiferellum really belongs there needs further investigation.

And then Don had listed under “NEW GENERA – Gracillariinae” the species albomarginatum, described by Walsingham in 1897 from Saint Thomas in the Virgin Islands. Next to this name, Don had the note, “Devil’s Den, AK, 16744 TL = St. Thomas” (TL meaning type locality). Devil’s Den is in Arkansas (AR), not Alaska (AK). Walsingham had described the species in the genus Coriscium; somewhere along the line it had been transferred to Acrocercops, but Don had determined that it belonged to an undescribed genus.

Beyond putting together the updated checklist, work on the Gracillariidae monograph stalled, because Don wanted to finish his monograph on fairy moths (Adelidae) before turning his attention to this family, and then COVID-19 happened and Don was shut out of the museum for over a year—and he had no computer at home, so I don’t think he was getting much done there, if anything, and there was no easy way to communicate with him. In May 2020, I added a note in Don’s file next to albomarginatum, “looks a lot like quinquistrigella (Ornixolinae)”—but I have no recollection of ever discussing that with Don, and in the final checklist (published in 2023) it is listed with the other three species under “Acrocercops” in quotes, with the note that it “is included in this list based on specimens in the USNM [United States National Museum] collected at Devil’s Den, AR.”

Don’s fairy moth monograph was finally published in 2023, just in time for all the new species he described in it to be included in the new checklist. Meanwhile, he informed me that now he had two other projects that he wanted to finish before turning his attention back to Gracillariidae. He was still working on the first of these when he passed away in October 2024. A huge loss, to say the least.

In the past few weeks, after a long hiatus, I’ve returned to dissecting tiny moths and trying to learn to make slides of their tiny tiny genitalia that are presentable enough to be published, so that I can start describing new species on my own. It’s going pretty well, except for some frustrations like brownish blobs surrounding the genitalia (caused by incomplete mixing of the clove oil that I’m supposed to leave the genitalia in for a few hours before putting them in Canada balsam on the slide), and the difficulty of removing a zillion specks of dust from the coverslip, which are invisible until viewed under the compound scope (the example below is from a male of Parornix betulae):

At this point I’m not sure if it would be more time-consuming to try to use a photo editing program to get rid of all the imperfections in my images, or actually do the tedious things that knowledgeable people are telling me I need to do to fix these issues.

Anyway, this morning Steve Nanz commented on this photo of a moth in Oklahoma that I had identified as “Acrocerops” quinquistrigella in 2017, noting that this moth’s DNA barcode had matched it to a specimen that Don Davis had identified as “Acrocercops” albomarginatum. He asked for my feedback on his treatment of this species on BugGuide and the Moth Photographers Group website. I had forgotten all about this species, but after looking into it, I have these comments and questions:

There are photos of the type specimen and its (male) genitalia here. That’s very helpful.

In his “1933” (actually published in 1934) paper on the Microlepidoptera of Cuba, August Busck wrote of this species (under the name Neurobathra albomarginata): “Described from St. Thomas and recorded from Porto Rico by Forbes, but foodplant hitherto not ascertained. Mr. Otero reared the species repeatedly from leaf-mining larvae of Bradburya plumieri. (Otero No. 9679.)”. That plant is now known as Centrosema plumieri (Fabaceae). Did Busck dissect one of these reared specimens to confirm that it was the same species?

There are several species of Centrosema in the US (some of them known as “butterfly peas”), but to my knowledge no one has found leaf mines on them that could possibly have been made by this moth. Presumably Don compared the genitalia of a male from the US with the type specimen to make his determination. But the two specimens he identified as albomarginata that have DNA barcodes (here and here) were collected by Don and his wife in 1984 in Oklahoma (well away from the Arkansas border), not in Arkansas. Why didn’t he mention these, or are these in fact the specimens that he said were collected in Arkansas? And what evidence is there that this species isn’t synonymous with quinquistrigella, if the type specimen of that species is missing its abdomen?

There is one specimen identified as quinquistrigella in the Barcode of Life Database, here. It looks just like albomarginata, except the scale bar indicates it is much smaller, with wings only 2 mm long. I am certain that scale bar is incorrect, and I’m not sure I trust any of those scale bars. That specimen was collected in Texas in 1939, and although the label data on the BOLD website don’t say as much, I think it must be the 1939 specimen that Don said had been reared from Sphaeralcea. Troublingly, it is clearly also the same specimen that Don told me was the type. This, I suppose, explains why it is in such good condition; I have seen a lot of Chambers’ type specimens at Harvard’s Museum of Comparative Zoology, and they tend to be in pretty sorry shape. Here, for instance, is the type of Phyllocnistis populiella, the species that makes those beautiful serpentine squiggles on poplar leaves:

One way to move forward would be to compare genitalia and/or DNA from specimens reared from Fabaceae (Centrosema), Euphorbiaceae (Tragia), and Malvaceae (Sida, Sphaeralcea) and see how many species are involved. It would be very unusual for a single gracillariid species to have such disparate host plants. At this point, genitalia-wise, all I have available for comparison is the photo of the (male) type specimen of albomarginatum, which was not reared. I haven’t yet checked what sex my specimens are, but I have the one from Sphaeralcea (Texas) and four from Tragia—two from Mike Palmer in Oklahoma, and two from Chet Burrier in Texas. If there turn out to be multiple species in Texas that look like this, there may be no way to determine which one is quinquistrigella, although getting a look at the actual type specimen would be a good start.

That one alleged quinquistrigella specimen has not been assigned a BIN (Barcode Identification Number), but it does have a partial sequence, so we can visually check to see how well it matches the Oklahoma albomarginatum specimens. Here’s the “quinquistrigella” (the Ns are the missing bits):

AACACTTTATTTTATATTTGGCATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTATT
AATTCGAGCTGAATTAGGGAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAACAC
TATTGTAACTGCTCACGCTTTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCCTTCCCTCG
TCTAAATAATATAAGATTTTGATTACTTCCACCCTCCCTAATCTTACTAATTTCAAGGAG
TATTGTTGAAAACGGAGCTGGAACTGGTTGAACTGTCTACCCACCTTTATCATCTAATAT
TGCCCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATCTC
TTCTATTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCTTTTACTTCT
ATTATCATTACCTGTACTAGCCGGAGCAATTACAATACTATTAACAGACCGTAATTTAAA
TACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATCTTATACCAACATTTATTT

and one of the albomarginatum specimens:

AACACTTTATTTTATATTTGGCATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTATT
AATTCGAGCTGAATTAGGGAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAACAC
TATTGTAACTGCTCACGCTTTTATTATAATTTTTTTTATAGTGATACCAATTATAATTGG
TGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCCTTCCCTCG
TCTAAATAATATAAGATTTTGATTACTTCCACCCTCCCTAATCTTACTAATTTCAAGGAG
TATTGTTGAAAACGGAGCTGGAACTGGTTGAACTGTCTACCCACCTTTATCATCTAATAT
TGCCCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATCTC
TTCTATTTTAGGAGCTATCAATTTTATTACTACAATTATCAACATACGACCAAATGGAAT
AACATTTGATAATATACCACTATTTGCTTGAGCAGTTGGTATTACCGCTCTTTTACTTCT
ATTATCATTACCTGTACTAGCCGGAGCAATTACAATACTATTAACAGACCGTAATTTAAA
TACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATCTTATATCAACATTTATTT

I copied and pasted these into a Word document just now, colored the “quinquistrigella” in red, and shuffled the two together so we can compare them line by line. Ignoring the “N”s, they appear to be identical except for one T-C substitution, which I’ve highlighted in yellow below (and I’ve put this in boldface in the two sequences above, but it’s a little subtle):

Not a big enough difference to say these are two different species, for sure. If both August Busck and Don Davis made their identifications of albomarginatum based on comparison of the genitalia with the type specimen of that species (and this may be possible to determine, eventually*), then this suggests that the mallow feeder could in fact be the same as the legume feeder. (There is some precedent for this; the leaf-mining fly Calycomyza malvae feeds on both mallows and legumes.) It doesn’t tell us anything about the true identity of quinquistrigella, but it’s a start. If the Tragia feeder turns out to be the same as the mallow feeder, there will be a strong case for synonymizing albomarginatum with quinquistrigella.

So, to answer your question, Steve, I don’t know. I guess it’s fine for now, except I’ve moved albomarginatum to Ornixolinae on BugGuide, so that it’s grouped with quinquistrigella under “genus undetermined.”

* Added the next morning: As I was closing the numerous tabs I had opened on my browser while writing this post, I noticed that this specimen shown on BOLD (from which no DNA sequence was obtained) has the following note: “E.E.A. de Cuba No. 9679|Pupated: Dec.21.1931|Genitalia on slide AB Mar/6/1937; leaf miner on Bradburya plumieri.” So August Busck did dissect at least one of those reared specimens from Cuba, and the genitalia slide is at the Smithsonian, so surely Don would have seen it (although this one is a female). It’s still a mystery why Don was identifying some specimens as albomarginatum and others as quinquistrigella, and whether the alleged quinquistrigella female he illustrated showed any differences with albomarginatum.

Another thing I thought to check just now is that the Barcode Identification Number for albomarginatum (BOLD:ABX0021) has its nearest neighbor at a distance of 10%, and that is the South American species Acrocercops serrigera, which feeds on mallows**. That BIN, in turn, has its nearest neighbor at a distance of 8%—an undetermined gracillariid that has been collected in Florida, Mexico, and Costa Rica. Both of these moths look very much like albomarginatum and quinquistrigella, except they appear to lack the dark speckles in the white dorsal margin.

…And another update! (February 16, 2025): This morning I started organizing my copies of Don Davis’s genitalia drawings in a way that will make things easier to find, and I discovered that I do in fact have his drawings of male and female albomarginatum genitalia. In the male drawing, there are a number of differences with the type specimen that seem rather significant to me. Unfortunately his drawings don’t generally indicate what specimens they are based on, but there are some drawings that are annotated with “holotype” or “paratype,” and this isn’t one of them. It therefore seems likely that these are based on the specimens from Oklahoma (or Arkansas, if such specimens exist). I suppose they could also be based on Busck’s slides, but in any case they represent Don’s concept of albomarginatum. Pending further investigation, I am inclined to think the North American record of albomarginatum is based on a misidentification. Supporting evidence includes the facts that BIN BOLD:ABX0021 only has specimens from Oklahoma and Texas (none from the Caribbean), and that no one has yet found mines on Centrosema in North America that could have been made by anything related to these moths (but this is only relevant if Busck’s identification of the reared Cuban specimens was correct).

Once I’ve got my slide-mounting issues worked out, I can dissect my specimens from Sphaeralcea and Tragia and see how they compare with one another, and with Don’s drawings, and with the type of albomarginatum. And hopefully I can get DNA barcodes from them at some point. Then there’s the matter of comparing these moths against the 28 described genera of Ornixolinae to see if any of them fit, before contemplating describing a new one.

** Bernard Landry’s 2006 paper describing the subspecies Acrocercops serrigera galapagosensis states that the larvae feed on flower buds of Waltheria ovata, rather than being leafminers. The genitalia in his figure are more similar to the type of albomarginatum than is what Don Davis illustrated for albomarginatum. The next species described in Landry’s paper, incidentally, is Caloptilia dondavisi.

And speaking of beetles associated with galls (which we were, briefly, several weeks ago in my previous post), here’s an odd thing I noticed last May while wandering in the woods of Aton Forest in northwestern Connecticut. A lot of the leaves of shagbark hickories (Juglandaceae: Carya ovata) were covered with little round, flattened galls:

Nothing too odd about that; galls like these are a common sight on hickories, and they are caused by aphidlike insects called phylloxerans (Phylloxeridae: Phylloxera spp.). Here’s a larger (7 mm across) gall of a different species that I cut open 14 years ago to get a look at the Phylloxera nymphs within:

The odd thing was that I kept seeing little weevils on the leaves with the galls. I didn’t think much of the first one I saw, but after the second or third weevil, I started to wonder, “What is it with you guys and these galls?” As I wondered this, I had a vague recollection of having seen weevil larvae come out of phylloxera galls at some point. And I wondered if the dark blemishes I kept seeing on these galls had been caused by the weevils I was seeing, maybe chewing holes in which to lay eggs. The one weevil I photographed in the field was certainly doing something to one of the galls:

So naturally, after I ate the sandwich I had brought, I put several gall-laden leaves in my sandwich box along with a few weevils, including a mating pair. At home I got some better photos of the weevils, including this one:

And when trying to get better photos of the galls, it was hard to find any that didn’t have the dark blemishes on them—they were made from the lower surface but the damage was often visible from the upper surface as well.

On May 29, twelve days after I had collected the galls, a couple of squirming, legless weevil larvae appeared in my sandwich box.

The galls, to my surprise, had continued to develop on the detached leaves, and were now nearly spherical in some cases.

Some galls had been visibly munched, presumably by the weevil larvae, although in some cases this may have been from a few caterpillars that had hatched on the collected leaves and were now devouring them.

One of the caterpillars was this little inchworm, which I first noticed on May 19:

By May 27 it looked like this, and was recognizable as the larva of a “half-wing” (Geometridae: Phigalia titea):

There were also a couple of owlet moth caterpillars, which looked like this on May 27:

By May 29 the second one had molted, confirming my suspicion that these were larvae of the “ruby quaker” (Noctuidae: Orthosia rubescens):

Anyway, I moved the weevil larvae to a jar with soil in the bottom for the larvae to burrow into. On June 11, two adult weevils appeared in the jar. One looked much like the ones I’d photographed previously…

…and one was plain black, without the red markings on the elytra.

Knowing what these weevils did for a living, it took only a quick internet search to identify them as Anthonomus suturalis (Curculionidae), which has been a known associate of phylloxera galls since 1866. The account by Gates & Burke (1972)* makes it sound like the munching on the last gall shown above was in fact caused by the caterpillars rather than the weevil larvae: “By the time a larva has completed its development, the tissue of the inner wall of the gall has been consumed. There is no tunneling by the larvae as in cases of some other Anthonomus inquilines; instead, the inner tissue of the galls is rather smoothly gnawed away. The frass resulting from the activities of a larva is packed in one end of the gall.”

It’s just as well that I didn’t discover anything new about these weevils, because evidently no one is willing to review my papers about weevils anymore. I submitted a two-page manuscript on leaf-mining weevils to a journal a full year ago, and another one-page manuscript half a year ago, and I’m still waiting for reviews on both of these. This makes me a bit grumpy since I’ve never taken more than a few weeks to review a manuscript, and I only take that long if the paper is several hundred pages long.

As for my vague recollection of having seen weevil larvae come out of phylloxera galls before, I checked my files, and what I was remembering was actually a single gall on a shagbark hickory catkin that I found on the ground on June 1, 2018, possibly having been nipped off by a squirrel. I didn’t take a picture of the gall until eight days later, when things had started emerging from it; at this point the plant material had all turned brown, but you can still get a general idea of what it looked like:

Two identical weevil larvae emerged from this gall, one on June 5 and one on June 9. They were identical with one another, but looked nothing like the larvae of Anthonomus suturalis pictured above.

Also on June 9, this fly larva appeared in the jar with the gall, apparently having emerged from it along with the weevil larvae. I assume it is one of the hover flies (Syrphidae) that are predators of aphids and other insects.

I put these three larvae, along with the gall, in a jar of soil with the hope of rearing adults, but all that ever emerged—in March of the following year—was this blastobasid moth, which Aaron Hunt identified as Asaphocrita busckiella (which he believes to be a species complex):

I’m not sure if anything is known about the larvae of A. busckiella, but I see that A. aphidiella was reported in 1886 to have been “reared from the larvae feeding on the contents of Phylloxera hickory galls.” Blastobasids are known as “scavenger moths”, and I presume the larva was feeding on the damaged plant tissue and maybe on the weevil larvae’s frass rather than preying on whatever phylloxerans weren’t eaten by the fly larva. As for what kind of weevil the weevil larvae belonged to, I have no idea!

* Gates, Danny B. and Horace R. Burke. 1972. Review of the gall-inhabiting weevils of the genus Anthonomus, with description and biology of a new species (Coleoptera: Curculionidae). Annals of the Entomological Society of America 65(5): 1215-1224.

Normally I limit my investigations of stem-feeding insects to those that produce some kind of external evidence that catches my eye (a certain wingstem stem being an exception), but last spring , for whatever reason, I decided to have a peek inside a dead stem of tall blue lettuce (Asteraceae: Lactuca biennis) that had been leaning against the side of my house, right by the front door, all winter long. On April 12, I broke off a short chunk from the top of the stem, split it lengthwise, and immediately saw that there were little round cells in the walls of the stem with larvae inside.

I guessed these must be cryptic wasp galls—something I’d first become aware of in 2019 when two adults of Aulacidea harringtoni (Cynipidae) emerged from a two-inch piece of a Lactuca canadensis stem I’d collected the previous July because it had a puparium of a stem-mining agromyzid fly on the surface.

I put the split pieces of the L. biennis stem in a jar, along with a couple of intact pieces from farther down the stem, and put the jar on a shelf in my office to find out if my guess was right.

Between May 9 and June 10, ten of these wasps emerged in the jar:

These are eurytomid wasps (Eurytoma sp.), which are parasitoids of gall insects rather than being gall inducers themselves. When the first ones emerged, I figured this would be a good time to see some wasp pupae, so I split one of the intact stem pieces. The exposed cells still had larvae inside, and there was also a spider living in the stem’s hollow center.

I think this spider is in the genus Euryopis (Theridiidae), which makes distinctive tufted egg sacs—one of which (maybe) is shown in this post. Here’s a closer view of the above wasp larva:

On May 27, this beetle appeared in the jar.

This is Isohydnocera curtipennis (Cleridae), which I had seen a couple of times in June 2020 wandering around on milkweed plants in my yard. Until this one appeared in that jar, I had been completely unaware that these beetles develop in galls of other insects. It turns out this same species has been reared from stem galls of the goldenrod gall moth Gnorimoschema gallaesolidaginis (Gelechiidae), and of Euura salicisnodus (Tenthredinidae), a sawfly that causes galls in willow stems*.

Between May 29 and June 27, 22 gall wasp adults emerged. Louis Nastasi tells me they belong to an undescribed species of Aulacidea.

I did eventually see a gall wasp pupa, on June 10. I think it was from one of the larvae whose cells I had broken open, and was found loose on the bottom of the jar.

Meanwhile, another 24 parasitoid wasps emerged between June 18 and 27. Twenty-two of them were pteromalids; I’m not sure if the ones shown below are two different species or differently colored male and female of the same species. Probably I’ll never know; I’ve never been able to get anyone to identify the pteromalids I’ve reared over the years.

And there were two of these ormyrids (Ormyrus sp.).

I got the feeling that more and more wasps would just keep emerging indefinitely, but I had to leave for a six-week road trip at the beginning of July, so that’s where the story ends. If you want to learn more about these herb gall wasps—and maybe help make some new discoveries—take a look at Louis Nastasi’s post here. (Most of the galls, by the way, are externally obvious, not cryptic like the ones in this lettuce stem.)

[Edit, 3/20/2024: Louis saw this post and he assures me that all of these parasitoid wasps are undescribed, not just the Aulacidea, for which he already has a name picked out, and he thinks the pteromalids may belong to the genus Homoporus.]

* Sabrosky, Curtis W. 1934. Notes on the larva and larval habit of Isohydnocera curtipennis (Newmn.) (Coleoptera, Cleridae). Journal of the Kansas Entomological Society 7(2): 65-68.

Uh-oh, spring has arrived—as evidenced by the hazelnuts starting to bloom in my yard—and I haven’t finished going through last year’s photos yet. I have, however, made it far enough to finish this post I started a few months ago. The story starts in August 2020 when, as you may recall, I was keeping a running list of all the leafminers I found in my yard. The 23rd installment of that series included this entry toward the bottom:

“I don’t remember specifically planting garden phlox (Polemoniaceae: Phlox paniculata), but it’s been jumping around our yard for a few years now.

“I’ve been watching it closely for leaf mines of Liriomyza phloxiphaga (Agromyzidae), which is known from a single specimen I reared from phlox in my mother’s garden three years ago. No luck so far, but on August 17 I did find this:

“Leafminer #153: A heretofore unknown leafminer that forms a narrow linear mine in leaves of garden phlox, soon entering the midrib and presumably continuing into the stem—as with Marmara viburnella, but this isn’t a Marmara; at this point I’m not sure what insect order it belongs to. I can’t see an eggshell at the beginning of the mine, there is no evident frass or larva when I backlight the leaf, and there is no external evidence of feeding in the stem.

“I’ve found one other example so far, right next to the garage.”

In the 30th installment (two months later), I included this update:

“On October 11, I finally collected the mysterious Leafminer #153, which forms a short mine in a leaf blade of garden phlox before disappearing into the midrib and, I surmised, completing its development as a stem borer without leaving any further external evidence.

“I split open a couple of stems that had mines like this, and sure enough, something had been tunneling in the pith:

“Since the mine isn’t really visible in the leaf midrib and since the midrib and stem are difficult to dissect cleanly, I wasn’t able to see the mine actually transitioning from the leaf to the pith of the stem, but I confirmed that there was no tunneling in the stem immediately above a mined leaf but there was a tunnel right at the node with the mined leaf. I didn’t want to break apart too many stems for fear of damaging the larvae or pupae that I hope are still inside, but it seems that the tunneling continues all the way to the ground. Hopefully I got enough of the root to capture the mystery bug, and will be able to see who comes out in the spring.”

Nothing ever emerged from that stem, but in the spring I watched the phlox plants closely, and on May 27 I noticed the mines had appeared:

This example shows something that was also evident in the one I had found by the garage in October: associated with the mine are a bunch of little dots, which are “host-feeding” punctures a female agromyzid fly makes with her ovipositor, not for the purpose of laying eggs but to drink the juices that bubble out of the wounds—for nutrition and, I imagine, to “taste” and confirm that it is a suitable leaf to lay eggs in.

Not only did I see this strong circumstantial evidence that an agromyzid was responsible, I actually got to see several females making these punctures on the same day.

A shiny, metallic agromyzid fly whose larva lives as a stem borer is likely to belong to the genus Melanagromyza, which I don’t know much about because none of them are supposed to be leafminers. I collected one and sent it to Owen Lonsdale, even though I was pretty sure all he would be able to say was yup, that’s a female Melanagromyza, and we need to see male genitalia to get it to species—which is exactly what happened.

In July 2021, I uprooted a few mined phlox plants and put them in a clear garbage bag, but the only fly that ever appeared in it (in early September) was this “little house fly,” Fannia canicularis (Fanniidae):

In May of 2022, I split open a couple of the previous year’s phlox stems and found an empty Melanagromyza puparium in one of them—so the larvae evidently don’t always make it into the roots.

Nevertheless, most of the tunnels in the stems I split did go all the way to the ground. So that fall, I marked several plants that had leaf mines on them, and last April I dug two up, bagged them, and put them in the corner of my office to keep an eye on. (This, and what happens next, may look familiar if you’ve been following this blog for a while.)

Over the next several weeks, the tiny creatures that appeared in the bags included this 8-mm jumping spider (Salticidae: Phidippus princeps)…

…this 2-mm “shining flower beetle” (Phalacridae; maybe Stilbus)…

…lots of dark-winged fungus gnats (Sciaridae; this one was <2 mm long)…

…this 5.5-mm soldier fly (Stratiomyidae), which is Allognosta fuscitarsis, the same species I once reared from a larva that had apparently arrived on the kitchen counter by way of a zucchini from the garden…

…this 3-mm ghost spider (Anyphaenidae: Wulfila saltabundus)…

…this 1-mm “mesh web weaver” (Dictynidae)…

…this 2.5-mm lauxaniid fly (Poecilolycia sp.)…

…and at last, a 2-mm male Melanagromyza! Somehow I sensed that this would be the only one, and I was worried I would lose it if I tried to get a live photo, so I chickened out and put it in the freezer first.

This winter, Owen and I have been working on a paper that deals with all the specimens I sent him through 2022, saving the 2023 specimens for a future paper. But since we were already describing a new Melanagromyza species John van der Linden had reared from a different phlox species in Iowa, it made sense for him to have a look at this specimen too. His assessment: another new species! I’ll reveal its name once that paper is published.

But wait, there were still more things appearing in those bags, like this ~2.5-mm “dusky lady beetle” (Coccinellidae, tribe Scymnini)…

…this ~1.3-mm spider, which I think is an Agroeca (Liocranidae)…

…this ~1.7 mm beetle (another Stilbus)…

…several ~1-mm spiders I can’t identify, and for which no one on BugGuide has suggested IDs yet…

…this ~1.2 mm “pleasing fungus beetle” (Erotylidae: Toramus pulchellus)…

…this ~1.5 mm “dirt-colored seed bug” (Rhyparochromidae: Antillocoris)…

…more and more dark-winged fungus gnats, which are consistently difficult to photograph alive, but I managed with this 3-mm long one…

…a bunch of little blackish slugs (Agriolimacidae: Deroceras)…

…this 4-mm casebearer moth larva (Coleophoridae), probably a species in the goldenrod-feeding Coleophora duplicis complex…

…this 5-mm wolf spider (Lycosidae)…

…this 5.5 mm ichneumonid wasp (tribe Phaeogenini; larvae are internal parasitoids of caterpillars)…

…this 2.4 mm eulophid (tribe Entedonini; similar to some of the ones that parasitize leafminers)…

…this four-spotted clover leafhopper (Cicadellidae: Agallia quadripunctata)…

…this ground spider (Gnaphosidae: Zelotes)…

…this ~2-mm agromyzid fly, which I think is something in the Phytomyza atomaria species group; possibly P. crassiseta, which mines leaves of speedwells (Plantaginaceae: Veronica spp.)…

…still more dark-winged fungus gnats…

…a ~1-mm encyrtid wasp…

…another eulophid wasp, maybe the same as before…

…this click beetle (Elateridae: Melanotus)…

…this figitid wasp, which would have emerged from some kind of fly puparium, but it doesn’t look like the ones I rear from agromyzids; we’ll see what Matt Buffington has to say about it, eventually…

…another wolf spider…

…and finally, between June 4 and 10, nine of these ~2-mm frit flies (Chloropidae: Rhopalopterum):

I might not have thought much of these frit flies, but as it happens, in early April I split open a phlox stem right next to the garage and found three fly larvae near the base. They weren’t producing distinct tunnels as the Melanagromyza larvae do, but definitely living inside the stem.

All three formed puparia between the two layers of the piece of double-ply toilet paper I stuffed into the bottom of the vial I collected that chunk of stem in, and they emerged as adults between May 19 and 23.

To me they looked the same as the nine flies that emerged from the bagged phlox plants, and I sent them all to George Foster, who happens to be working on a revision of the genus Rhopalopterum. He agreed that they are all the same, and last I heard he was thinking they are a new species—the only new species he had encountered in the course of his revision. I will post an update when we have the last word on that, but I’ll add that I think this species has more than a casual association with garden phlox, because in July 2017, when I was investigating the leaf mines in my mother’s garden that turned out to be the work of the agromyzid that Owen and I later named Liriomyza phloxiphaga, I collected a few tiny flies that I found resting on the leaves, thinking they might be agromyzids—and they, too, turned out to be this same Rhopalopterum species.

When I decided to start working on a guide to North American sawfly larvae, the first thing I did was put together an updated list of all the species that occur here (the most recent list was published in 1979), so I could start taking stock of what was known about the host plants and larvae of each species. With this list completed, I discovered that there were eleven pairs of species that had identical names, all the result of a paper published ten years ago* that did away with several genera—including Amauronematus, Eitelius, Pachynematus, Pikonema, Pontania, Pteronidea, and Phyllocolpa—and declared them synonyms of the now enormous genus Euura, which now includes over 25% of the North American species in the largest sawfly family, Tenthredinidae. This is a shame, because many of these genera were convenient groupings; for instance, larvae of Pikonema species ate spruce needles, Pontania species all made round leaf galls on willows, Phyllocolpa species made leaf-fold galls on willows and poplars, and as previously defined, Euura contained two subgenera, of which one formed willow bud galls and the other formed willow stem galls.

In any case, when a similar change was made with agromyzid flies, lumping Chromatomyia and some other genera in with the now enormous genus Phytomyza, the paper that did so** included a complete list of all the world’s Phytomyza species and established new names to deal with the ten pairs of species that now had identical names as a result of this change. It seemed like no one was planning on doing this for the sawflies anytime soon, so one day last year I dashed off a little paper to take care of it myself, and that was just published yesterday***. All of the new names are based on the original ones; some are meaningless anagrams and for the rest I just changed the endings, as follows:

Amauronematus orbitalis Marlatt, 1896 → Euura borilista Eiseman

Pachynematus robustus Marlatt, 1896 → Euura borsutus Eiseman

Euura brachycarpae Rohwer, 1908 → Euura brachycarpella Eiseman

Pachynematus coloradensis Marlatt, 1896 → Euura colorado Eiseman

Pontania gracilis Marlatt, 1896 → Euura cragilis Eiseman

Pteronus pacificus Marlatt, 1896 → Euura ficicapus Eiseman

Pachynematus nevadensis Marlatt, 1896 → Euura nevada Eiseman

Pontania marlatti Ross, 1929 → Euura ramlitta Eiseman

Messa atra MacGillivray, 1893 → Euura tara Eiseman

Pachynematus auratus Marlatt, 1896 → Euura sutaura Eiseman

Euura minuta MacGillivray, 1914 → Euura untima Eiseman

I have never met any of the above species, but there was one more change I needed to make, and it involved a species I’ve found in my own front yard—the third type of sawfly larva I found in 2020 when I kept a running list of all the sawfly larvae and leafminers in my yard. I found five of these larvae munching on leaves of a bigtooth aspen sapling on May 31…

…All of them burrowed into a jar of soil the next day, and emerged as adults like this one the following spring:

Dave Smith identified these adults as the species that Marlatt had described as Amauronematus dyari in 1896 (named after Harrison Dyar, who is apparently the only person to have reared this species before me). When Dave put together the 1979 sawfly list, he placed this species in the genus Nematus, and because Marlatt (1896) had named another species Pteronus dyari that was later determined to be a synonym of Nematus latifasciatus Cresson, 1880, Dave established a new name for Amauronematus dyari, Nematus attus. The recent checklist of Canadian sawflies**** listed this species as Euura attus, as does the Electronic World Catalog of Symphyta, but this is incorrect: Dave’s replacement name is no longer necessary, because while this species has been transferred to Euura, N. latifasciatus (and therefore its synonym Amauronematus dyari) is still placed in the genus Nematus. So according to the rules of the International Commission on Zoological Nomenclature, the species in my yard must now go by the name Euura dyari.

I never thought I’d get mixed up in this kind of nomenclatural shenanigans, but as it happens I also felt compelled to rename a spider in another little paper that was also published yesterday*****. I wrote about this species ten years ago, and it is responsible for this egg sac, which I found on the underside of a board on Nantucket:

In 1884, H. C. McCook coined the name Micaria limnicunae for this spider, but his description—which applied only to the egg sac and the spiderlings that emerged from it—was considered “worthless” by arachnologists, and M. limnicunae has been treated as a name that can’t be attributed to any known species. However, for reasons explained in my paper, I am now convinced that this is the same spider that N. Banks described in 1892 as Agroeca ornata. I therefore have declared that the correct name for this spider is Agroeca limnicunae, and A. ornata is a junior synonym (and therefore should no longer be used). In this paper I also reveal that the maker of the mystery egg sac at the top of this post is Agroeca pratensis, and that also goes for the one on page 45 of Tracks & Sign of Insects and Other Invertebrates that is attributed to “Micaria limnicunae.” (My paper also discusses the mystery egg sac that was discussed on pp. 42–43 and here, concluding that the genus Tetragnatha is in need of revision and that arachnologists ought to take egg sac characteristics into account when working out the species limits.)

And while we’re getting caught up on taxonomic matters, I should mention that I wrote or co-wrote the sections on Bucculatricidae, Gracillariidae, Heliozelidae, Nepticulidae, Opostegidae, and Tischeriidae in the new checklist of North American Lepidoptera that was published a few months ago******, in which Erik van Nieukerken and I declared the poplar leafminer Stigmella aromella (Nepticulidae) a synonym of S. populetorum, and Don Davis and I declared the beech leafminer Phyllonorycter restrictella (Gracillariidae) a synonym of the European species P. maestingella, and the magnolia leafminer Phyllocnistis magnoliella a synonym of the tuliptree leafminer P. liriodendronella. Which brings us to the sad fact that I have now subtracted more species from the list of known North American moths than I have added. And, as it happens, one of the three moth species I have named–this little beauty, Grapholita thermopsidis (Tortricidae)…

…has had its name changed to the much less pronounceable Ephippiphora thermopsidis after the new checklist came out*******.

There are, of course, hundreds of leaf-mining moths that have yet to receive their first name, but unfortunately dealing with those requires a great deal more effort than shuffling around the names of the ones that have already been described.

* Prous, M., S. M. Blank, H. Goulet, E. Heibo, A. Liston, T. Malm, T. Nyman, S. Schmidt, D. R. Smith, H. Vårdal, M. Viitasaari, V. Vikberg, and A. Taeger. 2014. The genera of Nematinae (Hymenoptera, Tenthredinidae). Journal of Hymenoptera Research 40: 1–69. [Available online here.]

** Winkler, I. S., S. J. Scheffer, and C. Mitter. 2009. Molecular phylogeny and systematics of leaf-mining flies (Diptera: Agromyzidae): delimitation of Phytomyza Fallén sensu lato and included species groups, with new insights on morphological and host-use evolution. Systematic Entomology 34: 260–292. [Available online here.]

*** Eiseman, C. S. 2024. New names for Nearctic species of Euura Newman (Hymenoptera: Tenthredinidae). Proceedings of the Entomological Society of Washington 125(2) [2023]: 264–267.

**** Goulet, H. and A. M. R. Bennett. 2021. Checklist of the sawflies (Hymenoptera) of Canada,
Alaska and Greenland. Journal of Hymenoptera Research 82: 21–67. [Available online here.]

***** Eiseman, C. S. 2024. On the identities of some distinctive, suspended spider egg sacs (Araneae: Liocranidae, Tetragnathidae). Proceedings of the Entomological Society of Washington 125(2) [2023]: 278–284.

****** Pohl, Gregory R. and Stephen R. Nanz (eds.). 2023. Annotated Taxonomic Checklist of the Lepidoptera of North America, North of Mexico. Wedge Entomological Research Foundation, 580 pp.  [Print book; available for purchase here.]

******* Hu, G.-L., J. Brown, M. Heikkilä, L. Aarvik, and M. Mutanen. 2023. Molecular phylogeny, divergence time, biogeography and trends in host plant usage in the agriculturally important tortricid tribe Grapholitini (Lepidoptera: Tortricidae: Olethreutinae). Cladistics 39: 359–381. [Available online here.]

I just noticed that I never bothered to mention here that I finished the second edition of Leafminers of North America last December. Apparently I quietly updated the page dedicated to that book and then went back to working on other writing projects, including my guide to sawfly larvae and various papers on leafminers and other herbivorous insects. Of course all of the leafminer book subscribers received the last installment of the second edition at that time, and I sent out the first monthly installment of the third edition last month. So if you’ve been meaning to subscribe, now is a good time! Details are on that page (or you can click the image of the book cover below), and it’s still true that you can have the whole first edition for as little as $5, as explained here.

Also, someone just asked if there will be a calendar this year, and yes, a box of them is on the way to me right now! As usual, I will send a copy to anyone who makes a donation of at least $30 (the amount WordPress charges me each year to keep this blog free of annoying ads) before the end of November, which you can do here (select “Send,” and then include your mailing address in the notes). In this year’s calendar, some months have a single full-page photo and some show an adult leafminer along with its larval mine.

Also, I will be back at Eagle Hill in Maine next summer, teaching a week-long “Leaf and Stem Mining Insects” seminar the week of August 4. Their 2024 schedule isn’t on their website yet, but I suspect it isn’t too early to get yourself a spot if you contact them about it.

And also, one reason that things have been pretty quiet on this blog lately is that earlier this year, Julia and I had a baby girl, Ayla (pronounced eye-la). But the main reason is that this summer, we took Ayla on a six-week road trip—during which she got to meet two other baby girls at the International Congress of Dipterology in Reno, Nevada, where I was invited to speak about leaf-mining flies, and she also got to hang out with some moth people at the Lepidoptera Course at the Southwestern Research Station in Arizona, where I invited myself to visit and speak about leaf-mining moths on our way home—and as a result I’ve been extra busy with work (and bug rearing projects) ever since. Here’s Ayla examining a columbine flower in Arizona and an “oak apple” gall in Oklahoma (she determined the latter to be crunchy and full of ants):

Now the reports I had to do for other people are in, and almost all of my bugs are put away in the fridge for the winter, so I expect BugTracks will become a little more active as I go through all my photos from this year. In the meantime, if you know your western and midwestern plants, I’d appreciate any help you can offer identifying the hosts of the leafminers I found this summer, which are all posted on iNaturalist. I’m slowly getting caught up with reviewing everyone else’s leafminer observations in the Leafminers of North America project; I’m up to early September now, with just 4300 or so left to go! iNaturalist’s “computer vision” AI has improved greatly in recognizing leafminer species, so that I now can often select the correct identification from a dropdown list of its top guesses, but of course what makes things most efficient is when the (human) observer has made an informed identification (e.g. by using my book) and all I have to do is click “agree” and move on. One of the projects I’m currently focusing on is another big paper on agromyzid flies with Owen Lonsdale, which will include a number of new host records, new distribution records, and new species based on specimens that various iNaturalist users reared when I asked them to follow up on some particularly interesting finds.

Okay, I think those are all my announcements for now!

You know those hairs that line the basal portion of the midrib on the lower surface of black cherry (Rosaceae: Prunus serotina) leaves?

Or the ones in the vein axils on the lower surface of many other tree leaves, like this black oak (Fagaceae: Quercus velutina)?

It turns out these are Acarodomatia! Which is to say, they are structures that evolved for the purpose of housing mites that benefit these plants, either by preying on tiny herbivores (e.g. other mites) or by feeding on pathogenic fungi. I just heard about this for the first time last night when James Trager accidentally sent me a message on Facebook, which caused me to see a link he’d sent me four years earlier that I’d missed until now. (Tip: if you want me to see something, send me an email; I often miss things on Facebook messenger. If you want to make sure I never hear something, leave me a voicemail.) That link was to this “In Defense of Plants” podcast, which I listened to last night; it features Gussie Maccracken talking about her work with fossils, including this paper that gives evidence of acarodomatia already existing around 75 million years ago. Googling “acarodomatia” turns up lots of other information, including this review paper which says (among other things) that these structures are found in about half of North American tree species. I’m a little annoyed that I spent almost 20 years in school and no one ever mentioned the existence of these things.

So, today I walked around the yard and plucked a few leaves that had acarodomatia on them, including the two pictured above, and had a look at them under the microscope. I didn’t see anything among the hairs of the black cherry leaf, but they provide an extensive hiding place and it would be easy to miss any mites that may have been there. When I looked at the ones in the black oak vein axils, I saw a little colorless mite go scrambling out of the second one I looked at, and the same thing happened with the third—I think they were disturbed by the intense light under the scope. I was unable to relocate them when I trained my camera on them, but I believe the spherical object at the center of this photo is a mite egg:

Leaves of striped maple (Sapindaceae: Acer pensylvanicum), it turns out, have nice cavernous retreats in the vein axils behind these hairs. There are several pairs of these acarodomatia along the length of the midrib.

The red maple (A. rubrum) leaves I looked at just had a single pair of tufts at the base of the midrib. This restricted real estate, it seems, improved my chances of spotting the resident mite. See it?

Okay, it’s pretty subtle, given that it’s extremely tiny (~0.2 mm long) and hiding behind a couple of hairs. Here’s a closer crop:

I got a few other photos of it as it ran around on the leaf veins; they’re certainly not good, but maybe sufficient for an acarologist to tell us approximately what kind of mite it is:

So, as with extrafloral nectaries, these acarodomatia are common structures that are often mentioned in botanical manuals (hairs in the axils of veins noted in this key, for instance), but bafflingly, no one ever bothers to point out what their purpose is.